P. 1
cahier du bac

cahier du bac

4.33

|Views: 19,066|Likes:
Publié partunisiaahladalil
sciences
sciences

More info:

Published by: tunisiaahladalil on Sep 09, 2009
Droits d'auteur :Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOC, PDF, TXT or read online from Scribd
See more
See less

01/10/2016

pdf

text

original

‫وزارة التربية والتكوين‬ ‫الدارة الجهوية للتعليم بجندوبة‬ 

‫المركز الجهوي للتربية والتكوين المستمر بجندوبة‬

Exercices corrigés - Exercices non corrigés - Sujets de synthèse avec corrigés Réalisé par un groupe de professeurs da la région : Mersni Amor Kamel Hmissi Sadok Bouzazi Ridha Ben Hmida Noura Kaabi Taoufik Rouaissi Hedi Arfaoui Jalel Assistance de: Mr Maâlmi Lazaâr (Inspecteur des sciences naturelles) Guesmi

Cahier n°1 : Reproduction humaine Génétique

Septembre 2005

1

Avant-propos
Ce modeste ouvrage est le fruit d’un effort collectif d’un groupe de professeurs de la région de Jendouba. Le présent cahier est destiné aux élèves de la 4ème sciences expérimentales et comporte un ensemble d’exercices et de sujets de synthèse avec des corrigés détaillés se rapportant aux deux premiers chapitres. L’élève est appelé à tirer profit de ce manuel en s’exerçant aux questions et problèmes proposés mais aussi d’examiner attentivement ensuite les corrigés. Nos chers élèves ainsi que nos aimables collègues sont priés d’adresser tous leurs remarques et critiques selon deux voies : • Par voie postale ou par téléphone au CREFOC de Jendouba • Par e -mail : amor.mersni@laposte .net

Les auteurs

2

Première partie :

Fonction de reproduction chez l’homme Fonction de reproduction chez la femme

3

EXERCICE 1 : QCM.

Pour chacune des questions suivantes, il peut y avoir plus qu’une réponse exacte. Reporter le numéro de chaque question et indiquer la (ou les) lettre(s) correspondant à la (ou aux) réponse(s) exacte(s).
1- La testostérone est sécrétée par :
abcdabcdLes tubes séminifères Les cellules de Sertoli Les cellules interstitielles L’hypothalamus. Permet la mobilité du gamète mâle Renferme un noyau diploïde Pénètre dans l’ovocyte lors de la fécondation Renferme un noyau haploïde.

2- la tête du spermatozoïde :

3-Le spermatozoïde est une cellule :
abcdabcdDe grande taille Présente dans le sperme Fabriquée par la prostate Mobile.

4- La castration d’un sujet mâle pubère provoque :
Une diminution de la sécrétion de LH Une augmentation de la sécrétion de LH Une diminution des pulses de GnRH L’atrophie du tractus génital.

5- La testostérone est une hormone qui:
abcdabcdEntretient les caractères sexuels primaires et secondaires mâles Est sécrétée à taux constant par les cellules de Leydig Intervient dans la spermatogenèse Exerce une rétroaction sur le complexe hypothalamo-hypophysaire. Une augmentation du taux de LH et une diminution de celui de FSH Une diminution du taux de LH et une augmentation de celui de FSH Une diminution du taux de LH et de FSH Une augmentation du taux de LH et de FSH.

6- La castration chez un mâle entraîne :

7- Un spermatocyte I est : 4

abcd-

Diploïde et chaque chromosome comporte deux chromatides Diploïde et chaque chromosome comporte une chromatide Haploïde et chaque chromosome comporte deux chromatides Haploïde et chaque chromosome comporte une chromatide

8- A la fin de la spermatogenèse, le nombre de spermatozoïdes obtenu est :
abcdabcdLe double du nombre de spermatocytes I Egal au nombre de spermatides Quatre fois le nombre de spermatocytes I Egal au nombre des spermatides I. Tube séminifère —› canal déférent —› urètre Epididyme —› canal déférent —› urètre Tube séminifère —› canal déférent —› urètre Tube séminifère —› épididyme —› spermiducte —› urètre.

9- Le trajet précis suivi par les spermatozoïdes est:

10-La testostérone set une hormone:

a- De nature protéique b- De nature stéroïdienne c- Une glycoprotéine d- Est un mélange de lipide et de protide.

11- Les hormones sexuelles féminines (ovariennes):

12- Un follicule est:

a- Ont une sécrétion cyclique b- Sont à l’origine du fonctionnement cyclique de leurs organes cibles c- N’ont aucun effet sur le complexe hypothalamo-hypophysaire d- Sont toujours sécrétées à fortes doses. a- Une cellule reproductrice femelle b- Un ensemble de cellules entourant la cellule reproductrice femelle c- Une structure ovarienne productrice d’oestrogènes et de progestérone

13- La menstruation est:

a- Destruction partielle de l’endomètre b- Une destruction totale de l’endomètre c- Déterminée par une chute du taux des hormones ovariennes d- La conséquence de la fécondation.

14- Le deuxième globule polaire est:

a- Diploïde et chaque chromosome est à deux chromatides b- Haploïde et chaque chromosome est à deux chromatides c- Diploïde et chaque chromosome est à une chromatide d- Haploïde et chaque chromosome est à deux chromatides.

15- l’ablation de l’hypophyse chez une femme provoque:
a- L’arrêt de la sécrétion de FSH b- L’arrêt du cycle ovarien

5

c- L’arrêt de la sécrétion de LH d- Une ovulation prématurée.

16-La progestérone est sécrétée par:
a- La thèque interne du follicule b- La thèque externe du follicule c- Les cellules du corps jaune d- La granulosa du follicule. abcdabcdLe corps jaune La thèque interne du follicule L’hypophyse L’hypothalamus. Contrôlent directement le développement de l’utérus Contrôlent directement le fonctionnement de l’ovaire Contrôlent indirectement le développement de l’utérus Sont soumises à une rétroaction par les hormones ovariennes.

17- Les oestrogènes sont sécrétés par:

18- Les gonadostimulines (FSH et LH):

19- Le pic ovulatoire de LH est dû à:

a- Un rétrocontrôle positif exercé par l’oestradiol b- Un rétrocontrôle positif exercé par la progestérone c- Un rétrocontrôle négatif exercé par l’oestradiol d- Un rétrocontrôle négatif exercé par la progestérone.

2O- La croissance d’un follicule ovarien est contrôlée par :
a- La LH b- La FSH c- Les oestrogènes d- La progestérone.

21- La menstruation est la conséquence de:
a- L’ovulation b- La nidation c- La sécrétion accrue des hormones ovariennes d- La chute du taux d’hormones ovariennes.

22- La pilule combinée:

23- Le placenta:

a- Inhibe le fonctionnement du complexe hypothalamo-hypophysaire b- Permet une interruption volontaire de la grossesse c- Active les ovaires d- Rend l’endomètre propre à la nidation. a- Sécrète la FSH et la LH durant la grossesse b- Sécrète la HCG c- Est une barrière pour l’alcool et les virus d- A un rôle trophique pour le fœtus.

24- La fécondation se déroule normalement:
a- Dans le tiers supérieur de la trompe b- Dans le tiers inférieur de la trompe

6

c- Dans l’ovaire d- Dans l’endomètre.

25- Au cours de la phase de maturation de l’ovocyte, l’émission du deuxième globule polaire se fait:
a- Avant la fécondation b- Au moment de la fécondation c- Dans l’endomètre d- Dans l’ovaire.

26- La HCG est une hormone:

a- Qui est sécrétée par l’ovaire pendant la grossesse b- Qui est sécrétée par le jeune placenta c- Qui maintient le développement du corps jaune d- Qui maintient le développement de l’endomètre.

27- La caryogamie est une fusion entre:

28- Les granules corticaux de l’ovocyte une fois libérés:
a- Assurent la monospermie b- Assurent la polyspermie c- Réalisent une réaction corticale d- Réalisent une réaction acrosomique.

a- Un pronucléus mâle haploïde et un pronucléus femelle diploïde b- Un pronucléus mâle diploïde et un pronucléus femelle diploïde c- Un pronucléus mâle haploïde et un pronucléus femelle haploïde d- Un pronucléus mâle haploïde et un pronucléus femelle haploïde.

29- À partir du troisième mois de grossesse, le placenta:
a- Secrète la HCG b- Secrète la FSH c- Secrète la LH d- Secrète l’oestradiol et la progestérone.

30- La fécondation:

a- Assure un polymorphisme au sein de la même espèce b- N’assure pas un polymorphisme au sein de la même espèce c- Rétablie la diploïdie d- Est une union entre deux gamètes haploïdes.

7

EXERCICE 2 :

Résumez à l’aide d’un schéma fonctionnel, les mécanismes de contrôle et de régulation des fonctions testiculaires chez l’homme.

EXERCICE 3 : Le document 1 représente le schéma d’une portion de coupe dans un organe de l’appareil génital chez la femme.

Document 1

Document 2

1°a- Identifiez l’organe observé et complétez la légende correspondante en reportant les numéros (1 à 5) et les lettres (A, B, C, D et E) sur votre copie. b- Précisez à quelle phase du cycle sexuel, cette coupe a été réalisée ? 2°- Le document 2 est une photographie de la structure A (doc. 1) au moment de l’ovulation. a- Faites un schéma annoté de l’élément représenté par cette photographie b- Indiquez les différences entre l’élément A du document 1 et celui du document 2. 3°- En supposant que la garniture chromosomique de l’élément A est de 2n = 4, représentez à l’aide de schémas simples, l’état des chromosomes au cours de l’anaphase I et de l’anaphase II de la méiose.

8

EXERCICE 4 : Le document 1 représente schématiquement une coupe partielle au niveau d’un testicule humain.

Document 1

1°-indiquez sur votre copie la légende correspondante aux numéros figurant sur le schéma du document 1. 2°- Précisez la fonction de chacune des régions A et B indiquées sur le document1. 3°- Les cellules indiquées par les lettres a, b et c sur le document 1 sont en cours de division. En vous basant sur le processus qui se déroule au niveau de la région A : a- Précisez la phase et le type de division pour chaque cellule b- En simplifiant le nombre de chromosomes à 2n = 4, faites un schéma d’interprétation bien soigné et légendé de chacune des cellules a, b et c. 4°- Pour montrer le rôle de la région B indiquée sur le document 1, on vous demande deux expériences et leurs résultats : • Une qui montre le rôle de cette région • une qui montre sa voie d’action

9

EXERCICE 5 : Les figures du document 1 illustrent quelques étapes d’un phénomène biologique important qui se déroule dans l’appareil génital de la femme.

1°-Identifier et définir ce phénomène biologique. 2°- Complétez la légende et le titre de chaque figure du document 1 en reportant les numéros et les lettres sur votre copie. 3°- Classez par ordre chronologique de leur déroulement, les étapes représentées par ces figures. 4°- indiquez la garniture chromosomique des éléments n°1, n°4, n°5, n°7, n°8 et n°9. 5°- Le éléments n°5 et n°7 proviennent de deux cellules souches différentes (document 2) et dont la garniture chromosomique a été simplifiée à 2n= 4.

10

a- En l’absence du phénomène de crossing-over, donnez les différentes combinaisons
chromosomiques possibles dans chacun des éléments n°5 et n°7, en justifiant la réponse à l’aide de schémas simples et clairs. b- Quel serait alors le nombre de combinaisons théoriquement possibles dans la structure issue des éléments n°5 et n°7.

