Vous êtes sur la page 1sur 50

UNIVERSIDADE DE SO PAULO INSTITUTO DE QUMICA DEPARTAMENTO DE BIOQUMICA

I
M

Indivduo

P R E S S O D I G I T A L D O D N A

Sondas

QBQ-217 BIOQUMICA E BIOLOGIA MOLECULAR DO GENE 2003

DOCENTES RESPONSVEIS: Profa. Suely Lopes Gomes (Coordenadora) Profa. Aline Maria da Silva

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

QBQ-217 Bioqumica e Biologia Molecular do Gene Cincias Farmacuticas, 2003 - Diurno


DOCENTES RESPONSVEIS: Profa. Suely Lopes Gomes (Coordenadora, sala 1211 - Bloco 12 inferior) Profa. Aline Maria da Silva (sala 1224 - Bloco 12 inferior) MONITORES: Karina F. Ribichich Daniela Beton HORRIO E SALAS: Aulas Expositivas: 4as. e 5as. feiras das 14 s 16hs - Sala 10 - Bloco 6 inferior Exerccios (Discusso): 4as. e 5as. feiras das 16 s 18 hs - Salas 9 e 10 - Bloco 6 inferior Aulas Prticas: Bloco 7 superior ORGANIZAO DO CURSO: O Curso envolve aulas expositivas, perodos para resoluo e discusso de exerccios e aulas prticas. Utilizando as informaes das aulas expositivas e a bibliografia recomendada, os alunos devero resolver os exerccios. Os exerccios sero discutidos nos perodos de discusso em sala de aula com acompanhamento das professoras e monitores. Nas aulas prticas sero realizadas experincias que envolvem algumas tcnicas utilizadas na Biologia Molecular. Os alunos sero divididos em grupos e cada aluno dever apresentar um RELATRIO INDIVIDUAL contendo os resultados obtidos e a resoluo das questes correspondentes. S sero aceitos relatrios de alunos que realizaram as aulas prticas. POR RAZES DE SEGURANA, O USO DO AVENTAL NAS AULAS PRTICAS OBRIGATRIO. AVALIAO: A avaliao ser feita atravs da mdia ponderada das notas obtidas nas trs provas (P1, P2 e P3), nos relatrios (R) e na participao nos perodos de discusso de exerccios (E), de acordo com a frmula abaixo: Nota final= [(P1 x 3) + (P2 x 3) + (P3 x 3) + (R + E)] 10 A matria das provas ser CUMULATIVA. No final do curso, ser oferecida uma prova substitutiva (com toda a matria) para alunos que faltarem a uma das trs provas (apresentar justificativa) ou que no atingiram mdia 5,0. Os alunos que no atingirem mdia 5,0, porm atingirem mdia 3,0 e 75% de frequncia podero realizar a prova de recuperao no segundo semestre de 2003. A FREQUNCIA OBRIGATRIA MINMA S AULAS DE 75%.

BIBLIOGRAFIA RECOMENDADA: - Biologia Molecular Bsica (2000) A. Zaha (Coordenador) Ed. Mercado Aberto - Biochemistry (1995) L.Stryer. 3rd & 4th edition. W.H.Freeman and Co. New York. - Recombinant DNA (1992) J.Watson, M.Gilman, J.Witkowski & M.Zoller. Ed. Scientifc American Books. - Guia de Rotas na Tecnologia do Gene (1999), M. R. Walker & R. Rapley, Atheneu Editora So Paulo.

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

CRONOGRAMA QBQ-217
19/02. 4a. feira - Estrutura e Funo dos cidos Nucleicos. 20/02. 5a. feira - Fluxo da Informao Gentica. Exerccio I. 26/02. 4a. feira - Estrutura do DNA e Replicao. Exerccio I. 27/02. 5a. feira Reao em cadeia da polimerase (PCR). Exerccio II. 05/03. 4a. feira No haver aula (Cinzas). 06/03. 5a. feira Mutao e Reparo. Exerccio III. 12/03. 4a. feira Experincia 1: Extrao de DNA de E. coli. 13/03. 5a. feira - Plasmdeos e transposons. Exerccio IV. 19/03. 4a. feira Experincia 2: Transformao de bactrias com plasmdeos. 20/03. 5a. feira Explorando os genes: clonagem de DNA. Exerccio IV. 26/03. 4a. feira - Sntese e Processamento de RNA. Exerccio V. 27/03. 5a. feira - Cdigo Gentico. Exerccio VI. 02/04. 4a. feira - PROVA I. 03/04. 5a. feira - Sntese proteica. Exerccio VII. 09/04. 4a. feira - Controle da Expresso Gnica em Procariotos I. Exerccio VII. 10/04. 5a. feira Controle da Expresso Gnica em Procariotos II. Exerccio VIII. 16/04. 4a. feira SEMANA SANTA (No haver aula). 17/04. 5a. feira - SEMANA SANTA (No haver aula). 23/04. 4a. feira - Experincia 3: Induo da -galactosidase por IPTG. 24/04. 5a. feira - Cromossomos de Eucariotos. Exerccio VIII. 30/04. 4a. feira - Controle da Expresso Gnica em Eucariotos. Exerccio IX. 1/05. 5a. feira DIA DO TRABALHO (No haver aula). 07/05. 4a. feira - Mecanismos de Transduo de sinal. Exerccio IX. 08/05. 5a. feira - Oncogenes e cncer. Exerccio X. 14/05. 4a. feira - Exerccio X/Planto de Dvidas. 15/05. 5a. feira - PROVA II 21/05. 4a. feira - Reunio Anual da SBBq (No haver aula). 22/05. 5a. feira - Anlise de Genomas I e II. 28/05. 4a. feira Experincia 4: Preparao de DNA plasmidial. 29/05. 5a. feira - Anlise de Genomas III. Exerccio XI 04/06. 4a. feira - Experincia 5: Digesto de DNA e eletroforese em gel de agarose. a. feira Protenas Recombinantes/Transgnicos. Exerccio XII. 05/06. 5 11/06. 4a. feira - Experincia 6: Expresso de protena recombinante em E. coli. 12/06. 5a. feira Diagnstico clnico atravs do DNA/Terapia Gnica. 18/06. 4a. feira Exerccio XIII. 19/06. 5a. feira CORPUS CHRISTI (No haver aula). 25/06. 4a. feira PROVA III 26/06. 5a. feira Perodo de estudo. 02/07. 4a. feira PROVA SUBSTITUTIVA

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXERCCIOS
I. Estrutura e Funo dos cidos Nucleicos
1. Quais as diferenas de composio e estrutura entre RNA e DNA. Como se distingue entre a uracila e a timina, e entre a ribose e a desoxirribose. 2. Escreva os nomes das bases, ribonucleosdeos, desoxirribonucleosdeos, ribonucleotdeos e desoxirribonucleotdeos do DNA e RNA. 3. Escreva a sequncia de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequncia: (5') ATGCCGTATGCATTGCATTC (3') Exprima, em porcentagem, a composio de bases do DNA de fita dupla. 4. Como so chamadas as ligaes covalentes que unem dois nucleotdeos consecutivos nas molculas de cidos nucleicos? Esquematize estas ligaes. 5. Uma molcula de cido nucleico tem a seguinte composio de bases: C = 24,1% G = 18,5% T = 24,6% A = 32,8% O que voc pode afirmar sobre esta molcula? 6. Explique por que cidos nucleicos so desnaturados quando submetidos a alta temperatura ou pHs extremos ? Uma molcula de DNA desnaturada por aquecimento pode ser renaturada? Como? 7. O valor de Tm para o DNA pode ser calculado usando-se a frmula : Tm = 69,3 + 0,41(%GC), onde GC a porcentagem de Guanina + Citosina a) DNA de E. coli contm 50% GC. Calcular o Tm para o DNA desta bactria. b) As curvas de fuso da maioria dos DNAs que ocorrem naturalmente revelam que o Tm normalmente maior do que 65oC. Por que isto importante para a maioria dos organismos? c) Como varia o Tm com a fora inica da soluo? d) O que acontece com Tm quando se adiciona etanol soluo de DNA? 8. Descreva os principais experimentos que indicaram que o DNA o material gentico. 9. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste experimento se a replicao do DNA fosse conservativa? 10. Quais os diferentes tipos de RNA que podem ser encontrados nas clulas? Quais as suas funes principais?

