Vous êtes sur la page 1sur 233

UNIVERSITE JOSEPH FOURIER – GRENOBLE I

U.F.R. DE PHARMACIE

Année 1999 Thèse N°

THESE
présentée pour obtenir le grade de

DOCTEUR DE L’UNIVERSITE JOSEPH FOURIER – 

GRENOBLE I

SPECIALITE : Chimie Moléculaire

Option : Sciences Pharmaceutiques

Présentée et soutenue publiquement le 14 décembre 1999

Par

Philippe OP de BECK

ETUDE PHYTOCHIMIQUE ET BIOLOGIQUE DE 

LEEA GUINEENSIS G. DON (LEEACEAE)

JURY

1
M.  LECLERC G. Professeur à l’Université de Grenoble I Président

M.  BARRON D. Professeur à l’Université de Lyon I Rapporteur

M.  DAVID B. Docteur, Institut de Recherche Pierre FABRE Rapporteur

M.  HOSTETTMANN K. Professeur à l’Université de Lausanne

Mme MARIOTTE A.M. Professeur à l’Université de Grenoble I

Mme DIJOUX­FRANCA M.G. Maître de Conférence à l’Université de Grenoble I

2
A ma sœur Christelle.

A ma famille, sources constantes d’encouragement, de soutien, de confiance et


d’affection.

A Perrine, pour le soutien et l’aide si précieuse que tu m’apportes au quotidien.

A mes amis.

3
Remerciements

Nous tenons tout d’abord à remercier les Laboratoires Pierre FABRE et notamment :

Monsieur André CASSAN, Président de l’Institut KLORANE.


Nous avons été très sensible à votre appui, au financement que nous avons bénéficié ainsi qu’à
la confiance que vous nous avez témoignée. Veuillez recevoir ici notre profonde
reconnaissance et tous nos remerciements.

Au membre du jury :

A Monsieur le Professeur Kurt HOSTETTMANN, Professeur de Pharmacognosie et de


Phytochimie de l’Université de Lausanne.
Nous vous remercions d’avoir accepté de juger ce travail malgré vos nombreuses sollicitations.
Nous sommes honorés par votre présence à notre jury.

A Monsieur le Docteur Bruno DAVID, Directeur du Département Phytochimie du Centre de 

Recherches   sur   les   Substances   Naturelles   de   l’Institut   de   Recherche   Pierre   FABRE   à 

Ramonville.
Nous exprimons nos vifs remerciements pour avoir accepté de juger ce travail. D’un contact
toujours aimable, vous avez répondu présent à nos nombreuses demandes malgré vos multiples
taches Vos remarques et discussions ainsi que l’aide efficace que vous nous avez apportées
dans la réalisation de ce travail ont été très appréciées. Soyez en vivement remercié.

A Monsieur le Professeur Denis BARRON, Professeur de Biochimie Végétale à l’Université


Claude Bernard Lyon I.
Soyez remercié d’avoir bien voulu accepté de juger ce travail. Sachez aussi que vos travaux
sur les flavonoïdes sulfatés nous ont beaucoup inspirés et que nous sommes très sensibles à
l’honneur que vous nous faite d’être rapporteur.

4
A Monsieur le Professeur Gérard LECLERC, Professeur de Chimie Organique à l’UFR de
Pharmacie de Grenoble et Directeur du Département de Pharmacochimie Moléculaire.
Nous sommes sensible à l’intérêt que vous portez à juger notre travail. Recevez ici le
témoignage de ma gratitude.

A Madame le Professeur Anne-Marie MARIOTTE, Professeur de Pharmacognosie à l’UFR de


Pharmacie de Grenoble.
Votre accueil dans votre laboratoire m’a permis de faire mes premiers pas dans la recherche sur
les substances naturelles. Recevez ici, mes sincères remerciements.

A Madame le Docteur Marie-Geneviève DIJOUX-FRANCA, Maître de Conférence en


Pharmacognosie à l’UFR de Pharmacie de Grenoble.
Qu’il me soit ici permis de te remercier pour l’autonomie dont j’ai bénéficiée ainsi que pour les
conseils et ta disponibilité pour l’apprentissage de l’enregistrement des spectres RMN. Tu m’as
aussi réconcilié avec l’anglais, bravo ! En témoignage de ma profonde gratitude, trouves ici
mes plus vifs remerciements.

Aux personnes qui ont participé "de près ou de loin" à son élaboration :

A Monsieur Jean Marie BESSIERE, Professeur à l’Ecole Nationale Supérieure de Chimie de


Montpellier.
Je vous remercie pour les analyses CG/SM que vous avez effectuées ainsi que pour le constant
suivi du devenir de ces composés volatils. Comme vous le dites si bien, on touche au but !

A Mesdames M.-F. ARIES, C. VAISSIERE, A. BEL et C. CHARVERON du Département


Evaluation et Exploration Fonctionnelle et Cutanée, Laboratoire de Biologie Cellulaire de
l’Institut de Recherche Pierre FABRE de Toulouse.
Nous vous remercions pour les analyses effectuées au sein de votre unité.

5
A Monsieur Claude BOSSO, Directeur de l’unité de Spectrométrie de Masse du Centre
d’Etude et de Recherche sur les Macromolécules Végétales de Grenoble.
Soyez remerciez pour la réalisation et les analyses des spectres de masse. Vos conseils
judicieux et votre disponibilité ont été très appréciés.

A Monsieur François TOMASSON, Ingénieur recherche, responsable du service commun de


RMN de l’UFR de Pharmacie, pour m’avoir donner la possibilité de manipuler l’AC200.
L’obtention généreuse de ces précieuses unités RMN pour les soirées, les WE ou les vacances
ainsi que vos discussions à propos de nos travaux scientifiques ou en ce qui concerne nos si
belles montagnes ont été fortement appréciées.

A Monsieur Gilbert CARTIER, le "Géotrouvetout" du Laboratoire de Pharmacognosie pour la


préparation des extraits et leur lyophilisation. Je vous remercie pour votre disponibilité et votre
enthousiasme très communicatif.

A Messieurs DEBOUZY et BRAHME du Laboratoire de Biophysique du Centre de Recherche


du Service de Santé des Armées de Grenoble, pour nous avoir donné la possibilité d’effectuer
des analyses spectrales (RMN, MS/MS).

A Monsieur Achoundong, Botaniste au Cameroun, pour la récolte de Leea guineensis. Sans


vous point d’étude !

A Monsieur Jean Marc NUZILLARD, Directeur de Recherche CNRS au Laboratoire de


Pharmacognosie de l’Université de Reims pour avoir passer un échantillon sur le 500 MHz tant
rêvé !

A Monsieur Ahcène BOUMENDJEL, Maître de Conférence au Laboratoire de


Pharmacognosie, pour tes conseils, ton intérêt à nos travaux et nos discussions éclectiques.

6
A Monsieur Patrick RAVANEL, Professeur de Biologie Végétale, Directeur du Laboratoire
Ecosystèmes et Changements Environnementaux de Grenoble, pour tes encouragements tout
au long de ce travail, ton aide et ta disponibilité. J’ai aussi beaucoup aimé tes diapos sur les
plantes toxiques de France, il va de soit que ta narration avec l’accent d’la Yaute y sont pour
quelque chose !
A Madame Claude VIAL, pour sa gentillesse et sa disponibilité pour les nombreuses
recherches en ligne que nous avons effectuées.

A Diderot Noungoue Tchamo, je te remercie, entre autre, pour m’avoir offert ton amitié et
amené Leea guineensis. Reçois ici, toi qui es devenu Maître de Conférence à Yaoundé, un
témoignage de ma profonde amitié.

A Gilles BRUN, "le Dupont bis", ton travail sur Catharanthus roseus, nous aura confronté aux
mêmes situations. Reçois ici un témoignage de mon Amitié.

A toutes les personnes du Laboratoire de Pharmacognosie, pour l’ambiance chaleureuse


rencontrée et leur vive sympathie.

A Stéphane, thésard au Laboratoire de Chimie bioorganique pour avoir enregistré les spectres
au 300 MHz au CEA cet été !

A Jin, Médecin Pharmacologue de l’Université de Shanghai, en stage chez nous qui a essayé de
mettre au point un test antioxydant pour l’analyse de nos produits ainsi que pour les résultats
préliminaire sur la relaxation des muscles lisses.

Au Laboratoire de Pharmacologie Médicale de l’UFR de Médecine pour les premiers résultats


sur la recherche d’une activité relaxante sur les veines saphènes humaines.

A ma sœur Muriel et son entreprise O de Gamme pour avoir eu la gentillesse de me scanner les
planches et dessins de Leea.

7
Liste des abréviations

13
C J modulé spectre carbone 13 réalisé avec J modulation
BAW Butanol-Acide acétique-Eau
BuOH butanol
C(x) Solvant de Chromatographie de type (x)
C-18 Chromatographie sur support en phase inverse C-18
CCM Chromatographie sur Couche Mince
CCMprep Chromatographie sur Couche Mince Préparative
CDCl3 chloroforme deutérié
CD3OD méthanol perdeutérié
CG/SM couplage Chromatographie Gazeuse-Spectrométrie de Masse
CHCl3 chloroforme
cHex cyclohexane
CH2Cl2 dichlorométhane
CLMP Chromatographie Liquide Moyenne Pression
CO chromatographie sur Colonne Ouverte
COLOC XH shift Correlation by Long range Coupling
COSY Correlated SpectroscopY
CPG Chromatographie en Phase Gazeuse
CV Composés Volatils
DCI Desorption by Chemical Ionisation
DIC Degré d’Insaturation et de Cycle
DMSO diméthyl sulfoxyde
DMSO-d6 diméthyl sulfoxyde hexadeutérié
E(x) Elution de type x
EI Electronic Impact
EtOAc acétate d’éthyle
EtOH éthanol
FAB Fast Atom Bombardement
F () ST Flavonol Sulfotransférase
J (Hz) constante de couplage exprimé en Hz
L. Leea
LH-20 chromatographie sur gel de Sephadex LH-20
MeOH méthanol
m/z masse/charge électronique
nd non déterminé
PM Poids Moléculaire
ppm partie par million
Rdt rendement
rel relatif
Rf Rapport frontal
Rha Rhamnosyl
RMN Résonance Magnétique Nucléaire
RP Phase Inverse
Si et SiO2 support chromatographique en silice
SM Spectrométrie de Masse
ST Sulfotransférase
uma unité de masse atomique

8
UV Ultra-Violet
Visiprep Colonne prête à l’emploi de type Visiprep
VLC Vacuum Liquid Chromatography
XHCORR XH shift CORRelated 2D NMR
δ (ppm) déplacement chimique exprimé en ppm
λmax longeur d’onde d’absorbance maximale

9
TABLE DES MATIERES
PAGE

Introduction 2

Première Partie – Bibliographie 4

Chapitre I - Etude Botanique 5

I­ Position systématique 5
A) Historique de la taxonomie du genre Leea 5
B) Position systématique de la famille des Leeaceae 7
C) Conclusion 9

II- Généralités sur le genre Leea 11


A) Classification et composition du genre 11
B) Principaux caractères botaniques 14
C) Répartition géographique 15

III- Généralités sur l’espèce Leea guineensis G. Don 17


A) Dénomination et synonymies 17
B) Noms vernaculaires 20
C) Répartition géographique 21
D) Description botanique 22
E) Divers 26

Chapitre II – Etudes phytochimique et biologique des Leeaceae 27

I- Etude phytochimique 27
A) Criblage phytochimique 27
B) Huile essentielle 28
C) Composés phénoliques 28

10
11
II- Etude biologique des Leea 31
A) Activités des différentes espèces de Leea 31
B) Activités de Leea guineensis 35
C) Conclusion 39

Chapitre III - Les Flavonoïdes Sulfatés 40

I­ Introduction 40

II­ Classification, Structure 40
A) Les flavones sulfatées 42
B) Les flavonols sulfatés 45

III­ Distribution 49

IV­ Fonctions 50
A) Détoxification 51
B) Transfert d’ion 51
C) Bioactivation 51
D) Régulation du transport de l’auxine 52

V­ Enzymologie 52

VI­ Métabolisation et Bioconversion 54
A) Métabolisation 54
B) Bioconversion 55

VII­ Propriétés biologiques des flavonoïdes sulfatés 55
A) Activité Antiallergique 55
B) Activité Mutagène – Carcinogène 56
C) Inhibition des déshydrogénases 57
D) Inhibition de l’aldose réductase 57
E) Activité Anti-oxydante – Antiradicalaire 60
F) Chimioprévention des cancers du sein 61

12
Conclusion 63

13
Deuxième Partie ­ Travaux Personnels 64

Chapitre I - Matériel végétal et Chimie Extractive 65

I- Matériel végétal 65

II- Chimie extractive 65


A Extraction solide-liquide des feuilles 65
B Extraction liquide-liquide 65
C Hydrodistillation 66

Chapitre II - Isolement des composés 68

I- Extrait hexanique 68
II- Extrait dichlorométhane 69
III- Extrait acétate d’éthyle 70
IV- Extrait butanolique 71
V- Extrait aqueux 72

Chapitre III - Analyse Structurale 73

A- Etude des composés volatils 73

I- Analyse 73
II- Discussion 77

B- Etude des Terpénoïdes 80

I- Identification de Terp-1 80
II- Identification de Terp-2 83
III- Identification de Terp-3 87
IV- Identification de Terp-4 89
V- Identification de Terp-5 91

14
VI- Identification de Terp-6 95
VII- Identification de Terp-7 100

C- Etude des Flavonoïdes 103

I Identification de Flav-1 103


II Identification de Flav-2 105
III Identification de Flav-3 107
IV Identification de Flav-4 109
V Identification de Flav-5 115
VI Identification de Flav-6 118
VII Identification de Flav-7 120

D- Etude des composés divers 125

I Identification de Ac Ph-1 125


II Identification de Ac Ph-2 126
III Identification de AG-1 128

Chapitre IV – Activités Biologiques 130

A– Evaluation des extraits EtOAc, BuOH, H2O sur la


viabilité cellulaire 130
I- Introduction 130
II- Résultats 131
III- Conclusion 132

B– Activité du palmitate de β-amyrine et des extraits EtOAc,


BuOH, H2O sur la production de prostaglandines 6KF1α 133
I- Introduction 133
II- Résultats 134
III- Conclusion 136

C– Activité du palmitate de β-amyrine sur l’expression de


l’ARNm de la métalloprotéinase MMP-1 137

15
I- Introduction 137
II- Résultats 138
III- Conclusion 138

D– Activité antiradicalaire des extraits EtOAc, BuOH, H2O et


de certains composés 139
I- Introduction 139
II- Résultats 140
III- Conclusion 142

Discussion 144

Conclusion 155

Bibliographie 159

Annexes 173

Matériels et Méthodes 174

I Lyophilisation 174

II Matériel chromatographique 174
A Chromatographie analytique en couche mince (CCM) 174

B Chromatographie préparative
174
C Chromatographie en phase gazeuse (CPG) 176

III Méthodes chromatographiques


177
A Extrait hexanique 177
B Extrait dichlorométhane 179
C Extrait acétate d’éthyle 181
D Extrait butanolique 182

16
E Extrait aqueux 183

IV Mesures spectrales 184

A spectre UV
184
B Spectre de masse (SM) 184
C Spectre de résonance magnétique nucléaire (RMN) 184
D Pouvoir rotatoire
184

V Méthodes chimiques 185

A Recherche de tanins
185
B Recherche d’alcaloïdes
185
C Recherche de saponines
185
D Hydrolyse du palmitate de β-amyrine
185

VI Tests biologiques 186
A Evaluation de la viabilité cellulaire 186
B Evaluation de la production de prostaglandines 6KF1α par les kératinocytes humains 188
C Evaluation de l’expression de l’ARNm de la métalloprotéinase MMP-1 189
D Evaluation d’une activité antiradicalaire
191

VII Fiches produits 193

VIII Liste des noms usuels des flavones 210

IX Liste des noms usuels des flavonols 210

X Liste des figures 211

XI Liste des tableaux 213

17
Philippe OP de BECK
Etude Phytochimique et Biologique de Leea guineensis G. Don (Leeaceae)

Mots Clés :
Leea guineensis G. Don, Leeaceae, Composés volatils, Flavonoïdes, Flavonols sulfatés, 
Terpènoïdes, Triterpènes acylés, Acides phénoliques, Anti­inflammatoire, Cardiovasculaire, 
Antiradicalaire, RMN, CG/SM

Résumé :
Très peu étudiée, Leea guineensis G. Don appartient à la famille monogénérique des 
Leeaceae.   Elle   est   utilisée   en   médecine   traditionnelle   notamment   dans   les   domaines 
cardiovasculaire et anti­inflammatoire. Pou ces raisons, l’étude phytochimique et biologique 
de cette plante est intéressante.
Dans   une   première   partie,   nous   avons   rappelé   les   données   bibliographiques 
concernant la classification et la description botanique de cette plante, ses utilisations en 
médecine populaire et les études phytochimiques déjà réalisées. 
Une deuxième partie présente les résultats de notre propre étude phytochimique et 
biologique. Ainsi, 73 composés volatils et 17 métabolites provenant de cinq extraits (hexane, 
dichlorométhane, acétate d’éthyle, butanol et eau) des feuilles ont été identifiés. L’utilisation 
conjointe de plusieurs méthodes spectroscopiques (CG/SM, UV, RMN 1D et 2D, SM) a 
ainsi mis en évidence 7 terpénoïdes dont 3 triterpènes acylés, 7 flavonoïdes dont 3 flavonols 
sulfatés, 2 acides phénoliques et 1 acide gras.
La présence de flavonoïdes sulfatés et de terpénoïdes dans cette famille est recensée 
pour la première fois. Le coriolate de  β­amyrine, la quercitrine 3’­sulfate et la quercétine 
3,3’,4’­trisulfate sont isolés pour la première fois du règne végétal.
Les activités anti­inflammatoire et antiradicalaire ont été recherchées sur les extraits polaires 
et   quelques   composés   purs.   L’activité   anti­inflammatoire,   mesurée   par   la   production   de 
prostaglandines, est peu significative pour les extraits alors que le palmitate de  β­amyrine 
s’est montré actif. Par ailleurs ces mêmes extraits ainsi que les acides phénoliques et les 
flavonols non sulfatés présentent une activité antiradicalaire.

