Vous êtes sur la page 1sur 182

UNIVERSITE SIDI MOHAMED BEN ABDELLAH

FACULTE DES SCIENCES DHAR EL MEHRAZ FES

Thse
Prsente pour lobtention du diplme de

Doctorat National
UFR : Biologie cellulaire et molculaire applique lenvironnement et la sant

Spcialit : Microbiologie de LEnvironnement

Soutenue le 20 / 06 / 2003
Par

Melle Halah AISSAM

Etude de la biodgradation des effluents des huileries (margines) et leur valorisation par production de lenzyme tannase

Devant le jury compos de :

M. BENLEMLIH M. CHAOUCH M. EL HASSOUNI M. PENNINCKX M. MERZOUKI A. ZAID

Professeur la Facult des Sciences de Fs Professeur la Facult des Sciences de Fs Professeur la Facult des Sciences de Fs. Professeur-Chef de Service lInstitut Pasteur de Bruxelles Professeur la Facult des Sciences de Fs. Professeur la Facult des Sciences de Mekns

Prsident Rapporteur Rapporteur Rapporteur Examinateur Examinateur

Laboratoire de Microbiologie de lEnvironnement Dept de Biologie Fac. Sc. DEM B.P 1796 Fs 30000

DEDICACES

A mes trs chers parents


Aucune ddicace aussi parfaite et douce soit-elle, ne saurait exprimer toute ma reconnaissance et tout lamour que je vous porte. Ce travail reprsente le fruit de votre soutien, vos sacrifices, et vos encouragements. Jamais il naurait vu le jour sans les conseils que vous avez consentis pour mon ducation. Que Dieu vous protge et vous accorde une longue vie pleine de sant et de bonheur !

A mes trs chres surs : Fadoua, Khaoula, Rouae et Manal. A tous ceux qui me sont chers.

REMERCIMENTS
A Monsieur Mohamed BENLEMLIH, Professeur la Facult des Sciences de Fs et Directeur de Laboratoire de Microbiologie de lEnvironnement, je vous dois le meilleur accueil que vous mavez rserv dans votre laboratoire, et la mise ma disposition tous les moyens pour me permettre de raliser mes recherches dans les meilleures conditions. Vous mavez tant aid et support au moment o jen avais le plus besoin. Aucun mot ne pourrait exprimer mes remerciements et ma vive gratitude, et que le prsent travail soit un faible tmoignage de ma trs haute reconnaissance et mon profond respect. Merci pour tout. Jadresse ma profonde reconnaissance Monsieur Mohamed MERZOUKI, Professeur la Facult des Sciences de Fs, quil trouve ici lexpression de ma gratitude et mes sincres remerciements pour laide quil ma apporte dans les corrections du manuscrit et les discussions enrichissantes. Je ne saurais remercier suffisamment Monsieur Mohammed El HASSOUNI, Professeur la Facult des Sciences de Fs, de mavoir permis de mener bien la partie molculaire de ce mmoire et de lintrt quil na cess de maccorder tout au long de ce travail avec patience et matrise. Je tiens remercier galement Monsieur Abdelhamid ZAID, Professeur la Facult des Sciences de Mekns qui a accept dexaminer ce travail, cest un honneur pour moi de le voir siger parmi les membres de jury de ce mmoire. A Monsieur Mehdi CHAOUCH, Professeur la Facult des Sciences de Fs, quil trouve ici le tmoignage de mes vifs remerciements pour lhonneur quil ma fait en acceptant dapporter son jugement sur ce travail. A Monsieur Michel PENNINCKX, Professeur-Chef de Service lInstitut Pasteur de Bruxelles, tous mes remerciements pour le temps quil a consacr la lecture de ce travail et surtout pour la peine quil sest donne pour son dplacement. Un remerciement spcial et sincre Monsieur Faouzi ERRACHIDI qui, sans sa collaboration et son aide, je naurais pu surmonter bon nombre de difficults dans mon travail,

il a su me prodiguer tout instant, conseil et encouragement tant au niveau scientifique quamical. Mes vifs remerciements sadresse aussi Madame Ilham ATIKI, pour laide et lamiti quelle ma apporte. Un grand merci Monsieur Noureddine EL OUTASSI pour sa sympathie inpuisable et son sens de collaboration. Mes remerciements les plus sincres tout le personnel de la Facult des Sciences de Fs et tous ceux qui ont contribu de prs ou de loin la ralisation de ce travail.

RESUME
La caractrisation physico-chimique des margines de la station d'vaporation naturelle de la ville de Fs, a montr que cet effluent est trop charg en matires organiques values en terme de DCO (154 g d'O2.l-1). Il est caractris aussi par un taux lev en composs phnoliques (9,7 g/l). L'tude microbiologique de ces margines a rvl que ce rejet renferme une charge microbienne assez faible (FMAT : 8,4 103 UFC.ml-1, levures : 7,6 103 UFC.ml-1, champignons : 4 102 UFC.ml-1). Ltude microbiologique de ces margines a permis disoler une seule souche bactrienne appartenant au genre Pseudomonas, deux types de champignons (Penicillium sp. et Aspergillus niger), et 8 espces de levures (Candida boidinii, Candida diddensiae, Candida wickerhamii, Pichia kluyveri, Pichia membranaefaciens, Saccharomyces cerevisiae, Geotrichum terrestre et Zygosaccharomyces fermentati). La croissance de ces souches sur diffrentes sources de carbone a rvl que les levures : Candida boidinii et Geotrichum terrestre, ainsi que les champignons : Penicillium sp. et Aspergillus niger sont les souches les plus performantes dans l'assimilation des composs phnoliques et lipidiques. Ladaptation de ces quatre souches indignes crotre sur les margines diffrentes concentrations croissantes (25%, 50%, 75% et 100%) permet daugmenter la rsistance des micro-organismes la toxicit des composs phnoliques des margines brutes. Ainsi, les souches A. niger, Penicillium sp., G. terrestre et C. boidinii ont rduit la DCO des taux de 78,3% ; 63,1% ; 48,4% et 40,3% respectivement aprs un mois de traitement des margines brutes. Cette tude a montr galement l'intrt de la souche A. niger dans llimination de la DCO (78,3%) et des composs phnoliques (63,1%). Ltude prliminaire de la production de lenzyme tannase par Aspergillus niger HA37 sur diffrentes concentrations dacide tannique telles que 0,2%; 0,5% et 1% a montr que lactivit enzymatique maximale est respectivement de lordre de 0,6 ; 0,9 et 1,5 UE.ml-1. Ltude de la production de lenzyme tannase par Aspergillus niger HA37 en utilisant les margines 25% comme milieu de culture a donn des rsultats encourageants. La production de cette enzyme reste plus ou moins stable pendant plus que 30 heures, elle varie entre 0,37 et 0,64 UE.ml-1. Cette production de lenzyme tannase est accompagne par des taux dabattement des composs phnoliques et de la DCO de lordre de 71,1% et 66% respectivement.

Mots cls Margines, tude physico-chimique et microbiologique, traitement biologique, tannase.

SOMMAIRE
INTRODUCTION GENERALE....... ETUDE BIBLIOGRAPHIQUE I. Situation olicole mondiale..... II. Secteur olicole au Maroc. III. Synoptique de fabrication dhuile dolives III. 1. Oprations prliminaires.... III. 2. Broyage.. III. 3. Malaxage III. 4. Sparation des phases. IV. Procds dextraction dhuiles dolives.. IV. 1. Procd en discontinu ou systme presse... IV. 2. Procd en continu ou systme centrifugation.... IV. 3. Comparaison entre les procds en continu et en discontinu V. Problmatique environnementale gnre par les margines. V. 1. Origine des margines... V. 2. Estimation du dbit des margines... V. 3. Pollution par les margines... VI. Caractrisation physico-chimique des margines... VI. 1 Fraction minrale VI. 2. Fraction organique. VI. 2. 1. Sucres. VI. 2. 2. Composs azots.... VI. 2. 3. Vitamines... VI. 2. 4. Acides organiques.. VI. 2. 5. Huiles..... VI. 2. 6. Composs phnoliques.. VI. 2. 6. 1. Les monomres phnoliques VI. 2. 6. 2. Les polymres phnoliques...... VI. 2. 6. 3. Mtabolisme des composs phnoliques..... VI. 2. 6. 3. 1. Dgradation arobie des monomres aromatiques.. VI. 2. 6. 3. 2. Induction et rpression. VI. 2. 6. 3. 3. Dgradation des lignines. VI. 2. 6. 3. 4. Distribution et rle physiologique des Oxygnases VII. Origine de la coloration.. VIII. Toxicit des margines.... IX. Caractrisation microbiologique des margines. 5 6 8 8 8 9 9 9 9 11 12 13 13 14 14 14 16 18 18 18 19 19 19 20 20 23 24 24 31 31 31 32 34 34 1

X. Impact sur le milieu naturel. XI. Traitement des margines. XI. 1. Procds physiques.. XI. 1. 1. Processus thermiques XI. 1. 1. 1. Distillation XI. 1. 1. 2. Evaporation.. XI. 1. 1. 3. Schage. XI. 1. 1. 4. Incinration... XI. 1. 2. Techniques membranaires XI. 1. 2. 1. Ultrafiltration........................................................................................ XI. 1. 2. 2. Osmose inverse..................................................................................... XI. 1. 2. 3. Electrodialyse....................................................................................... XI. 2. Procds chimiques................................................................................................ XI. 2. 1. Coagulation-floculation.................................................................................... XI. 2. 2. Adsorption........................................................................................................ XI. 3. Procd biologique................................................................................................ XI. 3. 1. Traitement anarobie des margines.................................................................. XI. 3. 1. 1. Les digesteurs contact.......................................................................... XI. 3. 1. 2. lits de boues flux ascendant (UASB)................................................. XI. 3. 1. 3. Lit de boues filtre anarobie.............................................................. XI. 3. 2. Traitement arobie des margines...................................................................... XI. 4. Procds combins................................................................................................. XI. 4. 1. Procd physique en srie................................................................................. XI. 4. 2. Procd physique et biologique........................................................................ XI. 4. 3. Procd biologique et physico-chimique.. XI. 4. 4. Procd physico-chimique XII. Valorisation des margines.......................................................................................... XII. 1. Production de biogaz............................................................................................ XII. 2. Compostage des margines.................................................................................... XII. 3. Production des protines dorganismes unicellulaires (POU).............................. XII. 4. Production denzymes.......................................................................................... XII. 5. Epandage (Fertilisation des terres agricoles)........................................................ XII. 6. Utilisation en alimentation animale..

35 36 36 36 36 37 38 39 39 39 39 40 41 41 41 42 42 43 43 44 44 46 47 47 48 48 49 49 50 51 52 53 54

-CHAPITRE I Caractrisation physico-chimique et microbiologique des margines


I. INTRODUCTION... II. MATERIEL ET METHODES. II. 1. Echantillonnage... 56 56 56

II. 2. Etude physico-chimique des margines.. II. 2. 1. Dtermination des paramtres organiques. II. 2. 1. 1. Acidit (pH)... II. 2. 1. 2. Matires en suspension (MES).. II. 2. 1. 3. Matire sche (MS) et matire volatile (MV) II. 2. 1. 4. Demande chimique en oxygne (DCO). II. 2. 1. 5. Composs phnoliques... II. 2. 1. 6. Sucres totaux.. II. 2. 1. 7. Matire grasse II. 2. 2. Dtermination des paramtres minraux II. 2. 2. 1. Conductivit lectrique.. II. 2. 2. 2. Orthophosphates. II. 2. 2. 3. Azote total.. II. 2. 2. 4. Ions ammoniums II. 2. 2. 5. Calcium et magnsium... II. 2. 2. 6. Sodium et potassium.. II. 2. 2. 7. Chlorures II. 2. 3. Dtermination des paramtres mtalliques.. II. 2. 3. 1. Minralisation des mtaux lourds.. II. 2. 3. 2. Dosage des mtaux lourds.. II. 3. Etude microbiologique des margines. II. 3. 1. Dnombrement... II. 3. 2. Purification. II. 3. 3. Identification... III. RESULTATS ET DISCUSSION III. 1. Caractrisation physico-chimique..... III. 1. 1. Caractrisation organique.. III. 1. 1. 1. Acidit III. 1. 1. 2. Matires en suspension (MES).. III. 1. 1. 3. Matire sche (MS) et matire volatile (MV) III. 1. 1. 4. Demande chimique en oxygne (DCO). III. 1. 1. 5. Composs phnoliques.. III. 1. 1. 6. Sucres totaux. III. 1. 1. 7. Matire grasse... III. 1. 2. Caractrisation minralogique... III. 1. 2. 1. Conductivit... III. 1. 2. 2. Calcium, magnsium, potassium et sodium.. III. 1. 2. 3. Chlorures...

56 57 57 57 57 57 58 58 58 59 59 59 59 59 60 60 60 61 61 61 61 61 62 63 64 64 64 64 64 65 65 65 65 66 66 67 67 67

III. 1. 2. 4. Orthophosphates et azote total... III. 1. 2. 5. Ions ammoniums III. 1. 3. Caractrisation mtallique. III. 2. Caractrisation microbiologique.. III. 2. 1. Dnombrement des micro-organismes.. III. 2. 2. Identification des micro-organismes. III. 2. 2. 1. Bactries. III. 2. 2. 2. Champignons.. III. 2. 2. 3. Levures... IV. CONCLUSION.

68 68 68 69 69 70 70 71 72 74

-CHAPITRE IIIdentification et caractrisation des souches de levures


I. INTRODUCTION... II. MATERIEL ET METHODES..... II. 1. Identification classique des souches de levures II. 1. 1. Etude des caractres morphologiques.. II. 1. 1. 1. Etude du mode de reproduction vgtative. II. 1. 1. 2. Etude du myclium. II. 1. 1. 3. Etude de la sporulation II. 1. 2. Etude des caractres physiologiques.. II. 1. 2. 1. Fermentation des sucres.. II. 1. 2. 2. Assimilation des sources de carbone... II. 1. 2. 3. Assimilation des nitrates. II. 1. 2. 4. Croissance sur milieu sans vitamine... II. 1. 2. 5. Croissance 37C... II. 1. 2. 6. Test de lurease... II. 1. 2. 7. Rsistance au cycloheximide.. II. 2. Identification molculaire des souches de levures.. II. 2. 1. PCR II. 2. 2. Conditions de la PCR. II. 2. 3. Visualisation des produits de PCR par lectrophorse... II. 2. 4. Squenage des ADN amplifis. III. RESULTATS ET DISCUSSION III. 1. Identification classique... III. 1. 1. Identification du genre.. III. 1. 2. Description de lespce. 76 77 77 77 77 77 77 78 78 78 79 79 79 79 79 80 80 80 81 81 81 81 81 84

III. 2. Identification molculaire. IV. CONCLUSION.

88 91

-CHAPITRE IIISlection des souches de levures et de champignons performantes dans le traitement des margines
I. INTRODUCTION... II. MATERIEL ET METHODES. II. 1. Echantillonnage... II. 2. Choix des souches pour cette tude. II. 3. Slection des souches choisies II. 4. Bio-traitement.. II. 4. 1. Prparation de la prculture II. 4. 2. Mise en culture... II. 5. Analyses physico-chimiques III. RESULTATS ET DISCUSSION III. 1. Caractrisation des souches de levures et des champignons. III. 2. Traitement des margines en cascade diffrentes concentrations par les quatre souches slectionnes 93 93 93 94 94 94 95 96 97 97 97 99

III. 2. 1. Dgradation des composs phnoliques 99 III. 2. 2. Dgradation de la matire organique 100 III. 2. 3. Dosage de la biomasse produite 101 III. 2. 4. Discussion. 102 III. 3. Suivi du traitement des margines brutes durant un mois... 105 III. 3. 1. Evolution des composs phnoliques III. 3. 2. Evolution de la DCO. III. 3. 3. Evolution de la biomasse produite III. 3. 4. Interprtation des rsultats de lvolution des composs phnoliques, de la DCO et de la biomasse produite... III. 3. 5. Evolution du pH III. 4. Discussion IV. CONCLUSION. 105 106 107 107 109 111 114

-CHAPITRE IVEtude cintique de la production de lenzyme tannase par Aspergillus niger HA37 sur lacide tannique

I. INTRODUCTION... 115 II. MATERIEL ET METHODES. 117 II. 1. Milieu de culture.. 117 II. 2. Matriel biologique.. 117 II. 3. Inoculation du milieu de culture.. 118 II. 4. Techniques du dosage.. 118 II. 4. 1. Dosage du CO2... II. 4. 2. Dosage de lacide tannique et des composs phnoliques. II. 4. 3. Dtermination de la biomasse sche... II 4. 4. Dosage des protines contenues dans la biomasse produite II. 4. 5. Dosage de lenzyme tannase... II. 4. 6. Chromatographie des composs phnoliques sur colonne de Sphadex G-50. III. RESULTATS ET DISCUSSION 118 118 119 119 119 119 120

III. 1. Production de lenzyme tannase par A. niger HA37 sur lacide tannique. 120 III. 1. 1. Croissance dA. niger HA37 sur milieu solide (ATA) contenant lacide tannique 1% III. 1. 2. Effet de la concentration initiale dacide tannique sur la croissance dA. niger HA37.. III. 1. 3. Effet de la concentration initiale dacide tannique sur la production de lenzyme tannase A. niger HA37... III. 1. 4. Production de la biomasse dA. niger HA37 aprs 48 heures dincubation... III. 1. 5. Effet de la concentration dacide tannique sur les paramtres de la croissance de la production de lenzyme tannase 121 122 124 125 126

III. 2. Production de lenzyme tannase par A. niger HA37 sur les margines... 127 III. 2. 1. Evolution de la teneur des composs phnoliques et de lenzyme tannase produite durant le traitement des margines par A. niger HA37. 127 III. 2. 2. DCO finale et biomasse produite par A. niger HA37 129 III. 2. 3. Evaluation par chromatographie de lefficacit du traitement des margines par A. niger HA37.... 129 IV. CONCLUSION. 131 CONCLUSION GENERALE 132 REFERENCES BIBLIOGRAPHIQUES.. 137 ANNEXES 156

Introduction gnrale

PROBLEMATIQUE Au cours des dernires dcennies, en raison de laccroissement dmographique, de lexpansion industrielle et du dveloppement de lagriculture, les cours deau ont subi une trs forte dgradation due essentiellement aux rejets domestiques et industriels, lutilisation des engrais et des pesticides et aux produits chimiques qui y sont dverss. Le cas de lOued Sebou, en aval de la ville de Fs, reste un exemple frappant et inquitant, car son tat de pollution a atteint un niveau ncessitant des actions concrtes immdiates. Plusieurs tudes et campagnes danalyse ont t ralises par lOffice National de lEau Potable (O.N.E.P) et le Laboratoire National de lEnvironnement. Ces investigations ont prouv que la priode situe entre la mi-octobre et la mi-mars se caractrise par une intensification de la pollution des eaux de lOued Sebou. Cette priode correspond la saison de la production de lhuile dolive par les industries olicoles. La trs forte charge organique rejete durant cette priode est estime au taux de la pollution engendre par des centaines de milliers dhabitants. Cette pollution de lOued Sebou constitue un phnomne particulirement critique au Maroc puisquil reprsente une ressource importante en eau potable pour les villages aux alentours de lOued jusqu knitra. La province de Fs constitue le premier ple de concentration des units industrielles (42% des huileries marocaines) (Achkari-Begdouri, 1994). On estime que pendant la priode olicole, les margines pourraient reprsenter les 2/3 de la pollution biodgradable industrielle de la ville et environ la moiti de la pollution totale de lagglomration de Fs. De ce fait, durant cette priode, lOued Sebou peut tre exempt doxygne sur plusieurs dizaines de kilomtres et par consquent, toute forme de vie aquatique disparat (ONEP, 1989). Le suivi de la qualit des eaux de Sebou men par lONEP a montr que limpact des rejets des huileries de la ville de Fs et de sa rgion est fortement ressenti au niveau des installations de potabilisation. Lindustrie olicole qui produit principalement lhuile dolive, engendre deux rsidus : lun solide (les grignons) et lautre liquide (les margines). Les grignons sont rutiliss en agriculture et en industries, alors que les margines sont rejetes directement dans les gouts. Les critres de la pollution des margines se limitent trois facteurs principaux : Lacidit,

Introduction gnrale

Une conductivit leve due lajout du sel lors du stockage des olives avant leur trituration, Une concentration leve en matire organique reprsente essentiellement par les composs phnoliques qui sont responsables de la toxicit et de la coloration brune-rougetre noire des margines. De ce fait, le rejet de ces effluents dans les rivires et les gouts sans aucun traitement pralable pose de srieux problmes pour le systme aquatique (Levis-Menzi et al., 1992 ; Francesco, 1993 ; Bouranis et al., 1995 ; Cabrera et al., 1996 ; Sayadi et al., 2000). Leur effet nocif drive en grande partie de leur contenu en composs phnoliques qui peuvent inhiber la croissance des micro-organismes, spcialement les bactries (Capasso et al., 1995 ; Capasso, 1997). Ce qui diminue la dcomposition biologique naturelle. Ces considrations ont conduit plusieurs chercheurs lchelle nationale et internationale choisir la voie du traitement et de la valorisation des margines pour limiter leur pollution (Gharsallah et al., 1999 ; Garcia Garcia et al., 2000 ; Leger et al., 2000 ; Kissi et al., 2001 ; Garrido Hoyos et al., 2002 ; Pozo et al., 2002 ; Fenice et al., 2003). Cependant, les procds dvelopps jusqu prsent restent trs limits et leur cot trs lev (Hamdi, 1993a ; Hamdi, 1993c). Par consquent le traitement par des bassins dvaporation naturelle reste actuellement, la technique la plus usite en raison de sa simplicit. Nanmoins, elle provoque des effets nfastes sur lenvironnement (Hamdi, 1993a). Les margines dverses dans le bassin versant de lOued de Sebou reprsentent 40% de celles produites au Maroc (Scandiaconsult, 1992). Vu limportance de cette rivire, il sest avr ncessaire de trouver une solution immdiate cet ala. Plusieurs tudes ont t ralises et diffrentes solutions ont t proposes par la wilaya de Fs, par lONEP et par la firme SWEEP-Scandiaconsult. Cependant, la plupart de ces procds souffrent de contraintes technico-conomiques et ncessitent une adaptation aux conditions locales et rgionales de Fs. La collecte des margines et leur mise en dcharge tait la seule solution immdiate et provisoire pour rsoudre ce problme en attendant des procds de traitement innovants. En 1996, la station dvaporation naturelle situe Oulad Jamaa a t mise en service afin de soulager les eaux de lOued de Sebou des rejets des huileries. Elle est constitue de deux bassins qui reoivent seulement 30% des margines produites par les huileries de la ville de Fs durant les campagnes olicoles (Ministre des Travaux Publics, 1997). Cependant, cette solution prconise par la ville de Fs est non seulement funeste sur le plan cologique mais

Introduction gnrale

galement peu efficace. La pollution saccentue au fil des annes et la recherche dun systme de traitement adquat devient imminente. Les diffrents types de traitement des margines tudis jusqu prsent ne rsolvent quen partie le problme. En effet, la plupart des procds proposs restent insuffisants et incomplets voire mme limits. Le traitement physique ne permet quune simple sparation de leau des matires en suspension. Ce qui engendre lapparition de boues en fin de traitement dont la gestion nest pas tout fait rationnelle. Le traitement chimique des margines demande de grandes quantits de ractifs, en raison de leur richesse en matires organiques et minrales. Le traitement biologique classique arobie ncessite de fortes dilutions pour que le processus ne soit pas inhib par les composs phnoliques toxiques. De plus, ce systme arobie demande une nergie trs importante pour laration et le brassage du milieu. Le traitement biologique anarobie est limit par des problmes dacidification, de toxicit et de biodgradabilit. En plus, les bactries mthanognes sont sensibles aux lipides rsiduels contenus dans les margines (Hamdi, 1991a ; Mouncif et al., 1993a ; Borja et al., 1995a). Les tendances actuelles doivent viser lintgration de diverses technologies pour traiter les margines faible cot. Ceci ncessite la production dune valeur ajoute susceptible de couvrir les charges du traitement. Les procds biologiques innovants restent par excellence les moins coteux, ce qui rpond parfaitement notre situation socio-conomique. Cest ainsi que notre laboratoire sest orient vers lusage de voies biologiques qui exploitent la flexibilit mtabolique des souches adaptes la dgradation des composs phnoliques et des technologies cellulaires nouvelles. Ce type de traitement prsente au niveau des ouvrages de dpollution des margines un impact positif sur le cot de traitement. En effet, il permet lconomie de lutilisation des produits chimiques toxiques, et dautre part lobtention dune biomasse qui peut tre valorise comme aliment de btail. Lextraction des exo-enzymes intrt industriel peut produire une valeur ajoute capable de surpasser les difficults techniques et conomiques. En utilisant un tel procd de traitement biologique, nous pourrions liminer les composs phnoliques des effluents des huileries au meilleur rendement et faible cot.

Introduction gnrale

Le prsent travail constitue lune des premires tudes sintressant la caractrisation physico-chimique et microbiologique des margines de la station dvaporation naturelle de la ville de Fs. Le but de cette tude est dvaluer lefficacit du traitement des margines dans ces bassins, et dy mettre en vidence les micro-organismes responsables de lautopuration ventuelle. Dans ce sens, nous avons procd dans le premier chapitre : - Une caractrisation organique, minralogique et mtallique de la charge polluante de ces margines. - Une caractrisation microbiologique par lisolement et lidentification des microorganismes capables de survivre sur cet effluent haute toxicit. Dans le deuxime chapitre nous avons approfondie la caractrisation et lidentification des souches de levures isoles via deux mthodes : - Technique classique fonde sur ltude des critres morphologiques, sexuels et physiologiques des souches. - Technique molculaire base sur lamplification par PCR des 28S et leur squenage. Le troisime chapitre vise en premier lieu, une slection des souches isoles et identifies pouvant tre les plus performantes vis vis de la dgradation des composs phnoliques, afin de cribler des souches pouvant jouer un rle fondamental dans le traitement biologique des margines. En deuxime lieu, nous avons tudi le traitement des margines fraches prleves dune huilerie industrielle via les souches slectionnes. Ce traitement a t amlior par une adaptation des souches crotre sur les margines concentration croissante. Dans le quatrime chapitre, nous avons tudi la production dune exo-enzyme nomme tannase par une souche isole des margines Aspergillus niger HA37 sur un milieu artificiel base des tannins, et sur les margines. Cette tude a pour objectif la production dune valeur ajoute pouvant surpasser les difficults des charges du traitement biologique des margines.

Etude bibliographique

I. Situation olicole mondiale Environ 840 millions doliviers sont implants en mditerrane, et 90 millions dans le reste du monde (Faostat, 2001). Les oliveraies sont de lordre de 10 millions dhectares, soit une densit moyenne de 80 oliviers par hectare (COI, 2000). Les variations observes dans les densits de plantations sont lies aux conditions climatiques et topographiques et aux objectifs de production recherchs. Plus de 70% des arbres se trouvent en Europe Mditerranenne, 13% se situent au Proche-Orient, 13% en Afrique du nord et 3% en Amrique Latine et aux Etats Unis dAmrique (figure 1) (Amoretti et Comet, 1985).

Figure 1 : Aires de rpartition des oliviers au monde (Amoretti et Comet, 1985). La culture des oliviers fait partie de la tradition mditerranenne. Cest un symbole de civilisation chez les mditerranens et en mme temps un dlice ncessaire sur leurs tables. Loliculture occupe une place prpondrante dans lconomie nationale de ces pays et particulirement lEspagne, lItalie, la Grce, la Turquie, la Tunisie et le Maroc (Tableau 1). Loliveraie couvre dans ces pays 65% de la surface mondiale et produit 74%; soit 8,4 millions de tonnes dolives annuellement (Nefzaoui, 1987).

Etude bibliographique

Tableau 1 : Nombre doliviers et les superficies occupes par les oliveraies dans les six principaux pays mditerranens olicoles (Faostat, 2001). Pays mditerranen Espagne Italie Grce Turquie Tunisie Maroc Oliviers (106) 210 190 95 70 60 62 Superficie (106 ha) 2 1,2 0,7 0,9 1,5 0,55

Ces pays sont aussi les plus grands exportateurs dhuile dolive avec un taux de production dpassant 80% en matire dhuile dolive (Steegmans, 1995). LEspagne se situe en premier rang avec 43% de la production mondiale suivie de lItalie (28%), la Grce (19%), la Turquie, la Tunisie et le Maroc. Paradoxalement la production dhuile dolive, ces pays rejettent des eaux uses appeles margines qui posent actuellement un vrai problme environnemental pour toute la rgion mditerranenne (Zimbalatti, 1995 ; Levis-Menzi et al., 1995). En effet, plus de 30 106 m3 de margines sont produits annuellement dans le bassin mditerranen par rapport au volume mondial infrieur 40 millions de m3/an (Fiestas Ros de Ursinos, 1981 ; Sayadi et Ellouz, 1995 ; Borja et al., 1995a). II. Secteur olicole au Maroc Au Maroc, loliculture joue un rle socio-conomique trs important. En effet, lolivier constitue la principale espce fruitire plante au Maroc, avec environ 550 000 hectares. Le patrimoine olicole reprsente plus de 50% de la superficie arboricole totale (Foastat, 2001), et est concentr dans trois zones principales (Achkari-Begdouri, 1994) : La zone sud : occupe une superficie de 114 600 ha, soit 29% de la superficie totale. Elle est reprsente par les oliveraies des provinces de Marrakech, Tadla, BeniMellal, Kalaa de Sreghnae et Taroudante. La zone nord : couvre une surface de 107 000 ha, soit 27% de la superficie totale. Elle est reprsente par les oliveraies des provinces de Chefchaoun, Ouazzan et Taounate. La zone centre : occupe une superficie de 86 000 ha, soit 22% du total. Elle regroupe les oliveraies des Provinces de Taza, Fs et Mekns.

Etude bibliographique

Figure 2 : Rpartition gographique des principales zones olicoles nationales. A lchelle nationale, lhuile dolive est extraite par des systmes modernes de centrifugation (units industrielles) ou par des mthodes traditionnelles de pression faisant usage de presses mcaniques (petites masras). Le potentiel de trituration des olives compte 16 360 huileries rparties comme suit : - 16 000 units traditionnelles (Masras), avec une capacit de production dpassant les 50% des olives tritures annuellement. - 360 units industrielles avec une capacit de trituration de prs de 400 000 tonnes. La province de Fs constitue le premier ple de production de lhuile dolive. En effet plus de 42% des units industrielles sont concentres dans cette ville tandis que les units traditionnelles (masras) ne prsentent que 18% du nombre total des huileries. Marrakech et ses environs viennent en second lieu; avec 22,4% des units industrielles et 11% des masras, puis la province de Mekns constitue le troisime centre avec un taux de 16,2% dunits industrielles et 5% des masras (tableau 2).

Etude bibliographique

Ces trois rgions assurent environ 50% de la production nationale en huile dolive (Samhale, 1992). Tableau 2 : Rpartition par rgion des principales units industrielles et traditionnelles (Masras) (Achkari-Begdouri, 1994). Province Fs-Taounate Marrakech Mekns Essaouira Agadir Sidi Kacem Beni Mellal Azilal Taza Oujda Nador Errachidia Nombre dunits Industrielles Traditionnelles 72 2879 25 1760 29 183 8 1109 6 1351 8 778 5 529 2 1107 1 1815 3 304 3 181 3 382

III. Synoptique de fabrication dhuile dolives La production dhuile dolives a toujours t le principal objectif de la culture de lolivier. Les mthodes dextraction ont volu mais, le processus dextraction dhuile dolives reste toujours le mme. Il inclut quatre oprations principales : les oprations prliminaires, le broyage, le malaxage et la sparation des phases liquides ; huile et eau (Chimi, 1997). III. 1. Oprations prliminaires Elles consistent leffeuillage des olives qui se fait gnralement par aspiration, suivi par le lavage afin dliminer les matires trangres (salets, moisissures). Ces matires peuvent dune part, altrer les proprits organoleptiques de lhuile (couleur, odeur, got) et dautre part, user les broyeurs mtalliques. III. 2. Broyage Cette opration consiste la dilacration du tissu des olives pour librer les gouttelettes dhuile contenues dans les vacuoles lintrieure des cellules dolives.

Etude bibliographique

III. 3. Malaxage Il consiste en un broyage lent et continu de la pte dolive pralablement chauffe. Il a pour but de librer le maximum dhuile en brisant les vacuoles qui sont restes entires durant la phase prcdente et damasser les gouttelettes dhuile en gouttes plus grosses. III. 4. Sparation des phases Cette opration consiste : Sparation des phases liquides-solides : Le broyage et le malaxage aboutissent la formation dune pte qui contient de la matire solide et des fluides. La matire solide appele grignon est forme de dbris de noyaux, dpiderme, de parois cellulairesetc, alors que la partie fluide est compose dhuile et deau de vgtation appele margine. Sparation des phases liquides-liquides : La sparation entre la phase aqueuse de la phase huileuse se fait essentiellement par simple dcantation ou par centrifugation. Elle est base sur la diffrence de densit entre lhuile dolive et leau de vgtation. IV. Procds dextraction dhuiles dolives Au Maroc et jusqu ces dernires dcennies, le secteur olicole nutilisait que des techniques traditionnelles. Lextraction a t ralise laide des systmes archaques de pression faisant appel la force animale dfaut de lnergie lectrique. Avec le dveloppement du secteur olicole, les systmes traditionnels ont cd la place aux quipements modernes. Le perfectionnement de ces procds a permis dextraire lhuile travers des phases successives. Auparavant, lextraction tait effectue de manire discontinue (lavage des olives, broyage mcanique, malaxage, extraction des mots huileuses). De mme, aprs le dveloppement des appareils de centrifugation, la sparation de lhuile des eaux de vgtation est devenue moins onreuse (Francesco, 1993). IV. 1. Procds en discontinu ou systme presse Ce sont les systmes classiques par pression avec broyeurs. Le broyage des olives suivi du malaxage se font sous des meules. Une pte est obtenue au bout dune demi-heure environ. Elle est compose de grignon et un mot contenant lhuile et les margines. La sparation des

Etude bibliographique

deux phases solide-liquide se fait par simple pression, alors que lhuile est spare des margines par dcantation naturelle.

Oliviers Olives

Bois de taille, feuille, Brindilles

Oleifacteurs

Huile dolive

Margines

Grignons bruts

Acides Extraction de lhuile de grignons Huile de Grignon Industrie Grignons puiss

Sparation coques pulpes

Grignons puiss tamiss

Coques

Figure 3 : Diagramme de traitement des olives par pression et nature des diffrents sous-produits (Nefzaoui, 1987).

10

Etude bibliographique

IV. 2. Procds en continu ou systme centrifugation Lextraction dhuile dolive se fait travers des phases successives contrairement au procd discontinu. Les olives sont laves, broyes, mlanges avec leau chaude et malaxes. Les phases liquides et solides sont spares par centrifugation. Le mot subit son tour une centrifugation pour sparer lhuile des margines. Bois de taille, Feuilles et brindilles

Olives

Olives Broyage des olives

Mlange de la patte avec de leau chaude

Sparation par centrifugation des parties solides et liquides

Solide : grignons

Liquide : Eau + huile

Sparation par centrifugation de lhuile et de leau

Margines

Huile dolive

Figure 4 : Procd dobtention de lhuile dolive par centrifugation et nature des diffrents sous-produits (Nefzaoui, 1987).

11

Etude bibliographique

IV. 3. Comparaison entre les procds en discontinu et en continu La diffrence substantielle entre les deux procds rside dans la dure des oprations et les rendements en terme de quantit et de qualit de lhuile par quintal dolives traites. Les installations cycle continu permettent de rduire la main duvre et daugmenter la capacit de production globale dhuile dolive (figure 4). Nanmoins, ces installations prsentent des inconvnients dus principalement la consommation leve deau chaude dont le volume peut parfois dpasser celui des olives mises en uvre, ce qui se traduit par une production accrue de margines. Dans les systmes traditionnels (figure 3), lextraction se fait sans addition significative deau, ce qui se rpercute sur la charge des margines en matires organique et en suspension (tableau 3). En effet, les margines des units traditionnelles sont plus charges et plus concentres que ceux des units modernes. Certains auteurs rapportent que la DCO des margines provenant dun procd dextraction par centrifugation varie entre 20 et 200 g dO2.l-1 de margines (Di-Giovacchino et al., 1988 ; Martin et al., 1991 ; Hamdi, 1993c). Celle des margines produites par les systmes dextraction par pression varie entre 100 et 390 g dO2.l-1 de margines (Di-Giovacchino et al., 1988 ; Mouncif et al., 1993b). Dans ce sens, les usines dolifaction sont actuellement remises en cause en raison des effluents quelles produisent. Tableau 3 : Comparaison de la charge organique des margines issues du procd en continu et du procd en discontinu (Ranalli, 1991a ). Paramtre Substances organiques (g.kg-1) Sucres rducteurs (g.l-1) Carbone total (g.l-1) DCO (g dO2.l-1) DBO5 (g dO2.l-1) Procd discontinu 94,6 35,2 59 148 67,1 Procd continu 55,4 17,3 37,1 85,1 39,8

12

Etude bibliographique

Figure 5 : Schma descriptif du procd super-presse utilis pour lextraction dhuile dolive avec les sous-produits engendrs. Actuellement, les grandes usines dites galement super-presse emploient de plus en plus le procd en continu (figure 5) dans le but damliorer le rendement de production dhuile dolive sans se proccuper des grandes quantits des margines produites. V. Problmatique environnementale gnre par les margines V. 1. Origine des margines Le processus de trituration des olives produit principalement lhuile dolive vierge et lhuile de grignon (huile secondaire extraite par des solvants organiques) et engendre deux rsidus lun liquide, les margines et lautre solide, les grignons. Les olives contiennent environ 20% dhuile, 30% de grignons et 50% deau de vgtation (Di-Giovacchino et al., 1988 ; Hamdi et al., 1992). Les margines sont composes de 40 50% de leau vgtal qui provient du fruit (olive) et le reste de leau de fabrication ajoute lors du processus de trituration (Nefzaoui, 1987 ; DiGiovacchino, 1996).

13

Etude bibliographique

V. 2. Estimation du dbit des margines La quantit et la qualit des margines produites dpendent essentiellement du systme dextraction utilis. Au Maroc, on estime que la production de 30 000 tonnes dhuile est accompagne de 75 000 m3 de margines (Scandiaconsult, 1992). En moyenne, 100 kg dolives produisent 50 litres de margines via la centrifugation et environ 10 litres par le systme classique de pression (Martin et al., 1991). V. 3. Pollution par les margines Les grignons ne posent pas de problmes particuliers pour lenvironnement et connaissent lheure actuelle diverses voies dutilisation et de valorisation telles que : la production de charbon de bois et la possibilit ventuelle dexploitation des clats de bois pour la fabrication de la pte papier (Jardak, 1999). En revanche, les margines constituent une source dinquitude au Maroc. Elles crent dimportantes nuisances et perturbations du milieu rcepteur. Ces effluents sont acides et extrmement chargs en matires organiques qui contiennent essentiellement des composs phnoliques provenant de la pulpe dolive (Vasquez et al., 1974). Do la forte activit polluante des margines sur les eaux de surface. LOued de Sebou pendant la priode olicole, prsente une si grande dgradation de sa qualit que lONEP sest trouv dans lobligation darrter le traitement de ses eaux avant la confluence dans 3 stations. De ce fait, la ville de Fs a connu une pnurie deau potable en janvier 1992, principalement pour la population rsidant lancien mdina (Scandiaconsult, 1992). VI. Caractrisation physico-chimique des margines Les margines se prsentent comme un liquide rsiduel aqueux, de couleur brunerougetre noire avec une forte odeur dolive et un aspect trouble (Ranalli, 1991a). Leur pH est acide (4 - 5,5) avec un fort pouvoir tampon et une odeur ftide qui se dveloppe au fur et mesure que les margines vieillissent (Ranalli, 1991a ; Hamdi, 1993c ; Mouncif et al., 1993a). Elles ont gnralement une forte salinit due lajout important de sel pour la conservation des olives (conductivit suprieure 10 mS.cm-1) (Zenjari et al., 1999 ; Tsioulpas et al., 2002). La composition des margines a t tudie par plusieurs chercheurs et comporte approximativement 83 94% deau, 4 16% de matires organiques et 0,4 2,5% de substances minrales (Ramos-Cormenzana, 1986 ; Ranalli, 1991a).
14

Etude bibliographique

La caractrisation physico-chimique des margines est gnralement tributaire des techniques et des systmes retenus pour lextraction dhuile dolives et diffre dun pays lautre. En gnral, les margines prsentent une composition chimique trs complexe et htrogne. Elles contiennent une varit de composs organiques et minraux, de nature et de concentration trs diffrentes. Cette variation est due essentiellement aux facteurs suivants (Karapinar et Worgan, 1983 ; Bambalov et al., 1989) : Stade de maturation des olives, Conditions climatiques, Varit des oliviers, Systme de culture, Situation gographique, Temps de stockage des olives avant la trituration, Techniques et lieu de stockage, Nature de conservation des olives, Procd dextraction dhuile dolive qui reprsente llment le plus important (De Felice et al., 1997 ; Ramos-Cormenzana, 1986 ; Annaki et al., 1999b). Les analyses menes sur les margines peuvent nous renseigner sur les intervalles de variation de leurs diffrents composants chimiques (Fiestas Ros de Ursinos et Borja, 1992 ; Lutwin et al., 1996). Tableau 4 : Principales composantes des margines (Lutwin et al., 1996). Composant Matire sche Matires minrales Sucres divers Graisses et huiles diverses Composs phnoliques Azote organique % en poids de la matire frache 1,4-17 10-15 30-50 12-35 5,0-25 <10%

15

Etude bibliographique

VI. 1. Fraction minrale Les margines contiennent des quantits significatives en sels minraux (Ranalli, 1991a) dont 80% sont solubles (phosphates, sulfates et chlorures) et 20% insolubles (carbonates et silicates). Daprs Fiestas Ros de Ursinos et Borja (1992), les lments les plus reprsentatifs sont le potassium (47%), les carbonates (21%), les phosphates (14%) et le sodium (7%). La fraction minrale a t analyse par Salvemini (1985). Le tableau 5 regroupe les concentrations de ces lments. Tableau 5 : Composition minrale des margines (Salvemini, 1985). Elment Orthophosphates (PO43-) Chlorures (Cl-) Sulfate (SO42-) Sodium (Na+) Potassium (K+) Calcium (Ca2+) Magnsium (Mg2+) Fer (Fe) Aluminium (Al) Chrome (Cr-) Nickel (N) Cobalt (Co) Manganse (Mn) Cadmium (Cd) Oxyde de silicium (SiO2) Zinc (Zn) Concentration (mg.l-1) 800,6 270,2 16,68 5370,9 15295,5 1167,6 410,3 103,4 8,34 0,66 3,36 1,33 1,66 0,83 41,7 10,0

Ce tableau montre que les margines sont riches en phosphore, sodium, potassium et calcium. Par consquent elles peuvent tre utilises comme fertilisants des terres agricoles (Buldini et al., 2000 ; Capasso et al., 2002a, 2002b). La composition minrale des margines a t aussi tudie par Lutwin et al. (1996). Le tableau 6 montre les valeurs des lments minraux en % du poids de la matire sche. Tableau 6 : Constituants minraux des margines (Lutwin et al., 1996). Elment Potassium (K2O) Calcium (CaO) Phosphore (P2O5) Magnsium (MgO) Sodium (Na2O) Valeur en % du poids de la matire sche 5-15 0,2-2,5 0,5 3,0 <1%

16

Etude bibliographique

Arienzo et Capasso (2000) ont analys les cations mtalliques et les anions inorganiques prsents dans deux types de margines Italiennes (Tableau 7). Tableau 7 : Concentrations des Cations et des Anions dans les margines issues dun systme par pression (omww1) et dun processus par centrifugation (omww2). Cations (g.l-1) omww1 omww2 17,10 0,31 9,80 0,12 2,72 0,13 2,24 0,14 0,40 0,17 0,129 0,05 0,0630 0,001 0,0147 0,001 0,0086 0,001 1,65 0,11 1,35 0,10 0,162 0,08 0,033 0,01 0,0301 0,001 0,0091 0,001 0,0098 0,001 Anions (g.l-1) omww1 omww2 1,63 0,06 1,3 0,02 1,07 0,06 0,57 0,01 0,53 0,05 0,85 0,04 0,53 0,01 0,42 0,02

Cation K+ Mg2+ Ca2+ Na+ Fe2+ Zn2+ Mn2+ Cu2+

Anion ClH2PO4FSO4NO3-

0,023 0,01 0,0110,008

Ces rsultats montrent que les margines issues du systme de centrifugation sont moins concentres en cations et en anions. Ceci est d leur dilution par leau durant lextraction dhuile dolives (Arienzo et Capasso, 2000). La composition des mtaux contenus dans les polymres des margines a t tudie par Capasso et al. (2002a) (Tableau 8). Tableau 8 : Composition des mtaux contenus dans les polymres. Mtal K+ Na+ Ca2+ Mg2+ Fe3+ Zn2+ Cu2+ Total mg 100 1 8,26 0,82 0,85 0,46 0,54 0,11 0,02 11,06 mmol 100 1 0,2100 0,0360 0,021 0,019 0,0097 0,0017 0,00031 0,30

17

Etude bibliographique

VI. 2. Fraction organique Les margines comportent deux fractions organiques : Fraction insoluble constitue essentiellement de pulpes dolives. Cette fraction reprsente les matires en suspension et collodales (Hamdi, 1991a). Fraction soluble dans la phase aqueuse et contient les sucres, les lipides, les acides organiques et les composs phnoliques (Hamdi, 1991a). VI. 2. 1. Sucres Les tudes effectues sur les margines par Hamdi (1993a) ont montr que la teneur en glucides varie entre 2 et 8% du poids de la pulpe dolive frache. Les glucides rencontrs dans les margines contiennent principalement des composs lignocellulosiques et des pectines qui reprsentent respectivement 3% et 0,6% (Fernandez Diaz, 1983). La prsence dautres sucres simples tel que : glucose, saccharose, mannose, arabinose, raffinose et xylose a t galement signale par Salvemini (1985). La composition des monosaccharides contenus dans les polymres des margines a t tudie par Capasso et al. (2002a) (Tableau 9). Tableau 9 : Composition des monosaccharides contenus dans les polymres. Monosaccharide Arabinose Galactose Glucose Rhamnose Acide Glucuronique Acide Galacturonique Total VI. 2. 2. Composs azots La fraction azote est reprsente principalement par les protines avec une concentration variant entre 1,2 et 2,4% (p/v). Presque tous les acides amins sont prsents dans les margines. Les plus abondants sont lacide aspartique, lacide glutamique, la proline et la glycine (Salvemini, 1985 ; Ranalli, 1991a ; Capasso et al., 2002a). mg 100 1 20,90 10,45 9,90 5,50 4,40 3,85 55,00 mmol 100 1 0,13 0,058 0,055 0,034 0,023 0,020 0,32

18

Etude bibliographique

Tableau 10 : Composition (Capasso et al., 2002a). Acide amin Asp + Asn Glu + Gln Cys Thr Ser Pro Gly Ala Val Met Ile Leu Tyr Phe Lys His Arg Total VI. 2. 3. Vitamines

des

acides

amins

des

polymres

des

margines

mg 100 1a 1,95 2,02 0,10 0,87 1,37 1,30 2,29 1,36 1,35 0,37 0,60 1,15 0,55 0,54 0,054 0,088 0,64 16,60

mmol 100 1a 0,015 0,014 0,00083 0,0073 0,013 0,011 0,031 0,015 0,012 0,0024 0,0046 0,0088 0,0030 0,0033 0,00037 0,0057 0,0037 0,15

Plusieurs vitamines ont t identifies. Les plus frquentes sont les vitamines du groupe D et la vitamine PP avec une concentration de 124 mg.kg-1 de margines (Salvemini, 1985). Cette teneur peut tre exploite lchelle industrielle. VI. 2. 4. Acides organiques La proportion des acides organiques prsente dans les margines varie entre 0,5 et 1,5% (p/v). Les principaux acides organiques rencontrs sont les acides fumarique, glycrique, lactique, malique et malonique (Fiestas Ros de Ursinos, 1981 ; Salvemini, 1985). VI. 2. 5. Huiles La concentration dhuile rsiduelle contenue dans les margines est trs variable selon le procd dextraction utilis. Elle varie entre 0,02 et 1% (v/v) (Fiestas Ros de Ursinos et Borja, 1992). Lacide olique est lacide gras le plus abondant avec un pourcentage de 65% par rapport la totalit dhuile (Ranalli, 1991a).

