Vous êtes sur la page 1sur 18

thme 1 .

expression, stabilit et variation du patrimoine gntique


de la cellule et la rplication de lADN

Chapitre 1 La reproduction conforme


Unit

La division cellulaire
Connaissances du programme

[pp. 18-19 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Effectuerungestetechniqueenobservantaumicroscopedesdivisions decelluleseucaryotes.

Engnralladivisioncellulaireestunereproductionconformequi conservetouteslescaractristiquesducaryotype(nombreetmorphologiedeschromosomes).

Conseils et suggestions
La division cellulaire, la variation dtat des chromosomes au cours du cycle cellulaire et la variation de la quantit dADN au coursducyclecellulaireonttdveloppsenTroisime.Maisces notions ont t prsentes avec un niveau dexplication lmentairevoirenonttlobjetquedunsimpleconstat.CepremierchapitredePremireSviseendtaillerlexplication.Laconservation ducaryotypeaucoursdelamitoseestunacquisducollgeet, cetitre,faitlobjetdunindispensablerappelpralable(voirp. 15). Lunit 1 a pour objet de rappeler le comportement des chromosomesaucoursdeladivisioncellulaire.Lechoixatfait,ici, dentamerlanalyseparunemanipulationquiconduitlobservationmicroscopiquedecellulesderacinesdailendivision(doc. 1). Cettemanipulationpeuttreralisesurunautrematrielvgtal (mristmederacinedejacinthe,parexemple). Cette tude est loccasion de fixer plus prcisment le droulement de la mitose (condensation des chromosomes, sparation des chromatides) en identifiant notamment les phases qui la constituent(doc. 2). Si la prsentation du mcanisme cellulaire de sparation des chromatides(doc. 3)nestpasindiqueparleprogramme,ilapparatintressantdelementionnersommairementpourmieuxfaire comprendrelephnomneluvreaucoursdelanaphase. Cette unit est enfin loccasion dintroduire le terme, nouveau pourleslves,demitose.

Unetchecomplexe,intgrantunemanipulationetlobservation dunvidogrammedunemitosepeuttreenvisagepouridentifier etschmatiserlestapesdelamitose.

Exploitation des documents par les activits


(Manipuler et exprimenter, extraire des informations partir dobservations et de documents, organiser ces informations, communiquer par crit). Aprsanalysedudoc. 2,ilestpossibledereconstituerlenchanement des phases de la mitose et de caractriser chacune delle: la prophase, lors de laquelle les chromosomes doubles deux chromatides se condensent; la mtaphase, lors de laquelle les chromosomes doubles condenss salignent lquateur de la cellule; lanaphase, lors de laquelle les chromatides de chaque chromosomessontsparesetmigrentchacuneversunpledela cellule.Aprslamigrationdeschromatidessursverslesplesde lacellule,grceauxcablesdetubulines(doc. 3),latlophaseest la dernire tape de la mitose qui voit la division du cytoplasme en deux cellules filles qui contiennent le mme nombre de chromosomessimplesuneseulechromatide,identiqueceluide lacellulemre.Leschromosomessedcondensentalorsprogressivement(doc. 2). La mitose permet donc bien la conservation du nombre de chromosomes dans une cellule (voir le schma, p. 24 du manuel de llve,tendre3pairesdechromosomes).

SVT 1reS ditions Belin 2011

Thme 1 ChapiTre 1

Unit

Le cycle cellulaire
Connaissances du programme

[pp. 20-21 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Recenser,extraireetexploiterdesinformationspermettantdecaractriserlecyclecellulaireetsesphases,dansdiffrentstypescellulaires.

ChaquechromatidecontientunemolculedADN. Leschromosomessontdesstructuresconstantesdescelluleseucaryotes quisontdansdestatsdecondensationvariablesaucoursducyclecellulaire

Conseils et suggestions
Aprsavoirrinvestietapprofondiledroulementdelamitose danslunit 1,cetteunit 2visereplacercephnomnedans le contexte gnral du cycle cellulaire, dont on prsente dabord les4phases(doc. 1).Laprsentationducycleestindissociablede ltudedelavariationdelaquantitdADNcellulaire(doc. 2 et 3). Elleestgalementunpralableimportantltudedelavariation deltatdecondensationdeschromosomes(doc. 4 et 5). LadmonstrationexprimentaledelacopiedechaquechromosomeaucoursdelaphaseSestdifficile.Lechoixadonctfait dobserver,parlutilisationdesondesspcifiquesfluorescentes,le nombredecopiesdungnedanslenoyaudunecelluleenphase G1etG2(doc. 3). CetteunitprpareltudedtailledelarplicationdelADN quiseralobjetdelunit 3. Lesdiffrentsdocumentsproposspermettentdoncdemontrer lestatsdecondensationdelADNaucoursducycleunniveau adaptladmonstrationetauxexigencesduprogramme(doc. 4 et 5).IlnestpasncessairededtaillerexhaustivementlesdiffrentsniveauxdenroulementdelADN.

sont donc toujours constitus chacun de deux chromatides, mais sont fortement condenss (doc. 4). la fin de la mitose, en revanche,laquantitdADNparcelluleestbrutalementdivisepar 2:ceciconcordeaveclasparationdes2chromatidesdechaque chromsomeetleurmigrationverschacundes2plesdelacellule (commevudanslunit 1)

Doc. 2 et 3 (Pratiquer une dmarche scientifique : exploiter des rsultats exprimentaux).LedoublementdelaquantitdADN (doc. 2) ainsi que le doublement du nombre de copies du gne situsurlapairedechromosomes22(doc. 3)entrelesphasesG1 etG2indiquentquunecopiedelADNcontenudanslenoyauest raliselorsdelaphaseS. Doc. 2 A 4 (Extraire et organiser des informations, raisonner avec rigueur). OnpeutsupposerqueleschromosomesdeuxchromatidesquicaractrisentlaphaseG2sontissusdudoublementde laquantitdADNenphaseS.Commelesdeuxchromatidesportent lammeinformationgntique(doc. 3),etquechaquechromatidemigreversunpledelacellulelorsdelamitose,linformation gntique des cellules filles est ncessairement identique celle delacellulemre.

en conclusion(Communiquer dans un langage scientifiquement appropri). Phase G1: les chromosomes sont dcondenss et simples (une seulechromatide).ChaquechromosomecontientdoncunemolculedADN. Phase S: les chromosomes sont toujours dcondenss mais la quantitdADNestdouble.Cestaucoursdecettephaseducycle cellulaire que les chromosomes, chacun compos initialement dunechromatide,enviennenttreconstitusde2chromatides sursporteusesdelammeinformationgntique. Phase G2: les chromosomes sont toujours dcondenss, mais doubles(2chromatides).Chaquechromosomeestdonccompos dedeuxchromatidesndoncde2molculesdADN. PhaseM:leschromosomessontconstitusde2chromatidesetse condensent.lafindelaphaseM,les2chromatidesdechaque chromosome sont spares et migrent chacune vers un ple de la cellule, qui constituera la future cellule fille. Les chromosomes simples contenus dans chacune des cellules filles commencent ensuitesedcondenser.

Exploitation des documents par les activits


Doc. 1, 4 et 5(Extraire des informations dune photographie et dun schma lgends). En phase G1, la quantit dADN est mesureunevaleurQ(doc. 2).Onconstatelaprsencededeux copies dun gne situ sur la paire de chromosome 22 (doc. 3), soitunecopiedugneparchromosome.Onsupposedoncqueles deux chromosomes dune mme paire ne sont constitus chacun que dune seule chromatide. En G1, le chromosome est en outre dcondens(doc. 5). EnphaseG2,onmesureunequantitdADNde2Q,soitledouble decellerelevelorsdelaphaseG1(doc. 2).Onconstategalementlaprsencede4copiesdugnesitusurlapairedechromosome22,soit2copiesparchromosomes.Commeleconfirmele doc. 5,lesdeuxchromosomesdunemmepairesontdoncchacun constitusde2chromatides,dansuntattoujoursdcondens. EnphaseM,audbutdelamitose,laquantitdADNparcellule est la mme que celle mesure en G2 (2Q). Les chromosomes

2 Thme 1 ChapiTre 1

SVT 1reS ditions Belin 2011

Unit

La rplication du matriel gntique


Connaissances du programme

[pp. 22-23 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Mettreenuvreunemthode(dmarchehistorique)et/ouuneutilisationdelogicielset/ouunepratiquedocumentairepermettantdecomprendrelemcanismederplicationsemi-conservative

AucoursdelaphaseS,lADNsubitlarplicationsemi-conservative. Enabsencederreur,cephnomneprserve,parcopieconforme,la squencedesnuclotides. Ainsi,lesdeuxcellules-fillesprovenantparmitosedunecellule-mrepossdentlammeinformationgntique.

Conseils et suggestions
Aprs la mise en vidence de la copie de lADN au cours de la phaseS(unit 2),lunit3visedmontrerlesmodalitsdecette copieainsiquesesmcanismesmolculairessimples. Lapremirepartiedecetteunitsinscrittrsnaturellementdans unedmarchehistorique,conseilleparleprogramme.Ilconvient doncdereplacerlesmcanismesrecherchsdanslefoisonnement de questions et de travaux en biologie molculaire des annes 1950. Lhypothse dune rplication semi conservative avait t miseds1953parWatsonetCrickaumomentdeladcouverte de la structure de lADN. Il a fallu attendre les expriences de Tayloren1957etcelles,dcisives,deMeselsonetStahlen1958 pour valider ces hypothses. Nous avons choisi ici de dvelopper lesexpriencestrsdmonstrativesdeMeselsonetStahl(doc. 1 et 2)maislesexpriencesdeTaylorpeuventtreutilisescomme supportpourunexercicedapplicationouunevaluation. Unefoislecaractresemi-conservatifdelarplicationdelADN dmontr,lapagededroiteabordelesmcanismesmolculaires delarplication.llvedobserverlorganisationdesfourchesde rplication(doc. 3)etdecomprendrelerledelADNpolymrase (doc. 4 et 5) au niveau ncessairement simple attendu par le programme. Les diffrents documents conduisent les lves construire un modledefourchederplicationincluantledtaildesnuclotides desbrinsparentauxetnosynthtiss. Lacomprhensiondesmcanismesmolculairesdelarplication peut tre rinvestie dans ltude de la PCR propose par le programmedanslespistes(voirchapitre 2, unit 1, p. 33).

fragments synthtiss pendant la rplication. Il sagit du modle dispersif.