Abstract :
The Leeaceae is a monogeneric family close to the Vitaceae. Leea guineensis is a
widespread shrub that grows in tropical climate. It was reported to be used in traditional
African medicine for its cardiac and antalgic properties.
Our phytochemical investigations led to the identification of 73 volatils compounds
from the wood and leaves, and of 17 compounds coming from five different extracts from
leaves (hexane, dichloromethane, ethylacetate, butanol and water). They were identified by
means of their spectroscopic data (GC/MS, UV, NMR, SM) and especially 2D NMR
experiments, as 7 terpenoids (including 3 acylated triterpens), 7 flavonoids (including 3
sulphated flavonols), 2 phenolic acids and 1 fatty acid.

18
Sulphated flavonoids and terpenoids have never reported previously in the Leeaceae.
Coriolic ester of β-amyrine, quercitrine 3’-sulphate and quercetine 3,3’,4’-trisulphate are
reported for the first time in the plant kingdom.
Biological activity of the polar extracts and of some pure compounds have been 
evaluated on prostaglandins production and metalloproteinase expression in keratynocyts. 
Besides these anti­inflammatory activities, a potential antiradicalar property was mesured.

INTRODUCTION

19
INTRODUCTION

Au sein du Département de Pharmacochimie Moléculaire, unité mixte de recherche


CNRS/UJF (5063), dont la thématique de recherche est la conception, la synthèse et le criblage
de molécules à activités antioxydante et cardiovasculaire, le Laboratoire de Pharmacognosie a
pour objectif, l’isolement, l’identification et l’hémisynthèse de molécules naturelles actives.

Dans cette optique, il m’a été confié l’étude d’une plante camerounaise, Leea
guineensis (Leeaceae). Celle-ci est notamment utilisée en médecine traditionnelle pour ses
effets anti-inflammatoires et antihypertensifs.
Or, l’analyse de la littérature montre que la famille des Leeaceae a été très peu étudiée.
On ne répertorie, de 1959 à 1991, qu’une vingtaine de dérivés phénoliques (flavonoïdes et
acides phénoliques), et quelques criblages préliminaires faisant apparaître des tanins, des
alcaloïdes et des saponines pour certaines espèces.

L’étude entreprise sur Leea guineensis offre deux intérêts majeurs. Premièrement, toute
l’analyse phytochimique sera nouvelle pour cette espèce, car avant nous, aucun travail n’a été
entrepris. L’identification des constituants majoritaires permettra aussi de mieux connaître la
famille et de la situer dans la systématique moderne. Deuxièmement, une étude des propriétés
biologiques des extraits ainsi que des composés isolés, permettront de valider les usages de
cette plante en médecine traditionnelle ou d’apprécier de nouvelles propriétés.

La première partie, bibliographique, est consacrée à une étude botanique très générale
de la famille des Leeaceae, et de l’espèce Leea guineensis G. Don. L’étude phytochimique et
biologique des Leeaceae fait l’objet d’un second chapitre. Cette étude bibliographique est
complétée par un troisième chapitre consacré aux flavonoïdes sulfatés. L’isolement de ces
composés n’ayant encore jamais été rencontrés chez les Leeaceae, il paraît intéressant de
rappeler leurs principales caractéristiques.

La deuxième partie est consacrée aux travaux personnels. Dans un premier temps, nous
exposons comment à partir de la préparation de différents extraits de polarité croissante, nous
avons purifié les composés. Puis nous analyserons les principaux composés obtenus par

20
hydrodistillation du bois et des feuilles par chromatographie en phase gazeuse couplée à la
spectrométrie de masse. L’étude des extraits provenant des feuilles, a permis, après des
fractionnements successifs sur différents supports chromatographiques, d’isoler et d’identifier
des composés essentiellement de nature terpénique et phénolique. L’identification de ces
molécules est obtenue par l’analyse conjointe de plusieurs techniques spectrales comme l’UV,
la spectrométrie de masse, la résonance magnétique nucléaire RMN 1D et 2D (COSY,
COLOC, XHCORR).

Le chapitre suivant présente les recherches menées sur les activités biologiques des
extraits acétate d’éthyle, butanolique et aqueux des feuilles, ainsi que de quelques composés
purifiés, ceci afin de vérifier l’utilisation de la plante en médecine traditionnelle. Les activités
anti-inflammatoire et antiradicalaire sont ainsi déterminées.

21
Première Partie :
Bibliographie

Botanique
Phytochimie et biologie des Leeaceae
Flavonoïdes sulfatés

22
Chapitre I - Etude Botanique

Ce chapitre présente les données générales de l’évolution historique au sein de la


systématique du genre Leea et de la famille des Leeaceae, ainsi que les difficultés rencontrées
pour classer cette famille dans la taxonomie actuelle. Une étude des caractéristiques botaniques
du genre Leea et de l’espèce étudiée, Leea guineensis G. Don, est ensuite présentée, suivie
d’une revue bibliographique concernant la phytochimie et les diverses activités biologiques de
cette famille et plus particulièrement de notre espèce.

I- Position systématique

Pour la plupart des auteurs, Leea guineensis G. Don appartient aux Dicotylédones
Dialypétales, à l’ordre des Rhamnales, à la famille des Leeaceae. Cette hypothèse soutient la
thèse de Cronquist [1988]. Cependant la position taxonomique du genre Leea van Royen ex L.
a subi diverses modifications au cours du temps.

A) Historique de la taxonomie, positionnement du genre Leea :

Les recherches de Suessenguth [1953], Nair [1968] et Ridsdale [1975] montrent toutes
les difficultés rencontrées pour classer le genre Leea au sein de la systématique. Les premières
traces "pré-Linnéenne" montrent que le genre était connu par Rheede (vers 1678-79), qui fut le
premier à le décrire et l’illustrer sous le nom de Nalugu. Plus tard, Rumphius (1743) décrit et
représente deux espèces provenant d’Ambon, une île d’Indonésie. Ces taxons sont aujourd’hui
connus comme étant L. aculeata et L. aequata. Ce n’est que depuis 1767 que cette famille est
monogénérique et a pour nom de genre, Leea. Ce genre a été nommé ainsi en l’honneur de
James Lee (1715-1795), horticulteur qui a créé une pépinière à Hammersmith à Londres et qui
avec son collègue William Malcolm a été le premier à cultiver les Leea en Europe dès 1767.
Les collections de ces spécimens cultivés sont préservées au British Museum. Quant à la
famille Leeaceae, sa création est attribuée à Dumortier (1829), qui place cette famille près des
Sapotaceae. Cela n’empêchera pas au cours de l’histoire de voir les Leea ballottées dans
différentes familles et sous-familles.

23
Tableau 1 : Classement taxonomique du genre Leea
Classement Auteurs Années
genre Nalugu Rheede 1678
genre Leea Lee 1767
genre Staphylea Burm. 1768
genre Aquilicia Mantissa 1771
genre « Sapotis affinia » De Jussieu 1789
Leea dans une tribu Ampelideae De Candolle 1824
famille Leeaceae Dumortier 1829
Leea dans famille Meliaceae Mérat et De Lens 1829
famille monogénérique Leeaceae Bartling 1830
Leea dans Vitaceae (Ampelidaceae) Lindley 1833
Leea dans Vitaceae (Ampelidaceae) Bentham et Hooker 1862
Leea dans Vitaceae (Ampelidaceae) (relation avec Meliaceae) Le Maout, Decaisne 1876
Leea hors des Vitaceae Planchon 1887
Leea dans sous-famille Leeoïdeae à côté des Vitioïdae dans Gild 1896
famille Vitaceae
famille Leeaceae Gagnepain 1910
Leeoïdae élévés en famille Leeaceae Gild, Brandt 1912
famille Leeaceae (relation avec Buettnerinae des Sterculiaceae) Suessenguth 1953
genre Leea hors des Vitaceae Periasamy 1962
Leea inclus dans Vitaceae Hutchinson 1973
famille Leeaceae à côté des Vitaceae Behnke et Dahlgren 1976
famille Leeaceae Cronquist 1988
sous-famille Leeoïdae dans les Vitaceae Thorne 1992
famille Leeaceae Takhtajan 1997

Aujourd’hui, le genre Leea est placé dans la famille des Leeaceae proche des Vitaceae.
Mais si on remonte dans la systématique, on se rend compte que le choix d’appartenance à un
ordre est tout aussi difficile. En effet, la place des Leeaceae a subi aussi diverses modifications.

24
B) Position systématique de la famille dans un ordre

La   famille   des   Leeaceae,   tout   en   étant   étroitement   liée   à   celle   des   Vitaceae,   est 

généralement placée dans l’ordre des Rhamnales. Or cette position est parfois contestée. Ainsi 

même s’il existe des différences entre les graines de Leeaceae et de Vitaceae, celles­ci sont 

trop différentes de celles des autres familles de l’ordre des Rhamnales pour justifier cette 

inclusion [Corner 1976].

De même Behnke et Dahlgren [1976] montrent que les Vitaceae et Leeaceae ont des
plastides de type P (avec des protéines cristalloïdes polygonales) alors que chez les
Rhamnaceae, ils sont de type S (avec de l’amidon). Ainsi, il faut séparer clairement ces deux
groupes de familles. Cronquist sépare les Leeaceae des Vitaceae, et les place aux côtés des
Rhamnaceae [Cronquist 1988]. Ces trois familles sont placées dans l’ordre des Rhamnales.
Plus récemment, Takhtajan [1986, 1997], sépare le groupe des Leeaceae et Vitaceae de la
famille des Rhamnaceae, et place celui-ci dans un même ordre, les Vitales, issu du superordre
des Vitanae. En effet, les Leeaceae et Vitaceae diffèrent, entre autres, des Rhamnaceae par la
présence de raphides (absence chez les Rhamnaceae), de fruits qui sont des baies, (drupes chez
les Rhamnaceae), de plastides de type P (type S chez les Rhamnaceae) et par l’anatomie des
graines.
Ces derniers critères sont aussi ceux que Cronquist utilise pour étudier l’ordre très diversifié 

des Rhamnales. Et bien que les Leeaceae et les Vitaceae soient très proches, ces deux familles 

sont bien distinctes des Rhamnaceae.

L’évolution de la position des Leeaceae dans la systématique moderne peut être résumée dans 

le tableau suivant :

Tableau 2 : Situation des Leeaceae dans la systématique moderne


Auteur Hutchinson Dahlgren Cronquist Thorne Takhtajan
Année 1973 1989 1988 1992 1986 - 1997
Superordre Santaliflorae Vitanae
Ordre Rhamnales Vitales Rhamnales Cornales Vitales
Sous-ordre Vitinae

25
Famille Vitaceae Vitaceae Leeaceae Vitaceae Leeaceae
(Leeaceae incluse)
Sous-famille Leeoideae
(Nbre d’espèces) (70) (34) (70) en 1986
(34) en 1997
Cet historique sur la taxonomie des Leea nous aura permis de les placer dans une
famille monogénérique, les Leeaceae, proche des Vitaceae. A l’heure actuelle, il est préférable
de placer ces deux familles dans un même ordre, celui des Rhamnales. Cette classification est
simple et a l’avantage de grouper des familles proches dans un même ordre, tout en les
séparant distinctement.

Mais comme nous avons pu le remarquer, la position systématique des Leea a été
quelque peu controversée. Des affinités ont même été suggérées avec les Sapotaceae
[Suessenguth 1953], les Meliaceae [Le Maout 1876] et les Sterculiaceae [Nair 1968].

Néanmoins, c’est surtout avec les Vitaceae qu’elles ont été longtemps classées. Or, les
Leeaceae semblent avoir suffisamment de caractères distinctifs pour en être séparées (Tableau
3), (Figure 1). Ce sont les études sur l’anatomie florale, l’embryologie, la palynologie et la
chimiotaxonomie qui ont permis de classer en tant que famille monogénérique les Leeaceae, et
de les séparer des Vitaceae [Gagnepain 1911, Suessenguth 1953, Nair 1957 et 1968,
Tarnavschi 1968, Ridsdale 1975, Corner 1976, Patil 1984, Gerrath 1990, Umadevi 1991,
Verdcourt 1993, Thakhtajan 1997].

Tableau 3 : Différences essentielles entre les Leeaceae et les Vitaceae :


Différences Vitaceae Leeaceae
Port lianescent droit
Vrilles présence absence
Inflorescence extra-axillaire terminale
Tube staminal absent présent
Nombres de carpelles par ovaire 2 + de 2
Nombre de loges simple double
(3-8)
(par la formation de
fausse cloison)
Nombre d’ovule dans chaque loge 2 au moins 1
Graines 1-3 4-6
ovoïdes triangulaires-ovalées
ruminées très ruminées
(souvent à 5 croissances)
Nombre de chromosomes 2n=38 ou 40 2n=24
2n=24 pour quelques Cissus
Stomates gros, peu nombreux petits et nombreux

26
Figure 1 : Différents types de graines de Vitaceae et Leeaceae [Ridsdale 1975]

C) Conclusion sur la systématique

Bien qu’il y ait de très fortes affinités avec les Vitaceae, les Leea ont suffisamment de
caractères distinctifs pour être considérées comme une famille monogénérique à part entière ;
les Leeaceae, appartenant à l’ordre des Rhamnales.

D’après tous ces critères, et avant d’aborder les généralités propres aux Leea, nous
pouvons situer dans la systématique la plante qui fait l’objet de ce travail, Leea guineensis G.
Don (Figure 2).