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

II. Fluxo da Informao Gentica


1. Aps a infeco de E. coli com o bacteriofago T2, quais dos seguintes eventos ocorrem e em que ordem ? (a) novas protenas so sintetizadas (b) novos RNAS so sintetizados (c) novos ribossomos so sintetizados (d) novos RNAS se associam a novos ribossomos (e) novos RNAS se associam a ribossomos pr-existentes 2. RNA facilmente hidrolizado por lcali, enquanto DNA no o . Por que? 3. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequncia 5'...AGGTTACCTAGTTGC...3' Suponha que um mRNA seja transcrito a partir deste DNA usando a fita complementar como molde. Qual ser a seqncia deste mRNA? O que voc pode dizer sobre a capacidade de formao de um hbrido RNA-DNA? 4. Qual a sequncia do polipeptdeo que seria codificado pelo mRNA sintetizado na questo 3. Assuma que o quadro de leitura comea com o primeiro nucleotdeo. 5. Quais os diferentes tipos de RNA que podem ser encontrados nas clulas e como eles se diferenciam quanto estrutura, tamanho, abundncia e funo? 6.Baseando-se na lista de cdons e amino cidos abaixo, quais das seguintes afirmaes so corretas? AGU = serina AAU = asparagina AUG = metionina AGC = serina AAC = asparagina AUA = isoleucina

(a) o cdigo gentico degenerado (b) a alterao de um nico nucleotdeo no DNA que dirige a sntese destes cdons poderia levar substituio de uma serina por uma asparagina no polipeptdeo. (c) a alterao de um nico nucleotdeo no DNA que dirige a sntese destes cdons necessariamente levaria substituio de um aminocido no polipeptdeo codificado. (d) um tRNA com o anticdon ACU se ligaria a um ribossomo na presena de um destes cdons. 7.Uma globina de 146 aminocidos sofreu uma mutao no cdon correspondente ao sexto aminocido da cadeia. A anlise do DNA indicou uma mudana de (5')TTC(3') para (5')TAC(3') na fita molde. Pergunta-se : (a) A mutao provocou a troca de um aminocido por outro? Em caso afirmativo, qual este aminocido? (b) Quais as implicaes para a estrutura da protena? (c) Qual seria o resultado se a mesma troca ocorresse na base do lado (5') do DNA?

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

III.

Estrutura do DNA e Replicao/ PCR

1. Combine as caractersticas da coluna da direita com o tipo de hlice do DNA da coluna da esquerda (a) A-DNA (b) B DNA (c) Z-DNA (1) As pirimidinas esto na configurao anti (2) Os fosfatos na cadeia esto em ziguezague (3) A sua formao favorecida por superenovelamento negativo (4) Apresenta um sulco maior relativamente largo e profundo (5) Apresenta uma estrutura helicoidal no sentido dextrgiro (6) Tem 10,4 pares de bases por volta (7) Tem a estrutura similar quela do RNA de fita dupla (8) As fitas na hlice tm polaridades opostas

2. Combine as propriedades ou funes na coluna direita com a DNA polimerase na coluna da esquerda: (a) DNA polimerase I (1) envolvida na replicao (b) DNA polimerase II (c) DNA polimerase III (2) requer um iniciador e um molde (3) envolvida no reparo de DNA (4) sintetiza a maior parte do DNA durante a replicao (5) remove o iniciador e preenche as lacunas durante a replicao

3. Defina os seguintes termos: primer, ori, RNA primase, fragmento de Okasaki, sntese descontnua de DNA, DNA ligase, girase, fita lder. 4. O fragmento de DNA no esquema abaixo de fita dupla em ambas as extremidades porm de fita simples no meio. A polaridade da fita superior est indicada. 5'__________________________3' __________P HO_________ a) O fosfato (P) indicado na fita inferior est na extremidade 5' ou 3' do fragmento ao qual ele pertence ? (Indique no esquema). b) Como voc esperaria que a lacuna fosse preenchida pelos processos de reparo do DNA "in vivo" ? c) Quantos fragmentos voc esperaria encontrar na fita inferior se o experimento fosse realizado "in vitro", na presena de todos os desoxirribonucleotdeos-trifosfato e DNA polimerase ? 5. Explique porque certas variedades mutantes da DNA polimerase I podem apresentar atividade de DNA polimerase praticamente ausente, mas podem ter atividade de exonuclease 5' 3' praticamente normal.

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

6. Qual a atividade da DNA polimerase III que responsvel pela editorao durante a replicao ? 7. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas no podem ser replicadas pelo crescimento no mesmo sentido (como mostra a figura abaixo)? Como a clula supera o problema ? Esquematize a formao da ligao fosfodiester durante a replicao a partir do nucleotdeo trifosfato livre mostrando o grupo fosfato que incorporado.

8. A tcnica de PCR (polymerase chain reaction) utilizada para obter grandes quantidades de DNA a partir de amostras contendo quantidades nfimas de DNA. a) Descreva os passos envolvidos nesta tcnica. b) Que tipo de DNA polimerase normalmente utilizada? c)Exemplifique aplicaes desta tcnica. 9. Voc deseja amplificar atravs da tcnica de PCR, o DNA contido entre as sequncias mostradas na figura abaixo. Escreva a sequncia do par de primers que voc ter que utilizar na reao. Esquematize as reaes de polimerizao at o terceiro ciclo da amplificao. 5 GACCTGTGGAAGC CATACGGGATTG 3

IV. Mutao e Reparo do DNA. Plasmdeos e Transposons


1. Que propriedade da DNA polimerase I responsvel pela observao de que bactrias mutantes polA1 so mais sensveis luz ultravioleta ? Explique. 2. Descreva brevemente as 3 etapas de reparo do DNA lesado por luz UV e as enzimas nelas envolvidas. 3. Como a maquinaria de reparo de E. coli identifica a fita de DNA que tem um nucleotdeo no complementar incorporado durante a replicao?
7

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

4. Visto que U pareia com A to bem quanto T pareia com A, por que somente T encontrado no DNA ? 5. Bromouracila um mutagnico que produz troca de bases, enquanto acridina causa adies ou delees de uma base no DNA. Mutaes causadas por acridina frequentemente podem ser compensadas por mutaes secundrias, distantes vrios nucleotdeos da primeira mutao,, enquanto aquelas causadas por bromouracila, geralmente requerem mudanas dentro do mesmo codon. Explique. 6. Explique como algumas cepas da bactria Salmonella so usadas para detectar substncias carcinognicas. Por que extrato de fgado de mamfero est envolvido no teste ? 7. Clulas de mamfero de dois gentipos diferentes podem ser fundidas na presena do virus Sendai, para formar clulas multinucleadas (heterocarions) contendo ncleos de ambos os gentipos. Quando fibroblastos de dois pacientes sofrendo de Xeroderma pigmentosum foram fundidos, os heterocarions resultantes no mostraram deficincia em reparo de DNA. Que concluses podem ser tiradas desta observao? Explique. 8. Defina o termo "transposon". Explique como os transposons podem: conduzir ativao ou inativao gnica. 9. Descreva as condies necessrias para que duas bactrias conjuguem com sucesso. O que uma clula Hfr ? Qual a diferena entre fator F e F'. 10. Suponha que uma cepa Hfr de E. coli sensvel estreptomicina (Str ), capaz de sintetizar os aminocidos Leu e His, misturada em meio de cultura com uma cepa F- que resistente estreptomicina e incapaz de sintetizar Leu e His. Aps certo tempo a conjugao interrompida, colocando-se a mistura num liquidificador e transferindo-se amostras da cultura para placas seletivas para testar se houve ou no conjugao. (a) Ocorre algum crescimento bacteriano quando as bactrias so transferidas para um meio contendo estreptomicina e na ausncia de Leu e His? Explique este resultado. (b) Suponha que voc repetiu o experimento com menor tempo de incubao antes de colocar a mistura no liquidificador. Explique porque agora as bactrias crescendo na presena de estreptomicina necessitam do aminocido His, mas no do aminocido Leu. 11. Como voc explica a necessidade do antibiograma antes de prescrever um antibitico?
S

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

V. Explorando os Genes
1. Quando uma molcula de DNA estranha, isto , de um organismo diferente, entra em certas bactrias o DNA frequentemente hidrolisado. Explique as bases enzimticas deste fenmeno de restrio. Explique como o DNA estranho pode as vezes escapar desta hidrlise. Por que o DNA da prpria bactria no sofre hidrlise? 2. Quais das seqncias abaixo so possveis stios de reconhecimento de uma enzima de restrio ? Por que ? (a) 5'-AGTC-3' (b) 5'-ATCG-3' 3'-TCAG-5' 3'-TAGC-5' (c) 5'-ACCT-3' 3'-TGGA-5' (d) 5'-ACGT-3' 3'-TGCA-5'

3. As enzimas de restrio Hind III e Hae III, que reconhecem e clivam respectivamente as seqncias de DNA: (5') AAGCTT (3') (5') GGCC (3') (3') TTCGAA (5') (3') CCGG (5') foram utilizadas separadamente para clivar a molcula do DNA dupla fita circular abaixo .... AAGCTTTCAGCAGGCCTA .... .... TTCGAAAGTCGTCCGGAT .... Aps a clivagem a soluo foi aquecida para inativar a enzima de restrio e a soluo foi esfriada lentamente aps a adio ou no de NaOH 0,1M, para tornar a soluo alcalina. Em que condies o DNA assim tratado apresentou-se circular quando observado ao microscpio eletrnico ? 4. Voc deseja clonar um gene de levedura no fago lambda. Por que necessrio clivar tanto o DNA de levedura quanto o DNA de lambda com a mesma enzima? Se as enzimas forem diferentes, que caractersticas devem ter as extremidades dos fragmentos produzidos pela digesto enzimtica ? 5. Como voc pode verificar que um fragmento de DNA foi inserido num plasmdeo durante um experimento do clonagem ? Que enzimas voc teve que utilizar para a fazer a clonagem ?

