Vous êtes sur la page 1sur 17

Exercice 1 Soient les enzymes de restriction BamH I, Pst I, Xho I et Mbo I dont les sites reconnus sont : BamH

I : 5' G/GATCC 3' ; Pst I : 5' CTGCA/G 3' ; Xho I : 5' C/TCGAG 3' ; Mbo I : 5' /GATC 3'. Recopier la squence de lADN et encadrer les sites de restriction en indiquant la position des coupures.

5 ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3 3 TATGCCCTAGGCTCGAGAGCTAGCAGACGTCTTTAAGG 5 Seule MboI a une coupure franche Les autres enzymes aboutissent a des bouts cohsifs
Facile a faire par vous-mme

Exercice 2 : Un fragment dADN


1. coup par lenzyme EcoRI donne un fragment de 8Kb, un de 4 Kb et un de 3 Kb 2. coup par lenzyme SmaI donne un fragment de 9 Kb et un de 6 Kb 3. coup par les deux enzymes EcoRI et SmaI produit un fragment de 6 Kb, un de 4 Kb, un de 3 Kb et un de 2Kb. Choisir votre rponse par ce qui suit : 1. la digestion par lenzyme EcoRI produit des fragments dADN bouts francs non 2. la taille des fragments dADN digrs est value par lectrophorse oui 3. lors dune lectrophorse, les fragments dADN les plus longs migrent les plus vite non 4. les fragments dADN deviennent fluorescents lorsquils sont illumins par des rayons UV non (il faut les mettre en contact avec le bromure dethidium) 5. dans cette exprience, lanalyse de la taille permet de dduire que lordre des sites de restriction sur le fragment dADN est EcoRI-SmaI-EcoRI ( il suffit de tracer la carte de restriction)

Exercice 3:

Si nous travaillons avec un ADN linaire tel que celui montr dans la figure cidessous, Quelle est la taille en paires de bases (pb) des fragments d'ADN obtenus en effectuant des digestions simples par les enzymes d, e et f et des doubles digestions avec diverses combinaisons entre eux?. NB : Les chiffres correspondent au nombre de paires de bases d'ADN (taille totale est de 1500 pb).

Digestion e : 250 pb + 1250pb Digestion f : 500 pb Digestion d : 650pb+750+100 Digestion d+e : 250pb+400+750+100 Digestion d+f : 500+150+350+400+100 Digestion e+f :250+250+500+500

Exercice 4:

Exercice 4:

Exercice 5 L'ADN dun plasmide recombinant de 48,6 kpb a

t hydrolys par l'enzyme de restriction Sal I.


Cet ADN est analys par lectrophorse sur gel dagarose (pistes 2 et 4). Un marqueur de taille (l'ADN du phage lambda hydrolys par l'enzyme de restriction Hind III ) est dpos dans les puits 1 et 3. Ce marqueur de taille est un mlange quimolaire de fragments dADN de tailles

connues.
La quantit dADN total dpos dans les puits 1 et 2 est le double de celle des puits 3 et 4. Aprs coloration par le bromure dethidium, limage suivante est obtenue.

Exercice 5 suite

dduire la taille des fragments issus de la digestion par l'enzyme de restriction Sal I de l'ADN du cosmide recombinant (pistes 2 et 4). (tracer la gamme etalon puis deduire la taille des fragment) La somme des tailles des fragments obtenus vous semble-t-elle en accord avec la taille attendue de 48,6 kpb ? Non vue les erreurs du au manipulateur lors de la determination des distances de migration et a lextrapolation des tailles de fragment a partir de la gamme etalon

Exercice 6 Un plasmide recombinant contenant le gne M (appel pBM1) est digr par les enzymes de restriction Bam HI et Eco RI. Aprs migration et sparation des fragments d'ADN sur gel d'agarose puis coloration au bromure d'thidium, on obtient les profils de restriction suivants:

Donnez la carte de restriction du plasmide recombinant pBM1.