19

Etude bibliographique

VI. 2. 6. Composs phnoliques Les composs phnoliques des margines sont trs divers et leur structure est trs variable. Ils proviennent de lhydrolyse enzymatique des glucides et des esters de la pulpe dolive au cours du processus dextraction. Leur solubilisation dans lhuile est cependant bien infrieure celle dans les eaux de vgtation, ce qui explique leur concentration leve dtecte dans les margines (Ranalli, 1991a). Les caractristiques organoleptiques de lhuile dolive vierge dpendent de la prsence des composs phnoliques et des substances volatiles (Vazequez, 1978). La teneur en composs phnoliques dans les margines dpend du systme dextraction de lhuile dolive (Annaki et al., 1999b). En gnral, elle varie entre 3 et 5 g.l-1 (Balice et al., 1997 ; Al-Malah et al., 2000 ; Oukili et al., 2001 ; Garrido Hoyos et al., 2002 ; Tsioulpas et al., 2002 ; Casa et al., 2003 ; Fenice et al., 2003) et elle peut mme dpasser les 9 g.l-1 (Klibanov et al., 1983 ; Borja et al., 1992 ; Sayadi et Ellouz, 1993 ; Kissi et al., 2001 ; Aissam et al., 2002). Plus de 50 composs phnoliques et plusieurs alcools ont t identifis (Saiz-Jimnez at al., 1987 ; Maestro-Duran et al., 1991 ; Brenes et al., 1999 ; DAnnibale et al., 2000 ; Casa et al., 2003). La composition des margines en composs phnoliques diffre aussi selon la procdure dextraction et la varit dolive traite (Ramos-Cormenzana, 1986). VI. 2. 6. 1. Les monomres phnoliques Plusieurs monomres aromatiques ont t identifis dans les margines par des techniques de chromatographie (HPLC ou CPG). Ils sont reprsents essentiellement par des acides et des alcools phnoliques. - Acides phnoliques Les acides phnoliques sont les monomres les plus abondants dans les margines, ce qui explique leur acidit. Plusieurs acides phnoliques ont t identifis dans diffrents types de margines : - Acide cafique (Vazequez et al., 1974 ; Borja et al., 1995a). - Acide p-coumarique (Vazequez et al., 1974 ; Borja et al., 1995a). - Acide protocatchuique (Vazequez et al., 1974 ; Cichelli et Solinas, 1984 ; Borja et al., 1995a). - Acide vanillique (Vazequez et al., 1974 ; Balice et Cera, 1984 ; Borja et al., 1995a). - Acide 4-hydroxyphnylactique (Cichelli et Solinas, 1984 ; Borja et al., 1995a). - Acide syringique (Cichelli et Solinas, 1984 ; Borja et al., 1995a).

20

Etude bibliographique

- Acide p-hydroxybenzoique (Cichelli et Solinas, 1984 ; Borja et al., 1995a). - Acide vratrique (Balice et Cera, 1984 ; Martinez et al., 1992). - Alcools phnoliques Parmi les alcools phnoliques les plus rencontrs dans les margines, nous citons : - 4-Hydroxyphnylthanol (Vazequez et al., 1974 ; Cichelli et Solinas, 1984). - 3,4-dihydroxyphnylthanol (Vazequez et al., 1974 ; Cichelli et Solinas, 1984 ; Wagner et al., 1984 ; Borja et al., 1995a), appel aussi hydroxytyrosol. - 4-hydroxyphnylthanol (tyrosol) (Wagner et al., 1984 ; Borja et al., 1995a). - Syringaldhyde (Borja et al., 1995a). Ces alcools peuvent tre parfois lis des glucosides comme le 4-diglucoside (3,4 dihydroxyphnyl) thanol. - Autres composs phnoliques : (Wagner et al., 1984 ; Capasso, 1997) Dautres composs phnoliques monomres ont t identifis : - Oleuropine - L-cafyl- glucose - Apgine - Lutoline Loleuropine est trs abondant dans les margines et se caractrise par un got amre, elle peut atteindre jusqu 2% du poids dolives (Wagner et al., 1984). Les composs phnoliques sont essentiellement contenus dans la fraction soluble des margines. Balice et Cera (1984) ont quantifi certains composs phnoliques des margines par chromatographie liquide haute performance (HPLC) (tableau 11). Tableau 11 : Teneur de quelques composs phnoliques identifis dans les margines (Balice et Cera, 1984). Compos phnolique - Acide vanillique - Acide 4-hydroxyphnylactique - Acide syringique - Acide vratrique - Acide 3,4,5- trimthoxybenzoque Teneur en mg.l-1 242 145 710 500 80

21

Etude bibliographique

La composition phnolique des margines dItalie a t tudie par chromatographie en phase gazeuse (CPG) (DAnnibale et al., 2000) et par chromatographie en phase liquide (HPLC) (Casa et al., 2003). Les tableaux 12 et 13 illustrent les rsultats de leurs tudes. Tableau 12 : Composition phnolique des margines tudies par DAnnibale et al. (2000). Compos phnolique Acide 3-hydroxybenzoique Acide 4-hydroxybenzoique Acide 3-hydroxyphnylpropionique Acide 4-hydroxyphnylpropionique Acide 4-hydroxyphnylactique 4-hydroxyphnylthanol Catchol Acide 3,4-dihydroxyphnylthanol Acide 3,4-dihydroxyphnylactique Acide 2,3-dihydroxyphnylactique Acide 3,4-dihydroxyphnylpropionique Acide 3,4-dihydroxycinnamique Teneur (mg) 28 71 70 23 23,4 173 234 438 92 16,4 11,7 35,2

Tableau 13 : Phnols totaux, ortho-diphnol et monomres aromatiques contenus dans les margines (Casa et al., 2003). Composs phnoliques Phnols totaux (g.l-1) Ortho-diphnol (g.l-1) Acide 3 ,4-dihydroxybenzoique (mM) Catchol (mM) Acide 4-hydroxybenzoique (mM) Tyrosol (mM) Acide syringique (mM) Acide cafique (mM) 4-Methylcatechol (mM) Acide 3-hydroxyphnylpropionique (mM) Acide para-coumarique (mM) Acide vratrique (mM) Acide 3,4,5-trimethoxybenzoique (mM) Acide trans-cinnamique (mM) Teneur 3,7 0 0,1 1,20 0,02 0,35 0,01 2,28 0,1 0,12 0,004 2,47 0,07 0,196 0,04 1,53 0,1 4,12 0,3 0,06 0,19 0,227 0,21 0,03 0,33 0,08

22

Etude bibliographique

Plusieurs composs phnoliques ont t identifis par HPLC dans des margines Espagnoles par Borja et al. (1995a) (tableau 14). Tableau 14 : Composs phnoliques identifis dans les margines (Borja et al., 1995a). Acides phnoliques Acide cafique Acide p-coumarique Acide protocatchuique Acide vanillique Acide 4-hydroxyphnylactique Acide syringique Acide sinapique Acide ferulique Acide p-vanilline Acide 3,5-dimthoxy-4-hydroxycinnamique Acide p-hydroxybenzoique Alcools phnoliques 4-hydroxyphnylthanol (tyrosol) Syringaldhyde

La variabilit des margines influence considrablement leur contenu qualitatif et quantitatif en composs phnoliques. Toutefois, ceux-ci restent la fraction dominante de la matire organique. Lanalyse qualitative des composs phnoliques par les techniques de chromatographie reste trs dlicate. Ceci est d la polymrisation des monomres phnoliques en polyphnols, et au chevauchement de certains pics dans le chromatogramme des molcules ayant des poids molculaires et des structures trs proches. VI. 2. 6. 2. Les polymres phnoliques Les polyphnols identifis dans les margines sont essentiellement : Les anthocyanes (Tanchev et al., 1980). Les tannins : leur structure est trs complexe, leur concentration peut atteindre 12 g.l-1 (Balice et al., 1982) . Ils sont classs conventionnellement en tanins hydrolysables et tanins condenss (Monties, 1980). i.Les tannins hydrolysables renferment trois groupes : * Esters dacides phnoliques, * Esters dacides phnoliques et sucres, * Glucosides, est le groupe le plus abondant o lacide gallique est le plus important. Laction de lenzyme tannase chez Aspergillus niger hydrolyse ce type de tanins en glucose et en acide gallique. Les gallotanins sont les plus reprsentatifs de ce groupe.

23

Etude bibliographique

ii.Les tanins condenss, appels aussi flavotanins. Ils sont forms par la polymrisation de la catchine diffrents degrs. Leur poids molculaire est compris entre 500 et 3 000. Le catcholmlaninique est le flavotanin le plus retrouv en quantit leve dans les margines. Les flavotanins sont souvent associs aux anthocyanes. En milieu alcoolique et en prsence de HCl 5N, ils sont dgrads avec formation de pigments anthocyaniques de coloration rouge (cyanidine). La lignine est un htropolymre form par la polymrisation oxydative de trois types de monomres drivs de lalcool hydroxycinnamique : le 4-hydroxycinnamate, le 4-hydroxy 3-mthoxycinnamate (conifrylate) et le 3,5-dimthoxy-4-hydroxycinnamate (sinapylate) (Hamdi, 1991a). VI. 2. 6. 3. Mtabolisme des composs phnoliques Les composs phnoliques des margines sont toujours susceptibles dtre dgrads par les micro-organismes (Borja et al., 1992 ; Sayadi et Ellouz, 1993 ; Dannibale et al., 1998 ; Garcia Garcia et al., 2000 ; Garrido Hoyos et al., 2002 ; Tsioulpas et al., 2002 ; Fountoulakis et al., 2002) ou par les enzymes dorigine microbienne (Tien et Kirk, 1984 ; Douglas et al., 1990 ; Martirani et al., 1996 ; DAnnibale et al., 2000 ; Robles et al., 2000 ; Casa et al., 2003). Cependant, le temps ncessaire pour une dgradation totale peut tre considrable. Un grand nombre de micro-organismes y compris les bactries Pseudomonas putida (Di Gioia et al., 2001a ; Bertin et al., 2001), Rhodopseudomonas satustrisand (Rahlkar et al., 1993), les champignons comme Aspergillus niger (Hamdi et Ellouz, 1993 ; Garcia Garcia et al., 2000), Aspergillus terreus (Garrido Hoyos et al., 2002) Phanerochaete chrysosporium (Sayadi et Ellouz, 1992, 1993, 1995 ; Kissi et al., 2001) et les levures comme Candida tropicalis (chang et al., 1995 ; Fadil et al., 2003) a t isol et caractris. Ces micro-organismes possdent la capacit de dgrader les phnols faible concentration. Peu dtudes ont t ralises pour amliorer la dgradation des composs phnoliques par ces micro-organismes (Chang et al., 1995). Bien que plusieurs travaux aient t raliss sur la dgradation des composs aromatiques, les informations sur leur mtabolisation chez les micro-organismes restent trs limites (Middelhoven, 1993 ; Van-berkel et al., 1994 ; Capasso, 1997). VI. 2. 6. 3. 1. Dgradation arobie des monomres aromatiques La minralisation des composs aromatiques naturels commence par lhydrolyse de polymres, avec ensuite des ractions essentiellement de dcarboxylation et de mthylation

24

Etude bibliographique

qui aboutissent des monomres aromatiques facilement clivables. Cette dgradation arobie peut tre ralise par les bactries, les levures, les champignons et les algues. Les premires ractions impliques dans la mtabolisation des composs aromatiques sont les hydroxylations de lanneau aromatique avec loxygne molculaire, par l'intermdiaire dun groupe denzymes appel oxygnases (Maeda-Yorita et Massey, 1992). Ces enzymes sont divises en deux groupes : 1- Le premier groupe est connu sous plusieurs nomenclatures, monooxygnases, hydroxylases ou oxydases fonctions mixtes. Ces dernires fixent un atome doxygne aux substrats et rduisent le deuxime atome d'oxygne en eau par l'intermdiaire du cofacteur enzymatique rduit comme le montre la raction suivante :
COOH + O2 + NADPH OH monooxygnase COOH + H2 O + NADP OH OH

Figure 6 : Hydroxylation de l'acide parahydroxybenzoque par la monooxygnase. 2- Le deuxime groupe comprend des oxygnases qui fixent deux atomes doxygne au substrat sans formation concomitante deau. On cite comme exemple, l'hydroxylation de lacide benzoque en catchol.

COOH
+ O2 + NADPH

H dioxygnase

COOH
+ NADP

OH

OH Acide benzoique
H

Catchol

OH

Figure 7 : Hydroxylation de l'acide benzoque en Catchol par la dioxygnase. Les processus dhydroxylation cits ci-dessus varient selon les cellules. En effet, chez les bactries, l'hydroxylation de l'acide benzoque par une dioxygnase conduit la formation du benzne 1,2-dioxetane qui se rduit au cis 1,2-dihydro 1,2-dihydroxy benzne. Cependant, chez les levures et les champignons, le systme implique les monooxygnases microsomiques qui dpendent du cytochrome P-450 et amne la formation dun poxyde qui aprs

25

Etude bibliographique

hydrolyse enzymatique se transforme en trans 1,2-dihydro 1,2-dihydroxy benzne et par la suite soxyde en catchol. Dans plusieurs cas, chez les levures et les champignons, la raction initiale de la fission de lanneau aromatique est linsertion de deux groupes hydroxyles en position ortho lun par rapport lautre (Peelen et al., 1995 ; Katayama-Hirayama et al., 1994). Dans le cas ou le noyau aromatique contient dj un groupe hydroxyle, un deuxime groupe hydroxyle est introduit gnralement en position ortho et aprs oxydation, il y a formation du catchol. La dgradation ultrieure du catchol ou dacide protocatchuique (catchol substitu) form par linsertion de deux groupes hydroxyles peut avoir lieu par lune des deux voies connues sous le nom dortho ou de mta clivage. - le premier type de clivage connu sous le nom dorthoclivage, aboutit la formation de lacide cis-cis muconique. Par la suite, il se transforme en acide -ctoadipique qui dans l'tape ultime se clive en actyle-CoA et succinyl-CoA (figure 8).

OH

O2

COOH COOH

OH Catchol
Figure 8 : Ortho-clivage du Catchol. Un cas similaire chez Candida tropicalis a t galement observ par Chang et al. (1995) o lactivit 2-3 dioxygnase na pas t dtecte.

Acide cis-cis muconique

26

Etude bibliographique

OH

HOOC OH

OH OH

HOOC

OH OH

HOOC COOH COOH HOOC

COOH COOH

O COOH O

O COOH CO2 O

COOH

COOH Acide ctoadipique COOH

CO-CoA COOH

CH3--CO-S--CoA Actyl-CoA

COOH--CH2 --CH2--CO-S--CoA Succinyl-CoA

Figure 9 : Voies mtaboliques de dgradation par ortho-clivage

- le deuxime type de clivage connu sous le nom de mtaclivage se fait via une dioxygnase et forme lacide 2-hydroxymuconique semi-aldhyde (Figure 10).

OH O2 OH Catchol

CHO COOH OH

Acide 2-hydroxymuconique semi-aldhyde

Figure 10 : Mta-clivage du Catchol.

27

Etude bibliographique

Dans ce cas, le produit ultime partir du catchol est lacide pyruvique et lactaldhyde (figure 11).

OH CH 3 OH

OH

OH OH OH OH COOH CHO OH OH COOH COOH COOH CO CH


3

CH 3

O COOH COOH

O CH COOH + H2O

CH 3COOH

CO2

CH3---CHOH---CH2---CO---COOH

CH3---CHO Actaldhyde

CH3---CO---COOH Acide pyruvique

Figure 11 : Voies de dgradation par mta-clivage. Les deux types de clivage peuvent avoir lieu dans le mme organisme, comme chez les bactries de genre Pseudomonas (Nakazawa et Yokota, 1973) comme le montre la figure suivante :

28

Etude bibliographique

CHO COOH O2 OH OH 2-Hydroxymuconique semi-aldhyde OH Catchol O2 COOH COOH Acide cis-cis muconique

Figure 12 : Double quipements enzymatiques des bactries du genre Pseudomonas impliques dans les deux types de clivages. Un troisime type de clivage appel paraclivage peut tre rencontr chez quelques micro-organismes. Ceci aura lieu lorsque les groupements hydroxyles sont en position para lun par rapport lautre. Dans lacide gentisique (acide 2,5-dihydroxydroxybenzoque), on assiste un paraclivage oxydatif et la voie qui en dcoule est celle du gentisiate. Lors de la dgradation des principaux composs aromatiques intermdiaires, le flux de carbone issu du clivage des noyaux aromatiques (dihydroxyphnols) varie selon la nature du substrat qui peut tre soit le catchol, lacide protocatchuique (catchol substitu) ou lacide gentisique comme le montre la figure 13.

29

Etude bibliographique

COOH COOH
ACETYL-COA CATECHOL SUCCINYL-COA

OH OH OH OH

CHO COOH OH CHO COOH HOOC OH

ACETALDEHYDE

COOH COOH HOOC HOOC


PROTOCATECHUIC

PYRUVATE

HOOC-CH2

OH OH

HOOC-CH2

CHO COOH OH
SUCCINIC SEMIALDEHYDE

HOMOPROTOCATECHUATE

OH HOOC-CH2 HOOC-CH2 O COOH


ACETOACETATE

OH
HOMOGENTISATE

OH
FUMARATE

OH HOOC HOOC O COOH

PYRUVATE

OH
GENTISATE

OH

Figure 13 : Principales voies microbiennes de dgradation de plusieurs composs aromatiques rencontrs lors de la biodgradation des composs aromatiques (Dagley, 1983). Chez les champignons, il existe dautres voies mtaboliques qui sont trs diverses. Il a t dmontr que chez Trichosporon cutaneum, le dficit en dioxygnases est compens par lutilisation de diverses voies mtaboliques et plusieurs hydroxylases (Anderson et Dagley, 1980). Les composs rsultant du clivage des diffrents composs aromatiques sont ensuite compltement oxyds en CO2 et H2O lors de leur utilisation dans le cycle de krebs. Durant le catabolisme arobie des composs phnoliques, loxygne joue un double rle, dactivateur au moment des hydroxylations et du clivage, et daccepteur final des lectrons issus du cycle de krebs.

30

Etude bibliographique

VI. 2. 6. 3. 2. Induction et rpression La concentration denzymes impliques dans les voies de dgradation des composs phnoliques est contrle par un certain nombre de ractions dinductions et de rpressions. C'est ainsi que chez Candida tropicalis, la phnol hydroxylase est induite par le phnol, et elle est fortement rprime par le glucose (chang et al., 1995). Chez Aspergillus niger, le systme enzymatique peroxysomal est fortement induit en prsence des composs non glucidiques. VI. 2. 6. 3. 3. Dgradation des lignines Les lignines constituent 20 30% de bois et 5 15% de la plupart des produits agricoles. Un groupe de champignons basidiomyctes dgradent les lignines compltement en H2O et CO2 et plus rapidement que les autres groupes de micro-organismes. Plusieurs tudes ont montr que la lignine peroxydase et manganse peroxydase jouent un rle capital dans la dgradation initiale du complexe aromatique. Chez les basidiomyctes, la souche la plus tudie est Phanerochaete chrysosporium (Pazzynski et al., 1985 ; Sayadi et Ellouz, 1992, 1993, 1995 ; Sayadi et al., 1996, 2000 ; Kahraman et Yesilada, 1999 ; Kissi et al., 2001). Les ractions catalyses par ces peroxydases en prsence de H2O2 incluent le clivage des liaisons C-C, les hydroxylations, l'oxydation des phnols, le clivage du noyau aromatique (Sarah et al., 1989) et la dpolymrisation des lignines (Hammel et Moen, 1991 ; Cullen et Kersten, 1996). Des expriences ont montr que les tats excits de ces deux enzymes sont similaires celles de la HRP (Hors Radich Peroxydase) qui sont des vraies oxygnases, mais elles sont typiques (Tien et Kirk, 1984 ; Wariishi et al., 1988). Les informations fondamentales concernant la structure et la fonction de ces enzymes lchelle biochimique et molculaire peuvent tre orientes vers des exploitations biotechnologiques de lenvironnement (Nakamoto et Machida, 1991 ; Nicell et al., 1992). VI. 2. 6. 3. 4. Distribution et rle physiologique des oxygnases Les oxygnases qui ont t dcouvertes la premire fois chez les bactries de genre Pseudomonas jouent un rle ubiquiste chez les animaux, les vgtaux et les microorganismes. Ce groupe denzymes joue un rle important non seulement dans le mtabolisme des composs aromatiques, mais aussi des composs aliphatiques simples comme les alcanes, le lactate et la lysine et la synthse des strols (Weete et al., 1974). Thermodynamiquement, les ractions doxygnation apparaissent comme une perte d'nergie, cependant, elles peuvent jouer un rle rgulateur de la distribution d'nergie dans la cellule. Dici, les oxygnases et les
31

Etude bibliographique

hydroxylases entrent en comptition avec les systmes cytochromes de la chane respiratoire pour l'oxygne. Le clivage de certains composs aromatiques peut avoir lieu mme en absence doxygne. Mais, la prsence du groupe hydroxyle reste essentielle. El Kasmi et al. (1995) rapportent que l'enzyme hydroxybenzonyl-CoA rductase rduit p-hydroxybenzonyl-CoA par lintermdiaire de deux lectrons en benzonyl-CoA qui, ultrieurement sera mtabolis par la voie de dgradation des lipides.

VII. Origine de la coloration En gnral, les margines sont de couleur brune-rougetre noire. Cette variation de couleur est due plusieurs facteurs (Karapinar et Worgan, 1983 ; Bambalov et al., 1989W) : Varit et degr de maturit des olives, Etat de fracheur des margines, Etat de dgradation des composs phnoliques, Proportion relative entre les deux groupes des composs phnoliques. Le pigment brun ou catcholamine est un polymre de nature phnolique responsable de la couleur fonce des margines. Ce polyphnol ne se trouve pas dans les olives. Il se forme au cours du broyage partir des orthodiphnols, trs abondants dans la pulpe, sous laction des phnoloxydases. Cette enzyme est inactive dans les drupes entires (Ranalli, 1991a). Ltude des composs phnoliques de diffrents chantillons de margines tunisienne a montr quils contiennent pratiquement les mmes composs phnoliques simples, mais des concentrations variables suivant la maturit des olives et la conservation des margines (Hamdi, 1991a). Cette fraction phnolique renferme deux groupes de composs : - Composs de poids molculaires infrieur 2. 104 qui sont responsables de la couleur rouge violette. Ces composs correspondent aux polymres phnoliques de faibles poids molculaires (anthocyanes, tannins). Ils renferment galement une classe de composs correspondant aux monomres et oligomres phnoliques qui sont responsables de la coloration jaune masque par la coloration rouge (Hamdi, 1993b). - Composs phnoliques de poids molculaire suprieur 2.104 responsables de la coloration noire des margines. Ce sont des polymres phnoliques obtenus aprs
32

Etude bibliographique

oxydation des polyphnols du premier groupe (Saez et al., 1992 ; Hamdi, 1993b). Cette 2me catgorie semble constituer une forme de la lignine (pseudolignine) (Hamdi, 1993b). Donc, selon Hamdi (1993b), la couleur des margines qui varie du rouge violet fonc au noir est sous la dominance dun groupe de composs phnoliques par rapport lautre. Durant le stockage des margines, il a t constat que leur coloration devient de plus en plus noire. Ceci peut tre expliqu par : loxydation des polyphnols du premier groupe qui se polymrisent et donnent les polyphnols du second groupe (Hamdi, 1993b ; Saez et al., 1992). La biodgradation naturelle des polyphnols du premier groupe. Ces phnomnes de biodgradation et de polymrisation des tanins et des anthocyanes ont t signals aussi par Field et Lettinga (1991). La dcoloration des margines a t tudie par plusieurs auteurs. Ces derniers ont constat que le champignon Phanerochaete chrysosporium est capable de dcolorer les margines grces aux deux enzymes, la lignine peroxydase (LiP) et la manganse peroxydase (MnP) (Sayadi et Ellouz, 1992, 1993, 1995 ; Sayadi et al., 1996, 2000 ; Gharsallah et al., 1999 ; Kahraman et Yesilada, 1999 ; Garcia Garcia et al., 2000 ; Kissi et al., 2001). Dautres travaux ont montr la capacit du champignon Pleurotus ostreatus dcolorer les margines grce lenzyme phnol oxydase ou laccase (Tomati et al., 1991 ; Martirani et al., 1996 ; Flouri et al., 1996 ; Kissi et al., 2001 ; Fountoulakis et al., 2002). Leffet de prtraitement des margines par Pleurotus ostreatus a montr ses performances lors dun traitement anarobie ultrieur (Fountoulakis et al., 2002). Une tude mene sur plusieurs souches de Pleurotus sp. a montr quelles sont toutes capables de crotre sur les margines sans prtraitement ni ajout des nutriments (Tsioulpas et al., 2002). La coloration noire des margines est devenue jaune marron avec un taux dlimination des composs phnoliques de 76% aprs 15 jours dincubation. Loxydation chimique reprsente aussi un moyen efficace pour la dcoloration des margines. Flouri et al. (1996) ont obtenu une dcoloration de 50% des margines en ajoutant 20 g.l-1 du peroxyde dhydrogne (H2O2).

33

Etude bibliographique

VIII. Toxicit des margines Les margines ne sont pas toxiques pour lhomme, par contre, ces eaux paraissent avoir une certaine toxicit pour la microflore et la faune aquatique. Son indice dinhibition relatif est de 48,1% (Ranalli, 1991a). Les margines sont des effluents contenant plusieurs composs phnoliques qui sont responsables de leur coloration noire, et qui ont des proprits phytotoxiques et antimicrobiens (Gonzalez, 1986 ; Moreno et al., 1987 ; Ramos-Cormenzana, 1986, 1990 ; Gonzalez et al., 1990 ; Capasso et al., 1992 ; Sierra et al., 1994 ; Prez et al., 1986, 1987, 1992, 1997 ; Ehaliotis et al., 1999 ; Casa et al., 2003). Daprs Prez et al. (1992), leffet inhibiteur des margines est particulirement prononc contre la sporulation des bactries du sol. Certains composs phnoliques comme le mthylcatchol et le O-quinone inhibent la croissance des bactries Gram-positives et Gram-ngatives (Capasso et al., 1995, Capasso, 1997), et ils agissent sur les bactries en dnaturant leurs protines cellulaires, en abmant leurs membranes et en affaiblissant leur tension superficielle, ce qui augmente laction antibactrienne (Ranalli, 1991a, 1991c). IX. Caractrisation microbiologique des margines Les tudes microbiologiques effectues sur plusieurs chantillons de margines ont confirm labsence totale de micro-organismes pathognes. Donc, ces effluents ne posent aucun problme hyginico-sanitaire (Ranalli, 1991a). Des analyses microbiologiques ont montr que les levures et les champignons sont capables de sy dvelopper mieux que les bactries (Aissam et al., 2002). Ces micro-organismes supportent la salinit leve et le pH acide caractristiques de ces effluents, et rsistent plus que les bactries aux substances phnoliques. Parmi les levures, on trouve Trichosporium cutaneium, Cryptococcus albidius ainsi que les genres Rhodotorula sp., Candida sp. et Saccharomyces sp. (Ramos-Cormenzana, 1986 ; Gharsallah, 1993 ; Aissam et al., 2002 ; Fadil et al., 2003). La flore fongique se compose essentiellement dAspergillus flavius, Aspergillus candidus, Penicillium negricans, et Alternaria sp. La flore bactrienne regroupe les bactries qui rsistent aux polyphnols particulirement les bactries Gram-ngatif. Le genre Pseudomonas sp. ainsi que Bacillus megaterium ont t dcrits. Une tude microbiologique mene par Mouncif et al. (1993a) sur les margines Marocaines a not la prsence des levures et des champignons (Penicillium sp., Aspergillus sp., Geotrichum candidum). La caractrisation microbiologique des margines de quatre

34

Etude bibliographique

stations dvaporation en Espagne a rvl la prsence dun nombre variable de bactries, de levures et de champignons (Millan et al., 2000). X. Impact sur le milieu naturel Les margines sont extrmement charges en matires organiques particulirement les composs phnoliques qui exercent une activit polluante trop leve (Saez, 1989). Dailleurs, Ranalli (1991c) rapporte quun mtre cube de margines provoque une pollution gale celle de 1 500 personnes en un jour. En effet, Ranalli (1991a) estime que le potentiel polluant de 2 litres de margines est gal celui de 3 habitants. Dautant plus que le taux de matires en suspension est 100 fois suprieure celui des eaux uses domestiques (Lutwin et al., 1996). Cossu et al. (1993) ont montr galement que la DCO des margines est 200 400 fois suprieure celle dune eau use typiquement municipale. Le rejet de ces effluents dans les milieux aquatiques entrane une diminution de la concentration en oxygne dissous. Les composs phnoliques soxydent facilement par loxygne du milieu en subissant une quinonisation, ce qui rend lenvironnement irrespirable avec une asphyxie de toute vie aquatique (levis-Menzi et al., 1992). Ce phnomne entrane donc une dgradation de la qualit des eaux de surface en inhibant le dveloppement des microorganismes spcialement les bactries (Capasso et al., 1995 ; Capasso, 1997). Par consquent, la capacit dautopuration naturelle serait limite. Une tude mene par Ranalli (1991a) a rvl que les deux espces de poissons Chondrostoma polylepsi et Ciprynus carpio tolrent normalement une concentration moyenne de margines 8,8% durant 24 heures et 6,8% durant 48 heures. Dun autre ct, lpandage directe des margines sur le sol est lorigine de nuisances diverses (Fiestas Ros de Urenos, 1981). Leur pH acide, leur salinit leve ainsi que leur abondance en composs phnoliques provoquent la destruction de la microflore du sol (Morisot et Tournier, 1986) et induisent des effets toxiques aux cultures vgtales (effets herbicides). Ceci entrane la strilisation du sol et le dsquilibre de la symbiose entre la microflore du sol et les plantes (Dommergues, 1971 ; Morisot et Tournier, 1986). Vu les effets toxiques des margines sur lenvironnement aquatique et terrestre, des procds dpuration ont t adopts afin dliminer ou de rduire la concentration des substances phnoliques nocives pour le milieu rcepteur.

35

Etude bibliographique

XI. Traitement des margines Jusqu nos jours, le traitement des margines constitue un problme complexe vue la qualit et la quantit des substances chimiques quelles renferment. En effet, lapplication dun traitement simple savre insuffisant et incomplet (Ranalli, 1991a ; Hamdi, 1993a). Plusieurs systmes dpuration des margines sont cits dans la littrature. Les procds de traitement dont nous avons pris connaissance sont nombreux, et il serait difficile de les dcrire dans cette synthse bibliographique. Toutefois, les procds de traitement envisageables pour llimination de la charge polluante des margines peuvent tre classs selon trois catgories, et peuvent tre utiliss seuls ou combins : - procds physiques, - procds chimiques, - procds biologiques. Le choix du systme de traitement appropri est li plusieurs facteurs locaux, savoir le systme utilis pour lextraction dhuile, la possibilit de stockage et le rapport entre la charge produite par les huileries et la population locale (Francesco, 1993). XI. 1. Procds physiques Les procds de traitement physique des margines sont des oprations de sparation de matires minrales et organiques solubles et insolubles de leur phase aqueuse. XI. 1. 1. Processus thermiques XI. 1. 1. 1. Distillation La technique de distillation des margines a t ralise sur une installation pilote par loffice national dassainissement de Sfax (ONAS) en 1977 aprs plusieurs essais au laboratoire. Le procd adopt est celui de la distillation tage avec une circulation naturelle pour les deux premiers tages et une circulation force pour le troisime. Le taux dabattement pour les trois tages est de 90% de DCO. Cependant, le distillat est dune DCO de 10 g dO2.l-1 et le condenst contient des concentrations apprciables en composs volatiles. Par consquent, un traitement complmentaire est ncessaire au distillat avant son rejet ou sa rutilisation en irriguation.

36

Etude bibliographique

XI. 1. 1. 2. Evaporation - Evaporation naturelle Lvaporation naturelle est tributaire des conditions climatiques. En effet, elle dpend troitement de la vitesse du vent, du degr densoleillement et de lhumidit de lair. Ce procd consiste stocker les margines dans des bassins de faibles profondeur (0,7 1,5 m). Elles sont ensuite sches pendant plusieurs semaines, voire plusieurs mois selon les conditions climatiques. Cette mthode simple permet dviter le rejet des margines dans les gouts et dans les rivires (Strom, 1989). Durant leur sjour dans les bassins dvaporation, les margines subissent une autopuration naturelle par une srie de processus de fermentation arobie et anarobie. Les agents de cette biodgradation sont surtout des levures qui se trouvent lorigine dans les olives (Aissam et al., 2002). Les travaux de Cabello et Fiestas Ros de Ursinos (1981) ont montr quau cours de ces processus, une srie de modifications est observe, elle se manifeste par : - une faible variation des microorganismes dpendant de la temprature ambiante et de la profondeur des bassins, - une diminution de la matire organique nintervenant que pendant le premier mois du sjour, - une lgre modification du pH. Dautres critres ont t signals par Balice et al., (1986), notamment une diminution progressive de la quantit de matires organiques solubles, tels que les tannins. Par contre, la quantit des matires en suspension dcrot rapidement durant les deux premiers mois du stockage. Cependant, il sest avr que ce systme prsente plusieurs inconvnients, tels que : - problmes desthtiques et odeurs nausabondes, - faible biodgradation, - formation dune pellicule lipidique tanche la surface qui entrave la pntration de la lumire et limite lvaporation naturelle, - norme modification du bilan hydrique de la station par une variation de la pluviomtrie (Lutwin et al., 1996 ; Annaki et al., 1999a).

37

Etude bibliographique

La faible biodgradation est compense par laugmentation de la surface des bassins dvaporation. Cette compensation est traduite par loccupation de grandes surfaces de terrain qui sont relativement difficiles amnager dans les zones peuples. Ainsi, en essayant dviter une pollution hydrique, on risque dentraner une pollution atmosphrique par dgagement dodeurs ftides (Hamdi, 1993a). - Evaporation force Pour pallier les problmes de lvaporation naturelle, Fiestas Ros de Ursinos et Borja (1992) ont introduit des panneaux vaporateurs dans les bassins de stockage des margines. Ainsi, elles sont pompes puis projetes par des asperseurs sur les panneaux juxtaposs, ayant une importante surface dchange dair. Cette installation permet de faciliter lvaporation de la phase aqueuse des margines de 100 300 m2/m3 du bassin. Cette technique est base sur la diffrence du potentiel hydrique entre les mailles des panneaux et leau. La dshydratation des margines est donc plus facile par arrosage sur un lment gnrateur de la surface expos au vent. Cette mthode a lavantage dutiliser une superficie rduite des bassins dvaporation et permet de multiplier par 40 100 fois la quantit deau par m3 occup du sol. Tandis que, les huiles et les graisses sont rcupres manuellement. Parmi les inconvnients de cette mthode; le dgagement de mauvaises odeurs et limportance du cot dnergie dpense. - Concentration thermique Ce procd physique consiste une vaporation force qui favorise llvation du taux de matire sche des margines environ 70% (Fiestas Ros de Ursinos et Borja, 1992). Des tudes dpuration par ce processus ont t menes par Amirante et Montervino (1996) dans une station pilote dont le dbit est de 1 m3.h-1. Ces essais ont confirm la crdibilit de lpuration des margines. Leau distille spare avait une DCO moyenne gale 1500 - 2000 ppm et le concentr obtenu avait une humidit denviron 50 60% et une teneur leve en carbone, potassium et azote. XI. 1. 1. 3. Schage Le procd dcrit par Ranalli (1991b) consiste en un schoir rotatif axe horizontal qui utilise les noyaux broys ou les grignons asschs comme combustible. Le schage est assur par les fumes issues de la chambre de combustion. A laide dun ventilateur, ces fumes sont dpoussires dans un cyclone puis refoules vers une chemine. Lensemble est sch environ 100C. Ce schage apporte un accroissement denviron 1% de la teneur en huile.

38

Etude bibliographique

Ce procd a t galement amlior par dautres techniques, notamment laddition de carbonate de sodium (Na2CO3) 6% au mlange (margines + grignons) suivi dun schage fond et dune extraction de lhuile par lhexane (Vaccarino et al., 1986). XI. 1. 1. 4. Incinration Ce procd permet dvaporer dabord la phase aqueuse des margines et de brler ensuite les matires organiques. Ces dernires forment le pouvoir calorifique et cdent ainsi la chaleur ncessaire lincinration. Les margines sont nbulises laide dune buse spciale, et introduites dans un four o elles seront vapores et le rsidu solide sera transform en cendres avec production de chaleur. Lnergie ncessaire au systme est obtenue par combustion de grignon (Ranalli, 1991b). Un systme dincinration a t conu en 1981 en Italie impliquant la construction dune usine modulaire pour traiter les margines (Baccioni, 1981). Celles-ci subissent une centrifugation, puis une incinration par des changes thermiques haute temprature slevant jusqu 750-850C grce la condensation des gaz de combustion. XI. 1. 2. Techniques membranaires Les margines peuvent tre aussi traites par des techniques membranaires. Ces processus se basent sur lutilisation de membranes de filtration qui permettent la sparation des substances dissoutes selon la taille des particules et la charge lectrique. XI. 1. 2. 1. Ultrafiltration Ce procd repose sur la filtration travers une membrane permettant la rtention de macromolcules de masse molculaire suprieure 500. La sparation se fait sous leffet dun gradient de pression de 3 10 bar. Cest une technique qui est actuellement applique lchelle industrielle pour le traitement des margines. Les tests dultrafiltration ont donn un liquide limpide (Reimers, 1983 ; Renzo et Amirante, 1988 ; Ranalli, 1991a). XI. 1. 2. 2. Osmose inverse Losmose inverse permet de sparer une solution en deux phases : lune concentre et lautre dilue sous une pression allant jusqu 80 bar. Des essais de traitement des margines ont t raliss par cette technique (Reimers, 1983 ; Renzo et Amirante, 1988), les margines obtenues taient limpides et incolores (Ranalli, 1991a).

39

Etude bibliographique

XI. 1. 2. 3. Electrodialyse Llectrodialyse est un procd lectro-membranaire fond sur la dissociation des molcules ionises en les transfrant travers des membranes changeuses dions sous leffet dun champ lectrique. Cette technique est utilise pour la rcupration des composs phnoliques des margines (Ranalli, 1991a), ou pour la rduction de leur contenu en ces composs afin de faciliter le traitement biologique ultrieur (Longhi et al., 2001). Lapplication de ces processus membranaires prsente un certain nombre davantages : - une faible consommation dnergie, - un trs haut degr de purification par une meilleure rduction via lultrafiltration et une diminution quasi-totale de la charge polluante par osmose inverse, - un rtablissement de matires premires sans quelles soient contamines par des agents chimiques (Buldini et al., 2000), - possibilit dassocier lpuration des margines, la rcupration des produits dintrt commercial, - une flexibilit dexploitation. Cependant, ces procds de filtration prsentent certains inconvnients tels que : - insuffisance de permabilit et entassement des membranes, - formation dune couche de polarisation sur la membrane qui se traduit par des difficults de fonctionnement en continu, - cots levs dinvestissements et dexploitations cause de la forte teneur des margines en matires en suspension et de la viscosit.