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

VI. Sntese e Processamento de RNA


1. D a composio de subunidades da holoenzima e do cerne da RNA polimerase de E. coli, atribuindo funes s subunidades. 2. Quando uma cultura de E. coli em crescimento submetida a um rpido aumento de temperatura, um novo e caracterstico conjunto de genes altamente expresso. Explique como ocorre esta alterao na expresso dos genes. 3. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo nucleotdeo para o crescimento da cadeia polinucleotdica. necessrio um iniciador para a ao da RNA polimerase? 4. Que subunidades da RNA polimerase bacteriana so necessrias para a iniciao da transcrio a partir de um promotor? E para a terminao da transcrio? Explique como uma mutao poderia dar origem a uma E. coli resistente ao antibitico rifamicina. 5. Uma pequena cadeia de RNA sintetizado in vitro tem a seguinte seqncia: 5'- AUGUACCGAAGUGGUUU - 3' Coloque os grupos fosfato e um asterisco naqueles que sero radiativos quando a transcrio 32 for feita na presena de [ P]-ATP 32 b) Faa o mesmo para [ P]-UTP 6. Defina "promotor", enumere as suas propriedades e diga como podem ser localizados atravs da tcnica de "footprinting". 7. A sequncia de um segmento de uma molcula. de DNA duplex : (a) 5'-ATCGCTTGTACGGA-3' (b) 3'-TAGCGAACATGCCT-5' Quando este segmento serve de molde para a RNA polimerase de E. coli ele d origem a um segmento de RNA com a seguinte sequncia: (c) 5'-UCCGUACAAGCGAU-3'. Indique: a) a fita codificadora; b) a fita senso; c) a fita molde; d) a fita anti-senso. 8. At que ponto o mRNA, rRNA e tRNA modificaes que podem ocorrer. so modificados nos procariotos ? Indique as

10. Combine as descries na coluna da direita com a RNA pol DNA-dependente eucaritica apropriada: a) RNA pol I (1) localizada no nuclolo (2) localizada no nucleoplasma (3) sintetiza hnRNA b) RNA pol II (4) sintetiza tRNA (5) sintetiza rRNA

10

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

c) RNA pol III

(6) sintetiza precursores do rRNA (7) inibida por -amanitina (8) sintetiza RNA na direo 5'-3' (9) composta de vrias subunidades

11. Voc usaria num paciente, como agente teraputico anti-bacteriano, qual destes antibiticos: a) rifamicina ou b) actinomicina D ? Justifique a sua escolha. 12. Quais as principais caractersticas das sequncias de promotores de genes eucariticos transcritos em mRNAs? Qual a funo dos fatores de transcrio e enhancers? 13. Em que consiste o terminal 5' cap do mRNA e qual o seu papel ? Qual a caracterstica do terminal 3' encontrado na maioria dos mRNAs de eucariotos e como eles so formados ? 14. Genes de eucariotos so geralmente constitudos de introns e exons. Estas seqncias so tanto transcritas como traduzidas? A remoo dos ntrons (splicing) tem que ser um processo extremamente preciso. Por que? D um exemplo de "splicing" aberrante que leva a um tipo de talassemia em humanos. 15. Suponha que o DNA humano clivado em fragmentos do tamanho aproximado de um mRNA humano maduro e que ento so preparados hbridos RNA-DNA. O mesmo procedimento repetido com E. coli. Quando os hbridos RNA-DNA de cada espcie so examinados ao microscpio eletrnico, qual deles mostra o maior grau de hibridizao? Explique e faa um esquema. 16. O mRNA monocistrnico de eucariotos geralmente representa o transcrito primrio ? E o mRNA dos procariotos ? Explique. Faa uma comparao, indicando as principais diferenas encontradas em eucariotos entre um gene, seu transcrito primrio e o mRNA maduro que deixa o ncleo para a traduo no citoplasma.

11

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

VII.

Cdigo Gentico e Sntese de Protenas

1. Dada a semelhana entre valina e isoleucina e a maior concentrao de Val em relao a Ile (5:1) em E. coli, os clculos indicam que a isoleucil-tRNA sintetase deveria incorporar s protenas, erroneamente, valina em lugar de isoleucina a cada 40 reaes. Entretanto, o erro acontece apenas 1 vez em cada 3000 reaes. Explique porque. 2. Como algumas aminoacil-tRNA sintetases podem atingir elevado grau de preciso nas reaes, mesmo sem ter um mecanismo hidroltico de reviso ? 3. Explique porque as molculas de tRNA devem ter, concomitantemente, caractersticas estruturais particulares e comuns. 4. Complete: Cada aminocido levado aos ribossomos para a sntese de polipeptdeos pelo pareamento de bases entre o _________________ de uma molcula de aminoacil-tRNA e o _____________de um mRNA. 5. Escreva os produtos finais das seguintes reaes: a) valina + ATP + tRNAVal + valil-tRNA sintetase . b) valina + ATP + tRNAIle + isoleucil-tRNA sintetase . 6. Em um experimento verificou-se que Cys-tRNACys pode ser convertido a Ala-tRNACys e usado num sistema in vitro de sntese de protenas. (a) Se o Ala-tRNACys for marcado com 14C no aminocido, a alanina marcada seria incorporada na protena sintetizada no lugar de outros resduos Ala ? Explique. (b) O que o experimento indica sobre a importncia da preciso da reao da aminoacil-tRNA sintetase em relao ao processo global da sntese protica ? 7. Assumindo que cada nucleosdeo na coluna da esquerda est na primeira posio de um anticdon, com qual(is) nucleotdeo(s) na coluna da direita ele vai parear durante uma interao cdon-anticdon, se cada um dos nucleotdeos da direita estiver na terceira posio (3') de um cdon ? anticdon cdon (a) Adenosina-P (1) Adenosina-P (b) Citidina-P (2) Citidina-P (c) Guanosina-P (3) Guanosina-P (d) Inosina-P (4) Uridina-P 8. De acordo com o princpio de oscilao no pareamento de bases ("wobble"), qual o nmero mnimo de tRNAs necessrio para decodificar os seis cdons de leucina - UUA, UUG, CUU, CUC, CUA e CUG ? Explique. 9. Uma mutao supressora compensa o efeito de outra mutao num gene distinto do primeiro. Explique como o tRNA poderia estar envolvido neste processo. 10. Em procariotos, a maioria da cadeias polipeptdicas so iniciadas com o aminocido ______, cujo cdon ______. 11. Num sistema de sntese de protenas in vitro, que permita o incio e trmino da sntese em qualquer sequncia de RNA, que peptdeo seria produzido pelo poli-ribonucleotdeo 5'-UUUGUUUUUGUU-3' ? Indique qual o aminocido N-terminal e o C-terminal do polipeptdeo obtido.
12

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

12. Qual o papel da vitamina cido flico no processo de traduo em procariotos? 13. O cdon AUG funciona tanto para iniciar uma cadeia polipeptdica quanto para dirigir a incorporao de uma metionina em posies internas de uma protena. Quais os mecanismos de seleo do cdon AUG para a iniciao da traduo em procariotos? 14. Para cada uma das etapas da traduo, descritas abaixo, d o nucleotdeo trifosfato envolvido como cofator e o nmero de ligaes fosfato de alta energia consumidas. a) Ativao do amino cido b) Formao do complexo de iniciao 70S (procariotos) ou 80S (eucariotos) c) Entrada do aminoacil-tRNA no ribossomo d) Formao da ligao peptdica e) Translocao 15. Os trs cdons de terminao so ______, _______ e ______. 16. Muitos antibiticos exercem sua ao por inibio da sntese proteica. Como, ento, alguns destes antibiticos podem ser usados em humanos para combater infeces microbianas sem causar efeitos txicos devido inibio da sntese proteica eucaritica? 17. Considere a seguinte sequncia de um fragmento de DNA isolado de bactria:
5' CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTTC 3'

a) Assumindo que esta sequncia corresponde a sequncia da fita codificadora, qual seria a sequncia de aminocidos do polipeptdeo produzido quando um mRNA transcrito deste gene for traduzido? Que caractersticas na sequncia do mRNA determinam qual o cdon iniciador? Considere a primeira base como o incio da transcrio. 18. Quais so as caractersticas das seqncias sinais que dirigem certos polipeptdeos para o retculo endoplasmtico nas clulas eucariticas e para secreo em bactrias? 19. Qual o compartimento celular em que so sintetizadas a maioria das glicoprotenas? 20. D exemplos de modificaes ps-traducionais que podem ocorrer nas protenas.