Aprs 1 rplication Aprs 2 rplications

Doc. 2 (Manifester sens de lobservation et esprit critique). Les LDP_A1u3 90 x 90 bandes observes aprs centrifugation correspondent de lADN lourd(dontlesdeuxbrinsontincorpordelazotelourd),delADN lger(dontaucundesdeuxbrinsnaincorpordazotelourd)oude lADN intermdiaire (dont un seul des deux brins a incorpor de lADNlourd).

Exploitation des documents par les activits

Doc. 1 et 2 (Formuler une hypothse, pratiquer une dmarche


scientifique). Audbutdelexprience,lacentrifugationdelADN rvlequechaquemolculedADNdescellulestudiesprsente de lazote lourd dans ses deux brins. Aprs un cycle cellulaire sur de lazote lger (14N), on observe une seule bande dADN intermdiaire. Ce rsultat limine lhypothse du modle conservatif, qui aurait d produire deux bandes, lune dADN lourd (molcule parentale), lautre dADN lger (molcule synthtise pendant le cyclecellulairecoul). Aprsdeuxcyclescellulairessurdelazotelger,onobservedeux bandes dADN en quantits quivalentes, lune dADN lger, et lautre dADN intermdiaire. Ce rsultat limine lhypothse du
Thme 1 ChapiTre 1

Doc. 1 (Raisonner avec rigueur). Dans le modle (a), aprs

rplicationdelADN,onobserve,pourlesdeuxmolcules,unbrin parental et un brin synthtis pendant la rplication. Il sagit du modlesemi-conservatif. Danslemodle(b),aprsrplicationdelADN,onobservequune molcule dADN est constitue de deux brins parentaux et que lautremolculeestconstituededeuxbrinssynthtisspendant larplication.Ilsagitdumodleconservatif. Dans le modle (c), aprs rplication de lADN, on observe pour les deux molcules un mlange des fragments parentaux et de

SVT 1reS ditions Belin 2011

modle dispersif qui aurait toujours dproduireune seulebande dADNintermdiaire(donttouteslesmolculesdevaienttrecomposeslafoisdADNparentallourdetdADNsynthtislger). Aprstroiscyclescellulairessurdelazotelger,onobservedeux bandes dADN, lune contenant de lADN lger en quantit 3 fois plusimportantequelautre,quicontientdelADNlourd.Cersultat estseulementcompatibleaveclemodledunerplicationsemiconservative.

Doc 3 5 (Communiquer laide dun schma). Voirschma au bas de la p. 25 dumanueldellve.

en conclusion (Communiquer dans un langage scientifique appropri). PendantlaphaseSducyclecellulaire,uncomplexede rplication ouvre la double hlice dADN puis synthtise un nouveaubrinpartirdubrinmatrice.Cettesynthseestassurepar lassemblage de nuclotides selon une squence complmentaire dubrinmatrice,assemblageralisparlADNpolymrase. Cettemodalitsemi-conservativedelarplicationproduitainsides chromosomesdeuxchromatidessursportantuneinformation gntiqueidentique.

Chapitre 2 lorigine de la variabilit


gntique : les mutations
Unit

Les mutations, des modifications de lADn


Connaissances du programme

[pp. 32-33 du manuel de llve]

Capacits et attitudes de mises en uvre dans lunit


Concevoiretraliserunprotocole. Utiliserdeslogicielspourcaractriserdesmutations.

PendantlarplicationdelADNsurviennentdeserreursspontaneset rares.LADNpeutaussitreendommagendehorsdelarplication.

Conseils et suggestions
La page douverture du chapitre (p.31) peut permettre de revenir sur le codage de linformation gntique par la squence de la molcule dADN et sur le fait quune modification de cette squence (mutation) peut entrainer une modification hrditaire descaractresdelindividu(ici,lacouleurdupelage). CetteunitvisemontrerquedesmodificationsdelADNpeuventapparatrespontanment(doc. 1 3),diffrentsmoments ducyclecellulaire(doc. 4 et 5).Unmodleexprimentalsimple estutilis:uneculturedelevures(doc. 1). Laralisationdeculturesdelevures(doc. 1)estloccasiondinsistersurlesbonnespratiquesdelaboratoire,notammentlemploide matrielstrileetletraitementadquatdesdchets.Lasouchede levuresade2etlesmilieuxdeculturesontdisponiblesauprsdes fournisseurshabituelsdeslaboratoiresdelyce.Lamiseenculture en milieu liquide est ralise au laboratoire avant la sance de TP.Leslvespeuventtalerunefractiondecettesuspensionsur milieusolideetobserverlersultataprsquelquesjours.Lerepiquagedesventuelsmutantsblancsobtenuspeutenfintreralis parleprofesseurdevantleslves,etlersultatobservquelques joursplustard.Remarqueimportante:tantdonnlenombrede botes ncessaires pour obtenir au moins un mutant blanc, il est
4 Thme 1 ChapiTre 2

peu probable que le rsultat soit probant en ne travaillant qu lchelle dune classe. Le TP mis en uvre dans lunit 2 tant beaucoupplusfacileraliserenclasseetdonnantdesrsultats plussignificatifs,ilpeuttreprivilgi. Dans loptique de lvaluation des capacits exprimentales, les lves peuvent utiliser le logiciel Anagne pour retrouver les informationsdudoc. 2.(voirlafiche pdagogiquedisponiblesur www.libtheque.fr) Cetteunitpeuttreloccasiondecomparerlesdiffrentstauxde mutations calculs chez diffrentes espces (doc. 3) et dans des milieuxacellulaires(doc. 4)etderechercherdeshypothsesexpliquantcesdiffrences.Onpeutgalementvoquerlesdiffrences de taux derreurs en fonction du type de polymrase utilise lors desractionsdePCR. Lexercice 4, p. 44 offre un prolongement de cette unit en prsentantunexempledaltrationspontanedunebasedelADN pouvant conduire une mutation. Grce lutilisation du logiciel Rastop, les lves peuvent retrouver les informations apportes parledocumentetsentranerlamanipulationdulogicielenvue delvaluationdescapacitsexprimentales(voirlafiche pdagogique disponiblesurwww.libtheque.fr).

SVT 1reS ditions Belin 2011

Exploitation des documents par les activits


(Raliser une culture de levures, utiliser un logiciel, extraire des informations partir dobservations et de documents, organiser ces informations, communiquer par crit). Ledoc. 1prsenteuneexprienceralisepartirduneculturede levures.Lescoloniesrougesdedpartsontconstituesdelevures ade2-,quiportentlallleade2dugneade2.Leurcouleurrouge estduelaccumulationetloxydationducomposAIR.Aprsde trs nombreuses divisions successives de ces levures, on observe lapparitiondecoloniesblanches,quinaccumulentdoncpasdAIR oxyd.Cecipeuttredaufaitque: lallledugneade2quilpossdeestnouveaufonctionnel:ily donceuunemutationenposition662deGversT(doc. 2); unemutationestapparue,rendantnonfonctionnelungneintervenantenamontdansleprocessusdesynthsedeladnine(lAIR nestalorsplussynthtis,doncplusaccumul); unemutationestapparue,rendantnonfonctionnelungnequi permet loxydation dAIR (ainsi lAIR nest plus oxyd en pigment rouge). Cescoloniesblanchessonttrsrares:3pour100200colonies,soit 0,015%descolonies. Ces colonies blanches sont apparues spontanment, sans application daucun agent exogne, uniquement suite aux divisions successivesdeslevuresenculture. Ledoc. 3estuntableaursumantletauxdemutationsspontanes chezdiffrentesespces.Onpeutcalculerlenombredenuclotides devanttrerpliquspourobserverunemutation: ChezE. coli :4,6.106435=2.109 ChezN. crassa :4,2.107333=1,4.1010

Chezlalevure:1,4.107370=5,2.109 Les mutations spontanes sont donc des phnomnes extrmementrares. Danslexprienceprsentesurledoc. 4oneffectueuneunesuite derplicationsenchanedunfragmentdADNouPCR,dansun milieuacellulaire,grcenotammentuneADNpolymrase.lissuedelaractiondePCR,onobservequunetrsgrandemajorit desfragmentsdADNaunesquenceidentiqueaufragmentinitial: larplicationsestdoncbieneffectuedemanireconforme.Mais onobservegalement: unfragmentprsentantunAaulieudunTen18eposition,en1 exemplaire.Lapolymraseadoncintroduitunmauvaisnuclotide lorsdelavantderniercycledePCRsoitlorsdu15ecycle. unfragmentprsentantunCaulieudunTen8eposition,en4 exemplaires.Ilyadonceuuneerreurderplication3cyclesavant lafindelaPCR,soitlorsdu12ecycle. Cedocumentnousindiquedoncque,lorsdelarplicationdelADN, lapolymrasepeutfairedeserreursetintroduiredesnuclotides errons,conduisantdesmutations. De plus, tout moment du cycle cellulaire, des altrations chimiques de la molcule dADN peuvent avoir lieu, conduisant desmodificationsdelasquencelorsdelarplicationsuivante (doc. 5). Pour conclure, les mutations sont donc des modifications de la squencedADN(doc. 2),pouvantapparatredemanirespontane(doc. 1)unefrquencetrsfaible(doc. 1etdoc. 3).Elles ontpouroriginedesmodificationschimiquesdelADNendehors delarplication(doc. 5)oudeserreursdesADNpolymraseslors delarplication(doc. 4).

Unit

Les variations de la frquence des mutations


Connaissances du programme

[pp. 34-35 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Recenser,exploiteretinterprterdesbasesdedonneset/ouconcevoir etraliserunprotocolepour: mettreenvidencelinfluencedagentsmutagnessurdespopulations humaines(UV); analyserlinfluencedelirradiationduneculturedelevurespardesUV (suividutauxdemortalit). Utiliserdeslogicielspourcaractriserdesmutations.

PendantlarplicationdelADNsurviennentdeserreursspontaneset rares,dontlafrquenceestaugmenteparlactiondagentsmutagnes. Pistes. Quantification de la mutation dans une population cellulaire (mathmatiques) ; les agents mutagnes dans lenvironnement (physique-chimie).

Conseils et suggestions
Danslunitprcdente,onamontrquelesmutationspeuvent apparatre de manire spontane et on a calcul leur frquence dapparition,trsfaible.Danscetteunit2,onmettraenvidence lexistencedagentsmutagnesquiaugmententlafrquencedapparitiondesmutationsetontdoncdeseffetsnfastessurlasant humaine.