Document 2

EXERCICE 6: Les figures du document 1 illustrent des observations microscopiques de structures cellulaires prélevées au niveau des oviductes chez un lot de lapines après accouplement.

1°- Définissez brièvement le phénomène représenté par les figures du document 1. 2°- Complétez la légende correspondant aux numéros indiqués par le document 1. 3°- Attribuez un titre à chacune des figures A, B, C, D, E et F. 4°- Classez par ordre chronologique, les étapes représentées par les figures du document 1. 5°- Expliquez en quelques lignes : • Le déroulement de l’étape A • Le (ou les) mécanisme(s) qui assure (ent) la monospermie.

Document 1

11

EXERCICE 7: Pour étudier le déterminisme hormonal du cycle sexuel chez la femme, des expériences ont été réalisées chez la guenon (femelle de singe) dont le cycle sexuel est semblable à celui de la femme. On soumit cette guenon à une série d’expériences : 1ère série d’expériences : Expériences 1- Stimulation électrique de certains noyaux de l’hypothalamus. 2- Lésions de l’hypothalamus 3- Injection discontinue de Gn-RH extraite de l’hypothalamus selon un protocole expérimental approprié Résultats Elévation du taux sanguin des gonadotrophines (FSH et LH) hypophysaires Chute du taux sanguin de LH et de FSH Augmentation du taux de FSH et de LH

1°- Interprétez les résultats de ces expériences. 2°- Que peut-on déduire quant au rôle de l’hypothalamus ? 2ère série d’expériences :  A l’instant T0 : on fait l’ablation des deux ovaires.

12

une valeur proche de 60 pg.ml-1.  A l’instant T2 : on injecte une dose d’œstradiol de l’ordre de 600 pg.ml-1.  A l’instant T3 : on injecte une faible dose d’œstradiol et de progestérone. On dose à chaque fois le taux plasmatique d’une hormone hypophysaire (LH). Les résultats sont consignés dans les graphiques suivants

 A l’instant T1 : on fait une perfusion continue d’œstradiol qui maintient le taux sanguin à

1°- Analysez les courbes du document 3 en mettant en relation les variations du taux des hormones ovariennes et hypophysaires 2°- En déduire le principe de la contraception hormonale (pilule combinée). 3°- En intégrant les informations fournies par ces expériences, dressez un schéma fonctionnel illustrant le déterminisme hormonal de l’ovulation.

13

EXERCICE 8: Trois types d’hormones jouent un rôle important au cours de la grossesse chez la femme. A fin de préciser le rôle de ces hormones, on réalise les expériences suivantes : • Expérience 1 : Chez la femme enceinte, l’ablation des ovaires, pratiquée avant 3 mois, provoque l’avortement. En revanche, si l’intervention est effectuée plus tard, elle n’a pas d’influence majeure sur la grossesse qui se poursuit normalement. • Expérience 2 : Chez une femme sui n’est pas enceinte, l’injection d’une hormone, la HCG, pendant 10 jours en phase lutéale entraîne le maintient du corps jaune et le taux des hormones ovariennes est comparable à celui observé au cours d’une grossesse.

Document 2

Interprétez ces deux expériences en précisant les structures responsables de la sécrétion de ces hormones au cours de la grossesse tout en vous aidant du document 2. EXERCICE 9 : Chez la femme, au cours de la phase pré ovulatoire, la concentration plasmatique d’oestradiol augmente.

14

1- Schématisez les structures ovariennes assurant la production croissante d’oestradiol
au cours de la phase folliculaire du cycle ovarien. 2- Précisez les messages nécessaires au développement de ces structures. 3- Montrez comment les taux élevés d’oestradiol à la fin de la phase folliculaire déclenchent l’ovulation. 4- Indiquez brièvement les modifications que subit l’utérus sous l’effet de l’oestradiol au cours de la même phase

EXERCICE 10 : On se propose de déterminer le mode d’action des pilules contraceptives combinées, à partir de certains résultats expérimentaux et des acquis. Les graphes A et B suivantes montrent l’évolution du taux sanguin d’hormones ovariennes naturelles et de l’hormone lutéinisante (LH) au cours d’un cycle sexuel chez une femme qui prend des pilules combinées, par référence à une femme qui ne prend pas de pilules.

15

1°- Faites une analyse comparative des deux cas de figures A et B. 2°- Exploitez certaines de ces données et vos connaissances pour expliquer le blocage de l’ovulation dans le cas de prise de pilules combinées.

EXERCICE 11 : Les deux figures du document 1 représentent 2 cellules germinales chez la souris à la fin de prophase I pour lesquelles on a simplifié la formule chromosomique à 2n = 4 chromosomes.

16

1 2

1 2

Document 1 1°- A l’aide de schémas simples, représentez pour chaque cellule l’anaphase de la 1ère division et l’anaphase de la 2ème division de la méiose (en envisageant tous les cas possibles). 2°- En utilisant les lettres et les numéros correspondant aux chromosomes, dressez un tableau illustrant les différents types de gamètes ainsi que les zygotes qui peuvent résulter de leurs rencontres. 3°- Chez une espèce, le nombre de chromosomes est 2n = 8. Calculez le nombre de gamètes possibles puis le nombre de combinaisons possibles de zygotes. 4°- Que pouvez-vous en déduire ? EXERCICE 12 :(non corrigé) La créatinine est une substance qui provient de la dégradation des protéines et qui est éliminée dans les urines de la femme. Des dosages réguliers du taux de créatinine ont été effectués chez trois femmes X, Y et Z. Les valeurs obtenues en UI (unités internationales), sont données par le tableau suivant
Jours Femmes X Y Z 34 150 40 36 140 32 54 150 40 32 145 33 50 102 22 34 125 28 198 122 25 62 110 22 26 138 32 30 150 44 44 162 45 28 135 40 26 150 35 30 140 36 2 4 6 8 10 12 14 16 18 20 22 24 26 28

1°- Représentez ces valeurs sur le même système d’axes. 2°- Précisez quelle substance normalement présente dans l’organisme féminin est à l’origine de la créatinine ? 3°- Déduire et expliquez l’état physiologique de chacune des trois femmes X, Y et Z.

17

Deuxième partie :
Génétique des diploïdes Génétique moléculaire Génétique humaine

18

Génétique des diploïdes

EXERCICE 1 : QCM.

19

Pour chacune des questions suivantes, il peut y avoir plus qu’une réponse exacte. Reporter le numéro de chaque question et indiquer la (ou les) lettre(s) correspondant à la (ou aux) réponse(s) exacte(s).
1- La méiose assure :
abcd-

2- un crossing-over :
abcdabcdabcdabcd-

une redistribution des allèles un brassage de l’information génétique une diversité génétique la formation que de gamètes recombinés.

échange de fragments de chromatides homologues brassage inter chromosomique brassage intra chromosomique ne se déroule pas chez le mâle de la drosophile. est porté par un chromosome X est porté par un chromosome Y est porté par un chromosome non sexuel est porté par les deux chromosomes X et Y. la F2 est toujours du type 9,3, 3 et 1 le test- cross et du type ¼, ¼, ¼ et¼ la F2 du type ¾, ¼ le test- cross du type ½, ½. entre un individu de phénotype connu avec un testeur récessif entre un individu de phénotype inconnu avec un testeur récessif entre un individu de génotype inconnu avec un testeur récessif entre un individu de génotype inconnu avec un testeur récessif.

3-un gène autosomique:

4- Dans le cas d’un dihybridisme (dominance absolue) avec 2 gènes indépendants:

5- Un test- cross est un croisement:

6- La distance gène- gène (cas de linkage) est estimée :
a- à partir de la fréquence des recombinés b- à partir de la fréquence des chiasmas c- à partir de la fréquence des parentaux

7- Dans le cas de la transmission d’une anomalie autosomique récessive :
a- tous les garçons seront atteints b- toutes les filles seront atteintes c- l’anomalie est indifférente au sexe. abcd-

8- Dans le cas de la transmission d’une anomalie autosomique dominante :
tous les garçons seront atteints toutes les filles seront atteintes l’anomalie est indifférente au sexe un enfant atteint doit avoir au moins un parent atteint.

9- Dans le cas de la transmission d’une anomalie hétérosomale (liée à X) récessive :
a- la maladie touche les garçons plus que les filles

20

10-Dans le cas d’une maladie autosomique récessive :

b- la maladie touche les filles plus que les garçons c- un garçon atteint doit avoir un père atteint d- une fille atteinte doit avoir un père atteint et une mère hétérozygote.

a- Un individu sain peut être hétérozygote ; b- un couple normal ne donne jamais des enfants malades ; c- le mariage consanguin augmente le risque d’apparition de cette maladie ; d- est plus fréquente chez les filles que les garçons.

11- Le diagnostique prénatal est une technique qui permet :
a- de savoir le sexe du foetus b- de déceler certaines anomalies génétiques c- de déceler la trisomie 21 d- de réaliser le caryotype du foetus.

12- Le génie génétique est une technique qui permet :
a- d’isoler un gène d’une espèce et le faire exprimer chez une autre b- le clonage des gènes c- la manipulation des gènes.

13-Au cours de l’expression d’un gène :

a- l’ARNm mature est de même taille que le gène chez les eucaryotes b- l’ARNm présente des signaux de début et de fin de traduction c- la traduction s’arrête avec l’apparition du codon AUG d- l’ARNm est plus petit que le gène chez les procaryotes.

14- Dans le cas de la transmission d’une anomalie hétérosomale (liée à Y) récessive :
abcdla maladie touche seulement les garçons la maladie touche les filles plus que les garçons un garçon atteint doit avoir un père atteint une fille atteinte doit avoir une mère atteinte.

15- La sonde moléculaire est:

a- une séquence radioactive simple brin d’ADN b- une séquence radioactive double brin d’ADN c- une séquence radioactive simple brin d’ARNm d- une séquence radioactive d’acides aminés.

A- On croise une drosophile femelle de type sauvage aux ailes longues et au corps gris avec une drosophile mâle aux ailes vestigiales et au corps ébène. On a obtenu en 1ère génération 182 drosophiles aux ailes longues et au corps gris.

EXERCICE 2 :

21

On a croisé ensuite des drosophiles femelles obtenues en F1 avec des drosophiles mâles aux ailes vestigiales et aux corps ébènes. Les résultats sont les suivants : 492 drosophiles aux ailes longues et corps gris 509 drosophiles aux ailes longues et corps ébènes 515 drosophiles aux ailes vestigiales et corps gris 487 drosophiles aux ailes vestigiales et corps ébènes A partir de l’analyse de ces résultats et des lois de Mendel, proposez une hypothèse explicative de ces croisements. B- On croise des drosophiles de races pures, les unes aux ailes longues et aux yeux rouge sombre (Yeux normaux), les autres aux ailes vestigiales et aux yeux pourpres. Les individus de F1 ont tous des ailes longues et yeux normaux. On croise alors des femelles de F1 avec des mâles aux ailes vestigiales et yeux pourpres. On obtient : 1339 drosophiles aux ailes longues et yeux normaux 1195 drosophiles aux ailes vestigiales et yeux pourpres 151 drosophiles aux ailes longues et yeux pourpres 154 drosophiles aux ailes vestigiales et yeux normaux 1°- À partir de l’analyse de ces résultats, proposez une hypothèse qui explique ces croisements. 2°- Vérifiez la validité de cette hypothèse 3°- En tenant compte de vos réponses en A et B, dressez une carte factorielle des gènes responsables des caractères étudiés dans cet exercice.