13

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

VIII. Controle da Expresso Gnica em Procariotos


1. Defina expresso gnica constitutiva. Compare expresso gnica induzida com represso gnica. Use o esquema proposto por Jacob e Monod para o operon da lactose e defina os termos operon, gene estrutural, gene regulador, operador, promotor, indutor, repressor e corepressor. 2. Numa cultura de E.coli em um meio contendo tanto lactose quanto glicose, qual dos acares metabolizado preferencialmente? Qual o mecanismo que permite esta seletividade ? O que acontece quando a glicose se esgota durante o crescimento da bactria ? 3. Para o cultivo de componentes: a) lactose b) lactose + glicose c) glicose E.coli utilizaram-se meios contendo alm dos sais necessrios, os d) glicose + cAMP e) lactose + glicose + cAMP

Analise a produo de - galactosidase em cada caso, justificando a resposta segundo o modelo de Jacob e Monod. 4. Qual o efeito da deleo do gene regulador do operon lac? Haveria outro tipo de mutao resultando no mesmo efeito ? 5. Um mutante incapaz de crescer tanto em galactose quanto em arabinose, alm de diversas outras fontes de carbono, foi isolado de uma cultura de E. coli do tipo selvagem. Que tipo de mutao pode ter produzido estes resultados ? 6. Algumas mutaes constitutivas conhecidas no operon da lactose ocorrem no operador(O) ao invs do gene regulador (I). (a) Voc esperaria que um mutante O- seria dominante ou recessivo em relao ao alelo selvagem O+ (b) A mutao constitutiva no stio operador atua em cis ou trans ? (c) Proponha um experimento envolvendo os genes I+,O-, O+ e Z+ que confirme a sua resposta no tem (b). Assuma que possvel diferenciar a quantidade de enzima produzida no diploide (++) daquela produzida no haploide (+). (d)Mostre de forma anloga se a mutao constitutiva no gene regulador (I-) atua em trans ou em cis. 7. Por que o triptofano chamado de co-repressor na regulao do operon das enzimas biossintticas deste aminocido ? Qual o efeito provvel da deleo do gene regulador trp R ? 8. Demonstrou-se que o operon para a biossntese do aminocido fenilalanina de uma certa bactria regulado por um mecanismo de atenuao. O que pode ser afirmado sobre a sequncia de aminocidos do peptdeo lder para este operon ? Explique. 9. Uma clula de E. coli que possui um profago imune infeco ltica por outro fago . Por que ? 10. Qual o efeito da deleo do gene CI de ? Qual o efeito da deleo do gene N de ?

14

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

IX. Cromossomos de Eucariotos Controle da Expresso Gnica em Eucariotos


1. Quais os aspectos mais comuns na organizao dos genes dos genomas eucariticos? 2. Combine os organismos listados na coluna do seu genoma haplide na coluna da direita. E. coli (bactria) S. cerevisiae (levedura) D. melanogaster (mosca de fruta) H. sapiens (homem) da esquerda com a quantidade correta de DNA (1) 1,7 x 108 pb (2) 4 x 106 pb (3) 3,9 x 109 pb (4) 1,4 x 107 pb

3. Quais das seguintes afirmaes sobre o DNA isolado de um cromossomo eucaritico so corretas ? - resistente quebra durante a extrao por seu grande tamanho. - linear e no ramificado - uma molcula nica - Pode ter tamanho superior a 100 Mb 4. O ncleo de uma clula humana tem 6m de dimetro e a extenso total do DNA dos seus 46 cromossomos soma 1,8m. Como resolvida a discrepncia entre estas duas grandezas? 5. Esquematize a estrutura do nucleossomo. O que so histonas e qual o seu papel na organizao da cromatina? 6. Dois estudantes de bioqumica: Norberto e Lucia, decidem fracionar uma amostra de cromatina para isolar cada uma das histonas. Norberto adiciona sal amostra e aplica a soluo resultante numa coluna de gel-filtrao. Lucia toma a amostra original e a adiciona a uma coluna de cromatografia de troca inica. Comente sobre as perspectivas de sucesso para cada um destes experimentos, explicando o seu raciocnio. Se necessrio, sugira um procedimento alternativo. 7. Cromossomos artificiais de levedura (YACS) podem ser construdos a partir de trs espcies de elementos de DNA. Quais so les ? 8. Compare a expresso gnica em procariotos e eucariotos quanto a: a) grau de acoplamento da transcrio e da traduo. b) nmero de produtos gnicos em um transcrito primrio. c) nmero de protenas resultantes da traduo de um transcrito primrio. d) proporo de seqncias codificadoras no DNA. e) organizao de genes em operons. 9. Cromatina que ativa transcricionalmente (eucromatina) tem estrutura dispersa, enquanto cromatina que inativa (heterocromatina) compacta. Quando ncleos de clulas de galinha produzindo globina foram tratados brevemente com DNase pancretica, os genes de globina de adultos foram seletivamente destrudos, mas os genes para globina embrionica e ovalbumina permaneceram intactos. Quando os ncleos de clulas de oviduto foram tratadas com DNase, os genes de ovalbumina foram destrudos. Explique estes resultados.

15

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

10. Conceituar: a) fatores de transcrio; b) "enhancers" (ativadores) indicando suas funes. Exemplifique caractersticas estruturais exibidas por fatores de transcrio. 11. O fator de transcrio IIIA (TF IIIA) liga-se ao 5SRNA to bem quanto regio de controle interna do gene que o codifica. Por que ? Como esta ligao ao produto gnico pode ser usada para regular a expresso do gene 5S ? 12. A RNA polimerase II, responsvel pela sntese dos mRNAs em eucariotos, incapaz de se ligar aos seus promotores no DNA, a menos que fatores de transcrio estejam ligados na vizinhana destes promotores. O que voc espera que acontea durante o choque trmico em clulas eucariticas, quando os genes para as protenas de choque trmico so fortemente induzidos? Explique. 13. Casena a protena mais abundante do leite. produzida em clulas epiteliais do tecido mamrio em resposta a hormnios, incluindo o hormnio polipeptdico prolactina. Tecido mamrio em cultura incubado na ausncia de prolactina contm cerca de 300 molculas de mRNA de casena por clula, enquanto clulas incubadas na presena de prolactina contm cerca de 30.000 molculas de mRNA de casena. No entanto o ncleo de clulas de tecido mamrio em cultura sintetiza somente cerca de 3 vezes mais mRNA de casena na presena de prolactina. Proponha uma explicao para estes resultados?

16

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

X. Transduo de Sinal/Oncogenes e Cncer


1. Exemplifique como uma cascata de sinalizao intracelular pode ser ativada, citando alguns tipos de sinais extracelulares. 2. Qual o tipo de modificao covalente reversvel em protenas mais frequente nas cascatas de sinalizao intracelular ? Quais so as enzimas que catalisam esta modificao ? 3. O cAMP (AMP cclico) um importante mensageiro secundrio para muitos hormnios. Como pode ocorrer a ativao da enzima adenilato ciclase aps ativao de um receptor hormonal ? 4. Como ocorre a transmisso do sinal mitognico em resposta ao estmulo pelo fator de crescimento de epiderme (EGF) ? 5. Como a transcrio de certos genes pode ser influenciada em resposta a um sinal extracelular ? 6. Qual foi a importncia da descoberta que um extrato celular de uma galinha com um sarcoma causava um sarcoma quando era injetado em outra galinha ? 7. O que so protooncogenes e oncogenes? Que tipos de protenas estes genes podem codificar ? 8. A protena c-src homloga protena viral oncognica conhecida com v-src e atua como tirosina quinase citosslica, cuja atividade regulada por fosforilao. Qual a caracterstica de v-src que a torna uma protena oncognica. 9. A predisposio ao cncer pode ser hereditria. Explique este fato lembrando-se que existem protenas que agem como supressores do crescimento celular. 10. Retinoblastoma, um cncer de retina que aflige crianas, est asssociado a uma deleo no cromossomo 13. Proponha uma possvel funo para o gene selvagem (Rb), que codifica uma protena de 105 kD localizada no ncleo capaz de se ligar ao DNA.