Bien que le problme de traitement des margines soit partiellement rsolu par les procds physiques, certains inconvnients peuvent limiter leur utilisation; notamment lapparition dune forte pollution solide la fin de cette opration et le cot lev des installations.

40

Etude bibliographique

XI. 2. Procds chimiques Le traitement chimique des margines est ralis afin de rduire lintensit de leur coloration (Chamrani, 1994 ; Balice et al., 1997). Il peut tre utilis en tant que prtraitement ou traitement de finition aprs puration biologique. Ces techniques sont bases gnralement sur les phnomnes de coagulation-floculation ou dadsorption. XI. 2. 1. Coagulation-floculation La coagulation est lune des mthodes les plus efficaces pour liminer les matires organiques en suspension et collodales. Elle consiste traiter les margines avec des produits tensioactifs ou certains coagulants. Ce type de traitement reste le plus global et certainement le moins coteux par rapport la masse de matires limines (Castillo-Rivera, 1999). Fiestas Ros de Ursinos (1958) a obtenu des rductions de 35% et de 31% de la matire organique en utilisant respectivement des sels de fer et des sels daluminium. La coagulation par la chaux a donn une rduction de la DCO de 40 50% (Mendia et Procino, 1964 ; Beccari et al., 1999). Ce processus peut tre utilis aprs traitement biologique pour liminer les matires en suspension et les polluants rsiduels (Fiestas Ros de Ursinos et Borja, 1992). Linconvnient majeur de ce traitement rside dans le fait quon a un simple transfert de la pollution de ltat soluble ltat boueux. En plus, la plupart des composs organiques contenus dans les margines sont difficiles prcipiter. XI. 2. 2. Adsorption Ladsorbant le plus communment utilis pour liminer les polluants organiques des eaux rsiduaires est le charbon actif. Cependant, il est non seulement une matire relativement chre, mais aprs saturation, le cot de rgnration pour sa rutilisation est lev. Dautant plus que ladsorption sur charbon actif est gnralement limite pour llimination des substances non polaires (Diamadopoulos et al., 1992). Ainsi, dautres adsorbants organiques et inorganiques de substitution ont t tudis ces dernires annes. Beccari et al., (1999) ont montr que le prtraitement des margines par adsorption sur bentonites permet dobtenir une bonne rduction de la DCO allant jusqu 61,6% pH 6,5. Oukili et al., (2001) ont utilis aussi ce processus dadsorption sur des argiles de Fs. Ils ont obtenu aprs optimisation du systme un taux dabattement de la DCO de lordre de 86%. Ce mme procd a t ralis par Al-Malah et al. (2000) sur une argile active (bentonite jordanienne), les pourcentages dlimination des polyphnols et de la DCO sont de lordre de
41

Etude bibliographique

81% et 71% respectivement. La ralisation de ce procd grande chelle rencontre plusieurs difficults, vu limportance de la quantit dargiles utilise. Vu la forte charge organique contenue dans les margines, ces procds chimiques ncessitent gnralement lajout de grandes quantits de ractifs. Ce qui pose le problme de la production des boues putrescibles et du cot lev des ractifs. XI. 3. Procds biologiques La biodgradation pourrait tre dfinie comme tant la dcomposition de la matire par le biais dun agent biologique en particulier, les micro-organismes. Ces derniers jouent un rle trs important dans le processus de dpollution et permettent la rduction de la toxicit des lments polluants engendrs par lactivit naturelle ou humaine (Ranalli, 1991a). La dgradation biologique loppos des procds physico-chimiques est considre comme une mthode plus saine, efficace et moins coteuse pour la rduction des polluants (Hamdi, 1993a ; Hamdi, 1993c). XI. 3. 1. Traitement anarobie des margines La fermentation anarobie peut tre utilise comme un moyen de traitement et dexploitation des margines (Antonacci et al., 1981 ; Fiestas Ros de Ursinos et al., 1982 ; Vaccarino et al., 1986 ; Hamdi et Garcia, 1991 ; Martin et al., 1991, 1994 ; Hamdi et Garcia, 1993 ; Hamdi et Ellouz, 1993 ; Borja et al., 1993, 1994a, 1994b, 1995c ; Beccari et al., 1996, 1998, 1999, 2000 ; Ergder et al., 2000 ; Fountoulakis et al., 2002). En effet, la digestion anarobie des margines offre des avantages significatifs en matire de rduction de la consommation dnergie et de la production de boues. De plus, elle a rvl des performances leves en comparaison avec le traitement anarobie dautres rejets industriels agroalimentaires (Anderson et al., 1977). Parmi les avantages de ce type de traitement : - les bactries anarobies ont la capacit de transformer en mthane la plupart des substances organiques prsentes, - la demande de nutriments est faible, - les mauvaises odeurs ne sont pas mises. Selon Martin et al. (1991), la digestion anarobie est performante, elle permet une rduction de la DCO de lordre de 70% 85%. Son rendement est proportionnel la

42

Etude bibliographique

concentration des micro-organismes et varie largement avec la nature du support (montmotillonite ou sepiolite) (Martin et al., 1991). Di Gioia et al. (2001b) ont montr que la co-culture des deux bactries Ralstonia sp et Pseudomonas putida en anarobiose a permis la dgradation de 7 parmi 9 composs aromatiques monocycliques prsents dans les margines. Le problme majeur rencontr lors du traitement anarobie des margines par la majorit des chercheurs est le dmarrage de leurs digesteurs. En effet, la stabilit de ces derniers est trs longue si les margines sont trs concentres. Ces problmes pourraient tre pargns en diluant les margines et en ajoutant lure comme source dazote (Hamdi, 1993a ; Boari et al., 1984). Le traitement anarobie des margines comprend plusieurs procds tels que les digesteurs contact anarobies, le lit de boues flux ascendant (Upflow Anarobie Sludge Blanked - UASB) et les lit de boues filtre anarobie. XI. 3. 1. 1. Digesteurs contact Ils peuvent galement tre dfinis comme les boues actives anarobies. Ils ont t tests par plusieurs auteurs (Antomacci et al., 1981 ; Fiestas Ros de Ursinos et al., 1982 ; Aveni, 1984). Un abattement important de la matire organique (80-85% de DCO) a t obtenu lors du traitement des margines dans une installation pilote pour un temps de rtention de 20-25 jours (Martin et al., 1991). La production de mthane a t de 60-70%. Lefficacit de ce systme est variable. Les rsultats non satisfaisants sont dus lagitation mcanique excessive de la matire organique introduite dans le digesteur. Ce qui favorise le dveloppement dune flore actogne la place des bactries mthanognes (Boari et al., 1984 ; Hamdi et Garcia, 1991). XI. 3. 1. 2. Lit de boues flux ascendant (UASB) Ce processus a t dvelopp pour la premire fois en Hollande (Lettinga et al., 1980). Puisque la pollution contenue dans les margines est principalement soluble et collodale (90%), ce procd UASB a donn de meilleurs rsultats par rapport aux autres procds anarobies (Boari et al., 1984). Le problme principal rencontr tait la formation de mousse lie la surcharge organique des margines pendant le dmarrage. Ce problme a t rsolu par dilution de margines et augmentation de la teneur en azote (DCO/N de 170/1).

43

Etude bibliographique

XI. 3. 1. 3. Lit de boues filtre anarobie Le principe de ce traitement est la tendance des micro-organismes anarobies se fixer aux matriaux inertes en suspension (le sable, le carbone en poudre, les silicates). Ce qui permet dviter la perte de micro-organismes qui peuvent atteindre des temps de rsidence levs. Ainsi, lpuration est ralise grce la forte concentration en bactries. Les rendements de la production du mthane obtenus avec les filtres anarobies traitant les margines ont t trs proches des valeurs thoriques (Rigoni-Stern et al., 1988). En effet, la mthanisation par le filtre anarobie permet un dmarrage plus court et une meilleure stabilit que celle du processus contact-anarobie (Hamdi et Garcia, 1991). Malheureusement, les rsultats du traitement anarobie restent toujours non satisfaisants, puisque une fraction considrable de composs phnoliques persiste dans leffluent trait (Borja et al., 1995b ; Beccari et al., 1996, 1998). Cette digestion anarobie peut tre inhibe par les acides gras chane longue, notamment lacide olique (Koster et Cramer, 1980). De mme, partir dune concentration de 100 mg.l-1 dacide phnolique dans les margines, les bactries mthanognes sont inhibes (Hamdi et al., 1991b). XI. 3. 2. Traitement arobie des margines Plusieurs tudes ont t ralises sur le traitement arobie des margines, par des cultures pures de micro-organismes tels que Aspergillus niger, Azotobacter chroococcum, Azotobacter vinelandii, Aspergillus terreus, Phanerochaete chrysosporium et Pleurotus ostreatus (Hamdi et al., 1991b, 1991c ; Sayadi et Ellouz, 1992, 1993, 1995 ; Martirani et al., 1996 ; Sayadi et al., 1996, 2000 ; Fiorelli et al., 1996 ; Ehaliotis et al., 1999 ; Gharsallah et al., 1999 ; Kahraman et Yesilada, 1999 ; Piperidou et al., 2000 ; Garcia Garcia et al., 2000 ; Kissi et al., 2001 ; Pozo et al., 2002 ; Garrido Hoyos et al., 2002 ; Fountoulakis et al., 2002). Les tests de toxicit raliss sur les microtox et sur la germination de quelques plantes ont montr une diminution de la toxicit des margines traites par ces micro-organismes (Hamdi et al., 1993b ; Martirani et al., 1996 ; Ehaliotis et al., 1999 ; Kissi et al., 2001). Dautres travaux ont prouv lefficacit du traitement arobie par des cultures mixtes. Une dgradation considrable de deux composs phnoliques les plus reprsentatifs dans les margines (tyrosol et lacide cafique) a t obtenue en utilisant les micro-organismes isols des margines (Borja et al., 1995c).

44

Etude bibliographique

Saiz-Jimnez et al. (1986) ont tudi le traitement arobie des margines, et ils ont beaucoup insist sur le problme de linhibition pos par les composs phnoliques. Ainsi, Balice et al. (1988) ont recommand la dilution de leffluent 70 fois avec de leau de robinet lors du traitement avec les boues actives. Durant ce traitement, un mlange de microorganismes ltat de floculation est soumis en culture dans les margines. Les flocs sont gnralement composs de bactries et de protozoaires dont les cilis jouent un rle important. Hamdi et al. (1991b, 1991c) ont tudi le prtraitement des margines par Aspergillus niger afin de rduire leur effet inhibiteur vis--vis des bactries mthanognes. Des taux dabattement de 60% et de 58% pour la DCO et les composs phnoliques ont t enregistrs respectivement. Les margines prtraites ont subit ensuite une digestion anarobie. Martinez et al. (1992) ont galement tudi la dgradation arobie des composs phnoliques par Aspergillus terreus sur des margines filtres, strilises et dilues diffrentes concentrations. Cette tude a montr que lefficacit du traitement par cette souche diminue lorsque les margines sont de plus en plus concentres. Garrido Hoyos et al. (2002) ont obtenu une limination de 65,77% de la DCO des margines traites en arobiose avec la mme souche. Sayadi et Ellouz (1992, 1993, 1995) ont tudi la possibilit de traiter les margines en arobiose avec un champignon Phanerochaete chrysosporium. Comme les margines prsentent un dficit notamment en matire azote, ces auteurs ont procd lajout des nutriments. Aprs optimisation du milieu de culture (margines), cette tude a rvl que lajout du veratryl alcool induit lactivation du systme ligninolytique qui joue un rle principal dans la dgradation des composs phnoliques des margines. Par consquent, ils ont obtenu environ 74% de dcoloration des margines. La biodgradabilit des margines par Funalia troggi permet d'liminer 70% de la DCO et 93% des phnols, alors que Coriolus versicolor permet une rduction de 63% de la DCO et 90% des phnols pour une DCO initiale de 28,20 g dO2.l-1 (Yesilada et al., 1995, 1998). Vinciguerra et al. (1995) ont tudi le traitement arobie des margines par Leutinus edodes. Un taux dlimination de 75% du carbone organique total (COT), une rduction de 66% des phnols totaux et une dcoloration de lordre de 45% aprs 4 jours dincubation ont t enregistrs. Le traitement par des consortiums de bactries arobies obtenus par enrichissement sur les margines a permis la dgradation des composs mono-aromatiques des margines non dilues. Neuf de ces souches bactriennes ont t isoles et testes pour leur croissance et leur
45

Etude bibliographique

capacit de dgradation des composs aromatiques. Diffrentes combinaisons donnent une rduction de 50% de la DCO initiale, et une dgradation de presque tous les composs aromatiques simples (Zouari et Ellouz, 1996). Robles et al. (2000) ont isol partir des margines des souches de Penicillium sp. capables de dgrader les polyphnols et de produire la biomasse partir des margines brutes (DCO : 120 g dO2.l-1). Les rsultats enregistrent un taux de rduction de la DCO qui se situent entre 61,82% et 74,75%. La co-culture des souches de bactries Ralstonia sp. et Pseudomonas putida a rvl leur capacit de dgrader en conditions arobies les composs aromatiques monocycliques prsents dans les margines (Di Gioia et al., 2001a ; Bertin et al., 2001). Au Maroc, le traitement arobie des margines pH neutre par les micro-organismes du sol a permis dliminer 70% des composs phnoliques et de rduire 63% de la DCO initiale (Zenjari et al., 1999). Kissi et al. (2001) ont montr lefficacit du traitement arobie des margines par Phanerochaete chrysosporium. Les rsultats de cette tude ont rvl des taux dabattement de la DCO et des polyphnols de lordre de 73% et 83% respectivement aprs 12 jours dincubation pour une DCO initiale de 50 g dO2.l-1. Une limination de la DCO de lordre de 55%, 52,5% et 62,8% a t obtenue avec des margines traites en arobiose par Geotrichum sp., Aspergillus sp. et Candida tropicalis respectivement (Fadil et al., 2003). Linconvnient majeur du traitement arobie est la consommation excessive doxygne. En gnral, le traitement des margines par lapplication seule des procds biologiques a donn des rsultats insuffisants (Ranalli, 1991a). Ceci est d en grande partie la prsence de fortes charges organiques polluantes reprsentes particulirement par les composs phnoliques. Ces composs constituent des inhibiteurs de la flore microbienne responsable de la biodgradation (Borja et al., 1994a ; Beccari et al., 1996 ; Yesilada et Sam, 1998). Le traitement biologique des margines en plusieurs tapes savre ncessaire pour obtenir un meilleur rendement puratoire (Ranalli, 1991a, 1992 ; Hamdi, 1993a). XI. 4. Procds combins Les margines ne peuvent tre traites par un simple procd biologique, physique ou chimique. Une srie de traitements savre ncessaire pour rduire la forte concentration en DCO et la toxicit de ces effluents. Les procds combins les plus importants sont les suivants :

46

Etude bibliographique

XI. 4. 1. Procd physique en srie Un procd de traitement des margines par ultrafiltration et osmose inverse a t dvelopp et brevet par Cova (1988) selon la rcente lgislation Italienne. Les margines sont dabord rassembles dans de grands bassins de stockage. Aprs avoir limin les gros lments solides, leau subie une ultrafiltration pour la sparation complte des particules solides de la fraction collodale et des molcules organiques ayant un haut poids molculaire. Les eaux sont ensuite partiellement pures et leur DCO est rduite de 50 75%. Ensuite, les eaux sont traites par des rsines changeuses dions qui absorbent les composs phnoliques prsents dans la solution concentre. A la dernire tape du traitement, leau est soumise une session dosmose inverse pour avoir une eau parfaitement purifie et dcolore. Ce procd permet dobtenir 70% deau traite, 27% de concentr solide et 3% dune solution concentre de polyphnols. Cette solution pourrait tre utilise comme colorant ou comme anti-oxydant naturel. XI. 4. 2. Procds physiques et biologiques Ce type de traitement a t exclusivement dvelopp en Italie durant les annes quatrevingt. Dans la majorit des cas, les procds de traitement biologique par boues actives ou par les champignons sont toujours appliqus dans la phase liquide rcupre aprs traitement physique comme la distillation, la concentration, la filtration ou lultrafiltration (Tableau 15). Tableau 15 : Procds physiques et biologiques de traitement des margines (Bastista et Giorgo, 1988). Procd Constructeur Filtration-Distillation ITALIA-DEPURATORI Arobiose Coagulation-Arobiose SERNAGIOTO Evaporation-Arobiose FIAT-ENGINEERING Distillation-Arobiose STILMAS Microarobiose TECHNOSIS Anarobiose-Arobiose AMENDUNI Floculation-Sdimentation Ultrafiltration-Arobiose ENEA Arobiose-Concentration BALAFUR-ITALIA Solaire Ultrafiltration-Arobiose CONTRETAT Anarobiose-Clarification Distillation-Arobiose MTC Ultrafiltration-Arobiose ENICHEM Filtration-Osmose inverse METALART Arobiose
47

Anne 1987 1980 1983 1983 1986 1986 1986 1986 1986 1987 1987 1988

Nombre dinstallation 26 2 2 2 1 1 1 1 1 1 13 3

Etude bibliographique

Procd Fernando-Saro company Les margines sont additionnes des floculants et des coagulants en doses appropries. Aprs sparation des boues, le surnageant obtenu est complt par des nutriments minraux puis neutralis par une solution basique. Ensuite, une fermentation arobie et une sparation des boues par centrifugation sont ralises. Lultrafiltration et losmose inverse sont deux tapes finales du traitement (Fiestas Ros de Ursinos et Borja, 1992). - En Espagne, Le processus ralis par Balice et al., (1997) consiste ajouter en continu des polylectrolytes aux margines et la solution obtenue est filtre sous pression rduite. Aprs correction du pH, le filtrat est trait en arobiose. Les taux de rduction de la DCO sont de 76% pour le traitement physique et 22,5% pour le traitement biologique. Ce traitement donne de bons rsultats mais le cot dinstallation est onreux. XI. 4. 3. Procd biologique et physico-chimique Plusieurs procds appliqus dans diffrentes installations de traitement des margines ont t dcrits par Ranalli (1991a, 1991b). Parmi lesquels, nous citons celui de Ranalli : Procd Ranalli : il est bas sur lemploi de souches microbiennes slectionnes (Ranalli, 1989). Aprs neutralisation du pH, les margines subissent une correction du rapport C/N/P afin davoir un rapport final de 100/10/2. Ensuite, les composs phnoliques sont oxyds par lacide Caro pour rduire la DCO. Les margines sont filtres pour liminer leurs matires en suspension et leurs mulsions huileuses. Le traitement biologique est effectu par une culture appele SNKD contenant 83 souches microbiennes. La flore prdominante appartient aux genres Azotomonas, Bacillus, Bacterium, Candida, Cladosporium, Clostridium, Endomycopsis, Nocardia, Pseudomonas, Saccharomyces, Steptomyces et Basidiomyctes. Le traitement par cette culture mixte rvle un taux de rduction de 83% pour une DCO initiale de 43 g dO2.l-1 aprs 14 jours dincubation. XI. 4. 4. Procd physico-chimique Oukili et al. (2001) ont mis au point un procd de traitement physico-chimique des margines par technique dadsorption et doxydation. Ce procd consiste ajouter 7% de sol argileux et 0,5% de peroxyde doxygne. Aprs 24 heures de contact, leffluent obtenu est de coleur jaune ple, avec des taux dabattement de 87% des polyphnols et de 66% de la DCO.

48

Etude bibliographique

Le tableau 16 montre une valuation approximative du cot et de la consommation dnergie de certains processus utiliss pour le traitement des margines. Tableau 16 : Evaluation des processus de traitement des margines (Hamdi, 1993a). Traitement Cot capital (US$ / m3) Incinration Distillation Boues actives Digestion anarobique MS : matire sche. MV : matire volatile. 5 103 1,1 104 2 104 4 103 Energie Electrique (kWh / m3) 8 20 30 <1 Thermique (kWh / m3) 670 730 <200-240 Concentrt cendre / boue (kg / m3) 2 MS 90 MS 30 MV 10 MV

Le traitement des margines par incinration ou distillation est efficace mais onreux. Le cot du traitement par boues actives est 5 fois plus lev que celui par digestion anarobie, en raison de la consommation leve dnergie mcanique (tableau 16). XII. Valorisation des margines Paralllement aux recherches ralises sur le traitement des margines, des tudes de valorisation ont t effectues. Les margines sont riches en lments nutritifs minraux et organiques. Ce critre a amen les chercheurs mettre au point de nombreux procds de valorisation et dexploitation des margines aussi bien lchelle de laboratoire qu lchelle pilote (Fiestas Ros de Ursinos, 1981). Cette valorisation a pour objectif llimination des composs phnoliques dune part et lutilisation des margines dans les domaines de la biotechnologie, de la chimie et de lagriculture dautre part (Levis-Menzi et al., 1992). XII. 1. Production de biogaz Lapplication du processus de la digestion anarobie aux margines permet de transformer environ 80% des substances organiques en biogaz (65 70% de mthane). Ainsi, la fermentation mthanique permet la dpollution des margines tout en produisant de lnergie (Nefzaoui, 1987 ; Loulan et Thelier, 1987). Le tableau 17 rsume les principaux travaux mens sur ce type de valorisation.

49

Etude bibliographique

Tableau 17 : Performances des procds de mthanisation appliqus aux margines. Procds Contact Volume (l) 2600 70000 UASB 15 5000 20 19,7 21 300 10 10 11 11 Charge Efficacit Rfrences (g DCO /R-J) 1,55 70 Antonacci et al., 1981 Fiestats Ros de Ursinos et al., 2,55 80 1982 16,00 70 Boari et al., 1984 16,00 70 Boari et al., 1984 15,40 70 Balice et al., 1988 190,00 40 Tsonis et Grigoropoulos, 1988 2,800 83 Rigoni-Stern et al., 1988 8,00 87 Rigoni-Stern et al., 1988 2,50 60 Rozzi et al., 1989 2,50 55 Rozzi et al., 1989 3,00 65 Rozzi et al., 1989 3,00 60 Rozzi et al., 1989

HAUSBUF Filtre arobie

La production de biogaz par digestion anarobie des margines a t tudie par Mouncif et al. (1993b). La rduction de la DCO et le taux de biogaz produit ont atteint respectivement 42% et 207 l.kg-1 de matire organique digre. Ergder et al. (2000) ont montr que le traitement anarobie dun litre de margines permet un rendement lev de lordre de 85,4 93,4% et une production de 57,1 l ( 1,5) de gaz mthanique. XII. 2. Compostage des margines Les margines peuvent tre utilises pour obtenir un compost fertilisant pour les sols (Papadimitriou et al., 1997). Le compostage des margines a t ralis traditionnellement en Espagne dans des bassins dvaporation (Fiestas Ros de Ursinos, 1981 ; Fiestas Ros de Ursinos et Borja, 1992). La technique consiste ajouter aux margines toutes sortes de rsidus secs, agricoles ou forestiers, et le mlange subit une fermentation arobie-anarobie. Ensuite, un schage partiel et un conditionnement sous forme de pellette sont effectus. Le produit ainsi obtenu est utilis comme engrais. Lavantage du compost form partir des margines est labsence des micro-organismes pathognes avec des concentrations leves en phosphore et en potassium contrairement aux rsidus solides urbains. Tomati et Galli (1992) ; Galli et al. (1994) ont mis en uvre un procd permettant la biotransformation des margines en engrais. Les margines sont mlanges avec la paille de bl, et compostes sous aration force. La composition du produit final obtenu est reporte dans le tableau 18.

50

Etude bibliographique

Tableau 18 : Composition physico-chimique du compost final (Galli et al., 1994). Azote total P2O5 K2O5 MgO CaO Fe Zn Mn Mtaux lourds 3,10% 1,40% 2,10% 1,30% 1,90% 0,50% 200 mg.l-1 200 mg.l-1 < 1 mg.l-1 Humidit Taux dhumidification Degr dhumidification Index dhumidification Taux de rtention de leau Poids spcifique Conductivit lectrique Index de germination C/N 37,30% 41,60% 78,20% 0,28 195% 0,345 kg.dm-3 9,56 ms.cm-1 75% 11,5

Piperidou et al. (2000) ont dvelopp un systme de biofertilisation qui exploite la capacit de la souche Azotobacter vinelandii crotre sur les margines et les transformer en un liquide organique fertilisant. Des taux de rendement lev de lordre de 90-96% ont t obtenus aprs 3-7 jours de traitement respectivement. Capasso et al. (2002b) ont extrait partir des margines des polymres contenant des ions minraux et ont test leur effet sur la croissance des tomates. Les rsultats ont rvl que les polymres solubles et leurs drivs ont un effet toxique et la plante se fane et se dessche aprs quelques jours. Zenjari (2000) a tudi un procd de compostage en mlangeant les margines avec les dchets cellulosiques (la paille). Le compost obtenu est stable et riche en substances humiques, avec une rduction de 50% et 95% de la DCO et des phnols totaux respectivement. XII. 3. Production des protines dorganismes unicellulaires (POU) Grce leur richesse en matires organiques, les margines reprsentent un substrat nutritif pour la production des POU qui peuvent tre transformes en fourrage. Yazsioglu et al. (1978) ont prouv que de nombreux micro-organismes donnent des taux en protines non ngligeables sur les margines (tableau 19). Tableau 19 : Micro-organismes utiliss pour la production des POU sur les margines (Yazcioglu et Celikkol, 1978). Micro-organisme T. magnoliac R. glutinis F. manoliforma M4 T. utilis M. pusilis Biomasse (g.l-1) 31 21 21 21 17 Protines (g.l-1) 11,6 8,84 8,36 7,18 6,6

51

Etude bibliographique

Fiestas Ros De Ursinos (1961, 1966, 1981) a tudi la croissance de Torulopis utilis sur les margines lchelle industrielle en vue de produire des POU. Il a dmontr que cette levure est capable dassimiler une grande varit de composs renfermant du carbone et de lazote. De ce fait, ce type de traitement permet non seulement une production des POU mais aussi une rduction considrable des substances organiques initiales. La culture arobie de levures sur les margines pour la production des POU a t teste en raison de la facilit de leur culture et de leur teneur leve en protines. Les principaux travaux de production de levures-aliments sont reports dans le tableau 20. Tableau 20 : Utilisation des levures pour la production de POU partir des margines. Souche Torulopsis utilis Saccharomyces lipolitica Saccharomyces et Candida Saccharomyces cerevisiae Biomasse (g.l-1) 13 18-26 20-26 30 Rfrence Fiestas Ros de Ursinos, 1981 Ercoli et Ertola, 1983 Giulietti et al., 1984 Loulan et Thelier, 1987

Gharsallah (1993) a tudi la production des POU sur les margines par trois souches de levures Candida krusei, Saccharomyces chevalierie et Saccharomyces rouxii. Une concentration en protines de 3,35 g.l-1 et un rendement de 0,45 g de biomasse par g de glucose sont obtenus par Saccharomyces rouxii. Florenzano et Balloni (1983) ont utilis les margines comme substrat pour la croissance de Candida utilis avec une production de levures contenant 40% des protines, Candida tropicalis, des bactries photosynthtiques (Ehodospiralles) et des cyanobactries. Les champignons Aspergillus sp. et Geotrichum candidum ont t galement tests (Vaccarino et al., 1986). Les rsultats ont rvl que la biomasse obtenue est trs digestible, prsentant une teneur en protine brute de lordre de 30% potentiellement utilisable pour lalimentation des ruminants. Parmi les germes utiliss pour la production des POU, les champignons semblent les meilleurs (Gharsallah, 1993). La synthse des protines est limite chez les levures cause de la fixation des composs phnoliques sur la biomasse (Amat et al., 1986). XII. 4. Production denzymes Les margines peuvent servir aussi comme milieu favorable pour la production denzymes par des micro-organismes. La culture de Cryptococcus albidus sur les margines pendant 48 heures limine un taux important de la matire organique tout en produisant de la

52

Etude bibliographique

biomasse et des enzymes (13 UV.ml-1). Cette production peut atteindre 29,5 UV.ml-1 si on limine les polyphnols par floculation-clarification (Francesco, 1993). Laddition de 2 litres dune solution de ces enzymes concentres par ultrafiltration (90 UV/ml) pendant un cycle de broyage augmente le rendement de lhuile de 84,3 90,7% (Petruccioli at al., 1988). La production de lenzyme laccase par la culture de deux champignons Coriolus versicolor et Funalia trogii sur les margines a t tudie (Kahraman et Yesilada, 2001). Cette tude a montr que laddition des tiges du coton augmente significativement lactivit laccase (phnol oxydase). XII. 5. Epandage La valorisation des margines par pandage a t largement tudie par plusieurs auteurs (Morisot, 1979 ; Morisot et Tournier, 1986 ; Prez et al., 1986 ; Saiz-Jemenez et al., 1987 ; Lombardo et al., 1988 ; Ranalli, 1991a ; Levis-Menzi et al., 1992 ; Tomati et Galli, 1992). Les margines peuvent tre utilises dans lirrigation en raison de leur richesse en eau et en minraux nutritifs (Fiestas Ros de Ursinos, 1986). Un mtre cube de margines apporte 3,5 11 kg de K2O; 0,6 2 kg de P2O5 et 0,15 0,5 kg de MgO par hectare de terrain irrigu. Cependant, cette technique prsente certains inconvnients : - Problmes du stockage vu que la priode olicole concide avec la priode pluviale (Ranalli, 1991a). - Colmatage du sol (Proietti et al., 1988 ; Ranalli, 1991a) - Lacidit et la salinit leves peuvent provoquer des brlures sur les plantes (Morisot, 1979 ; Sierra et al., 1994). - Contamination des eaux souterraines (Fiestas ros de Ursinos, 1977 ; Ranalli, 1991a). - Inhibition de la germination due leffet phytotoxique exerc par les composs phnoliques sur les plantes (Morisot, 1979 ; Prez et al., 1980, 1986 ; Ranalli, 1991a ; Ehaliotis et al., 1999 ; Casa et al., 2003). - Modification de la composition de la flore du sol (Parades et al., 1986 ; Prez et al., 1987, 1992). - Modification des caractristiques physico-chimiques du sol (Proietti et al., 1988 ; Sierra et al., 2001 ; Zenjari et Nejmeddine, 2001).

53

Etude bibliographique

- Cot lev de transfert des margines des huileries vers les terres agricoles. Quoique le potassium et le phosphore contenus dans les margines puissent remplacer ceux des engrais chimiques, lacidit, la forte salinit et la haute conductivit, ainsi que le contenu en composs phnoliques sont lorigine dune limitation de toute utilisation efficace des margines comme fertilisant. Pour rsoudre partiellement ce problme, Buldini et al. (2000) ont dvelopp une mthode automatique pour la dtermination et la rcupration des anions inorganiques totaux prsents dans les margines aprs 10 minutes. Cette technique repose sur lutilisation de la dialyse couple la chromatographie dchange ionique sans laddition de ractifs qui risquent dinfecter les quantits danions solubles. XII. 6. Utilisation en alimentation animale Les margines ont t utilises directement comme aliment pour le btail (Ercoli et Ertola, 1983). Cependant, cette pratique reste risque, en raison des taux levs en sodium et en composs phnoliques pouvant engendrer un effet antitrypsique. De mme, elles ont t fournies aux volailles la place de leau potable (Fedeli, 1977). Cette exprience a montr quil y avait un lger abaissement du taux de mortalit de ces animaux. Lapport des margines dshydrates a provoqu des diarrhes chez les ruminants (Salvemini et Cera, 1984 ; Salvemini, 1985). Le procd Dalmolive dcrit par Martillotti (1993) semble remdier au problme. Il consiste mlanger 50 kg de margines avec 20 kg de grignons et 12,6 kg de divers rsidus et sous produits agricoles pour rduire leffet inhibiteur des composs phnoliques. Ceci produit 29 kg daliments en pellettes dont la composition est indique dans le tableau 21. Tableau 21 : Composition chimique de la pte des margines obtenue par le procd Dalmolive (Martilotti, 1993). Composant Matire azote totale Matire grasse Cellulose brute Matire minrale Extrait non azot Matire azote digestible Valeur (% de la matire sche totale) 21,6 4,0 13,1 8,9 52,5 17,2

54

Etude bibliographique

Malgr les multiples procds tests pour le traitement et la valorisation des margines, seulement quelques-uns sont appliqus lchelle industrielle en raison du cot lev des installations. En plus, les rsultats obtenus montrent pour la plupart des procds, que le cot et lnergie consomme taient trop levs par rapport au rendement dpuration obtenu. Ceci est li essentiellement la grande quantit des margines produites annuellement et leur forte et complexe charge polluante.

55

Physico-chimie et microbiologie des margines

I. INTRODUCTION Dans le cadre de ltude du traitement biologique des effluents dindustries agro-alimentaires de la ville de Fs, nous avons ralis la prsente tude sur les effluents des huileries de cette ville. En effet, les huileries reprsentent lactivit industrielle la plus dominante dans la ville de Fs aprs les tanneries. Ainsi, avant dentamer toute tude de traitement ou de valorisation, il nous a apparu intressant de dterminer la quantit et la qualit de la charge polluante engendre par le rejet des effluents des huileries. Le prsent travail, est lune des premires tudes qui se sont intresses la caractrisation physico-chimique et microbiologique des margines de la station dvaporation naturelle de la ville de Fs. Le but de ce travail est dvaluer lefficacit du traitement des margines dans les bassins de cette station et de mettre en vidence les micro-organismes responsables de lautopuration ventuelle. II. MATERIEL ET METHODES II. 1. Echantillonnage Cette tude a port sur les margines de la station d'vaporation naturelle localise au nord-ouest de la ville de Fs. Les prlvements dchantillons ont t effectus chaque mois durant la campagne olicole (Novembre 2000 - Mars 2001). La station est constitue de deux bassins de schage, recouvrant une superficie de l'ordre de 14 000 m2 qui correspond une capacit de rception de 40 000 tonnes. Seulement 30% des rejets des huileries de la ville de Fs produits dans les campagnes olicoles sont vacus dans ces bassins (Ministre des travaux publics, 1997). Les chantillons prlevs ont t mis dans des flacons de 2 litres pour les dosages physico-chimiques. Ceux qui sont destins aux analyses microbiologiques ont t prlevs dans des flacons striles puis transports rapidement au laboratoire. Les chantillons des margines sont conservs 20C pour une utilisation ultrieure. II. 2. Etude physico-chimique des margines La caractrisation physico-chimique et minralogique a t base sur ltude des paramtres suivants : Acidit (pH), matires en suspension (MES), matire sche (MS), matire volatile (MV), demande chimique en oxygne (DCO), composs phnoliques, sucres

56

Physico-chimie et microbiologie des margines

totaux, matire grasse, conductivit, azote total, ions ammoniums, orthophosphates, chlorures, calcium, magnsium, sodium et potassium. Avant de procder au dosage des diffrents paramtres physico-chimiques, les chantillons de margines sont centrifugs (8000 g) dans une centrifugeuse Sigma 2K15. Pour la dtermination des MES, MS et MV, les chantillons des margines sont utiliss sans centrifugation. II. 2. 1. Dtermination des paramtres organiques II. 2. 1. 1. Acidit (pH) Le pH a t mesur laide dun pH-mtre type ORION modle 230A. II. 2. 1. 2. Matires en suspension (MES) Les MES sont dtermines par centrifugation dun volume de 20 ml dchantillon 8 000 g pendant 20 minutes. Le culot est mis dans une coupelle en porcelaine pralablement pese puis sch ltuve 105C pendant 24 heures. La diffrence entre le poids de lchantillon sch et celui de la coupelle dtermine le taux de MES. Il est exprim en g.l-1. II. 2. 1. 3. Matire sche (MS) et matire volatile (MV) La matire sche est constitue par lensemble des substances organiques et inorganiques, en solution ou en suspension, contenues dans les margines. La MS est dtermine par vaporation dun chantillon de 20 ml dans une capsule en porcelaine 105C pendant 24 heures. Elle est exprime en g.l-1 par rapport au poids frais. La matire volatile est dtermine en faisant la diffrence entre la matire sche obtenue par vaporation 105C et les rsidus de cendres issues de la calcination 550C pendant 2 heures. Elle est exprime en g.l-1 par rapport au poids sec. II. 2. 1. 4. Demande chimique en oxygne (DCO) La DCO correspond la consommation doxygne ncessaire loxydation complte de la matire organique des margines. Elle est exprime en gramme doxygne par litre dchantillon. Le DCOmtre utilis pour loxydation de la matire organique chaud est de type RECORD T5A FUSES. La dtermination de la DCO est effectue par la mthode de dichromate de potassium. Le principe de cette mthode est bas sur une oxydation bullition (150C pendant 2 heures)
57

Physico-chimie et microbiologie des margines

des matires rductrices par un excs de dichromate de potassium en milieu acide (H2SO4), et en prsence du sulfate dargent comme catalyseur et du sulfate de mercure comme complexant des chlorures. En fin de la raction, la DCO est value par prise dun chantillon convenablement dilu avant loxydation. La densit optique de lchantillon est obtenue par spectrophotomtrie une longueur donde de 585 nm. Les valeurs de la DCO sont mesures laide dun spectrophotomtre type UV/Visible de marque Jenway 6 105. II. 2. 1. 5. Composs phnoliques Les composs phnoliques contenus dans les margines sont dtermins en utilisant la mthode lamino-4-antipyrine par spectrophotomtrie dabsorption molculaire. Cette mthode avec distillation pralable et extraction, demande un temps considrable, mais elle est sensible et particulirement bien adapte pour des teneurs infrieures 1 mg.l-1. Elle permet le dosage du phnol et des composs substitus en ortho et en mta. Les composs substitus en para avec les groupes carboxyl, mtoxyl, halogne pourront tre doss dans des conditions particulires de pH. - Principe : Les phnols donnent avec lamino-4-antipyrine en milieu alcalin et en prsence de ferricyanure de potassium, une coloration extractible par le chloroforme, susceptible dun dosage spectrophotomtrique une longueur donde de 510 nm. - Expression des rsultats : Pour une prise dessai de 50 ml, la courbe de la gamme dtalon donne directement la teneur en phnol exprime en milligramme par litre deau. II. 2. 1. 6. Sucres totaux La mthode utilise est celle dcrite par Dubois et al. (1956). Les sucres simples, oligosaccharides, polysaccharides et leurs drivs ragissent avec le phnol et lacide sulfurique concentr et donnent une coloration jaune-orange. La raction est sensible, et la coloration reste stable pendant plusieurs heures. La densit optique est lue une longueur donde de 490 nm. La concentration des sucres totaux est dtermine partir dune courbe dtalonnage dune solution de glucose des concentrations allant de 10 100 mg.l-1. II. 2. 1. 7. Matire grasse A 100 ml de margines, 75 ml de chloroforme et 100 ml du mthanol sont ajouts. Aprs agitation suivie dune dcantation, le mlange est divis en deux phases. La phase suprieure

58

Physico-chimie et microbiologie des margines

constitue de margines et de mthanol est limine, alors que la phase infrieure contenant le chloroforme et les lipides soluble est vapore dans un rotavapeur. Le chloroforme svapore et les lipides sont rcuprs. Le volume de lipides obtenu est valu en pourcentage par rapport au volume de margines utilis (v/v). II. 2. 2. Dtermination des paramtres minraux II. 2. 2. 1. Conductivit lectrique La conductivit lectrique est mesure par un conductimtre de type WTW modle LF 318/SET, elle est exprime en mS.cm-1. II. 2. 2. 2. Orthophosphates Les orthophosphates sont doss selon la mthode de Murphy et Riley (1962). La dtermination de leur concentration est base sur la formation dun complexe antimoine-phosphate-molybdate. Ce complexe est rduit par lacide ascorbique en compos fortement color en bleu. La densit optique est lue une longueur donde de 882 nm. Une courbe talon est ralise partir dune solution de KH2PO4 des concentrations comprises entre 5 et 10 mg de PO43-.l-1. II. 2. 2. 3. Azote total Les composs azots prsents dans les margines sont oxyds en nitrates par une solution alcaline de persulfate lautoclave (120C). Ensuite, les nitrates sont doss par la mthode de salicylate de sodium, ils donnent du paranitro-salicylate de sodium color en jaune et susceptible dun dosage colorimtrique une longueur donde de 415 nm. La concentration de lazote total est dtermine partir dune gamme talon de KNO3 des concentrations comprises entre 0,5 et 5 mg de NO3-.l-1. II. 2. 2. 4. Ions ammoniums Les ions ammoniums sont doss par la mthode dindophnol. En milieu alcalin et en prsence de nitroprussiate de sodium comme catalyseur, ils ragissent avec le phnol et lhypochlorite de sodium, et forment le bleu dindophnol susceptible dun dosage colorimtrique. La lecture de la densit optique au spectrophotomtre se fait une longueur

59

Physico-chimie et microbiologie des margines

donde de 630 nm. La concentration des ions ammoniums est dduite partir dune gamme talon dune solution de NH4Cl des concentrations comprises entre 1 et 10 mg de NH4+.l-1. II. 2. 2. 5. Calcium et magnsium Le calcium et le magnsium prsents dans les margines sont complexs par lthylne diamine ttra-actate disodique (EDTA) en milieu tamponn. Le noir erichrome T (NET), qui donne une couleur rouge fonce ou violette en prsence des ions Mg++ et Ca++ est utilis comme indicateur color pour la dtermination de la duret totale. Les ions Ca++ sont doss par lEDTA en milieu alcalin (pH 12) et en prsence dindicateur color. Les ions Mg++ sont prcipits puis dtermins par diffrence entre la duret totale et le calcium. Les deux sont exprims en g.l-1. II. 2. 2. 6. Sodium et potassium Les ions Na+ et K+ sont doss directement dans les chantillons de margines filtrs et dilus avec de leau distille au spectrophotomtre flamme de type PHF 90 D ; ISA Biologie. Ils sont exprims en g.l-1. II. 2. 2. 7. Chlorures Les chlorures sont doss par la mthode de Mohr, en milieu neutre par une solution titre de nitrate dargent et en prsence du chromate de potassium. La fin de la raction est indique par lapparition de la teinte rouge caractristique du chromate dargent. Le dosage colorimtrique des composs phnoliques, sucres totaux, azote total, ions ammoniums, orthophosphates a t effectu par un spectrophotomtre de type CWF modle 12/13. Les rsultats sont exprims en g.l-1. Les mthodes utilises pour le dosage de la conductivit, MES, MVES, MS, MV, DCO, composs phnoliques, azote total, ions ammoniums, chlorures, calcium, magnsium, sodium et potassium sont celles dcrites par Rodier (1996). Tous les essais ont t raliss en triple. Les valeurs reprsentes sur les tableaux sont la moyenne des mesures effectues.