Lexprimentationdudoc. 1reprendlescomptencestechniques mises en oeuvre dans le doc. 1 p. 32 de lunit prcdente, ce qui permet aux lves de se concentrer sur les aspects mthodologiques (tmoin, talement du mme nombre de cellules sur chaquebote,reproductibilitdursultat,etc.).Leportdeprotectionanti-UVestmettreenlienaveclesdoc. 3 5 etleffetcancrignedesUVpourlHomme.Leslevuresdesoucheade2ainsi

SVT 1reS ditions Belin 2011

Thme 1 ChapiTre 2

que le matriel ncessaire lexposition aux UV sont disponibles chez les fournisseurs habituels des laboratoires de lyce. Ceux-ci fournissent gnralement un kit mutagnse, comprenant un protocoledtailldelamanipulation. LesUVonttchoisiscommeexempledagentmutagneayant des effets sur les populations humaines afin de faire le lien avec lemodleexprimentaltudip. 35 etaveclamiseenvidence dessystmesderparationdanslunit 3.Unrappelpourratre faitultrieurementquandonaborderalechapitre 2 du thme 5 consacraucancer.Lunit2(p.265)surlesbasesgntiquesdes cancerspermettranotammentderevenirsurleffetmutagnedes UV.Unautreexempledagentmutagne:lebenzopyrnecontenu danslafumedutabac,yestdvelopp. GrceInternet,leslvespeuventreconstituer,enautonomie, les informations apportes par le doc. 5 (voir la fiche pdagogique disponiblesurwww.libtheque.fr). Onpourragalementinsistersurlaprventionetledpistagedu mlanome,loccasiondelajournenationaledeprventionetde dpistagedescancersdelapeauparexemple,ayantlieuchaque anneaumoisdemai. Lexercice8 p. 46prsenteunautreexempledagentmutagne laflatoxine B1 et le protocole exprimental standard mis en uvrepourmesurerleffetmutagnedunemolcule. Latelier Enqute p. 68poseleproblmedesantpubliqueli auxagentsmutagnesauquellhommepeuttreexposenmilieu professionnel. NB : pour accder aux donnes originales prsentes par le doc 4, on peut se reporter au rapport 2010 de lInstitut national du cancer, bas entre autres sur ltude de Veierod, Adami et al. (2010).

Exploitation des documents par les activits


(Raliser une culture de levures, pratiquer une dmarche scientifique, extraire et organiser des informations partir dobservations et de documents, tre conscient de sa responsabilit face la sant, communiquer par crit). Onobservesurledoc. 1quelepourcentagedecoloniesblanches augmenteavecladuredexpositionauxUV.Or,danslunit1ona montrquelaprsencedecoloniesblanchestaitduedesmuta-

tionsdanslamolculedADN.LexpositionauxUVacroissentdonc lafrquencedapparitiondecesmutations.Onobservegalement quelenombretotaldecoloniesdiminuelorsqueladuredexposition aux UV augmente. Certaines mutations ont donc un effet ltalsurleslevures(la ralisation dun graphique reprsentant le nombre total de colonies et le pourcentage de colonies blanches en fonction de la dure dexposition aux UV est ici opportune). Les UV entrainent la formation de dimres de thymine, qui conduisentlamortdelacelluleoulintroductionderreursde rplication et de mutations (doc. 2). Les UV sont donc un agent mutagne. Lutilisationdescabinesdebronzage,mmeunefrquencefaible (10foisparan),conduittoujoursunrisquerelatif(RR)suprieur 1pourlapparitiondescancersdelapeau(doc. 3 et 4).CeRR estdautantpluslevquelafrquenceetladuredexpositionest importante.Cecisexpliquesimplement:lesUVmisparlescabines sont des agents mutagnes et laccumulation de mutations peut entranerlapparitiondecancers. OnconstateunenettecorrlationentrelindiceUVobservpourun tatamricain(lorsdunaprs-mididt)etlamortalitparmlanomechezleshommespeaublanche(doc. 5).Parexemple,en Floride,lindiceUVestde10etlamortalitsuprieure3,34pour 100000habitants.Enrevanche,dansltatdeWashington,lindice UVestde3etlamortalitinfrieure2,75pour100000habitants. Onpeutdoncmettrelhypothsequeletauxdecancerdelapeau chezleshommespeaublanchedpenddeladosedUVreue. Pour conclure, certains agents prsents dans lenvironnement, comme les rayons UV, quils soient dorigine solaire (doc. 5) ou artificielle(doc. 1, 3 et 4),ontuneffetmutagnesurlamolcule dADN:ilsentranentlaformationdedimresdethymineconduisantuneaugmentationdelafrquencedesmutations(doc. 2). Ces mutations peuvent se traduire lchelle cellulaire par une mortdescellulesouunemodificationdeleurscaractres(doc. 1), etlchelledespopulationshumainesparuneaugmentationdu risquedesurvenueduncancerdelapeau(doc. 4 et 5).

Unit

Le devenir des lsions de lADn


Connaissances du programme

[pp. 36-37 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Recenser,exploiteretinterprterdesbasesdedonnespourmettreen videncelinfluencedagentsmutagnessurdespopulationshumaines (UV).

Leplussouventlerreurestrparepardessystmesenzymatiques. Quandellenelestpas,silesmodificationsnempchentpaslasurvie delacellule,ilapparatunemutation,quiseratransmisesilacellulese divise. Unemutationsurvientsoitdansunecellulesomatique(elleestensuite prsentedanslecloneissudecettecellule)soitdansunecellulegerminale(elledevientalorshrditaire).

6 Thme 1 ChapiTre 2

SVT 1reS ditions Belin 2011

Conseils et suggestions
Lunit 2 prsentait les effets sur la molcule dADN dun agent mutagne (les rayons ultraviolets) et ses consquences possibles pourlacelluleetpourlindividu.Lunit3approfonditcettenotion, lesconsquencesdesmodificationsdelamolculedADNpouvant tretrsdiversesselonquellessontounonprisesenchargeparun systmederparation(doc. 1, 2 et 3)etselonquellesontlieudans unecellulegerminale(doc. 4 et 5)ousomatique(doc. 4 et 6). Les doc. 1, 2 et 3 reposent sur ltude de cellules de patients atteints de xeroderma pigmentosum. Cette maladie est gnralement connue des lves, essentiellement par les images impressionnantes des malades vtus de combinaisons anti-UV, maisgalementparlesfilmsquilamettentenscne(Les Autres dAlejandroAmenbaretplusrcemmentLa permission de minuit deDelphineGleize). Ledoc. 5,ainsiquelexercice 5, p. 45,prsententunexemple demutationgerminale. Ledoc. 6prsenteunexempledemutationsomatiqueetpeut tremisenrelationaveclap. 267(thme 5,chapitre 2, unit 2) traitantdesbasesgntiquesducancer. Lexercice 6, p. 45prsenteunautreexempledagentmutagne (lesrayonsgamma)ainsiquunebactriepossdantunsystmede rparationdelADNextraordinairementefficace. NB : pour accder aux documents originaux des exemples tudis, on peut se reporter aux publications scientifiques ci-dessous (voir les complments pdagogiques sur www.libtheque.fr). Doc. 1 : Cluestoepidermicalcancerpronenessrevealedbyreconstructionof DNA repair-deficientxeroderma pigmentosum skin in vitro, F. Bernerd, PNAS, 2000. Doc. 3 : Association between DNA repair-deficiency and high level of p53 mutations in melanoma of xeroderma pigmentosum, Alain Spatz, Giuseppina Giglia-Mari, SimoneBenhamouet al.,Cancer Res,2001.Doc. 5 :FOXP2 andthe neuroanatomyofspeechandlanguage,Vargha-Khademet al.Nat Rev Neurosci.,2005Feb.Doc. 6 :Themutationspectrumrevealed bypairedgenomesequencesfromalungcancerpatient,William Leeet al. Nature465,473-477(27may2010).

Doc. 2 et 3 (Recenser, extraire et organiser des informations). Le systme de rparation de lADN est un ensemble denzymes, respectivement capable de reconnatre un dimre de thymine, de sparer les 2 brins dADN et de couper le brin ls en amont etenavaldudimre.Cefragmentliminestensuitenouveau synthtis.Chezlesindividusatteintsdexeroderma pigmentosum, aumoinsunedecesenzymesestinactive,provoquantladficience globaledecesystmederparation(doc. 2). LeDoc. 3 mesurelincorporationdethyminedansdeuxculturesde celluleslorsdelaphaseG1.Celle-cisedrouleavantlarplication de lADN: en labsence dexposition aux UV (tmoin, dose dUV = 0J.m-2),lincorporationdethyminedanslescellulesestdoncnulle. Toutefois, chez les cellules tmoins, on constate que plus la dose dUV est leve, plus lincorporation de thymine par noyau est importante (jusqu 76 thymines par noyaux pour une dose dUV de20J.m-2).Onpeutdoncmettrelhypothsequelesthymines ayantformdesdimressouslactiondesUVsontremplacespar de nouvelles thymines. Dans les cellules dindividus souffrant de xeroderma pigmentosum,lincorporationdethymineenphaseG1 restefaible(<10thyminesparnoyau),mmeaprsuneexposition intenseauxUV.Cettetrsfaibleincorporationdenouvellesthymine dans lADN appuie lhypothse que le systme de rparation des dimresdethymineestdficientchezcesindividus.