17

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

XI. Anlise de Genomas


1. Descreva a tcnica de Southern. O que a diferencia da tcnica de Northern? 2. Qual a tcnica para o estudo simultneo do nvel de expresso de milhares de genes em uma determinada condio fisiolgica ? 3. Qual a diferena entre uma biblioteca genmica e uma biblioteca de cDNA. Explique como a presena de ntrons em genes eucariticos complica a produo de produtos proticos que eles codificam quando a expresso feita em bactria. Como se pode resolver este problema? 4. Descreva o sequenciamento de DNA pelo mtodo de interrupo controlada da replicao (mtodo de Sanger) incluindo o mtodo de separao e anlise das molculas de DNA produzidas na reao.

18

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

5. A figura abaixo mostra o autorradiograma de um gel de sequenciamento de DNA pelo mtodo de Sanger. Escreva a sequncia deste fragmento de DNA lendo o gel de baixo para cima. A sequncia obtida codifica para um domnio de uma protena. Encontre a fase de leitura desta sequncia. O que aconteceria se durante a leitura do gel voc tivesse omitido uma base? Como voc faria para ter segurana absoluta da sequncia deste fragmento de DNA ? G AT C

19

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

6. No exerccio anterior utilizou-se nucleotdeos radioativamente marcados na reao de sequenciamento. Que derivados de nucleotdeos so utilizados no sequenciamento automatizado ?

XII. Obteno de Protenas Recombinantes/Animais transgnicos


1. A partir de uma biblioteca de cDNA voc isolou um cDNA completo que codifica para uma protena que um potente estimulador do sistema imunolgico. Voc agora deseja clonar este cDNA em um vetor de expresso para produzir grande quantidade desta protena em E. coli. O cDNA possui nas suas extremidades stios para enzima BamHI e voc planeja clon-lo no stio de BamHI do vetor de expresso. Esta sua primeira vez com experimentos de clonagem e voc decide seguir cuidadosamente as instrues do manual de clonagem, que recomenda que o vetor digerido deve ser tratado com fosfatase alcalina para remover o fosfato da extremidade 5. a) Por que deve ser feito o tratamento com fosfatase alcalina? b) Como voc analisaria se a clonagem foi bem sucedida? c) A protena de seu interesse afeta o crescimento das bactrias. Como voc faria para obter grande quantidade desta protena recombinante? 2. O antgeno que utilizado na vacina recombinante contra a Hepatite B uma glicoprotena. Como voc faria para obter esta protena recombinante ? 3. Suspeita-se que o aminocido Lisina da posio 272 essencial para a ao cataltica de uma certa enzima, que pode ser facilmente purificada com atividade a partir de extratos de E.coli expressando a protena recombinante. Como voc investigaria se este aminocido de fato essencial para atividade cataltica desta enzima? Que metodologias teria que utilizar? 4. O gene completo (contendo todos os exons e ntrons) do hormnio de crescimento de ratos pode ser expresso em camundongos sob o controle de um promotor indutvel por Cd2+. Como podem ser obtidos tais camundongos transgnicos? Quais as suas caractersticas? Como voc explica o fato da expresso do gene do rato ser expresso perfeitamente em camundongos? 5. Planeje a obteno de cabras transgnicas que possam produzir o hormnio de crescimento humano em seu leite. 6. H poucos anos atrs, cientistas europeus realizaram a clonagem de uma ovelha (Dolly), a partir de clulas de uma ovelha adulta. Compare este tipo de experincia com a obteno de um animal transgnico.

XIII. Diagnstico Clnico atravs do DNA/Terapia Gnica


1. Dois recm-nascidos desenvolveram infeco com o vrus herpes simplex na maternidade. Um deles se recuperou e o outro morreu. A autopsia mostrou infeco generalizada por herpes. Epidemiologistas precisavam saber se os recm-nascidos haviam sido infectados pela mesma cepa viral. Amostras de ambas as crianas foram usadas para cultivar o vrus. DNA marcado radioativamente das culturas do vrus foi analisado com enzimas de restrio e os resultados indicaram que as duas crianas foram infectadas pela mesma cepa. Como endonucleases de restrio podem ser usadas para distinguir cepas do vrus herpes simplex?
20

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

2. A anemia falciforme est associada a existncia de uma mutao pontual de AT, no gene da -globina que provoca a troca do aminocido Glu por Val na protena. Esta mutao elimina um stio reconhecido pela enzima de restrio MstII. O desenho abaixo representa um esquema dos genes selvagem e mutante. Planeje um teste utilizando a tcnica de "Southern blot" para o diagnstico pr-natal desta doena. Faa o esquema do resultado esperado considerando um feto normal e de um portador da doena cujos pais so heterozigticos.

Stio que est ausente na -globina mutante MstII MstII MstII

1,1 kpb 1,3 kpb

3. A distrofia muscular de Duchenne (DMD) uma das doenas genticas mais comuns. O gene da DMD localiza-se no cromossomo X, possui mais de 2 x 106 pares de base e contem pelo menos 70 exons. 60% dos casos so devidos ocorrncia de delees grandes concentradas em duas regies do gene. 1/3 dos novos casos so devidos a novas mutaes no gene. A tcnica de PCR- multiplex um mtodo rpido e eficiente no diagnstico da DMD e pode detectar aproximadamente 80% de todas as delees j conhecidas. Nesta tcnica so utilizados mltiplos pares de primers que podem amplificar, em uma reao, 9 segmentos (de tamanhos diferentes) do gene nas regies onde as delees ocorrem mais frequentemente. Um exemplo de anlise por PCR-multiplex apresentado abaixo. Descreva as delees, se houverem, em cada um dos seis pacientes de DMD analisados. Que controle adicional voc sugere para confirmar o diagnstico do paciente F? As setas apontam os nove stios amplificados pela PCR. Normal equivale a um indivduo do sexo masculino no portador da DMD e O um controle negativo onde no foi adicionado DNA mistura de reao.

21

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

4. O mtodo de identificao de indivduos mais frequentemente utilizado est baseado na comparao do nmero de certas repeties variveis em srie que esto localizadas em regies conhecidas do genoma humano. Explique como pode ser realizado um teste para identificao de indivduos, levando em conta este fato. 5. Quais so as alternativas possveis para realizao de terapia gnica (tipos de vetores) ?

22

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

ROTEIRO PARA AS AULAS PRTICAS

23

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

ROTEIRO PARA AS AULAS PRTICAS


RECOMENDAES:
1. Por razes de segurana no ser permitido ao aluno frequentar as aulas sem avental. PROIBIDO COMER, BEBER E FUMAR NO LABORATRIO. 2. Leia com detalhe o protocolo e preste ateno as instrues fornecidas antes de iniciar a experincia. 3. Procure utilizar reagentes, vidraria e equipamentos disponveis com cuidado, para evitar desperdcio e quebra. 4. Mantenha sua rea de trabalho organizada. Ao terminar a experincia passe gua na vidraria utilizada e coloque no local indicado. 5. O relatrio individual dever ser entregue no final de cada uma das aulas prticas. O relatrio dever ser feito de acordo com modelo ao final de cada protocolo experimental. Aps preenchidas, as respectivas folhas devem ser destacadas e entregues. 6. Qualquer dvida ou acidente pea auxlio aos monitores ou aos professores.

USO DO AVENTAL NAS AULAS PRTICAS OBRIGATRIO.

24

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No.1: EXTRAO DE DNA (E RNA) DE Escherichia coli.