EXERCICE 3:

On croise une chatte noire de race pure avec un chat orange de race pure. On obtient en F1 : 50% de chats tous de couleur noire et 50% de chattes bicolores (noire et orange). On obtient en F2, sur plusieurs portées : 20 chattes de couleur noire 22 chattes bicolores 19 chats de couleur noire 21 chats de couleur orange 1°- interprétez ces résultats et étudiez la descendance de F1 et F2. 2°- Quel serait le produit d’un croisement réciproque (Chatte orange X Chat noir) ?

EXERCICE 4:
On dispose de deux variétés pures d’une plante alimentaire : l’une à graines brunes et riches en amidon, l’autre à graines blanches et riches en sucre.

22

Le croisement de ces deux variétés donne une F1 où tous les individus ont des graines brunes et riches en amidon. 1°- Quels renseignements peuvent –on tirer de ces résultats ? 2°- On croise ensuite un individu de variété à graines brunes et riches en amidon avec un individu à graines blanches et riches en sucre. On obtient les résultats suivants :  758 graines brunes riches en amidon  66 graines brunes riches en sucre  62 graines blanches riches en amidon  714 graines blanches riches en sucre a- De quel type de croisement s’agit- il ? Justifiez votre réponse. b- Interprétez génétiquement les résultats de ce croisement tout en écrivant les génotypes des parents et des descendants. c- Précisez la localisation chromosomique des gènes en question. 3)- On veut sélectionner une variété pure possédant des graines brunes riches en sucre. a- Quel croisement doit-on réaliser ? b- Quelle proportion d’individus ayant le phénotype graines brunes riches en sucre obtiendra t- on ? c- Quelle proportion d’individus recherchés peut – on prévoir ? Des souris à poils gris et lisses sont croisées avec d’autres à poils blancs et crépus. La F1 obtenue comporte des animaux tous au pelage gris et lisse. L’autofécondation de la F1 donne une F2 qui comporte 211 souris à poils gris et lisses et 69 souris à poils blancs et crépus. 1°- Que déduisez-vous des résultats de chaque croisement ? 2°- Vérifiez alors génétiquement et statistiquement les résultats des 2 croisements. 3°- Prévoyez les résultats du croisement F1 x animal «poils blancs et crépus». On croise deux variétés pures de tomate : l’une de taille normale à feuilles entières, l’autre naine (taille petite) et à feuilles découpées. Les plants obtenus en première génération F 1 sont tous de taille normale et à feuilles découpées. En 2éme génération F2, on obtient : - 926 plants normaux à feuilles découpées - 288 plants normaux à feuilles entières - 293 plants nains à feuilles découpées. - 104 plants nains à feuilles entières. 1- Précisez le (s) caractère (s) étudié (s). 2- Précisez la relation entre les allèles du (ou des) gène (s) responsable (s) du (ou des) caractère (s) étudié (s). Justifiez la réponse. 3- Donnez la localisation et la relation entre ces gènes. Justifiez les réponses. 4- On croise entre eux deux plants de la F2 décrite précédemment : l’un (A) de taille normale, a feuilles découpées, l’autre (B) de taille normale à feuilles entières. On obtient : - 219 plants normaux à feuilles découpées. - 207 plants normaux à feuilles entières

EXERCICE 5:

EXERCICE 6:

23

- 64 plants nains à feuilles découpées. - 71 plants nains à feuilles entières. Indiquez les génotypes des plants (A) et (B). Justifiez et vérifiez la réponse proposée. 5- On croise entre eux, deux autres plants provenant également de la deuxième génération F2, l’un (C) de taille normale, à feuille entière l’autre (D), main à feuille découpée. On obtient : - 70 plants normaux à feuilles découpées. - 91 plants normaux à feuilles entières - 86 plants nains à feuilles découpées. - 77 plants nains à feuilles entières. Indiquez les génotypes des plants (C) et (D). Justifiez et vérifier la réponse proposée.

* Des plantes de lignées pures à corolle rouge et ouverte sont croisées avec d’autres de lignée pure à corolle blanche et fermée. La F1 obtenue est composée de plantes toutes à corolle rose et ouverte. * Les plantes F1 croisées entre elles donnent une F2 composée de : 15 plantes à corolle rouge et ouverte. 6 plantes à corolle rouge et fermée. 31 plantes à corolle rose et ouverte. 9 plantes à corolle rose et fermée. 16 plantes à corolle blanche et ouverte 6 plantes à corolle blanche et fermée

EXERCICE 7:

1/ Que déduisez – vous des résultats du premier croisement ? 2/ Donnez alors l’interprétation chromosomique et statistique des deux résultats

On s’intéresse à l’étude de la transmission de la couleur du pelage chez l’espèce Chat. Pour cela on a rassemblé les données suivantes :

EXERCICE 8:

24

A - Des techniques modernes de la biologie moléculaire montrent que les chattes (quelque soit leur couleur) possèdent toujours deux allèles de la couleur (identiques ou non) alors que les chats n’en ont qu’un seul allèle. B- Les chattes de phénotype « bigarré» (bicolore) sont toujours hétérozygotes alors que celles de phénotype «Noir» ou de phénotype «Orange » sont toujours homozygotes. C- Le phénotype « bigarré » ne se manifeste jamais chez les chats. Questions : 1/ Quels renseignements tirez vous à partir des données A et B ? 2/ Montrez que ces renseignements sont confirmées par la donnée C. 3/ prévoyez les résultats :

a) Du croisement

bigarrée avec

Noir

b) Du croisement ♂ oronge avec ♀ Noir

25

Génétique moléculaire

Le phénotype est l’expression d’une information génétique localisée au niveau de l’ADN. Les hématies de l’homme n’ont pas de noyau lorsqu’elles se trouvent dans le sang.

EXERCICE 1:

26

Elles proviennent d’érythroblastes : cellules nucléées, qui, en perdant leur noyau, se transforment en hématies énucléées. Les érythroblastes énucléés réalisent la synthèse de l’hémoglobine, une protéine qui s’accumule dans le cytoplasme. Après la perte du noyau, les cellules continuent, mais pendant un temps court, à fabriquer la protéine puis la synthèse cesse. Dans les hématies il n’y a pas du tout de synthèse de l’hémoglobine. 1°- Quelle(s) information(s) pouvez-vous tirez de ce paragraphe sachant que la synthèse de chaque protéine est contrôlée par un gène spécifique ? 2°- On représente ci-dessous un fragment du brin transcrit de l’ADN codant pour la synthèse de l’hémoglobine humaine Sens de lecture .......TGAGGTCTTCTT………..ATC Nucléotide en position 3 a- Donnez la séquence de l’ARNm obtenue b- Retrouvez, en utilisant le code génétique, la séquence des acides aminés codée par le gène.

c- Complétez et arrangez dans un ordre logique les schémas du document ci-dessous

27

Etape A : …………………………………

Etape B : ………………………

Etape C : ……………………………………

Etape D : ……………………………………

d- Quelle conséquence aurait sur ce polypeptide le remplacement sur le brin codant du nucléotide en position 3 par un nucléotide à guanine ? e- Quelle propriété du code génétique ce résultat met-il en évidence ? f- Suite à une mutation génique par addition de nucléotide, la séquence peptidique est devenue la suivante : NH2 – Thr –Pro COOH Donnez le fragment de l’ADN transcrit muté. Justifiez la réponse

EXERCICE 2 :

On connaît chez une variété de blé, un champignon (R) qui s’attaque aux graines ce qui limite de façon importante, la production de la plante.

28

D’autre part, les techniques du génie génétique, ont permis d’isoler dans l’ADN d’un virus (V), un gène X qui code pour la synthèse d’une protéine capable d’arrêter le développement du champignon(R). 1°- Rappeler les outils utilisés en génie génétique. 2°- Expliquez brièvement, comment peut-on isoler un gène de structure ? 3°- Le découpage de l’ADN viral a donné des fragments parmi lesquels se trouve le gène X qu’on veut repérer à l’aide d’une sonde moléculaire. Le tableau suivant montre la structure partielle de la sonde ainsi que celles des fragments obtenus. Sonde moléculaire Fragments d’ADN viral F1 F2 F3 F4 AUUCGUAAACGGUAACACUGG CTAGCATATAGGAAAGATCAATGG TAAAGGCCCAGTTTCGCC TAAGCATTTGGGATTGTGACCG UUUAACGAGGGACAAATCAAAG

abcd-

Rappelez qu’est ce qu’une sonde moléculaire? Quel est le principe de son utilisation ? Retrouvez à partir du tableau, le fragment appartenant au gène X. Proposez une démarche expérimentale permettant d’utiliser le virus dans la lutte contre le champignon R

29

Génétique humaine

EXERCICE 1 :
On connaît chez l’homme un couple d’allèle (A, a) qui détermine la présence ou l’absence d’une anomalie héréditaire. L’arbre généalogique suivant est celui d’une famille dont certains membres sont atteints par cette anomalie :

30

I

Homme sain

1

2

Homme atteint

II 1 III 1 2 3 4 2 3 4 5 6
Femme atteinte Femme saine

1- L’anomalie est-elle récessive ou dominante ? justifier votre réponse. 2- Préciser la localisation du gène, envisager et discuter chaque hypothèse.

L’arbre généalogique ci-dessous est celui d’une famille dont certains membres sont atteints d’une maladie héréditaire.

EXERCICE 2 :

I 1 II
3 4 5 6

Homme malade

2

Homme sain Femme saine

1- L’allèle responsable de la maladie est-il dominant ou récessif ? justifier votre réponse. 2- S’agit-il d’un cas d’hérédité autosomique ou liée au sexe(X et Y) ? justifier. 3- Par des techniques de la biologie moléculaire, on sait distinguer par analyse de l’ADN l’allèle normal de l’allèle muté responsable de la maladie. L’ADN du sujet n°2 montre seulement la présence de l’allèle normal. a- Quelle est l’hypothèse confirmée par ces résultats ? b- Déterminer les génotypes possibles des sujets 1, 3 et 5.

EXERCICE 3 :

Un médecin a établi l’arbre généalogique suivant faisant apparaître une tare, la myopathie de Duchenne caractérisée par la dégénérescence des muscles conduisant à la mort généralement avant la puberté.

31

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19 20

21

22

23

24

25

26

27

28

29

30

: Femme saine

: Homme sain

: Homme malade

1- Le responsable de la maladie est-il dominant ou récessif? Discuter chaque cas. 2- Déterminer s’il s’agit d’une hérédité autosomique ou liée au sexe (X ou Y) ? Justifier votre réponse. 3- Des analyses génétiques ont montré que le sujet n°1 ne porte que l’allèle normal. Laquelle des deux hypothèses vous paraît la plus probable ? Justifier. Ecrire alors les génotypes possibles des individus 4, 5, 7, 9 et 10. 4- Comment peut-on expliquer qu’un seul des deux jumeaux 14 et 15 est atteint ? Ecrire alors leur génotype et celui de leurs parents.

EXERCICE 4 :

Le document suivant représente une partie d’un arbre généalogique d’une famille dont certains de ses membres sont atteints d’une maladie héréditaire.

1

2

3

4

5
: Homme sain : Femme saine.