60

Physico-chimie et microbiologie des margines

II. 2. 3. Dtermination des paramtres mtalliques II. 2. 3. 1. Minralisation des mtaux lourds La minralisation des mtaux lourds est ralise selon la mthode dcrite par Auger (1989). Des volumes de 50 ml de margines sont mis dans des creusets en porcelaine et placs dans une tuve 80C pendant 24 heures jusqu schage total. Des chantillons de 0,5 g du rsidu obtenu sont mis dans des bombes digestion en Tflon contenant chacune 4 ml dacide nitrique (65%), puis laisss pendant une nuit une temprature ambiante pour quils subissent une prdigestion. Ensuite, ils sont mis dans un bain de sable forte temprature (120C) pendant 4 heures pour subir la digestion proprement dite qui permet de dtruire toute la matire organique. Aprs refroidissement, les chantillons sont renverss dans des flacons en polythylne et complts jusqu 50 ml par de leau bidistille. II. 2. 3. 2. Dosage des mtaux lourds Les mtaux lourds choisis dans cette tude sont le cadmium (Cd), le chrome (Cr), le cuivre (Cu), le fer (Fe) et le zinc (Zn). Le dosage de ces mtaux est effectu par spectrophotomtrie dabsorption atomique (S.A.A) de type Varian A-A 20 muni dun four graphique. II. 3. Etude microbiologique des margines Les analyses microbiologiques des margines ont port dans un premier temps sur le dnombrement de la flore msophile arobie totale (FMAT), des coliformes totaux (CT), coliformes fcaux (CF), des streptocoques fcaux (SF), des levures et des champignons. Dans un second temps, lisolement, la purification et lidentification de ces micro-organismes ont t raliss. II. 3. 1. Dnombrement Lanalyse microbiologique des chantillons a t ralise ds rception au laboratoire, afin dviter toute modification ventuelle de la concentration microbienne initiale. Aprs homognisation des margines, une srie de dilutions dans de l'eau physiologique strile est ralise (NaCl 0,9%). Un volume de 0,1 ml de la dilution approprie est tal sur des botes de Ptri contenant le milieu glos convenable raison de trois botes par dilution.

61

Physico-chimie et microbiologie des margines

Flore msophile arobie totale (FMAT) : Le milieu de culture utilis est la glose nutritive pH 7, l'incubation des botes tales est effectue 37C pendant 24 heures. Coliformes totaux et fcaux : Cest le milieu glose lactos au tergitol et au TTC (Chlorure de Triphnyl Tetrazolium) qui est utilis. Les botes tales sont incubes 44C pour les CF et 37C pour les CT pendant 24 heures. Streptocoques fcaux (SF) : Le milieu de culture utilis est Slanetz et Bartely additionn du TTC. Lincubation des botes est effectue 37C pendant 24 48 heures. Champignons : Le milieu de culture YM est utilis, l'incubation des botes ensemences est effectue 30C pendant 3 7 jours. Levures : Le milieu de culture utilis est YPG, auquel est ajout le chloramphnicol (25 g.ml-1) et lampicilline (50 g.ml-1) comme antibiotiques afin dinhiber toute croissance bactrienne. Lincubation est ralise 30C pendant 48 72 heures. II. 3. 2. Purification Les souches de bactries et de champignons sont isoles sur les mmes milieux utiliss pour leur dnombrement. Alors que pour les souches de levures, lisolement est effectu sur milieu glos additionn aux margines dilues dans de leau de robinet (v/v) (25%, 50%, 75% et 100%). Une fois isoles, les souches sont purifies par repiquages successifs sur le milieu d'isolement convenable. Ensuite, les souches de champignons sont stockes sur glose incline (2% de lextrait de malt et 2% dagar) 4C. Celles des bactries et des levures sont conserves dans du glycrol (40% pour les levures et 20% pour les bactries) - 20C.

62

Physico-chimie et microbiologie des margines

II. 3. 3. Identification - Les bactries : Les colonies de bactries isoles et purifies sont ensemences sur des milieux de culture slectifs (King A, King B, Endo, Chapman, Slanetz et bartely). Ensuite, lidentification est effectue par le systme des plaques API 20 NE (Biomrieux, SA, France). Elle est base sur lassimilation de 12 sources de carbone et lutilisation de 8 tests biochimiques par des bactries Gram-ngatif et non entriques. Le profil de lidentit de la souches obtenue est compar avec celui des donnes du catalogue analytique API 20 NE. - Les champignons : Lidentification des champignons isols est effectue par ltude de leurs critres morphologiques tels que la forme du myclium, du sporange et celle des spores (Robert et al., 1981). Les champignons sont ensemencs sur le milieu Czapek-agar et sur lextrait de malt-agar 2%, et incubs 25C pendant une semaine. La croissance sur lextrait de malt permet dtudier la forme du myclium et du sporange sous microscope, alors que sur milieu Czapek les caractristiques morphologiques des spores sont values. - Les levures : L'identification est base sur l'analyse des caractres morphologiques et sexuels, et sur l'tude de certains critres physiologiques. Cette dtermination systmatique est ralise conformment aux cls Kreger-Van Rij (1987) et Barnett et al. (1990). Pour sassurer de la position taxonomique de ces souches, nous avons fait appel une autre mthode didentification molculaire. Elle se base sur lamplification cyclique par PCR (Polymerase Chain Reaction) de lADN ribosomal 28S avec les amorces spcifiques des rgions conserves. Les produits PCR des souches testes sont visualiss par le bromure dthidium aprs lectrophorse en gel dagarose, puis ils sont squencs par un squenceur automatique. Les squences obtenues sont compares la banque de donnes pour dduire la position taxonomique (White et al., 1990 ; Fell, 1993). Lidentification de ces souches a t ralise dans notre Laboratoire de Microbiologie de lEnvironnement la Facult des Sciences Dhar El Mehraz en collaboration avec lquipe F. BARRAS, Laboratoire de Chimie Bactrienne de lInstitut de Biologie Structurale et Microbiologie CNRS - Marseille, France.

63

Physico-chimie et microbiologie des margines

III. RESULTATS ET DISCUSSION III. 1. Caractrisation physico-chimique Les margines prsentent un rejet fortement pollu sous forme de liquide rsiduel dont la composition est variable. Cette variabilit dpend du type dolives, du degr de leur maturation, des systmes de culture, de la pratique de salage pour la conservation des olives, des conditions climatiques et du procd utilis pour lextraction dhuile dolive (De Felice et al., 1997). Les margines se caractrisent aussi par une odeur nausabonde qui saccentue au fur et mesure de leur stockage. Au cours de notre tude effectue durant la priode olicole (Novembre 2000 - Mars 2001), les rsultats obtenus des analyses de diffrents chantillons des margines na montr presque aucun changement pour tous les paramtres tudis. Les tableaux (22, 23 et 24) reprsentent les moyennes des valeurs obtenues des chantillons prlevs chaque mois durant toute la priode olicole (5 mois). III. 1. 1. Caractrisation organique III. 1. 1. 1. Acidit (pH) La mesure du pH effectue en plusieurs manipulations donne une valeur de lordre de 4,5. Les margines sont donc des effluents acides, en raison de la prsence des acides organiques (acides phnoliques, acides gras). La valeur enregistre dans notre tude se trouve dans la limite infrieure de la fourchette cite dans la littrature (4,5 6). Cette variation dpend des facteurs mentionns ci-dessus. En plus, lacidit des margines augmente avec la dure de leur stockage dans la station dvaporation naturelle. Ceci peut tre expliqu par des ractions dauto-oxydation et de polymrisation qui transforment les alcools phnoliques en acides phnoliques (Hamdi, 1991a). Ces ractions se manifestent par un changement de la coloration initiale des margines vers un noir trs sombre (Assas et al., 2002). En effet, nos margines sont caractrises par une coloration trs fonce. III. 1. 1. 2. Matires en suspension (MES) Les margines sont trs riches en matires en suspension, leur teneur est de lordre de 18 g.l-1. Cette valeur est similaire celles rapportes par dautres auteurs dans les margines industrielles (Balice et al., 1997 ; Al-Malah et al., 2000 ; Assas et al., 2002). Bien que dans les bassins, les MES des margines baissent sous leffet de la dcantation, la valeur moyenne

64

Physico-chimie et microbiologie des margines

enregistre au cours de notre tude est leve. Ceci est probablement d leffet du vent et/ou de lagitation provoque au moment du dchargement des margines. III. 1. 1. 3. Matire sche (MS) et matire volatile (MV) Les teneurs moyennes des margines en matire sche et en matire volatile sont de lordre de 98 g.l-1 et de 86 g.l-1 respectivement. La MV reprsente 90% de la MS, ce qui montre la nature organique des margines. Ce pourcentage est proche de celui observ par plusieurs auteurs (Hamdi, 1991a ; Garcia Garcia et al., 2000 ; Assas et al., 2002 ; Fountoulakis et al., 2002 ; Fadil et al., 2003). III. 1. 1. 4. Demande chimique en oxygne (DCO) La teneur moyenne en matires organiques exprime en DCO est de lordre de 154 g d'O2.l-1. Ceci montre la forte demande en oxygne pour loxydation complte de la matire organique contenue dans cet effluent. Cette teneur en DCO est trs leve par rapport celle enregistre dans dautres types de rejets. En effet, la DCO ne dpasse pas 4,02 g d'O2.l-1 dans les effluents dabattoir qui sont considrs comme les principaux rejets caractre organique dominant (Aissam et al., 2001). Toutefois, notre valeur reste comparable celles obtenues par plusieurs auteurs dans des margines issues du systme de centrifugation (Martinez et al., 1992 ; Annaki et al., 1999a ; Ergder et al., 2000 ; Tsioulpas et al., 2002). III. 1. 1. 5. Composs phnoliques Ces rejets sont aussi caractriss par la prdominance de substances toxiques notamment les composs phnoliques (9.7 g.l-1) qui leur confrent un pouvoir anti-microbien (Ranalli, 1991a, Capasso et al., 1995 ; Capasso, 1997). Cette concentration leve pourrait limiter toute biodgradation naturelle, et par consquent pourrait entraner une perturbation plus ou moins profonde de tout l'cosystme. Nanmoins, elle est proche de celle cite dans la bibliographie (Borja et al., 1992 ; Kissi et al., 2001 ; Fountoulakis et al., 2002). III. 1. 1. 6. Sucres totaux La prsence de faible concentration en sucres (0,28 g.l-1), montre que les microorganismes dans les margines utilisent pour leur mtabolisme les produits de dgradation des composs phnoliques, plutt que celle des sources glucidiques. Donc, ces micro-organismes empruntent des voies mtaboliques secondaires pour produire le pouvoir rducteur (NADH et

65

Physico-chimie et microbiologie des margines

NADPH) et lnergie (ATP) qui assure leur maintenance cellulaire sous les conditions drastiques de cette station. Sous microscope, les levures isoles directement des margines sont rarement observes en plein bourgeonnement. Ce qui nous laisse dduire quil ny a pas une croissance de la plupart des micro-organismes dans les margines mais seulement une survie. Cette concentration des sucres obtenue dans notre tude reste bien infrieure celles reportes par dautres auteurs (Sayadi et Ellouz, 1993 ; Martin et al., 1994 ; Kahraman et Yesilada, 1999). Ceci pourrait tre expliqu par le stockage des margines dans les bassins, puisque la prsence des sucres indique ltat de fracheur des margines. Pendant leur stockage, les sucres sont ferments en acides organiques (Hamdi, 1992). III. 1. 1. 7. Matire grasse La quantit en matires grasses rsiduelles prsente dans les margines, dpend du systme dextraction dhuile dolive. Le processus de centrifugation permet dobtenir des taux faibles par rapport au processus traditionnel (Zimbalatti, 1995). Les margines tudies dans notre cas prsentent un aspect visqueux li la prsence de la fraction huileuse qui reprsente 1% (v/v). Elle forme une couche lipidique la surface des margines au niveau des bassins, ce qui pourrait limiter lvaporation naturelle. Tableau 22 : Composition organique des margines collectes partir de la station d'vaporation naturelle de Fs. Paramtre PH Matires en suspension (MES) (g.l-1) Matire sche (g.l-1) Matire volatile (g.l-1) Demande chimique en oxygne (DCO) (g d'O2.l-1) Composs phnoliques (g.l-1) Sucres totaux (g.l-1) Matire grasse (%) Valeur moyenne 4,5 18 98 86 154 9,7 0,28 1

III. 1. 2. Caractrisation minralogique En ce qui concerne la composition minrale, tous les ions minraux sont dtects (Tableau 23).

66

Physico-chimie et microbiologie des margines

III. 1. 2. 1. Conductivit Les margines tudies ont une conductivit lectrique trop leve de lordre de 36 mS.cm-1. Cette valeur reflte la teneur leve en sels prsents dans ces effluents. En effet, en plus de la richesse naturelle en sels minraux, les olives sont conserves au niveau des usines dans le sel commercial, ce qui confre aux margines une forte conductivit lectrique. III. 1. 2. 2. Calcium, magnsium, potassium et sodium Les margines sont riches en Ca++, Mg++, K+ et Na+ qui sont de lordre 2 g.l-1 ; 1,3 g.l-1 ; 4,37 g.l-1 et 2,78 g.l-1 respectivement. Le K+ reprsente le mtal cationique le plus prdominant, ce rsultat est similaire ceux cits dans la littrature (Arienzo et Capasso, 2000 ; Capasso et al., 2002a, 2002b). Cette teneur en K+ est proche de celle trouve par Arienzo et Capasso (2000) qui est de lordre de 3,68 g.l-1. La teneur moyenne des margines en Na+ (2,78 g.l-1) est plus leve que celles enregistres dans la littrature. En effet, elles ne dpassent pas 0,7 g.l-1 (Sayadi et Ellouz, 1993 ; Cabrera et al., 1996 ; Arienzo et Capasso, 2000). Toutefois, la concentration obtenue dans notre tude reste infrieure celle observe dans les margines de petites masras o la conservation des olives dans le sel simpose par dfaut de capacit des usines. Cest cette richesse en lments minraux qui a pouss beaucoup de chercheurs dorienter le traitement des margines vers leur valorisation en composte ou en fertilisant des terres agricoles (Tomati et Galli, 1992 ; Galli et al., 1994 ; Papadimitriou et al., 1997 ; Piperidou et al., 2000 ; Capasso et al., 2002b). III. 1. 2. 3. Chlorures La concentration moyenne des chlorures dans les margines est leve (5 g.l-1). Elle est due lajout du sel en quantit importante pour la conservation des olives. Cet lment a un effet nfaste sur les cultures. En effet, il a un pouvoir bio-oxydant sur la plupart des micro-organismes, lorsque sa concentration dpasse 10 g.l-1.

67

Physico-chimie et microbiologie des margines

III. 1. 2. 4. Orthophosphates et azote total Les margines prsentent galement des teneurs leves en orthophosphates (0,12 g.l-1) et en azote total (0,14 g.l-1). Toutefois, les concentrations en phosphate et en azote restent plus faibles par rapport celle du carbone (DCO). Ceci pourrait tre lune des causes qui entrave lpuration des margines par voies biologiques. Dans ce sens, Bechac et al. (1984) recommandent un rapport DCO/N/P denviron 100/5/1 pour assurer un dveloppement optimum des micro-organismes arobies. Tandis que, Ranalli (1992) recommande un rapport DCO/N/P de lordre de 100/16/1. Ce qui ncessite une correction de la teneur en azote et en phosphore lors dun ventuel traitement biologique des margines. III. 1. 2. 5. Ions ammoniums Pour valuer le degr dauto-puration, des chantillons de margines sont incubs temprature ambiante pendant un mois. Des prlvements tous les trois jours sont effectus pour le dosage des ammoniums. Les rsultats ont montr que leur concentration est assez faible (0,01 g.l-1) et surtout trs stable durant toutes les mesures effectues dans les mmes chantillons de diffrentes margines. Ce rsultat suggre que la biodgradation de ces effluents est trs limite. Tableau 23 : Composition minrale des margines tudies. Paramtre Conductivit (mS.cm-1) Calcium (g.l-1) Magnsium (g.l-1) Potassium (g.l-1) Sodium (g.l-1) Chlorures (g.l-1) Orthophosphates (g.l-1) Azote total (g.l-1) Ammoniums (g.l-1) III. 1. 3. Caractrisation mtallique Les rsultats du dosage des mtaux lourds dans les margines sont prsents dans le tableau 24. Lanalyse de ces rsultats montre que les margines contiennent des teneurs non ngligeables en mtaux surtout en fer (7300 g.l-1). Le Zn, le Cu et le Fe ayant comme origine, entre autres, le fruit lui-mme. En effet, ces mtaux sont des oligo-lments essentiels Valeur moyenne 36 2 1,3 4,37 2,78 5 0,12 0,14 0,01

68

Physico-chimie et microbiologie des margines

qui entrent dans la constitution minralogique des olives. Par contre, le Cr et le Cd ont une origine exogne. Ils proviennent probablement de leau dirrigation, des engrais phosphats et de certains produits phytosanitaires de traitement des olives. Donc la composition mtallique des margines dpend de la qualit des olives tritures surtout pour le Zn, Cu et le Fe. Les rsultats de cette caractrisation mtallique sont comparables ceux obtenus par Zenjari (2000). Tableau 24 : Composition mtallique des margines collectes partir de la station d'vaporation naturelle de Fs. Paramtre (g.l-1) Cadmium Chrome Cuivre Fer Zinc Valeur moyenne 4 30 23 7300 180

III. 2. Caractrisation microbiologique Jusqu prsent, peu de travaux ont t raliss sur la caractrisation microbiologique des margines. Ceci est probablement d lintrt accord aux matires organiques des margines, sans se soucier de leur contenu microbien. Cest pour cela que nous avons jug utile de faire une tude microbiologique des margines de la station dvaporation naturelle de la ville de Fs, dans le but de mettre en vidence les micro-organismes qui se dveloppent ou survivent sur ces effluents. III. 2. 1. Dnombrement des micro-organismes Les rsultats du dnombrement des germes prsents dans le tableau 26 montrent que les levures et les champignons reprsentent la flore majoritaire des margines de cette station. Ils sont denviron 7,6 103 UFC.ml-1 et 4 102 UFC.ml-1 respectivement. Ce rsultat est comparable ceux obtenus par plusieurs auteurs qui ont montr que les champignons et les levures sont capables de se dvelopper plus que les bactries dans les margines (Mouncif et al., 1993a ; Millan et al., 2000). En effet, ils semblent tre les mieux adapts lacidit et la salinit leves des margines, et ils rsistent plus que les bactries la toxicit des substances phnoliques. La charge microbienne totale est value par le dnombrement de la flore msophile arobie totale (FMAT). Elle est relativement faible (8,4 103 UFC.ml-1) par rapport celle
69

Physico-chimie et microbiologie des margines

enregistre dans les effluents dabattoir (1,23 106 UFC.ml-1) (Aissam et al., 2001). Ceci peut tre li aussi aux caractristiques physico-chimiques des margines qui gnent la croissance des micro-organismes notamment la prsence des substances antimicrobiennes (composs phnoliques, tanins, acides gras). Pour vrifier sil y a une ventuelle contamination par les germes fcaux, nous avons procd la recherche des coliformes totaux (CT), des coliformes fcaux (CF) et des streptocoques fcaux (SF). Les rsultats ont montr labsence totale de ces germes dans les margines. Des rsultats similaires ont t obtenus pour les margines de Taza et Marrakech (Mouncif et al., 1993a). Une tude microbiologique est effectue sur des olives crues a montr la prsence dune flore trs diversifie (Asehraou, 1993). Les coliformes fcaux sont prsents et leur concentration peut atteindre 2,8 104 UFC.g-1 dolive. Cette flore pourrait provenir en grande partie du sol, des insectes volants tels que les coloptres et les lymnoptres (Mundt, 1970) ou des mains des ouvriers lors de la rcolte. Par consquent, labsence totale de ces germes dans les margines ne pourrait tre explique que par une inhibition de leur croissance par les composs phnoliques (polyphnols, tannins, acides gras) (Ranalli, 1991a). Tableau 25 : Caractrisation microbiologique des margines de la station dvaporation naturelle. Flore microbienne FMAT Champignons Levures Coliformes totaux Coliformes fcaux Streptocoques fcaux III. 2. 2. Identification des micro-organismes III. 2. 2. 1. Bactries Toutes les souches slectionnes sont des bactries gram ngatif et capables de crotre sur milieux King A et B. Les rsultats de lidentification des souches tudies, par la galerie API 20 NE montrent quelles appartiennent toutes une seule espce du genre Pseudomonas sp. Ce sont les seules bactries capables de rsister la toxicit des composs phnoliques. Selon la bibliographie, les bactries de ce genre disposent dun mtabolisme spcial qui leur permet de rsister aux composs phnoliques. En effet, elles possdent des UFC.ml-1 8,4 103 4,0 102 7,6 103 0 0 0

70

Physico-chimie et microbiologie des margines

plasmides cataboliques (plasmide Tol) qui facilitent lassimilation des hydrocarbures aromatiques (Benlemlih et al., 1991). Garcia-Ribera et al. (2001) ont transform la souche Pseudomonas putida par le plasmide pSK2665 contenant 3 gnes codant pour lenzyme PHA synthase. Cette enzyme catalyse lanabolisme du PHA (Polyhydroxylkanoate) partir des composs phnoliques qui est utilis comme prcurseur dans la synthse du plastique. Cette souche hbergeant le plasmide devient capable de crotre sur les margines haute concentration avec le stockage des granules du PHA. III. 2. 2. 2. Champignons Deux espces ont t identifies dans notre tude : - Espce 1 : Aspergillus niger Elle est caractrise par un myclium cloisonn, avec conidiophore tte globulaire. Sur milieu Czapek-agar 25C, la croissance du champignon est lente. Les colonies peuvent atteindre un diamtre de 4 5 cm aprs une semaine dincubation. Elles sont constitues par un myclium rompant la surface de la glose avec des conidiophores noires. Parfois, nous observons un myclium intramatriciel sur des cultures ges. Les ttes conidiennes prennent une position radiale tendant se morceler en colonnes avec lge. Sous microscope, les conidiophores sont lisses et ont gnralement une coloration brune. Les conidies ont une forme globuleuse dun diamtre de 3,5 5 m, elles prsentent des ornementations rugueuses en forme dpine. Sur lextrait de malt-agar, les colonies sont minces, mais la sporulation est trs dense. La partie apicale du conidiophore ronfle permet de situer cette espce dans le genre Aspergillus. La forme des spores donne la souche le nom dAspergillus niger. - Espce 2 : Penicillium sp. Elle est caractrise par un myclium lche, arien, cloisonn et sporange vert. Les phialides sont courts, les conidiophores sont en pinceau et les colonies sont gnralement bleu-verdtres. Sur milieu Czapek, les colonies prsentent une croissance faible, elles natteignent que 1 1,5 cm de diamtre aprs une semaine dincubation. Les conidiophores sont denses et ressemblent une peau bleu-verdtre. Sous microscope, les conidies sont globuleuses ou

71

Physico-chimie et microbiologie des margines

subglobuleuses et se prsentent sous forme dune chane sur le myclium. Ces conidies sont produites partir dune cellule spciale (conidiogne) appele phialide en forme de bouteille. Sur lextrait de malt, les colonies prsentent une croissance plus rapide et moins dense. Toutes ces caractristiques sont conformes celles du genre Penicillium sp. Ce rsultat est conforme celui obtenu par Mouncif et al. (1993a) sur des margines Marocaines de Taza et Marrakech. Les espces appartenant ces deux genres semblent tre les champignons les plus adapts survivre dans cet effluent haute toxicit. Le nombre de champignons isol dans notre chantillon marocain reste infrieur celui trouv en Espagne par Millan et al. (2000). Celui-ci a trouv 12 souches de champignons appartenant aux genres : Acremonium, Alternaria, Aspergillus, Chalara, Fusarium, Lecytophora, Paecilomyces, Penicillium, Phoma, Phycomyces, Rhinocladiella et Scopulariopsis. Cette diffrence peut tre explique par la toxicit spcifique de nos margines marocaines issues des units industrielles qui utilisent des technologies classiques dans la trituration des olives (Annaki et al., 1999b). III. 2. 2. 3. Levures Dans le but de cribler des souches de levures performantes capables de crotre sur ce type de rejet; nous avons isol et purifi sur milieu YPG, 71 colonies de levures appartenant 40 espces diffrentes avec la prdominance du genre Candida (Aissam et al., 2002). Les 71 colonies sont testes pour leur capacit de se dvelopper sur des margines dilues (25, 50, 75 et 100%). Les colonies qui ont pouss sur milieu de culture solide base des margines 25% sont tales sur un autre base des margines 50%. Cette prslection nous a permis disoler 48 types de colonies. Cependant, seulement 12 colonies ont pu survivre sur le milieu glos contenant les margines brutes (100%). Ces 12 souches ont t identifies par une mthode classique (Kreger-van Rij, 1987 ; Barnett et al., 1990) et les rsultats ont rvl quelles appartiennent 8 espces de levures (tableau 26). Les rsultats de lidentification par approche molculaire (squences des 28S) sont comparables ceux obtenus par la technique classique.

72

Physico-chimie et microbiologie des margines

Tableau 26 : Liste des souches de levures identifies partir des margines. Espce identifie Candida boidinii Candida diddensiae Candida wickerhamii Geotrichum terrestre Pichia kluyveri Pichia membranaefaciens Saccharomyces cerevisiae Zygosaccharomyces fermentati Nombre de souches 3 2 1 1 1 2 1 1

Ces 8 souches de levures peuvent tre considres comme les souches les plus adaptes la toxicit de ces rejets. Le nombre des souches de levures isoles sur milieu riche (YPG) est suprieur celui des souches qui se sont dveloppes sur milieu base de margine 100%. Ceci peut tre expliqu par le fait que toutes les espces n'existent pas seulement sous forme vgtative dans la station d'vaporation naturelle, mais aussi sous une forme de rsistance telle que les spores. Le milieu base de margine simule d'une manire approximative la composition des margines dans la station d'vaporation naturelle. Ce qui explique le nombre rduit des souches capables de crotre sur ce milieu, mais ceci donne une ide immacule sur la majorit des micro-organismes adapts gntiquement cette niche cologique. Nous pouvons donc dire que les 8 souches de levures qui se sont dveloppes sur ce milieu base de margine, pourraient tre les plus performantes vis vis de la dgradation des composs majeurs des margines de nature phnoliques et lipidiques. Cette dgradation est troitement lie aux capacits mtaboliques typiques de ces souches (Horiguchi et al., 2001b). Sous ces conditions physiologiques, la majorit de ces espces forment des peroxysomes de grande taille qui jouent un rle important dans la dgradation et la mtabolisation des composs phnoliques et lipidiques. Plusieurs enzymes participent au mtabolisme peroxysomal, parmi lesquelles on trouve la catalase. Cette enzyme joue un rle majeur non spcifique dans l'adaptation de ces souches de levures dans les conditions drastiques (Aissam et al., 2002). Elle protge la cellule contre les molcules agressives et les drivs toxiques de l'oxygne formes en grande quantit au moment de la mtabolisation des composs non glucidiques (Wang et al., 1999 ; Horiguchi et al., 2001a). En effet, le mtabolisme des composs phnoliques fait intervenir une premire tape d'oxydation par une oxydase non spcifique. Cette transformation est accompagne par la formation d'eau oxygne qui est rapidement dgrade par une catalase spcifique, dont l'activit est plus leve dans les cellules cultives sur milieu contenant les

73

Physico-chimie et microbiologie des margines

composs phnoliques que sur celui contenant le glucose (Aissam et al., 2002). Cette induction leve de l'activit catalase dmontre leffet de la flexibilit mtabolique sur ladaptation des souches dans les margines de la station dvaporation naturelle. Il est connu dans la littrature que plusieurs peroxysomes sont prsents dans les cellules de levures cultives sur les composs phnoliques. Leur nombre est corrl avec l'augmentation de l'activit catalase dans les cellules. Ces peroxysomes ne contiennent pas seulement la catalase, mais aussi d'autres enzymes. Laction symbiotique de ces enzymes protge les levures contre loxygne activ form en grande quantit au moment de l'assimilation des composs non glucidiques (Horiguchi et al., 2001a).

IV. CONCLUSION

Daprs cette tude microbiologique nous pouvons dire que les margines de la station dvaporation naturelle renferme une charge microbienne assez basse par rapport celle trouve dans dautres effluents. Ltude physico-chimique effectue sur ces margines a montr quelles sont caractrises par une forte pollution organique value en terme de DCO (154 g dO2.l-1). Ceci montre que cet effluent na pas t pur par biodgradation naturelle. Lactivit et la croissance des micro-organismes sont probablement altres par la prsence des composs phnoliques forte concentration (9,7 g.l-1). Par consquent, lautopuration naturelle des margines dans ces bassins serait trs limite. Notre tude a t effectue pendant la priode olicole qui se caractrise par une pluviomtrie leve. Nous pouvons exclure toute concentration des margines lie une vaporation naturelle. En plus, ltude du suivi de lvolution des paramtres physicochimiques des margines de cette station a t ralise durant toute lanne (rsultats non encore publis). Ces rsultats ont montr que ces paramtres restaient trs stables avec quelques variations non significatives. Ceci nous laisse dduire que les margines navaient subi quune faible vaporation. Le bilan hydrique de la station est perturb par les fluctuations thermiques et pluviomtriques. En effet, la prsence dune pellicule tanche forme de lipides rsiduels la surface des margines rendrait lvaporation naturelle limite.

74

Physico-chimie et microbiologie des margines

Lensemble de ce travail montre que le traitement des margines par des bassins dvaporation naturelle est inefficace. Ce traitement ne permet quune partielle vaporation et une faible autopuration naturelle, puisque la plupart des micro-organismes sont ltat de survie et non de croissance dans ces rejets. De ce fait, ces bassins dvaporation ne permettent que dviter le rejet direct des margines dans les gouts et les rivires. Les microorganismes isols de ces margines peuvent tre considrs comme les plus adapts la toxicit de ces rejet. Ils peuvent tre tests pour leur capacit dgrader les composs phnoliques dans le but de les utiliser dans un procd innovant de traitement biologique des margines. Ceci fera lobjectif du 3 me, 4me chapitres.

75

Identification des levures

I. INTRODUCTION Lidentification des souches de levures a t effectue par deux techniques : classique et molculaire. La mthode classique est base sur lanalyse des caractres morphologiques et sexuels, et sur ltude de certains critres dordre physiologique et biochimique. Cette mthode a t ralise conformment la cl de Kreger-Van Rij (1987) et de Barnett et al. (1990). La description standard de Kreger-van Rij des espces donne les caractristiques avec lesquelles elles sont reconnues. Ces caractristiques sont en gnral similaires pour les espces y compris la morphologie, la physiologie, la biochimie et parfois lcologie. Pour les espces sporognes, les caractristiques du cycle sexuel sont aussi inclues. La valeur taxonomique des caractres dcrits dpend de leur capacit diffrencier entre les espces. Les caractristiques qui sont bien corrles avec la nature des espces, sont considres comme les indicateurs utiles et cls pour la caractrisation des espces. Les conditions des tests sont strictement standardises puisquelles pourraient influencer les rsultats didentification. Ceci ne concerne pas seulement les proprits physiologiques et biochimiques, mais aussi les caractristiques morphologiques pouvant varier avec la croissance du myclium. Au cours des annes, les mthodes didentification changent et le nombre de caractres tudier augmente considrablement. Par exemple, le milieu liquide utilis pour les tests dassimilation prenait la place de la mthode oxanographique (Wickerham et Burton, 1948). Wickerham (1951) a tendu le nombre des composs organiques de 5 31 qui contribue bien identifier lespce. Lidentification des souches de levures via cette mthode standard est un travail fastidieux sur le plan pratique, et peut durer plusieurs mois. En plus, les souches peuvent subir des mutations tout au long des gnrations pour assurer une meilleure adaptation aux conditions drastiques des milieux naturels. Ce qui rend leur identification dure et pnible. Pour pallier ce problme dans notre tude, nous avons insist sur le fait que les caractres cits dans la cl didentification soient identiques ceux de chaque souche tudie. Ces problmes techniques sont la cause majeure de la raret des travaux effectus sur lidentification biochimique et physiologique des souches de levures isoles partir des margines. La plupart des chercheurs font recours lidentification molculaire.

76

Identification des levures

Lidentification par techniques molculaires est considre avoir une importance fondamentale. Elle a un grand effet sur la taxonomie, non seulement dans la sparation entre les genres, mais aussi pour les espces. Lidentification par approche molculaire des levures a fait aussi lobjectif de notre travail. Cette tude a t effectue dans le but de sassurer de la position taxonomique de chaque espce. II. MATERIEL ET METHODES II. 1. Identification classique des souches de levures II. 1. 1. Etude des caractres morphologiques II. 1. 1. 1. Etude du mode de reproduction vgtative La reproduction vgtative chez les levures se fait par trois modes : Bourgeonnement, fission ou par cloisonnement du myclium (anse danastomose). Le mode de reproduction par bourgeonnement est largement rpondu chez les levures. La reproduction par fission et par cloisonnement du myclium semble spcifique un nombre restreint de genres de levures. Les souches examiner sont mises en culture en milieu YM et incubes 25C pendant 3 jours. Lobservation microscopique portera sur la forme et la taille des cellules, et sur le mode de reproduction asexue. II. 1. 1. 2. Etude du myclium La croissance des souches sur milieu PDA permet de mettre en vidence la prsence dun pseudomyclium ou dun vrai myclium. Lobservation microscopique est ralise aprs 10 jours dincubation 25C. La forme du myclium est une caractristique importante pour la dtermination systmatique des souches. II. 1. 1. 3. Etude de la sporulation Le mode de reproduction sexue est lun des principaux critres dans la classification systmatique des levures. En effet, il permet de les situer au sein de trois grands groupes de champignons : Levures ascosporognes, rattaches aux ascomyctes dont la reproduction est assure par des ascospores qui sont des endospores.

77

Identification des levures

Levures ballistosporognes, apparentes aux basidiomyctes dont la reproduction est assure par des basidiospores qui sont des exospores. Levures imparfaits, rattaches aux deuteromyctes dont aucun mode de reproduction sexue nest dfini. Ce groupe a les deux affinits ascomyctes et basidiomyctes. La forme des spores est value par la culture des souches sur des milieux spcifiques (milieu Mac Calary, milieu dAdams). Lincubation se fait 25C pendant un mois. Les trois formes de sporulation sont mises en vidence laide des observations microscopiques aprs coloration des spores avec le vert de malachite. II. 1. 2. Etude des caractres physiologiques II. 1. 2. 1. Fermentation des sucres Les souches ont t testes pour leur capacit fermenter le glucose, galactose, saccharose, maltose, lactose et le trhalose selon la mthode de Durham. Le milieu comporte 0,45% dextrait de levures, 0,75% de peptone et 2% de sucre appropri. Aprs ensemencement, les tubes sont incubs 25C et examins quotidiennement pendant un mois. La mesure de la partie vide dans la cloche de Durham donne une estimation du volume du gaz form par fermentation. II. 1. 2. 2. Assimilation des sources de carbone Il sagit de lun des principaux tests physiologiques utiliss pour la dtermination taxonomique des levures. Le milieu de base (Yeast Nitrogen Base : YNB) est celui dfini par Wikerham (1951), auquel est ajout la source carbone sous forme de sucres en C6, C12, C18, mthyle de pentose, des polymres dalcool, dacides organiques et des polysaccharides une concentration de 0,5%. Dans notre tude nous avons utilis 26 sources de carbone. Lassimilation dun compos organique se traduit par une croissance de la souche dans le milieu aprs 3 7 jours 28C. Comme tmoins, nous avons utilis le milieu minimum contenant le glucose (tmoin positif), et le mme milieu exempt de source de carbone (tmoin ngatif). Les tubes sont examins aussi pour la prsence de pellicule la surface des milieux, et la possibilit de scrtion de quantits visibles en riboflavines qui sont produits par certaines souches.

78

Identification des levures

II. 1. 2. 3. Assimilation des nitrates Lassimilation des nitrates comme seule source dazote reprsente un critre taxonomique trs important. Il reprsente un caractre dordre gnrique. Nous avons utilis le milieu YNB-glucose (Yeast Nitrogen Base) additionn au nitrate de potassium comme seule source dazote. Lincubation est ralise 28C pendant 3 7 jours. II. 1. 2. 4. Croissance sur milieu sans vitamine Les levures varient quant leurs exigences en vitamine. Alors que certaines espces semblent autotrophes, dautres sont auxotrophes vis--vis de plusieurs facteurs de croissance. Ce test estime la capacit des levures crotre sur un milieu dpourvu de vitamines. Le milieu complet standard YNB-glucose sur lequel poussent les espces auxotrophes ou htrotrophes, comprend neuf vitamines : la biotine, le pantothnate de calcium, lacide folique, linositol, la nicotinamide, lacide para-amino-benzoque, le chlorhydrate de pyridoxine, la flavine et la thiamine. Ces dernires sont absentes dans le milieu sans vitamine. Au cours de la ralisation de ce test, nous avons effectu des purges successives dans des tubes du cultures partir dun ensemencement trs faible afin dliminer les erreurs dues lapport de vitamines endognes. Lincubation est ralise 25C pendant 7 jours. II. 1. 2. 5. Croissance 37C et 42C Les levures sont testes pour leur capacit crotre des tempratures de 37C et de 42C. Les souches de levures sont inocules dans le milieu de culture YNB-glucose et les tubes sont ensuite incubs 37C ou 42C pendant 7 jours. II. 1. 2. 6. Test de lurease Le milieu christensen permet la mise en vidence de lactivit urease chez les levures tudies. Cette enzyme transforme lure en ammoniac, ce qui provoque laugmentation de pH qui vire lindicateur color. Une raction positive se traduit par lapparition dune coloration rose violette vive dans le milieu de culture aprs 3 7 jours dincubation 25C. II. 1. 2. 7. Rsistance au cycloheximide Au milieu synthtique complet YNBglucose est ajout 0,1 et 1 mg.l-1 de cycloheximide (Fluka). Ce test est utilis pour mettre en vidence la rsistance des souches de

79

Identification des levures

levures cet inhibiteur qui bloque la traduction chez les cellules eucaryotes. Lincubation des boites se fait 25C pendant 3 semaines. II. 2. Identification molculaire des souches de levures II. 2. 1. PCR Les levures isoles sont identifies aprs amplification et squenage des ADNr 28S. Lamplification par PCR (Polymerase chain reaction) est ralise en utilisant les primers V3-1 et V3-2. Ensuite le squenage du domaine variable V3 de lADNr (28S) de la grande sousunit des ribosomes est effectu. Au dbut, seulement la rgion variable V3 est squence. Cependant, quand cette squence est insuffisante pour tablir lidentification, les rgions ITS sont aussi squences. Pour raliser la PCR, un aliquote de 500 l dune culture de nuit est centrifug, le culot est repris dans 50 l deau bidistille strile. La suspension est congele 20C pendant 10 minutes, puis chauffe 94C pendant 5 minutes. Ceci est ralis 2 fois pour faire clater les cellules. Aprs centrifugation, 2 l du surnageant contenant lADN sont utiliss pour la raction PCR. II. 2. 2. Conditions de la PCR La rgion variable V3 5 terminale de lADNr 28S est amplifie avec les amorces fongiques universelles (Fell, 1993) : V3-1 (5GCATATCAATAAGCGGAGGAAAAG3) V3-2 (5GGTCCGTGTTTCAAGACGG3) Les concentrations des ractifs sont de lordre de 0,2 M pour les amorces V3-1 et V3-2 ; 2,5 mM de MgCl2, 200 M pour chacun des quatre dsoxynuclosides triphosphates (dNTP) et 1,25 U de Taq ADN polymrase (PROMEGA) pour 50 l du mlange ractionnel. Lamplification est performe par 30 cycles dont chacun est compos dune tape de dnaturation 94C pendant 1 min, une tape dhybridation 60C pendant 1 min et une tape dlongation 72C pendant 1 min. Les rgions ITS sont amplifies en utilisant les amorces fongiques universelles (White et al., 1990) :

80

Identification des levures

ITS-1 (5 TCCGTAGGTGAACCTGCGG3) ITS-4 (5 TCCTCCGCTTATTGATATGC3) Les concentration des ractifs du PCR sont identiques celles utilises pour V3-1 et V3-2, avec lexception de 0,25 M pour les amorces ITS-1 et ITS-4 et 1,5 mM pour MgCl2. Lamplification est performe par 35 cycles avec dnaturation 94C pendant 1 min., hybridation 56C pendant 1 min. et longation 72C pendant 1 min. Les produits amplifis sont purifis en utilisant un kit de purification des produits PCR QIAquick (Qiagen). II. 2. 3. Visualisation des produits de PCR par lectrophorse Les produits de PCR amplifis sont visualiss par lectrophorse sur gel dagarose en utilisant un systme de gel horizontal. Lagarose (Gibco BRL Life Technologies) est utilis une concentration de 0,8% (p/v). Llectrophorse est ralise dans le tampon TBE (5,4 g de tris base, 2,75 g dacide borique et 2 ml de 0,5 M EDTA [pH 8,0] dans 1 litre deau distille) 10 v/cm. Le marqueur de taille utilis est le 1kb+ ADN ladder (Gibco BRL). LADN est visualis par le bromure dthidium et photographi sous la lampe UV en utilisant un Transilluminateur GelDoc2000 (Bio-Rad). II. 2. 4. Squenage des ADN amplifis Les deux brins des produits amplifis par PCR sont squencs par la bote Genome express (France) en utilisant les primers de la PCR.

III. RESULTATS ET DISCUSSION III. 1. Identification classique III. 1. 1. Identification du genre Pour situer les souches de levures sur le plan taxonomique au niveau du genre, nous avons fait appel trois tests critiques : la morphologie de lappareil vgtal (myclium ou pseudomyclium), le mode de reproduction (lorgane de fructification ascospores, basidiospores) et un test physiologique bas sur lassimilation des nitrates. La formation de pellicules peut tre aussi un critre gnrique important.

81

Identification des levures

* Pichia : (souches 1, 4 et 6) La reproduction vgtative seffectue p..ar bourgeonnement multilatral au niveau de la base troite des cellules. Quelques espces de ce genre peuvent former des arthrospores. Les cellules sont gnralement sphriques, ellipsodales, ou allonges et parfois effiles. Ce genre peut prsenter un pseudomyclium ou un vrai myclium abondant. Les asques sont gnralement dhiscents et rarement persistants, ils produisent 1 4 ascospores sous forme de chapeau, hmisphrique, saturne ou sphrique avec une surface lisse. Les asques ne se conjuguent pas habituellement, mais si la conjugaison doit avoir lieu elle seffectuera entre le bourgeonnement et la cellule parentale ou entre les cellules singulires. Le septum du myclium ne contient pas de dolipores. Les ascospores ne sont pas formes uniquement et exclusivement sur le myclium. On note toujours la prsence de la forme bourgeonnante mme sil y a prsence dun vrai myclium. Les espces du genre Pichia sont homothalliques ou htrothalliques. Les sucres peuvent tre ou non ferments et les nitrates ne sont pas assimils. * Zygosaccharomyces : (souche 8) La reproduction vgtative se fait par bourgeonnement multilatral. Les cellules vgtatives ont une forme globulaire, ellipsodale ou cylindrique. Le pseudomyclium peut tre form avec absence du septum. La phase vgtative prdominante est la phase haplode. La conjugaison se fait habituellement entre les cellules singulires, et parfois entre la cellule mre et son bourgeonnement. Cette conjugaison se fait juste avant la formation des asques persistants. Les ascospores ont plusieurs formes, ils sont globulaires ellipsodales avec 1 4 par asque. Ce genre est caractris aussi par une fermentation trs importante et la non assimilation des nitrates. On note aussi une formation tardive de pellicules. * Saccharomyces : (souche 9) La reproduction vgtative se fait par bourgeonnement multilatral. Les cellules ont une forme globulaire, ellipsodale ou cylindrique. Le pseudomyclium peut tre form avec absence du septum. La phase vgtative prdominante est la phase diplode (rarement polyplodes), et les ascospores diplodes peuvent tre forms. La conjugaison aura lieu aprs la germination des ascospores qui sont de petite taille globulaire ou ellipsodale avec une paroi lisse. Les asques sont persistants contenant gnralement 1 4 spores mais rarement plus. Les espces de Saccharomyces fermentent vigoureusement les sucres et nassimilent pas les nitrates.