27
Magnoliophyta
Sous-embranchement (Angiospermes)
220000 espèces
Liliopsida
(Monocotylédones)
55000 espèces
Classes Magnoliopsida
(Dicotylédones)
165000 espèces

Magnoliidae Hamamelidae
Sous-classes
Caryophyllidae

Dilleniidae Asteridae

Rosidae
116 familles
Ordres (60000 espèces)

Rosales

Fabales Proteales Podostemales Haloragales

Myrtales Rhizophorale Cornales Santalales


s
Rafflesiales Celastrales Euphorbiales Linales

Polygalales Sapindales Geraniales Apiales

Rhamnales
3 familles
(1700 espèces)

Familles
Rhamnaceae Leeaceae Vitaceae
(900 espèces) (70 espèces) (700 espèces)

Genre

Leea

Espèce

Leea guineensis G. Don


Figure 2 : Situation dans la systématique de Leea guineensis G. Don (selon Cronquist 1988)

28
II- Généralités sur le genre Leea

Avant d’aborder les principaux caractères des Leea, nous discuterons des possibilités de
division du genre.

A) Classification et composition du genre Leea

Ce genre a été divisé par Clarke en 1881 en deux séries en fonction de la couleur des 

fleurs (Tableau 4). Puis, ces séries furent sous­divisées en sections contenant une ou plusieurs 

espèces. Les sections dressées par Clarke consistent à grouper les espèces parentes, mais sont 

insuffisantes pour former des séparations formelles entre elles [Suessenguth 1953, Ridsdale 

1975].

Tableau 4 : Classification selon Clarke (1881)

Séries Sections Espèces typiques


Rubiflorae Edgeworthiae L. alata
(fleurs rouges) Laetae L. laeta
Rubrae L. rubra

Viridiflorae Pycnoneurae L. crispa


(fleurs vertes) Paucifoliolosae L. macrophylla
Sambucinae L. sambucina
Aequatae L. aequata

Cette   division   du   genre   en   deux   séries   n’est   pas   satisfaisante   et   d’autres   caractères   plus 

importants   sont   à   prendre   en   compte  pour   la   connaissance   et   la   description   des   espèces. 

Gagnepain [1910] a lui aussi tenté de classer les différentes Leea. Il commence l’analyse par 

les caractères floraux qui, bien que très homogènes dans la famille, montrent des variations 

très précises de l’androcée suivant les espèces. Il sépare ainsi en 4 groupes les  Leea. A ces 

caractères floraux, il ajoute l’analyse des feuilles (simples, composées, glabres ou plus ou 

moins velues), et la coloration des fleurs pour distinguer 19 espèces de Leea asiatiques.

29
Selon les travaux de Burt (1935), on peut séparer le genre en subdivisions reposant sur 

le type structural de la fleur (pentamère ou tétramère). Cette suggestion est pratique pour les 

taxas des Philippines (qui présentent par ailleurs de nombreux types de graines). C’était un 

bon moyen pour séparer le genre en groupes distinctifs, mais de récentes collections montrent 

par exemple que L. tetramera est une espèce qui peut être tétra ou pentamère [Ridsdale 1975].

Kirtikar et Basu [1975] distinguent quant à eux 3 groupes selon les feuilles de quelques
Leea asiatiques :

Tableau 5 : Classification selon Kirtikar et Basu [1975]


Groupe Feuilles Espèces
A Feuilles simples L. macrophylla
B Feuilles simplement pennées L. crispa
(le plus souvent)
C Feuilles bi- ou tripennées
glabres L. indica

faces inférieures velues L. robusta


L. diffusa
L. aspera
L. hirta

Ces   différentes   études   montrent,  qu’il   est   difficile   de   diviser   de   façon   formelle   le 

genre,   aussi   est­il   préférable   de   parler   de  famille   monogénérique.   La   détermination   des 

différentes  espèces  se  fera sur  l’utilisation d’une clef du type  de celle  mise au point par 

Ridsdale [1975].

Ridsdale [1975] a fait une révision complète de la famille, dans laquelle il reconnaît 34
espèces. 32 se rencontrent dans l’aire Indo-Malaisienne, et 2 sont limitées dans l’aire Afro-
Malgache. Il a remarqué qu’il était très difficile de différencier certaines espèces sur les seuls
critères des feuilles et des fleurs (la séparation des espèces n’étant possible qu’en considérant
de grosses différences dans la longueur de certains organes).

30
31
Voici la liste des différentes espèces qu’il reconnaît :

L. aculeata Bl. ex Spreng. L. macrophylla Roxb. ex Hornem.


L. acuminatissima Merr. L. macropus K. Schum. & Laut.
L. aequata L. L. magnifolia Merr.
L. alata Edgeworth L. papuana Merr. & Perry
L. amabilis Masters L. philippinensis Merr.
L. angulata Korth. ex Miq. L. quadrifida Merr.
L. compactiflora Kurz L. rubra Bl. ex Spreng
L. congesta Elm. L. saxatilis Ridl.
L. coryphantha Laut. L. setuligera Clarke
L. crispa van Royen ex L. L. simplicifolia Zoll. & Moritzi
L. curtisii King. L. smithii Koorders
L. gonioptera Laut. L. spinea Desc.
L. grandifolia Kurz L. tetramera Burtt.
L. guineensis G. Don L. thorelii Gagnep.
L. heterodoxa K. Schum. & Laut. L. tinctoria Baker
L. indica (Burm f) Merr. L. unifoliata Merr.
L. krukoffiana Ridsd. L. zippeliana Miq.

Par ailleurs, il recense trois espèces douteuses :


L. erecta Voll. & Brade qui serait une espèce non reconnue en botanique,
L. humilis Hassk. qui serait probablement L. aequata
L. javanica Bl. ex Spreng. qui serait une espèce dont on ne retrouve plus trace.

Il exclue aussi 6 espèces :


L. cordata Wall. qui devient une espèce de Vitis (Vitaceae).
L. dielsii Léveillé qui est Ampelopsis chaffanjoni (Léveillé) Rehder (Vitaceae).
L. laevis Heyne ex Wall. qui est Trichilia connaroides (W. & A.) Bentv. (Meliaceae).
L. odontophylla Wall. qui est Ampelopsis latifolius (Wall.) Planch. (Vitaceae).
L. spinosa Spreng. qui est Aralia chinensis L. (Araliaceae).
L. theifera Léveillé qui est Ampelopsis cantoniensis (Hook. & Arn.) Planch. (Vitaceae).

32
Avec le nouveau mode de communication qu’est Internet, on retrouve d’autres espèces 

[Phytochemical   and   ethnobotanical   database,   GRIN   database].   Peut­être   s’agit­il   de   noms 

synonymiques non répertoriés ?
L. coccinea Boj.
L. guinensis
L. hirta Banks ex Roxb.
L. robusta
L. sambucina Schum. et Thonn.

Cette famille monogénérique Leea Royen ex Linn., Mant. I, 17, (1767), 124. comprend
à ce jour plus de 70 espèces réparties dans différentes régions d’Afrique, d’Asie, d’Australie et
d’Océanie.

B) Principaux caractères botaniques [Descoings 1967]

Les Leea peuvent être des plantes herbacées, des arbres, ou des arbustes de 2 à 10 m
de hauteur.

 Les tiges et les feuilles

Les tiges sont droites, ramifiées ou non, généralement lenticellées, parfois munies de fortes
épines, sans vrille, à feuilles généralement groupées aux extrémités.
Les feuilles sont composées, pennées, bi- ou triternées, à rachis caniculé, à pétiole élargi et
embrassant à leur base. Les stipules sont soudées aux pétioles, et caduques.

 Les folioles
Les folioles de forme et de taille variables, sont généralement simples, à bord crénelé ou denté,
à nervation simple, pennée.

33
 Les inflorescences

Elles sont grandes, corymbiformes et sont opposées aux feuilles supérieures.

 Les fleurs

Elles sont rouge ou jaune verdâtre, de taille réduite (5­6 mm) et pédicellées. 

 Les fruits

Ce sont des baies globuleuses, côtelées faiblement charnues, à 4­6 graines avec la présence de 

raphides.

 Les graines

Elles sont ovales, anguleuses, à section transversale triangulaire par compression latérale et
présentent sur les faces latérales des dessins ou un léger creux. Elles sont constituées d’un
embryon linéaire à radicule infère, avec un albumen ruminé montrant de profondes fossettes.

C) Répartition géographique

On rencontre les Leea principalement dans les zones tropicales d’Asie et d’Afrique
alors qu’elles ne sont pas présentent sur le continent américain. Le genre est centré sur la
Malaisie et s’est développé vers l’ouest en Afrique et Madagascar, et vers l’est aux îles Fiji
[Suessenguth 1953, Harriman 1991, Ridsdale 1975].

Les espèces afro-malgaches ont des similitudes bien établies avec celles présentes en
Asie et en Indonésie. Cela laisse présumer une origine orientale fondée sur la théorie
wegenerienne de la dérive des continents plus qu’à un moyen de dispersion par les courants
marins [Cadet 1980].

34
Les Leea sont rencontrées dans des zones humides ne dépassant guère 900 m d’altitude
et de formations forestières ombragées. De plus, certaines d’entre-elles comme L. indica,
semblent jouer un grand rôle dans l’embroussaillement des trouées forestières car elles sont à
croissance rapide et à tempérament grégaire. Leur bois est tendre. Elles constituent donc
rapidement des fourrés denses dépassant 2m de hauteur à l’âge de 2 à 3 ans en présence
d’autres espèces telles que Trema orientalis (Ulmaceae) et Macaranga roxburghii
(Euphorbiaceae) [Blasco 1971].

___
zone de répartition
des Leea

Figure 3 : Répartition géographique des Leea [Suessenguth 1953]

35
III- Généralités sur l’espèce Leea guineensis G. Don

Figure 4 : Représentation de Leea guineensis [Lavergne 1990]

A) Dénomination et synonymies

Appelée Leea guineensis G. Don, Gen. Hist. I (1831) 712, on retrouve plusieurs noms
synonymiques pour cette espèce, qui peuvent être à l’origine de nombreuses confusions :

L. sambucina auct. non Will., L. maculata Desf., L. arborea Telf. ex W. & A., L. arborea
Sieber ex Boj., L. sambucina Willd. var. arborea Miq., L. manillensis Walp., L. aurantiaca
Zoll. & Mor., L. coccinea Planch., L. lucida Linden ex Planch., L. punctata Desf. ex Planch.,
L. cuspidifera Baker, L. javanica auct. non Bl., L. speciosa Sieb. ex Miq., L. laeta Wall., L.
sanguinea Wall., L. acuminata Wall., L. cumingii Clarke, L. pumila auct non Kurz, L. wightii
Clarke, L. parva Elm., L. negrosense Elm., L. palawanensis Elm., L. euphlebia Merr., L.
parvifoliola Merr., L. papillosa Merr., L. luzonensis Elm., L. robusta auct. non Roxb., L.
dentata Craib, L. schomburgkii Craib, L. brunoniana auct. non Clarke, L. pallidifolia
Kanehira, L. bulusanensis Elm.

36
Il faut noter que cette espèce présente de nombreuses variabilités dues à sa répartition
géographique ou écologique. C’est en partie pour cela que cette espèce est répertoriée sous
plus de 30 noms synonymiques car bien des travaux ont décomposé cette espèce en plusieurs
entités. Or la plupart de ces taxas ne sont séparés que par des différences végétatives mineures.
Ainsi, même entre des espèces africaines et asiatiques telles que L. guineensis et L.
manillensis, il n’existe qu’une petite différence de couleur du tube staminal (due semble-t-il
aux habitats différents) ; les caractères morphologiques des feuilles et des fleurs sont en tous
points identiques [Ridsdale 1975].
Ainsi, le mauvais usage des synonymies peut être illustré par l’exemple de L. rubra
sensu auct. non Blume ex. Sprengel et L. sambucina sensu auct. non Willd [Staples 1996]. Des
horticulteurs ont employé L. rubra pour désigner une forme de L. guineensis ayant des feuilles
rougeâtres, alors que L. rubra est une authentique espèce déjà existante. Quant à L.
sambucina, c’est une espèce dont le nom a été mal employé dans la littérature, car L.
sambucina est un des synonymes de L. indica.

Toutefois certaines différences ont permis à Descoings [1967] lors de son étude sur la
flore de Madagascar d’observer des variétés locales bien distinctes :

L. guineensis G. Don

­ var. longifoliolata  Desc.
Folioles supérieures très grandes, jusqu’à 25 X 6cm, oblongues, très
étroites, de largeur plus grande vers la base, acuminées au sommet, à bords crénelés.
Folioles inférieures de taille réduite et de forme variable.
Dans les marais à raphias et bas fonds.

- var. monticola Desc.


Folioles petites, 7-11 X 2-3.5cm, oblongues-elliptiques, oblongues-
lancéolées, de largeur plus grande vers le milieu, à base en coin, à sommet acuminé, à bords
crénelés.
Dans les régions montagneuses.

37
- var. spiculata Desc.
Folioles de taille moyenne à faible, 9-12 X 3-4cm, elliptiques, oblonges
elliptiques, acuminées, à bords présentant 5-7 paires de lobes très atténués, terminés par une
dent en spicule courte, épaisse, fortement saillante vers l’extérieur.
Plateaux calcaires.

- var. truncata Desc.


Folioles grandes, 12-15 X 4.5-11cm, oblongues-ovales, de largeur plus
grande dans la partie supérieure, à base en coin, à sommet tronqué, largement arrondi, terminé
par un long acumen, à bords crénelés.
Forêts ombrophiles.

- var. cuspidifera Desc. –L. cuspidifera Bak.


Pubescence cuspidée des tiges, pétioles rachis et ramifications, surtout
aux insertions.
Folioles elliptiques ou elliptiques-lancéolées, 4-18 X 2-8cm, à base en
coin ou obtuse, à sommet en acumen long et étroit (10-30 X 1.5-3 mm) obtus, à bords crénelés
ou dentés.
Forêts tropophiles, sur sables et calcaires.

- var. comoriensis Desc.


Folioles grandes, 10-15 X 4.5-6cm, ovales-elliptiques, elliptiques, à base
obtuse ou arrondie, à sommet longuement acuminé, à bords crénelés, à pubescence
généralement nettement concentrée aux confluents des nervures.
Forêts ombrophiles.

- var. orientalis Desc. Endémique


Folioles oblongues-elliptiques, elliptiques, 8-16 X 3-6cm, à base en coin,
à sommet acuminé, à bords finement dentés, à pubescence régulièrement répartie.
Forêts ombrophiles.

38
Pour notre plante, l’échantillon présente une foliole supérieure très grande 18 X 6 cm, 

acuminée au sommet, des folioles inférieures de taille réduite de forme variable, acuminées. 

De plus, celle­ci provient d’une forêt à raphiales marécageuse ou périodiquement inondée. 

Bien qu’aucune variété ne soit décrite pour Leea guineensis au Cameroun [Descoings 1972], 

notre échantillon fait penser à la variété longifoliolata rencontrée à Madagascar.

Figure 5 : Feuille séchée de Leea guineensis provenant du Cameroun

B) Noms vernaculaires

La liste n’est pas exhaustive, car chaque tribu a sa propre appellation. Nous n’en
donnerons que quelques exemples :
La Réunion bois de source, bois de sureau
Inde karkatajihva (sanscrit)
République Centrafricaine gamboula (gbaya)
Gabon mopaga-poga (apindji), debole-nyembaka (bakele)
Madagascar fanamboavanana, mahimboavana, sadrakidraky
Côte d’Ivoire diawa (guimini), koulateo (guéré)
Cameroun essong, n’top fitta, utua-bisson (yaoundé), wabozeende (mabea)

39
C) Répartition géographique

L. guineensis pousse dans les forêts humides, les galeries forestières, notamment dans
les raphiales marécageuses, les forêts marécageuses ou périodiquement inondées et dans le lit
des ravines - d’où peut-être l’appellation de Bois de Source - des zones tropicales.