Doc. 4 6 (Pratiquer une dmarche scientifique, recenser,

Exploitation des documents par les activits


Doc. 1. (Manifester sens de lobservation et esprit critique, extraire des informations). DixminutesaprslexpositionauxUV,on constate sur la coupe de peau artificielle la prsence de taches vertes, correspondant aux noyaux des cellules o les anticorps fluorescents se sont fixs. LADN de ces cellules contient donc des dimres de thymine. Quatre jours aprs lexposition, ces dimres sonttoujoursprsentsabondammentdanslescellulesissuesdindividuatteintdexeroderma pigmentosum,maisleurquantitatrs fortementdiminudanslescellulesdelindividutmoin.Onpeuten dduirequilexiste,chezlesindividussains,unsystmepermettant lliminationdecesdimresinduitsparlesUV,maisquecesystme estdficientchezlesindividusatteintsdexeroderma pigmentosum. LaprsencededimresdethyminedanslADNpeutinduirelapparitiondemutations(doc. 2, p. 34):lessystmesdliminationdeces lsionsdelADNmaintiennentdonclesmutationsunfaibletaux.
SVT 1reS ditions Belin 2011

extraire et organiser des informations). Danslafamilleprsentepar ledoc. 5,lesindividusprsentantdestroublesdulangagepossdent tousunalllemutdugneFOXP2(onconstatelasubstitutiondune cytosine par une adnine). La frquence de cette mutation dans cettefamilleindiquequelleesthrditairementtransmisechaque individumaladeparsesparents.Ilsagitdoncdunemutationgerminale,seuletransmissibleladescendance(doc. 4). Ledoc. 6 estunecomparaisondugnomededeuxcellulessomatiques du mme individu: une cellule cancreuse et une cellule saine. On constate de trs nombreuses modifications gntiques dans les cellules tumorales: des dplacements de fragments de chromosomesetdesmutationsaffectantunnuclotide.Cesmutationssontportespardescellulesnonreproductrices(cellulesde tumeur du poumon): ce sont donc des mutations somatiques, transmissibles uniquement aux cellules descendant de la cellule ayant subi la mutation initiale. Toutes les cellules de la tumeur formentunclone,portantcesmodificationsgntiques.

en conclusion (Communiquer dans un langage scientifiquement appropri). Lorsquune lsion est forme dans la molcule dADN(undimredethymineparleffetdesUV,parexemple),elleest gnralementlimineparlesenzymesdessystmesderparation (doc. 1, 2 et 3).SilamodificationdelADNnestpasrpare,ellepeut entranerlamortdelacelluleouunemutation(unit 1).Silamutationestprsentedansunecellulegerminale,ellepeuttretransmise ladescendanceettreloriginedecaractresparticuliers(doc. 4 et 5).Enrevanche,unemutationdansunecellulesomatiquenesera pastransmiseladescendancedelindividu,maisauxseulescellules delorganismeissuesdeladivisiondelacellulemute.Lesmutations somatiquespeuventainsientraneruncancer(doc. 4 et 6).
Thme 1 ChapiTre 2

Unit

Les mutations, source de biodiversit


Connaissances du programme

[pp. 38-39 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Utiliserdeslogicielspourcaractriserdesmutations. Recenseretexploiterdesinformationspermettantdecaractriserla diversitallliquedunepopulation.

Lesmutationssontlasourcealatoiredeladiversitdesallles,fondementdelabiodiversit.

Conseils et suggestions
Lunit4seplacedansleprolongementdelapartieLa biodiversit, rsultat et tape de lvolutionduprogrammedeseconde,au coursdelaquellesonttablislanotiondebiodiversitgntiqueet lesmcanismesdebasedelvolutionmolculaire. Lesdoc. 1 et 2sappuientsurunexempletrsparlantdebiodiversitgntique:ladiversitdespigmentationsdelapeauchez diffrentesracesdeporcetsonfondementgntique. Les lves peuvent, en autonomie, rechercher et comparer les squencesprsentesdansledoc. 2.Sontutilissunebanquede donne (GenBank) et un logiciel gratuit (Seaview) quotidiennement utiliss dans les quipes de recherche en volution molculaire. Le logiciel Seaview a dj t utilis dans le manuel de seconde (Chapitre 4, p. 57) pour comparer des allles dun gne (voirlescomplments pdagogiques surwww.libtheque.fr). Le doc. 3 est adapt dune exprience dvolution bactrienne, ralise en laboratoire sur plus de 20 ans. Cette exprience a permisdesuivreentempsrellaccumulationdesmutationsdans le gnome de bactries et la diversification de leurs populations. Lquipe de Richard Lenski, linitiative de ce projet, dtaille la dmarche utilise sur son site Internet (voir les complments pdagogiques surwww.libtheque.fr). Lexercice 9, p. 46prolongecetteunitetprsenteunexemple de biodiversit gntique et de slection naturelle appliqu aux populationshumaines. NB : pour accder aux documents originaux des exemples tudis, on peut se reporter aux publications scientifiques ci-dessous : Doc. 1 et 2 : Theoriginofthedomesticpig:independentdomestication and subsequent introgression, E. Giuffra et al., Genetics, 1998. Doc. 3 : Genome evolution and adaptation in a long-term experimentwithEscherichia coli,JeffreyE.Barricket al.,Nature, oct. 2009. Ex. 9, p. 46 : Convergent adaptation of human lactase persistence in Africans and Europeans. Tishkoff et al., Nature Genetics,2007.

morphologiques observables sur des individus appartenant la mmeespcemaisdesracesdiffrentes.Onconstatenotamment unediffrencedecolorationdelapeauetdupelage:noir(Large Blackparexemple),roux(Duroc),sanspigment(Largewhite)ou ingalementpigment(Meishan).Chacunedecesracesprsente un allle diffrent pour le gne MC1R, rgulant la production de pigments(doc. 2).Onpeutdoncendduirequladiversitmorphologiquedesracesdeporccorrespondunediversitalllique.

Doc. 3 et 4 (Pratiquer une dmarche scientifique, manifester un sens de lobservation). Onconstateque,aufildesgnrations, legnomedesbactriesaccumulelesmutations.Ainsi,lacomparaisondugnomedesbactriesaprs20000gnrationsetcelui desbactriesinitialesrvleautotal45mutationsaccumules. Au dbut de lexprience, lensemble des bactries, au gnome identique,formaituneuniquepopulation.Aufildesgnrations,le nombredepopulationsbactriennes,diffrantgntiquementpar uneouplusieursmutations,augmente(jusqu5populationsdiffrentesaprs10000gnrations).Onpeutmettrelhypothseque lesdiffrentesracesdeporcobservesprcdemmentsontissues dune unique race, qui aurait accumul des mutations au fil des gnrations,conduisantladiversitgntiqueactuelle. Doc. 4(Recenser et organiser des informations).Unemutation peutsetraduireparlapparitiondunnouveaucaractresi:elleest transmiseladescendancedelindividu(ilestalorsncessaireque cettemutationsoitgerminaleetquelegamtemutsoitimpliqu danslafcondation);elleaffecteungne;ellemodifielecaractre contrlparcegne. en conclusion (Organiser des informations, communiquer dans un langage scientifiquement appropri).Lesmutationspeuventapparatredemanirespontanedanslegnome(unit 1). Siellessontprsentesdansdescellulesgerminales,ellespeuvent tre transmises la descendance (unit 3). Elles sont alors loriginedalllesnouveauxdugne.Cesmutationssontdoncune sourcedebiodiversitgntique,dontlaccumulationpeutconduire lapparition de populations diffrentes gntiquement (doc. 3). Cette biodiversit gntique peut galement se traduire par une diversitdescaractresobservsauseindelammeespce(doc. 1, 2 et 4).

Exploitation des documents par les activits

Doc. 1 et 2 (Recenser extraire et organiser des informations, utiliser un logiciel). Ledoc. 1prsenteladiversitdescaractres

8 Thme 1 ChapiTre 2

SVT 1reS ditions Belin 2011

Chapitre 3 Lexpression du patrimoine


gntique
Unit

La relation gnes-protines
Connaissances du programme

[pp. 48-49 du manuel de llve]

Capacits et attitudes de mises en uvre dans lunit


Recenser,extraireetexploiterdesinformationspermettantdecaractriserlesprotinescommeexpressionprimairedelinformationgntique.

LasquencedesnuclotidesdunemolculedADNreprsente uneinformation. []LesportionscodantesdelADNcomportentlinformationncessaire lasynthsedechanesprotiquesissuesdelassemblagedacides amins.

Conseils et suggestions
La page douverture du chapitre constitue une occasion de remobiliser des connaissances acquises en classe de Troisime: distingueruncaractredelespcehumaineetsesvariationsindividuelles,serappelerlidequelepatrimoinegntiquedtermine lescaractreshrditairesdunindividuetmettreenvidencedes variationsdescaractreslieslenvironnement. DepuislaclassedeSeconde,leslvesconnaissentlastructure delamolculedADN,ainsiquelanaturedumessagequellecode. Lanotiondesquenceataborde.Leslvesontaussiunepremireidedecequestungne:unfragmentdADN,porteurdune informationgntique,quidtermineuncaractrehrditaire. Lobjectifdecechapitreestdecomprendrecommentlesgnes dterminentlaralisationdescaractreshrditaires,entudiant prcisment comment linformation gntique dune cellule sexprime. Lunit 1prsentelastructureduneprotine,molculedontles lvesconnaissentdjlexistence,etmetenvidencelarelation entregnesetprotines. Ledoc. 1illustreladiversitetlimportancedesfonctionsassures par les protines. Il permet dattribuer une nature protique aux enzymes voques dans lexpriencehistorique de Beadle et Tatum(doc. 2 4),rcompenseparunprixNobelen1958. Les logiciels Rastop et Anagne (doc. 5 et 7) peuvent tre le support dune activit pratique mettant en vidence la correspondance entre squence en acides amins dune protine et squencenuclotidiquedugnequilacode(voirlescomplments pdagogiques sur www.libtheque.fr). Les fiches techniques de ces logiciels, utilisables lors des preuves dvaluation des capacits exprimentales, sont tlchargeables ladresse suivante: http://pedagogie.ac-toulouse.fr/svt/serveur/bankact. Lexemple delaGFPatchoisipourfairechoauchapitre4duthme1du manueldeSeconde.