Protocolo: Ser utilizada uma cultura de bactrias E.coli HB101 que foi inoculada ontem no final da tarde em meio de cultura lquido esterilizado (meio LB: triptona 1%, extrato de levedura 0,5%, NaCl 1%, pH final ajustado para 7,5 com NaOH) e mantida sob agitao vigorosa a 37C at hoje pela manh, quando a cultura foi transferida para geladeira. Coletar as bactrias pela centrifugao de 20mL da cultura a 5000rpm por 5 min. Descartar o meio de cultura em um frasco contendo Lisoform a 10 %. Secar bem o tubo, invertendo-o sobre papel absorvente. Balancear os tubos! Adicionar 6mL da soluo I (citrato de sdio 0,015M, NaCl 0,15M, pH final ajustado para 7,0 com HCl). Tampar o tubo e ressuspender o precipitado de bactrias por inverso. Remover a tampa e adicionar 0,7mL da soluo II [Dodecil Sulfato de Sdio (SDS) 10% (P/V)]. Fechar o tubo e incub-lo em banho-maria a 60C por 10 min, com agitao manual suave. Retirar o tubo do banho, abrir e deix-lo a temperatura ambiente por 5min. Adicionar igual volume (6,7mL) da soluo III (Clorofrmio:alcool isoamlico 24:1 V/V). No pipetar com a boca! Fechar muito bem o tubo. Agitar suavemente por 10 min a temperatura ambiente. Esta etapa deve ser realizada na capela de exausto. Centrifugar 5 min a 5000 rpm. Remover delicadamente a fase aquosa (fase superior) com pipeta Pasteur de ponta grossa para uma proveta. Estimar o volume e transferir para um clice graduado. Medir, na mesma proveta, 2 volumes de etanol resfriado a -20C e adicion-lo lentamente com pipeta Pasteur, pela parede do clice. "Enrolar" o DNA com uma pipeta Pasteur de ponta curva. Transfer-lo para um tubo de ensaio contendo 10mL de Soluo IV (NaCl 1%). Aquecer a 50oC, por 10-20min, at completa dissoluo. Identificar o tubo com o nmero do grupo. Tomar uma alquota e diluir em 1 ml de gua. Medir a D.O.260nm e D.O.280nm e calcular a relao D.O.260nm /D.O.280nm. Estimar a quantidade de DNA obtida assumindo que D.O.260nm (Densidade ptica a 260nm) = 1 equivale a 50g DNA/mL.

25

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.1 Nome: Grupo No.

Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS :_______________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

26

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. Qual a funo do SDS, Clorofrmio: Isoamlico e Etanol nas etapas da purificao? Consultar tabela (no fim da apostila).

2. Por que possvel "enrolar" o DNA no basto de vidro?

3. Cite dois cuidados importantes para o sucesso da experincia realizada.

4. Se compararmos as medidas de absoro a 260 nm e a 280 nm da amostra de DNA obtida e de uma soluo de DNA puro obtido a partir do mesmo volume inicial de cultura de bactrias, o que observaramos? Por que?

27

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

5. Qual o espectro de absoro do DNA na luz ultravioleta. Como se compara com o espectro de absoro de albumina?

6. Como voc faria para obter DNA puro a partir dessa preparao que contm DNA e RNA?

7. Por que ocorre o efeito hipercrmico na desnaturao do DNA?

28

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No.2:INDUO DA -GALAGTOSIDASE POR IPTG.


A -galactosidase de E.coli uma enzima indutvel que hidrolisa -D-galactosdeos. A atividade desta enzima pode ser medida com substratos cromognicos que quando hidrolisados do origem a produtos coloridos. Um exemplo o orto-nitrofenil--D-galactosdeo (ONPG) que incolor mas na presena de -galactosidase convertido a galactose e orto-nitrofenol. O ortonitrofenol amarelo e sua absoro pode ser medida a 420nm. Altos nveis de -galactosidase s so medidos em culturas crescendo na presena de lactose ou de um indutor no metabolizvel, o IPTG (isopropil-tiogalactosdeo).

Protocolo: Ser utilizada uma pr-cultura de bactrias E.coli CSH23 que foi semeada ontem no final da tarde em meio de cultura lquido esterilizado e mantida at hoje pela manh, quando a cultura foi transferida para geladeira. Tome uma alquota da pr-cultura de bactrias e dilua em meio lquido na presena e ausncia de IPTG (1mM) sob agitao vigorosa a 37C at a cultura atingir D.O.600nm (Densidade ptica a 600nm) = 0,7. Esfrie as culturas no gelo por 20 min. Retire 0L, 50L e 100L de cada cultura, transferindo separadamente para 3 tubos Eppendorf previamente identificados. Complete com gua para um volume final de 100L. Adicione 0,7mL de tampo de ensaio (tampo fosfato de sdio 0,1M pH 7,0 contendo KCl 10mM, MgSO4 1mM e -mercaptoetanol 50mM). No descarte o restante das culturas mantendo-as no gelo. Adicione 50 L de cloroformio. Agite bem. Incube os tubos em banho de gua a 30oC por 5 min. Inicie a reao pela adio de 200 L de ONPG (4mg/mL) e incube a mistura de reao em banho de gua a 30oC por 10 min. Interrompa a reao adicionando 0,4mL de Na2CO3 1M. Centrifugue os tubos por 5 min na minicentrfuga. Remova delicadamente o sobrenadante de cada tubo para a cubeta sem retirar o clorofrmio, e faa a leitura da D.O.420nm (Densidade ptica a 420nm). Enxague as cubetas com gua entre a cada leitura. Faa uma diluio 1:10 das culturas de E.coli e faa a leitura da D.O.600nm (Densidade ptica a 600nm).
29

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Calcule a atividade de -galactosidase das duas culturas: Atividade de -galactosidase = 1000 x D.O.420nm __________________ tempo (min) x volume x D.O600nm de cultura (mL) UNIDADES

30

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.2 Nome: Grupo No. Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS :_______________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

31

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. O que voc pode concluir sobre o gentipo da cepa CSH23?

O que voc esperaria encontrar em um experimento semelhante utilizando uma cepa cujo gentipo I-O+Z+? E no caso de uma cepa I+O-Z+? Proponha um experimento para distinguir entre estas cepas.

32

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No. 3: TRANSFORMAO DE BACTRIAS COM PLASMDIOS CONTENDO GENES DE RESISTNCIA A ANTIBITICOS.
A tcnica de transformao permite a introduo de plasmdeo em uma bactria e sua manuteno como um elemento autnomo auto-replicativo. Este plasmdeo pode conferir bactria hospedeira certas propriedades (por exemplo resistncia a drogas) que podem ter valor seletivo no meio. Vrias tcnicas so disponveis para transformar uma bactria. Na aula prtica usaremos o mtodo do CaCl2. Neste mtodo as bactrias so submetidas a um tratamento num meio hipotnico contendo clcio que as torna competentes para a transformao pelo DNA do plasmdeo. Usaremos o plasmdeo pBR322 (ver mapa abaixo). O plasmdio pBR322 comumente usado para clonagem de genes inteiros ou de fragmentos de genes. Alm da origem de replicao que permite sua propagao em bactrias (E. coli) o pBR322 apresenta duas marcas genticas, ou seja, genes que codificam para protenas que conferem resistncia a ampicilina (ampr) e tetraciclina (tetr). Portanto a introduo de pBR322 em E. coli que normalmente sensvel tanto ampicilina como tetraciclina, leva ao aparecimento de bactrias capazes de crescer em meio (lquido ou slido) contendo estes antibiticos. Note que a introduo de genes exgenos no stio da enzima de restrio Pst I leva perda da resistncia ampicilina, uma vez que este stio est localizado na regio ampr. Da mesma forma, clonagem no stio da enzima Bam HI leva perda da resistncia a tetraciclina. Transformao de bactrias que so sensveis a um antibitico, em resistentes, ser revelada atravs de plaqueamento (inoculao) de bactrias em placas de agar contendo meio LB (meio rico de Luria Bertani) na ausncia e na presena de antibiticos: placas LB-A ou LBtet. contendo 50 mg/ml ampicilina ou 12,5 mg/ml tetracicilina.

33

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Protocolo: O ideal seria fazermos a experincia em condies estreis, para evitar contaminao. Como isto no ser possvel, manipule convenientemente o material estril fornecido. NO ABRA AS PLACAS DE GAR AT O MOMENTO DE USO. As bactrias competentes para transformao foram preparadas a partir de uma cultura em fase exponencial do crescimento e atravs de sucessivas lavagens do precipitado de bactrias com uma soluo de CaCl2 e mantidas congelads a -80oC. Inocular 5 ml de meio LB lquido com uma colnia de bactrias HB101 (E. coli) e incubar 37C at o dia seguinte sob forte agitao (200-250 rpm). Diluir a pr-cultura 1/10 em 10 ml de meio LB, incubar 37C sob agitao at OD600nm =0,3 (fase logartmica de crescimento). Transferir a cultura para o gelo, coletar as bactrias por centrifugao (4000 rpm, 5min). Ressuspender o sedimento de bactrias em 10 ml de tampo acetato de sdio (frio) 20 mM pH 6,5 contendo CaCl2 0,1M. Incubar no gelo por 20 minutos. Coletar as bactrias (4000 rpm, 5 min) e ressuspender em 1 ml do mesmo tampo (frio). Aps pelo menos 30 min. no gelo estas BACTRIAS COMPETENTES podem ser transformadas. Para transformar, distribui 0,1 ml/tubo da suspenso de bactrias competentes para cada um de 2 tubos. Adicionar o DNA transformante (0,5 g DNA de pBR322 em 10 l de tampo 10 mM Tris pH 7,5 contendo 1 mM EDTA) a um dos tubos. O outro tubo ser usado como controle (bactria apenas). Incubar em gelo por 15 min. antes de dar o choque trmico (42C por exatamente 90 segundos). Transferir os tubos para o gelo por 2 min. Adicionar 0,9 ml/tubo de meio LB e incubar a 37C sem agitao, em banho-maria, por uma hora. Tranferir 25l ou 250l da suspenso para placas de gar LB e LB-A (LB contendo ampicilina) previamente identificadas conforme a tabela abaixo. Espalhar as bactrias com o auxlio de uma ala de vidro, previamente flambada e em seguida resfriada na prpria tampa da placa de Petri.