82

Identification des levures

* Candida : (souches 2, 3, 5, 7, 10 et 12) Le genre Candida est trs htrogne (morphologie, reproduction lchelle du genre et de lespce). Cest pour cela que le manuel didentification Kreger-van Rij (1987) a donn une cl spcifique pour classer les espces appartenant ce genre. Le genre Candida est caractris par une reproduction par bourgeonnement multilatral. La forme vgtative est globulaire, ovode, cylindrique, allonge, et rarement triangulaire. Le pseudomyclium peut tre absent, rudimentaire ou bien dvelopp, mais le vrai myclium nest prsent que chez quelques espces. Les ascospores, les teliospores, les ballistospores, les basidiospores, les blastospores (sous forme daiguille) et les arthrospores sont absents, alors que les chlamydospores peuvent tre prsents. Les polysaccharides extracellulaires peuvent tre forms et peuvent donner une coloration verte violette sous raction avec liodine. Lassimilation de linositol est variable selon les espces, les souches qui lassimilent forment un pseudomyclium. La fermentation des sucres peut tre positive ou ngative. Puisque un nombre trs lev despces sont inclus dans ce genre candida, celui-ci est subdivis en 10 groupes en se basant sur des proprits physiologiques. Le premier groupe inclut seulement les basidiomyctes anamorphes. En gnral, les basidiomyctes donnent une coloration rouge fonc en prsence du ractif : Diazonium Blue B (DBB). Les espces du groupe 1 sont donc DBB (+). Aprs vrification dans la cl de ce groupe, aucune de nos souches ny appartient. Donc, elles sont DBB (-). La classification des autres groupes qui sont DBB (-), a t base sur lutilisation des tests physiologiques suivants : Inositol, nitrates, erythritol, raffinose, maltose, mannitol et galactose. Nos souches appartiennent aux groupes 3 et 5. Groupe 3 : DBB (-), inositol (-), nitrate (+). Groupe 5 : DBB (-), inositol (-), nitrate (-), erythritol (+), raffinose (+).

* Trichosporon : (souche 11) La reproduction vgtative seffectue par formation dun vrai myclium, par arthrospores et par bourgeonnement multilatral. Les cellules bourgeonnantes prsentent plusieurs formes, le pseudomyclium peut tre rduit ou bien dvelopp. Le myclium cloisonn et les arthtospores sont toujours prsents et gnralement trs abondants. Il ny a production ni dascospores, ni de basidiospores, ni de ballistospores et ni de teliospores. Par contre, les endospores asexuelles peuvent tre formes. La fermentation peut tre positive ou

83

Identification des levures

ngative, et la pellicule est gnralement forme sur milieu liquide. Chez les espces de ce genre, il ny a pas formation dagglomration cellulaire. Le genre Trichosporon est trs htrogne selon plusieurs auteurs, car il regroupe des espces tendance ascomyctes et basidiomyctes. Ltat parfait des espces ascomyctes peut tre prsent chez plusieurs genres. Cette situation a incit les chercheurs reclasser les espces appartenant ce genre. Pour se faire, ils se sont bass sur lutilisation des tests supplmentaires dassimilation des aminoacides et sur lapplication de la taxonomie numrique (Dupont et Hedrick, 1971). Depuis, plusieurs espces ont t transfres vers dautres genres. Ainsi, Weijman (1979) a class Trichosporon terrestre dans le genre

Geotrichum. Cest pour cette raison que le taxonome doit tre vigilant lors de lutilisation des cls didentification. III. 1. 2. Description de lespce * Zygosaccharomyces fermentati : (souche 8) Les cellules sont cylindriques, singulires ou en paires. Les colonies sont lisses, brillantes et de couleur blanche avec bordures entires. Le pseudomyclium est absent. La conjugaison se fait gnralement entre les cellules singulires et prcde la formation des asques. On trouve 2 4 ascospores par asque, ils sont globulaires et lisses. Les cultures en bouillon forment souvent des agglutinations. Zygosaccharomyces fermentati est caractrise par lassimilation du cellulose, saccharose, raffinose, galactose, tandis que le lactose, amidon, ribose, rhamnose et lacide citrique ne sont pas assimils par cette souche. Elle est aussi caractrise par la croissance une temprature de 37C. * Saccharomyces cerevisiae : (souche 9) Les cellules sont cylindriques, singulires ou en paires. Les colonies sont de couleur crme lgrement convexes et lisses avec striation lumineuses brillantes. Le pseudomyclium nest pas form. Les cellules vgtatives sont directement transformes en asques contenant 1 4 ascospores petites et globulaires. Saccharomyces cerevisiae nassimile ni la cellulose ni le xylose, alors que le saccharose, le galactose et lamidon sont bien assimils. Elle est caractrise aussi par labsence de pellicule.

84

Identification des levures

* Pichia kluyveri : (souche 4) Les cellules sont ovodes allonges, et elles sont sous forme singulire ou en paires. La croissance sur milieu liquide prsente une coloration jaune bronze avec toujours prsence de pellicule. Les colonies sont ternes avec bordures entires. Un nombre de 2 4 ascospores sous forme de chapeau sont produites dans chaque asque. Le pseudomyclium nest pas form. Pichia kluyveri nassimile pas la cellulose, le raffinose, le maltose, le xylose et elle est incapable de crotre sur un milieu non vitamin. Elle ne fermente pas le maltose et elle est caractrise par une fermentation rapide du glucose. * Pichia membranaefaciens : (souches 1 et 6) Les cellules sont ovodes allonges, elles se prsentent sous forme singulire ou en paires. La croissance sur milieu liquide prsente une coloration jauntre bronze accompagne par la formation dune pellicule. Les colonies sont blanche-jauntre, mattes, lisses rides avec bordures irrgulires. Nous navons pas observ la formation de pseudomyclium. Les asques peuvent ne pas se conjuguer ou montrent des conjugaisons entre les cellules indpendantes ou entre la cellule mre et son bourgeonnement. Gnralement, 1 4 spores sont formes par asque. Dans notre cas nous avons not la prsence mme de 6 spores par asque. Les spores peuvent tre sphriques ou hmisphriques et avec ou sans bordure. Pichia membranaefaciens nassimile pas la cellulose, le raffinose et le mannose. Elle se caractrise aussi par une croissance sur milieu sans vitamines et une fermentation trs lente du glucose. * Candida boidinii : (souches 2, 3 et 10) Cette espce appartient au groupe 3 : DBB (-), inositol (-), nitrate (+). Les cellules sont allonges, ovodes sphriques. Une couche de pellicule en poudre est toujours prsente. Les colonies sont colores en crme, ternes et rugueuses. Les gros pseudomycliums montrent des ramifications. Les courts pseudomycliums sont arrangs en forme darbre. Les blastospores sont ovodes et se prsentent en amas. Candida boidinii est caractrise par la fermentation du glucose et lassimilation de lerythritol. La cellulose et le rhamnose ne sont pas assimils.

85

Identification des levures

* Candida diddensiae : (souches 5 et 7) Cette espce appartient aussi au groupe 3. Les cellules sont gnralement ovales, et sont singulires ou en paires. Elles peuvent tre prsentes aussi sous forme triangulaire, allonge filamenteuse. Les colonies sont blanchtres crme, rugueuses, peuvent apparatre plate, ronde et creuses au centre. Le pseudomyclium est form et prsente des branches de chanes de cellules allonges avec un amas de blastospores dont les bordures apparaissent ondules. Candida diddensiae est caractrise par la fermentation du glucose et lassimilation du maltose et du galactose. Elle nassimile ni le rhamnose ni le lactose, et elle peut crotre une temprature de 37C. * Candida wickerhamii : (souche 12) Cette souche appartient au groupe 5 : DBB (-), inositol (-), nitrate (-), erythritol (+), raffinose (+). Les cellules sont sphriques. Les colonies sont jaune-gristres, ternes brillantes, molles et lisses. Le pseudomyclium nest pas form. Candida wickerhamii assimile la cellulose, galactose et le xylose, alors que le maltose nest pas assimil. Elle est caractrise aussi par la fermentation du glucose et la croissance une temprature de 37C. * Trichosporon terrestre ou Geotrichum terrestre : (Souche 11) Trichosporon terrestre et le synonyme de Geotrichum terrestre (Weijman, 1979). Le myclium cloisonn form est trs abondant. Les arthrospores et quelques pseudomycliums sont aussi prsents. Les cellules bourgeonnantes dtaches sont petites ovales allonges. Les colonies sont de couleur crme, sches, molles, bombes et dlicatement rides avec des bordures lobes. Les blastospores sont prsents sur le myclium ct des septums et entre eux. Les blastospores peuvent tre seules, en chanes ou parfois en amas. Les arthrospores varient en longueur, et peuvent tre trs petites et sphriques. Le septum contient des plasmodesmes arrangs de faon alatoire. Trichosporon terrestre est caractrise par la croissance 37C et par lassimilation des nitrates. Elle est la seule espce ascomyctes qui assimile les nitrates. Les rsultats de la caractrisation morphologique, physiologique et biochimique des souches tudies sont reprsents dans le tableau 27.

86

Identification des levures

Tableau 27 : Caractrisation morphologique, physiologique et biochimique des souches isoles des margines. Souches identifies
Croissance 37C Croissance 42C Pellicule Myclium Spores 1, 6 + (+) Ascospores + (+) 2, 3, 10 + + Blastospores (+) + + 4 + (+) Ascospores + (-) (-) 5, 7 (+) + Blastospores (-) 8 (+) Ascospores + (-) + 9 + (-) Ascospores + (-) 11 (+) + + Blasto et Arthrospores (+) + + 12 (-) Blastospores (+) + +

Urease Assimilation de NO3Milieu sans vitamines Prsence de cycloheximide Glucose Galactose Saccharose Maltose Lactose Trhalose Glucose Galactose Saccharose Maltose Cellobiose Trehalose Lactose Raffinose Amidon Xylose Arabinose Ribose Rhamnose Erythritol Ribitol Mannitol Acide succinique Acide citrique Inositol Melizitose Inulin Arbutine Mannose Sorbitol Dextran Mthyle glucoside

(+) + (-) + (-) + + + + (-) -

Fermentation des sucres (+) (+) (+) + + + + (-) + + + Assimilation du compos carbonique + + + + (+) (+) + + + (+) (-) (+) (-) (-) + (+) + + + + (-) (-) (-) (-) (+) (-) + (-) + + + (-) (-) + (-) (-) (+) (-) (+) (-) + + + + + + + + + + (-) (-) (-) (-) (-) + + + + + + + + + + + + + -

+ + + + + + (+) (+) (-) (+) (-) (-) + (-) + + -

+ + + + + + + + + + + + + + + + + + + + + + +

(+) + + (+) + (-) (+) (+) + (-) + + -

(-), (+) : Les caractristiques cls de chaque souche.

87

Identification des levures

III. 2. Identification molculaire Pour sassurer de la position taxonomique des souches tudies, nous avons fait appel une mthode didentification molculaire. Cette technique compare les squences nuclotidiques des ADNr 28S des squences de la banque des donnes. Selon la phylognie des levures, il y a une volution des squences typiques et spcifiques lchelle du genre et de lespce. Lamplification par PCR de la rgion V3 de lADNr 28S des 12 souches de levures a t ralise, la figure 14 illustre les rsultats obtenus.

PMP

PMP 9

10

11

12

Figure 14 : Electrophorse en gel d'agarose des produits PCR en utilisant les primers V3-1 et V3-2 des souches de levures. T : tmoin (E. coli), 1-12 : produit PCR partir des souche de levure, MPM : marqueur de poids molculaire dADN (1kb+ ladder). La figure 14, montre lamplification dun fragment PCR de 500 pb, alors quaucune amplification na t observe dans le tmoin ngatif contenant lADN dE. coli comme matrice. Ceci prouve que nos souches appartiennent la famille des levures. Les produits PCR ont t par la suite purifis par le kit "PCR Wizard" et 3 l ont t dposs sur gel dagarose (figure 15).

88

Identification des levures

MPM

7 8 9 10 MPM 11 12

Figure 15 : Electrophorse en gel d'agarose des produits PCR aprs purification des souches de levures. Nous constatons que les solutions PCR ont t concentres et les bandes deviennent nettes. Ensuite, les produits ont t squencs, et les squences obtenues ont t compares la banque des donnes pour dduire leur position taxonomique. Les rsultats sont sous forme dun pourcentage didentit entre nos squences dADNr et les squences disponibles dans la banque des donnes. Seuls les rsultats avec un pourcentage didentit suprieur 99,5% ont t retenus. Les squences de la rgion V3 amplifie des souches 1 et 6 sont identiques, de mme pour les souches 2, 3 et 10 dune part et les souches 5 et 7 dautre part. Ces rsultats confirment ceux obtenus par mthode classique.

89

Identification des levures

Les rsultats de la comparaison des squences sont comme suit : * Souches 1 et 6 : Pichia galeiformis ou Pichia mandshurica La squence amplifie est identique lADNr de Pichia galeiformis et Pichia mandshurica avec un pourcentage de 99,9%. Dans la cl Kreger-van Rij (1987), Pichia galeiformis nest pas prsente. Cependant Pichia mandshurica et Pichia membranaefaciens sont synonymes daprs Saito (1914). Selon Kodama, Kyono et Kodama (1955), il existe une souche Pichia membranaefaciens varit mandshurica. Dans la cl didentification de Barnett et al. (1990), Pichia galeiformis et Pichia membranaefaciens sont synonymes selon Goto et al. (1987). Les rsultats de lidentification classique et molculaire sont compatibles et nous avons gard le nom de Pichia membranaefaciens pour les souches 1 et 6. * Souches 5 et 7 : Candida naeodendra ou Candida diddensiae La squence amplifie est identique lADNr de Candida naeodendra et Candida diddensiae avec un pourcentage de 99,9%. C. naeodendra assimile le rhamnose et lamidon, alors que notre souche ne les assimile pas et C. diddensiae est caractrise dans la cl didentification par la non assimilation du rhamnose. Cette souche nest que Candida diddensiae. Dans ce cas cest lidentification classique qui nous a permis de trancher entre les deux espces trouves par la mthode molculaire. * Souches 2, 3 et 10 : Candida boidinii et Candida ooitensis Dans la cl didentification Kreger-van Rij (1987), la souche Candida ooitensis nest pas prsente. Dans la cl de barnett et al. (1990), ces deux souches sont presque identiques. La diffrence rside dans le fait que C. boidinii est caractrise par lassimilation des nitrates alors que C. ootensis ne lest pas. Il y a aussi une remarquable diffrence qui rside dans leur habitat. C. ootensis se trouve dans les boues visqueuses au Japon (Barnett et al., 1990). C. boidinii est rencontre dans les effluents de tanneries, sol, olives, mer, les boissons non alcoolises et le vin (Barnett et al., 1990). Puisque notre souche assimile le nitrate et son origine est lolive, elle ne peut tre que Candida boidinii.

90

Identification des levures

* Souche 4 : Pichia kluyveri ou Pichia fermentans Ces deux souches sont trs proches, la seule diffrence rside dans lassimilation du xylose. Notre souche nassimile pas le xylose et Pichia kluyveri est caractrise selon la cl de Kreger-van Rij (1987) par la non assimilation de ce sucre, par consquent notre souche ne peut tre que Pichia kluyveri. * Souche 8 : Zygosaccharomyces fermentati Dans ce cas, lapproche molculaire donne une seule espce sans ambigut. Ce rsultat est identique celui de lapproche classique. Notre souche est donc Zygosaccharomyces fermentati. * Souche 9 : Saccharomyces cerevisiae ou Saccharomyces ellipsoideus Dans la cl Kreger-van Rij (1987), des auteurs comme Hansen (1883) considrent ces deux espces comme synonymes. Il existe aussi la souche Saccharomyces cerevisiae varit ellipsoideus selon Stelling-Dekker (1931). Donc, nous avons gard le nom de Saccharomyces cerevisiae pour notre souche. * Souche 11 : Galactomyces sp. Dans ce cas, linterrogation de la banque des donnes a donn comme rsultat le genre Galactomycs. Donc, nous avons pris en considration les rsultats de lidentification classique. Puisque dans la cl de Kreger-van Rij (1987), les espces Trichosporon terrestre et Geotrichum terrestre sont considres comme synonymes, nous avons gard le nom de Geotrichum terrestre pour notre souche. * Souche 12 : Candida wickerhamii Pour la souche 12, lapproche molculaire confirme sans ambigut les rsultas de lidentification par approche classique.

IV. CONCLUSION Lidentification classique des souches de levures a permis de dduire la position taxonomique de chaque souche au niveau de lespce. Mais, le temps de cette tude est considrable surtout que tous les tests sont effectus en double et en triple afin de minimiser

91

Identification des levures

lerreur. Cependant, lavantage de cette mthode est quelle permet de bien connatre les caractristiques biochimiques et physiologiques propres aux souches testes. Ce qui nous permettrait de slectionner des souches intrt biotechnologique sur le plan environnemental et industriel et de dcouvrir des espces nouvelles. Cette tude met en uvre le rle important que joue la mthode classique dans lidentification des levures. En revanche, la technique didentification molculaire est trs rapide, mais ncessite la consommation des ractifs coteux et lutilisation des appareils sophistiqus. Dans notre cas, lamplification et le squenage de la rgion V3 de lADNr donnent parfois le choix entre 2 souches trs proches dans leur structure gnomique et parfois, nindique la position taxonomique quau niveau du genre ou de lordre (cas de la souche 11). Ceci peut tre palli par lamplification et le squenage dautres rgions trs spcifiques. Nanmoins, lutilisation des tests morphologiques, biochimiques ou physiologiques qui prsentent les caractristiques cls de chaque souche reste complmentaire au test molculaire. La mthode molculaire reste fiable aussi pour des souches rencontres dans le domaine mdical comme les souches pathognes (Candida albicans, Candida glabrata, ). Elle joue aussi un rle important en industrie; en permettant la diffrenciation entre la souche employe (Saccharomyces cerevisiae) et les autres souches pouvant contaminer les cycles de fermentation. En guise de conclusion, cette partie de travail montre qu la fois la mthode classique et la mthode molculaire par amplification de V3 de lADNr sont complmentaires et concordantes de point vu rsultats de la situation taxonomique des souches identifies.

92

Biotraitement des margines

I. INTRODUCTION Vu la forte charge organique et les quantits produites annuellement, le rejet des margines constitue actuellement un problme environnemental majeur particulirement pour les pays du bassin mditerranen. Le problme fondamental rencontr lors de lapplication de diffrents procds de traitement des margines, est la hausse des charges financires. Cest ainsi que notre laboratoire sest orient vers lusage de voies biologiques qui exploitent la flexibilit mtabolique des souches adaptes la dgradation des composs phnoliques. Ce type de traitement des margines prsente des retombs conomiques sur le cot de traitement. Daprs ltude de la premire partie de ce travail, nous disposons dune collection importante de micro-organismes isole des margines. Ces souches pourront jouer un rle considrable dans la dcomposition de la matire organique et en particulier les composs phnoliques des margines. Avant de commencer ltude du traitement biologique des margines par ces souches, nous avons jug intressant de faire une tude prliminaire pour slectionner celles qui peuvent tre efficaces pour lpuration des margines. Dans ce chapitre, nous avons tudi le traitement des margines par les souches slectionnes. Le traitement arobie via des souches pures a t lobjectif de plusieurs travaux de recherche. Cependant, la prsente tude constitue lune des premires tester leffet de ladaptation des micro-organismes crotre sur des concentrations croissantes en margines sur le traitement des margines brutes. II. MATERIEL ET METHODES II. 1. Echantillonnage Cette tude a port sur des margines fraches provenant dune huilerie industrielle situe Doukkarat dans la ville de Fs, durant la campagne olicole 2001-2002. Les prlvements sont effectus dans des flacons striliss au pralable, puis transports rapidement au laboratoire dans des glacires une temprature de 4C. Ensuite, ils sont stocks - 20C pour une utilisation ultrieure. Les caractristiques physico-chimiques des margines traiter sont prsentes dans le tableau 28.

93

Biotraitement des margines

Tableau 28 : Composition physico-chimique des margines fraches. Paramtres PH DCO (g dO2. l-1) Composs phnoliques (g.l-1) MES (g.l-1) MS (g.l-1) MV (g.l-1) II. 2. Choix des souches pour cette tude Dans le but de slectionner des souches capables de traiter les margines, nous avons choisi les micro-organismes isols et identifis durant la 1re partie de ce travail. Ces souches vont tre testes pour leur capacit dgrader les composs phnoliques. Elles sont les suivants : Huit espces de levures : Candida boidinii, Candida diddensiae, Candida wickerhamii, Pichia kluyveri, Pichia membranaefaciens, Saccharomyces cerevisiae, Geotrichum terrestre et Zygosaccharomyces fermentati. Deux espces de champignons : Penicillium sp. et Aspergillus niger. Une bactrie : Pseudomonas sp. II. 3. Slection des souches choisies Cette recherche est base sur ltude de la croissance des onze souches choisies sur diffrents milieux de cultures. Le milieu de base est le milieu minimum Yeast Nitrogen Base agar (YNB-agar) dfini par Wikerham (1951), auquel est ajout la source carbone sous forme dacide tannique, dacide olique, dacide gallique, de pyrogallol, de phnol ou de catchol une concentration de 0,5%. Les composs phnoliques extraits des margines ont t ajouts aussi comme source de carbone ce milieu. Lassimilation dun compos organique se traduit par une croissance de la souche teste dans le milieu glos 30C pendant 3 7 jours dincubation. Le milieu YNB-agar contenant le glucose 0,5% est utilis comme tmoin positif. Le mme milieu exempt de source de carbone reprsente le tmoin ngatif. II. 4. Biotraitement Deux espces de levures Candida boidinii et Geotrichum terrestre et deux espce de champignons Penicillium sp. et Aspergillus niger sont slectionnes pour le traitement des Teneur 5 82 3,2 2,8 20 18

94

Biotraitement des margines

margines. Ces souches ont t mises en conservation adaptative dans un milieu glos contenant 25% de margines dilues dans de leau de robinet, 0,1% dextrait de levure, 0,5% (NH4)2SO4, 0,4 % de KH2PO4, 0,05% MgSO4, 0,05% NaCl et 2% dagar. Le milieu de culture est strilis lautoclave 120C pendant 20 minutes. Les botes de Ptri sont ensuite ensemences par les 4 souches choisies et mises en incubation dans une tuve 30C pendant 48 heures pour les levures et 72 heures pour les champignons. Leur conservation est effectue 4C. La culture des souches est renouvele tous les 15 jours. II. 4. 1. Prparation de la prculture Pour le traitement des margines, la prparation de linoculum est ncessaire. Ainsi, des volumes de 100 ml dun milieu de culture liquide sont mis dans des Erlenmeyers de 250 ml. Ce milieu est compos de margines 25% additionnes de sels appropris (voir composition ci-dessus), et le pH est ajust 5. Ces Erlenmeyers sont striliss par autoclavage une temprature de 120C pendant 20 minutes. Ensuite, ces milieux sont inoculs par une biomasse importante pralablement adapte crotre sur le mme milieu glos. Comme la taille de linoculum influence dune manire critique le taux de croissance et de dgradation des composs phnoliques (Sayadi et Ellouz, 1992), les Erlenmeyers sont inoculs avec une biomasse de levures correspondant 10 cellules.ml-1, et une concentration optimale de 10 spores.ml-1 pour les champignons. Les cultures sont mises en incubation lobscurit pendant 18 heures 30C sous agitation horizontale. Au bout de ce temps, la biomasse rcolte aprs centrifugation est utilise pour inoculer le premier milieu contenant une concentration de 25% des margines. - Enumration des levures : Une srie de dilutions de la biomasse prleve des botes dans de leau physiologique (NaCl 0,9%) est effectue. Le comptage des levures est ralis laide dune cellule de thomas. - Enumration des spores des champignons : La biomasse prleve des botes est mise dans un tube Eppendorf contenant des billes de verre et de leau physiologique. Le tube est mlang laide dun vortex pour que les sporanges sclatent et librent les spores. Le comptage des spores est effectu aussi par cellule de thomas.
7 9

95

Biotraitement des margines

II. 4. 2. Mise en culture - Prparation des milieux de culture : Les cultures liquides sont faites en duplicata dans des Erlenmeyers de 250 ml contenant 100 ml dune solution de margines. Celle-ci est compose de 25%, 50%, 75% ou de 100% (v/v) des margines dilues dans de leau de robinet. Les milieux sont additionns dune source dazote (0,35% de (NH4)2SO4) et de phosphate (0,065% de KH2PO4) ncessaires l'assimilation des composs phnoliques par les micro-organismes et la production de la biomasse. Tous les milieux sont striliss lautoclave 120C pendant 20 minutes. Inoculation des milieux de cultures :

La biomasse de la prculture dj prpare est utilise pour inoculer le milieu de margines 25% traiter. Aprs incubation 30C sous agitation pendant 36 heures, un chantillon de 5 ml est prlev et centrifug. Le culot sert valuer la biomasse produite, le surnageant est utilis pour doser les composs phnoliques et la DCO soluble. Le reste de la culture est centrifug et le culot est utilis pour ensemencer le milieu contenant les margines 50%. Le mme protocole est suivi pour inoculer les margines 75% et 100% (figure 16). Pour le dernier milieu 100%, une fois le prlvement de 36 heures est effectu, lincubation est ralise pendant un mois. Un suivi tous les 3 jours de lvolution des composs phnoliques, de la DCO soluble, de la biomasse produite et du pH est effectu. En parallle, un essai tmoin est ralis avec des margines brutes, striles et non ensemences.

Figure 16 : Schma synoptique du traitement en cascade des margines avec les souches tudies.
96

Biotraitement des margines

II. 5. Analyses physico-chimiques Le pH, la DCO, les MES, la MS et la MV sont effectus selon les mthodes dcrites dans le premier chapitre (Rodier, 1996). Les composs phnoliques sont dtermins par la mthode spectrophotomtrique labore par Maestro-Duran et al. (1991). Elle est base sur la rduction dun mlange dacide phosphotungstique (Ractif de Folin-Dennis). Les monophnols et les polyphnols rduisent ce ractif un mlange bleu doxyde de tungstne et de molybdne. La coloration produite prsente un maximum dabsorption 600 nm. Les rsultats sont exprims en quivalant de gramme dacide tannique par litre dchantillon utilis dans la gamme talon. Lextraction des composs phnoliques des margines est effectue par la technique dcrite par Macheix et al. (1990). A 20 ml de margines pralablement acidifies par lacide mtaphosphorique 2% (1/10 ; v/v) pour empcher loxydation des composs phnoliques, un volume gal (v/v) de sulfate dammonium 40% est ajout afin daugmenter la force ionique du milieu. Le mlange subit ensuite 3 fois une dlipidation par le mme volume de lhexane. Lextraction des composs phnoliques est effectue par lactate dthyle pur (3v). Aprs vaporation de la phase suprieure, le rsidu est repris dans le mthanol. La biomasse sche est dtermine par centrifugation d'un volume de 5 ml du milieu de culture. Le culot est sch 105C pendant 24 heures. La diffrence entre le poids du tube vide et sch donne la biomasse sche en g.l-1. Le surnageant est soumis aux analyses de composs phnoliques, de la DCO soluble et du pH. Tous les essais ont t raliss en triples. Les rsultats ports sur les figures et les tableaux sont les moyennes des mesures effectues. III. RESULTATS ET DISCUSSION III. 1. Caractrisation des souches de levures et des champignons Le stockage des margines dans les bassins de la station dvaporation naturelle pendant plusieurs mois entrane la polymrisation des composs phnoliques (Assas et al., 2002). Ce qui rendrait difficile leur biodgradation. Pour cela, et dans le but dtudier le traitement des margines par nos souches, nous avons choisi les margines fraches provenant dune huilerie industrielle. Ltude physico-chimique de ces margines a montr quelles sont caractrises par une DCO de lordre de 80 g dO2.l-1 et renferment une teneur en composs phnoliques de 3,2 g.l-1.

97

Biotraitement des margines

Avant dentamer le traitement biologique de ces margines, nous avons opt pour une slection des souches capables d'assimiler les composs phnoliques. Pour ceci, nous avons test la croissance des onze souches sur milieu minimum (YNB) auquel est ajout plusieurs sources de carbone telles que : l'acide tannique, lacide olique, lacide gallique, le pyrogallol, le catchol, le phnol ou les composs phnoliques extraits des margines. Ces composs organiques tests donnent une ide sur le mtabolisme des composs phnoliques et lipidiques. Les rsultats de cette tude sont prsents dans le tableau 29. Tableau 29 : Etude de la croissance des micro-organismes isols des margines sur les diffrentes sources de carbone.
Acide olique Acide tannique Acide gallique Catchol Pyrogallol Phnol Composs phnoliques

+++ C. diddensiae ++ C wickerhamii G. terrestre +++ P. kluyveri P. membranaefaciens + S. cerevisiae Z. fermentati A. niger Penicillium sp.
Pseudomonas sp. C. boidinii

++ + +++

++ + + + +++

++ + + + + +

++ + ++ +

+ + +++ +

+ + + + + +++ +

+ ++ +++

: Pas de croissance : Survie : Croissance : Croissance importante : Croissance trs importante : Prsence daurole de dgradation. Daprs le tableau 29, nous remarquons que les souches qui se sont dveloppes sur

toutes les sources de carbone tudies sont Candida boidinii, Geotrichum terrestre, Penicillium sp. et Aspergillus niger. Les rsultats de l'assimilation de ces composs phnoliques tests dmontrent bien la flexibilit mtabolique dont disposent ces souches. L'assimilation du catchol est un bon indicateur des voies mtaboliques de la dgradation des composs phnoliques. Ce compos est un mtabolite intermdiaire carrefour de la biodgradation des composs phnoliques monocycliques et polycycliques. L'assimilation de l'acide tannique et de l'acide gallique montre bien l'quipement enzymatique impliqu dans la dgradation des tannins.

98

Biotraitement des margines

L'acide olique est test pour cribler les souches capables de mtaboliser les huiles rsiduelles qui flottent la surface des margines et forment une pellicule tanche. Ce film lipidique empche la pntration de la lumire et par consquent lvaporation naturelle des margines. Dailleurs, la formation de cette couche lipidique est linconvnient majeur qui limite l'utilisation du traitement des margines par la technologie d'vaporation naturelle. A travers ces sources de carbone testes, nous avons slectionn des souches ayant un mtabolisme alternatif trs efficace vis vis de la dgradation des composs phnoliques et lipidiques. De ce fait, nous pouvons dire que les souches C. boidinii, G. terrestre, Penicillium sp. et A. niger sont les plus performantes dans la dgradation des composs phnoliques faible concentration (tableau 29). Nous pouvons donc les choisir pour tudier le biotraitement des margines. Comme celles-ci contiennent de fortes concentrations en composs phnoliques (3,2 g.l-1), nous avons pens raliser une adaptation de ces souches crotre sur des concentrations croissantes en margines avant de les traiter ltat brute. III. 2. Traitement des margines en cascade diffrentes concentrations par les quatre souches slectionnes Une tude prliminaire du traitement biologique des margines 100% et 75% par les quatre souches slectionnes a montr des rsultats non satisfaisants. Dans le but damliorer le rendement du traitement biologique, une adaptation des souches crotre sur des milieux concentrations croissantes en margines a t ralise. Pour cela, nous avons compar la capacit des souches Candida boidinii, Geotrichum terrestre, Penicillium sp. et Aspergillus niger traiter, en cultures discontinues (en batch), les margines 25%, 50%, 75% et 100%. III. 2. 1. Dgradation des composs phnoliques Le taux dabattement des composs phnoliques par les souches tudies dans les milieux de culture contenant diffrentes concentrations en margines est illustr dans la figure 17.

99

Biotraitement des margines

C. boidinii
80 70 Taux d'abattement des CP (%) 60 50 40 30 20 10 0 25

G. terrestre

Penicillium sp.

A. niger

50

75

100 Conce ntration de s margine s (%)

Figure 17 : Taux dabattement des composs phnoliques (CP) par les quatre souches en fonction de la concentration initiale en margines aprs 36 h dincubation. Daprs les rsultats rapports dans la figure 17, on constate que la rduction des composs phnoliques est influence par la concentration des margines. Plus la concentration est leve, plus le taux dabattement des composs phnoliques est faible. Dans les margines 25%, les taux dabattement obtenus sont de lordre de 40,2% ; 48,8% ; 62,2% et 73,2% en prsence de C. boidinii, G. terrestre, Penicillium sp. et A. niger respectivement. Par contre dans les margines brutes, le pourcentage de la rduction des composs phnoliques ne dpasse pas 10,6% ; 17,5% ; 36,9% et 40,9% en prsence de C. boidinii G. terrestre, Penicillium sp. et A niger respectivement. III. 2. 2. Dgradation de la matire organique Le dosage de la matire organique est exprim en terme de DCO. La figure 18 reprsente le taux dlimination de la DCO par les souches tudies dans les milieux diffrentes concentrations en margines.

100

Biotraitement des margines

C. boidinii
80 Taux d'abattement de la DCO (%) 70 60 50 40 30 20 10 0 25

G. terrestre.

Penicillium sp.

A. niger

50

75

100 Concentration des margines (%)

Figure 18 : Taux dabattement de la DCO soluble en fonction de la concentration initiale en margines par les quatre souches aprs 36 h dincubation. Lanalyse des rsultats de la figure 18 montre que le pourcentage dabattement de la matire organique exprime en terme de DCO dcrot avec la diminution de la dilution des margines comme pour les composs phnoliques. Dans les margines brutes, malgr lapport dinoculum dj adapt crotre sur margines 75%, la capacit de C. boidinii ou G. terrestre liminer la DCO est faible. Ainsi aprs 36 heures dincubation, environ 12,5% et 18,1% de rduction de la DCO sont obtenus respectivement. Par contre en prsence des souches Penicillium sp. et A. niger, cette rduction atteint 35,6% et 48,1% respectivement. En revanche, le maximum de la diminution de la DCO est observ dans les margines dilues 25% comme dans le cas des composs phnoliques. Ainsi, des taux dabattement qui sont de lordre de 41,4% ; 50,9% ; 65,1% et 74,5% sont obtenus chez C. boidinii, G. terrestre, Penicillium sp. et A. niger respectivement. III. 2. 3. Dosage de la biomasse produite Le dosage de la biomasse produite (exprime en gramme de poids sec par litre) par les souches tudies dans les milieux diffrentes concentrations en margines est illustr dans le tableau 30.

101

Biotraitement des margines

Tableau 30 : Dosage de la biomasse produite dans les margines diffrentes concentrations aprs 36 h dincubation. Biomasse produite (g de poids sec.l-1) Biomasse de la prculture 1,7 1,9 2,4 2,2 25% 2,2 2,5 3,2 3 50% 2,86 3,32 4,56 4,24 75% 3,4 3,91 5,89 6,01 100% 4,05 4,62 6,8 7,36

C. boidinii G. terrestre Penicillium sp. A. niger

Daprs ce tableau, on remarque quil y a une production de la biomasse dans les diffrentes concentrations en margines mme 100%. Ceci suggre que la croissance des souches ntait pas inhibe sur les margines brutes. La biomasse produite atteint 4,05 ; 4,62 ; 6,8 et 7,36 g de poids sec.l-1 sur les margines brutes en prsence de C. boidinii, G. terrestre, Penicillium sp. et A. niger respectivement. III. 2. 4. Discussion D'aprs les figures (17 et 18) et le tableau 30, on note l'action bnfique d'un traitement en cascade. Tous les micro-organismes tests sont capables de crotre sur les margines diffrentes concentrations. Lavantage de cette tude en cascade est ladaptation des microorganismes crotre sur les margines et par consquent dgrader leur matires organiques. Puisque la concentration des composs phnoliques est faible sur les margines dilues 25%, les souches testes arrivent sy dvelopper facilement. La biomasse produite sur ce milieu est inocule sur un autre contenant les margines plus concentres. Lquipement enzymatique des cellules se trouve dj stimul et prt dgrader nouveau dautres composs phnoliques. En plus, le nombre de cellules est lev permettant ainsi de rduire davantage la matire organique et de produire une nouvelle biomasse. En prsence des margines brutes, malgr que le rendement de la dgradation des composs phnoliques et de la matire organique est faible, nous assistons toujours une croissance de tous les microorganismes tests. Cette croissance est value par la biomasse produite (tableau 30). Llimination des composs phnoliques et de la DCO est optimale dans les margines dilues 25% en prsence des quatre souches tudies. Leffet des micro-organismes sur la dgradation de la matire organique est alors affect par llvation de la concentration des margines. Yesilada et al. (1998), ont observ que la capacit de Coriolus versicolor et Funalia

102

Biotraitement des margines

trogii rduire la DCO et les phnols diminue avec laugmentation de la concentration initiale des margines. Des rsultats similaires ont t observs dans les deux types de biotraitement des margines; la fermentation arobie (Benitez et al., 1997 ; Fadil et al., 2003) et la digestion anarobie (Hamdi et Garcia, 1993 ; Gharsallah, 1994). Les taux dabattement des composs phnoliques et de la DCO sont donc augments par la dilution des margines. Assas et al. (2000) ont montr que la dcoloration des margines par Geotrichum candidum est rduite dans les margines concentres. Sayadi et Ellouz, (1992) ont trouv le mme rsultat pour Phanerochaete chrysosporium. Martirani et al. (1996) ont report que la croissance de Pleurotus ostreatus est inhibe dans les margines plus concentr de 20%. Les rsultats obtenus suggrent que les margines concentres diminuent lactivit des micro-organismes. Ceci pourrait tre expliqu par une rduction de lactivit des microorganismes par un excs de substrat. Linoculation directe de margines brutes par nos souches sans adaptation pralable donne des rsultats insatisfaisants voire mme ngatifs (pas de croissance). Ceci est probablement d la nature des margines fortement charges en polluants organiques, en particulier la prsence en grandes concentrations des composs toxiques comme les tannins et les composs phnoliques simples. Certains de ces composs pourraient avoir un effet antimicrobien qui se manifeste par laltration des membranes cellulaires (Capasso et al., 1995 ; Capasso, 1997). Cependant, aprs avoir adapt nos souches sur des margines concentrations croissantes, nous avons constat quil y a un abattement la fois de la DCO et des composs phnoliques des margines brutes accompagn dune croissance cellulaire. En prsence des composs phnoliques, le systme enzymatique du mtabolisme alternatif est activ. Certaines espces forment des peroxysomes de grande taille qui jouent un rle important dans la dgradation et la mtabolisation des composs phnoliques et lipidiques (Horiguchi et al., 2001b). Plusieurs enzymes participent au mtabolisme peroxysomal chez les levures et les champignons. Laction cooprative de ces enzymes aboutit la dgradation de ces composs et protge les micro-organismes contre loxygne activ form en grande quantit au moment de l'assimilation des composs non glucidiques (Wang et al., 1999 ; Horiguchi et al., 2001a ; Aissam et al., 2002). Lefficacit du mtabolisme alternatif rside dans la production dune gamme denzymes spcificit large. Ceci permet la dgradation de plusieurs composs structure similaire ou variable en mme temps. Donc, certains micro-organismes peuvent dgrader facilement les composs

103

Biotraitement des margines

phnoliques faibles concentrations grce leur quipement enzymatique. Cependant, en prsence de fortes concentrations, la majorit des composs phnoliques pourrait se fixer sur les enzymes. Ainsi, lactivit enzymatique serait altre et les cellules seraient prives de mtabolites intermdiaires, dnergie et du pouvoir rducteur. Et par consquent la plupart des cellules meurent. Les composs phnoliques forte concentration agissent aussi sur les structures membranaires. Ils peuvent altrer les macromolcules telles que les protines. Cette caractristique est exploite dans beaucoup de protocoles pour lextraction de certaines molcules. En effet, le phnol est trs utilis pour liminer les protines histones afin dextraire lADN (Sambrook et al., 1989), et les tannins sont utiliss pour prcipiter les protines (Hagerman et al., 1992). Les rsultats montrent galement que la capacit dA. niger assimiler les composs phnoliques est plus leve que celle des autres micro-organismes. En effet, la chitine des parois dA. niger est connue par sa capacit de fixer les composs phnoliques, ce qui peut contribuer leur limination des margines (Seng, 1988). A. niger est capable la fois de dgrader des polymres aromatiques comme les tannins et les anthocyanes et des monomres aromatiques (Kieslich, 1976). En plus, le catchol qui est un intermdiaire important du catabolisme arobie des composs aromatiques, est facilement dgradable par A. niger grce sa catchol 1,2-dioxygnase (Nninnekar et Vaidyanathan, 1981). La dgradation des huiles est assure grce sa lipase et son systme de -oxydation des acides gras longue chane. Donc, tous les micro-organismes tudis sont capables de crotre dans les margines. Cette croissance se manifeste par la production de biomasse et la diminution de la charge organique. La dgradation de la matire organique et parallle celle des composs phnoliques. Les rsultats du traitement des margines diffrentes concentrations par les micro-organismes montrent que Aspergillus niger est la plus performante suivie de Penicillium sp., de Geotrichum terrestre et de Candida boidinii. A la lumire de ces rsultats, nous pouvons constater que ladaptation progressive des souches crotre sur des concentrations croissantes en margines a un effet positif sur le traitement des margines. En effet, sous ces conditions, les souches testes ont permis la dgradation de la matire organique et des composs phnoliques, et la production de la biomasse sur les margines brutes. Nanmoins, le taux dlimination de la DCO et des composs phnoliques reste faible par rapport celui enregistr dans les margines dilues. Le rendement pourrait tre amlior par augmentation de la dure de fermentation. Pour cela, nous avons suivi le traitement des margines brutes par ces souches durant un mois.

104

Biotraitement des margines

III. 3. Suivi du traitement des margines brutes durant un mois A des intervalles de temps bien dtermins (3 jours), des chantillons sont prlevs dans des conditions striles pour effectuer le dosage des composs phnoliques, de la DCO soluble et de la biomasse produite. Les rsultats du suivi du traitement des margines brutes par les quatre souches sont donns par les figures 19 et 20. III. 3. 1. Evolution des composs phnoliques Les rsultats de lvolution des composs phnoliques pendant un mois (figure 19) montrent quen absence de micro-organismes (tmoin), la dgradation des composs phnoliques est absente. Ceci suggre que ces composs ne subissent gure une dgradation chimique.

Tmoin
3,5 3 2,5 2 1,5 1 0,5 0 0 3

C boidinii

G. terrestre

Penicillium sp.

A niger

Composs phnoliques (g.l )

-1

12

15

18

21

24

27

30 Temps (jours)

Figure 19 : Evolution des composs phnoliques dans les margines brutes en fonction du temps par les souches tudies. En prsence des margines brutes, lactivit des quatre souches nest pas inhibe. La grande part de la dgradation des composs phnoliques est ralise pendant les 6 premiers jours. Ainsi, en prsence de C. boidinii, Penicillium sp., G. terrestre et A. niger la rduction des composs phnoliques est de lordre de 40% ; 43,4% ; 56,3% et 64,4% respectivement. Par ailleurs, du 9me au 30me jours, le taux de dgradation de ces derniers est faible et reste stable jusquau 30me jour. Le taux dabattement aprs 30 jours dincubation atteint 40,3% ;

105

Biotraitement des margines

48,4% ; 63,1% et 75,6% en prsence des souches C. boidinii, G. terrestre, Penicillium sp. et A. niger respectivement. III. 3. 2. Evolution de la DCO Les rsultats de lvolution de la DCO au cours du temps sont prsents dans la figure 20. Lanalyse de ces rsultats montre quen absence de micro-organismes (tmoin), la matire organique exprime en DCO ne subit pas de dgradation chimique comme pour les composs phnoliques.

Tmoin
90 80 70 DCO (g d'O2.l )
-1

C. boidinii

G. terrestre

Penicillium sp.