Elle est présente en Afrique tropicale, en Angola, au Bénin, Burkina Faso, Burundi,
Cameroun, Congo, Côte d’Ivoire, Gabon, Guinée, Kenya, Madagascar, Malawi, Mali, île
Maurice, Nigeria, Ouganda, île de La Réunion, République Centrafricaine, République
Démocratique du Congo, Sierra Leone, Soudan, Tanzanie, Togo, Zambie.
On la rencontre aussi en Asie : Ceylan, Cambodge, Chine, Inde, Indonésie (Java,
lle
Sumatra, N Guinée), Laos, Malaisie, Népal, Philippines, Taïwan, Thaïlande.

zone de répartition de L.
guineensis

Figure 6 : Répartition géographique de L. guineensis.

40
D) Description botanique (Figure 8) [Descoings 1967]

C’est un arbuste de 2 à 5 m, à tiges droites, peu ramifiées, renflées aux nœuds, à 
lenticelles nombreuses, petites, à feuilles groupées aux extrémités.

 Les feuilles bi- ou triternées atteignant 30 X 30 cm avec :


- un rachis (30-60 cm) et des ramifications (20-40 cm) ± caniculées sur le dessus et
présentant de petits tubercules vers la base, glabres ou faiblement pubescents
aux insertions ;
- pétiole renflé et ± engainant ;
- stipules épaisses rapidement caduques (Figure 7).

Figure 7 : Schéma d’une stipule de L. guineensis


[Ridsdale 1975]

 Les folioles sont de forme très variable : elliptiques, ovales-elliptiques, ovales


oblongues, oblongues, oblongues-elliptiques, avec :
- toujours la base en coin, rarement obtuse, et le sommet à acumen long, étroit,
obtus ;
- les bords crénelés ou dentés; de 7-25 X 3-11 cm; 8 à 10 paires de nervures
secondaires, peu saillantes en dessous, assez fortement sur le dessus ;
- le réticulum presque plan à la face supérieure, en léger relief sur la face
inférieure ;
- une pubescence pratiquement nulle, sauf parfois quelques poils aux intersections
des nervures.
- le limbe plan, assez épais, vert luisant sur les deux faces.

 Les inflorescences sont opposées aux feuilles du sommet, très grandes :


- en corymbes de 10-16 cm de diamètre ;
- au pédoncule et ramifications épais, ± cylindriques, sillonnés, munis de quelques
rugosités, à pubescence lâche, courte, irrégulièrement répartie et rapidement
caduque ;
- aux bractées ovales, deltoïdes, aiguës, de 1-1,5 X 1-1,5 mm, minces, faiblement
pubescentes, rapidement caduques.

41
1 -représentation d’un rameau avec son inflorescence x1/3 ; 2 -détail du bord du limbe x1 ; 3 -fleur mature x8 ;
4 -bouton floral x8 ; 5 -coupe schématique de la fleur fermée (étamines omisent) x8 ; 6 -anthère (vue arrière)
x15 ; 7 -agrandissement de la couronne étalée x8 ; 8 -fruit x2 ; 9 -graine x5 ; 10 -section transversale médiane
de la graine x5
Figure 8 : Représentation de L. guineensis [Descoings 1972, Verdcourt 1993]

42
 Les fleurs de ± 5 mm de long, ± 3 mm de diamètre sont glabres avec (Figure 9) :
- un bouton floral ovale ou conique ;
- un pédicelle de 1-2 mm de long, cylindrique, nettement épaissi sous le
calice, faiblement pubescent.
- un calice rouge corail, de 2-2,5 mm de haut, ± 2,5 mm de diamètre, épais,
rigide, généralement glabre, à dents deltoïdes, aiguës.
- une corolle rouge corail à l’extérieur, plus pâle à l’intérieur, de ± 4 mm de
long, en tube dans la partie inférieure sur ± 1,5 mm de hauteur.
- aux segments oblongs-ovales, rétrécis vers la base, à plus grande largeur
vers le tiers inférieure, au-dessus longuement atténués en coin, aigus au
sommet et nettement cucullés, de ± 1,6 mm de large, épais.
- une coronule blanche, rose ou citrine, de 2,5-3 mm de hauteur et 2-2,5 mm
de diamètre ;
- aux lobes de ± 2 X 0,8 mm, oblongs, épais, un peu élargis dans la partie
supérieure, présentant deux petites dents obtuses ; sinus très minces,
profonds, échancrés jusqu’à 0,8-1,2 mm en dessous du sommet des
lobes ;
- le talon ne descend pas au fond de la fleur et entoure à sa base le style
seulement, de 0,6-0,8 mm de haut, épais sauf dans sa partie inférieure,
fortement aminci du côté interne avec juste au-dessus un très fort
bourrelet en saillie vers l’extérieur, horizontal ou ± oblique, généralement
très net.
- les étamines à filets blancs, sont fixées un peu au-dessus du milieu du
connectif ;
- les connectifs sont oblongs, étroits, ± bilobés au sommet, aigus à la base, de
± 1,8 X 0,6 mm, dépassant un peu les loges au sommet.
- l’ovaire est 5-côtelé, de ± 1 mm de diamètre, ± 0,6 mm de haut, glabre ;
- le style de ± 1,5 mm de long, cylindrique, isodiamétrique ;
- et stigmate capité peu distinct.

43
feuille

bourgeon axillaire

inflorescence

sépale

pétale

étamines

gynoecium

axe d’inflorescence

Figure 9 : Diagramme floral [Gerrath 1990]

44
 Les baies rouges à maturité, sont glabres, à péricarpe mince, bourrées de raphides
comprimées sur les faces supérieure et inférieure. Elles ont 8 à 10 mm de diamètre, 6-7 mm de
longueur.

 Les graines de ± 5 X 4 mm, sur leurs faces latérales présentent des dessins très nets en
lignes larges, épaisses, saillantes, beaucoup plus visibles en creux sur l’albumen mis à
nu, (une ligne courbe concave avec parfois 1-3 petites ramifications simples et peu
prononcées du côté ventral, et du côté dorsal, 1-5 ramifications courtes et simples).

E) Divers

Leea guineensis G. Don est considérée comme plante fétiche par plusieurs ethnies de
Côte d’Ivoire et du Burkina Faso : le charbon de racines constitue un fard bénéfique. Il est
recommandé, lorsqu’on part pour un long voyage, de se munir de bâtonnets de tiges qui, sucés
pendant la route, préservent des accidents et des mauvais sorts toujours possibles [Kerharo
1950]. La population locale au Cameroun s’en sert aussi comme bois de chauffage.

L. guineensis dans un dialecte africain, le "baoulé du sud", se nomme adiapokou-


adiabrien et traduit une onomatopée rappelant le bruit de la navette (y’a-t-il un lien avec le
métier à tisser ?). On la retrouve aussi sous le nom de akohima-tui, ces deux mots voulant dire
coq et fusil. Traduit comme "fusil du coq" (est-ce la sarbacane ?) [Garnier 1976].

Le développement morphologique de L. guineensis est maintenant connu, tant du point


de vue du développement végétatif [Lacroix 1990] que floral [Gerrath 1990].

Par ailleurs, L. guineensis ou "Bois de sureau" est un arbuste très élégant, de part ses
grandes feuilles composées, sa jolie floraison, et ses fruits décoratifs. S’acclimatant à de faibles
conditions lumineuses, il peut être cultivé en zone humide et ombragée comme plante
ornementale d’extérieure ou d’intérieure [Lavergne 1990, Gerrath 1997].

45
Chapitre II – Etudes phytochimique et biologique des Leeaceae

Les plantes de la famille des Leeaceae sont très peu étudiées, sans doute parce qu’elles
ont été souvent intégrées dans la famille des Vitaceae qui comprend plus de 700 espèces (Vitis
vinifera...).
Néanmoins, quelques études relativement récentes ont été faites sur la phytochimie de
différentes Leea.

I- Etude phytochimique

A) Criblage phytochimique

Les données présentées ici doivent être considérées avec une certaine réserve, car ce
sont essentiellement des tests d’orientation. Ces tests ont été réalisés pour trois espèces
différentes, et ont montré la présence de saponosides, d’alcaloïdes, de flavonoïdes et de tanins :
Tableau 6 : Criblage de quelques Leea
Plantes Sap Alc Tri St Flav Ta Référence
(partie utilisée si connue)
L. indica + - - - [Bin Rahmani 1985]
L. compactiflora (Kurz) - + + - [Brahman 1989]
racines
L. indica (Burm. F) Merr. - - - - [Brahman 1989]
tiges, feuilles et fruits
L. guineensis G. Don - - - - + + [Lavergne 1990]
feuilles cat
Sap=saponines, Alc=alcaloïdes, Tri=triterpènes, St=stéroïdes, Flav=flavonoïdes, Ta=tanins, cat=catéchiques
Test phytochimique positif (+) ou négatif (-)

Par ailleurs, l’étude de Lavergne [1990] montre pour L. guineensis G. Don, plante
médicinale de l’Ile de la Réunion :
-la présence de phénols, de flavanes et de proanthocyanidols.
-l’absence d’anthraquinones libres ou hétérosidiques, de coumarines et
d’anthocyanes.
-l’absence d’alcaloïdes (réactions négatives aux tests de Mayer, de Dragendorff
et silicotungstique).
B) Huile essentielle

46
C’est en 1953 que Gupta et Chopra isolent pour la première fois une huile essentielle
d’une plante appartenant à la famille des Leeaceae : L. hirta Roxb. Les seules données sont les
caractéristiques physiques et biochimiques. Cette huile essentielle provient d’une
hydrodistillation avec un rendement de 0,15 %. Elle est odorante, se solidifie à température
ambiante et présente une activité tuberculostatique [Gupta 1953].

C) Composés phénoliques (Figure 10 p 30)

C’est la classe de composés la plus étudiée (Tableau 7 p 29).

Bates-Smith [1959] a entrepris une recherche de constituants phénoliques, après


hydrolyse, dans les feuilles de nombreuses Dicotylédones afin de rechercher des liens
chimiotaxonomiques. Ainsi par chromatographie sur couche mince il a montré l’existence dans
les feuilles de L. coccinea Planch. de 5 composés phénoliques : kaempferol (1), quercétine (2),
myricétine (3), delphinidine (7), cyanidine (8).

Chez L. rubra Blume, on recense dans les feuilles un flavonoïde et trois acides phénols
: la myricétine 3-O-α-rhamnosyl (6), l’acide p-hydroxybenzoïque (12), l’acide syringique (14)
et l’acide gallique (17), et dans les tiges une leucoanthocyane, le leucocyanidol (10) [Yem Yok
Siv 1971].

Hegnauer [1990] cite pour les Leea, en plus des composés déjà cités pour L. coccinea
Planch (kaempferol (1), quercétine (2), myricétine (3), leucodelphinidine (7), leucocyanidine
(8)), la présence de tanins dans les fruits de L. rubra Blume, et dans les feuilles et les racines de
L. sambucina Willd.

L’étude de la taxonomie des Vitaceae a permis une analyse de quatre Leea qui sont L.
herbaceum Wall., L. indica Merrill., L. macrophyla Roxb. et L. sambucina Willd où l’on
recense un grand nombre de flavonoïdes et d’acides phénoliques [Umadevi 1991].

Les résultats de ces travaux sont reportés dans le tableau ci-dessous :

Tableau 7 : Principaux métabolites secondaires identifiés des différentes Leea

47
L. L. L. L. L. L.
Composés herbaceum indica macrophyla sambucina coccinea rubra
Wall. Merrill. Roxb. Willd. Planch. Blume
a a a a b c
kaempferol (1) + +
quercétine (2) + + +
myricétine (3) + + + + +
3’-OMe-quercétine (4) + + +
3’,4’-di-OMe-quercétine (5) + + +
3-O-rhamnosyl de myricétine (6) +
delphinidine (7) +
cyanidine (8) +
proanthocyanidine (9) + + + +
leucocyanidol (10) +
acide gentisique (11) + +
acide p-hydroxybenzoïque (12) + + + +
acide vanillique (13) + + + +
acide syringique (14) + + + +
acide mélilotique (15) + +
acide protocatéchuique (16) +
acide gallique (17) + + + + +
acide cis-p-coumarique (18) + +
acide trans-p-coumarique (19) + +
acide férulique (20) + + +
glycoflavone +
tanins + + + + +
alcaloïdes +
Références : a) [Umadevi 1991], b) [Bates-Smith 1959], c) [Yem Yok Siv 1971] et [Hegnauer 1990].

48
R1 OMe OH

R2 OR OH

HO O HO O HO O
R3 OH

OH OH O

OH O OH O OH O
OH
OH
O
OH
CH3
(1) R1=R3=H, R2=OH (4) R=H
Kaempferol 3’-OMe-quercétine
(2) R1=R2=OH, R3=H (5) R=Me (6)
Quercétine 3’,4’-diOMe-quercétine 3-O-rhamnosyl de myricétine
(3) R1=R2=R3=OH
Myricétine
OH

OH OH HO
OH
OH

HO O

HO O
O HO O
R OH
H H
OH OH
OH
H
OH
OH H OH
O OH
H
HO
(7) R=OH
(10)
Delphinidine H OH
Leucocyanidol
(8) R=H HO

Cyanidine (9)
Proanthocyanidine

R4 R5 O O

O R
OH OH
R3

OH
OH HO
R2 R1

(15) (18) R=H, cis


(11) R1=R3=R4=H, R2=R5=OH
Acide mélilotique Acide cis-p-coumarique
Acide gentisique
(19) R=H, trans
(12) R1=R2=R4=R5=H, R3=OH
Acide trans-p-coumarique
Acide p-hydroxybenzoïque
(20) R=OCH3, trans
(13) R1=R4=R5=H, R2=OCH3, R3=OH
Acide férulique
Acide vanillique
(14) R1=R5=H, R2=R4=OCH3, R3=OH
Acide syringique
(16) R1=R4=R5=H, R2=R3=OH
Acide protocatéchuique
(17) R1=R5=H, R2=R3=R4=OH
Acide gallique
Figure 10 : Les structures chimiques identifiées chez différentes Leea :

49
II- Etude biologique

Les différentes activités biologiques seront présentées pour chaque espèce connues
(avec leur synonymies), puis nous recenserons les activités propres à Leea guineensis G. Don.

A) Activités des différentes espèces de Leea (Tableau 8 p 38)

La plupart des données sur ce sujet sont assez récentes, mais en règle générale les
espèces du genre ont des propriétés calmantes, émollientes et astringentes [Kirtikar 1975].

L. sp. :
-l’extrait aqueux de feuilles de L. sp. présente des propriétés antifongiques avec
100% d’inhibition contre Drechslera oryzae [Ganesan 1994].

L. aequata L. :
- au Népal, les tubercules et les tiges de L. aequata Linn. sont astringentes et
mucilagineuses [Suwal 1970] ;
- utilisée en cas de blessures, elle est calmante, antiseptique, bactéricide. Elle est
aussi préconisée pour soigner la fièvre, la dysenterie, la dysurie, la neuralgie, la paralysie, la
pleurésie, la pneumonie, la tuberculose, les rhumatismes [Phytochemical and Ethnobotanical
Database].

L. hirta Roxb. ex Hornem (syn. L. aequata Linn.) :


- l’huile essentielle (0,15 %) inhibe la croissance de Mycobacterium
tuberculosis, Staphylococcus aureus et Pasteurella pestis aux concentrations de 10 µg/ml, 100
µg/ml et 50 µg/ml respectivement [Gupta 1953] ;
- en Inde les tubercules et les tiges sont utilisées pour leur activité astringente et
sont riches en mucilages [Chopra 1956] ;
- les racines sont amères, âcres, épicées, et sont dotées de propriétés
anthelmintique, vulnéraire, antipyrétique, “ alexitérique ”, anesthésique locale. Elles sont
utilisées en cas de bronchite, de dyspepsie, de fièvres nauséeuses, de lèpre, de démangeaisons
et d’ulcères tuberculeux (Ayurveda) [Kirtikar 1975] ;
- on retrouve les même indications sur Internet que l’espèce précédente
[Phytochemical and Ethnobotanical Database].