Exploitation des documents par les activits


(Pratiquer une dmarche scientifique, extraire des informations partir dobservations et de documents, organiser ces informations, communiquer par crit). LesculturesralisesaveclasouchesauvagedeNeurospora,ainsi que toutes celles ralises avec des souches mutantes sur milieu minimum(MM)+tryptophaneserventdetmoins.Chaquemutant deNeurosporaobtenuparBeadleetTatumestincapabledepousser sur milieu minimum (doc. 4): lune des ractions chimiques de la voie de synthse du tryptophane (doc. 3) une molcule organique essentielle (doc. 2) nest pas ralise, signifiant que lenzymencessairecetteractionestdficiente.Onsait,deplus, quechaquemutantprsenteunemutationsurununiquegne.La souche mutante 1 pousse sur tous les milieux sauf sur le milieu minimum(doc. 4).Elleestdonccapablederaliserlesractions2 et3maispaslaraction1:sonenzyme1estdoncdficiente.La seulediffrenceexistantentrelasouchesauvagedeNeurosporaet lemutant1estlaprsencedunemutationdansununiquegne chezlemutant1.Onpeutdoncsupposerquilexisteunerelation entre ce gne 1 et lenzyme 1. De mme, la souche mutante 2 est incapable de pousser sur milieu minimum et sur MM + acide anthranilique:sonenzyme2estdoncdficiente.Lasouche2tant mute au niveau dun gne diffrent de celui de la souche 1, on peutpenserquilexisteunerelationentrecegne2etlenzyme 2.Enfin,lasouchemutante3pousseuniquementsurMM+tryptophane:elleprsenteuneenzyme3dficiente.Lasouche3tant muteauniveaudungnediffrentdeceuxdessouches1et2,on peutpenserquilexisteunerelationentrecegne3etlenzyme3. Finalement,ilsembleraitdoncquelafonctionnalitduneenzyme soitdirectementassocieungneprcis. Lesenzymessontdesprotines(doc. 1).Uneprotineestconstitue par une succession ordonne dacides amins (doc. 5). La relationungneuneenzymepressentieparlesrsultatsde BeadleetTatumestconfirmeparledoc. 6,quiprcisequungne permet la synthse dune protine spcifique par la cellule. Les squencesdacidesaminsdesprotinesGFPetBFPdiffrentuniThme 1 ChapiTre 3

SVT 1reS ditions Belin 2011

quementauniveaudelacideamin65tyrosinedanslaprotine GFP, histidine dans la protine BFP (doc. 7). Or, les squences nuclotidiques des gnes qui codent pour ces protines diffrent parununiquenuclotideCdanslegneBFPlaplacedeTdans legneGFP(doc. 7).Ilsembleraitdoncquilexisteunecorrespondanceentrelasquenceenacidesaminsduneprotineetla squencenuclotidiquedugnequilacode.

Pourconclure,ungneestdoncuneunitdinformationsurlADN quipermetlasynthseduneprotine:lasquencenuclotidique dugneconditionnelasquenceenacidesaminsdelaprotine code.

Unit

La transcription, premire tape de lexpression dun gne


Connaissances du programme

[pp. 50-51 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Mettreenuvreunemthode(dmarchehistorique)et/ouuneutilisationdelogicielset/ouunepratiquedocumentairepermettantdapprocher lemcanismedelatranscription.

Chezleseucaryotes,latranscriptionestlafabrication,danslenoyau, dunemolculedARNpr-messager,complmentairedubrintranscritde lADN.

Conseils et suggestions
Danslunitprcdente,onamontrquelexpressiondungne se traduit par la synthse dune protine et que la squence en acidesaminsduneprotinedpendtroitementdelasquence ennuclotidesdugnequidirigesaproduction. Cetteunitdmontrelancessitdelexistencedunintermdiaire entreADNetprotineetidentifiequelquescaractristiquesdecet intermdiaire lARN (doc. 1 3). Elle expose enfin les mcanismesquiconduisentsasynthsedanslenoyautranscription (doc. 4 et 5). LaprsentationdelamolculedARNpeutfournirunenouvelle occasion de manipuler le logiciel Rastop. (voir les complments pdagogiques surwww.libtheque.fr) Lamiseenvidencedurledintermdiairejouparlamolcule dARNpeutgalementtrecomplteparlexercice 5, p. 65,qui prsenteuneexpriencetrsclassiquedepulse-chase. Uneanimationillustrantlatranscriptionestdisponibleladresse suivante(catgoriebiologiecellulaire): www.biologieenflash.net.

de lactabulaire se droule dans le cytoplasme. La localisation desgnesgouvernantlasynthsedecesprotinesdanslenoyau cellulaire implique ncessairement lexistence dun intermdiaire entreADNetprotines.

Doc. 2 et 3B (Extraire des informations dune capture de logiciel lgende et pratiquer une dmarche scientifique : exploiter des rsultats exprimentaux, raisonner avec rigueur).Aprssectionde lactabulaireettraitementdesfragmentslaRNase(doc. 3B),le fragment1nedveloppepasdechapeaualorsquelefragment2 nucldeveloppeunchapeaunormal.Parcomparaisonaveclexprienceprcdente(doc. 3A),onpeutdirequeletraitementla RNasesembleavoirbloqulapeoductiondeprotinencessaire lamiseenplaceduchapeauparlefragmentsectionn.Cersultat faitdelARNuncandidattrssrieuxpourjouerlerledintermdiaireentreADNetprotines.LefaitquelARNsoitsynthtisdans lenoyaupuisexportdanslerestedelacellule(doc. 2)renforce cettehypothse.

Exploitation des documents par les activits

Doc. 1 et 3A(Pratiquer une dmarche scientifique : exploiter


des rsultats exprimentaux et raisonner avec rigueur).Aprssectiondelactabulaire(doc. 3A),lefragment1,necontenantque ducytoplasme,dveloppeunchapeauidentiqueceluidvelopp parlefragment2quipossdeunmoyau.Or,lamiseenplacedece chapeauncessiteuneimportantesynthsedeprotines(doc. 1). Onpeutdoncendduirequelasynthsedesprotinesduchapeau

Doc. 4 et 5(Extraire des informations dune photographie et dun schma lgends). Chaque molcule dARN est synthtise dans le noyau cellulaire, au contact dune molcule dADN, grce laction denzymes: les ARN polymrases. La squence dune molcule dARN synthtise est complmentaire dun des brins du fragment dADN correspondant au gne qui sexprime. LARN migreensuitedanslecytoplasme,assurantunetransmissionfidle de linformation gntique porte par un gne, du noyau vers le cytoplasme.

en conclusion(Communiquer laide dun schma).


Voirleschma dumilieudelap. 60dumanueldellve.

10 Thme 1 ChapiTre 3

SVT 1reS ditions Belin 2011

Unit

La traduction, seconde tape de lexpression dun gne


Connaissances du programme

[pp. 52-53 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Mettreenuvreunemthode(dmarchehistorique)et/ouuneutilisationdelogicielset/ouunepratiquedocumentairepermettant: dapprocherlemcanismedelatraduction; decomprendrecommentlecodegntiqueatlucid.

Lecodegntiqueestlesystmedecorrespondancemisenjeulors delatraductiondecetteinformation.quelquesexceptionsprs,ilest communtouslestresvivants. []lARNmessageresttraduitdanslecytoplasmeenprotines.

Conseils et suggestions
Danslunitprcdente,onamontrquelARNassureunetransmissionfidledelinformationgntiqueporteparungne,du noyauverslecytoplasme. Cette unit montre le devenir de lARN messager (ANRm) parvenu dans le cytoplasme et explicite les relations existant entre ARNmetprotinesynthtise. Lesdoc. 1 3permettentdecomprendrecommentlemessage port par la molcule dARNm est cod et dexpliciter la relation existantentresquencesprotiqueetnuclotidique(lecodegntique).Lesdoc. 4 et 5exposentlesmcanismesmolculairesqui conduisentlasynthseduneprotinepartirdunARNmdansle cytoplasme(traduction). LelogicielAnagne peuttreutilisparleslvespourobtenir, enautonomie,lesinformationsapportesparledoc. 3,cequileur fournituneoccasionsupplmentairedesexercerdansloptiquede lvaluation des capacits exprimentales (voir les complments pdagogiquessurwww.libtheque.fr). Lexercice 6, p. 65 illustre quelques exceptions au code gntique.Lexercice 7, p. 65fournitllveloccasiondesexercer lutilisationdutableauducodegntique. Des informations complmentaires concernant le dchiffrage du code gntique sont disponibles ladresse suivante: http://history.nih.gov/exhibits/nirenberg. Une animation illustrant la traduction est disponible ladresse suivante(catgoriebiologiecellulaire):www.biologieenflash.net. Une animation en anglais, illustrant le principe dune exprience de pulse-chase au cours dune synthse protique, est disponible ladresse suivante: www.sumanasinc.com/webcontent/ animations/content/pulsechase/pulsechase.html. Elle peut, par exemple,treutilisepourunapprofondissementdanslecadrede laccompagnement personnalis, ou de lenseignement en classe europenne.

Exploitation des documents par les activits

Doc. 1 (Raisonner).Si1nuclotidecodaitunacideamin,4

acidesaminsdiffrentsuniquementpourraienttrecods.Siune combinaison de 2 nuclotides codait un acide amin, 4 5 4 = 16 acidesaminspourraienttrecods.Enfin,siunecombinaisonde 3nuclotidescodaitunacideamin,45454=64acidesamins pourraienttrecods.Pourquechacundes20acidesaminssoient cods, il est donc ncessaire et suffisant dassocier 3 nuclotides pourunacideamin.

Doc. 2 et 3 (Extraire des informations dun texte et dune capture de logiciel).Lesacidesaminscodsparlescodonsindiqus sont:AUGMet;UAGaucunacideamin;CUULeu;AAU Asn;UUGLeu. linverse,lescodonscorrespondantsauxacidesaminsindiqus sont:GluGAG,GAA;ValGUG,GUA,GUU;TyrUAU,UAC;Lys AAA,AAG;PheUUU,UUC.

Doc. 2 et 3 (Extraire des informations dun texte et dune

capture de logiciel, raisonner).Chaquecodoncodeununiqueacide amin: le code gntique est dit univoque. Un acide amin peut en revanche tre cod par plusieurs codons diffrents: le codegntiqueestditredondant.Lecodegntiquesestavr quasiment identique chez tous les tres vivants tudis jusqu aujourdhui(doc. 2):ilestuniversel,quelquesexceptionsprs.

Doc. 4 et 5(Extraire des informations dune photographie et dun schma lgends).Danslecytoplasme,unemolculedARN messager est prise en charge par des ribosomes qui lisent sa squence et la convertissent en une squence dacides amins. Pourcefaire,lesribosomesassocientchaquecodonlacideamin qui lui correspond et mettent en place les liaisons entre acides aminssuccessifs.

en conclusion (Communiquer par un schma).

Dugnelaprotine. Voirleschma dubasdelap. 60dumanueldellve.

SVT 1reS ditions Belin 2011

Thme 1 ChapiTre 3

11

Unit

Les modifications de lARn aprs la transcription


Connaissances du programme

[pp. 54-55 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


PratiquerunedmarchescientifiquepourmettreenvidencelesmodificationssubiesparunemolculedARNavantsonexportationdansle cytoplasme.