A. niger

60 50 40 30 20 10 0 0 3 6 9 12 15 18 21 24 27 30 Temps (jours)

Figure 20 : Evolution de la DCO dans les margines brutes en fonction du temps par les souches tudies. La souche C. boidinii est capable de rduire environ 46,3% de la DCO des margines traites juste aprs 3 jours dincubation. La DCO atteint une concentration de 44 g dO2.l-1 qui reste stable jusquau 21me jour. Aprs, elle subit une lgre augmentation pour atteindre 50 g dO2.l-1 au 30me jour. En parallle, les souches G. terrestre, Penicillium sp. et A. niger ont montr une limination considrable de la DCO de 47,2% ; 59,4% et 69,8% respectivement aprs 6 jours dincubation. Les taux dlimination de la DCO obtenus aprs 30 jours de traitement sont de lordre de 52,2%; 65,2% et 78,3% en prsence de G. terrestre, Penicillium sp. et A. niger respectivement.

106

Biotraitement des margines

III. 3. 3. Evolution de la biomasse produite La figure 21 montre lvolution de la biomasse produite au cours du traitement des margines brutes par les souches de levures et de champignons.

C. boidinii Penicillium sp.


16 14 Biomasse (g de poids sec.l )
-1

G. terrestre A. niger

12 10 8 6 4 2 0 0 3 6 9 12 15 18 21 24 27 30 Temps (jours)

Figure 21 : Evolution de la biomasse produite dans les margines brutes en fonction du temps par les souches tudies. La biomasse produite augmente considrablement durant les 6 premiers jours chez les souches. Elle atteint respectivement 5,74 ; 6,3 ; 12,4 et 14,8 g de poids sec.l-1 chez C. boidinii, G. terrestre, Penicillium sp. et A. niger. Au del du 9me jour, elle reste constante jusquau 30me jours du traitement. Chez Candida boidinii, le maximum de la biomasse produite est observ aprs seulement 3 jours dincubation et reste stable 5,8 g de poids sec.l-1 jusquau 15me jour. Puis, la biomasse baisse rgulirement pour atteindre 3,8 g de poids sec.l-1 au 30me jour. III. 3. 4. Interprtation des rsultats de lvolution des composs phnoliques, de la DCO et de la biomasse produite Les figures (19 et 20) nous permet de constater que les courbes volutives des composs phnoliques prsentent la mme allure que celle de lvolution de la DCO soluble. Ce qui nous permet de suggrer lexistence dune corrlation entre le contenu en composs phnoliques et la DCO. Effectivement, une relation linaire a t tablie entre la rduction des composs phnoliques et celle de la DCO soluble avec un coefficient de corrlation trs

107

Biotraitement des margines

significative variant entre 0,97 et 0,98 (figure 22). En effet, plusieurs auteurs ont signal cette corrlation (Sayadi et Ellouz, 1992 ; Vinciguerra et al., 1995 ; Zenjari et al., 1999).

C. boidinii
DCO (g d'O2.l -1 )

G. terrestre
DCO (g d'O2.l -1 )
y = 27,964x - 7,8883 R2 = 0,9701

y = 28,198x - 7,351 R2 = 0,9865 100 50 0 0 1 2 3


-1

100 50 0 0 1 2

C ompos s ph nolique s (g.l -1 )

Compos s ph nolique s (g.l )

Penicillium sp.
DCO (g d'o2.l-1) 100 50 0 0 1 2

DCO (g d'O2.l -1 )

y = 26,3x - 3,205 R2 = 0,9736

A. niger
y = 25,897x - 4,1941 R2 = 0,9791 100 50 0 0 1 2 3 4 C ompos s ph nolique s (g.l -1 )

C ompos s ph nolique s (g.l-1)

Figure 22 : Corrlation entre lvolution de la DCO et celle des composs phnoliques. Cette relation entre la rduction de la DCO et celle des composs phnoliques nous permet de dduire que la biomasse provient des produits du catabolisme des composs phnoliques. Paralllement la diminution de la biomasse produite par C. boidinii pendant la deuxime quinzaine du traitement, la concentration de la DCO augmente lgrement de 44 50 g dO2.l-1 (figure 20). Ceci peut tre expliqu par une lyse cellulaire. Un effet semblable a t observ par Gharsallah (1993). C. boidinii et G. terrestre ont montr une limination considrable des composs phnoliques (40%, 37,5%) aprs 3 jours, alors que cette limination na pas dpass 10,6% et 17,5% aprs 36 heures (figure 19). Ce retard peut tre expliqu la nature des margines fortement charges en polluants organiques. En plus, les levures prsentent un systme enzymatique moins performant que celui des champignons dans la dgradation des composs phnoliques. La rapidit de lattaque de la matire organique par les deux champignons Penicillium sp. et A. niger suggre limplication dun mtabolisme alternatif performant qui

108

Biotraitement des margines

joue un rle important dans la dgradation des composs phnoliques. Cette biodgradation pourrait sexpliquer par leurs capacits mtaboliques dans la dgradation squentielle des noyaux aromatiques des composs phnoliques travers les enzymes oxygnase hautement exprimes chez les champignons (Horiguchi et al., 2001b). Ce rsultat est en concordance avec celui obtenu par Hamdi et al. (1992). Par contre, on note presque une stabilit de la diminution de la DCO et des composs phnoliques, et de la production de biomasse au del du 9me jour dans le cas des quatre souches. Ceci pourrait tre attribu lpuisement des composs organiques biodgradables dans les milieux de culture, et la bioconversion en composs phnoliques stables et non biodgradables. En effet, il a t dmontr par Hamdi et Ellouz (1993) que loxydation des margines entrane la polymrisation des composs phnoliques simples et forme des tannins rsistants la biodgradation. Ces composs phnoliques qui sont non biodgradables cause de leur structure complexe et htrogne (Capasso, 1997) pourraient prsenter des activits antibiotiques, antifongiques, antioxydantes ou anticancreuse. Ceci ouvre dautres axes de recherche quil faudrait dvelopper. Donc le traitement des margines brutes pourrait tre achev aprs seulement 6 jours, puisque environ de 90% de la matire organique et des composs phnoliques sont dgrads durant les 6 premiers jours. III. 3. 5. Evolution du pH Les rsultats de la variation du pH durant le traitement des margines sont montrs dans le tableau 31. Tableau 31 : Evolution du pH en fonction du temps dans les margines brutes traites par les souches tudies. 0 5 5 5 5 5 2 5 3,9 4,2 4,3 4,2 3 5,1 3,8 4,1 4,3 4,1 6 4,9 3,8 4,1 4,2 4 9 5 3,9 4,9 4,8 5 12 5 3,9 4,9 4,8 5,1 15 4,9 3,9 4,9 4,8 5,2 18 5 4,2 5 4,9 5,2 21 4,9 4,7 5 4,9 5,2 24 5 5,6 5 4,9 5,3 27 5 6 5 4,9 5,3 30 5 6,2 5 4,9 5,3

Tmoin C. boidinii G. terrestre Penicillium sp. A. niger

Daprs les rsultats du tableau 31, nous remarquons dans le cas des quatre souches, le pH diminue pendant les 6 premiers jours. Il diminue de 5 3,8 ; 4,1 ; 4,2 et 4 en

109

Biotraitement des margines

prsence de C. boidinii, G. terrestre, Penicillium sp. et A. niger respectivement. Cette baisse du pH pourrait tre due une dgradation des composs phnoliques, ce qui permet une augmentation du taux dacides organiques par rapport celui des composs phnoliques dans le milieu ractionnel. Nous pouvons attribuer galement cette diminution du pH, la libration des ions H+ par les cellules dans le milieu ractionnel. Cette libration seffectue au moment du transport antiport des acides amins, des sucres et des composs phnoliques du milieu de culture vers les cellules. Lactivit cellulaire se manifeste donc par une baisse du pH, alors que son augmentation pourrait indiquer que les cellules sont en difficult physiologique. A partir du 6me jour on assiste une augmentation du pH. Il passe de 4,1 5, de 4,2 4,9 et de 4 5,3 en prsence de G. terrestre, Penicillium sp. et A. niger respectivement. Ceci est d probablement la dgradation des acides phnoliques et organiques portant des groupements COO- et/ou OH- comme lacide lactique et lacide actique qui sont prsents dans les margines (Ercoli et Ertola, 1983). La disparition de ces composs entrane une lvation du pH. En plus, lactivit microbienne entrane une dgradation des protines en librant les ions NH4+ qui provoque laugmentation du pH. Cette lvation du pH des margines traites par rapport aux valeurs initiales a t observe par plusieurs auteurs (Fountoulakis et al., 2002 ; Fadil et al., 2003). Hamdi et al. (1992) ont not une augmentation du pH de 7 8,2 lors de la dgradation microbienne des margines. De mme, au cours du traitement arobie des margines par les micro-organismes du sol, Zenjari et al. (1999) ont observ que le pH passe de 7,1 8,4. En prsence de C. boidinii, le pH initial dcrot de 5 3,8 aprs 6 jours de fermentation, puis il reste presque stable. Au del du 18me jour on assiste une augmentation considrable du pH qui atteint 6,2 au 30me jour. Nous pensons que la phase de stabilisation du pH correspond la phase stationnaire de la levure puisque pendant cette priode, il ny a ni rduction de la DCO ni production de la biomasse. Laugmentation du pH pourrait sexpliquer par la mort et la lyse de la majorit des cellules. Ceci entrane la libration de certains mtabolites essentiellement les protines dans le milieu ractionnel, provoquant ainsi une alcalinisation du milieu et une augmentation de la DCO (figure 20). La diminution du pH initial suivi de son lvation durant le traitement des margines a t signal par plusieurs auteurs. En effet, Gharsallah (1993) a constat que le pH passe de 5 3,9 pour atteindre 4,2 avec Saccharomyces rouxii sur les margines. Garcia Garcia et al. (2000) ont remarqu une diminution du pH suivi dune lvation pendant le traitement arobie des

110

Biotraitement des margines

margines par les souches suivantes : Phanerochaete chrysosporium, Aspergillus niger, Aspergillus terreus et Geotrichum candidum. Assas et al. (2002) ont not aussi la mme observation durant le traitement des margines fraches par Geotrichum candidum. III. 4. Discussion La croissance des quatre souches tudies dans les margines concentration croissante a permis le changement de lquipement enzymatique et linduction dun mtabolisme alternatif trs efficace. Sous ces conditions physiologiques, les cellules synthtisent des enzymes non spcifiques entranant lhydrolyse des composs phnoliques des concentrations leves. Ce qui permet entre autres, la croissance des levures et des champignons sur la matire organique provenant du catabolisme des composs phnoliques. En effet, certains auteurs ont signal le rle important jou par linduction mtabolique des champignons et des levures pour amliorer le traitement des margines (Errachidi, 1997 ; Kahraman et Yesilada, 1999, 2001). Kahraman et Yesilada (1999, 2001) ont montr que laddition des tiges de coton lors du traitement des margines par les champignons Coriolus versicolor et Funalia trogii, augmente significativement lactivit de lenzyme laccase (phnol oxydase). L'effet bnfique de ladaptation des souches a t valu par la teneur en biomasse produite sur les margines brutes. Lensemencement des margines 75% et 100% par des prcultures des quatre souches a montr une faible croissance et une germination rudimentaire des spores. Des observations microscopiques sur Aspergillus niger ont montr la germination de quelques spores, mais le myclium reste rudimentaire nenvahissant pas le milieu de culture. Des tests de survie des souches ont montr que ladaptation provoque le passage des souches d'un tat de survie sous forme dun pseudomyclium un tat de croissance de cellules en plein bourgeonnement pour les levures dans les margines brutes. Ladaptation des souches crotre sur de fortes concentrations en margines pourrait se manifester par des changements structuraux au niveau des membranes notamment la composition chimique des lipides membranaires. Ainsi, les acides gras saturs sont remplacs par les acides gras insaturs. Ce qui permet de modifier lespace hydrophobe pour diminuer dune part le flux de transport de ces composs phnoliques vers le milieu intracellulaire et dautre part leur solubilisation par les composs phnoliques. Lensemble des rsultats obtenus a rvl limportance de nos souches dans le traitement des margines brutes :

111

Biotraitement des margines

- Aspergillus niger Au cours de cette tude, Aspergillus niger a permis dobtenir le meilleur rendement dans la rduction des composs phnoliques (75,6%) et de la DCO (78,3%) des margines brutes. Ceci montre la performance de notre souche dans le traitement des margines. Un taux dabattement de la DCO de 50 60%, a t enregistr par Hamdi (1991b). Ce qui prouve leffet bnfique de ladaptation sur le rendement de notre souche A. niger. Penicillium sp. Ltude du traitement des margines brutes par Penicillium sp. a rvl les capacits de notre souche rduire 65,2% de DCO et dgrader 63,1% des composs phnoliques. Cependant, ce champignon est moins viable que A. niger et ncessite un contrle permanent. Les exigences des conditions de culture des souches de Penicillium pourraient tre lune des causes de la raret des travaux de recherches sur le traitement des margines par ce genre de champignon. Geotrichum terrestre La plupart des travaux de recherches du traitement des margines par le genre Geotrichum se sont polariss sur lespce Geotrichum candidum. Ainsi, il a t dmontr par Assas et al. (2000) que cette espce est incapable de traiter les margines brutes. Un bon rendement est obtenu avec les margines dilues 20% aprs 6 jours dincubation (Assas et al., 2002). Le traitement des margines par Geotrichum candidum a permis un taux dabattement de 45,8% de la DCO, alors que la concentration des phnols totaux est reste stable durant le traitement (Garcia Garcia et al., 2000). Selon ces auteurs, cette rduction de la DCO est li la dgradation dautres composs organiques prsents dans les margines. La souche Geotrichum candidum tudie na donc aucun effet sur la dgradation des phnols. Tous ces rsultats mettent en uvre les qualits avantageuses de notre souche Geotrichum terrestre. Elle est capable de crotre sur les margines brutes en rduisant 52,2% de DCO et 48,4% des composs phnoliques pour une DCO initiale de 82 g dO2.l-1. Ce rsultat est proche de celui trouv par Fadil et al. (2003), ils ont obtenu un taux dabattement des polyphnols de lordre de 46,6% en prsence de Geotrichum sp. mais pour une DCO initiale de 40 g dO2.l-1.

112

Biotraitement des margines

Candida boidinii Notre souche Candida boidinii a permis llimination de 40% des composs phnoliques et 46,3% de DCO aprs 3 jours dincubation. Ces rsultats sont lgrement infrieurs ceux obtenus aprs optimisation du traitement des margines par Candida tropicalis (Fadil et al., 2003). Cette souche a pu dgrader 51,7% des polyphnols et 62,8% de la DCO des margines dilues (DCO initiale de 40 g dO2.l-1). Mme si ces taux dabattement sont considrables, le traitement des margines par Candida tropicalis reste limit puisquelle est considre comme une souche pathogne. En revanche, Candida boidinii prsente plusieurs avantages, en plus du fait quelle nest pas pathogne, elle est facile cultiver et capable de crotre sur les margines brutes une DCO initiale de 82 g dO2.l-1 en. Le rendement du traitement des margines par C. boidinii pourrait tre amlior en optimisant les conditions du milieu de culture. C. boidinii est trs connue dans la littrature par sa capacit dgrader le mthanol (Hristozova et al., 1994 ; Sakai et al., 1998 ; Aggelis et al., 2000 ; Santovito et al., 2002). De ce fait, linduction mtabolique par addition du mthanol pourrait jouer un rle important dans lactivation du systme enzymatique du mtabolisme alternatif. Ce qui pourrait augmenter le rendement de la dgradation des composs phnoliques. Les champignons sont en gnral plus efficace que les levures dans le traitement des margines. Ceci est d probablement leur systme enzymatique plus performant dans la dgradation des composs phnoliques par rapport celui des levures. En effet, daprs la littrature, le traitement des margines par les souches de levures est trs peu tudi. Cependant, leur culture prsente plusieurs avantages par rapport celle des champignons. Elles sont faciles cultiver et leur temps de gnration ne dpasse pas 2 heures, alors que celui des champignons est de 4 6 heures. Vu les avantages que prsentent les levures, loptimisation des conditions de leur culture sur les margines pourrait donner de meilleurs rsultats. Limmobilisation des cellules de levures ainsi que linduction mtabolique pourraient aussi amliorer le rendement dpuration de ces rejets (Errachidi, 1997 ; Yesilada et al., 1998 ; Kahraman et Yesilada, 1999, 2001).

113

Biotraitement des margines

IV. CONCLUSION Notre contribution dans le traitement des margines a t focalise sur ladaptation des souches indignes pour augmenter leur rsistance la toxicit des composs phnoliques gnre forte concentration. Les souches non adaptes narrivaient pas se dvelopper sur les margines brutes, do lintrt de notre tude. A partir des rsultats obtenus lors de cette tude, nous pouvons conclure que : La caractrisation physiologique a montr que les levures Candida boidinii et Geotrichum terrestre, ainsi que les champignons Penicillium sp. et Aspergillus niger sont les souches les plus performantes dans l'assimilation des composs phnoliques et lipidiques. La capacit des quatre souches dgrader la matire organique diminue avec laugmentation de la concentration initiale de la DCO des margines. Les souches A. niger, Penicillium sp., G. terrestre et C. boidinii ont permis un taux dabattement de la DCO de 78,3% ; 63,1% ; 48,4% et 40,3% respectivement aprs un mois de traitement des margines brutes. Cette tude a montr aussi l'intrt de la souche Aspergillus niger qui contribue la rduction de 78,3% de la DCO et de 63,1% des composs phnoliques. Lavantage de notre tude rside dans le fait que la biodgradation nobit pas la loi de tout ou rien, mais des systmes de modulation et dadaptation pour faire passer les cellules dun tat physiologique un autre plus avantag.

114

Production de lenzyme tannase

I. INTRODUCTION Durant ltude du traitement biologique des margines, la souche Aspergillus niger a montr sa capacit dgrader les composs phnoliques. Cependant, le cot de revient de ce traitement est lev en raison de la consommation des quantits deau utilises dans la dilution des margines. Nous avons donc, orient notre recherche vers la voix de valorisation des margines en produisant une valeur ajoute suffisante pour couvrir les charges du traitement. En gnral, les souches dAspergillus niger sont connues par leur croissance marque sur plusieurs sources de carbone et aussi par leur rsistance aux conditions drastiques de l'environnement (Hamdi et al., 1991b, 1991c). A lchelle industrielle, ces souches offrent plusieurs applications par la production denzymes (tableau 32) et dacides organiques tels que les acides citriques, maliques, fumarique et oxalique. Tableau 32 : Enzymes produites par A. niger et leurs applications lchelle industrielle. Enzyme Amylases Anthocyanases Arabinanases Glucoamylase Glucose oxydase Inulinase Naringinases xylanases Pectinases Protases Tannases Application industrielle Mdecine, alimentation, boissons Dcoloration des vins rouges Hydrolyse des gommes et des mucilages Sirop de glucose partir damidon Dosage, antioxydants, alimentation Production de fructose partir dinuline Hydrolyse des glucosides amers Clarification des jus de fruits, traitement du caf Mdecine, alimentation et industrie de cuir Pharmacie, Tanneries, alimentation

A. niger a t aussi largement utilis dans la valorisation de plusieurs substrats biologiques par la production de protines dorganismes unicellulaires (POU) ou parfois dans la dpollution (tableau 33).

115

Production de lenzyme tannase

Tableau 33 : Bioconversion de plusieurs effluents agro-alimentaires par A. niger. Substrat Rejet de bananes Manioc Mangostone Sous produits craliers Effluents sucrs Riz contamin par Aflatoxine Pulpe de citron Arabinane et gomme Objectif POU POU POU POU Dpollution Dtoxification POU Hydrolyse Rfrence Sethi et Grainger, 1980a Raimbault et Alazard, 1980 Sethi et Grainger, 1980b Gibriel et al., 1981 Anderson et al., 1981 Tsubouchi et al., 1983 Rodriguez et al., 1985 Voragen et al., 1987

Les margines renferment un taux non ngligeable de tannins hydrolysables, pouvant tre dgrads par une enzyme extracellulaire appele : tannase ou tannin acyl hydrolase (CE 3.1.1.20). Cette enzyme hydrolyse la liaison ester des tannins hydrolysables et produit lacide gallique et le glucose (Lekha et Lonsane, 1997). Lenzyme tannase est extrmement utile dans divers domaines. Elle est utilise comme inhibiteur de mousse dans le th et comme clarifiant dans la production de bire et les jus de fruits (Masschelein et Batum, 1981 ; Cantarelli et al., 1989). Elle joue aussi un rle important en industrie pharmaceutique, surtout dans la fabrication dun antibiotique appel trimethoprim qui est un driv d'acide gallique (Bajpai et Patil, 1997). Cette enzyme est employe galement dans le traitement des effluents des tanneries (Suseela et Nandy 1985). Malgr les vertus que prsente cette enzyme, les travaux de recherche sont limits cause des difficults de la mthodologie de dosage (Iacazio et al., 2000 ; Sharma et al., 2000). Bien que plusieurs micro-organismes soient des sources potentielles pour la production de cette enzyme (Bradoo et al., 1997 ; Bajpai et Patil, 1997 ; Lane et al., 1997 ; Sharma et al., 1999), la recherche continue slectionner de nouveaux organismes comptents dans la production dune tannase plus stable et capable de rsister aux conditions drastiques des procds industriels. Vu le rle important que joue lenzyme tannase dans lenvironnement et dans lapplication industrielle, et puisque les souches dA. niger sont connues par la production de cette enzyme, il nous a paru intressant dtudier la production de cette enzyme par notre souche nomme Aspergillus niger HA37. Les margines sont utilises comme substrat puisquelles renferment un taux lev en tannins hydrolysables capables dinduire la production de lenzyme tannase.

116

Production de lenzyme tannase

Avant dentamer ltude de la production de lenzyme tannase partir des margines, nous avons jug intressant de commencer par ltude de cette production en utilisant lacide tannique comme substrat. Cette recherche porte sur deux volets : Le premier vise ltude de la production de lenzyme tannase sur milieu minimum contenant lacide tannique comme source de carbone diffrentes concentrations (0,2% ; 0,5% et 1%). Le deuxime volet tudie la production de cette enzyme par A. niger HA37 en utilisant les margines dilues 25% comme milieu de culture. II. MATERIEL ET METHODES II. 1. Milieu de culture Le milieu de culture est un milieu minimum qui contient des concentrations croissantes dacide tannique (0,2%, 0,5% et 1%). Dans des Erlenmeyers de 250 ml, des volumes de 50 ml dun milieu base dacide tannique (AT) qui contient 0,065% de K2HPO4 et 0,35% de (NH4)2SO4 sont prpars. Ces milieux sont striliss lautoclave 120C pendant 20 minutes. Lacide tannique strilis par filtration est ajout aseptiquement au milieu des concentrations de 0,2% ; 0,5% et 1% (p/v). Paralllement, des botes de ptri contenant le mme milieu additionn de 2% dagar et 1% dacide tannique sont prpares (ATA). Un volume de 50 ml des margines dilues 25% additionnes de 0,065% de K2HPO4 et 0,35% de (NH4)2SO4 est mis dans des Erlenmeyers de 250 ml. Ce milieu est strilis lautoclave 120C pendant 20 minutes. Les margines utilises sont celles tudies dans le chapitre III. II. 2. Matriel biologique Dans cette tude, la souche Aspergillus niger HA37 est choisie comme matriel biologique. Elle est isole des margines de la station dvaporation naturelle durant la compagne 2000 2001. La souche est stocke sur glose incline (2% de lextrait de malt, 2% dagar) 4C, et elle est repique chaque mois.

117

Production de lenzyme tannase

II. 3. Inoculation des milieux de culture A. niger HA37 a t cultive dans des botes de ptri contenant le milieu AT avec 2% dagar et 0,5% dacide tannique (ATA). Lincubation est effectue 30C pendant 7 jours pour favoriser la sporulation. A partir des spores formes, le centre des botes contenant 1% dacide tannique est inocul. Lincubation est ralise dans une tuve 30C pendant 48 heures. Aprs dnombrement laide dune cellule de thomas, 107 spores.ml-1 sont inocules dans chaque Erlenmeyer. Les milieux de culture sont ensuite incubs 30C sous agitation horizontale pendant 48 heures pour ceux contenant lacide tannique, et pendant 96 heures pour ceux des margines. Des prlvements de 1 ml sont effectus des intervalles de 3 heures et le surnagent est utilis pour le dosage de l'enzyme tannase et des composs phnoliques. La DCO initiale et finale des margines traites aprs 96 heures sont doses selon la mthode dcrite dans le chapitre I. II. 4. Techniques du dosage II. 4. 1. Dosage du CO2 Le taux de croissance de la souche A. niger HA37 est estim par le dosage du CO2 total libr dans le milieu de culture base dacide tannique selon la mthode gravimtrique (Pochon et Tordux, 1962). Dans des Erlenmeyers de 250 ml col large contenant 50 ml du milieu de culture, on y trompe des petites bouteilles de 25 ml contenant 20 ml de NaOH (0,2 N). Aprs lajout dacide tannique strilis par filtration, le milieu de culture est ensemenc avec les spores de A. niger HA37. Le dosage du CO2 est ralis au bout de chaque 3 heures. Le CO2 produit par mtabolisation de lacide tannique par le champignon est neutralis par un lger excs dune solution de NaOH. Le taux de cette consommation est ensuite dtermin laide dune solution dacide chlorhydrique (0,02 N) en prsence de chlorures de Baryum. II. 4. 2. Dosage de lacide tannique et des composs phnoliques Ils sont doss par la mthode Maestro-Duran et al. (1991) dcrite dans le chapitre III. Le choix de cette technique est bas sur le fait que lacide tannique est un compos phnolique.

118

Production de lenzyme tannase

II. 4. 3. Dtermination de la biomasse sche La biomasse produite par A. niger HA37 sur les diffrents milieux de culture est recueillie par filtration sur un morceau de tissu de Tergal plac dans un entonnoir. La biomasse est mise dans une coupelle en porcelaine pralablement pese puis sche dans ltuve 105C pendant 24 heures. II. 4. 4. Dosage des protines contenues dans la biomasse produite La biomasse rcupre est broye laide dun mortier dans 10 ml de leau distille. Ensuite, un aliquote de 1 ml est dos selon la mthode de Bradford (1976). Le srum de lalbumine bovine (BSA) est utilis comme solution talon. II. 4. 5. Dosage de lenzyme tannase Aprs culture de la souche Aspergillus niger HA37 sur l'acide tannique, lactivit de lenzyme tannase a t dtermine par chromatographie sur couche mince pour dtecter la disparition de lacide tannique et l'apparition d'acide gallique. Le dosage quantitatif de la tannase produite est effectu dans les deux milieux de culture artificiel et naturel. Le degr d'hydrolyse de la liaison ester de lacide tannique est estim par mesure de la disparition dacide tannique la longueur donde de 310 nm d'aprs la mthode lgrement modifie de Iibuchi et al. (1967). Le protocole dtaill de cette technique est dcrit dans lannexe II. Une unit enzymatique (UE) est dfinie comme la quantit d'enzyme ncessaire pour hydrolyser la liaison ester dun mol d'acide tannique par minute. Les rsultats sont exprims en UE.ml-1. II. 4. 6. Chromatographie des composs phnoliques sur colonne de Sphadex G-50 Le gel de filtration Sphadex G-50 est utilis pour analyser les composs phnoliques prsents dans les margines traites et non traites. Un volume de 200 ml environ de ce gel est plac dans une colonne en quartz (2,5 50). Aprs stabilisation et lavage avec le tampon (NaOH 0,05M, LiCl 0,025 M), 1 ml de lchantillon est inject dans la colonne et est lu par fraction de 3 ml un dbit de 0,60 ml.min-1. Lquilibration de la colonne est ralise par le tampon. La densit optique de ces fractions est mesure par spectrophotomtrie 280 nm.

119

Production de lenzyme tannase

III. RSULTATS ET DISCUSSION III. 1. Production de lenzyme tannase par A. niger HA37 sur lacide tannique Ltude de la croissance des onze micro-organismes isols des margines sur milieu minimum contenant comme seule source de carbone lacide tannique 0,5% a t effectue dans le chapitre III. Cette tude a rvl lefficacit et la performance de A. niger vis--vis de la dgradation de lacide tannique (tableau 34). Cest pour cela quelle est considre la meilleure souche pour la production de l'enzyme tannase partir des sources d'nergie renouvelables, telles que lacide tannique ou un effluent contenant des tannins comme les margines. Tableau 34 : Croissance des souches de bactries, levures et de champignons isoles des margines sur milieu base dacide tannique 0,5%. Souche Pseudomonas sp. C. boidinii C. diddensiae C. wickerhamii G. terrestre P. membranaefaciens P. kluyveri S. cerevisiae Z. fermentati A. niger Penicillium sp. + ++ +++ : Pas de croissance : Survie : Croissance : Croissance importante : Croissance trs importante : Prsence daurole de dgradation. Croissance ++ + +++

120

Production de lenzyme tannase

III. 1. 1. Croissance dA. niger HA37 sur milieu solide (ATA) contenant lacide tannique 1% La croissance dA. niger sur milieu minimum YNB (Wickerham, 1951) contenant comme source de carbone lacide tannique 0,5% a montr des auroles de dgradation sur les botes de ptri. Pour approfondir ltude, nous avons test la capacit de cette souche crotre sur milieu minimum ATA contenant 1% dacide tannique comme seule source de carbone. Contrairement au milieu YNB, le milieu ATA ne contient ni vitamines ni oligolments. Les rsultats de cette tude sont illustrs dans la figure 23.

Figure 23 : Croissance dAspergillus niger HA37 sur l'acide tannique 1%.

L'aurole de dgradation montr sur la bote de Ptri visualise nettement l'activit tannase aprs seulement deux jours de croissance de la souche A. niger HA37. Cette dernire est capable de dgrader lacide tannique 1% comme seule source de carbone. Aguilar et al. (2001) ont tudi lactivit tannase de Aspergillus niger sur des milieux solides contenant diffrentes concentrations dacide tannique. Les rsultats ont montr que le maximum de

121

Production de lenzyme tannase

lactivit tannase est obtenu 10% dacide tannique mais sur des milieux riches en acides amins, en vitamines et en sucres. Ainsi la fraction en substrat conue pour la maintenance cellulaire est minimise. Dans notre tude, le milieu utilis ne contient que les lments minraux et ceci pour simuler au maximum le milieu de culture base des margines.

III. 1. 2. Effet de la concentration initiale dacide tannique sur la croissance dA. niger HA37 Lacide tannique fait partie des tannins hydrolysables sous forme de gal1oy1-g1ucose qui contient plusieurs molcules d'acide gallique par molcule de glucose (Spencer et al., 1988) (figure 24).
OH OH OH OH OH OH
O C

O C OCH2 O O O

O C

OH OH OH

O O O C O C

OH O OH

O C

OH OH OH

OH OH

OH

Tannins hydrolysables

Tannase
OH OH O OH OH OH

OH OH OH

O C OH

Glucose

Acide gallique

Figure 24 : Production de lacide gallique et du glucose partir des tannins hydrolysables sous laction de lenzyme tannase. La variation de la concentration dacide tannique et du taux de croissance dA. niger HA37 en fonction du temps est illustre dans la figure 25. Le taux de croissance de la souche est estim par la production du CO2.

122

Production de lenzyme tannase

[AT]

(0,2% d'AT)

[AT]

(0,5% d'AT)

[AT]

(1% d'AT)

(CO2] (0,2% d'AT)


12 Acide tannique et CO2 (g.l-1) 10 8 6 4 2 0 0 6 12 18

[CO2] (0,5% d'AT)

[CO2] (1% d'AT)

24

30

36

42

48

54 Temps (heures)

Figure 25 : Variation de la concentration de lacide tannique (AT) et du CO2 en fonction du temps. Daprs cette figure, nous remarquons que la souche A. niger HA37 peut assimiler l'acide tannique 0,2% ; 0,5% et 1% sur milieu liquide. Elle a trouv dans lacide tannique le carbone ncessaire pour sa croissance et sa maintenance cellulaire. La prsence de lacide tannique et les oligomres phnoliques qui laccompagnent narrte pas sa croissance. Les courbes peuvent tre divises en deux phases : La premire phase correspond la phase de latence. Elle ne prsente ni consommation dacide tannique, ni croissance de la souche A. niger HA37 due un retard de la germination des spores. La souche A. niger HA37 est incapable de crotre immdiatement en prsence d'acide tannique, elle a besoin dune phase d'adaptation qui dure environ 20 heures. La deuxime phase se caractrise par la dgradation d'acide tannique et la croissance de la souche. Daprs lallure des courbes, cette dgradation diminue progressivement en fonction de la concentration initiale dacide tannique. Plus cette concentration augmente, plus la dure de sa dgradation est lente. La croissance de la souche augmente galement avec la teneur en acide tannique initiale.

123

Production de lenzyme tannase

III. 1. 3. Effet de la concentration initiale d'acide tannique sur la production de lenzyme tannase par A. niger HA37

[UE] (0,2% d'AT)


1,6 1,4 Enzyme tannase (UE.ml )
-1

[UE] (0,5% d'AT)

[UE] (1% d'AT)

1,2 1 0,8 0,6 0,4 0,2 0 0 6 12 18 24 30 36 42 48 54 Temps (heures)

Figure 26 : Concentration de lenzyme tannase libre par A. niger HA37 dans les trois types de milieu en fonction du temps Lactivit extracellulaire de lenzyme tannase a t suivie pendant toutes les phases de croissance. Cette activit enzymatique a t dtecte ds la premire heure de fermentation (figure 26). La production de la tannase commence au dbut de la phase dadaptation physiologique correspondant la phase de latence de la souche tudie. Suseela et Nandy (1985) ont montr aussi que lenzyme tannase est produite la phase initiale de croissance. La production de lenzyme tannase augmente avec la concentration initiale de lacide tannique (figure 26). Lactivit enzymatique maximale est de 0,6 UE.ml-1, 0,9 UE.ml-1 et 1,5 UE.ml-1 dans les milieux de culture contenant lacide tannique 0,2%, 0,5% et 1% respectivement. Ceci suggre que la fraction de substrat conu pour la production de l'enzyme tannase crot avec laugmentation de la concentration de lacide tannique. Des rsultats similaires ont t obtenus avec la souche Aspergillus japonicus (Bradoo et al., 1997). Dans le milieu AT contenant 0,2% dacide tannique, le maximum de production de lenzyme est obtenu aprs 9 heures dincubation, alors que lactivit maximale de cette enzyme est observe aprs 12 heures dans les deux milieux AT contenant 0,5% et 1% dacide tannique. Ensuite, lactivit enzymatique diminue progressivement. Cette diminution pourrait

124

Production de lenzyme tannase

tre due la libration de lacide gallique et du glucose dans le milieu de culture qui exercent une rpression catabolique sur la production de lenzyme tannase (Suseela et Nandy, 1985 ; Bradoo et al., 1997). III. 1. 4. Production de la biomasse dA. niger HA37 aprs 48 heures dincubation La biomasse produite par A. niger HA37 aprs 48 heures de fermentation est de lordre de 0,9 ; 2 et 3,3 g de poids sec.l-1 sur lacide tannique 0,2% ; 0,5% et 1% respectivement (figure 27).

3,5 3,0 Biomasse (g de poids sec.l )


-1

2,5 2,0 1,5 1,0 0,5 0,0 0,2 0,5 1

Acide tannique (%)

Figure 27 : Biomasse produite par A. niger HA37 sur diffrentes concentrations dacide tannique aprs 48 heures dincubation. La quantit de biomasse produite par A. niger HA37 augmente proportionnellement avec la concentration initiale dacide tannique. Bradoo et al. (1997) ont trouv des rsultats similaires par Aspergillus japonicus sur lacide tannique de 0,5% 1%. Cette biomasse peut tre utilise comme additif alimentaire pour le btail aprs schage et traitement adquat. Le dosage des protines dans la biomasse produite par A. niger HA37 sur diffrentes concentrations dacide tannique a montr quelle est enrichie de 28% en protines. En effet, A. niger a t largement utilis pour la production de POU en raison du taux des protines quelle renferme (tableau 33).

125

Production de lenzyme tannase

III. 1. 5. Effet de la concentration dacide tannique sur les paramtres de la croissance et de la production de lenzyme tannase Le tableau 35 rsume les paramtres cintiques de la croissance dA. niger HA37 et lactivit enzymatique en fonction de la concentration initiale dacide tannique. Tableau 35 : variation des paramtres cintiques en fonction de la concentration initiale dacide tannique.
Concentration dacide tannique initiale (g.l-1) Activit enzymatique maximale (UE.ml-1) Rendement Ym/s (g.g-1) Taux de croissance (h-1)

2 5 10

0,6 0,9 1,5

0,44 0,40 0,36

0,23 0,16 0,09

Daprs ce tableau, nous remarquons que lactivit enzymatique maximale augmente avec la concentration en acide tannique initiale. En effet, lacide tannique est un inducteur pour la production de lenzyme tannase (Bradoo et al., 1997). Par contre, le rendement pondral et le taux de croissance diminuent avec laugmentation de la concentration dacide tannique initiale. Ceci pourrait sexpliquer par le faite quen prsence des concentrations leves dacide tannique dans un milieu minimum, la souche A. niger HA37 utilise une fraction considrable du substrat vers la maintenance cellulaire. Aguilar et al. (2001) ont montr que le taux de croissance augmente avec laugmentation de la concentration dacide tannique dans des milieux liquides contenant 1,25%, 2,5% et 5%. Ceci est d probablement au fait quils ont utilis un milieu de culture plus riche que le notre. Daprs cette tude prliminaire, nous pouvons conclure que lacide tannique avec les lments minraux ajouts constituent un milieu convenable la croissance productive de lenzyme tannase haute concentration (10 g.l-1) par A. niger HA37. Cette fermentation se manifeste aussi par la formation dune biomasse protique trs importante. Elle peut tre rcupre par centrifugation et utilise comme aliment au btail aprs traitement adquat. A partir de ces rsultats prliminaires sur les processus et les techniques dvelopps pour simuler le biotope naturel dA. niger HA37, nous pouvons tudier la production de lenzyme tannase sur milieu base des margines.

126

Production de lenzyme tannase

III. 2. Production de lenzyme tannase par A. niger HA37 sur les margines Lenzyme tannase joue un rle important dans la dgradation des tannins hydrolysables. Cest pourquoi nous avons jug utile de suivre lvolution de la production de lenzyme tannase par A. niger HA37 utilise dans le traitement arobie des margines. III. 2. 1. Evolution de la teneur des composs phnoliques et de lenzyme tannase produite durant le traitement des margines par A. niger HA37 Les rsultats du suivi du traitement des margines (25%) par A. niger HA37 durant 96 heures sont illustrs dans la figure 28.

Tannase 1 Composs phnoliques (g.l ) 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 0 9 18 27 36
-1

CP (tmoin)

CP (trait) 1 0,9 0,8 0,6 0,5 0,4 0,3 0,2 0,1 0 Tannase (U.ml )
-1

0,7

45

54

63

72

81

90 Temps (heures)

Figure 28 : Evolution de la teneur des composs phnoliques et de lenzyme tannase produite par A. niger HA37 dans les margines en fonction du temps. Daprs la figure 28, nous constatons que la dgradation des composs phnoliques par A. niger HA37 est prcde par une phase de latence. Cette phase correspond au temps ncessaire pour la germination des spores qui dure 24 heures. Aprs cette phase dadaptation, la teneur en composs phnoliques diminue progressivement. Elle passe de 0,9 g.l-1 0,26 g.l-1 aprs 72 heures dincubation pour rester stable jusqu la fin de la fermentation, ce qui correspond un taux dabattement de 71,1%. Nous pouvons donc dire, que la prsence des composs phnoliques dans les margines ne limitent pas la capacit des spores dA. niger HA37 germer. Cependant, nous remarquons que la phase de latence est lgrement plus

127

Production de lenzyme tannase

longue par rapport celle obtenue en culture sur lacide tannique diffrentes concentrations. Ceci pourrait tre attribu la nature complexe des margines renfermant diffrents types de composs organiques. Le dosage de la production de lenzyme tannase a t suivi durant le traitement des margines par A. niger HA37 (figure 28). Lanalyse de cette figure nous permet de constater que la souche A. niger HA37 produit lenzyme tannase ds les premires heures dincubation. La production enzymatique augmente rapidement aprs 3 heures dincubation pour atteindre 0,43 UE.ml-1. De la 3me heure jusqu la 42me heure, la quantit de lenzyme produite oscille entre 0,37 et 0,64 UE.ml-1. Ensuite, elle diminue progressivement pour sannuler aprs 54 heures dincubation. Nous constatons galement, que loptimum de la production de cette enzyme est plus large que celle obtenue avec lacide tannique (figure 26). Ceci pourrait tre expliqu par la stabilit enzymatique prolonge de lenzyme tannase sur un milieu naturel riche en composs phnolique, en sels et autres molcules de nature trs variable. Daprs ces rsultats, nous constatons que la capacit de la souche A. niger HA37 produire lenzyme tannase nest pas inhibe par les margines 25%. Ce qui nous laisse supposer que le systme enzymatique responsable de la production de lenzyme tannase se trouve induit par la prsence des composs phnoliques. En effet, des rsultats similaires ont t trouvs par le champignon Phanerochaete chrysosporium qui, en prsence des margines son systme ligninolytique est activ afin de dgrader les composs phnoliques haut poids molculaire (Sayadi et al., 2000 ; Kissi et al., 2001). Donc il peut tre raisonnable de suggrer que le systme enzymatique de la tannase soit impliqu dans le processus de dgradation des composs phnoliques prsents dans les margines par A. niger HA37. Suite aux rsultats obtenus, nous pouvons conclure que A. niger HA37 est capable de dgrader les composs phnoliques des margines 25% par le biais des enzymes produites (particulirement la tannase). La germination des spores dA. niger HA37 inocules dans le milieu de culture base des margines nest pas inhibe par les composs phnoliques. La comparaison de la production de lenzyme tannase dans les deux systmes artificiel et naturel, montre que lactivit enzymatique sur les margines 25% est comparable celle trouve sur 0,2% dacide tannique. En plus la production de lenzyme tannase reste stable pendant plusieurs heures sur les margines. Ceci est d linduction prolonge du systme enzymatique par la prsence des composs phnoliques particulirement les tannins hydrolysables et la stabilit de lenzyme tannase sur ce milieu naturel.

128

Production de lenzyme tannase

III. 2. 2. DCO finale et biomasse produite par A. niger HA37 Nous avons constat dans le chapitre III une corrlation trs significative entre la dgradation des composs phnoliques et celle de la DCO. Donc, nous nous sommes limits au dosage de la DCO initiale et finale afin dvaluer le taux de rduction de la matire organique aprs traitement des margines 25% par A. niger HA37. La DCO initiale des margines 25% non traites est de lordre de 20 g dO2.l-1. Aprs fermentation par A. niger HA37 durant 96 heures, le taux des matires organiques baisse et la DCO atteint 6,8 g dO2.l-1, ce qui correspond un taux dabattement de 66%. Cette rduction est accompagne dune production de la biomasse de lordre de 1 g de poids sec.l-1 aprs 96 heures dincubation. Le dosage du contenu protique de cette biomasse a rvl quelle renferme 32% en protines. Ce rsultat est comparable celui obtenu par Hamdi (1991a), il a trouv que le myclium produit par A. niger lors du traitement des margines contient une teneur en protine qui peut atteindre 30%. La biomasse dA. niger cultive sur les margines a t teste en alimentation du btail et a donn des rsultats encourageants sans aucun risque dintoxication (Vaccarino et al., 1986). III. 2. 3. Evaluation par chromatographie de lefficacit du traitement des margines par A. niger HA37 Lefficacit du traitement des margines par A. niger HA37 a t vrifie galement par ltude de la chromatographie sur gel de Sphadex avant et aprs traitement pendant 96 heures. Ceci est dans le but de mettre en vidence le groupe de composs phnoliques dgrad par A. niger HA37 durant le traitement. La figure 29 illustre les rsultats de cette chromatographie.