Nmero de colnias/ placa Placa LB #1 Bactrias controle 25L #2 Bactrias controle 250L #3 Bactrias transformadas 25L #4 Bactrias transformadas 250L Placa LB-A

34

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.3 Nome: Grupo No. Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS: 1. Preencher a tabela com o nmero de colnias obtido em cada caso. Nmero de colnias/ placa Placa LB #1 Bactrias controle 25L #2 Bactrias controle 250L #3 Bactrias transformadas 25L #4 Bactrias transformadas 250L Placa LB-A

2. Qual a eficincia de transformao obtida, em termos de n de colnias/ug de DNA? _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

35

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. Por que se usa cultura em fase exponencial de crescimento para obter bactrias competentes?

2. Qual o papel do choque trmico?

3. Por que as bactrias devem ser incubadas por 60 min a 37C antes de espalh-las em placas de gar?

4. Que utilidade teria esta tcnica do ponto de vista biotecnolgico ? D um exemplo.

36

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No. 4: PREPARAO DE DNA PLASMIDIAL


A partir das bactrias transformadas obtidas na experincia anterior, extrair e purificar o DNA plasmidial, separando-o do DNA cromossomal bacteriano. Protocolo:
Utilizaremos cultura de E. coli em meio LB-A (50g/ml ampicilina).

1. Tomar 1 ml da cultura e colocar em um tubo Eppendorf. 2. Centrifugar a 12000xg por 5 min temperatura ambiente. 3. Descartar o sobrenadante e secar o sedimento invertendo o tubo sobre papel absorvente por 1 min. 4. Adicionar 100l de tampo GET/RNase e ressuspender as bactria por agitao no vortex. 5. Adicionar 200l de soluo de lise e inverter 10 vezes o tubo lenta e delicadamente. 6. Incubar a mistura por 5 min temperatura ambiente. 7. Adicionar 200l de soluo neutralizadora e inverter 10 vezes o tubo bem lenta e delicadamente 8. Incubar o tubo em gelo por 20 min. 9. Centrifugar a 12000xg por 15 min temperatura ambiente. 10. Transferir 440l do sobrenadante resultante da centrifugao do passo 9 para outro eppendorf contendo 300l de isopropanol. 11. Centrifugar a 12000xg por 10 min temperatura ambiente, 12. Desprezar o sobrenadante e levar o sedimento com 500l de 70% etanol. 13. Centrifugar a 12000xg por 5 min temperatura ambiente. 14. Secar o sedimento sob vcuo em speed vac e ressuspend-lo em 25l de T.E. 15. Incubar por 5 min a 65oC. 16. Tomar um volume apropriado da soluo de plasmdeos e adicionar tampo de amostra na proporo 1:10. 17. Aplicar a amostra em gel 0.7% agarose em TBE, contendo 0,5g/ml brometo de etido e submeter a eletroforese a 100V em tampo TBE. 18. Observar o DNA obtido na preparao por iluminao do gel com luz ultravioleta.
GET/Rnase dextrose 50mM, EDTA 10mM, Ribonuclease A 150g/ml em Tris-HCl 25mM pH 8.0 Soluo de lise SDS 1% em NaOH 0,2N Soluo neutralizadora Acetato de potssio 3M pH 4,8
37

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.4 Nome: Grupo No. Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS :_______________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

38

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. Que papel desempenha cada componente do tampo GET (glicose, EDTA e Tris)?

2. O que lisozima e para que usada na preparao de plasmdeos?

3. Qual a funo do NaOH e do SDS presentes na soluo de lise?

4. Se o DNA cromosomal tiver sido muito quebrado durante as manipulaes, onde espera encontr-lo aps precipitao com KAc? Quais as consequncias para a preparao de DNA plasmidial?

5. Como age o isopropanol? Este lcool poderia ser substitudo por etanol, por exemplo?

6. Por que se dissolve a preparao de DNA em tampo Tris-EDTA?

7. Quantas bandas do DNA plasmidial so vizualizadas no gel corado com EtBr? Quantas bandas voce esperaria caso o pBR322 purificado fosse digerido com a enzima EcoRI?

39

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No. 5: DIGESTO DE DNA COM ENZIMAS DE RESTRIO e ELETROFORESE DE DNA EM GEL DE AGAROSE
Preparaes de DNA plasmidial ou cromossomal purificadas podem ser submetidas a digesto com enzimas de restrio para identificao e caracterizao do DNA. A escolha das enzimas de restrio deve ser baseada no mapa de restrio (quando disponvel) ou opta-se pelo emprego de um conjunto de enzimas de forma a permitir a caracterizao do DNA em questo, ou seja, obter seu mapa fsico. As enzimas de restrio classificam-se em 3 gupos quanto a fora inica para a atividade (alta, mdia e baixa). As enzimas de restrio comercialmente disponveis costumam vir acompanhadas do tampo correspondente e instrues para realizar a reao. Na experincia a ser realizada o DNA do plasmdeo ser digerido com 4 enzimas de restrio diferentes. - Cada grupo (ver tabela abaixo) receber um tubo Eppendorf contendo os componentes da reao com exceo do DNA plasmidial. Manter o tubo em banho de gelo. Acrescentar 10L da soluo de plasmdeo (DBQ1, 150ng/10L) no tubo. GRUPOS 1,7,13,19 EcoRI H2O Tampo da enzima (10X) Enzima (1 U) Plasmdeo Volume total 7 L 2 L 1L 10L 20L 2,8,14,20 BglII 7 L 2 L 1L 10L 20L 3,9,15,21 EcoRI e BglII 6 L 2 L 1L / 1L 10L 20L 4,10,16,22 EcoRI e XbaI 6 L 2 L 1L / 1L 10L 20L 5,11,17,23 BglII e XbaI 6 L 2 L 1L / 1L 10L 20L 6,12,18,24 sem enzima 10L 10L 20L

Misturar o contedo dos tubos por agitao e centrifugao rpida. Incubar a reao em banho maria a 37C durante 60min. Interromper a reao pela adio de 1L EDTA 0,1 M (Opcional). Transferir o tubo para um banho a 65C, durante 15min. Retirar o tubo do banho e rapidamente coloc-lo em gelo. Adicionar a cada um dos tubos 5L de tampo da amostra. Misturar e centrifugar. A amostra est pronta para ser analizada em eletroforese em gel de agarose. Tampo de digesto 10X Tris-HCl 100mM - 500mM* NaCl 500mM-1M* MgCl2 100mM DTT 10mM *(depende da enzima) Tampo da amostra Tris 10mM pH 8, EDTA 1mM pH 8, azul de bromofenol 0,25% p/v xileno cianol 0,25% p/v sacarose 40% p/v

40

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

FRACIONAMENTO DO DNA EM GEL DE AGAROSE


Preparo do gel de agarose 1,0% OBS: Sero montados dois gis com espao para aplicao de at 14 amostras Pesar 1,0 g de agarose. Adicionar 100mL de tampo TBE (Tris-borato 89mM, EDTA 2mM pH8). Aquecer em banho fervente e misturar at completa dissoluo da agarose. Enquanto espera-se a dissoluo da agarose, preparar a forma para o gel. Resfriar at 40C (at conseguir segurar com as mos) e acrescentar 5L de uma soluo de brometo de etdio 10mg/mL. CUIDADO BROMETO DE ETDIO CARCINOGNICO! Despejar sobre a forma para o gel previamente preparada, incluindo a colocao do pente. Deixar solidificar por pelo menos 30min. Retirar o pente e transferir o gel para a cuba. Adicionar tampo TBE cuba de modo a cobrir o gel com menor volume possvel. Aplicar as amostras preparadas na experincia anterior. Ligar a fonte de eletroforese e aplicar aproximadamente 100V. Cuidado para no tocar o tampo. Interromper a eletroforese quando o corante azul estiver a 0,5cm do fim do gel. Tranferir o gel para o transiluminador e, em seguida observar o gel sob luz UV, utilizando culos protetores. Fotografar o padro de bandas observado com uma rgua posicionada na lateral do gel. OBS: Ordem de aplicao das amostras nos gis GEL 1 1 - 2 - 3 - 4 -5 6 - Padro de tamanho - 7 - 8 - 9 10 11- 12 GEL 2 13 - 14 -15 16 17 18 - Padro de tamanho - 19 20 21 22 23 24

41

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.5 Nome: Grupo No. Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS: :______________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

42

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. Por que se observam duas bandas no plasmdeo que no foi incubado com a enzima?