: Homme atteint

1- Préciser le déterminisme génétique de cette maladie (localisation chromosomique et dominance). Envisager et discuter toutes les hypothèses. 2- Par une technique récente de diagnostic génétique, on a pu déterminer le nombre d’allèles mutés et normaux chez les différents individus de l’arbre généalogique cidessus, désignés arbitrairement par les lettres A, B, C, D et E. Les résultats obtenus sont portés par le tableau suivant :
Indivi dus

A 1 1

B 0 1

C 1 0

D 1 0

E 1 1

Nombre d’allèles

mutés Normaux

32

a- En analysant les résultats de ce tableau, laquelle des hypothèses proposées dans la réponse à la question précédente est confirmée par ces résultats ? b- Compléter le tableau suivant : individus Génotype Numéro de l’individu

A

B

C

D

E

EXERCICE 5 non corrigé:
La drépanocytose est une maladie héréditaire grave caractérisée par la présence d’une β-globine anormale provoquant une déformation des hématies. L’arbre généalogique du document 1 est celui d’un couple (Mme et Mr X) qui a une fille malade et attend un 2ème enfant.

? Document 1 1°- Expliquez en justifiant votre réponse, le mode de transmission de cette maladie (dominance et localisation chromosomique) 2°- A partir de l’analyse de l’ADN fœtal prélevé des villosités choriales, une technique appropriée permet d’obtenir un grand nombre de copies du gène de la β-globine. Ces copies sont séparées en deux lots dont chacun est mis en présence d’une sonde moléculaire radioactive. a- Définir qu’est ce qu’une sonde moléculaire puis expliquer brièvement son principe d’utilisation pour le repérage des gènes. b- De l’ADN prélevé chez Mme et Mr X ainsi que leur fille est soumis à un traitement par deux sondes moléculaires puis à une autoradiographie. Les résultats sont figurés par le document2 Mr X Mme X Fille Foetus Sonde n°1 Sonde n°2

Document 2

D’un autre coté, le document 3 présente les séquences nucléotidiques partielles des allèles HBa et Hbs du gène de la β-globine (brins non transcrits) ainsi que les séquences complètes des 2 sondes moléculaires radioactives utilisées. Séquences partielles des nucléotides des allèles HBa et HBs du gène de la β-globine (brins non transcrits)

33

Position 1 10 20 30 40 des nucléotides HBa ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCC... HBs ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCC
Séquences complètes (19 nucléotides) des deux sondes radioactives utilisées : Sonde n°1 : GAGGACACCTCTTCAGACG Sonde n°2 : GAGGACTCCTCTTCAGACG

Document 3 A de l’analyse des documents 2 et 3 et de vos propres connaissances : a- Faites une correspondance entre chaque sonde et l’allèle qui lui convient. b- En déduire les génotypes de Mr et Mme X ainsi que ceux de leur fille et du foetus attendu.

EXERCICE 6 non corrigé:
On sait que les daltoniens confondent entre certaines couleurs, en particulier le rouge et le vert. Pierre est affecté de cette anomalie ainsi que certains membres de sa famille. Alors que la mère et l’une des sœurs de Pierre ne présente pas cette anomalie, le père et l’autre sœur de Pierre en sont atteints. Cette dernière a 3enfants : 2 garçons atteints de daltonisme et une fille non daltonienne. Pierre lui-même a 2 garçons et 2 filles non daltoniens. En revanche le frère de la mère de Pierre est atteint de cette anomalie. 1- Reconstituer l’arbre généalogique de cette famille, en représentant un homme par un carré et une femme par un cercle. Les individus atteints de daltonismes seront figurés en noir. 2- En supposant que cette anomalie est récessive liée à X, retrouver les génotypes du père, de la mère et des sœurs de Pierre. Expliquer les raisons qui vous conduisent à leur attribuer ces génotypes. 3- Quels sont, d’une part, les génotypes des enfants et de la femme de Pierre ; d’autres part, les génotypes des enfants et du mari de la sœur de Pierre ? Justifier votre réponse.

EXERCICE 7 non corrigé:
L’arbre généalogique suivant est celui d’une famille dont certains membres sont atteints d’une anomalie héréditaire.

I

1

2

Femme saine

34

II

Femme atteinte 1 1 2 2 3 3 4 4 5 Homme atteint Homme sain 1 2 3 4

III IV

1- L’anomalie est-elle dominante ou récessive ? Justifier votre réponse.

2- Cette anomalie est-elle autosomique ou liée au sexe ? Discuter les hypothèses possibles en se basant sur des arguments. 3- sachant que l’individu III1 est homozygote pour le gène considéré, que peut-on préciser sur le mode de transmission de cette anomalie ? 4- Ecrire les génotypes possibles des membres de cette famille.

EXERCICE 8 non corrigé:
Dans une population humaine, l’étude de la transmission d’une maladie héréditaire donnée est basée sur l’analyse généalogique. On rencontre les trois situations suivantes :

(I)
1 2 1

(II)
2 1

(III)
2

3

4

5

3

4

5

3

4

5 Femme normale

Homme normal

Homme malade

Femme malade

1- Indiquer la forme allélique dominante et la forme récessive? Justifier. 2- Le gène contrôlant cette maladie est-il autosomique ou lié au sexe ? Justifier. 3- Préciser les génotypes possibles des individus de la situation (1).

EXERCICE 9 non corrigé:
L’arbre généalogique suivant montre la transmission d’une anomalie héréditaire chez une famille :

I

1

2

Homme sain

35

II
1 2 3 4

Homme atteint Femme saine 3 4 Femme atteinte

III

1

2

1- L’anomalie est-elle dominante ou récessive ? Justifier votre réponse. 2- Cette anomalie est-elle autosomique ou liée au sexe ? Justifier les hypothèses possibles. 3- Sachant que dans la population un homme atteint transmet l’anomalie à toutes ses filles, quelle hypothèse peut-on alors confirmer ? 4- Ecrire les génotypes possibles de cette famille.

EXERCICE 10 non corrigé:
La mucoviscidose est une maladie héréditaire grave associant des troubles digestifs et respiratoires. L’arbre généalogique suivant est celui d’une famille dont certains de ses membres sont atteints de cette maladie:

I II III IV
1 1

1 2

2 Homme sain 3 4 5 Homme atteint Femme saine 2 3 Femme malade

Fœtus 1- L’allèle responsable de cette maladie est-il dominant ou récessif ? Justifier votre réponse. 2- S’agit-il d’une maladie autosomique ou liée au sexe(X ou Y) ? Justifier votre réponse. 3- Déterminer les génotypes possibles des individus : I1, I2 II2 II3 III1 etIII3. justifier. 4- Dans cette famille, il y a une union à risque. Laquelle ? Quelle est sa nature ?

36

Correction

37

Première partie :
 Fonction de reproduction chez l’homme  Fonction de reproduction chez la femme

EXERCICE 1 : QCM. 38

1-: c ; 2-: c - d ; 3-: d ; 4-: b-d ; 5- : a- c- d ; 6-:d ; 7-: a ; 8-: b- c ; 9-: d ; 10-: b ; 11-: a ; 12-: d; 13-: a-c ; 14-:d ; 15-: a- b- c ; 16-: c ; 17-: a-b ; 18-: b- c- d ; 19-: a ; 20-: b ; 21-: d ; 22-: a ; 23-: b-d ; 24-: a ; 25-: b ; 26-: b-c ; 27-: c ; 28-:a-c ; 29-:d ; 30-: a- c. EXERCICE 2 :
Stimulations (Internes et externes)

HYPOTHALAMUS
Pulse de Gn-RH

LH

HYPOPHYSE ANTERIEUR

FSH

1 Cellules de LEYDIG (Tissu interstitiel)

TESTICULE Tubes séminifères
Cellules de Sertoli Cellules germinales

2

TESTOSTERONE

APB

INHIBINE

• •

Développement des caractères sexuels secondaires masculins Développement du tractus génital

Schéma fonctionnel du mécanisme de régulation et de contrôle des fonctions testiculaires

1 : Rétrocontrôle négatif sur la sécrétion de LH 2 : Rétrocontrôle négatif sur la sécrétion de FSH
EXERCICE 3 : 39

1°a- Le document 1 représente une portion de coupe dans un ovaire d’une femme pubère. Légende du document1 : 1- Follicule primordial A- Ovocyte I 2- Follicule primaire B- Thèque externe 3- Follicule cavitaire C- Thèque interne 4- Follicule dominant D- Granulosa ou de DEGRAAF E- Antrum b- La coupe d’ovaire a été réalisée à l’age de la puberté pendant la phase folliculaire du cycle ovarien (présence de follicules en évolution). 2°a- Schéma de l’ovocyte II représenté par le doc.2

b- Différences entre A (doc1) et A (doc2) Différences Génétiques Ovocyte I (doc1) Cellule diploïde (2n=46) mais bloquée en prophase I Cytologiques Absence de globules polaire Ovocyte I (doc2) Cellule haploïde (n=23) mais bloquée en métaphase II Présence du 1er globule polaire

3°- Anaphase I et Anaphase II d’une cellule à 2n= 4chromosomes

EXERCICE 4 :

40

A1°- Légende : 1- spermatogonie 6- cellule de Sertoli 2- spermatocyte I 7- membrane basale 3- spermatocyte II 8- capillaire sanguin 4- spermatide 9- cellules de Leydig (tissu interstitiel) 5- spermatozoïde 10- tube séminifère 2°- la région A représente la périphérie d’un tube séminifère qui est le siège de la spermatogenèse (fonction exocrine du testicule) La région B représente le tissu interstitiel qui secrète l’hormone sexuelle mâle (Testostérone), cette région est responsable de la fonction endocrine du testicule. 3°- a- les cellules a, b et c présentent une image d’anaphase puisque les chromosomes sont en ascension polaire. Il existe deux lots de chromosomes aux deux pôles de la cellule. -La cellule a est une spermatogonie en anaphase de mitose puisque ces cellules se multiplient par mitoses. - la cellule b est un spermatocyte I en anaphase I c'est-à-dire en anaphase d’une division réductionnelle de méiose. - La cellule c est un spermatocyte II en anaphase II c'est-à-dire en anaphase d’une division équationnelle de méiose. b-

4°- a- L’expérience proposée pour montrer le rôle de la région A : On détruit sélectivement par irradiation le tissu interstitiel chez un animal pubère. Cet animal montre une régression des caractères sexuels primaires (tractus génital) et des caractères sexuels secondaires. b- Pour montrer le mode d’action du tissu interstitiel, on procède par des injections répétées d’extraits testiculaires à un animal pubère dont on a détruit auparavant ce tissu, les caractères sexuels Iaires et IIaires réapparaissent de nouveau.