129

Production de lenzyme tannase

Tmoin
0,6 0,5 Absorbance (280 nm) 0,4 0,3 0,2 0,1 0 0 6 12 18 24

Trait

30

36

42

48

54

60 Fraction

Figure 29 : Profil dlution du mlange des margines avant et aprs traitement par A. niger HA37. Les rsultats de la chromatographie sur gel de Sphadex G-50 des margines non traites (tmoin) montrent deux pics. Le premier correspond aux composs phnoliques polymres de haut poids molculaire, le deuxime pic correspond la fraction des composs phnoliques monomres de faible poids molculaire. Aprs traitement, une fraction importante des composs phnoliques polymres a t assimile. Cependant, le pic des monomres na pas beaucoup chang. Ceci pourrait tre expliqu soit par la concentration des monophnols qui est plus leve pour tre assimile par A. niger HA37, soit que ces composs sont rfractaires aux enzymes dont dispose cette souche. Nous pouvons aussi supposer que quelques monophnols des margines ont t assimils, alors que dautres ont t produits par la dgradation des polyphnols ou par la bioconversion des monophnols. Donc, la chromatographie des margines fermentes par A. niger HA37 a montr que les composs phnoliques polymres sont les plus dgrads durant ce type de traitement. Parmi ces composs on trouve les gallotannins qui reprsentent le groupe le plus abondant des tannins hydrolysables. Laction des tannases dA. niger hydrolyse ce type de tannins en glucose et en acide gallique. Nous pouvons donc dduire, que lenzyme tannase produite par A. niger HA37 a jou un rle important dans le traitement des margines.

130

Production de lenzyme tannase

IV. CONCLUSION Daprs les rsultats obtenus, nous pouvons dduire que la souche A. niger HA37 est capable de produire lenzyme tannase sur milieu artificiel base dacide tannique diffrentes concentrations et sur milieu naturel base des margines. Nous pouvons conclure aussi que, les margines 25% constituent un milieu convenable pour la production de lenzyme tannase par A. niger HA37 pendant plusieurs heures de fermentation. Cette production est accompagne de taux dabattement importants des composs phnoliques et de la DCO qui sont de lordre de 71,1% et 66% respectivement. En plus, la biomasse produite renferme une teneur considrable en protines (32%). Ainsi cet effluent ne peut tre considr comme source de prjudice pour lenvironnement mais un milieu de culture stable est facilement exploitable.

131

Conclusion gnrale

Au cours de ce travail, ltude physico-chimique des margines de la station dvaporation naturelle a montr que ces effluents sont caractriss par une forte pollution organique value en terme de DCO (154 g dO2.l-1). Ceci nous laisse dduire que les margines ne pourraient tre traites dans des bassins de stabilisation. Lactivit et la croissance des micro-organismes sont probablement altres par la prsence de forte teneur en composs phnoliques (9,7 g.l-1). L'tude microbiologique de ces margines a rvl que ce rejet renferme une charge microbienne assez faible par rapport aux autres effluents industriels (FMAT : 8,4 103 UFC.ml-1, levures : 7,6 103 UFC.ml-1, champignons : 4 102 UFC.ml-1). La prsence de faible concentration en sucres (0,28 g.l-1) montre que les micro-organismes dans les margines utilisent pour leur mtabolisme, les produits du catabolisme des composs phnoliques plutt que celle des sources glucidiques. Donc, ces micro-organismes empruntent des voies mtaboliques secondaires. Sous microscope, les levures isoles directement des margines sont rarement observes en plein bourgeonnement. Ce qui nous laisse dire quil ny a pas une croissance de la plupart des micro-organismes dans les margines mais seulement une survie. Par consquent, lautopuration naturelle des margines dans ces bassins pourrait tre trs limite. La prsence dune pellicule tanche forme de lipides rsiduels la surface des margines pourrait galement altrer lvaporation naturelle. Donc, le traitement des margines dans des bassins dvaporation naturelle est peu efficace, et ne permet quune vaporation partielle et une faible autopuration naturelle des margines. De ce fait, lutilisation de ces bassins dvaporation ne permet que lvitement du rejet direct des margines dans les gouts et les rivires. La caractrisation microbiologique de ces margines nous a permis disoler une seule souche de bactrie appartenant au genre Pseudomonas, deux types de champignons (Penicillium sp. et Aspergillus niger), et 8 espces de levures (Candida boidinii, Candida diddensiae, Candida wickerhamii, Pichia kluyveri, Pichia membranaefaciens, Saccharomyces cerevisiae, Geotrichum terrestre et Zygosaccharomyces fermentati). Cette tude a montr aussi que les levures reprsentent le groupe microbien le plus diversifi en genre et en densit et le plus adapt ce milieu pollu. Les micro-organismes isols de ces margines peuvent tre considrs comme les plus adapts et rsistants la toxicit de ces rejets. Laspect important de ce travail rside dans lidentification des micro-organismes isols des margines notamment les levures. En effet, rares sont les travaux consacrs ltude de la charge microbienne des margines. La comparaison des deux mthodes classique et molculaire utilises pour

132

Conclusion gnrale

lidentification des souches de levures a montr quelles sont complmentaires et donnent des rsultats concordants. La croissance des micro-organismes isols des margines sur diffrentes sources de carbone a rvl que les levures : Candida boidinii et Geotrichum terrestre, ainsi que les champignons : Penicillium sp. et Aspergillus niger sont les souches les plus performantes dans l'assimilation des composs phnoliques et lipidiques. Cependant, au cours de notre tude nous avons remarqu que ces souches narrivent pas se dvelopper sur les margines brutes. Cest pour cela que nous avons tudi ladaptation de ces quatre souches indignes crotre sur les margines diffrentes concentrations croissantes (25%, 50%, 75% et 100%). Cette adaptation permet ainsi leur rsistance la toxicit des composs phnoliques gnre forte concentration en margines. Cette tude a montr que la dgradation des composs phnoliques et de la DCO est optimale dans les margines dilues 25% en prsence des quatre souches tudies. Leffet des micro-organismes sur la dgradation de la matire organique est alors affect par llvation de la concentration des margines. Donc, ces microorganismes peuvent dgrader facilement les composs phnoliques faibles concentrations grce leur quipement enzymatique. Cependant, en prsence de fortes concentrations, la majorit des composs phnoliques pourrait se fixer sur les enzymes et altrer leur activit. Ainsi, les cellules seraient prives de mtabolites intermdiaires, dnergie et de pouvoir rducteur, et la plupart de celles-ci meurent ou restent ltat de survie. Dailleurs, les composs phnoliques forte concentration agissent sur les structures membranaires, et peuvent altrer les macromolcules telles que les protines. Les rsultats montrent galement que la capacit dA. niger assimiler les composs phnoliques est plus leve que celle des autres micro-organismes, suivi de Penicillium sp., G. terrestre et de C. boidinii. En effet, A. niger est capable de dgrader la fois des polymres et des monomres aromatiques grce son quipement enzymatique trs riche en enzymes jouant un rle trs important dans le mtabolisme alternatif. Le suivi du traitement biologique des margines brutes par les quatre souches durant un mois a permis de constater lexistence dune corrlation entre labattement de la DCO et celui des composs phnoliques. Ceci nous laisse dduire que la production de la biomasse provient en grande partie des produits de la dgradation des composs phnoliques. Durant ce traitement, les champignons A. niger et Penicillium sp. ont permis la rduction de la DCO et des composs phnoliques des taux plus levs que ceux obtenus par

133

Conclusion gnrale

les levures C. boidinii et G. terrestre. Ce qui indique limplication dun mtabolisme alternatif performant qui joue un rle important dans la dgradation des composs phnoliques chez les champignons. En plus, les levures prsentent un systme enzymatique moins efficace que celui des champignons pour mtaboliser ces composs phnoliques. Nous avons aussi not, une stabilit de la dgradation de la DCO et des composs phnoliques, et de la production de la biomasse au del du 9me jour dans le cas des quatre souches. Ceci pourrait tre attribu lpuisement des composs organiques biodgradables dans les milieux de culture, et leur bioconversion en composs phnoliques stables et non biodgradables. La croissance des quatre souches tudies dans les margines concentration croissante a permis linduction dun mtabolisme alternatif efficace. Les cellules synthtisent des enzymes non spcifiques entranant lhydrolyse des composs phnoliques des concentrations leves. Dans ces conditions, au niveau des lipides membranaires les acides gras saturs sont remplacs par les acides gras insaturs. Ce qui modifie lespace hydrophobe tout en diminuant le flux de transport de ces composs phnoliques vers le milieu intracellulaire. Donc, ladaptation des souches crotre sur des concentrations croissantes en margines a un effet positif sur le traitement des margines. En effet, les souches testes ont permis la dgradation de la matire organique et des composs phnoliques, et la production de la biomasse sur les margines brutes. Des taux dabattement de la DCO de 78,3% ; 63,1% ; 48,4% et 40,3% ont t obtenus en prsence des souches A. niger, Penicillium sp., G. terrestre et C. boidinii respectivement aprs un mois de traitement des margines brutes. Cependant, le temps du traitement des margines brutes peut tre limit 3 jours dincubation pour C. boidinii et de 6 jours pour les autres souches puisque llimination de la quasi-totalit de la DCO et des composs phnoliques est obtenue aprs cette dure. Cette tude a montr galement l'intrt de la souche Aspergillus niger dans llimination de la DCO 78,3% et des composs phnoliques 63,1%. La ralisation du biotraitement arobie des margines lchelle industrielle peut tre confronte des problmes du cot lev du fait quil ncessite une nergie trs importante pour laration et une grande quantit deau pour les dilutions des margines. Lextraction et la purification denzymes haute valeur industrielle pourraient prsenter un intrt conomique capable de surpasser ces difficults. Puisque les margines sont riches en tannins hydrolysables et Aspergillus niger HA37 possde dans son systme enzymatique lenzyme tannase qui

134

Conclusion gnrale

hydrolyse ces composs phnoliques, nous avons pens tudier la production de cette enzyme haute valeur industrielle. Avant dentamer ce travail, nous avons pens tudier la production de lenzyme tannase par cette souche sur milieu artificiel base dacide tannique diffrentes concentrations. Cette tude a montr que lactivit enzymatique maximale augmente avec laugmentation de la concentration dacide tannique initiale. Nous avons obtenu 0,6 UE.ml-1, 0,9 UE.ml-1 et 1,5 UE.ml-1 dans les milieux contenant 0,2%; 0,5% et 1% dacide tannique respectivement. En effet, lacide tannique joue le rle dinducteur pour la production de lenzyme tannase qui est produite au dbut de la phase de croissance. Nous avons aussi not que le rendement pondral et le taux de croissance diminuent avec laugmentation de la concentration dacide tannique initiale. Ceci peut tre expliqu par le fait quen prsence des concentrations leves dacide tannique dans un milieu minimum, la souche A. niger HA37 utilise une fraction considrable du substrat pour la maintenance cellulaire. Ltude prliminaire de la production de lenzyme tannase par Aspergillus niger HA37 en utilisant les margines 25% comme milieu de culture a donn des rsultats encourageants. Cette souche produit lenzyme tannase des teneurs comparables celles obtenues sur milieu base dacide tannique 0,2%. En outre, la production de cette enzyme sur les margines 25% reste plus ou moins stable pendant plus de 30 heures, ce qui augmente les chances de son extraction. Cette production de lenzyme tannase est accompagne par des taux dabattement des composs phnoliques et de la DCO de lordre de 71,1% et 66% respectivement et dune production de la biomasse de 1 g.l-1. Notre souche A. niger HA37 est donc capable la fois de traiter les margines et de produire lenzyme tannase qui prsente une haute valeur industrielle. Nous pouvons conclure que les margines 25% constituent un milieu convenable pour la production de lenzyme tannase par A. niger HA37. En perspectives, il serait intressant dapprofondir ltude de la production de lenzyme tannase sur les margines diffrentes concentrations. Lajout des inducteurs dans le milieu de culture pourrait jouer un rle important dans la production de cette enzyme. Aprs optimisation des conditions de culture du champignon A. niger HA37 pour une production maximale de lenzyme tannase, ltude de son extraction et sa purification devrait tre ralise. Laltration des enzymes par les composs phnoliques pourrait tre vite par la modification des enzymes les plus sensibles ces composs par gnie gntique, ce qui permettrait daugmenter la stabilit des enzymes.

135

Conclusion gnrale

Il serait envisageable aussi dtudier la capacit de la co-culture des quatre souches Candida boidinii, Geotrichum terrestre, Penicillium sp. et Aspergillus niger traiter les margines. Limmobilisation des souches ainsi que linduction mtabolique pourraient jouer un rle important dans lamlioration du traitement des margines par ces souches. Nos rsultats semblent tre trs prometteurs pour des applications biotechnologiques tenant compte de linfluence considrable des aspects conomiques sur le bon droulement des procds de traitement. En utilisant un tel procd, nous pouvons traiter les margines au meilleurs rendement et faible cot. Dans le traitement biologique des margines, le problme rside dans la mconnaissance des facteurs cls de la biodgradation. Ainsi, pour llaboration dun procd biotechnologique innovant, nous devrons faire appel des tudes biochimiques et gntiques qui doivent se joindre au gnie des procds.

136

Annexes

ANNEXE I : MILIEUX DE CULTURE


Milieux de culture utiliss pour lisolement et la conservation des micro-organismes Glose nutritive Tryptone Extrait de viande NaCl Agar-agar H2O distille qsp Milieu YM Peptone Extrait de levure Extrait de malt Glucose Agar-agar H2O distille Milieu YPG Peptone Extrait de levure Glucose Agar-agar H2O distille Milieu Czapek NO3Na KH2PO4 MgSO4. 7H2O Saccharose Agar-agar H2O distille 10 g 5g 5g 15 g 1000 ml 5g 3g 3g 10 g 20 g 1000 ml 20 g 10 g 20 g 20 g 1000 ml 2g 1g 0,01 g 30 g 20 g 1000 ml 20 g 20 g 1000 ml

qsp

qsp

qsp

Milieu lextrait de malt Extrait de malt Agar-agar H2O distille qsp

Milieux de culture utiliss dans lidentification des levures Milieu PDA (Potato-Dextrose-Agar) Glucose 20 g Extrait de pomme de terre 230 g Agar-agar 20 g H2O distille qsp 1000 ml

156

Annexes

Milieu de Mac calary Glucose KI Extrait de levure Actate de sodium Agar-agar qsp H2O distille Milieu dAdams Glucose Actate de sodium Agar-agar qsp H2O distille Milieu Christensen agar Peptone Glucose Na Cl KH2PO4 Rouge de phnol Ure Agar-agar H2O distille qsp

1g 1,8 g 2,5 g 8,2 g 15 g 1000 ml 0,4 g 20 g 20 g 1000 ml 1g 1g 5g 2g 0,012 g 0,1 g 20 g 1000 ml 10 g 10 g 0,1 mg 20 g 1000 ml

Milieu indicateur au Tetrazolium Glucose Peptone Chlorure de 2.3.5 Trimethyl tetrazolium Agar-agar H2O distille qsp pH = 7

Milieu Wikerham (YNB) Sulfate dammonium Vitamines : Biotine Pantothenate de calcium Acide folique Inositol Niacine Acide para-aminobenzoique Pyridoxine hydrohloride Riboflavine Thiamine hydrochloride 3,5 g 20 g 2 g 2 g 10 g 400 g 200 g 400 g 200 g 400 g

157

Annexes

Elments en trace : Acide borique Sulfate de cuivre Iodure de potassium Chlorure ferrique Sulfate de manganse Molybdate de sodium Sulfate de Zinc Sels minraux : Phosphate de potassium monobasique Phosphate de potassium dibasique Sulfate de magnsium Chlorure de sodium Chlorure de calcium H2O distille qsp

500 g 40 g 100 g 200 g 400 g 200 g 400 g 0,85 g 0,15 g 0,5 g 0,1 g 0,1 g 1000 ml

158

Annexes

ANNEXE II : PROTOCOLE DU DOSAGE DE LENZYME TANNASE


Ractifs A. Tampon citrate, 50mM; pH 5,5 : dissoudre 10,5 g dacide citrique dans 800 ml deau distille, ajuster le pH 5,5 avec NaOH (1 N) et complter avec de leau distille 1000 ml. B. Solution dacide tannique (substrat) 0,35% : 175 mg dacide tannique/50 ml du tampon citrate (Ractif A). (A prparer juste avant le dosage). C. Solution dthanol, 90% : 900 ml dthanol (99,5%) et 95 ml de leau distille. Procdure 1. Prlever 1 ml de la solution dacide tannique (ractif B) dans le tube essai. 2. Equilibrer 30C pendant 5 min. 3. Ajouter 0,25 ml de lchantillon. 4. Incuber 30C pendant 15 min. 5. Ajouter 5 ml de la solution thanol (ractif C) et bien mlanger pour stopper la raction. 6. Prlever 0,25 ml de lchantillon et du tmoin. 7. Ajouter 5 ml de la solution dthanol (ractif C) et bien mlanger. 8. Lire la densit optique 310 nm dans une cuve en quartz (Echantillon : AS, Tmoin : A0). Le tmoin est un prlvement idem lchantillon prpar paralllement et de la mme faon sans passer par ltape 4.

Calcul Lactivit peut tre calcule en utilisant la formule suivante : Activit (U/ml) = (A0 AS) 20,3 1 (ml) 1,04 df = A 7,93 df 0,71 0,25 (ml) 15 (min) 20,3 : Micromoles dacide tannique dans 1 ml de la solution substrat (ractif B). 0,71 : Changement de labsorbance aprs hydrolyse complte de 20,3 mol dacide tannique sous les conditions dessais. 1,04 : Facteur de correction entre la mthode de Libuchi et al. et la prsente mthode. df : Facteur de dilution. C : quantit de tannase dans lchantillon (g.ml-1).

159

Annexes

ANNEXE III : CARACTERISTIQUES DES SOUCHES DE LEVURES

Candida boidinii (Souches 2, 3, 10)


Croissance 37C : Croissance 42C : Pellicule : + Myclium : + Formation des spores : Blastospores Urease : Assimilation des nitrates : + Croissance sur milieu sans vitamines : + Prsence de cycloheximide : +

Fermentation des sucres : Glucose : + Galactose : Saccharose : Maltose : + Lactose : Trhalose : -

Assimilation des composs organiques : Glucose : + Galactose : Saccharose : + Maltose : Cellobiose : Trhalose : + Lactose : Raffinose : Amidon : Xylose : + Arabinose : + Ribose : + Rhamnose : Erythritol : + Ribitol : + Mannitol : + Acide succinique : + Acide citrique : + Inositol : Melizitose : Inulin : + Arbutin : + Mannose : + Sorbitol : + Dextran : Mthyle glucoside : +

160

Annexes

Candida diddensiae (Souches 5,7)


Croissance 37C : + Croissance 42C : Pellicule : Myclium : + Formation des spores : Blastospores Urease : Assimilation des nitrates : Croissance sur milieu sans vitamines : Prsence de cycloheximide : -

Fermentation des sucres : Glucose : + Galactose : Saccharose : Maltose : Lactose : Trhalose : +

Assimilation des composs organiques : Glucose : + Galactose : + Saccharose : + Maltose : + Cellobiose : + Trhalose : + Lactose : Raffinose : Amidon : Xylose : Arabinose : + Ribose : Rhamnose : Erythritol : + Ribitol : + Mannitol : + Acide succinique : + Acide citrique : Inositol : Melizitose : + Inulin : Arbutin : + Mannose : + Sorbitol : Dextran : Mthyle glucoside : -

161

Annexes

Candida wickerhamii (Souche 12)


Croissance 37C : Croissance 42C : Pellicule : Myclium : Formation des spores : Blastospores Urease : Assimilation des nitrates : + Croissance sur milieu sans vitamines : + Prsence de cycloheximide : +

Fermentation des sucres : Glucose : + Galactose : Saccharose : + Maltose : Lactose : Trhalose : -

Assimilation des composs organiques : Glucose : + Galactose : + Saccharose : + Maltose : Cellobiose : + Trhalose : Lactose : Raffinose : Amidon : Xylose : + Arabinose : Ribose : Rhamnose : Erythritol : Ribitol : Mannitol : Acide succinique : Acide citrique : + Inositol : Melizitose : Inulin : Arbutin : + Mannose : + Sorbitol : Dextran : Mthyle glucoside : -

162

Annexes

Geotrichum terrestre (Souche 11)


Croissance 37C : + Croissance 42C : Pellicule : + Myclium : + Formation des spores : Blastospores et Arthrospores Urease : Assimilation des nitrates : + Croissance sur milieu sans vitamines : + Prsence de cycloheximide : +

Fermentation des sucres : Glucose : + Galactose : Saccharose : Maltose : Lactose : Trhalose : -

Assimilation des composs organiques : Glucose : + Galactose : + Saccharose : + Maltose : + Cellobiose : Trhalose : + Lactose : Raffinose : + Amidon : Xylose : + Arabinose : + Ribose : + Rhamnose : + Erythritol : + Ribitol : + Mannitol : + Acide succinique : + Acide citrique : + Inositol : Melizitose : + Inulin : + Arbutin : + Mannose : + Sorbitol : + Dextran : + Mthyle glucoside : +

163

Annexes

Pichia kluyveri (Souche 4)


Croissance 37C : + Croissance 42C : Pellicule : + Myclium : Formation des spores : Ascospores Urease : + Assimilation des nitrates : Croissance sur milieu sans vitamines : Prsence de cycloheximide : -

Fermentation des sucres : Glucose : + Galactose : Saccharose : Maltose : Lactose : Trhalose : -

Assimilation des composs organiques : Glucose : + Galactose : Saccharose : + Maltose : Cellobiose : Trhalose : + Lactose : Raffinose : Amidon : Xylose : Arabinose : Ribose : Rhamnose : + Erythritol : Ribitol : Mannitol : Acide succinique : + Acide citrique : + Inositol : Melizitose : Inulin : Arbutin : + Mannose : + Sorbitol : Dextran : Mthyle glucoside : -

164

Annexes

Pichia membranaefaciens (Souches 1, 6)


Croissance 37C : + Croissance 42C : Pellicule : + Myclium : Formation des spores : Ascospores Urease : + Assimilation des nitrates : Croissance sur milieu sans vitamines : + Prsence de cycloheximide : -

Fermentation des sucres : Glucose : + Galactose : Saccharose : Maltose : Lactose : Trhalose : -

Assimilation des composs organiques : Glucose : + Galactose : Saccharose : Maltose : Cellobiose : Trhalose : + Lactose : Raffinose : Amidon : Xylose : Arabinose : Ribose : Rhamnose : + Erythritol : Ribitol : Mannitol : Acide succinique : + Acide citrique : + Inositol : Melizitose : Inulin : Arbutin : + Mannose : Sorbitol : Dextran : Mthyle glucoside : -

165

Annexes

Saccharomyces cerevisiae (Souche 9)


Croissance 37C : + Croissance 42C : Pellicule : Myclium : Formation des spores : Ascospores Urease : + Assimilation des nitrates : Croissance sur milieu sans vitamines : Prsence de cycloheximide : -

Fermentation des sucres : Glucose : + Galactose : + Saccharose : + Maltose : + Lactose : Trhalose : +

Assimilation des composs organiques : Glucose : + Galactose : + Saccharose : + Maltose : Cellobiose : Trhalose : Lactose : Raffinose : Amidon : + Xylose : Arabinose : Ribose : Rhamnose : Erythritol : Ribitol : Mannitol : Acide succinique : Acide citrique : + Inositol : Melizitose : Inulin : Arbutin : + Mannose : + Sorbitol : Dextran : Mthyle glucoside : -

166

Annexes

Zygosaccharomyces fermentati (Souche 8)


Croissance 37C : + Croissance 42C : Pellicule : Myclium : Formation des spores : Ascospores Urease : + Assimilation des nitrates : Croissance sur milieu sans vitamines : Prsence de cycloheximide : +

Fermentation des sucres : Glucose : + Galactose : + Saccharose : + Maltose : + Lactose : Trhalose : +

Assimilation des composs organiques : Glucose : + Galactose : + Saccharose : + Maltose : Cellobiose : + Trhalose : + Lactose : Raffinose : + Amidon : Xylose : Arabinose : Ribose : Rhamnose : Erythritol : Ribitol : Mannitol : Acide succinique : + Acide citrique : Inositol : Melizitose : Inulin : + Arbutin : + Mannose : + Sorbitol : Dextran : Mthyle glucoside : -

167

Annexes

CARACTERISTIQUES MORPHOLOGIQUES DES SOUCHES DE CHAMPIGNONS

Figure 31 : Croissance de la souche Aspergillus niger HA37 sur milieu Czapek.

Figure 31 : Croissance de la souche Penicillium sp. sur milieu lextrait de malt.

168

Annexes

ANNEXE IV : LISTE DES FIGURES ET DES TABLEAUX


Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 : Aires de rpartition des oliviers au monde (Amoretti et Comet, 1985). : Rpartition gographique des principales zones olicoles nationales. : diagramme de traitement des olives par pression et nature des diffrents sousproduits (Nefzaoui, 1987). : Procd dobtention de lhuile dolive par centrifugation et nature des diffrents sous-produits (Nefzaoui, 1987). : Schma descriptif du procd super-presse utilis pour lextraction dhuile dolive avec les sous-produits engendrs. : Hydroxylation de l'acide parahydroxybenzoque par la monooxygnase. : Hydroxylation de l'acide benzoque en Catchol par la dioxygnase. : Ortho-clivage du Catchol. : Voies Mtaboliques de dgradation par ortho-clivage : Mta-clivage du Catchol. : Voies de dgradation par mta-clivage : Double quipements enzymatiques des bactries du genre Pseudomonas impliques dans les deux types de clivages. : Principales voies microbiennes de dgradation de plusieurs composs aromatiques rencontrs lors de la biodgradation des composs aromatiques (Dagley, 1983). : Electrophorse en gel d'agarose des produits PCR en utilisant les primers V3-1 et V3-2 des souches de levures. : Electrophorse en gel d'agarose des produits PCR aprs purification des souches de levures. : Schma synoptique du traitement en cascade des margines avec les souches tudies. : Taux dabattement des composs phnoliques par les quatre souches en fonction de la concentration initiale en margines aprs 36h dincubation. : Taux dabattement de la DCO soluble en fonction de la concentration initiale en margines par les quatre souches aprs 36h dincubation. : Evolution des composs phnoliques dans les margines brutes en fonction du temps par les souches tudies. : Evolution de la DCO dans les margines brutes en fonction du temps par les souches tudies. : Evolution de la biomasse produite dans les margines brutes en fonction du temps par les souches tudies. : Corrlation entre lvolution de la DCO et celle des composs phnoliques. : Croissance dAspergillus niger HA37 sur l'acide tannique 1%.

Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 Figure 19 Figure 20 Figure 21 Figure 22 Figure 23

169

Annexes

Figure 24 Figure 25 Figure 26 Figure 27 Figure 28 Figure 29 Figure 30 Figure 31

: Production de lacide gallique et du glucose partir des tannins hydrolysables sous laction de lenzyme tannase. : Variation de la concentration de lacide tannique (AT) et du CO2 en fonction du temps. : Concentration de lenzyme tannase libre par A. niger HA37 dans les trois types de milieu en fonction du temps : Biomasse produite par A. niger HA37 sur diffrentes concentrations dacide tannique aprs 48 heures dincubation. : Evolution de la teneur des composs phnoliques et de lenzyme tannase produite par A. niger HA37 dans les margines en fonction du temps. : Profil dlution du mlange des margine avant et aprs traitement par A. niger HA37. : Croissance de la souche Aspergillus niger HA37 sur milieu Czapek. : Croissance de la souche Penicillium sp. sur milieu lextrait de malt.

Tableau 1 Tableau 2 Tableau 3 Tableau 4 Tableau 5 Tableau 6 Tableau 7 Tableau 8 Tableau 9 Tableau 10 Tableau 11 Tableau 12 Tableau 13 Tableau 14 Tableau 15

: Nombre doliviers et les superficies occupes par les oliveraies dans les six principaux pays mditerranens olicoles (Faostat, 2001). : Rpartition par rgion des principales units industrielles et traditionnelles (Masras) (Achkari-Begdouri, 1994). : Comparaison de la charge organique des margines issues du procd en continu et du procd en discontinu (Ranalli, 1991a ). : Principales composantes des margines (Lutwin et al., 1996). : Composition minrale des margines (Salvemini, 1985). : Constituants minraux des margines (Lutwin et al., 1996). : Concentrations des Cations et des Anions dans les margines issues dun systme par pression (omww1) et dun processus par centrifugation (omww2). : Composition des mtaux contenus dans les polymres. : Composition des monosaccharides contenus dans les polymres. : Composition des acides amins des polymres des margines (Capasso et al., 2002a). : Teneur de quelques composs phnoliques identifis dans les margines (Balice et Cera, 1984). : Composition phnolique des margines tudie par DAnnibale et al. (2000). : Phnols totaux, ortho-diphnol et monomres aromatiques contenus dans les margines (Casa et al., 2003). : Composs phnoliques identifis dans des margine (Borja et al., 1995a). : Procds physiques et biologiques de traitement des margines (Bastista et Giorgo, 1988).

170

Annexes

Tableau 16 Tableau 17 Tableau 18 Tableau 19 Tableau 20 Tableau 21 Tableau 22 Tableau 23 Tableau 24 Tableau 25 Tableau 26 Tableau 27 Tableau 28 Tableau 29 Tableau 30 Tableau 31 Tableau 32 Tableau 33 Tableau 34 Tableau 35

: Evaluation des processus de traitement des margines (Hamdi, 1993a). : Performances des procds de mthanisation appliqus aux margines. : Composition physico-chimique du compost final (Galli et al., 1994). : Microorganismes utiliss pour la production des POU sur les margines (Yazcioglu et Celikkol, 1978). : Utilisation des levures pour la production de POU partir des margines. : Composition chimique de la pte des margines obtenue par Dalmolive (Martilotti, 1993). le procd

: Composition organique des margines collectes partir de la station d'vaporation naturelle de Fs. : Composition minrale des margines tudies. : Composition mtallique des margines collectes partir de la station d'vaporation naturelle de Fs. : Caractrisation microbiologique des margines de la station dvaporation naturelle. : Liste des souches de levures identifies partir des margines. : Caractrisation morphologique, physiologique et biochimique des souches isoles des margines. : Composition physico-chimique des margines fraches. : Etude de la croissance des micro-organismes isols des margines sur les diffrentes sources de carbone. : Dosage de la biomasse produite dans les margines diffrentes concentrations aprs 36 h dincubation : Evolution du pH en fonction du temps dans les margines brutes traites par les souches tudies. : Enzymes produites par A. niger et leurs applications lchelle industrielle. : Bioconversion de plusieurs effluents agro-alimentaires par A. niger. : Croissance des souches de bactries, levures et de champignons isoles des margines sur milieu base dacide tannique 0,5%. : variation des paramtres cintique en fonction de la concentration initiale dacide tannique.

171

Rfrences bibliographiques

Achkari-Begdouri A. (1994) Problmatique des margines produites par les huileries et possibilits de valorisation et de traitement. Rapport destin la cellule dtudes dimpact sur lenvironnement, Ministre de lintrieur, Royaume du Maroc. Aggelis G., Margariti N., C Kralli C., Flouri F. (2000) Growth of Candida boidinii on methanol and the activity of methanol-degrading enzymes as affected from formaldehyde and methylformate. J. Biotechnol., 80 (2), 119-25. Aguilar C.N., Augur C., Favela-Torres E., Viniegra-Gonzalez G.(2001) Production of tannase by Aspergillus niger Aa-20 in submerged and solid-state fermentation : influence of glucose and tannic acid Food Research Department, Universidad Autonoma de Coahuila, Saltillo, Coah, Mexico.J Ind Microbiol Biotechnol., 26 (5), 296-302. Aissam H., Sendide K., Benlemlih M. (2001) Etude et traitement biologique prliminaire de la pollution azote et phosphore contenue dans les effluents d'industries agro-alimentaires. Ann. Chim. Sci. Mat., 26, 391-396. Aissam H., Errachidi F., Merzouki M., Benlemlih M. (2002) Identification des levures isoles des margines et tude de leur activit catalase. Cahiers de l'Association Scientifique Europenne pour l'Eau et la Sant, 7, 23-30. Al-Malah K., Azzam M.O.J., Abu-Lail N.I. (2000) Olive mills effluent (OME) wastewater post-treatment using activated clay. Separation and Purification Technology, 20, 225-234. Amat P., Rinaldi A., Sanjust E., Satt G., Viola A. (1986) Vegetable material in water in the olive oil industry: raw material or polluting waste. Riv. Merceol, 25, 183-199. Amirante P., Montervino A. (1996) Epuration par concentration thermique des effluents des huileries dolives et compostage du concentr. Une exprience applique dans les pouilles, Olivea, 63, 64-69. Amoretti M.C., Comet G. (1985) Le livre de lolivier. EDISUD. Anderson G., Donnelly T., Rippon G.M. (1977) Digestion anaerobia de aguas residuales industriales. Actas I. Congreso national de Quimica, Vigo., 549-565. Anderson J.J., Dagley S. (1980) Catabolism of aromatic acids in Trichosporon cutaneum. J., Bacteriol., 141, 534 - 543. Anderson J.G., Blain J.A., Marchetti P., Todd J.R. (1981) Processing of model dilute carbohydrate wastes using Aspergillus niger in disc fermenters. Biotechnol. Lett., 8, 451-454. Annaki A., Chaouch M., Rafiq M. (1999a) Elimination des margines par vaporation naturelle. L'eau, L'industrie, Les nuisances, 1, 99-107. Annaki A., Chaouch M., Rafiq M. (1999b) Influence de la dure du stockage des olives sur l'volution de la composition des margines. L'eau. L'industrie. Les nuisances, 218, 24-28. Antonacci R., Brunetti A., Rozzi A., Santori M. (1981) Trattemento anaerobico di acqua vegetazione di frantoio. I. Rissultati preliminanari. Ingegneria sanitara, 6, 257-262.

137

Rfrences bibliographiques

Arienzo M., Capasso R. (2000) Analysis of metal cations and inorganic anions in olive oil mill waste waters by atomic absorption spectroscopy and ion chromatography. Detection of metals bound mainly to the organic polymeric fraction. J Agric Food Chem., 48 (4), 1405-10. Asehraou A. (1993) Etude physico-chimique et microbiologique des olives vertes crues et en fermentation et des olives noires. Thse 3me Cycle. Univ. Cadi Ayyad, Fac. Sci., Semlalia. Assas N., Marouani L., Hamdi M. (2000) Scale down and optimization of olive mill wastewaters decolorization by Geotrichum candidum Bioprocess Engineering, 22 (6), 503-507. Assas N., Ayed L., Marouani L., Hamdi M. (2002) Decolorization of fresh and stored and stored-black olive mill wastewaters by Geotrichum candidum. Pro. Biochem., (sous press). Auger D. (1989) Methode du dosage de cadmium, du cuivre, du plomb et du zinc dans la chair du poisson. Direction de lenvironnement et des recherches ocanique. DERO 89-07MB. Aveni A. (1984) Biogaz from olive mill wastewater by anaerobic digestion. In anaerobic digestion and carbohydrate hydrolysis of waste. Eds Ferrero G.L., Ferranti M.P., Naveau H., Elsevier Applied Science, Barking. Baccioni L. (1981) Ricido delle acque e loro incenerilento : una soluzione per la depurazione delle acque dei frantoi. Riv. Ital. Sostanze Grasse, LVIII, 34-37. Bajpai B., Patil S. (1997) Induction of tannin acyl hydrolase (EC 3.1.1.20) activity in some members of fungi imperfecti. Enzyme Microb Technol., 20, 612-614. Balice V., Boari G., CERA O., Abbaticchio P. (1982) Indagine analitica sulle acque di vegetazione. Nota 1., Inquinamento, 7, 49-53 Balice V., Cera O. (1984) Acidic phenolic fraction of the juice of olives determined by gas chromatographic method. Grasas y Aceites, 25, 178-180. Balice V., Carriera C., Cera O., Difacio A. (1986) Naturel biodegradation in olive mill effluents stored in opened basins. In: International Symposium on olive by products Valorization FAO, Seville, Spain, 101-118. Balice V., Carieri C., Cera O., Rindone B. (1988) the fate of tannin-like compounds from olive mill effluents in biological treatment. In: Hall, E. R. and hobson, P. N. (Eds). Proceedings of the Fifth Internationl. Symposium: On Anaerobic Digestion. Bologna, 275280 Academic Press. Italy. Balice V., Carrieri C., Carrieri G. (1997) Trattamento chimico-fisico seguito dal biologico delle aque di vegetazione delle olive, Ricerca, 2, 50-53. Bambalov G., Israilides C., Tanchev S. (1989) Alcohol Fermentation in olive Oil Extraction Effluents, Biological Wastes, 27, 71-75. Barnett J.A., Payne R.W., Yarrow D. (1990) Yeasts: Characteristics and identification. 40 West 20th Street, New York.

138

Rfrences bibliographiques

Beccari M., Bonemazzi F., Majone M., Riccardi C. (1996) Interaction between acidogenisis in the anaerobic treatment of olive oil mill effluents. Wat. Res., 30, 183-189. Beccari M., Majone M., Torrisi L. (1998) Two reactor system withpartial phase separation for anaerobic treatment of olive oil mill effluents. Wat. Sci. Tech., 38, 53-60. Beccari M., Majone M., Riccardi C., Savarese F., Torrisi L. (1999) Integrated treatment of olive oil mill effluents : effect of chemical and physical pretreatment on anaerobic treatability. Wat. Sci. Tech., 40, 347-355. Beccari M., Majone M., Petrangeli Papini M., Torrisi L. (2000) Enhancement of anaerobic treatability of olive oil mill effluents by addition of Ca(OH)2 and bentonite without intermediate solid/liquid separation. Proceedings of the First World Congress of International Water Association, Paris, July 3-7. Bechak J.P. Mercier B., Nuer P. (1984) Traitement des eaux uses. Ed. Eyrolles, Paris, 281p. Benitez J., Bertrans-Heredia J., Torregrosa J., Acero J.L., Cercas V. (1997) Aerobic degradation of olive mill wastewaters. Appl. Microbiol. Biotechnol., 47, 185-188. Benlemlih M., Danglot C., Kuchta W., Vilagines R. (1991) Perspectives ouvertes par le gnie gntique sur les traitements des pollutions par les hydrocarbures. Revue annuelle de Institut Franais de Recherche pour lExploitation de la Mer, 7, 228-247. Bertin L., Majone M., Di Gioia D., Fava F. (2001) Anaerobic fixed-phase biofilm reactor system for the degradation of the low-molecular weight aromatic compounds occurring in the effluents of anaerobic digestors treating olive mill wastewaters. J. Biotechnol., 87 (2), 161-77. Boari G., Brunetti A., Passino R., Rozzi A. (1984) Anaerobic digestion of olive oil mill waste-waters. Agric. Wastes, 10, 161-175. Borja R., Martin M.A., Duran Barrantes M.M. (1992) Kinetic study of biomethanization of olive mill wastewater previously subjected to aerobic treatment with Geotrichum candidum. Grasas y Aceites, 43, 82-86. Borja R., Garrido E.S., Martinez L., Cormenzana R.A., Martin M.A. (1993) Kinetic study of anaerobic digestion of olive mill wastewater previously fermented with Aspergillus terreus. Process Biochem., 28, 397-404. Borja R., Martin A., Alonso V., Garcia A.I., Banks C.J. (1994a) Influence of different aerobic pre-treatement on the kinetic of anaerobic digestion of olive mill wastewater. Water Research, 19, 489-495. Borja R., Martin M.A., Maestro Duran R., Alba Mendoza J., Fiestas Ros de Ursinos J.A. (1994b) Enhancement of the anaerobic digestion of olive mill wastewaters by removal of phenolic inhibitoris. Process. Biochem., 27, 231-237. Borja R., Banks C.J., Alba J. (1995a) A simplified method for determination of kinetic parameters to describe the aerobic biodegradation of two important phenolic constituents of olive mill wastewater treatement by a heterogeneous microbial culture. Eniro, Sci. Health., A., 30 (3), 607-626.

139

Rfrences bibliographiques

Borja R., Alba J., Garrido S.E., Martinez L., Garcia M.P., Monteoliva M., Ramos-Cormenzana A. (1995b) Effect of aerobic pretreatment with Aspergillus terreus on the anaerobic digestion of olive-mill wastewater, Biotechnol. Appl. Biochem., 22, 233-246. Borja R., Martin M.A., Banks C.J., Alonso V., Chica A. (1995c) Kinetic study of anaerobic digestion of olive mill wastewater at mesophilic and thermophilic temperatures. Environ. Pollution, 88, 13-18. Bouranis D.L., Vlyssides A.G., Drosopoulos J.B., Karvouni G. (1995) Somme characteristics of new organic soil conditioner from the co-composting of olive oil processing wastewater and solid residue. Soil. Sci. Plant. Annal., 26, 2461-2472. Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principale of protein-dye binding. Anal Biochem., 72, 248-254. Bradoo S., Gupta R., Saxena R.K. (1997) Parametric optimization and biochemical regulation of extracellular tannase from Aspergillus Japonicus. Proc Biochem., 32, 135-139. Brenes M., Garcia A., Garcia B., Rios J.J., Garrido A. (1999) phenolic compouds in spanish olive oils. Agric. Food Chem., 47, 3535-3540. Buldini P.L., Mevoli A., Quirini A. (2000) On-line microdialysis-ion chromatographic determination of inorganic anions in olive-oil mill wastewater. J Chromatogr A., 882 (1-2), 321-8. Cabello L., Fiestas Ros de Ursinos J.A. (1981) Diffrentes utilisations des margines. Sminaire international sur la valorisation des sous-produits de lolivier. FAO, Tunis. Tunisie. Cabrera F., Lopez R., Martinez-Bourdiu E., Dupuy De Lome E., Murillo J.M. (1996) Land treatment of olive oil mill wastewater. International Biodegradation and Biodeterioration, 38, 215-225. Cantarelli C., Brenna O., Giovanelli G., Rossi M. (1989) Beverage stabilization through enzymic removal of phenolics. Food. Biotech., 3, 203-213. Capasso R., Evidente A., Scognamiglio F.A. (1992) Simple thin layer chromatographic method to detect the main polyphenols occurring in olive oil vegetation waters, Phytochemical. Analysis, 3, 270-275. Capasso R., Evidente A., Schivo L., Orru G., Marcialis M.A., Cristinzio G. (1995) Antibacterial polyphenols from Olive Oil Mill Waste Waters. J. Appl. Bacteriol., 79, 393-398. Capasso R. (1997) The chemistry, biotechnology and ecotoxicology of the polyphenols naturally occurring in vegetable wastes. Curr. Top. Phytochem., Res. Trends, 1, 145-156. Capasso R., De Martino A., Arienzo M. (2002a) Recovery and characterization of the metal polymeric organic fraction (polymerin) from olive oil mill wastewaters. J Agric Food Chem., 50 (10), 2846-55.