50
L. angulata Korth. :
- comme répellant du tigre à Java [Phytochemical and Ethnobotanical
Database].

L. crispa Linn :
- en Inde et au Bengal, les feuilles sont froissées et appliquées sur les blessures.
Les tubercules sont un remède contre le vers de Guinée [Chopra 1956, Kirtikar 1975] ;
- comme larvicide et contre les blessures [Phytochemical and Ethnobotanical
Database].

L. curtisii King :
- contre l’alopécie [Phytochemical and Ethnobotanical Database].

L. gigantea Griff. (syn L. indica Merr.) :


- des travaux sur des extraits méthanoliques de plantes de Malaisie, montrent
que les feuilles de L. gigantea ont une activité modérée contre Bursaphelenchus xylophilus à
10 mg/ball [Mackeen 1997] ;
- est préconisée contre les douleurs d’estomac, la fièvre, les blessures
[Phytochemical and Ethnobotanical Database].

L. indica Merrill :
- une des premières traces d’une activité biologique potentielle, remonte à 1829
[Mérat 1829]. Il est dit de Leea sambucina Willd. (appelé autrefois Aquilicia) que :
“ Aquilicia sambucina , arbrisseau de l’Inde, contient des baies à suc violent et caustique. La
décoction de ses racines est employée contre les douleurs de l’estomac ; celle du bois, contre la
soif ; ses feuilles broyées, torréfiées et appliquées sur la tête, soulagent le vertige et la faiblesse
du cerveau ; la vapeur de leur décoction suspend les douleurs de la goutte ; le suc, exprimé de
ses feuilles tendres, pris en boisson, aide la digestion... ”. Plus loin, “ ...La décoction de ses
feuilles est usitée en Guinée pour les femmes enceintes dont le ventre est douloureux ; elle
dissipe les nausées. La poudre de l’écorce sert à frotter les parties enflées. ”.
- en Inde, les racines de L. indica Merrill sont utilisées contre les diarrhées, la
dysenterie et sont sudorifiques. La décoction de racines est prescrite contre les coliques,
comme rafraîchissant et soulageant de la soif. Les feuilles grillées sont appliquées sur la tête
contre les vertiges [Chopra 1956] ;

51
- en Inde, dans le Goa, les racines de L. indica Merrill sont utilisées contre les
diarrhées et dysenteries chroniques. Le jus de jeunes feuilles est digestif [Kirtikar 1975] ;
- en Malaisie, l’intérêt porté aux plantes utilisées en médecine indigène montre
que l’extrait éthanolique de feuilles de L. indica a une activité antivirale contre le virus herpes
simplex de type 1 (HSV1) à 0,05 mg/ml [Ali 1996] ;
- on retrouve l’usage de L. indica contre les maux de tête, les piqûres de
chenilles, les dermatoses, les furoncles, la colique, les diarrhées, la dysenterie, les vertiges, les
verrues. Elle est apaisante et sudorifique [Phytochemical and Ethnobotanical Database].

L. linearifolia :
- les racines de cette herbe de saveur froide, insipide selon la médecine
bouddhique traditionnelle Theravada, neutralisent les fièvres « supérieures », le vent
« Sandan », cause de coliques chroniques [Phou Ngeun Souk-Aloun 1995].

L. macrophylla Roxb.ex Hornem. :


- en Inde, les racines sont connues pour être astringentes, et utilisées contre la
teigne, et le vers de Guinée. Réduites en poudre, elles sont appliquées sur les blessures pour les
cicatriser ou sur la peau pour soulager les douleurs [Chopra 1956] ;
- ses racines sont un bon alexipharmaque1 (antidote Ayurveda). Elles sont
astringentes et réputées être un remède de la pelade. Les Birmans l’appliquent sur les blessures
pour stopper les effusions de sang [Kirtikar 1975] ;
- au Népal, on retrouve les mêmes activités qu’en Inde, si ce n’est que les
feuilles et les fruits sont connus pour être comestibles [Suwal 1970] ;
­   la   plante   est   indiquée   comme   étant   calmante,   astringente,   cicatrisante, 

larvicide   et   vermifuge.   Elle   est   préconisée   contre   la   dysenterie,   le   vers   de   Guinée   (ou 

dracunculose), les fractures vétérinaires, les neuralgies, la pleurésie, la pneumonie, la teigne, 

les douleurs, et les blessures [Phytochemical and Ethnobotanical Database].
L. robusta Roxb. (syn. L. macrophylla Roxb.)
- en Inde et dans le Chota Nagpur, les racines (molles et charnues) sont
appliquées localement pour apaiser les douleurs et sont données au bétail pour soigner les
diarrhées [Chopra 1956, Kirtikar 1975] ;
- au Bengale, à Orissä et au Bihär, la médecine vétérinaire utilise 25 ml d’extrait
aqueux de racine en association avec 20 mg de gingembre pour le traitement des diarrhées et
1
Du grec alexein (défendre contre), c’est un antidote actif contre les poisons et les venins.

52
dysenteries des buffles, vaches et moutons. De plus, 15 ml de cet extrait avec la poudre de 7
grains de poivre noir et d’une petite quantité de sel est administré en cas de fièvre, aux chèvres
et moutons [Pal 1980] ;
- au Népal, on retrouve les mêmes propriétés, mais il est fait mention de
l’utilisation des racines contre la dysenterie [Suwal 1970] ;
- la plante est aussi indiquée pour soigner les diarrhées, la dysenterie
[Phytochemical and Ethnobotanical Database].

L. rubra Blume :
- au Cambodge, les racines bouillies constituent une boisson contre les coliques
[Douk 1966] ;
- cette plante est aussi employée comme diurétique [Yem Yok Siv 1971] ;
- l’irritation provoquée par les baies a été mise en relation avec la présence de
raphides (cristaux d’oxalate de calcium) [Sakai 1984] ;
- elle soigne la dysenterie, les intoxications. Elle est aussi taenifuge
[Phytochemical and Ethnobotanical Database].

Sur Internet, on trouve les résultats d’un sreening effectué par le NCI (National Cancer
Institute) fait sur quatre extraits de Leeaceae (espèce(s) non précisée(s) !) sur diverses cellules
tumorales humaines. Ils montrent une inhibition significative de la croissance des cellules
tumorales de leucémie, du colon et du sein. La DL50 n’est pas significative ou est modeste pour
les cellules tumorales du sein, et du colon [Cancer cell line screening data].

53
B) Activités propres à Leea guineensis

Lavergne [1990] relate l’ancien usage médical de L. guineensis G. Don. Il remonte à


Pingre (1761) qui, sous le terme de “ Sureau de Bourbon l’employait en topique contre
l’hydropisie et la difficulté d’uriner. Sa seconde écorce guérirait également les brûlures ”.
Ce nom de "Bois de Sureau" est à l’origine de quelques ambiguïtés, car certains auteurs se sont
aventurés à lui attribuer les mêmes vertus que le Sureau d’Europe.
Pour Leclerc (1864), la décoction de tiges et de feuilles du "Bois de Sureau" est
“ journellement employée ” pour des bains et des fomentations2, contre les érysipèles et “ les
engorgements qui surviennent aux pieds et aux jambes ”.
Contre le tambave3, Leclerc cite le “ remède de la bonne femme Olivette ” préparé à Maurice.
C’est une association de Bois de sureau, de Lingue café (Mussaenda arcuata Poiret
(Rubiaceae)), de Cochléria du pays (Centella asiatica L. (Apiaceae)), de Petit Tamarin blanc
(Phyllanthus amarus (Euphorbiaceae)), de Gros Indigo (Sophora deneduta (Leguminosae)),
de Guérivite (Siegesbeckia orientalis (Asteraceae)), d’Herbe la mare (Cyperus sp.
(Cyperaceae)) et de Cadoque (Caesalpinia bondue (Caesalpiniacae)).
Daruty (1886 et 1889) accorde à cette Leeaceae des vertus antiseptiques et détersives
lorsqu’elle est appliquée sur les plaies et les ulcères. Il conseille de râper l’écorce et d’en
répandre la poudre sur les plaies préalablement détergées avec une décoction de Guérivite
(Siegesbeckia orientalis (Asteraceae)).

A la Réunion, Cordemoy (1895) n’attribue que des effets néfastes au Bois de Sureau. “ Le suc
de ses baies est caustique. Une personne qui en avait écrasé et manié une certaine quantité
pour en faire une encre de couleur vit une heure après sa main rougir, puis se tuméfier. Elle
éprouva une forte douleur, et un sentiment de brûlure. Un érysipèle se déclara, qui fut suivi de
démangeaisons pendant trois semaines ”.
Selon Ducheman (1900), la décoction de fleurs ou de feuilles de Bois de Sureau “ combat 

l’éléphantiasis   par   bain   chaud ”.   Plus   tard,   Bosse   (1977)   et   Bersez   (1983)   reparleront   de 

l’éléphantiasis, alors que cette parasitose est oubliée dans l’île de la Réunion.

Les racines quant à elles, sont connues pour être sudorifiques [Kirtikar 1975].
L’utilisation de L. guineensis est aujourd’hui plus restreinte [Lavergne 1990]. Une
recette consiste en l’association de Bois de sureau, Bois de reinette (Dodonea viscosa
2
Fomentation : action d’appliquer la chaleur comme moyen thérapeutique.
3
Affection tropicale des jeunes enfants dont les principaux symptômes sont : diarrhée rebelle, selle verdâtre,
éruptions cutanées (et du cuir chevelu). L’enfant est amaigri et couvert de petits boutons.

54
(Sapindaceae)), Bois puant (Foetidia mauritiana (Lecythidaceae)), Patate à durand (Ipomoea
pescaprae (Convolvulaceae)), Eucalyptus (Eucalyptus sp. (Myrtaceae)), Pignon d’Inde,
Thombé (Leucas lavandulaefolia (Lamiaceae)) et marc de Café pour soigner les rhumatismes.
D’autres tisaneurs considèrent le Bois de sureau comme rafraîchissant. Ainsi, il est prescrit
également pour les troubles circulatoires, les douleurs articulaires, les douleurs dentaires et
contre les refroidissements. Les bains aux Bois de sureau sont également indiqués contre les
rhumatismes, les douleurs, la polynévrite.
Certains la préconisent pour soigner le tambave, d’autres l’utilisent en boisson et en bain,
contre la goutte et “ l’enflure ”, ou pour des tisanes dites de « refroidissement et
saisissement ».

Au Cameroun, les tradipraticiens utilisent L. guineensis principalement pour soigner


les problèmes inflammatoires et l’hypertension.

En Côte d’Ivoire et au Burkina Faso, L. guineensis G. Don. est utilisée en lavement à


base du jus des feuilles pour guérir les maux de reins et les crises d’épilepsie. Le macérât de
feuilles, bu le matin à jeun, calmerait les maux de ventre des femmes enceintes, tandis que les
frictions avec la pulpe de feuilles serait un bon remède contre les rhumatismes [Kerharo 1950].
De plus, nous pouvons retenir son action analgésique et calmante sur les douleurs musculaires
et articulaires, son emploi comme fortifiant, à caractère parfois aphrodisiaque, et enfin son
utilisation lors de certains accouchements difficiles [Bouquet 1974].

Au Gabon, les jeunes pousses, en association avec la graine de Xylopia aethiopica


(Anonaceae) sont ingérées en cas de palpitations cardiaques [Adjanohoun 1984].

En République Centrafricaine, la décoction de l’écorce de tige est employée en


lavement pour combattre la constipation. Les feuilles sont utilisées pour soigner la
conjonctivite des nouveau-nés ; la préparation consiste à ramollir les feuilles au feu, les froisser,
les presser et administrer l’extrait dans les yeux [Aké Assi 1985].

Dernièrement, Leea guineensis est citée dans le catalogue des plantes médicinales
majeures de l’Afrique. Les parties utilisées sont les feuilles et les racines, qui sont anti-
infectieuses, analgésiques, antidiabétiques, et aphrodisiaques [Iwu 1993].

55
Plus récemment, l’utilisation comme diurétique de L. guineensis à la Réunion a été mis
en relation avec l’inhibition de l’enzyme de conversion de l’angiotensine (ACE). On note 90 et
100% d’inhibition de l’ACE respectivement pour les extraits acétonique et éthanolique des
feuilles [Adsersen 1997]. Cette inhibition enzymatique est également à rapprocher de son
usage contre les troubles cardiovasculaires.

On lui attribue aussi des effets contre les maux de dents, les coliques, les convulsions, la
dyspepsie, l’épilepsie, la blennorragie, les rhumatismes, les enflures, les vertiges et les
problèmes liés à la grossesse. Elle est aussi purgative et apaisante [Phytochemical and
Ethnobotanical Database].

On peut remarquer que les utilisations traditionnelles se retrouvent d’un pays à un


autre. De plus, il existe de nombreuses similitudes entre les activités propres de L. guineensis
et celles des autres espèces. Ceci est un bon argument pour reconnaître la pertinence des
renseignements car les espèces proviennent aussi bien d’Asie que d’Afrique.

56
Tableau 8 : Différentes activités biologiques décrites pour le genre Leea

L. aequata L.

L. crispa Linn.

L.curtissi King

L. gigantea Griff

L. hirta Roxb.

L. indica Merr.

L. macrophylla Roxb.

L. robusta Roxb.

L. rubra Blume

L. linearifolia

L. guineensis G. Don.
Activités

analgésique - antalgique + + + + + + +
antiseptique - cicatrisant - vulnéraire - + + + + + +
contre blessures et brûlures
antiarthritique - antirhumatismal - + + + +
goutte
anti-inflammatoire + + + +
(pleurésie, pneumonie, bronchite,
polynévrite, blennorragie, conjonctivite,
brûlure)
antidermatique – antiprurigineux + + + +
(dermatose, teigne, pelade, érysipèle,
alopécie)
antidiarrhéique - tambave + + + + +
antidysentérique + + + + + +
anti-infectieux - anticontagieux + + +
(lèpre, tuberculose, érysipèle)
anthelminthique - parasiticide - + + + + + + +
larvicide
antifongique - bactéricide - vers Guinée
digestif - dyspepsique + + +
diurétique + +
dysurie + + +
contre hydropisie astringent + + + + +
elephantiasis
antihemmoragique +
anti-ulcéreux + +
anti-arythmique - antihypertensif - +
trouble circulatoire
antipyrétique + + + + + +
sudorifique + +
anesthésique local +
antidiabétique +
neuralgie - paralysie + + +
vertige - nausée - maux de tête + +
épilepsie - convulsions +
accouchement difficile - maux de ventre + +
des femmes enceinte
aphrodisiaque +
mucilagineux + +
contre intoxications +
contre soif - rafraîchissante + +
refroidissements +

57
L’intérêt pour les Leeaceae semble justifié par leurs capacités à soigner les problèmes
d’ordre infectieux, inflammatoire, digestif, urinaire et circulatoire. Leea guineensis a aussi
ses activités. Les tradipraticiens la préconisent essentiellement pour ses vertus
antirhumatismale, antalgique, antihypertensive et diurétique.

C) Conclusion

En résumé, cette famille a été très peu étudiée tant sur le plan chimique que
biologique.
Nous retiendrons cependant la présence dans cette famille de flavonoïdes, d’acides
phénoliques et de tanins.
L’utilisation en médecine traditionnelle montre que le genre a des propriétés
essentiellement calmante, anti-infectieuse, anti-inflammatoire, antidysentérique,
antirhumatismal et cardiovasculaire.

Ainsi, une étude phytochimique et pharmacologique sur les extraits et les composés
qu’ils contiennent semble intéressante afin d’établir un lien avec ces utilisations en médecine
traditionnelle.