2. Por que se utiliza EtBr (Brometo de Etdio) no gel e no tampo da eletroforese?

3. Gis de agarose podem ser usados para anlise de fragmentos de DNA que tenham entre 70 a 800.000 pares de base. Assim, possvel estimar o tamanho e a quantidade dos fragmentos de DNA. O tamanho pode ser estimado tomando-se por base a sua mobilidade em relao a de outros de tamanho conhecido. Se o gel foi fotografado com uma rgua ao lado, a mobilidade relativa pode ser lida diretamente da foto. O grfico da mobilidade em cm (M) contra o tamanho em pb (L) dar uma curva que pode ser usada para leitura do tamanho com relao a uma determinada mobilidade. Entretanto, a interpolao muito mais precisa se a funo puder ser encontrada em uma linha reta: grfico de log L versus M. Desenhe a reta utilizando papel monolog (eixo x, mobilidade em cm, eixo y, tamanho em pb). Usando-se a mistura de padres de tamanho em pb conhecida calcule o tamanho dos fragmentos obtidos da digesto do pQBQ com as enzimas utilizadas. Faa um desenho do pQBQ indicando a posio dos stios de clivagem para estas enzimas.

5000 bp 4000 bp 3000 bp 2000 bp 1600 bp 1000 bp 500 bp

43

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

EXPERINCIA No. 6: EXPRESSO DE PROTENA RECOMBINANTE EM E. COLI.


A produo de protenas exgenas em E. coli uma das muitas aplicaes da tecnologia do DNA recombinante. Para que a expresso da protena de interesse seja obtida, um fragmento de DNA contendo a regio codificadora do gene correspondente deve ser clonado num valor de expresso de E. coli, sob o controle de um promotor geralmente induzvel. Na experincia a ser realizada, a expresso da protena est sob o controle do promotor lac e a induo feita com IPTG. Aps a induo, as amostras sero analisadas por eletroforese em gel de poliacrilamida. O gel de eletroforese constitudo de um polmero de acrilamida. A polimerizao ocorre na presena de radicais livres, os quais so gerados por persulfato de amnio e estabilizados por TEMED (N,N,N,N-tetramethilethilenediamina). A polimerizao tambm depende da presena de um agente bifuncional N,N'-methilenebisacrilamida tornando as cadeias ligadas entre si formando um gel cuja porosidade determinada pelo comprimento das cadeias e pelo grau de interligao entre estas. O sistema de eletroforese que ser utilizado ser um sistema denominado descontnuo. So utilizados dois tipos de gel, um denominado gel de empilhamento e outro denominado gel de corrida. A funo do gel de empilhamento de concentrar amostras com grande volume, resultando em uma melhor definio e resoluo dos resultados. As molculas so, ento, completamente separadas no gel de corrida I Pr-Inculo: 10 mL de meio LB, antibitico a uma concentrao final 100g/mL (100L de carbenicilina 50mg/mL) e bactria (1 colnia). Crescer a 37C por uma noite com agitao de 200 rpm. II Induo 1 Num erlenmeyer colocar 10mL de meio LB fresco contendo carbenicilina 100g/mL e diluir o pr-inculo (DO600nm deve estar entre 0,1 e 0,15). Incubar a 37C e 200 rpm. 2 Quando a cultura atingir DO600nm entre 0,4 e 0,5 coletar uma alquota de 1mL (cultura no induzida) e adicionar IPTG cultura para concentrao final 1mM. Colocar a 37C, 200 rpm por 1 hora. 3 Depois de 1 hora coletar uma alquota de cultura induzida (1 mL). III Tratamento das amostras induzida e no induzida 1 Centrifugar 16000 x g por 5 minutos a temperatura ambiente. 2 Desprezar o sobrenadante. 3 Ressuspender o sedimento em 100L de tampo amostra para eletroforese 1X (Tris 50 mM pH 6,8; DTT 25 mM; glicerol 10%; SDS 1% e azul de bromofenol 0,025%). 4 Ferver a 95C por 5 minutos. 5 Aplicar as amostras no gel de poliacrilamida (SDS-PAGE).

44

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

RELATRIO - EXPERINCIA No.6 Nome: Grupo No. Data

OBJETIVO DA EXPERINCIA:___________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ RESULTADOS OBTIDOS: :______________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________ _____________________________________________________________________

45

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

Nome: QUESTES: 1. Qual o papel da carbenicilina?

2. Por que se usa IPTG para a induo da sntese da protena recombinante?

3. Pode ser produzida uma glicoprotena utilizando-se o procedimento aqui descrito?

46

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

47

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

PROPRIEDADES FSICO-QUMICAS DOS CIDOS NUCLEICOS DNA Fora inica baixa ("Salting in") alta ("salting out) Meio cido 0,5N (brando) frio Meio alcalino brando (0,3N KOH; 37C; 18h) Solvente orgnico (cte dieletr. < que da H2O) ex.: etanol, isopropanol Agentes desnaturantes quebram pontes de H ex.: formamida, uria Luz UV (260 nm) Calor Nucleases Exonucleases Endonucleases Solubiliza Precipita Precipita Depurina ss: estvel ds: desnatura Solubiliza Precipita Precipita Depurina Hidrolisa 2' e 3'nucleosdeos RNA

Precipita ss: estvel ds: desnatura ss: absorve mais ds: absorve menos ss: estvel ds: desnatura (Tm) + +

Precipita 1ria: estvel 2ria: destruda Absorve 1ria: estvel 2ria: destruda + +

48

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

INIBIDORES DE TRANSCRIO OU DE TRADUO ANTIBITICOS Rifamicina (Streptomyces) Rifampicina (sinttica) Inibe iniciao da transcrio (impede a formao da la. ligao fosfdieser) mas no inibe elongao da cadeia de mRNA. Liga-se subunidade de RNAP. Actinomicina D: Estrutura: 2 peptdeos + 3 anis benzeno fenoxazona (ver p 715 Stryer). Extrada de Streptomyces. Inibe transcrio. Liga-se a dsDNA impedindo que seja usado como template. Anis fenoxazona intercalam-se entre as bases nitrogenadas do RNA. Usado em tratamento de cncer. -Amanitina (octapeptdeo cclico) de um cogumelo (Amanita) Inibe RNAPII (muito) e III (um pouco, em maior concentrao). Liga-se a RNAPII bloqueando a formao de mRNA ou de precursores de mRNA. Inibe elongao. Puromicina: Inibe traduo. Anlogo de aminoacil-tRNA. Liga-se ao stio A do ribossomo, impedindo a entrada de aminoacil-tRNAS. Foma ligao peptdica com a cadeia polipeptdica nascente (peptidil transferase). Peptidil-puromicina: peptdeo liberado do ribossomo contendo puromicina ligada covalentemente ao C-terminal. Tetraciclina: Liga-se ao stio A do ribossomo, impede ligao de aminoacil-tRNA neste stio. Cloranfenicol: S inibe a sntese de protenas de procariotos e mitocndira (no inibe a sntese protica extramitocondrial de eucariotos). Cicloheximida: Inibe a formao dos ribossomos de eucariotos (80S) mas no de procariotos (70S). Estreptomicina: Causa leitura incorreta do cdigo gentico. TOXINAS Diftrica: Inibe sntese protica. Alvo EF2 que cataliza a translocao do peptdeo. O fragmento A da toxina cataliza a transferncia de ADP para EF2 (ADP-ribosilao) inativando este fator de elongao da cadeia polipeptdica. Ricina: Inativa a subunidade 60S dos ribossomos eucariticos.

49

QBQ-217/Bioqumica e Biologia Molecular do Gene 2003

UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG

Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met Val Val Val Val

UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG

CDIGO GENTICO Ser UAU Tyr Ser UAC Tyr Ser UAA STOP Ser UAG STOP Pro CAU His Pro CAC His Pro CAA Gln Pro CAG Gln Thr AAU Asn Thr AAC Asn Thr AAA Lys Thr AAG Lys Ala GAU Asp Ala GAC Asp Ala GAA Glu GAG Ala Glu

UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG

Cys Cys STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly

AUG parte do sinal de iniciao e tambm o cdon para as metioninas internas cadeia.

50