140

Rfrences bibliographiques

Capasso R., De Martino A., Cristinzio G. (2002b) Production, characterization, and effects on tomato of humic acid-like polymerin metal derivatives from olive oil mill waste waters. J Agric Food Chem., 50 (14), 4018-24. Casa R., D'Annibale A., Pieruccetti F., Stazi S.R., Giovannozzi Sermanni G., Lo Cascio B. (2003) Reduction of the phenolic components in olive-mill wastewater by an enzymatic treatment and its impact on durum wheat (Triticum durum Desf.) germinability. Chemosphere, 50 (8), 959-66. Castillo-Rivera L.A. (1999) Etude deffluent difficilement biodgradable: Caractrisation et traitement par procds doxydation avance (POA). Thse de Doctorat. Universit AixMarseille I, Marseille, France, 35-54. Chamrani C. (1994) Etude et possibilits du traitement physico-chimique des margines des huileries dolive du Maroc, Mmoire dingnieur dtat. IAV, Rabat. Maroc. Chang S.K., Li C., Hiang S., Chang M.C. (1995) Intraspecific protoplast fusion of Candida tropicalis for enhancing phenol degradation. Appl. Microbiol. Biotechnol., 43, 534-538. Chimi H. (1997) Sous produits de la transformation des olives: possibilits de valorisation et de traitement des margines. Cours international sur lamlioration de la qualit de lhuile dolive. 30-11 Cichelli A., Solinas M. (1984) I composti fenolici delle olive e delloloi di oliva. Riv. Merceol, 23, 55-69. COI. (2000) Conseil Olicole International, Olivae (2000). Cossu R., Blakey N., Cannas P. (1993) Influence of Codisposal of Municipal Solid Waste and Olive Vegetation Water on the Anaerobic Digestion of a Sanitary Landfill, Wat Sci Tech., 27 (2), 261-271. Cova B. (1988) II processo snia fibre per il trattamento dei frantoi oleari. 2a tavola rotonda sulle acqua reflue dei frantoi. Accademia Ntionle dellOlive. Spoleto, 334-39. Cullen D., Krersten P.J. (1996) Enzymology and molecular biology of legnin degradation. The Mycota III Biochimestry and Molecular Biology (Branbl / Marzult ed 1), 295-312. DAnnibale A., Crestini C., Vinciguerra V., Sermanni G.G. (1998) The biodegradation of recalcitrant effluents from an olive mill by a white-rot fungus. J Biotechnol., 61 (3), 209-18. D'Annibale A., Stazi S.R., Vinciguerra V., Giovannozzi Sermanni G. (2000) Oxiraneimmobilized Lentinula edodes laccase: stability and phenolics removal efficiency in olive mill wastewater. J Biotechnol., 77 (2-3), 265-73. Dagley S. (1983) Microbial degradation of aromatic compounds. In proc. Of the fortieth general meeting of the society for industrial microbiology, August 14-19. Florida, USA.

141

Rfrences bibliographiques

De Felice B., Pontecorvo G., Carfagna M. (1997) degradation of waste waters from olive oil mills by Yarrowia lipolytica ATCC 20 255 and pseudomonas pitida. Acta Biotechnol., 17, 231-239. Di Gioia D., Bertin L., Fava F., Marchetti L. (2001a) Biodegradation of hydroxylated and methoxylated benzoic, phenylacetic and phenylpropenoic acids present in olive mill wastewaters by two bacterial strains. Res Microbiol., 152 (1), 83-93. Di Gioia D., Fava F., Bertin L., Marchetti L. (2001b) Biodegradation of synthetic and naturally occuring mixtures of mono-cyclic aromatic compounds present in olive mill wastewaters by two aerobic bacteria. Appl Microbiol Biotechnol., 55 (5), 619-26. Diamadopoulos E., Samaras P., Sakellaropoulos G.P. (1992) The effect of actived carbon properties on the adsorption of toxic substances. Wat. Sci. Tech., 25, 153-160. Di-Giovacchino L., Mascolo A., Seghitti L. (1988) Sulle caractteristiche telle delle acque di vegetazione delle olive. La Rivista delle Sotanze Grasse. 65. Di-Giovacchino L. (1996) Linfluence des systmes dextraction, sur la qualit de lhuile dolive, Olivea, 63, 52-63. Dommergues Y. (1971) Interrelations sans caractre symbiotique entre la vgtation et la microflore du sol : leffet litire. La vie dans les sols : aspects nouveaux, tudes exprimentales. Gauthier-Villars dit., Paris, 423-471. Douglas S., Mountfort D., White Asher R.A. (1990) Oxidation of Lignin-related Aromatic Alcools by Cell suspensions of methylosinus trichosprorium. Appl. And. Environmtal. Microbiol., 56, (1), 245-249. Dubois M., Gilles K., Hamilton J., Rebers P., Smith F. (1956) Colorimetric method for determination of sugars and related substances. Anal. Chem., 28, 350-356. Dupont P.F., Hedrick L.R. (1971) Deoxyribonucleic acid base composition and numerical taxonomy of yeasts in the genus Trichosporon. J. Gen. Microbiol, 66, 349-359. Ehaliotis C., Papadopoulou K., Kotsou M., Mari I.I., Balis C. (1999) Adaptation and population dynamics of Azotobacter vinelandii during aerobic biological treatment of olivemill wastewater. FEMS Microbiol Ecol., 30 (4), 301-311. EL Kasmi, Brachman R., Fuchus F., Ragsdale S.W. (1995) Hydroxybenzonyl-CoA reductase : Coupling. Kinetics and Electrochemistry to enzyme mechanisms. Ercoli E., Ertola R. (1983) SCP production from olive black water. Biotechnol. Lett., 7, 457462. Ergder T.H., Guven E., Demirer G.N. (2000) Anaerobic treatment of olive mill wastes in batch reactors. Process Biochem., 36 (3),243-248. Errachidi F. (1997) Amlioration dune souche de Candida tropicalis EF 14 pour la production dthanol et lassimilation des phnols. Thse de 3me cycle en biologie. Facult des Sciences de Fs (Maroc).

142

Rfrences bibliographiques

Fadil K., Chahlaoui A., Ouahbi A., Zaid A., Borja R. (2003) Aerobic biodegradation and detoxification of wastewaters from the olive oil industry. International biodeterioration & biodegradation, 51, 37-41. Faostat (2001) Base de Donnes Agricoles FAOSTAT-FAO. Fedeli E. (1977) Lipids of olives. Pros. Chem. Fats other lipids, 15, 57-74. Fell J. W. (1993) Rapid identification of yeast species using three primers a polymerase chain reaction. Mol. Mar. Biol. Biotechnol., 1, 175-186. Fenice M., Giovannozzi Sermanni G., Federici F., D'Annibale A. (2003) Submerged and solid-state production of laccase and Mn-peroxidase by Panus tigrinus on olive mill wastewater-based media. J Biotechnol, 100 (1), 77-85 Fernandez Diaz M.J. (1983) Olives. In Rehm HJ, Reed G (eds) Biotechnology, Verlag Chemie, Weinheim, 5, 379-397. Field J.A., Lettinga G. (1991) Treatment and detoxification of acqueous spruce bark extracts by Aspergillus niger, Water Sci. Technol., 24, 3/4 127-137. Fiestas Ros de Ursinos J.A. (1958) Caractristiques et Elimination des eaux rsiduelles des usines huile. Ire Confrence Internationale des Techniciens olicoles. 21-27, Mai, TangerMaroc. 5-12. Fiestas Ros de Ursinos J.A. (1961) Estudio del alpecin para su aprovechamiento industrial V. Cinetica del desarrollo de la levadura Torulopsis utilis en el alpechin. Grasas y Aceites, 12, 57-66. Fiestas Ros de Ursinos J.A. (1966) Estudio del alpecin para su aprovechamiento industrial VII. Instalacion comercial para la obtencion de levaduras-pienso. Grasas y Aceites, 17, 41-47. Fiestas Ros de Ursinos J.A. (1977) Problemas del aprovechamiento y depuracion de las aguas residuales de las almazaras. XIII. Reunion plenaria asamblea mieembros dil instituto de la Grasa y Sus Derivados. Fiestas Ros de Ursinos J.A. (1981) Diffrentes utilisations des margines. Actes du Sminaire Internatinal sur la valorisation des sous produits de lolivier. Organisation des Nations Unies pour lAlimentation et lAgriculture (FAO). 93-110. Tunisie. Fiestas Ros de Ursinos J.A., Leon Gabello R., Garcia Buendia A.J., Maestrojuan Saez de Jauragui G.M. (1982) Energy production in the olive oil industry from biomethanisation of its effluents. Food Ind. Environ., 9, 163-172. Fiestas Ros de Ursinos J.A. (1986) Possibilidades de utilizacion del alpechin como fertilisante. Simposio Internacional. Sobre Valorizacion de los subproductos del olivar : alpechin y orujo. 5-6-7 Marzo, Sevilla- Aspana. 321-330. Fiestas Ros de Ursinos, J.A., Borja R. (1992) Use and traetement of olive mill wastewater : Current situation and prospects in Spain. Grasas y Aceites, 2, 101-106.

143

Rfrences bibliographiques

Fiorelli F., Pasetti L., Galli E. (1996) Fertility-Promoting metabolites produced by Azotobacter vinelandii grown on olive-mill wastewaters. International Biodeterioration & Biodegradation, 165-167. Florenzano G., Balloni W. (1983) Trattamento e utulizzazione delle acque di scarico di oleificio: considerazioni analitiche e proposte technologiche. Genio Rurale, 9, 342-348. Flouri F., Sotirchos D., Ioannidou S., Balis C. (1996) Decolorization of olive oil mill liquid wastes by chemical and biological means. International Biodeterioration & Biodegradation, 189-192. Fountoulakis M.S., Dokianakis S.N., Kornaros M.E., Aggelis G.G., Lyberatos G. (2002) Removal of phenolics in olive mill wastewaters using the white-rot fungus Pleurotus ostreatus. Water Res., 36 (19), 4735-44. Francesco G.L. (1993) Evaluations conomiques sur linnovation technologique. Les problmes de lenvironnement dans le lecteur olicole en Italie. Olivae, 47, 15-20. Galli E., Pasetti L., Volterra E., Tomati U. (1994) Compost from olive processing industry waste waters. Congresso Internazionale, Lapporoccio Integrato della Moderna Biologia : Uomo, Territorio, Ambiente, 1, 22-25. Vieste (FG). 22-25 Settembre Italia. Garcia Garcia I, Jimenez Pena PR, Bonilla Venceslada JL, Martin Martin A, Martin SantosMA, Ramos Gomez E.(2000) Removal of phenol compounds from olive mill wastewater using Phanerochaete chrysosporium, Aspergillus niger, Aspergillus terreus and Geotrichum candidum. Process Biochem, 1, 35 (8), 751-758. Garcia-Ribera R., Monteoliva-Sanchez M., Ramos-Cormenzana A. (2001) production of polyhidroxyalkanoates by Pseudomonas putida KT2442 harbouring pSK2665 in waste water from oil mills (alpechin). EJB Electronic journal of Biotechnology, 4 (2), 1-4. Garrido Hoyos S.E., MartinezNieto L., CamachoRubio F., RamosCormenzana A. (2002) Kinetics of aerobic treatment of olive-mill wastewater (OMW) with Aspergillus terreus. Pro. Biochem., 37, 1169-1176. Gharsallah N. (1993) Production of single cell protein from olive mill wastewater by yeasts. Environ. Technol., 14, 391-395. Gharsallah N. (1994) Influence of dilution and phase separation on the anaerobic digestion of olive mill wastewaters. Bioproc. Engineering. 10, 29-34. Gharsallah N., Labat M., Aloui F., Sayadi S. (1999) The effect of Phanerochaete chrysosporium pretreatment of olive mill wastewaters on anaerobic digestion. Ressources Conservation and recycling, 27, 187-192. Gibriel A.Y., Mahmoud R.M., Goma M., Abou-Zeid M. (1981) Production of single cell protein from cereal by-products. Agricultual Wastes, 3, 229-240. Giulietti A.M., Ercoli E., Ertola R. (1984) Purification and utilization of olive black water and distillery slops by microbial treatment. Acta Cient Venez 35, 76-86.

144

Rfrences bibliographiques

Gonzalez M.D., (1986) Ensayo de sensibilidad de bacterias aisladas de suelo frente al alpechin, Memoria de licenciatura. Faculta de Famacia Universidad de Granada. Espana. Gonzalez M.D., Moreno E., Quevedo-Sarmiento J., Ramos-Cormenzana A. (1990) Studies on antibacterial activity of waste waters from olive oil mills (alpechin) : Inhibitory activity of phenolic and fatty acids. Chemosphere, 20, 423-432. Goto S., Iwasaki H., Okuma Y., Ito Y., Endo A. (1987) New species belonging to the genera Pichia and Candida. Journal of general and Applied microbiology, 33, 275-286. [Candida hinoensis, C. soli, C. solicola, Pichia galeiformis] Hagerman A.E., Robbins C.T., Weerasuriya Y., Wilson T.C., Mcarthur C. (1992) Tannin chemistry in relation to digestion. Journal Range Manage, 45, 57-62. Hamdi M., Garcia J.L. (1991) Comparison between anaerobic filter and anaerobic contact process for fermented olive mill wastewaters. Biores. Technol, 38, 23-29. Hamdi M. (1991a) Nouvelle conception dun procd de dpollution biologique des margines, effluents liquides de lextraction de lhuile dolive, Thse de luniversit de Provence. Marseille, France. Hamdi M., Bouhamed H., Ellouz R. (1991b) Optimisation of Aspergillus niger growth on olive mill wastewaters, Appl. Microbiol. Biothecnol., 36, 285-288. Hamdi M., Khadir A., Garcia J.L. (1991c) The use of Aspergillus niger for the bioconversion of olive mill waste-waters. Appl. Microbiol. Biotechnol., 34, 828-831. Hamdi M. (1992) Toxicity and biodegrability of olive mill wastewaters in batch anaerobic digestion. Appl Biochem Biotechnol., 37, 155. Hamdi M., Garcia J.L., Ellouz R. (1992) Integrated biological process for olive mill wastewaters treatment. Bioprocess. Eng., 8, 79. Hamdi M., Ellouz P. (1993) Treatment of detoxified olive mill wastewaters by anaerobic filter and aerobic fluized bed processes. Environ. Technol., 14, 183-188. Hamdi M., Garcia J.L. (1993) Anaerobic digestion of olive mill wastewaters after detoxification by prior culture of Aspergillus niger. Process Biochem., 28, 155-159. Hamdi M. (1993a) Future prospects and constraints of alive mill waste waters use and treatment : A. Review. Bioprocess Engineering, 8, 209-214. Hamdi M. (1993b) Thermoacidic precipitations of darkly coloured polyphnols of olive mill wastewaters, Enviromnental Technology, 14, 495-500. Hamdi M. (1993c) Valorisation et puration des effluents des huileries dolives: lutilit de la microbiologie industrielle. Olivae, 46, 20-24. Hammel K.E., Moen A. (1991) Depolymerisation of syntetic lignin in vitro by lignin peroxydase. Enzyme. Microbiol. Technol., 13, 15-18.

145

Rfrences bibliographiques

Hansen E.C. (1883) Undersqgelser over alkoholgjaersvampenes fysiologi og morfologi. II. Om askosporedannelsen hos slaegten Saccharomyces. Medd. Carlsberg Lab., 2, 29-86. Horiguchi H., Yurimoto H., Kato N., Sakai Y. (2001a) Antioxidant system within yeast peroxisome. Biochemical and physiological characterization of cbpmp20 in the methylotrophic yeast Candida boidinii. J. Biol. Chem., 276 (17), 14279-14288. Horiguchi H., Yurimoto H., Goh T.K., Nakagawa T., Kato N., Sakai Y. (2001b) Peroxisomal Catalase in the Methylotrophic Yeast Candida boidinii : Transport Efficiency and Metabolic Significance. Journal of Bacteriology, 183 (21), 6372-6383. Hristozova T., Michailova L., Dmitriev V., Tsiomenko A., Roshkova Z., Tuneva D. (1994) Investigations of mannan and glucan in the cell wall of Candida boidinii cultivated on methanol, A. V. Leeuwenhoek, 65 (1), 13-20. Iacazio G., Prissol C., Faure B. (2000) A new tannase substrate for spectrophotometric assay. Journal of Microbiological Methods, 3, 209-214. Iibuchi S., Minoda Y., Yamada K. (1967) Studies on tannin acyl hydrolase of microorganisms. Part II. A new method determining the enzyme activity using the change of ultra violet absorption. Agric. Biol. Chem., 31, 513-518. Jardak T. (1999) Le secteur olicole en Tunisie: Potentiel, contraites et perspectives. The olive oil wastes Remediation Symposium. Sfax, Tunisia. 46-51. Kahraman S., Yesilada O. (1999) Effect of spent cotton stalks on color removal and chemical oxygen demand lowering in olive oil mill wastewater by white rot fungi. Folia Microbiol., 44 (6), 673-676. Kahramann S., Yesilada O. (2001) Industrial and Agricultural wastes as substrates for laccase production by white-rot Fungi. Folia microbial., 46 (2), 133-136. Karapinar M., Worgan M.J.T. (1983) Bioprotein production from the waste products of olive oil extraction, J. Chem. Tech. Biotechnol., 33, 185-188. Katayama-Hirayama K., Tobita S., Hirayama K. (1994) Biodegradation of phenol and monochlorophenols by yeast Rhodotorula glutinis. Water Science and Technology, 30 (9), 59-66. Kieslich K. (1976) Microbial transformations of non-steroid cyclic compounds. John Wiley and Sons Georg Thieme publishers, 1262 pp. Kissi M., Mountadar M., Assobhei O., Gargiulo E., Palmieri G., Giardina P., Sannia G. (2001) Roles of two white-rot basidiomycete fungi in decolorisation and detoxification of olive mill waste water. Appl Microbiol Biotechnol., 57 (1-2), 221-6. Klibanov A.M., Tu T.M., Scott K.P. (1983) Peroxidase catalysed removal of phenols from coal-conversion wastewaters. Science, 22, 259-261. Kodama K., Kyono T., Kodama S. (1955) A study of film-forming yeasts (II). Genus Pichia (2). J. Ferment. Technol., 33, 317-324.

146

Rfrences bibliographiques

Koster I.W., Cramer A. (1980) Inhibition of methanogenesis from acetate in granular sludge by long-chain fatty acids. Appl. Environ. Microbiol., 53, 403-409. Kreger-van Rij. (1987) The yeasts a taxonomic study; third revised and enlarged edition, Groninger, The Netherlands, Elsevier Science Publishers. B.V. Amsterdam. Lane R.W., Yamakoshi J., Kikuchi M., Mizusawa K., Henderson L., Smith M. (1997) Safety evaluation of tannase enzyme preparation derived from Aspergillus oryzae. Food and chemical Toxicology, 35, 207-212. Leger C.L., Kadiri-Hassani N., Descomps B. (2000) Decreased superoxide anion production in cultured human promonocyte cells (THP-1) due to polyphenol mixtures from olive oil processing wastewaters. J Agric Food Chem., 48 (10), 5061-7. Lekha P.K., Lonsane B.K. (1997) Production and application of tannin acyl hydrolase : state of the art. Adv. Appl. Microbiol., 44, 215-260. Lettinga G., Van Velson A.F.M., Lobma S.W., de Zeeuw W., Klapwijk A. (1980) Use of the upflow sludge blanket (USB) reactor concept for biological wastewater treatment, especiallt for anaerobic treatment. Biotech. Bioeng., 222, 699-734. Levis-Menzi R., Gaviozzi A., Riffaldi R., falzi L. (1992) Lpandage au champs des margines : effet sur les proprits du sol. Olivae, 40, 20-25. Levis-Menzi R., Raffaldi R., Saviozzi A., Cardelli R. (1995) Decomposition of anaerobically digested olive mill sludge, Environmental. Science, 7, 1411-1422. Lombardo N., Bricolli Bati C., Marsilio V., Di-Giovacchino L., Solinas M. (1988) Prime osservazioni suglli effetti somminstrazioni di acqua di vegetatione al terreno agario, estratto da annali del linstituto Sperimentale per lolivicoltura, 10, 9-22. Longhi P., Vodopivec B., Fiori G. (2001) Electrochemical treatment of olive oil mill wastewater. Annali di Chimica, 91, 1696-174. Loulan P.Y., Thelier Y. (1987) Procd et dispositif de traitement par fermentation mthanique des eaux rsiduaires lipidiques, Brevet franais, 2620439. Lutwin B., Fiestas Ros De Ursinos J.A., Geissen K., Kachouri M., Klimm E., De Ladorde Monpezat G., Xanthoulis D. (1996) Les expriences mditerranennes dans le traitement et llimination des eaux rsiduaires des huileries dolives, Editions (GTZ) Gmbh, Eschborn. Rpublique Fdrale dAllemagne. Macheix J.J., Fleuriet A., Billot U. (1990) Fruit phenolics. CRC Press Inc, Boca Raton Florida, 378p. Maeda-Yorita, Massey V. (1992) On the reaction mechanism of phenol hydroxylase. new information obtained by correlation of fluorescence and absorbance stopped flow studies. The journal of Biological chemistry, 268, 4139-4144. Maestro-Duran R., Borja R., Martin A., Fiestas Ros de Ursinos J.A., Alba Mendoza J. (1991) Biodegradacion de los compuestos fenolicos presentes en el alpechin. Grasas Y Aceites, 42, 271-276.

147

Rfrences bibliographiques

Martilotti F. (1993) Use of olive by-products in animal feeding in Italy. Division de la production et de la sant animale. FAO. Rome. 56-62. Martin A., Borja R., Garcia I., Fiestas J.A. (1991) Kinetics of methane production from olive mill wastewater. Process. Biochem., 26, 101-107. Martin A., Borja R., Banks C.J. (1994) Kinetic model for substrate utilization and methane production during the anaerobic digestion of olive mill wastewater and condensation water waste. J. Chem. Biotechnol., 60, 7-16. Martinez N.L., Ramos-Cormenzana A., Garcia Pareja M.P., Garrido Hoyos S.E. (1992) Biodegradacion de compuestos fenolic del alpechin con Aspergillus terrus, Grasas y Aceites, 43 (2), 75-81. Martirani L., Giardina P., Marzullo L., Sannia G. (1996) Reduction of phenol content and toxicity in olive mill wastewaters with the ligninolytic fungus Pleurotus ostreatus. Water Researsh, 1 (30), 1914-1918. Masschelein C.A., Batum M.S. (1981) Enzymic degradation and participation of ester linked beer polyphenols in chill haze formation. Proc. Cong. Eun Brew. Conv. I8TH, 359-370. Mendia L., Procino L. (1964) Studio sol trattamento delle acque di rificito dei frantvi oleari. Pro. ANDIS conference. Bologna, Italy. Middelhoven W.J. (1993) Catabolism of benzene compounds by Ascomycetous and Basidiomycetous yeasts and yeast like furgi. A. Literature Review and experimentapprach. Antome van Leewenhoek. International Journal of general and molecular microbiology, 63, 125-144. Millan B., Lucas R., Robles A., Garca T., Alvarez de Cienfuegos G., Glvez A. (2000) A study on the microbiota from olive-mill wastewater (OMW) disposal lagoons, with emphasis on filamentous fungi and their biodegradative potential Microbiol Res., 155 (3), 143-7. Ministre des Travaux Public (1997) Etat de qualit des eaux de loued de Sebou, Note prsente au sminaire sur lvolution du projet dlimination des margines Fs en collaboration avec la communaut urbaine et la RADEEF, Fs. Maroc. Monties B. (1980) Les polymres vgtaux. Gautier-Villars (eds). Moreno E., Perez J., Ramos-Cormenzana A., Martinez J. (1987) Antimicrobial effect of waste water from olive oil extraction plants selecting soil bacteria after incubation with diluted waste. Microbios, 51, 169-174. Morisot A. (1979) Utilisation des margines par pandage. Olivae. 19, 8-13. Morisot A., Tournier J.P. (1986) Rpercutions agronomique de lpandage deffluents et dchets de moulins huile dolive. Agronomie, 6, 235-241. Mouncif M., Tamoh S., Faid M., Achkari-Begdouri A. (1993a) A study of chemical and microbiological characteristics of olive mill waste water in Morocco. Grasas y Aceites, 44, 335-338.

148

Rfrences bibliographiques

Mouncif M., Achkari-Begdouri A., Faid M. (1993b) Traitement des margines par digestion anarobique. Actes Inst. Agron. Vet. Maroc, 13 (2), 13-19. Mundt J.O. (1970) lactic acid bacteria associated with raw plant food material. J. Milk Technol., 33, 550-553. Murphy J., Riley J.P. (1962) A modified single solution method for the determination of phosphate in natural water. Annal. Chim. Acta., 127. Nakamoto S., Machida M. (1991) Phenol removal from aqueous solutions by peroxidase catalysed reaction using Additives. Wat Res., 26, 49-54. Nakazawa T., Yokota T. (1973) Benzeate metabolism of in Pseudomonas putida (arvilla) mt2; demonstration of benzoat athway. J. Bacteriol, 115, 262-267. Nefzaoui A. (1987) Contribution la rentabilit de loliculture par la valorisation optimale des sous-produits. Sminaire sur lconomie de lolivier. Tunis. Nicell J.A., Bewtra J.K., Taylor K.E., Biswas N. (1992) Enzyme catalyzed polymerisation and precipitation of aromatic compounds from waste water. Wat. Sci. Tech., 25, 157-164. Ninnekar h.Z., Vaidyanathan C.S. (1981) Catchol 1,2-dioxygenase from Aspergillus niger : purification and properties. J. Indian Inst. Sci., 63, 131-136. Office National de lEau Potable (1989) Pollution de loued Sebou en amont du kariat ba Mohamed, rapport : 053/DC/05, Office National de leau potable, Rabat. Maroc. Oukili O., Chaouch M., Rafiq M., Hadji M., Hamdi M., Benlemlih M. (2001) Bleaching of olive mill wastewater by clay in the presence of hydrogen peroxyde. Ann. Chim. Sci. Mat., 26, 45-53. Papadimitriou E.K., Chatjipa I., Balis C. (1997) Application of composting to olive mill wastewater treatment. Environmental technology, 18, 101-107. Paredes M.J., Monteoliva-Sanchez M., Perez J., Ramos-Cormenzana A., Martinez J. (1986) Effect of waste waters from olive oil extraction plants on the bacterial population of soil. Chemosphere, 16, 1557-1564. Pazzynski A., Huynh V.B., Craw ford R.L. (1985) Enzymatic activities of an extracellular manganese dependant peroxidase from phanerochate chrysosporium. FEMS Microbiol Lett., 29, 37-41. Peelen S., Rietjens I., Boersma M.G., Vervoort B.J. (1995) Convertion of phenol derivatives to hydroxylated products by phenol hydroxylase from Trichasporon cutanum. A comparaison of regioselectivity and rate of conversion with calculated molecular orbital substrate characterictics. Eur. Journal of Biochemstry, 227, 284-291. Prez J., Gallardo Lara F., Astheban E. (1980) Aspectos a considerar en el empleo del alpechin comc fertilizante. I. Evaluacion de su efecto fitotoxico de la germinacion de semillas. Cuad. Cien. Biol., 7, 59-67.

149

Rfrences bibliographiques

Prez J., Estheban E., Gomez M., Gallardo-Lara F. (1986) Effects of wastewater from olive processing on seed germination and early plant growth of different vegetable species. Environ. Sci. Health, 49, 349-357. Prez J., Gallardo-Lara F. (1987) Effects of the application of wastewater from olive processing on soil nitrogen transformation. Commn. In Soil Sci. Plant Anal., 18, 1031-1039. Prez J., Rubia T., Moreno G., Martinez J. (1992) Phenolic content and antibacterial activity of olive oil waste waters. Environ. Toxicol. Chem., 11, 489-495. Prez J., Saez L., De la rubia T., Martinez L. (1997) Phanerochaete flavido-alba ligninolytic activities and decolorisation of partially bio-depurated paper mill wastes. Wat. Res., 31, 495-502. Petruccioli M., Servili M., Montedoro F., Federicio F. (1988) Development of recycle procedure for the utilization of vegetation waters in the olive-oil extraction process. Biotechnol. Lett., 10, 55-60. Piperidou C.I., Chaidou C.I., Stalikas C.D., Soulti K., Pilidis G.A., Balis C. (2000) Bioremediation of olive oil mill wastewater: chemical alterations induced by Azotobacter vinelandii. 1: J Agric Food Chem., 48 (5), 1941-8 Pochon J.P, Tordux (1962) Techniques d'analyse en microbiologie du sol .p.101 Collection Technique de base France. Pozo C., Martinez-Toledo M.V., Rodelas B., Gonzalez-Lopez J. (2002) Effects of culture conditions on the production of polyhydroxyalkanoates by Azotobacter chroococcum H23 in media containing a high concentration of alpechin (wastewater from olive oil mills) as primary carbon source. J. of Biotechnology, 97, 125-131. Proietti P., Cartechini A., Tombesi A. (1988) Influenza delle acque reflue dei frantoi oleari su olivi in vaso e in campo. Linformatore Agrario, 45, 87-91. Rahlkar S.B., Joshi S.R., Shivorman N. (1993) Phototabolism of Aromatic compounds by Rhodopsudomonas palustris. Cur. Mirbiol., 26, 1-9. Raimbault M., Alazard D. (1980) Culture method to study fungal growth in solid fermentation. Eur. J. Appl. Microbiol. Biotechnol., 9, 199-209. Ramos-Cormenzana A. (1986) Physical, chemical, microbiological and biochimical characteristics of vegetation water. In: Inter. Symp.: On olive by-products valorization. Sevilla-Spain. 41-60. Ramos-Cormenzana A. (1990) Studies on antibacterial activity of wastewaters from olive oil mills (alpechin) : inhibitory activity of phenolic and fatty acids. Chemosphere, 2, 423-432. Ranalli A. (1989) Fermenti selezionati nel trattamento biologico dell acque dei frantoi. Prove orientative col-complesso microbico S. N. K. D. Industrie Alimentari, 28, 141-148. Ranalli A. (1991a) The effluent from olive mills : Proposals for re-use and purification with reference to Italian legislation. Olivae, 37, 30-39.

150

Rfrences bibliographiques

Ranalli A. (1991b) The effluent from olive mills : Proposals for re-use and purification with reference to Italian legislation. Olivae, 38, 19-34. Ranalli A. (1991c) The effluent from olive mills : Proposals for re-use and purification with reference to Italian legislation. Olivae, 39, 26-40. Ranalli A. (1992) Microbiological treatment of oil mill waste waters. Grasas y Aceites, 43, 16-19. Reimers Suarez G. (1983) Posibilidades de tratamiento del alpechin por ultrafiltracion y osmosis inversa, Quimicae Industria, 273-274. Renzo C., Amirante P. (1988) Trattamento di osmosi inversa ed ultrafiltazione, In proc. Of Inter. Symp, on olive mill wastewater traetment. COI-FAO-APROL, Lecce, Italy. Rigoni-Stern S., Rismondo R., Szpyrkowicz L., Zilio grandi F. (1988) Anaerobic digestion of vegetation water from olive oil mills on a fixed biological bed with a biogas production. In: Proc. Of Fifth Int. Symp. On Anaerobic Digestion, Bologna, Italy, 22-26 May, Tilche, A. and Rozzi, A., (eds) pp. 561-565. Robert A.S., Ellen S.H., Connie A.N., Van Oorschrt. (1981) Introduction to food-borne fungi. Central bureau Voor Schimmel cultures, Institute of royal netherlands, Academy of Arts and Sciences. Robles A., Lucas R., De Cienfuegos G.A., Galvez A. (2000) Phenol-oxidase (laccase) activity in strains of the hyphomycete Chalara paradoxa isolated from olive mill wastewater disposal ponds. Enzyme and Microbial Technology, 26, 484-490. Rodier J. (1996) L'analyse de l'eau, 8me dition. Dunod, Paris. France. Rodriguez J.A., Ecchevarria J., Rodriguez F.J., Sierra N., Daniel A., Martinez O. (1985) Solid state fermentation of dried citrus pell by Aspergillus niger. Biotechnol. Lett., 7, 577580. Rozzi A., Passino R., limoni M. (1989) Anaerobic treatment of olive mill effluents in polyurethane foam bed reactors. Process Biochem., 68-74. Saiz-Jimnez C., Gomez Alarcon G., De Leeuw J.W. (1986) Chemical properties of the polymer isolated in fresh vegetation water and sludge evaporation pond. FAO, on olive byproducts valorisation. Madrid-Spanish, 41-60. Saiz-Jimnez C., De Leeuw J.W., Gomez Alarcom G. (1987) Sludge from the waste water of the olive processing industry: A potential soil fertilizer. Sci. total Environ., 52, 445-452. Saez Mertre L.E. (1989) Contenido fenolico del alpechin y actividal antibacteriana, licenciatura, Depto Microbiologia, facultad de farmacia, Universidad de Granada, Espana. Saez L., Perez J., Martinez J. (1992) Low Molecular weight Phenolics Attenuation during Simulated Treatment of Wastewater from Olive Oil Mills in Evaporation Ponds. Wat. Res., 26, 1261-1266.

151

Rfrences bibliographiques

Saito K. (1914) Mikrobiologishe studien ber die bereitung des mandschurischen branntweins. Rep., Centr. Lab. S. Manchurian Railway Co., 1, 1-60 (rev. in: Bull. Inst. Pasteur, 13, 1, 1915; Zentralbl. Bakteriol. Parasitenk., Abt II, 55, 323, 1922) Sakai Y., Yurimoto H., Matsuo H., Kato N. (1998) Regulation of peroxysomal proteins and organelle proliferation by multiple carbon sources in the methylotrophic yeast, Candida boidinii. Yeast, 14 (13) 1175-1187. Salvimini V., Cera O. (1984) Acidic phenolic fraction of the juice of olives determined by gas chromatographic method. Grassas y Aceites, 25, 178-180. Salvemini F. (1985) Composizione chimica e valutazione biologica di un mangime ottenuto essicando tercamente le acque di vegetazione delle olive. Riv. Delle Sostanze Grasse, 112, 559-564. Sambrook J., Fritsch E.F., Maniatis T. (1989) Molecular Cloning. A Laboratory Manual, Second Edition, Cold Spring Habor Laboratory Pres. Santovito G., Salvato B., Manzano M., Beltramini M. (2002) Copper adaptation and methylotrophic metabolism in Candida boidinii. Yeast, 19 (7), 631-640. Sarah F.; C. Philif; Kersten, Daniel cullen (1989) Recent Advances in the molecular genetics of lignin degradation fungus, Phanerochaete chrysosporium. Proc. Int. Synp. Biotechnology for energy. Eds :Malik. K. Nagri S.H and ALeeM MIH Published by NIAB, NIBGR Faisalabad Pakestan. Sayadi S., Ellouz R. (1992) Decolouration of olive mill wastewaters by the white-rot fungus Phanerochaete chrysosporium involvement of the lignin-degrading system. Appl. Micrbiol. Biotechnol., 37, 813-817. Sayadi S., Ellouz R. (1993) Screening of white rot fungi for the treatment of olive mill waste-waters. J. Chem. Biotechnol., 57, 141-146. Sayadi S., Ellouz R. (1995) Role of lignin peroxidase and manganese peroxidase from Phanerochaete chrysosporium in the decolorization of olive mill waste-waters. Applied and Environmental Microbiology, 61, 1098-1103. Sayadi S., Zorgani F., Ellouz R. (1996) Decolorization of olive mill waste-waters by free and immobilized Phanerochaete chrysosporium cultures. Effect of the high-molecular-weight polyphenols. Appl Biochem Biotechnol., 56 (3), 265-76. Sayadi S., Allouche N., Jaoua M., Aloui F. (2000) Detrimental effects of high molecularmass polyphenols on olive mill wastewater biotreatment, Process Biochemistry, 35 (7), 725-735. Scandiaconsult (1992) Projet de gestion de lenvironnement, Etude Institutionnelle, Juridique et de la pollution . Rapport de consultant prpar par Groupement SWEEPSCANDIACONSULT, Sude, Commandit par la Banque Mondiale. Seng J.M. (1988) Chitine, chitosane et drivs: De nouvelles perspectives pour lindustrie. Biofutur, 71, 40-44.

152

Rfrences bibliographiques

Sethi R.P., Grainger J.M. (1980 a) Conversion of banana into animal feed by Aspergillus niger using solid substrate fermentation. Advances in Biotechnology. Vol. 2. Moo-Young M and C.W. Robinson (eds). 71-79. Sethi R.P., Grainger J.M. (1980 b) Conversion of mangostone into SCP for animal feed by Aspergillus niger using solid substrate fermentation. Advances in biotechnology. Vol. 2. Moo-Young M and C.W. Robinson (eds). 319-325. Shamar S., Bhat T.K, Dawra R.K. (1999) Isolation, purification and properties of tannase from Aspergillus niger van Tieghem. World J. Biotechnol., 15, 673-677. Shamar S., Bhat T.K, Dawra R.K. (2000) A Spectrophotometric Method for Assay of Tannase Using Rhodanine. Anal. Biochem., 279, 85-89. Sierra B., Navarro-Pedreno J., Gomez I., Mataix J. (1994) Soil properties affected by wastes from olive oil processing industries. Fresenius, Environ. Bull. 3, 381-386. Sierra J., Mart E., Montserrat G., Crauaas R., Garau M.A. (2001) Characterisation and evolution of a soil affected by olive oil mill wastewater disposal. The Science of the total environment, 279, 207-214. Spencer C.M., Cai Y., Martin J.D., Graffney S.H., Goulding P.N., Magnolato D., Lilley T.H., Haslam E. (1988) Polyphenol complexation-some thoughts and observations. Phytochemistry, 27, 2397-2409. Steegmans R. (1995) Traitement des margines : Bilan des Expriences. Colloque National organis par lEcole Hassania des Travaux Publics. Mai, Casablanca, Maroc, 101 (121), 1617. Stelling-Dekker N. M. (1931) Die sporogen hefen. Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk., Sect. II, 28, 1-547. Strom J. (1989) Evaporation del alpechin, Jornadas sobre innovacion tecnologica, medio ambiente y desarrollo, Sevilla. Espana. Suseela R.G., Nandy S.C. (1985) Decomposition of tannic acid and gallic acid by Penicillium chrysogenum. Leather Science, 32, 278-280. Tanchev S., Joncheva N., Genov N., Codounis M. (1980) Identification of anthocyanins contained in olives. Georgike Ereuna, 4, 5-73. Tien M., Kirk T.K. (1984) Lignin-degrading enzyme from phanerochaetae chrysosporium purification. Characterisation and catalytic proprities of a unique H2O2-requiring oxygenase. Proc. Natl. Acad. Sci. USA., 81, 2280-2284. Tomati U., Galli E., Di Lena G., Buffone R. (1991) Induction of laccase in Pleurotus ostreatus mycelium grown in olive oil astewaters. Agrochimica, 35, 273-279. Tomati U., Galli E. (1992) In Humus, its structure and role in agriculture and environment, Kubat J. Ed. Elsevier, London. 117-126.

153

Rfrences bibliographiques

Tsioulpas A., Dimou D., Iconomou D., Aggelis G.(2002) Phenolic removal in olive mill wastewater by strains of Pleurotus spp. In respect to their phenol Oxidase (laccase) activity. Bioresource Technology, 84, 251-257. Tsonis S.P., Grigoropoulos S.G. (1988) High rate anaerobic treatment of olive oil mill wastewater. Fifth Intern. Symp. On Anaerobic digestion, Bologna. Hall E.R. and Hobson P.N. (Eds), 115-124. Tsubouchi H., Yamamoto K., Hisada K., Sakabe Y. (1983) Degradation of aflatoxins by A. niger and aflatoxin nonproducing Aspergillus flavus. Shok. Eise. Zas., 24, 113-119. Vaccarino C., Lo Curto R., Tripodo M.M., Lagana G., Patente R., Muano F. (1986) Vegetetion water treatment by anaerobic fermentation with fungi. Simposio Internacional sobre Valorizacion de los subproductos del olivar: Alpechin y Orujo. 23, 5-6-7 Marzo, Sevilla-Espana. Van-Berkel W.J.H., Eppink H.M., MiddlHoven W.J., Vervoort Rietgens I.M.C.M. (1994) Catabolism of 4-hydroxyBenzoate in Candida porapsilosis Proceeds through initial oxidative decarboxylation by a FAD-dependent 4-hydroxybenzoate 1-hydroxylase. FEMS. Microbiology. Letters, 121, 207-215. Vazequez R.A., Maestro D.R., Graciani C.E. (1974) Compentes fenolicos de la aceintuna. II. Poliphenoles del alpechin. Grasas y Aceites, 25, 341-345. Vazequez R.A. (1978) Les polyphnols de lhuile dolive et leur influence sur les caractristiques de lhuile, Revue franaise des corps gras, 25 (1), 21-26. Vinciguerra V., DAnnibale A., Delle Monache G., Sermanni G.G. (1995) Correlated effects during the bioconversion of waste olive waters by lentinus edodes. Bioresource Tochnol., 51, 221-226. Voragen A.G.J., Rombouts F.M., Searle-Van M.J.F. (1987) Conversion of arabinans by the arabinanases of Aspergillus niger. In proc. Int. Conf. On biomass for energy and industry, Orlans, France, 11-15 mai, 737-744. Wagner H., Bladf S., Zgainski E.M. (1984) plant drug analysis. Translated by Scott Th.A. Springer-Verlag. Wang H.J., LeDall M.T., Wach Y., Laroche C., Belin J.M., Gaillardin C., Nicaud J.M. (1999) Evaluation of Acyl Coenzyme A Oxidase (Aox) Isozyme Function in the n-AlkaneAssimilating Yeast Yarrowia lipolytica. Journal of Bacteriology, 181 (17), 5140-5148. Wariishi H., Akileswaran L., Gold M.H. (1988) Manganese Peroxidase from the Basidromycete phanerochaete chrysosporium: Spectral characterisation of the oxidized states and the catalytic cycle. Biochemestry, 27, 5365-5370. Weete J.D. (1974) Sterols of the funguis distribution and biosynthesis. Phytochem, 12, 18431864. Weijman A.C.M. (1979) Carbohydrate composition and taxonomy of Geotrichum, Trichosporon and allied genera. Antonie van Leeuwenhoek, 45, 119-127.

154

Rfrences bibliographiques

White T.J., Bruns T., Lee S., Taylor J. (1990) Amplification and direct sequencing of fungal rRNA genes for phylogenetics, p315-322. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed), PCR protocols : a guide to methods and applications. Academic Press, San Diego, Calif. Wickerham L.J., Burton K.A. (1948) Carbon assimilation tests for the classification of yeasts. J. Bacteriol., 56, 363-371. Wickerham L.J. (1951) Taxonomy of yeasts. VS. Dept. Agric washinton. D. C. Tech. Bull., 1029, 1-56. Yazcioglu T., Celikkol F. (1978) Some trials on the utilisation of whey, black water of olive, and vinase for production of SCP. In Turkey. Cento Seminar on biological conversion of agricultural waste and by prodcts into food and animal feeds-stuffs. Yesilada O., Fiskin K., Yesilada E. (1995) The use of white-rot-fungus Funalia trogii (Malatya) for the decolorization and phenol removal from olive mill waste water. Environ. Technol., 16, 96-100. Yesilada O., Sam M. (1998) Toxic effects of biodegraded and detoxified olive oil mill wastewaters on the growth Pseudomonas aeruginosa. Toxicol. Environ. Chem., 65, 87-94. Yesilada O., Sik S., Sam M. (1998) Biodegradation of olive oil mill wastewater by Coriolus versicolor and Funalia trogii: effects of agitation, initial COD concentration, inoculum size and immobilization. World Journal of Microbiology & Biotechnology, 14, 37-42. Zenjari B., Hafidi M., El Hadrami Bailly J.P., Nejmeddine A. (1999) Traitement arobie des effluents dhuilerie par les micro-organismes du sol. Agrochimica, XLIII, 5-6. Zenjari B. (2000) Etude ecotoxicologique des effluents liquides des huileries de la ville de Marrakech : Impact sur les milieux rcepteurs et dtoxication. Thse de 3me cycle, Facult des Sciences de Marrakech (Maroc). Zenjari B., Nejmeddine A. (2001) Impact of spreading olive mill wastewater on soil characteristics : laboratory experiments. Agronomie, 21, 749-755. Zimbalatti G. (1995) A new and alternative technology to reduce the pollution caudes by oil mills; Seventh International Symposium on Agricultural and Food Processing Wastes (ISAFPW 95). American Society of Agricultural Engineers, 420-428. Zouari N., Ellouz R. (1996) Microbial consortia for the aerobic degradation of aromatic compounds in olive oil mill effluent. Ind. Microbiol., 3, 155-162.

155