58
Chapitre III - Les Flavonoïdes Sulfatés

I- Introduction

Les flavonoïdes sont connus pour être d’importants métabolites synthétisés par les
plantes, responsables entre autres de la pigmentation et de la protection des plantes en réponse
à un stress d’irradiation UV, ou d’attaque microbienne (les phytoalexines). Récemment, ces
molécules ont été impliquées dans l’induction et l’inhibition des gènes de nodulation du
Rhizobium ou comme régulateur du transport de l’auxine (phytohormone de croissance) [Varin
1992a].
Dès 1975, tous ces composés possédant un ou des groupements sulfates ont été
classés dans un groupe appelé flavonoïde sulfaté [Harborne 1975a]. Une récente étude a
recensé toutes les données concernant ces composés (distribution, méthodes générales
d’extraction, de purification, d’analyse structurale, et de synthèse) [Barron 1988a, 1987c,
1988b, c]. Aussi, nous n’avons pas souhaité reprendre ici ces travaux, mais préférons plutôt
effectuer une « mise à jour » à partir de 1988 de ces données bibliographiques.

II- Classification, Structure

En 1988, Barron répertorie 101 flavonoïdes sulfatés [Barron 1988a]. A ce jour, nous
avons recensé 134 flavonoïdes sulfatés dans la littérature, qui se répartissent en 131 flavones
et flavonols sulfatés. On dénombre 74 flavonols sulfatés dont 19 structures sont nouvelles et
57 flavones sulfatées dont 12 nouvelles (Tableaux 9 p 42 et 10 p 45). A cela, nous pouvons
ajouter 2 anthocyanes sulfatées extraites de Babiana stricta (Iridaceae) (Figure 11) et 1
dihydroflavonol sulfaté, isolé de Myrica rubra (Myricaceae) (Figure 12).

59
OMe

OH

+
HO O
OMe

O-Gluc

RO OSO3H

HO HO

R= H 3-glucosyl-5-(2’’-sulfatoglucosyl)-malvidine
R= malonyl 3-glucosyl-5-(2’’-sulfato, 6’’-malonylglucosyl)-malvidine

Figure 11 : Antocyanes sulfatées isolées de Badiana stricta (Iridaceae) [Toki 1994]

OSO3K

OH

HO O
OH

OH O OH
O

OH

OH

3-galloyl-3’-sulfate-dihydromyricitine ou myricatine

Figure 12 : Dihydroflavonol sulfaté isolé de Myrica rubra (Myricaceae) [Nonaka 1983]

60
A) Les flavones sulfatées

Tableau 9 : Les flavones sulfatées

Apigénine
Hispiduline
Isoscutellaréine
Lutéoline
Chrysoeriol
Diosmétine
6-OH Lutéoline
Népétine
Nodiflorétine
Jaceosidine
Hypolaétine
Tricétine
Tricine
Vitéxine
Isovitéxine
Orientine
Iso-Orientine
Position de Sulfatation

Génine Monosulfatée
6 +
7 + + + + + + + + + + + + +
8 +
3’ + + +
4’ + +
Génine Disulfatée
6, 7 + +
7, 3’ + + +
7, 4’ + +
3’, 4’ +
Sulfatoglycosylée
6-sulfatoglucoside 
7-sulfatoglucoside + + +  + + +
7-sulfatogalactoside + 
7-sulfatoglucuronoside + +   +
7-sulfatorutinoside + +
7-disulfatoglucuronoside +
7-disulfatoglucoside  
Glycosylée et sulfatée
3’-glucuronoside, 7-sulfate +
3’-rutinoside, 7-sulfate +
8-glucoside, 7-sulfate 
8-glucoside, 3’-sulfate +
Divers
7-OMe, 3’-sulfatoglucuronoside 
7-OMe, 3’-sulfatogalactoside 
4’-OMe, 8-Glucoside, 3’-sulfate +
4’-OMe, 8-(2’’-sulfatoglucoside) 
7,4’-diOMe, 3’-sulfate 
 = produits nouvellement recensés depuis [Barron 1988a] (Cf. Figure 13 p 44)

D’après ce tableau qui présente 17 génines de base ;


- 20 flavones sont monosulfatées sur la génine, pour la plupart en position 7 (excepté
pour l’hypolaétine, la tricétine, la tricine et l’isoscutellaréine).
- 8 sont disulfatées sur la génine.
- 20 autres flavones sont sulfatées sur la partie osidique (constituée d’un glucose, d’un
galactose, d’acide glucuronique, ou d’un rutinose). Il y a 7 nouvelles structures :
- la lutéoline et le chrysoériol 7-disulfatoglucoside isolés de Phoenix dactylifera
(Palmae) [Tomás Lorente 1988],

61
- le chrysoériol 7-sulfatoglucuronoside isolé de Meeboldinama hysanantha
(Restionaceae) [Williams 1998].
- le premier sulfatoglucoside, fixé en position 6 sur l’hydroxylutéoline a été isolé
chez Tradescanta (Commelinaceae) [Del Pero Martìnez 1993].
- trois sulfatoglycosides de l’hypolaétine ont été isolés chez des Restionaceae
[Williams 1998], les 7-sulfatoglucoside et 7-sulfatogalactoside chez
Leptocarpus elegans (Restionaceae), ainsi que le 7-sulfatoglucuronique chez
Meeboldinama hysanantha (Restionaceae).
- On ne recense que 4 flavones dont la génine est à la fois sulfatée et glycosylée. Une
seule structure de ce groupe est nouvelle, c’est l’hypolaétine 8-glucoside, 7-sulfate
toujours isolée d’une Restionaceae, l’Hypolaena fastigiata (Restionaceae) [Williams
1998].
- Dans le dernier groupe, 4 flavones sulfatées sont nouvelles car elles sont à la fois
méthoxylées et sulfatées ou sulfatoglycosylées. Nous avons :
- l’isoscutellaréine 4’-méthoxy, 8-(2’’-sulfatoglucoside) de Althaea officinalis
(Malvaceae) [Gudej 1991],
- la lutéoline 7,4’-diméthoxy, 3’-sulfate [Harborne 1994], toujours des
Restionaceae,
- deux hypolaétines, la 7-méthoxy, 3’-sulfatoglucuronoside de Leptocarpus
elegans (Restionaceae), et la 7-méthoxy, 3’-sulfatogalactoside de
Leptocarpus tenax (Restionaceae) [Williams 1998].

62
R2

R3

R1 O

OH O

R1= disulfatoglucosyl, R2= OH, R3= OH 7-disulfatoglucosyl-lutéoline


R1= OMe, R2= OSO3 ; R3= OMe
-
7,4’-diméthoxy-3’-sulfate-lutéoline
R1= disulfatoglucosyl, R2= OMe, R3= OH 7-disulfatoglucosyl-chrysoériol
R1= sulfatoglucuronyl, R2= OMe, R3= OH 7-sulfatoglucuronyl-chrysoériol

R4

OH
R3

R2 O

R1

OH O

R1= sulfatoglucosyl, R2= OH, R3= H, R4= OH 6-sulfatoglucosyl-lutéoline


R1= OH, R2= OSO3 , R3= glucosyl, R4= OH
-
7-sulfate-8-glucosyl-hypolaétine
R1= OH, R2= sulfatoglucosyl, R3= OH, R4= OH 7-sulfatoglucosyl-hypolaétine
R1= OH, R2= sulfatogalactosyl, R3= OH, R4= OH 7-sulfatogalactosyl-hypolaétine
R1= OH, R2= sulfatoglucuronyl, R3= OH, R4= OH 7-sulfatoglucuronyl-hypolaétine
R1= H, R2= OMe, R3= OH, R4= sulfatoglucuronyl 7-méthoxyl-3’-sulfatoglucuronyl-hypolaétine
R1= H, R2= OMe, R3= OH, R4= sulfatogalactosyl 7-méthoxy-3’-sulfatogalactosyl-hypolaétine

OH OH
H
O
HO OCH3
HO O
OSO3-
HO O

OH O

Isoscutellaréine 4’-méthoxy, 8-(2’’-sulfatoglucosyl)

Figure 13 : Structure des nouvelles flavones sulfatées

63
B) Les flavonols sulfatés

Tableau 10 : les flavonols sulfatés

Kaempferol

Kaempferide

Rhamnocitrine

6-OH Kaempferol

Eupafoline

Eupalitine

Quercétine

Rhamnétine

Isorhamnétine

Tamarixétine

Rhamnazine

Ombuine

Quercétagétine

Patulétine

Eupatolitin

Spinacetine

Jaceidine

Veronicafoline

Eupatine

Gossypétine

Myricétine
Position de Sulfatation

Génine Monosulfatée
3 +  +  + + + + + + + + + + + + + +
7 +  + +
3’ 
4’ +
Génine Disulfatée
3, 7 + + +
3, 3’ + + +
3, 4’ + +
Génine Trisulfatée
3,5,4’ 
3, 7, 3’ +
3, 7, 4’ + + +
Génine Tétrasulfatée
3, 7, 3’, 4’ +
Sulfatoglycosylée
3-sulfatoglucoside 
3-(3’’-sulfatoglucoside) + +
3-(4’’-sulfatorutinoside) 
3-(6’’-sulfatoglucoside) +
3-(6’’-sulfatogentiobioside) +
3-sulfatorhamnoside + + +
3-sulfatorutinoside + + +
Glycosylée et sulfatée
3-glucuronoside, 7-sulfate + + +
3’-glucuronoside, 3,5,4’-trisulfate +
8-glucuronoside, 3-sulfate +
8-glucoside, 3-sulfate +
3-glucoside, 7-sulfate +
3-rhamnoside, 3’-sulfate 
3-glucuronoside, 3’-sulfate 
Divers
3’-OMe, 3-sulfate 
7,4’-diOMe, 3-sulfate + 
6-OMe, 3-sulfate 
6,7,4’-triOMe, 3-sulfate  
7,3’,4’-triOMe, 3-sulfate 
3-OMe, 7-sulfate + +
3,7-diOMe, 4’-sulfate 
3-acétyl, 7,3’,4’-trisulfate +
6,3’,4’-triOMe, 3-sulfate +
3-glucoside, 4’-OMe, 7-sulfate 
3-OMe, 5-glucoside, 3’-sulfate 
7-OMe, 3,3’-disulfate 
 = produits nouveaux depuis [Barron 1988a] (Cf. Figure 14 p 47 et 48)

64
Dans le tableau précédent, nous avons recensé 21 flavonols comme structure de base dont :
- 24 sont monosulfatés sur les génines, la plupart en position -3. Il existe trois
exceptions (jacéidine (qui porte un méthoxyl à cette position), quercétagétine et
myricétine). Dans ces dérivées monosulfatés, il y a 4 nouvelles structures ;
- le kampferide 3-sulfate isolé de Tamarix spp. (Tamaricaceae) [Tomàs-
Barberan 1990],
- le 6-hydroxykaempferol 3-sulfate d’Inula britanica (Compositae) [Öksüz
1987]
- la quercétine 7-sulfate isolée chez Frankenia pulverulenta (Frankeniaceae)
[Harborne 1975b],
- et la quercétine 3’-sulfate de Hypericum elodes (Guttiferae) [Seabra 1991].
- 14 flavonols sont polysulfatés, avec le plus souvent, la quercétine comme génine. Il y
a une seule génine tétrasulfatée, 8 génines disulfatées, 5 trisulfatées dont 1 est
nouvelle ;
- la rhamnétine 3,5,4’-trisulfate de Tamarix aphylla (Tamaricaceae) [Harborne
1988]. Ce composé semble provenir de la rhamnétine 3’-glucuronyl-

3,5,4’-trisulfate [Saleh 1975].


- Tout comme pour les flavones, il y a 12 flavonols sulfatoglycosylés (les oses
rencontrés sont le glucose, le gentiobiose, le rhamnose et le rutinose). Les 2
nouvelles structures dans ce groupe, sont :
- la quercétine 3-sulfatoglucoside isolée de Phoenix dactylifera (Palmae)
[Tomás Lorente 1988]
- et l’isorhamnétine 3-(4’’-sulfatorutinoside) de Zygophyllum dumosum
(Zygophyllaceae) [Li 1996].
- Par ailleurs, nous avons recensé 9 structures qui étaient à la fois glycosylées et
sulfatées, dont 2 sont nouvelles :
- la quercétine 3-glucuronyl-3’-sulfate isolée de Hypericum elodes (Guttiferae)
[Seabra 1988]
- la quercétine 3-rhamnosyl-3’-sulfate ou quercitrine 3’-sulfate isolée de Leea
guineensis (Leeaceae) [Op de Beck 1998].
- De plus, on dénombre 15 composés méthoxylés et sulfatés et parfois même
glycosylés. C’est d’ailleurs dans ce groupe que l’on recense le plus grand nombre de

65
structures nouvelles. Il s’élève à 10 dont la plupart dérive de la quercétine. Nous
avons :
- le 6-méthoxykaempferol 3-sulfate isolé de Flaveria chloraefolia (Compositae)
[Ibrahim 1995],
- le 6-hydroxy-7,4’-diméthoxykaempferol 3-sulfate, le
6,7,4’-triméthoxykaempferol 3-sulfate, et la 6,7,4’-triméthoxyquercétagétine
3-sulfate isolés chez Brickellia longifolia (Compositae) [El-Sayed 1990].
- Enfin, nous comptons 6 nouveaux dérivés de la quercétine, la
3’-méthoxyquercétine 3-sulfate ou percicarine et la 3-glucosyl-
4’-méthoxyquercétine 7-sulfate isolées de Polygonum hydropiper
(Polygonaceae) [Haraguchi 1996], la 7,3’,4’-triméthoxyquercétine 3-sulfate et
la 3,7-diméthoxyquercétine 4’-sulfate de Ipomoea regnellii (Convolvulaceae)
et la 7-méthoxyquercétine 3,3’-disulfate isolée d’une autre Convolvulaceae
Argyreia mollis [Mann 1999], la 3-méthoxy-5-glucosylquercétine 3’-sulfate
isolée de Calorophus elongatus (Restionaceae) [Williams 1998].

OMe

HO O

OSO3-

OH O

3-sulfate de kaempferide

R3

R2 O

R1 OSO3-

OH O

R1= OH, R2= OH, R3= OH 3-sulfate-6-hydroxykaempferol


R1= OMe, R2= OH, R3= OH 6-méthoxy-3-sulfate de kaempferol
R1= OH, R2= OMe, R3= OMe 6-hydroxy-7,4’-diméthoxy-3-sulfate de kaempferol
R1= OMe, R2= OMe, R3= OMe 6,7,4’-triméthoxy-3-sulfate de kaempferol

Figure 14 : Structure des nouveaux flavonols sulfatés

66
R3

R4

R2 O

R1

OH O

R1= OH, R2= OSO3-, R3= OH, R4= OH 7-sulfate de quercétine


R1= OH, R2= OH, R3= OSO3-, R4= OH 3’-sulfate de quercétine
R1= sulfatoglucosyl, R2= OH, R3= OH, R4= OH 3-sulfatoglucosyl de quercétine
R1= 4’’-sulfatorutinosyl, R2= OH, R3= OMe, R4= OH 3-(4’’-sulfatosulfatorutinosyl) d’isorhamnétine
R1= glucuronyl, R2= OH, R3= OSO3-, R4= OH 3-glucuronyl-3’-sulfate de quercétine
R1= rhamnosyl, R2= OH, R3= OSO3-, R4= OH 3’-sulfate de quercitrine
R1= OSO3-, R2= OH, R3= OMe, R4= OH 3-sulfate-3’-méthoxy de quercétine
R1= glucosyl, R2= OSO3-, R3= OH, R4= OMe 3-glucosyl-4’-méthoxy-7-sulfate de quercétine
R1= OSO3-, R2= OMe, R3= OMe, R4= OMe 3-sulfate-7,3’,4’-triméthoxy de quercétine
R1= OMe, R2= OMe, R3= OH, R4= OSO3- 3,7-diméthoxy-4’-sulfate de quercétine
R1= OSO3-, R2= OMe, R3= OSO3-, R4= OH 3,3’-disulfate-7-méthoxy de quercétine

OH

OMe

MeO O

MeO OSO3-

OH O

6,7,4’-triméthoxy-3-sulfate de quercétagétine

OSO3-

OH

HO O

OMe

O-gluc O

3-méthoxy-5-glucosyl-3’-sulfate de quercétine
OH

OSO3-

MeO O

OSO3-

OSO3- O

3,5,4’-trisulfate de rhamnétine

Figure 14 (suite) : Structure des nouveaux flavonols sulfatés

67
III- Distribution

Les flavonoïdes sulfatés bénéficient d’une large distribution. C’est pour cette raison 

que nous ne pouvons pas parler de traceur chimiotaxonomique au sens strict. Leur répartition 

fait d’avantage référence à leur situation géographique et écologique (milieux salins et/ou 

marécageux). En 1988, les travaux de Barron dénombraient 250 espèces réparties dans 17 

familles des Dicotylédones et dans 15 familles des Monocotylédones [Barron 1988a]. Depuis, 

nous   avons   dénombré,   3   nouvelles   familles   chez   les   Dicotylédones   (Cf.   Tableau   11  ). 