EXERCICE 5 :

41

1- Ce phénomène biologique est la fécondation : c’est la rencontre des 2 gamètes mâle et femelle puis la fusion de leurs noyaux (ou pronucleï) donnant naissance à une cellule diploïde (à 2nchromosomes) appelée cellule œuf ou zygote. 2- Légende et titres des figures :
1- 1er GP 2- Cytoplasme 3- Zone pellucide 4- Blastomère 5- 2ème GP 6- Pronucleus mâle 7- Pronucleus femelle 8- Cellule folliculaire (Corona radiata) 9- Spermatozoïde a- Gamète femelle (Ovocyte II bloqué en métaphase II) b- Stade de 2 cellules (ou 2 blastomères) c- Caryogamie (Fusion des 2 pronucleï) d- Formation des 2 pronucleï mâle et femelle e- Anaphase de la 1ère mitose du zygote f- Pénétration du spermatozoïde et activation de l’ovocyte II

3- Chronologie des étapes : a f d c e b 4- Garnitures chromosomiques : n° 1: n= 23 chromosomes n° 4: 2n= 46 chromosomes n°5: n= 23 chromosomes n°7: n= 23 chromosomes n° 8: 2n= 46 chromosomes n°9: n= 23 chromosomes 5a- Combinaisons chromosomiques issues de la méiose:

Remarques: On n’a représenté que les produits d’un seul pronucleus. Un même raisonnement (avec numérotation différente des chromosomes) permet de retrouver toujours 4 types de gamètes possibles selon deux possibilités de ségrégation

b- Nombre de combinaisons théoriquement possibles dans les zygotes = 2n x 2n

n=2 donc le nombre total de combinaisons = 22 x 22 = 4 x 4 = 16 combinaisons.

EXERCICE 6:

42

1°- les figures du doc. 1 illustrent le phénomène de la fécondation. La fécondation est la rencontre des 2 gamètes mâle et femelle puis la fusion de leurs matériaux nucléaires haploïdes (n) pour aboutir à la formation d’une cellule œuf ou zygote diploïde (2n) 2°- Légende : 1- Cellule folliculaire (corona radiata) 2- Spermatozoïde 3-Cellule issue de la 1ère mitose 4- Pronucléus mâle 5- Pronucléus femelle 3°- Titres des schémas : Pénétration du spermatozoïde Stade de 2 cellules Fusion des 2 pronucleï (caryogamie) Formation de 2 pronucleï mâle et femelle Anaphase de la 1ère mitose de la cellule œuf Rencontre des gamètes 4°- Ordre chronologique : F - A- D- C- E- B 5°a- Etape A= pénétration du spermatozoïde La fixation des spermatozoïdes sur les récepteurs de reconnaissance ovocytaires provoque la rétraction des cellules folliculaires de la corona radiata. L’éclatement de l’acrosome (réaction acrosomale) libère un contenu riche en enzymes qui entraînent la liquéfaction de la zone pellucide.

b-

La pénétration du 1er spermatozoïde déclenche la réaction corticale : éclatement des granules corticaux et déversement de leur contenu riche en enzymes dans l’espace péri ovocytaire. Ces enzymes détruisent les récepteurs protéiques de la zone pellucide ce qui empêche la fixation et la pénétration d’autres spermatozoïdes : c’est la monospermie.

EXERCICE 7 : 43

1ère série d’expériences : 1° Expériences 1 et 2 : La sécrétion des gonadotrophines (FSH et LH) est sous la dépendance des neurones hypothalamiques  Expérience 3 : le contrôle hypothalamique sur la sécrétion des gonadotrophines hypophysaires (FSH et LH) est exercé par l’intermédiaire d’une neurohormone (Gn-RH) dont la sécrétion est discontinue (ou pulsatile). 2°- L’hypothalamus détermine par voie sanguine, la sécrétion des gonadostimulines hypophysaires (FSH et LH), à travers la libération d’une neurohormone (La Gn-RH) et par là, il commande de façon indirecte les fonctions ovariennes. 2ème série d’expériences : 1°- Analyse et interprétations des courbes :  A t0 : L’ablation des deux ovaires est suivie d’une chute du taux d’oestradiol (~ 0 pg.ml-1) alors que le taux de LH augmente (25ng.ml-1) Les ovaires exercent un rétrocontrôle négatif (Rc-) sur la sécrétion de LH.

A t1 : L’injection d’une faible dose d’oestradiol (≤60 pg.ml-1) est accompagnée d’une baisse du taux sanguin de LH qui diminue jusqu’à 3ng.ml-1 L’oestradiol exerce, à faible dose, un rétrocontrôle négatif sur la libération de LH dans le sang(cas semblable à celui du Rc- au début de la phase folliculaire). A t2 : l’injection d’une forte dose d’oestradiol (≥ 300 pg.ml-1) entraîne une décharge

importante (ou pic) de LH (› 30 ng.ml-1) L’oestradiol agit, à forte dose, par Rc+ sur la sécrétion de LH (cas similaire à celui de la décharge pré ovulatoire)  A t3 : L’injection d’une faible dose d’oestradiol et de progestérone entraîne une chute du taux sanguin de LH L’oestradiol et la progestérone exercent un Rc- sur la sécrétion de LH (cas du Rc- au cours de la phase lutéale) 2°- La contraception hormonale est basée sur l’utilisation des hormones de synthèse (oestrogènes et progestérone de synthèse). Dans le cas de la pilule combinée, le mélange d’oestradiol et de progestérone administré chez la femme dès le début de son cycle sexuel, exerce un Rc- sur le complexe hypothalamo hypophysaire (4ème expérience). Ce rétrocontrôle a pour effet le maintien d’un taux faible de LH et empêche sa décharge (pic) pré ovulatoire à l’origine du phénomène de l’ovulation qui se trouve alors bloquée.

44

3°- Schéma fonctionnel du déterminisme hormonal du cycle sexuel à la veille de l’ovulation

HYPOTHALA MUS
Gn-RH

Rc+

HYPOPHY SE
FSH LH

Rc+

OVAIRE

FOLLICULE DOMINANT
Oestrogènes UTERU    Prolifération de l’endomètre Contraction du myomètre Perméabilité de la glaire cervicale

EXERCICE 8:

Expérience 1 : Les ovaires sont indispensables au maintien de la grossesse durant les 3 premiers mois seulement Expérience 2 : la HCG est une hormone nécessaire au maintien du corps jaune et donc de la sécrétion des hormones ovariennes : oestrogènes et progestérone. Ces deux hormones sont indispensables au maintien de la dentelle utérine et donc de la grossesse. La HCG est secrétée dès la 2ème semaine de la fécondation par le blastocyste pour maintenir le corps jaune. Le taux de cette hormone atteint un pic vers la 8ème semaine puis décroît. Vers la 11ème semaine, le placenta se forme et commence à secréter des oestrogènes et de la progestérone pour maintenir la grossesse ce qui signifie que le corps jaune n’est plus indispensable.

45

EXERCICE 9 :
1) – Structures ovariennes produisant l’oestradiol

2) Pendant la phase folliculaire l’hypothalamus libère de la Gn-RH selon un mode pulsatile (un pulse toutes les 90 minutes) ce qui stimule l’hypophyse à secréter la FSH : hormone qui assure le développement des follicules ovariens qui secrètent l’oestradiol. 3) L’augmentation importante de la sécrétion d’œstrogènes par le follicule dominant entraîne une augmentation des pulses de Gn-RH (un pulse toutes les 50 min) responsable de la décharge brutale ou pic de LH et la production augmentée de FSH qui sont nécessaires à l’ovulation. 4) L’œstrogène augmente l’épaisseur de l’endomètre avec apparition les glandes en tube entre les quelles s’intercalent des vaisseaux sanguins. L’oestrogène stimule la contraction de myomètre.

46

EXERCICE 10 :

1°- Analyse comparative de figures : Figures Hormones LH Figure A (Femme sans pilules) Variation cyclique avec un pic important vers le milieu du cycle Variation cyclique avec en particulier 2 pics (le 1er vers le 12ème jour et le 2èmr vers le 21ème jour) Absente pendant la 1ère phase du cycle (1er au 14ème jour) et importante pendant la 2ème phase (15ème au 28ème jour) avec notamment un pic vers le 21ème jour. Figure B (femme sous pilules) Taux faible et constant (absence de pic) Sécrétion faible et constante

Oestradiol

Progestérone

Sécrétion faible et constante

2°Chez la femme qui ne prend pas de pilules (Fig. A) : Taux élevé d’oestradiol (pic) Rétrocontrôle positif sur le complexe Hypothalamo-hpophysaire Pic (ou décharge) de LH

OVULATION
Chez la femme sous pilules contraceptives : Progestatifs de synthèse (pilule combinée) complexe hypothalamo-Hypophysaire

Rétrocontrôle négatif sur le Absence de pic de LH

Blocage de l’ovulation

47

EXERCICE 11 :

1°- Représentation schématique de l’anaphase I et L’anaphase II au cours de la gamétogenèse

Cellule mâle :

Ce llu le feme ll e :

48

2°- Tableau de la rencontre des gamètes et formation des zygotes
Gamètes melles Gamètes mâles

fe

1X

2 X’

1 X’

2 X

1X

1X 1X

2 X’ 1X

1 X’

1X

2X 1X

2Y

2 Y
1X

1X

2 X’
2Y 2Y

1 X’

2 X 2Y 2 X 1 Y 2X 2 X

1 Y 2 X

1Y
1X 2X

2 X’ 1 Y 2 X’ 2 X

1 X’ 1 Y
1 X’

2X

3°-Pour les gamètes : 2n = 8 d’où n=4

49

Le nombre de gamètes possibles est 2 n = 2 4 = 16 Nombre de zygotes possibles = 2nx 2n = 24 x 24 = 16 x16 = 256 4°- Déduction : La méiose par le biais du brassage inter chromosomique permet la formation de gamètes génétiquement différents. La fécondation assure la rencontre au hasard des gamètes ce qui permet la formation de zygotes génétiquement différents. Donc la méiose et la fécondation ensemble assurent la diversité génétique et par conséquent une diversité morphologique des êtres vivants (ou polymorphisme).

Deuxième partie :
50

Génétique des diploïdes Génétique moléculaire Génétique humaine

EXERCICE 1: QCM.

1-: a- b- c- d- ; 2-:a- c ; 3-: c ; 4-: a- b ; 5- : a ; 6-:a- b ; 8-: c- d; 9-: a- d; 10-: a ; 11-: a- b- c- d; 12-: a- b- c; 13-: a- b; 14-: a- c ; 15-: a- c.

7-: c ;

EXERCICE 2:

A- Les 2 parents diffèrent par 2 caractères héréditaires : « taille des ailes » et « couleur du corps » Il s’agit donc d’un dihybridisme. La F1 est homogène : tous les individus sont aux ailes longues et aux corps gris (1ère loi de Mendel vérifiée). Les parents sont alors de races pures. Etant donné que les phénotypes des descendants des deux croisements ne dépendent pas de leurs sexes, il s’agit d’un dihybridisme autosomique.