Aprsuneventuellematuration,lARNmessageresttraduitenprotinesdanslecytoplasme. UnmmeARNpr-messagerpeutsubir,suivantlecontexte,desmaturationsdiffrentesetdonctreloriginedeplusieursprotinesdiffrentes.

Conseils et suggestions
Danslesdeuxunitsprcdentes,onaexposlesmcanismes gnrauxdelasynthsedesprotines,classiquementtudisdans leprogrammedePremireSprcdent. Cette unit est axe sur ltude dun processus qui ntait pas abordjusqualors:lamaturationdelARN. Les doc. 1 3 conduisent llve supposer lexistence dune maturationdelARN(souslaformedunraccourcissement)dansle noyaucellulaire,tandisqueledoc. 4exposeparunschmasimple lemcanismedematuration.Lesdoc. 5 et6permettentdemettre envidence,laidededonnesexprimentales,lexistencedune maturationdiffrentielledelARN. Lexercice 4, p. 64offreunprolongementcetteunitetfournitllveloccasiondtudierdesrsultatsexprimentauxsous formedegraphiques. Desressourcessupplmentairespourleprofesseurconcernantla maturationdelARNsontdisponibles: Un mme gne pour plusieurs protines,DossierPourlaScience, Janvier-mars2005; Le deuxime code gntique, PourlaScience,28mai2010;Un nouveau type de mutations gntiques, Pour la Science, 15avril 2011(articlesetvidodisponiblessurwww.pourlascience.fr).

+30min).Danslecytoplasme,onneretrouveaucunARNradioactif nouvellement synthtis avant t0 + 30min ; cet instant, le plus long ARN radioactif cytoplasmique prsente 1200 nuclotides. Il semblerait donc que les ARN nouvellement synthtiss dans le noyau subissent effectivement un raccourcissement avant dtre exportsdanslecytoplasme.

Doc. 1 et 4 (Extraire des informations dun schma et raisonner). Une molcule dARN pr-messager est tout dabord synthtise, par complmentarit des bases avec le brin transcrit du fragment de la molcule dADN correspondant au gne exprim. Certaines portions de lARN pr-messager, appeles introns, sont ensuite limines. Les portions restantes, appeles exons, sont accolesboutbout,formantainsiunemolculedARNmessager (doc. 4).LensembledesmodificationssubiesparlARNpr-messager est appel maturation. Dans le doc. 1, les boucles A E correspondentdesportionsdADNnayantpasdesquencecomplmentaire sur lARNm, il sagit donc dintrons. Les zones dADN hybridesaveclARNm,desquencecomplmentaire,correspondentauxexons.

Exploitation des documents par les activits

Doc. 1 et 2 (Pratiquer une dmarche scientifique : observer,


formuler une hypothse). Les ARN messagers correspondant aux diffrentsgneshumainsonttousunetaillebieninfrieurecelle dugnequileuraservidemodle(doc. 2).Deplus,lhybridation de lADN du gne de lovalbumine de poule et de son ARN messager montre que les squences de ces molcules ne sont que partiellementcomplmentaires:delargesbouclesdADNnontpas dquivalentdanslamolculedARNm.Pourexpliquercesobservations, on peut faire lhypothse que la molcule dARN subit dimportantescoupuresaprssatranscription.

Doc. 5 et 6(Pratiquer une dmarche scientifique : exploiter des rsultats exprimentaux, raisonner avec rigueur).Latranscription dugneCalc-1donnenaissanceunemolculedARNpr-messagerde5700nuclotides(nt),formede6exonsetde5introns. Daprs les investigations menes avec les sondes molculaires, lARNmcalcitonine,de1000ntdelong,comporteuniquementles exons1,2,3et4dugneCalc-1;deplus,dessignauxspcifiques de liaisons inter-exons ont t identifis: liaisons E1-E2, E2-E3 et E3-E4. LARNm calcitonine est donc constitu par lassemblage des exons 1 4 du gne Calc-1. Par un raisonnement similaire: lARNmCGRPestconstituparlassemblagedesexons1,2,3,5et 6dugneCalc-1.LARNpr-messagerdugneCalc-1adoncsubi deux maturations diffrentes, donnant naissance deux ARNm diffrents,loriginedelasynthsededeuxprotinesdiffrentes.

en conclusion (Communiquer en rdigeant une synthse).


Dans le noyau, un ARN pr-messager nouvellement synthtis subit une maturation (limination des introns et assemblage des exons)quidonnenaissanceunouplusieursARNmessagersdiffrents. Ces derniers migreront ensuite dans le cytoplasme o ils seronttraduitsenprotinesdiffrentes.

Doc. 3 (Pratiquer une dmarche scientifique : exploiter des


rsultats exprimentaux, raisonner avec rigueur).Latailleduplus longARNradioactifprsentdanslenoyaudcrotaufildutemps, passantde8000nuclotides(t0+5min)1200nuclotides(t0

12 Thme 1 ChapiTre 3

SVT 1reS ditions Belin 2011

Unit

La diversit des protines cellulaires


Connaissances du programme

[pp. 56-57 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Recenser,extraireetexploiterdesinformationspermettantdediffrencierlesrlesdelenvironnementetdugnotypedanslexpressiondun phnotype.

Lensembledesprotinesquisetrouventdansunecellule(phnotype molculaire)dpend: dupatrimoinegntiquedelacellule(unemutationallliquepeuttre lorigineduneprotinediffrenteoudelabsenceduneprotine); delanaturedesgnesquisexprimentsousleffetdelinfluencedefacteursinternesetexternesvaris.

Conseils et suggestions
Danslesunitsprcdentes,onamontrquelesprotinescorrespondaient lexpression primaire de linformation gntique dune cellule, et dtaill les mcanismes lorigine de la synthseprotique.Onagalementmontrquunmmegnepeut conduirelasynthsedeprotinesdiffrentes. Danscetteunit,oncherchedterminerlesfacteursquiconditionnentlanatureetlaquantitdesprotinesprsentesdansune cellule. Lesdoc. 1 3sappuientsurlexempledesgroupessanguinspour montrerquelephnotypemolculairedunecelluledpenddeson gnotype(termedfinidansledoc. 4).Lesdoc. 5 7montrent que le phnotype molculaire dune cellule dpend de la nature des gnes qui sexpriment, sous linfluence de facteurs internes (doc. 5 et 7)etexternes(doc. 6 et 7)lorganisme. Lexercice 9, lexercice Objectif bac et latelier Sciences actualitoffrentunprolongementcetteunit. AlaidedulogicielAnagne,leslvespeuventobtenir,enautonomie,lesinformationsapportesparledoc. 3 (voirlescomplments pdagogiques surwww.libtheque.fr). Desressourcessupplmentairessontdisponibles: La vie agite du gnome, Pour la Science, n403, mai2011; Le bisphnol A : un danger pour la sant ?, Pour la Science, n396, octobre2010. Cette unit peut fournir loccasion dvoquer plus en dtail les groupes sanguins en utilisant un nouveau type de ressource voqu par le programme, par exemple au cours dune sance daccompagnement personnalis: les jeux srieux ou jeux pdagogiques.Unedecesactivits,consacreauxgroupessanguins, est disponible ladresse suivante: http://nobelprize.org/ educational/medicine/landsteiner/index.html

Groupe sanguin A B O AB

Phnotype molculaire EnzymeA EnzymeB EnzymeO EnzymeA+EnzymeB

Chaque enzyme intervenant dans la synthse dun marqueur est code par un allle, A, B ou O, du gne du groupe sanguin (doc. 2). Ces allles prsentent des squences nuclotidiques lgrement diffrenteslesunesdesautres(doc. 3).Unindividudonnpossde 2 allles, identiques ou non, de ce gne, ce qui conditionnera le(s) type(s)denzymesproduite(s).Lephnotypemolculairedunecellule (prsencedelaoudesenzymesA,BouO)dpenddoncdesongnotype(naturedesalllesdugnedugroupesanguinprsents,doc. 4).

Doc. 5 (Extraire des informations dun texte et raisonner).


Les tissus de la souris voque dans le doc. 5 prsentent 2 750 protines communes toutes les cellules mais aussi 2 018 protinesquinesontprsentesquedansunseultypecellulaire.Les diffrentescellulesdunmmeorganismenontdoncpaslemme phnotypemolculaire.

Exploitation des documents par les activits

Doc. 1 4 (Extraire des informations de schmas lgends,


dune capture de logiciel et dun texte, raisonner). Selonlesdocs. 1 et 2,lesenzymesprsentesdansleshmayies selonlegroupesanguindelindividusont:

Doc. 6 et 7 (Extraire des informations dun texte, pratiquer une dmarche scientifique : exploiter des rsultats exprimentaux, raisonner avec rigueur). Le phnotype molculaire des cellules dovaire dpend de labondance de lARNm CYP 19: plus lARNm estenquantitimportante,pluslaprotineCYP19seraabondante dans les cellules. Le traitement des cellules la FSH augmente considrablementlaquantitdARNmCYP19(labondancerelative delARNmCYP19passede20%sansFSH100%avec100ng.L-1 de FSH): la FSH tant une hormone naturellement prsente dans lorganisme,lephnotypemolculairedescellulesdovairedpend doncdefacteursinterneslorganisme.Lajoutdedosescroissantes deBPAauxcellulescultivesenprsencedeFSHdiminueprogressivement labondance relative de lARNm CYP19 (de 100% sans BPA18%avec100mol.L-1deBPA).LeBPAtantunesubstance chimiqueprsentedansnotreenvironnementalimentaire,onpeut direquelephnotypemolculairedescellulesdovairedpendde facteursexterneslorganisme. Doc. 7 (Raisonner). Le BPA agit sur lexpression du gne CYP19,impliqudanslemtabolismedescellulesovariennes.On

SVT 1reS ditions Belin 2011

Thme 1 ChapiTre 3

13

peutdoncsupposerquilinfluencelefonctionnementdelappareil reproducteur.

en conclusion (Communiquer en rdigeant une synthse). Lephnotypemolculairedunecelluledpenddonc:desongno-

type; de linfluence de facteurs internes lorganisme (comme parexempleleshormones);delinfluencedefacteursexternes lorganisme(ex:BPA).

Unit

Les diffrentes chelles du phnotype


Connaissances du programme

[pp. 58-59 du manuel de llve]

Capacits et attitudes mises en uvre dans lunit


Recenser,extraireetexploiterdesinformations(partirdunexemple commeladrpanocytoseoulexeroderma pigmentosum)permettantde: caractriserlesdiffrenteschellesdunphnotype; diffrencierlesrlesdelenvironnementetdugnotypedanslexpressiondunphnotype.