Quelques   espèces   sont   représentées   chez   les   Ptéridophytes,   comme  Adiantum   capillaris­

veneris (Adiantaceae), Asplenium filix­foemina, A. fontanum, A. septentrionale (Aspleniaceae) 

et  Cystopteris   fragilis  (Athyriaceae).   Par   contre,   aucun   flavonoïde   sulfaté   n’a   encore   été 

rencontré chez les Bryophytes et les Gymnospermes.

On peut cependant noter que les flavonoïdes sulfatés permettent de séparer les espèces 

en   groupes   distincts   dans   certaines   familles   comme   les   Cyperaceae,   les   Palmae   ou   les 

Zosteraceae [Ibrahim 1995].
De même, les flavonoïdes sulfatés rencontrés chez les espèces de Flaveria
(Compositae) peuvent être classés en étroite relation avec les 4 groupes déjà créés selon leurs
modèles photosynthétiques [Hanoufa 1994].
On rencontre par exemple pour le modèle photosynthétique de type C3, des monosulfates de
quercétine et patulétine. Pour le type C3-C4, des mono et disulfates principalement de
quercétine et de patulétine. Pour le type C4-like, des mono, di, tri et tétrasulfates
principalement de quercétine. Et pour le type C4, des mono, di et trisulfates de kaempferol,
d’isorhamnétine et d’apigénine [Hannoufa 1994].

A petite échelle, ces flavonoïdes sulfatés peuvent donc jouer un rôle dans la
systématique.

68
Tableau 11 : Répartition des flavonoïdes sulfatés dans les Magnoliophyta (Angiospermes)
Classe Sous-classe Ordres Familles
Magnoliopsida Hammamelidae Myricales Myricaceae
(Dicotylédones) Caryophyllidae Caryophyllales Chenopodiaceae
Polygalales Polygonaceae
Plumbaginales Plumbaginaceae
Dilleniidae Dilleniales Dilleniaceae
Theales Guttiferae
Malvales Malvaceae
Violales Bixaceae
Cistaceae
Frankeniaceae
Tamaricaceae
Rosidae Rosales Davidsoniaceae
Rosaceae
Myrtales Onagraceae
Rhamnales Leeaceae 
Sapindales Zygophyllaceae 
Apiales Umbelliferae
Asteridae Solanales Convolvulaceae 
Lamiales Verbenaceae
Asterales Compositae
Liliopsida Alismatidae Alismatales Alismataceae
(Monocotylédones) Hydrocharitales Hydrocharitaceae
Najadales Zamielelliaceae
Zosteraceae
Arecidae Arecales Palmae
Arales Araceae
Commelinidae Commelinales Commelinaceae
Cyperales Cyperaceae
Gramineae
Restionales Restionaceae
Juncales Juncaceae
Zingiberidae Zingibérales Marantaceae
Liliidae Liliales Liliaceae
Iridaceae
Orchidales Orchidaceae

IV- Fonction

En dépit des récentes avancées en phytochimie, le rôle des flavonoïdes sulfatés dans les
plantes reste encore mal connu. On peut cependant, avancer quatre hypothèses :

69
A) Détoxification

Tout comme dans le règne animal, la sulfatation des flavonoïdes peut être considérée 

comme un mécanisme de détoxification, en rendant hydrosolubles les produits en vue de leur 

stockage dans des compartiments cellulaires hydrophiles. Il s’agit notamment de détoxifier la 

plante à l’égard des groupes hydroxyles des flavonoïdes très réactifs, et de pouvoir excréter, 

tout comme les mécanismes de glycosylation, les flavonoïdes afin d’éviter leurs interactions 

avec des sites enzymatiques [Harborne 1977].

B) Transfert d’ions

La sulfatation peut aussi être un moyen de séquestrer les ions sulfates, et ainsi de jouer 

sur le dynamisme de la balance ionique. En effet, la plupart des plantes qui synthétisent ces 

dérivés, vivent dans un environnement écologique aquatique et/ou salin. La plante aurait donc 

par   ce   système,   la   possibilité   de   stocker   l’excès   d’ions   sulfates   présents   dans   son 

environnement. Ce phénomène pourrait également servir de transfert de groupes sulfates ou 

de soufre inorganique à une forme organique. Une expérience consistant à l’incorporation de 
35
SO42­  dans  les  tissus   de  Zostera  (Zosteraceae)  a révélé  que 36  heures   après, 50%   de  la 

radioactivité était présente dans la fraction contenant les flavonoïdes [Nissen 1964, Harborne 

1975a, 1977].

C) Bioactivation

On sait aussi que la sulfatation dans le règne animal est un moyen de bioactivation d’un
certain nombre de composés comme les hormones stéroïdiennes, et les neurotransmetteurs,
pour la modulation des activités biologiques. La sulfoconjugaison est même impliquée dans
l’activation des prodrogues (c’est le dérivé sulfaté du Minoxidil® agent antihypertenseur, qui
est actif) [Falany 1997]. Il en est de même chez certaines plantes, comme le Limonium

70
(Plumbaginaceae), qui, en réponse à un stress de salinité, accumule du sulfate de choline, ou
chez le Mimosa (Fabaceae), dont l’acide 4-(6’-sulfoglucosyl)-gallique est responsable des
mouvements seismonastique et nyctinastiques [Varin 1997].
D) Régulation du transport de l’auxine

La croissance des plantes est régulée par l’accumulation d’auxine, phytohormone de


croissance. L’auxine est elle-même stimulée par la quercétine et d’autres flavonoïdes. Or, les
dérivés 3-, 7- et 3’-sulfate de la quercétine bloquent cette stimulation [Faulkner 1992].
Cette hypothèse est confirmée par le fait que l’on rencontre les plus fortes concentrations en
flavonols sulfatés et en sulfotransférase (ST) dans les zones en croissance de la plante, alors
qu’elles sont les plus faibles dans les tissus âgés [Hannoufa 1991]. De plus, chez Flaveria
bidentis (Compositae), la régulation de la flavonol 3-ST par l’auxine a été démontrée. Cela
suggère donc que la sulfatation chez Flaveria, joue un rôle dans le contrôle du transport de
l’auxine [Ibrahim 1995].

V- Enzymologie

Dans les plantes il existe peu de sulfatases. Ce n’est que très récemment que des
flavonols sulfotransférases (F-ST) ont été identifiées à partir de Flaveria (Compositae) : la
flavonol 3-sulfotransférase (3-ST), ainsi que la 3’-ST, la 4’-ST et la 7-ST [Varin 1989, 1991,
1992b]. Ces enzymes sont très spécifiques, ainsi, la 3-ST ne reconnaît que la position 3 des
flavonols pour produire exclusivement le flavonol 3-sulfate selon une préférence allant de la
rhamnétine, l’isorhamnétine, la quercétine, la patulétine au kaempferol.
La 3’ et 4’­ST ne reconnaissent que les flavonols 3­sulfate, et la 7­ST que les flavonols 

3,3’­disulfate   ou   3,4’­disulfate.   Cette   constatation   a   permis   d’établir   une   séquence 

enzymatique de sulfatation pour expliquer la présence des flavonols déjà isolés dans cette 

espèce (Figure 15). La première étape étant la sulfatation en position 3 [Varin 1992a].

71
Flaveria
Quercétine

Flavériachloraefolia
3-ST

Quercétine-3-sulfate

chloraefolia
3'-ST 4'-ST

Quercétine-3,3'-disulfate Quercétine-3,4'-disulfate
7-ST 7-ST
Flaveria bidentis

Quercétine-3,7,3'-trisulfate Quercétine-3,7,4'-trisulfate
4'-ST 3'-ST

Quercétine-3,7,3',4'-tetrasulfate
Sulfatase

Quercétine-3,7,3'-trisulfate/3,7,4'-trisulfate
Sulfatase

Quercétine-3,7-disulfate

Figure 15 : Modèle biosynthétique des flavonoïdes sulfatés des espèces de Flaveria (Compositae) [Varin 1992a]

La réaction se fait par un mécanisme BI-BI qui utilise la PAPS (3’-Phosphoadénosine


5’-sulfate) comme premier substrat, puis vient le flavonol. Il y a réaction et libération du
flavonol sulfate puis du PAP.

Tableau 12 : Caractéristiques des flavonols sulfotransférases (F-ST) de Flaveria [Varin 1992a]


Propriétés F 3-ST F 3’-ST F 4’-ST F 7-ST
Km Flavonoïdes (µM) 0,2 0,29 0,36 0,24
Km PAPS (µM) 0,2 0,35 0,38 0,33
pH optimum 6,0 ; 8,5 7,5 7,5 7,5
pI apparent 5,4 6,0 5,1 6,5
Poids moléculaire (D) 35 000 35 000 35 000 35 000
Substrat Quercétine (Q) Q-3-sulfate Q-3-sulfate Q-3,3’-disulfate

Il y a de très fortes homologies de séquences entre les ST [Varin 1992a, 1997]. Ainsi 

entre la 3­ST et la 4’­ST il y a 70% d’homologie de séquence entre elles et environ 30% avec 

les ST animales, justifiant ainsi la présence de régions très conservées.
Par mutagénèse, on connaît à présent les sites de fixation du flavonol spécifique et du
co-substrat [Marsolais 1997, 1998]. L’activité de ces ST est fortement liée au développement
végétatif de la plante [Hannoufa 1991].

72
On localise même les flavonols sulfatés dans le compartiment nucléaire, et de manière 

transitoire dans le cytosol. Une protéine nucléaire qui a d’ailleurs une forte affinité avec la 

quercétine 3­sulfate (85 nM) est en cours d’étude [Grandmaison 1996]. Tout cela suggère une 

fonction probable de régulation. Rappelons que les flavonoïdes activent l’expression du gène 

nod du Rhizobium [Harborne 1994], et que chez les mammifères, les métabolites sulfatés sont 

impliqués dans la croissance et le développement cellulaire.

VI- Métabolisation et Bioconversion

A) Métabolisation

Il est maintenant admis que les flavonoïdes sont métabolisés par les cellules de
mammifères et excrétés dans la bile et/ou l’urine sous forme de dérivés glucuronoconjugués ou
sulfatés [Harborne 1982, 1994]. La sulfatation enzymatique joue un grand rôle dans la
détoxification des métabolites endogènes et des xénobiotiques, mais cette sulfatoconjugaison
est aussi impliquée dans la bioactivation. Ainsi, la quercétine est métabolisée par le foie et
donne des dérivés monosulfatés ainsi que des dérivés sulfatés et glucuronoconjugués [Shali
1991]. De plus, la quercétine, au pouvoir antioxydant reconnu, est administrée par sonde
intragastrique à des rats. Le sang prélevé au bout d’une heure, puis de six heures, de l’aorte
abdominale ne contient plus de quercétine libre, mais plusieurs de ses métabolites, dont des
dérivés sulfatés et sulfoglucuronés. Le plasma de rat contenant ces métabolites inhibent
d’avantage la peroxydation lipidique induite par le sulfate de cuivre, que le plasma contenant
seulement de la quercétine [da Silva 1998]. Aussi, la liquiritine (7,4’-dihydroxyflavone) qui a
une activité antihépatotoxique in vivo par voie orale chez le rat est métabolisée en 5 composés
dont les dérivés sulfatés suivants : 7,4’-disulfate, 7-sulfate-4’glucuronoside et 7-glucuronoside-
4’-sulfate. Le rein participe aussi à la métabolisation en dérivé 7,4’-disulfate [Shimamura
1993]. Il en est de même pour la génistéine qui est connue pour son activité inhibitrice de la
protéine tyrosine kinase ou pour son activité oestrogénique. Ces activités sont essentiellement
dues à ces dérivés sulfatés. En effet, l’administration de génistéine par voie orale chez le rat est
rapidement suivie d’une métabolisation, conduisant à l’élimination par voie urinaire et biliaire
de la génistéine 4’-sulfate et de son dérivé glucuroné en –7 essentiellement [Yasuda 1996].
B) Bioconversion

73
Les synthèses spécifiques de dérivés sulfatés ne sont pas toujours faciles [Barron
1988a]. Aussi, la bioconversion semble avoir un avenir certain par l’obtention de réaction
spécifique avec de bons rendements.
Par exemple, Streptomyces fulvissimus est capable, en suspension, de biotransformer la
5-hydroflavone en son dérivé 4’-sulfate [Ibrahim 1989].
De même, dans la flore intestinale humaine, il existe une arylsulfotransférase qui sulfate
des polyphénols comme les xanthones, chalcones et flavonols. Ainsi, la bactérie isolée de la
flore intestinale (Eubacterium A-44) peut catalyser par exemple, le transfert d’un sulfate sur la
quercétine à partir du sulfate de p-nitrophenyl ou PNS (et non pas à partir du PAPS). Cette
enzyme bactérienne est plusieurs milliers de fois plus active que les enzymes d’origine animale
ou végétale. Si le PNS est en excès, on obtient les dérivés 3,3’-disulfate et 3,3’,7-trisulfate.
Lorsque le PNS est mis dans des conditions équimolaires ou en léger excès, seul le dérivé
3,3’-disulfate est obtenu [Koizumi 1990].
Cette étude montre aussi qu’administrée oralement, la quercétine peut être sulfatée par
les bactéries intestinales et devenir plus hydrosoluble et par conséquent moins absorbable.
Par ailleurs, il est connu que la quercétine est mutagène in vitro mais ne semble pas être
carcinogène in vivo [Fukuoka 1980]. La sulfatation de la quercétine par la flore intestinale
entraînerait-elle cette détoxification ?

VII- Propriétés biologiques des flavonoïdes sulfatés

A) Activité antiallergique [Nagai 1975]

La baicaléine est un flavonoïde antiallergique peu soluble, isolée de la racine de


Scutellaria baicalensis (Lamiaceae) utilisée dans la médecine traditionnelle chinoise lors des
crises allergiques ou d’asthme. Deux dérivés plus hydrosolubles ont été synthétisés. Il s’agit
des sels de sodium de la baicaléine 6-sulfate (BSS) et de la baicaléine 6-phosphate (BPS),
testés pour leur activité antiallergique.

HO O

OH O

74
R=OH Baicaléine
R=OSO3Na Baicaléine 6-sulfate de sodium

Il existe trois groupes de réactions d’hypersensibilité allergique :
- L’hypersensibilité de type I ou hypersensibilité immédiate se produit lorsqu’un
allergène est reconnu par une IgE qui active un mastocyte. Le mastocyte activé
libère de l’histamine qui provoque la réaction allergique. Lorsque l’allergène pénètre
dans les bronches, l’hypersensibilité peut se manifester par une crise d’asthme avec
diminution du volume d’air inhalé.
- L’hypersensibilité de type II est liée à la présence d’anticorps dirigés contre les
membranes et d’antigènes cellulaires qui activent le complément.
- L’hypersensibilité de type III est le résultat du dépôt du complexe immun (Ac-Ag)
sur les parois des vaisseaux et dans les tissus provoquant la destruction de ceux-ci
par la libération par les phagocytes de dérivés actifs de l’oxygène. Cette
hypersensibilité est mise en évidence par la réaction d’Arthus qui est une réaction
cutanée qui se présente sous forme d’une zone rouge et gonflée après injection
intradermique de l’antigène.