51

Donc chaque caractère est contrôlé par un couple d’allèles : (vg+, vg) contrôle la taille des ailes : vg+ ailes longues vg ailes vestigiales

vg+ > vg

(e+, e) contrôle la couleur du corps : e+ corps gris e corps ébène e+ > e Le 2ème croisement est un test cross (F1 x double récessif) qui a fourni 4 phénotypes différents (2 parentaux et 2 recombinés) et avec des proportions équiprobables de 1 / 4 (2003 / 4 = 500,..) Ces proportions correspondent à celles d’un test cross dans le cas de deux gènes autosomiques indépendants. Hypothèse : Les deux caractères sont contrôlés par 2 gènes autosomiques indépendants avec une relation de dominance absolue entre les allèles (vg+ > vg) et (e+ > e) avec intervention d’un brassage inter chromosomique. Vérification de l’Hypothèse: 1er croisement : Parents : P1 [ vg+,e+] X P2 [vg, e ] Génotypes vg+ e+ vg+ e+ vg vg e e

Gamètes

100 % vg+

e+

100 % vg

e

Fécondation F1 : 100 % vg+ e+ [ vg+,e+]

vg
2ème croisement = test cross F1 + + [vg ,e ] vg+ e+ vg e

e

X

P2 [ vg ,e ] vg vg e e

52

Le parent P2 est un homozygote récessif, il ne peut fournir qu’un seul type de gamètes vg e ce qui signifie que les phénotypes obtenus correspondent aux différents types de gamètes produits par l’hybride F1 par brassage inter chromosomique (ségrégation indépendante des 2 couples d’allèles 2ème loi de Mendel) Les gamètes de l’hybride F1 : 25 % vg+ e+ 25 % vg e 25 % vg+ e 25 % vg e+ Echiquier de croisement:
Gamètes de F1 Gamètes P2

vg+

e+
¼ e+

vg+

e
¼ e

vg

e+
¼ e+

vg

e
¼ e

vg

e

vg

+

vg

+

vg

vg

vg e [vg+,e+]

vg e + [vg , e ]

vg e + [vg,e ]

vg e [vg ,e ]

25 %

25 %

25%

25 %

50 % Phénotypes recombinés

50 % phénotypes parentaux Résultats expérimentaux (% des [ ] des croisements) : • % [vg+,e+] = 24.46 % ≈ 25 %

• •

% [vg+, e ] = 25.41 % ≈ 25 % % [vg,e+ ] = 25.71 % ≈ 25 % % [vg ,e ] = 24.31 % ≈ 25 %

53

Les résultats obtenus dans le cadre de l’hypothèse sont conformes aux résultats de l’expérience L’hypothèse est alors vérifiée. B1°- Les deux parents diffèrent par deux caractères : La taille des ailes et la couleur des yeux cas de dihybridisme. F1 est homogène et tous les individus sont de mêmes phénotypes (ailes longues et yeux normaux) 1ère loi de Mendel vérifiée, on peut alors déduire : La taille des ailes est gouvernée par un couple d’allèles (vg+, vg) La couleur des yeux est contrôlée par un couple d’allèles (pr+, pr) Avec : vg+> vg et pr+> pr Le 2ème croisement est un test cross (F1 x P2). Si on suppose que les 2 gènes sont indépendants, on devrait s’attendre aux résultats théoriques d’un test cross c.à.d 50 % de phénotypes parentaux et 50 % de phénotypes recombinés Or les résultats expérimentaux sont les suivants : % [ ] parentaux = 1339 + 1195 x 100 = 89.25 % 2839 % [ ] recombinés = 151 + 154 x 100 = 10.74 % 2839 Les résultats obtenus par le croisement ne sont pas en accord avec les résultats théoriques du test cross avec 2 gènes indépendants (50 % parentaux, 50 % recombinés) ≠ (89 .25 %, 10.74 %) Les 2 gènes sont alors portés par la même paire de chromosomes (gènes liés) L’apparition de phénotypes recombinés dans ce test cross ne peut être expliqué que par une liaison partielle entre ces deux gènes c.à.d par un brassage intra chromosomique qui s’est produit au cours de la méiose entraînant la recombinaison des allèles. Hypothèse : Les deux gènes sont liés (portés par la même paire de chromosomes) avec le déroulement d’un brassage intra chromosomique

54

Vérification de l’hypothèse : P1 [vg pr+ ]
+

Phénotype Génotype

X

P2 [ vg pr ] vg pr vg pr

vg+ pr+ vg pr

Gamètes

100 % vg+ pr+

100 % vg pr
Fécondation

F1 :

100 %

vg+ pr+ vg pr

[vg+ pr+ ]

Test-cross:

F1
[vg+ pr+ ]

X

P2
[ vg pr ]

vg+ pr+ vg pr

vg pr vg pr ( 0.5 )

Brassage intra chromosomique

Gamètes :

89 % parentaux vg pr+ 44.5 % vg pr 44.5 % 11 % recombinés + vg pr 5.5 % vg pr+ 5.5 %
+

100 % vg pr

55

Echiquier de croisement :(résultats théoriques) Gamètes de F1 vg+ pr+ vg pr Gamètes de P2 1-p = 44.5% 2 vg+ pr+ vg pr [vg+ pr+ ] 1-p = 44.5% 2 vg pr vg pr [ vg pr ]

vg+ pr p = 5.5 % 2 vg+ pr vg pr [vg+ pr ]

vg pr+ p = 5.5 % 2 vg pr+ vg pr [vg pr+ ]

vg pr 100 %

Phénotypes parentaux 1 - P = 0.89 ou 89 % Résultats expérimentaux (ou résultats pratiques) : % [vg+ pr+ ] = 1339 x 100 = 47.16 % 2839 % [ vg pr ] = 42.09 % % [vg+ pr ] = 5.31 % % [vg pr+ ] = 5.42 %

Phénotypes recombinés P = 0.11 ou 11 %

Les résultats pratiques sont conformes avec les résultats théoriques d’où la validité de l’hypothèse. 3°- Carte factorielle : (vg+ , vg) 11cmg (pr+, pr)

(e+, e)

56

EXERCICE 3:

1°- Les deux parents diffèrent par un seul caractère (couleur du pelage) C’est un cas de mono hybridisme. Les individus de F1 ont un phénotype nouveau (bicolore) qui est différent de celui des parents qui proviennent de deux races pures différentes Il s’agit d’un mono hybridisme avec codominance (ou absence de dominance). On considère alors le couple d’allèles (N, O) tels que : N allèle déterminant la couleur noire du pelage [N] O allèle déterminant la couleur orange du pelage [O] Avec N ≈ O ; Les individus bicolores sont [B] ou [NO] Les deux parents sont de races pures différentes alors que la F1 est hétérogène (1ère loi de Mendel non vérifiée) Dans la F1, il y a une répartition phénotypique qui dépend du sexe de l’individu (♀ [B] et ♂ [N]) Hypothèse : Le couple d’allèles (N, O) est porté par un hétérosome (gène lié au sexe) • Si le gène (N, O) est porté par le chromosome Y : Le caractère couleur du pelage ne se transmet alors que chez les individus de sexe mâle. Or ce n’est pas le cas : l’hypothèse est rejetée • Le couple d’allèles (N, O) est porté alors par le chromosome X : Interprétations des résultats des croisements : Parents : Génotypes :

[N]

x


XO Y

[O]

XN XN

Gamètes des parents

100% XN

50% XO

50% Y

Tableau de rencontre des gamètes : Gamètes Gamètes ♀ X
N


XN XO

XO

50% XN Y

Y

50%

100% Soit : 50%

[B ]

50%

[N ] 50%

♀[B]

et 50% ♂ [ N ]

57

F2 :

( F1 ) [N] XN Y

x

( F1 ) [B] XN XO

Gamètes

50% XN

50% Y

50% XN

50% XO

Echiquier de F2 : (résultats théoriques) Gamètes ♂ 50% XN XN XN [N] 50% X
O

Gamètes ♀ 50% XN

50% Y XN Y 25% X Y
O

[N]

25%

X XO
N

[B]

25%

[O]

25%

Résultats expérimentaux : % ♀ [N] = 24,39% % ♀ [B] = 26,82% % ♂ [N) =23,17% % ♂ [O] =25,60% Les résultats théoriques sont conformes aux résultats expérimentaux : l’hypothèse proposée est valide. 2°- Croisement réciproque :

[O] XO XO

x

♂ [N]
XN Y

Echiquier :

100% XO

50% XN

50% Y

Gamètes Gamètes ♀


X
N

XN 50% X [B]
O

Y 50%
O

XO Soit : 50%

100%

X

50%

Y

[O]

50%

♀[B]

et 50% ♂ [ O ]

58

EXERCICE 4:

1°- Les parents sont de variétés pures qui diffèrent par 2 caractères : la couleur des graines et la richesse des graines en substances de réserves c’est un cas de dihybridisme. On considère alors les 2 couples d’allèles (B, b) et (A, s) tels que : (B, b) détermine la couleur des graines : B Graines brunes b Graines blanches (A, s) détermine la richesse des graines : A Graines riches en amidon s Graines riches en sucre ère La F1 est uniforme (1 loi de Mendel vérifiée) formée par des graines ayant un phénotype déterminé par les allèles dominants : il s’agit d’un dihybridisme avec dominance absolue Avec B > b et A > s 2° a- Le deuxième croisement est un backcross Justification : L’individu testeur de la variété à graines blanches et riches en sucre est un individu double homozygote récessif, il correspond à l’un des deux parents. Il est croisé avec un individu de phénotype dominant à graines brunes et riches en amidon. Ce croisement a fourni 4 phénotypes différents d’où on peut dire que l’individu testé est double hybride. b- Le backcross a fourni 4 phénotypes différents dont 2 sont de types parentaux et 2 de types recombinés. Si les deux couples d’allèles sont indépendants on aurait dû obtenir des proportions phénotypiques du type ¼, ¼, ¼ ,¼ Or, les proportions obtenues sont nettement différentes. Donc les deux gènes ne peuvent pas être indépendants. Nouvelle hypothèse : Les deux couples d’allèles sont liés c'est-à-dire portés par la même paire d’autosomes à une distance d l’un de l’autre. Interprétations chromosomiques : Parents : Variété 1 (graines brunes x Variété 2 (graines blanches riches en amidon) riches en sucre) Phénotypes: Génotypes: [ BA ] BA BA [ bs ] bs bs

Gamètes:

100% BA

100% bs

Fécondation F1 : 100% B A bs

[ BA ]

59

Backcross :

Hybride [BA] BA bs

x

Testeur [ bs] double récessif bs bs

4 types de gamètes

100%

b s

L’individu testeur étant double récessif, il ne peut fournir qu’un seul type de gamètes. Les 4 phénotypes obtenus par ce croisement s’expliquent par une diversité gamétique chez l’hybride qui doit alors fournir 4 types de gamètes. Les gamètes recombinés sont issus d’un brassage intra chromosomique (crossing-over) au cours de la méiose (pendant la prophase I) Interprétations chromosomiques:

Echiquier du backcross: (résultats théoriques) Gamètes de l’hybride Gamètes du testeur b s 100% B A b s [BA] b s b s [bs] B s b s [Bs] b A b s [bA] B A 1-p 2 b s 1-p 2 B s p 2 b A p 2

1-p 2 = 0.04

1-p 2

p 2

p 2

p = 66+ 62

= 0.08 donc p

60

1600 2 1-p = 0.46 2 Résultats expérimentaux : % [BA] = 758x100 /1600 = 47.30 % % [bs] = 44.62% % [Bs] = 4.12 % % [bA] = 3.87 % Les résultats théoriques sont conformes aux résultats expérimentaux d’où la validité de l’hypothèse : les deux gènes sont alors liés. c- Localisation chromosomique des deux gènes : Distance entre les 2 gènes = fréquence de recombinaison = 0.08 = 8 % Donc la distance (B,b)-(A,s) = 8 centimorgans Carte génétique ou factorielle : 8cmgs (B,b) (A,s)

3°-a- Pour obtenir une variété pure à graines brunes et riches en sucre, on doit croiser deux parents pouvant fournir tous les deux des gamètes recombinés Bs. Donc il faut croiser des individus de F1 entre eux (F1 x F1), les gamètes Bs sont obtenus par brassage intra chromosomique. Echiquier F1 x F1 = F2