Lephnotypemacroscopiquedpendduphnotypecellulaire,lui-mme induitparlephnotypemolculaire.

Conseils et suggestions
Danslunitprcdente,onadfinilestermesdegnotypeetde phnotypemolculaire.Onagalementmontrquelephnotype molculaire dune cellule dpendait de son gnotype et de linfluencedefacteursinternesetexterneslorganisme. Cetteunitvisemontrerquelephnotypesedfinitplusieurs chelles,dpendanteslesunesdesautres,etpeuttremodifipar desfacteursenvironnementaux. Lexemple de la drpanocytose, classique et bien document, a tchoisipourillustrercetteunit.Lexercice 8, p. 66permetde rinvestir les notions acquises dans lunit en utilisant un autre exemple,celuidelaphnylctonurie.Lexempleduxeroderma pigmentosumavaitdjtvoqudanslunit2duchapitre2:les doc.1et2,p.36pourraientdailleursconstituerunsupportdexercicevisantremobiliserlesnotionstabliesdanslaprsenteunit. Lesdoc. 1 et 2prsententlephnotypemacroscopiquedunindividudrpanocytaire,ledoc. 3sonphnotypecellulaire,lesdoc. 4 et 5lephnotypemolculairedeshmatiesmalades,ledoc. 6la comparaisondesgnotypesdunindividumaladeetdunindividu sainetledoc. 7voquelesfacteursenvironnementauxquipeuventinfluencerlephnotypedrpanocytaire. AlaidedulogicielAnagne,leslvespeuventobtenir,enautonomie,lesinformationsapportesparledoc 6.(voirlescomplments pdagogiques surwww.libtheque.fr). Une animation, en anglais, sur la drpanocytose est disponible ladresse suivante: http://www.dnalc.org/view/15968-Whatcauses-sickle-cell-.html. Elle peut tre utilise par le professeur pour effectuer une prsentation aux lves, ou par les lves

eux-mmesaucoursdesancesdaccompagnementpersonnalis dapprofondissementouencoreenclasseeuropenne. Latelier Art et science,p.69offreunprolongementcetteunit.

Exploitation des documents par les activits


Lesdiffrenteschellesduphnotypedunindividudrpanocytaire sontlessuivantes: chellemacroscopique:anmiechronique,obstructiondespetits vaisseauxsanguins,troublesarticulaires,ncrosesdutissuosseux, irrgularitdelacroissancedesdoigts(doc. 1 et 2). chellecellulaire:prsencedhmatiesfalciformes(doc. 3). chellemolculaire:prsencedefibresrigidesdedsoxy-hmoglobine(doc. 4 et 5). La prsence dune mutation dans la squence du gne codant pour la bta-globine chez un individu drpanocytaire conduit la synthse dune protine modifie: la protine code par lallle mut HbS compte, en 6e position, une valine, au lieu dun glutamate dans la protine code par lallle normal HbA (doc. 6). Cette modification entrane la formation de fibres rigides de dsoxyhmoglobine (phnotype molculaire), qui dforme les hmaties (phnotype cellulaire). Celles-ci ne peuvent alors plus circuler normalement dans les petits vaisseaux sanguins, ce qui provoquedestroublesdelafonctioncirculatoireetunemauvaise oxygnationdestissus,loriginedesnombreuxsymptmesdela maladie (phnotype macroscopique). Le phnotype dun individu drpanocytairedpenddoncdesongnotype.Lapparitionetlintensitdessymptmesdpendentaussidumodedevie(doc. 7), doncdelenvironnementdelindividu.

14 Thme 1 ChapiTre 3

SVT 1reS ditions Belin 2011

1
la la

exerCiCes du thme 1
Les corrigs des exercices des rubriques valuer ses connaissances et S'entraner avec un exercice guid se trouvent la fin du manuel (p. 256).

les

Chromosomes gants des larves de drosophile

Sinformer et raisonner. Rponses attendues : 1.Voirleschmacorrigsurwww.libtheque.fr. 2. Lors du cycle, la cellule passe de la phase G2 G1 sans subir de mitose. Il ny a de ce fait pas de sparation des chromatides sursdechaquechromosome.LesnombreusesmolculesdADN quiconstituentceschromosomesgantscorrespondentdoncdes copies successives issues de la rplication qui restent attaches entreelles.

Chapitre 1

[pp.29-30dumanuel]

mitose Chez le poisson-zbre

Faire preuve dun sens de lobservation. Rponses attendues : 1.Voirleschmacorrigsurwww.libtheque.fr. 2.Voirschmacorrigsurwww.libtheque.fr.

vitesse de rpliCation Chez les euCaryotes

Chapitre 2

[pp.45-46dumanuel]

une

maladie rare : la progeria

Calculer et raisonner. Rponses attendues : 1.SilavitessethoriquederplicationdelADNestde100nuclotidesparseconde,lechromosome1humain,dunetaillede250.106 nuclotides, est rpliqu en 250.106/100 = 2, 5.106 secondes, soient694heures. 2.Onobserveauniveaudechaquechromosomeplusieursunits de rplication qui fonctionnent en mme temps, avant de se rejoindre.Cettemultiplicationdesunitsderplicationassureune vitessederplicationdunchromosomebiensuprieurelaseule vitesse thorique de rplication dune unit. Cest ce qui explique que la rplication du chromosome 1 ne dure que 8h au lieu des 694heures thoriques, calcules dans le cas o une seule unit assurelarplicationduchromosomeentier.

Extraire des informations et raisonner. Rponses attendues : 1.LadiffrenceentrelesdeuxalllesdugneLMNAestdueune mutationenposition1824(substitutiondeCparT). 2. Les parents possdent tous les deux deux allles LMNA+. LenfantpossdeunallleLMNA+etunallleLMNA-. 3. Toutes les cellules de lenfant possdent les mmes allles (LMNA+etLMNA-),ilnepeutdoncpassagirdunemutationsomatiquesurvenuechezlenfant.Onpeutenrevanchemettrelhypothsedunemutationgerminalesurvenuechezundesparentspuis transmiselenfant.Cettemutationneseraitpasvisibleicipuisque lesalllesdesparentsonttidentifispartirdecellulessomatiques:descellulessanguines.

la

des

baCtries exCeptionnelles

polyplodie des plantes

Extraire des informations et raisonner. Rponses attendues : 1.LesbactriesE. coli(tmoin)ontuntauxdesurvieauxrayons gamma trs faible: 1/105 aprs une irradiation 1 J.m-2. En revanche,lesbactriesD. radioduransprsententunetrsgrande rsistanceauxrayonsUV:leurtauxdesurvienestquasimentpas affectparlesrayonnementsinfrieurs15J.m-2.Uneexposition desradiationsduneintensitleve(30J.m-2)estncessairepour queletauxdesurvieatteignelavaleurde1/105. 2. Les bactries D. radiodurans mutes pour le gne RecA prsententuntauxdesurvieauxradiationstrsprochedeceluides bactriestmoinE. coli.UngneRecAfonctionnelestdoncindispensable la survie de ces bactries aux radiations. Or, on sait que RecA contrle un systme de rparation de lADN. On peut donc mettre lhypothse suivante: le rayonnement gamma lse lamolculedADNetproduituneffetltal.Or,chezlesbactries D. radiodurans ces lsions sont prises en charge par un systme derparationcontrlparlegnerecA,quirestaureunemolcule dADNintgreetpermetlasurviedesbactries.

Construire un schma et exploiter des rsultats. Rponses attendues : 1. En prsence de colchicine, lors de la mtaphase, les chromosomessontdoublesetcondenss,maispasalignslquateurde lacellule.Lorsdelanaphase,onobservelasparationdeschromatidessursdeschromosomes,maispasleurmigrationauxples. Enfin,lorsdelatlophase,ladivisionducytoplasmedelacellule mre na pas lieu. Cette mitose ne produit donc pas deux, mais uneseulecellulesfille,quipossdeunmatrielgntiquedouble. 2.Voirleschmacorrigsurwww.libtheque.fr. 3.Lesbiologistespeuventobtenirdesplantestetraplodesenfaisantgermerdesgrainesenprsencedecolchicine.Celle-cibloque lamigrationdeschromatidesauxpleslafindelamitoseainsi queladivisiondelacellulemreendeuxcellulesfilles.Ilsobtiennentalorsdescellulesquihritentdequatrechromatidespourune paire de chromosomes au lieu de deux en conditions normales. Chaque chromosome est donc prsent non pas en deux mais en quatreexemplaires,identiquesdeuxdeux,dsledbutdeson cycle.

SVT 1reS ditions Belin 2011

Thme 1 exerCiCes

15

les

altrations de la molCule dadn

Communiquer dans un langage scientifiquement appropri. Rponses attendues : LesaltrationsdelamolculedADNpeuventavoirplusieurscauses. Ellespeuventtreduesdesmodificationschimiquesdesnuclotides, endehorsducyclecellulaire,demanirespontaneousouslaction dagentsmutagnes.Ellespeuventgalementtreduesdeserreurs de rplication par lADN polymrase, conduisant un appariement erron.Gnralement,cesdiversesaltrationssontprisesencharge parunsystmederparationdelADN.Sinon,etsilamolculedADN estrplique,lesaltrationspeuventgnrerdesmutations. Les consquences des mutations peuvent tre trs varies. Elles peuventprovoquerlamortdelacellule.Sinon,etsilacellulese divise, elles seront transmises aux cellules filles. Si la mutation touche un gne, elle peut entraner la modification du caractre dans la ralisation duquel ce gne est impliqu. Les mutations ayant lieu dans des cellules de la ligne germinale peuvent tre transmisesladescendancedelindividu.Lesmutationsayantlieu danslescellulessomatiquesnepeuventtretransmisesladescendancedelindividu,maisseronttransmisesaucloneissudela cellulemut.Ellespeuventtrelorigineduncancerparexemple.

mesurer

leffet mutagne dune molCule

Exploiter des rsultats exprimentaux. Rponses attendues : 1.EnlabsencedexpositionlaflatoxineB1(tmoin),onvoitapparatreunetrentainedecoloniesparbotesanshistidine,cescoloniessontdoncHis+.Or,onatalsurlaboteunesuspensionde bactriesHis-,incapablesdepoussersurunmilieusanshistidine. On peut donc penser que ces bactries His+ ont subi une ou des mutations qui ont restaur leur capacit synthtiser lhistidine. Cesmutationstantsurvenuessansactiondunagentdelenvironnement,onparledemutationsspontanes. 2. Chaque colonie de bactries His+ est issue dune bactrie His ayantsubiunemutationrestaurantsacapacitsynthtiserlhistidineetdoncdevenueHis+.Donclaquantitdecolonies(His+)par botesanshistidinedpenddelafrquencedesmutations.Doncsi lapplicationdunemolculeaugmentelaquantitdecoloniesHis+ parrapportautmoin,alorscettemolculeestunagentmutagne. 2. Lapplication daflatoxine B1 augmente la quantit de colonies par bote: elles passent dune trentaine de colonies par bote (tmoinsansaflatoxineB1)unecentaine(1,5gdaflatoxineB1 parbote).Or,lesbactriesHis+sontissuesdebactriesHisayant subi une ou des mutations. Laflatoxine augmente la frquence dapparition des mutations: cest donc un agent mutagne. On constategalementuneffetdedose:pluslaquantitdaflatoxine B1appliqueestleve,plusletauxdemutantsHis+estlev.