Exercice 6 : correction

Exercice 7: On ralise la carte de restriction d'un fragment amplifi par PCR (1,8 kpb) avec les enzymes de restriction EcoRI, BamHI, XbaI et NcoI. Les tailles des fragments obtenus sont (en kilo paires de bases): E 0,4 1,4 B 1,8 N 0,8 1 X 0,3 1,5 E-X 0,3 0,4 1,1 E-N 0,4 1 X-N 0,3 0,7 0,8

Donner la carte de restriction du fragment amplifi par PCR.

Exercice 7 suite: reponse Un fragment amplifi par PCR est linaire. Les cartes possibles sont:

Exercice 8 On se propose dtudier la carte de restriction dun plasmide avec EcoRV et PstI.
Quelle est la probabilit thorique de trouver un site de coupure de lADN par Pst I et EcoRV (probabilite = 1/4n )

La digestion de ce plasmide par EcoRV et Pst I nous donne le rsultat suivant :

enzymes EcoRV
Pst I EcoRV+Pst

Tailles des fragments de restriction 4,2


3,6 2,2

3,4
2,7 2 1,3 1,4 1,3 0,7

Etablir la carte de restriction de ce plasmide (pensez y tous:-)) NB: PstI: CTGCAG EcoRV: GATATC

Exercice 9 :

Schmatiser le profil lectrophortique des fragments issus de la digestion de ce plasmide par chacune des enzymes et par la double digestion (EcorI+PstI) PstI : 3 bandes (200+600+800 pb) EcoRI : 2 bandes (600+1000 pb) PstI+ EcoRI : 4 bandes (2 de 500pb + 300+200+100 pb)

Exercice 10: Le gnome dun nouveau bactriophage ADN double brin a t isol et sa squence nuclotidique a t dtermine (5000 paires de bases). Afin davoir plus de renseignement sur la structure de son gnome, lADN du bactriophage est digr par plusieurs enzymes de restriction et les fragments obtenus sont analyss par lectrophorse en gel dagarose natif suivi dune coloration au bromure dthidium (pistes 1-5, figure 4). Lanalyse bioinformatique de la squence gnomique a permis de prdire le nombre de site pour chaque enzyme (tableau 3).

Figure 4: Electrophorse en gel dagarose des fragmentsde restriction obtenus aprs digestion de lADN du bactriophage. Piste 1 : tmoin, ADN non digr. NB : Tous les fragments obtenus sont prsents sur le gel.

Tableau 3 : Nombre de sites de restriction prdits par informatique pour les diffrentes enzymes de restriction utilises dans lexprience prsente figure 3.

Exercice 10:
interprter tous les rsultats exprimentaux obtenus lissue des diffrentes ractions de digestion effectues Donnez le nombre de fragment(s) que lon obtiendrait lors des doubles digestions dcrites dans le tableau ci-dessous : Tableau 4 : Doubles digestions du gnome du bactriophage Enzymes de restriction Nombre de fragments obtenus

Eco RI + Bam HI
Bam HI + Hind III Eco RI + Pvu II

3
2 5

Exercice 10: interprtation

Ce gnome est linaire car : Piste 3 : 1 seul site Bam HI prdit, obtention de 2 bandes correspondant des fragments de 3 et 2 kb, soit une taille totale de 5 kb correspondant la taille de lintgralit du gnome. Si ce gnome avait t circulaire, 1 seule bande de 5 kb. Piste 4 : aucun site donc une seule bande correspondant au gnome linaire de 5 kb. Migration plus rapide pour un ADN circulaire gnralement constitu de superenroulements et donc plus compact. Piste 5 : 3 sites donc 4 bandes. Si circulaire, 3 bandes. Piste 1 : ADN linaire non digr donc migrant une taille de 5 kb. Idem piste 3. Piste 2 : 1 site EcoRI mais une seule bande dintensit identique celle de la piste 1. De ce fait, 2 fragments de 2,5 kb dont la somme totale fait bien 5 kb.

5 ATACGGGATCCG 3

A)3 TATGCCCTAGGC 5 B)3 TATGCCGTAGGC 5 C) 3 TAAGCCCTAGCC 5 D) 5 TATGCCCTAGGC 3 E) 3 TATCCCCTAGGC 5 F) 3 TATGGGTAGGC 5