Gamètes F1 Gamètes F1 BA bs Bs 46% 46% 4%

BA 46%

bs 46%

Bs 4%

BA 4%

B s [Bs] bs B s [Bs] bs Bs Bs [Bs]

bA

4%

61

b- Les individus ayant le phénotype [ Bs ] ont pour génotype

Bs Bs

ou B s bs

% [ B s ] = ( 0.04 x 0.04 ) + [ 2 x ( 0.46 x 0.04 ) ] = 0.0016 + 0.0368 = 0.0384 ou 3.84 % c- Les individus (graines) de la variété pure doivent être homozygotes de génotype B s Bs Leur % = (0.04 x 0.04) x 100 = 0.16 %

EXERCICE 5:

1°-Les parents du 1er croisement diffèrent par deux caractères, pigmentation et aspect des poils : C’est un cas de dihybridisme autosomique (en effet il n’y a pas de différences phénotypiques entre les deux sexes dans la descendance des croisements). La F1 est homogène de phénotype « poils gris et lisses » la 1ère loi de Mendel est vérifiée les deux parents sont de races pures cas de double dominance absolue. Soient donc : * Le gène (G, g) qui contrôle la couleur du pelage : G poils gris avec G > g g poils blancs * Le gène (L, l) qui contrôle l’aspect des poils : L poils lisses avec L > l l poils crépus Analyse de la F2 : 211 [ G L ] ≈ ¾ Résultats qui rappèlent la F2 d’un mono hybridisme 69 [ g l ] ≈ ¼ avec dominance absolue. Total = 280 On déduit alors que les deux gènes se transmettent toujours ensemble comme s’ils étaient un seul (hérédité en bloc), de plus l’absence de phénotypes recombinés prouve qu’il n’ y a pas de Crossing-over cas d’une liaison absolue entre les deux gènes. 2°- vérification des résultats des deux croisements : • Croisement 1 : Parents : P1 [ G L ] x P2 [ g l ] Génotypes : GL gl GL gl

Méiose
Gamètes : 100% G L Fécondation 100% g l

62

GL gl • Croisement 2 : Parents : Génotypes :

[G L]

F1 double hybride

F1 [ G L ] GL gl

x

F1 [ G L ] GL gl

50% G L Fécondation : 4 possibilités

50% g l

50% G L

50% g l

Gamètes femelles Gamètes males ½GL

½ GL

½gl

GL GL ¼ [G L] GL gl

GL gl ¼ [G L] gl gl

½gl

¼ [G L]

¼ [g l]

Ces résultats confirment l’hypothèse d’une liaison absolue. 3°- Il s’agit d’un test cross Parents : F1 [ G L ] Génotypes : Pas de C.O Gamètes GL gl

x

{gl] gl gl

50% G L

50% g l

100% g l

Fécondation : 2 possibilités Gamètes femelles Gamètes males 100% g l ½ GL GL gl ½ gl gl gl

½[GL]

½[gl]

Conclusion : Dans le cas de liaison absolue, les 2 allèles (des 2 gènes) présents sur le même chromosome se transmettent en « bloc » à la descendance, car le crossing-over ne survient pas au cours de la

63

méiose. Le double hybride produit alors toujours deux types de gamètes parentaux avec la même fréquence. 1/2 parental 1+ 1/2 parental 2 pour le test cross Descendance F2 à base de 4 pour le croisement entre doubles hybrides Pourcentage des recombinés = 0%

EXERCICE 6:

1/ Deux caractères étudiés : la taille de la plante et la forme des feuilles 2 gènes considérés : cas de dihybridisme. 2/ On pose : * le gène de la taille (N, n) N n avec N > n taille normale plante naine cas de double dominance car la F1 est homogène de phénotype]ND [

* le gène de la forme (D et d) D d avec D > d

feuille découpée feuille entière

3/ La F2 est composée de la manière suivants : % = 926 × 100 = 57,47 ≈ 9 1611 16 288 ] N d [ % = 288 × 100 = 17,87 ≈ 3 1611 16 293 ] n D [ % = 293 × 100 = 18,18 ≈ 3 1611 16 104 ] n d [ % = 104 × 100 = 06,45 ≈ 1 16 1611 ‫ـــــــــــــــــــــــــــــــــــــ‬ Total = 1611 = 100% La F2 est donc à base 16 ce qui correspond à un cas de deux gènes autosomiques indépendants. 4/ considérons chaque caractère à part, la génération obtenue par le croisement (A) x (B) est composée de la manière suivante : Pour la taille : % ] N [ = 219 + 207 × 100 = 75,93 % ≈ 3 561 4 926 ] N D [

64

% ] n [ = 64 + 71 × 100 = 24,06 % ≈ 1 561 4 Donc le croisement (A) ] N [ × (B) ] N [ a fournit : 3 ] N [ + 1 ] n [ 4 4 Les deux plantes sont donc hybrides (hétérozygotes) pour le caractère « taille ». Pour le caractère taille : (A) N et (B) N (vérifier par l’échiquier) n n

Pour la forme de la feuille : % ] D [ = 219 + 64 × 100 = 52,4 % = 1 561 2 % ] d [ = 207 + 71 × 100 = 76 % = 1 561 2 L’une des deux plantes doit être de lignée pure donc de génotype d et l’autre hybride donc de génotype D d d Conclusion : Génotype de (A) N n D d (à vérifier le résultat par l’échiquier) Résultat qui rappelle le test cross de mono hybridisme (50%, 50%)

Génotype de (B)

N n x

d d (D) ] n D [ n n ? ?

5/ (C) ] N d [ ? ? d d

Pour le caractère taille de la plante : % ] N [ = 70 + 91 × 100 = 49,6 % = 1 324 2 % ] n [ = 86 + 77 × 100 = 50,3 % = 1 324 2 On déduit que le génotype de la plante (c) concernant le caractère taille est N Pour le caractère forme des feuilles : n Ceci rappelle les résultats d’un test cross de mono hybridisme (50%, 50%)

65

% ] D [ = 70 + 86 × 100 = 48, 14 % = 1 324 2 % ] d [ = 91 + 77 × 100 = 51,8 % = 1 324 2

Résultats d’un test cross de mono hybridisme (50%, 50%)

le génotype de la plante (D) concernant le caractère forme des feuilles est donc D

Conclusion : (C) :

N n

d et (D) : n D d 1 2 N n d d 1 2 n d

gamètes de (C) gamètes de (D) 1 n D 2 1 n d 2 Résultats pratiques : 70 ] N D [ = 21,6 % = 1 4 91 ] N d [ = 28 % = 1 4 86 ] n D [ = 26,5 % = 1 4

1 ]ND [ 4 1 ]Nd [ 4

1 ]nD [ 4 1 ]nd [ 4

77 ] n d [ = 23,7 % = 1 4 Total =324 Les résultats théoriques sont conformes aux résultats expérimentaux donc l'hypothèse de deux gènes indépendants est vérifiée.

66

EXERCICE 7:

Deux gènes étudiés : cas de dihybridisme * Gène de la couleur de la corolle (R, B) :

R B

Corolle rouge Corolle blanche

Avec R = B : cas de codominance car la F1 est homogène de phénotype ] R B [ = rose apparition de nouveau phénotype intermédiaire.

* gène de la forme de la corolle (O, o) :

O
o

Corolle ouverte
Corolle fermée

Avec O > o : cas de codominance absolue car la F1 est homogène de phénotype ] O [. 2/ Analyse de la F2 = (F1 x F1 ) % ] R,O [ = % ] RB,O [ = % ] B,O [ = F2 est à base 16 15 x 100 = 18,07 % =

83
31 x 100 = 37,34 % =

3 % 16 6 % 16

] R,O [ = ] RB,o [ = ] B,o [ =

6 x 100 = 07,22 % = 1 83 16 9 x 100 = 10,84 % = 2 83 16

83

16 x 100 = 19,27 % = 3 % 83 16

6 x 100 = 07,22 % = 1 83 16

Les 2 gènes sont indépendants c.a.d Localisés sur deux paires différentes de chromosomes.

3) Premier croisement : Phénotypes Génotypes (2 n) P1 ] R O [ x P2 ] B,o [

R R

O O

B B

O o

67

Gamètes (n)

100% RO

100% Bo

Fécondation (2n) Zygote R B O o 100% F1 ] RB, O [

Deuxième croisement : Phénotypes: F1 ] RB, O [ x ] RB, O [ F1 R B O o R O B o Méiose

Génotypes (2n )

Gamètes (n) 4 types de gamètes équifréquents à cause du brassage inter chromosomique chez chaque parent.

R O
25% Parentaux (50%) Gamètes mâlesF1 Gamètes femelles F1 1 4 R O 1 4

R
25%

o

B o
25% 25%

B

O

recombines (50%) 1 4 1 4 1 4

R

O

B

o

R

o

B

O

R O R O ] R, O [ 1/16

R O B o ] RB,O [ 1/16

R R

O o ] R, o [ 1/16

R B

O O ] RB, O [ 1/16

1 4 B o

R B

O o ] RB, O [ 1/16

B B

o o ] B, o [ 1/16

R B

o o ] RB, o[ 1/16

B B

o O ] B, O [ 1/16

68

1 4

R

o

R R

O o ] R, O [ 1/16

R B

o o ] RB, o [ 1/16

R R

o o ] R, o [ 1/16

R o B O ] RB, O [ 1/16

1 4

B

O

R B

O O ] RB, O [ 1/16

B O B o ] B,O [ 1/16

R O B O ] RB, O [ 1/16

B O B O ] B, O [ 1/16

Bilan 6 ]RB, O [ ; 2 ]RB, o [ ; 3 ]R, O [ ; 3 ] B,O [ ; 1 ]R, o [ ; 1 ] B, o [ 16 16 16 16 16 16 Les résultats théoriques sont conformes aux résultats pratiques il s’agit de 2 gènes indépendant avec dominance pour l’un et codominance pour l’autre.

EXERCICE 8:

1°/ A – Les deux sexes diffèrent par le nombre d’allèles du gène de la couleur. Ceci ne peut s’expliquer que si l’on admette que le gène de la couleur chez cette espèce est porté par le chromosome hétérosexuel. Ainsi les femelles (XX) possèdent 2 copies du gène et les males 1 seule copie. B- Les animaux « bigarrés » sont toujours hybrides contrairement à ceux « noirs » et à ceux « oranges » homozygotes. On déduit qu’il s’agit d‘un cas de codominance Soit donc le couple d’allèles (N, O) tel que : N O Avec N ≈ O et le gène est porté par le chromosome X. Les chattes de génotypes XN XO sont bigarrées. XN / poils noirs poils oranges

2°- les chats « noir » sont de génotype

Les chats «orange » sont de génotype XO / Deux allèles N est O ne sont jamais présents simultanément chez les chats ce qui est en accord avec les données de l’exercice : les chats ne sont jamais « bigarrés ».

