Vous êtes sur la page 1sur 3

Parâmetros a ter em conta no desenho de primers

ƒ Tamanho (18-25 bp).


ƒ Sempre que possível devem começar e terminar em G/C.
ƒ Percentagem de G/C (40-60%).
ƒ Temperatura de melting (Tm) (50-65ºC).
ƒ A Tm dos dois primers deve ser semelhante (diferença
máxima de 5ºC).
ƒ Os primers não devem emparelhar entre si (dimers) ou com
eles próprios (self-dimers).

Primer3 : http://fokker.wi.mit.edu/primer3/input.htm
OligoAnalyzer : http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/

Desenho de primers

 



 


Primer Forward : 5’ GTCTAACAGACCCTTAGATC 3’

Tamanho = 20 bp %G/C = 45 % (9 G/C : 11 A/T)

Primer Reverse : 5’ CTAGCATGGAAGGTAGTCTC 3’

Tamanho = 20 bp %G/C = 50 % (10 G/C : 10 A/T)


Temperatura de melting (Tm) e Temperatura de Annealing (Ta)

Tm (ºC) = 4ºC . (G + C) + 2ºC . (A + T)

Ta (ºC) = Tm - 5ºC
Nota: Se os primers tiverem Ta diferentes, a Ta que deve ser escolhida
para realizar a reacção de PCR deve ser a mais baixa.

Exemplo

Primer Forward: 5’ GTCTAACAGACCCTTAGATC 3’

Tm = 4 (9) + 2 (11) = 58ºC


Ta = 58 - 5 = 53ºC
Ta = 53ºC
Primer Reverse: 5’ CTAGCATGGAAGGTAGTCTC 3’

Tm = 4 (10) + 2 (10) = 60ºC


Ta = 60 – 5 = 55ºC
1. Os pares de primers apresentados a seguir foram desenhados para
amplificar, por PCR, uma sequência de DNA. Indique o par que
considera ser o mais adequado para o resultado pretendido.

a) FW 5’ ATGTACGTGAGGCTAGTATG 3’

RV 5’ GTAGTCATCACGTACATGTAG 3’

b) FW 5’ GTTCCATCTCACTGTCGATC 3’

RV 5’ CTCATAAGCGGATATCATTGC 3’

c) FW 5’ CGATGTTCATCTGTCGATAC 3’

RV 5’ GCACGATCGAGTCAGTCCTG 3’

2. Indique um programa apropriado para realizar uma reacção de PCR


com o par de primers que seleccionou.

94º - 2 minutos

94º - 30 segundos
? - 1 minuto 30 ciclos
72º - 1 minuto

72º - 10 minutos