2.TouslesindividushomozygotesG/GpourlegneLCTsontintolrantsaulactose.Enrevanche,touslesindividushomozygotesA/A tolrent le lactose. On constate que les individus htrozygotes sontmajoritairementtolrantsaulactose.Lacapacitdigrerle lactoselgeadultedpenddoncdesalllesdugneLCT,lallle Afavorisantlatolranceaulactose. 3.Parmilespopulationstudies,celleprsentantlaplusgrande fractiondindividustolrantsaulactoseaunetraditiondlevage. Partradition,elleconsommedoncleplusdelaitlgeadulte.On observelaplusfortefractiondindividusintolrantsaulactosedans unepopulationdechasseurs-cueilleurs,doncneconsommantpas traditionnellementdelaitlgeadulte.Lespopulationsagro-pastoralesprsententdesfractionsintermdiairesdindividustolrants etintolrantsaulactose.Onpeutdoncenconclurequelatolrance aulactoseestassociellevagedanimauxdanslhistoiredeces populations. 4. La tolrance est un caractre dtermin par la prsence de certainsallles(parexemplelallledugneLCTportantunAen position22018).Onpeutpenserquechezlespopulationspastorales,laprsencedecesalllesconfreunavantageauxindividus: ilspeuventdigrerlelaitetdoncbnficientdapportsnutritionnels dontnebnficientpaslesindividusintolrantsaulactose.Ilsont doncplusdechancedevivreetdavoirdesenfants.Ainsi,aprsde nombreusesgnrations,lafrquencedecesalllesavantageux augmente dans la population, conduisant une population o la majoritdesindividussonttolrantsaulactose.Cestunexemple deslectionnaturelle. Enrevanche,danslespopulationsdetraditionchasseurs-cueilleurs, latolranceaulactosenapportepasdavantagepuisquelelaitnest pasconsommaprslesevrage.Lesalllespermettantdedigrer lelactosenesontdoncpasslectionns.

Chapitre 3

[pp.65-66dumanuel] [pp.65-66dumanuel]

Exercices du chapitre 3

un

intermdiaire entre adn et protine

Exploiter des rsultats exprimentaux. Rponses attendues : 1. Luridine nest prsente que dans les molcules dARN et non dans celles dADN. La prsence dun grain noir sur lautoradiographie montre donc la prsence dARN ayant incorpor de luridine radioactive. Au cours du pulse, lesARN nouvellementsynthtiss incorporentdeluridineradioactive,ilsserontdoncreprablespar laradioactivitquilsgnrent.Aucoursdelaphasedechase,les nouveaux ARN synthtiss incorporeront de luridine non radioactive (froide), ils ne gnreront aucun signal lautoradiographie. Decettefaon,seulslesARNfabriquspendantlepulsemettront de la radioactivit et pourront tre suivis au cours du temps lintrieur de la cellule. Il sera donc possible par cette technique desuivrelalocalisationdesmolculesdARNaucoursdutemps. 2.LacelluledelacultureAprsentedesgrainsnoirs,tmoinsdela prsencedARNradioactif,danssonnoyau.Lacelluledelaculture B,quantelle,prsentedelaradioactivit,nonplusdanslenoyau

lintolranCe
Sinformer et raisonner.

au laCtose

Rponses attendues : 1.DeuxalllesdiffrentsdugneLCTontttudisici:lunportantunnuclotideGenposition22018dugne,lautreprsentant unAcetteposition.


16 Thme 1 exerCiCes

SVT 1reS ditions Belin 2011

mais dans le cytoplasme. LARN synthtis dans le noyau a donc texportdanslecytoplasme:cecisuggrequelARNpeuttre un intermdiaire entre lADN (localis dans le noyau) et les protines(produitesdanslecytoplasme).

des

exCeptions au Code gntique

Mobiliser ses connaissances et raisonner. Rponses attendues : 1. Le code gntique est un systme de correspondance entre squencenuclotidiqueetsquenceprotique.Ilassocieunacide aminchaquecodon.Lecodegntiqueestunivoque,redondant etquasi-universel. 2.Lesexceptionsaucodegntiquerepresdanslesmitochondries de levure et de souris sont rcapitules dans le tableau suivant: Acide amin Codon AUA CUG UGA AGA Code gntique habituel Ile Leu Stop Arg Mitochondrie de levure Met Thr Trp Mitochondrie de souris Met Trp Stop

macroscopique:retardmental,troublesducomportement. CestlaprsenceduneenzymePAHnonfonctionnelle(phnotype molculaire), qui provoque une accumulation de phnylalanine et perturbe le mtabolisme des cellules du cerveau (phnotype cellulaire), ce qui entrane un retard mental et des troubles du comportement(phnotypemacroscopique). 2. La synthse de PAH non fonctionnelle est due la prsence dune mutation dans la squence des allles du gne codant la PAH(nuclotiden473:AaulieudeG).Lephnotypedunindividu atteintdephnylctonurieestdoncduaugnotypedecedernier. Cependant, les symptmes de la maladie peuvent tre attnus ensuivantunrgimealimentairelimitantlessourcesdephnylalanine:lephnotypedpenddoncgalementdelenvironnement delindividu.

les

effets dun arrt de la traite sur les vaChes laitires

Sinformer et raisonner. Rponses attendues : 1. La quantit dARNm des gnes tudis a t modifie suite larrt de la traite: certains gnes sont surexprims (MYC, SOD2), dautressontaucontrairemoinsexprims(LALBA,FASN,CSN3).Un facteur environnemental (larrt de la traite) a donc modifi lexpressiondugnomedescellulesmammairesdesvaches. 2.Suitelarrtdelatraite,lavariationdexpressiondugnome descellulesmammairesconduit: une diminution de la quantit denzymes impliques dans la synthse des glucides, lipides et protines du lait (phnotype molculaire).Cecientraneralaproductiondunlaitmoinsricheen nutriments(phnotypemacroscopique). une augmentation de la quantit de protines dclenchant la mortcellulaireetfavorisantlaractioninflammatoire(phnotype molculaire).Cecientraneralamortdescellules(phnotypecellulaire)ainsiquelinflammationdutissumammaireetladistension desmamelles(phnotypemacroscopique).

Aucuneexceptionaucodegntiquenatrepreauseindela mitochondriedArabette.

de

ladn la protine

Mobiliser ses connaissances et raisonner. Rponses attendues : 1. Allle normal : ARNm:AUGCAAUGCGUACCGACGUGA Protine:MetGlnCysValProThr Allle mut A : ARNm:AUGCAAUGCGUACCAACGUGA Protine:MetGlnCysValProThr Allle mut B : ARNm:AUGCAACGCGUACCGACGUGA Protine:MetGlnArgValProThr 2. La mutation A na aucune consquence sur la squence du polypeptide form car les codons CCG et CCA correspondent tous deux lacide amin Proline: cela illustre la redondance du code gntique.

Objectif bac

[p.67dumanuel]

le phnotype molCulaire de Cellules CanCreuses


Recenser, extraire et organiser des informations, raisonner avec rigueur. Rponses Le doc. 1 nous prsente la nature et la quantit de diffrentes protinestrouvesdansdestissusmammairessainsetdescellules issues de tumeurs du sein. On constate que certaines protines prsentesengrandequantitdanslescellulessainessontabsentes dans les cellules cancreuses (partie droite du document). linverse, certaines protines absentes dans les cellules saines sont prsentes en relativement grande quantit dans les cellules cancreuses(partiegauchedudocument).Seulesquelquesprotines semblenttreprsentesenquantitquivalentedanslescellules sainesetcancreuses. Le doc. 2 correspond deux clichs permettant de localiser la

la

phnylCtonurie, une maladie mtabolique

Extraire et organiser des informations. Rponses attendues : Le phnotype dun enfant atteint de phnylctonurie se dfinit diffrenteschelles: molculaire:PAHnonfonctionnelle; cellulaire:accumulationdephnylalaninedanslescelluleshpatiques,mtabolismedescellulesducerveauperturb;

SVT 1reS ditions Belin 2011

Thme 1 exerCiCes

17

protineHer-2suruntissusainetsuruntissucancreuxissudune tumeurdusein.Unecolorationmarron,tmoindelaprsencede Her-2,estlargementvisiblesurletissucancreuxalorsquellene lestpassurletissusain.Lescellulescancreusescontiennentdonc davantagedeprotineHer-2quelescellulessaines. Ledoc. 3estuntableaunousrenseignantsurlaquantitdARNm Her-2prsentsdansdescellulessainesetdescellulescancreuses issuesdetumeursdusein.Danslescellulessaines,lARNmHer-2 est environ 2 fois plus abondant que lARNm TBP (ARN tmoin) alorsquedanslescellulescancreusesilestenviron300foisplus abondant!

Finalement,lescellulescancreusesnecontiennentpaslesmmes protines que les cellules saines. En particulier, elles contiennent beaucoupplusdeprotineHer-2quelescellulessaines:lephnotypemolculaireestdoncperturbdanslescellulescancreuses. Comme elles prsentent aussi beaucoup plus dARNm Her-2, on peut penser que cest lexpression de linformation gntique, en particulierlatranscription,quiestperturbedanslescellulescancreuses.

18 Thme 1 ChapiTre 3

SVT 1reS ditions Belin 2011

Vous aimerez peut-être aussi