69

3° / a) Parents : Phénotype : Génotype (2n) : NO [ XN / XO X ♂ XN / ]N[

Gamètes : Fécondation : Gamètes 1/2 XN

1/2 XN F1 Gamètes ♂

1/2 XO 4 possibilités 1/2 XN

1/2 XN 1/2

1/2

X N XN 1/4 ] N [ X / XO
N

XN / 1/4 ] N [ XO / 1 /4 ] O [

1/2 X

O

1/4 ] NO [

b)

Parents : Phénotype :

♀ ]N [

X

]O[

70

Génotype (2n) :

XN / XN

XO /

Gamètes (n) : Fécondation : F1 tes tes 1/2 XN

100% XN 2 possibilités

1/2 XO

1/2

1/2 XO

1/2 XN / ] N[ 1/2

X N XO 1/21

] NO[

71

Génétique moléculaire

EXERCICE 1:

1°- Brin d’ADN :

sens de lecture .......TGAGGTCTTCTT………..ATC Transcription

Séquence d’ARNm : .......ACUCCAGAAGAA……….UAG 2°- La séquence d’acides aminés de la chaîne polypeptidique : ARNm : .......ACUCCAGAAGAA………..UAG Traduction

Protéine (chaîne polypeptidique) : Met - NH2 –Thr – Pro – Glu – Glu - COOH

72

Hydrolyse 3°- Les schémas sont présentés dans l’ordre logique de déroulement de la traduction : D – C – B -A

73

4°- Le nouveau brin muté : ADN
muté

: .......TGGGGTCTTCTT………..ATC

ARNm :

.......ACCCCAGAAGAA………..UAG

Protéine:

Thr – Pro – Glu – Glu - COOH

La chaîne peptidique est la même : il s’agit d’une mutation silencieuse

74

5°- Le code génétique est redondant- dégénéré : plusieurs codons (ou triplets) codent pour le même acide aminé. 6°- Nouvelle chaîne peptidique : NH2 – Thr – Pro – COOH La chaîne peptidique est devenue plus courte, donc il y a arrêt de la synthèse protéique par un codon STOP qui remplace le codon de l’acide aminé Glu. Donc : nouveau ARNm : ACUCCAUGAA………..UAG Donc l’ADN muté : TGAGGTACTT………..ATC C’est une mutation par insertion d’un nucléotide à base d’Adénine au niveau de l’ADN ce qui provoque l’arrêt de la traduction au niveau d’un codon STOP sur l’ ARNm

EXERCICE 2:
1°- Les outils du génie génétique : • Les plasmides bactériens • Les enzymes : - Enzymes de restriction (ou ciseaux moléculaires) - Les ligases - La transcriptase reverse • Les sondes moléculaires radioactives • Les cellules hôtes 2°- L’isolement d’un gène peut être réalisé selon 2 procédés : • A partir de l’ADN : on découpe l’ADN d’une cellule, spécialisée dans la synthèse de la protéine codée par le gène à isoler, à l’aide d’une enzyme de restriction. A partir des fragments obtenus, on peut isoler le gène en question à l’aide d’une sonde moléculaire radioactive. • A partir de l’ARNm : On synthétise à partir de l’ARNm et à l’aide d’une transcriptase reverse de l’ADN simple brin (ADN copie). Ce dernier est utilisé comme matrice pour synthétiser le brin complémentaire à l’aide d’une enzyme, l’ADN polymérase. L’ADN double brin qui en résulte constitue le gène à l’état pur (sans introns)

3°-

a- Une sonde moléculaire est une séquence radioactive de ribonucléotides (ADN ou ARNm)
qui possède une structure proche du gène à isoler (ou à cloner).

b- La sonde moléculaire radioactive peut s’apparier avec l’ADN du gène lorsque cet ADN

est sous forme de simple brin (Hybridation moléculaire) et par conséquent on peut faire le repérage des clones bactériens qui renferment le gène. c- La sonde possède une structure qui peut s’apparier avec le fragment F3. d- On peut utiliser le virus V pour lutter contre le champignon R selon l’un des deux procédés expérimentaux suivants : • Faire le clonage du gène X (repérage, insertion puis expression) en utilisant des plasmides bactériens. L’expression du gène X chez les bactéries permet de produire à l’échelle industrielle, des quantités considérables de la protéine virale qu’on peut alors utiliser comme fongicide (pour arrêter le développement du champignon R)

75

Greffer le gène viral X dans le génome de la plante de blé ( la plante est désormais transformée génétiquement : il s’agit d’un OGM ) ce qui permet à cette variété de blé , en exprimant le gène X , de synthétiser la protéine virale d’où sa protection contre le champignon R

76

Génétique humaine

EXERCICE 1 : 1- III2 malade, provient de deux parents phénotypiquement sains II5 et II6, donc l’allèle
responsable de la maladie est récessif (masquée chez les parents). Ou encore: Les individus II5 et II6 apparemment sains, ont eu un descendant III2 Malade : donc, l’allèle responsable de la maladie est récessif. On pose : - A : allèle responsable du phénotype normal. - a : allèle responsable du phénotype malade. Avec A › a 2- Localisation des gènes : Hypothèse 1 :l’allèle responsable de la maladie est autosomique.

77

Parents : Phénotypes: Génotypes: Gamètes :

I1 [A] A//a A ou a

x

I2 [a] a//a a I2 a I1 A A//a [A] a a//a [a]

Cette union donnera des enfants sains et des enfants malades indépendamment du sexe : l’hypothèse est à retenir. Hypothèse 2 : l’allèle responsable de la maladie est porté par Y. La présence de filles malades exclue l’hypothèse (car elles ne portent par le chromosome Y). Ou aussi, un garçon malade doit avoir un père malade, ce n’est pas le cas puisque II2 est malade et son père I1 est sain. Hypothèse 3 : l’allèle responsable de la maladie est porté par X. I2 étant une femme malade, tous ses garçons doivent être malades, ce qui n’est pas le cas : donc hypothèse à rejeter. Ou encore ; II3 étant une fille malade de génotype Xa// Xa, son père devrait être malade Xa //Y, or ce n’est pas le cas puisqu’il est phénotypiquement sain.

EXERCICE 2 : 1- Les parents -1- et -2- phénotypiquement sains ont dans leur descendance des enfants
atteints : donc, l’allèle responsable de la maladie est récessif. Notation : N: allèle normal. Avec N › m. m: allèle responsable de la maladie.

2- Localisation du gène : Hypothèse1 :L’allèle responsable de la maladie est lié à Y. L’individu -4- ; garçon malade, son père -1- sain : Hypothèse à rejeter. Hypothèse2 :L’allèle responsable de la maladie est lié à X.

78

L’individu -4- étant un garçon malade de génotype : Xm//Y, hérite Y de son père et Xm de sa mère qui doit être hétérozygote (donc vectrice) de génotype : XN//Xm, ce qui est le cas. Donc hypothèse possible. On peut vérifier ceci par l’échiquier suivant : 2 ½ XN ½ Xm 1 Filles. ½ XN XN XN N m X X N Garçons. ½Y X Xm Y Y Ce croisement donne des résultats conformes à la descendance de l’arbre généalogique. Hypothèse3 :L’allèle responsable de la maladie est autosomique. L’individu -4- étant malade, de génotype : m//m, hérite m de son père et m de sa mère (tous deux hétérozygotes N//m), ce qui est possible. Vérification : 2 ½N N N N m ½m N m m m

1 ½N ½m

Filles et garçons

3- a- L’ADN du sujet n°2 montre seulement la présence de l’allèle normal, il aura

nécessairement le génotype : N//N et ses enfants portent tous au moins un allèle normal N et seront par conséquent tous de phénotype normal, ce qui n’est pas le cas puisqu’il y a des descendants malade, donc le gène est lié à X conformément à l’hypothèse n°2. b- Génotypes : Individu n° 1 3 5 N N N Génotypes : X X X ou XN Xm Y Xm XN

EXERCICE 3 : 1- Hypothèse1 :L’allèle responsable de la maladie est dominant : dans ce cas, un enfant

malade doit avoir au moins un parent malade. Or, le sujet 9 est malade, mais aucun de ses parents n’est malade : hypothèse 1 à rejeter. Hypothèse2 :L’allèle responsable de la maladie est récessif : Le sujet 9 par exemple est malade, ses deux parents (1 et 2) sont phénotypiquement sains : hypothèse vraie semblable. N: allèle normal. m: allèle responsable de la maladie.

Soit :

Avec N › m.

79

les deux sexes : hypothèse possible. b) L’allèle responsable de la maladie est lié au sexe : - Lié à Y (sans équivalent sur X) : ceci suppose qu’un garçon malade doit avoir un père malade ; or ce n’est pas le cas puisque le sujet n°17 est malade, mais son père (n°6) est sain : donc, hypothèse à rejeter. - Lié à X (sans équivalent sur Y) : dans ce cas, un garçon malade de génotype Xm//Y, hérite un Xm de sa mère qui est vectrice XN//Xm et un Y de son père. Ce qui est possible dans cet arbre généalogique : donc hypothèse à retenir. 3- Puisque le sujet n°1 ne porte que l’allèle normal N, il ne peut être que : XN//Y et non de la forme N//N, ce qui confirme l’hypothèse « gène lié à X » et rejette l’hypothèse « gène autosomique ». 4 XN Xm 5 XN Xm 7 X ou XN XN Xm
N

2- a) L’allèle responsable de la maladie est autosomique : la maladie touche indifféremment

9 Xm Y

10 XN Y

4 -Les deux jumeaux 14 et 15 sont issues de deux ovules et deux spermatozoïdes différents, c’est pour cela qu’ils génétiquement différents (n’ont pas le même génotype).

1- Discussion des hypothèses : Hypothèse1 :L’allèle responsable de la maladie est localisé sur le chromosome Y. Dans les deux cas (dominant ou récessif), un père atteint transmet l’allèle anormal à tous ses fils qui doivent être tous atteints. Or ce n’est pas le cas, puisque le fils 4 est sain issu d’un père atteint : Hypothèse à rejeter. Hypothèse2 : L’allèle responsable de la maladie est récessif autosomique. Soit : -S : allèle normal (dominant). - m : allèle responsable de la maladie (récessif). Le fils (5) atteint, homozygote, de génotype m//m peut provenir d’un père atteint (1) de génotype m//m et d’une mère saine (2) qui doit être hétérozygote S//m : hypothèse à retenir.

EXERCICE 4 :

Hypothèse3 : L’allèle responsable de la maladie est récessif lié à X. Le garçon (5) atteint, de génotype Xm//Y doit avoir une mère hétérozygote Xs // Xm : hypothèse à retenir. Hypothèse4 : L’allèle responsable de la maladie est dominant autosomique. Soit : -M : allèle responsable de la maladie (dominant). -s : allèle normal (récessif). L’union entre le père atteint (1) de génotype M//s et la mère saine (2) de génotype s//s peut être à l’origine d’individus sains s//s et d’individus atteints M//s : hypothèse à retenir. Hypothèse5 : L’allèle responsable de la maladie est dominant lié à X.

80

Le père (1) atteint de génotype XM//Y ne donne pas de fille saine (3) de génotype Xs // Xs. Une mère saine (2) Xs // Xs ne peut donner un garçon atteint (5) de génotype XM//Y : Hypothèse à rejeter. 2a- si le gène est autosomique, chaque individu, quel que soit son sexe possède les deux allèles du gène, ce qui n’est pas le cas pour les sujets B, C et D. le gène n’est pas autosomique mais récessif lié au sexe. L’hypothèse3 est donc l’unique à retenir. b- tableau à compléter : Individu Génotype Individu correspondant Au génotype A XS Xm 2 ou 3 B XS Y 4 C Xm Y 1 ou 5 D Xm Y 5 ou 1 E XS Xm 3 ou 2

81

You're Reading a Free Preview

Télécharger
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->