Cette étude a montré que BPS et BSS inhibent les hypersensibilités de type I et II, 

mais qu’ils n’ont aucun effet sur l’hypersensibilité de type III (responsable de la polyarthrite 

rhumatoïde ou du lupus érythémateux disséminé entre autres).

B) Activité Mutagène - Carcinogène [Fukuoka 1980]

Les extraits aqueux de feuilles et de graines d’Anethum graveolens et d’A. sowa


(Umbelliferae) comestibles présentent une activité mutagène sur les souches TA98 et TA100 de
Salmonella typhimurium. Les auteurs ont recherché le principe mutagène, et examiné l’effet
carcinogène chez le rat en complémentant son alimentation durant 450 jours, par un apport de
33% de poudres de feuilles ou de graines.
Après fractionnement et purifications successives, les auteurs montrent que ce sont la
persicarine (isorhamnetine 3-sulfate) et la quercétine 3-sulfate qui sont responsables de cette
activité mutagène.

75
OR

OH

HO O

OSO3-

OH O

R=CH3 Persicarine ou Rhamnétine 3-sulfate


R=H Quercétine 3-sulfate

Ils soulignent bien que ces flavonols sulfatés sont mutagènes in vitro mais pas
carcinogènes in vivo ! Avec un apport journalier de 33% de poudres de feuilles et de graines, le
taux de flavonols sulfatés n’est pas suffisant pour induire des tumeurs.

C) Inhibition des déshydrogénases

Les dérivés de la quercétine 3,7,3’,4’-tétrasulfate et 3-acétyl-7,3’,4’-trisulfate inhibent


la réduction des groupes carbonyles catalysés par les alcool déshydrogénase ainsi que lactate et
malate déshydrogénases [Pérez 1986].

D) Inhibition de l’aldose réductase [Varma 1986]

L’aldose réductase est une enzyme clé dans la voie de synthèse des polyols  via  le 

métabolisme des sucres :

76
Aldose réductase
Glucose Sorbitol

NADPH NADP

Polyol déshydrogénase

Sorbitol Fructose

NAD NADH

Figure 16 : Métabolisme des polyols

L’aldose réductase est présente dans de nombreux tissus dont le cristallin. Chez les 

diabétiques, cette enzyme produit beaucoup de sorbitol, et cette accumulation dans le cristallin 

est responsable de la cataracte. Ce sont ces polyols qui sont responsables de l’opacification du 

cristallin   car   ils   diffusent   mal   à   travers   les   membranes   cellulaires   et   provoquent   une 

importante entrée d’eau dans les cellules par osmose. Ce phénomène serait responsable de 

certaines rétinopathies et neuropathies périphériques associées au diabète humain.
La recherche de composés inhibiteurs de l’aldose réductase est d’un grand intérêt
thérapeutique dans la lutte contre les complications du diabète. Certains flavonoïdes inhibent
cette enzyme comme la quercitrine notamment qui a une CI50 de 10-7M. Mais la limitation de
l’usage de ces flavonoïdes en thérapeutique est leur faible hydrosolubilité. Pour cela, les
Laboratoires Zyma© (Nyon Suisse) ont synthétisé des dérivés sulfatés pour les rendre plus
hydrosolubles. Il s’avère que ces flavonoïdes sulfatés sont les composés les plus actifs (CI50 10-
8
M).

Tableau 13 : Flavonoïdes sulfatés inhibiteurs de l’aldose réductase du cristallin obtenus par synthèse
Composés % d’inhibition à 10-8M
Quercitrine 0
Quercétine 3-acétyl, 7,3’,4’-trisulfate 70
Quercétine 3,7,3’,4’-tétrasulfate 55
Quercétine 3,5-diacétyl, 7,3’,4’-trisulfate 75
Quercétine 5,7,3’-triacétyl, 3,4’-disulfate 75

77
Cette action a été également démontrée pour d’autres flavonoïdes sulfatés isolés de
Polygonum hydropiper (Polygonaceae) sur l’aldose réductase du cristallin de porc [Haraguchi
1996].

Tableau 14 : Flavonoïdes sulfatés inhibiteurs de l’aldose réductase du cristallin isolés de Polygonum


hydropiper
Composés IC50 (µM) de l’aldose réductase
Quercétine 50,1
Quercétine-3-sulfate 50,9
Isorhamnétine >95,0
Isorhamnétine-3-sulfate 69,0
Isorhamnétine-3,7-disulfate 1,8
Rhamnazine >91,0
Rhamnazine-3-sulfate 30,1
Isoquercitrine 16,0
Tamarixétine-3-glucoside-7-sulfate 5,0

Ce tableau montre que les dérivés sulfatés les plus actifs sont l’isorhamnétine-3,7-
disulfate (IC50 =1,8 µmol.l-1) et la tamarixétine-3-glucoside-7-sulfate (IC50 = 5,0 µmol.l-1). La
sulfatation de l’hydroxyle en 7 semble être un facteur important dans l’inhibition de l’aldose
réductase. On remarque aussi que l’introduction d’un groupement sulfate sur une génine
augmente son activité de façon non négligeable. Ainsi l’activité de la rhamnazine-3-sulfate (IC 50
= 30,1 µmol.l-1) est trois fois plus importante que la génine correspondante (IC 50 >91,0 µmol.l-
1
).
R4

R5

R3 O

R1

R2 O

R1 = Rhamnosyl, R2 = OH, R3 = OH, R4= OH, R5 = OH Quercitrine


R1 = OSO , R2 = OH, R3 = OSO3 , R4= OSO3 , R5 = OSO3
3
- - - -
Quercétine 3,7,3’,4’-tétrasulfate
R1 = Acétyl, R2 = OH, R3 = OSO3 , R4= OSO3 , R5 = OSO3
- - -
Quercétine 3-acétyl-7,3’,4’-trisulfate
R1 = Acétyl, R2 = Acétyl, R3 = OSO3 , R4= OSO3 , R5 = OSO3 Quercétine 3,5-diacétyl-7,3’,4’-trisulfate
- - -

R1 = OSO3-, R2 = Acétyl, R3 = Acétyl, R4= Acétyl, R5 = OSO3- Quercétine 5,7,3’-triacétyl-3,4’-trisulfate


R1 = OSO3-, R2 = OH, R3 = OSO3-, R4= OMe, R5 = OH Isorhamnétine 3,7-disulfate
R1 = Glucosyl, R2 = OH, R3 = OSO3 , R4= OH, R5 = OMe
-
Tamarixétine 3-glucosyl-7-sulfate

78
E) Activité Anti-oxydante – Antiradicalaire

Antiradicalaire [Brasseur 1987]

La rutine est un des flavonoïdes majeurs de la thérapeutique, utilisée notamment dans


les troubles de la circulation veineuse, de l’athérosclérose, de l’hypertension et les
radiodermites (souvent associé à l’acide ascorbique).
Malheureusement peu soluble dans l’eau, des dérivés solubles ont été hémisynthétisés dont la
rutine sulfate sous forme de sel sodique. Afin de savoir si ses dérivés ont conservé l’activité de
la molécule originale, les auteurs ont effectué différents tests.
OH

OH

RO O

O-Gluc-Rha

OH O

R=H Rutine
R=OSO3Na Rutine sulfate

Tableau 15 : Activité comparée de la rutine et de la rutine sulfate (exprimés en %)


Action Concentration M Rutine Rutine sulfate
radical DPPH 3.10-6 36 7
% de capture du radical
radical OH 10-4 20 17
% de dégagement d’éthylène formé par réaction entre le
radical et le KMB* soumis à irradiation λ
antilipoperoxydante 10-3 25 2
% d’inhibition de formation de lipoperoxyde
antioxygène 10-4 67 40
% de la teneur résiduelle en acide ascorbique
biosynthèse des prostaglandines 10-3 248 186
% de stimulation de la biosynthèse
*
KMB : acide méthyl-4-oxo-2 butyrique

On observe que la rutine reste la plus active. Les auteurs soulignent tout de même que
le sulfate de rutine qui est testé, bien que majoritaire, contient des impuretés ( notamment des
dérivés de rutine dont le système ortho-dihydroxyl du cycle B n’est plus libre).

79
Antioxydante [Yagi 1994]

Isolés de Polygonum hydropiper (Polygonaceae), la quercétine 3-sulfate,


l’isorhamnétine 3,7-disulfate et la tamarixétine 3-O-β-glucoside 7-sulfate ont montrés une forte
activité antioxydante.
La méthode au thiocyanate ferrique montre que ces trois flavonoïdes ont une activité
supérieure à celle de la quercétine et de l’α-tocophérol (ces derniers étant connus pour être de
très bons antioxydants naturels).

R3

R4

R2 O

R1

OH O

R1=OSO3K R2=OH R3=OH R4=OH Quercétine 3-sulfate


R1=OSO3K R2=OSO3K R3=OCH3 R4=OH Isorhamnétine 3,7-disulfate
R1=O-Gluc R2=OSO3K R3=OH R4=OCH3 Tamarixétine 3-glucosyl, 7-sulfate

De même, la méthode utilisant l’anion superoxyde montre qu’ils sont plus actifs que la
quercétine pour capter ces anions induits par le système xanthine-xanthine oxydase (l’IC50 étant
en dessous de 10 ppm).

F) Chimioprévention des cancers du sein [Peterson 1996, Wong 1997]

Des   études   épidémiologiques   ont   montré   le   très   faible   taux   de   cancer   chez   les 

personnes ayant une alimentation riche en isoflavones (asiatiques,…). Bien que ce soit des 

génines non sulfatées qui sont consommées, celles­ci sont métabolisées en dérivés sulfatés par 

l’organisme. Ce sont ses dérivés qui sont fortement impliquées dans le processus d’inhibition 

de la croissance des tumeurs mammaires.

En effet, dans les cellules de cancer du sein MCF­7, la génistéine est métabolisée en 

dérivés   sulfatés   dont   la   génistéine   7­sulfate.   Ces   métabolites   sont   rapidement   excrétés, 

80
entraînant une chute de la concentration intracellulaire en génistéine. Ce processus permet 

d’inhiber la croissance mammaire.

De même, la biochanine A, active les cellules MCF­7 par la métabolisation en génistéine puis 

conversion en génistéine 7­sulfate.

R2 O

R1 O
R3

R1=H R2=OH R3=OH daidzéine


R1=OH R2=OH R3=OH génistéine
R1=OH R2=OH R3=OMe biochanine A
R1=OH R2=OSO3- R3=OH génistéine 7-sulfate
R1=H R2=OH R3=OSO3- daidzéine 4’-sulfate
R1=H R2=OSO3 -
R3=OSO3 -
daidzéine 7,4’-disulfate

Une autre voie dans la prévention des cancers du sein est celle de l’inhibition d’enzyme
spécifique comme la stérol sulfatase.
En effet, les stéroïdes oestrogéniques jouent un rôle dans l’évolution cancéreuse. Ces stéroïdes
sont véhiculés sous forme de sulfoconjugués, inactifs sous cette forme. La stérol sulfatase les
activent en les désulfatant. C’est cette désulfatation qui entraîne l’évolution cancéreuse. Or, les
dérivés sulfatés de daidzéine inhibent la stérol sulfatase. La daidzéine 4’-sulfate et
7,4’-disulfate ont une IC50 de 6 et 1,5 µM respectivement, alors que le Tamoxifen® (et ses
métabolites non-sulfatés), principal antioestrogène, inhibe cette même enzyme à 270 µM. La
génistéine ou la biochanine A ont une IC50 de 1,2 µM alors que la daidzéine n’inhibe pas cette
enzyme. Notons aussi que la daidzéine et la génistéine inhibent une enzyme de synthèse de
l’œstrogène et des androsténédiols ce qui a pour conséquences de diminuer leurs
concentrations dans les cellules mammaires et donc de diminuer l’évolution cancéreuse.

81
Conclusion

Depuis 1988, nous avons recensé 134 flavonoïdes sulfatés, dont 33 sont nouveaux (la
plupart étant à la fois méthylés et/ou glycosylés et sulfatés). Hormis une flavone sulfatée chez
les Malvaceae, notons que les nouvelles flavones sulfatées, proviennent des
Monocotylédones. Nous avons vu aussi que les flavonoïdes sulfatés sont présents dans 38
familles avec trois nouvelles familles chez les Dicotylédones et que leur répartition est liée au
milieu dans lequel ces plantes poussent (salin ou marécageux).
La plupart des propriétés décrites sont les mêmes que celles des flavonoïdes en
général. Mais le fait que les flavonoïdes se métabolisent en dérivés sulfatés hydrosolubles et
les travaux effectués montrent que les propriétés citées pour les flavonoïdes sont étroitement
liées aux activités de ces dérivés sulfatés.

82
Deuxième Partie :
Travaux personnels

Chimie extractive
Isolement des composés
Analyse structurale
Activités biologiques

83
Chapitre I Chimie Extractive

I- Matériel végétal

Toute l’étude a été effectuée sur l’espèce Leea guineensis G. Don. Celle-ci a été
récoltée en avril 1995 au Cameroun à Bella au sud d’Edea (3°14’N, 10°13’E) par le botaniste
le Dr Achoundoung. Un échantillon de la plante est conservé à l’Herbier National de Yaoundé
sous le numéro 3145 : Achoundoung.

Les feuilles et le bois provenant du même arbuste ont été séchés séparément à l’ombre
pendant une quinzaine de jours, puis ont été respectivement broyés. Les poudres de feuilles 1,5
Kg et de bois 1,5 Kg ont alors été envoyés au laboratoire de pharmacognosie de Grenoble.

II- Chimie extractive

A Extraction solide-liquide des feuilles

1 Kg de poudre de feuilles est soumis à une extraction à l’hexane (25 L) pendant 11H
dans un appareil de type Soxhlet. Les marcs sont séchés et épuisés au dichlorométhane (25 L,
15H). Ces deux extraits obtenus sont ensuite concentrés alors que les marcs subissent une
extraction hydroalcoolique 50% (30 L pendant 4 jours à température ambiante) (Figure 17 p
67).

B Extraction liquide-liquide

L’extrait hydroalcoolique est concentré sous vide afin d’obtenir 10 L de solution, dont
1 L est prélevé après homogénéisation et lyophilisé. Le reste subit une succession d’extraction
liquide-liquide avec les solvants de polarité croissante suivants : dichlorométhane, acétate
d’éthyle et butanol.
L’extraction est réalisée plusieurs fois pour chaque solvant. Les solutions extractives sont alors
concentrées. Les résidus des extraits EtOAc et BuOH sont repris dans l’eau et lyophilisés
(Figure 18 p 67).

84
Au total, nous obtenons 7 extraits dont les rendements d’extraction sont les suivants :

Tableau 16 : Rendements d’extraction


Type Extraits Quantité Rdt / Extrait Rdt total
d’extraction en g EtOH-H2O / Feuilles
Extraction Hexane 26 2,6
Solide-Liquide Dichlorométhane 42 4,2
Hydroalcoolique 143 100 14,3
Extraction Dichlorométhane 7 5 0,7
Liquide-Liquide Acétate d’éthyle 38 27 3,8
Butanol 15 10 1,5
Aqueux résiduel 36 25 3,6

Tous les extraits ont été analysés.

C Hydrodistillation

La recherche des composés volatils (CV) de L. guineensis G. Don, est menée par un
entraînement classique à la vapeur d’eau à partir d’échantillons de 100g de feuilles ou de bois
sec.
Le protocole utilisé est celui de la Pharmacopée Française Xèmeéd. [1983]. La durée
d’hydrodistillation a été de 4H pour les feuilles et le bois.
Les distillats obtenus dans les deux cas sont de couleur jaune foncée et sont plus légers
que l’eau.

Les rendements sont :


CV des feuilles : Rdt = 0,3%
CV du bois : Rdt = 0,4%

85
FEUILLES broyées
1Kg

Soxhlet Hexane 25 L, 11H


Extrait
Hexanique Marc
2,6 %
Soxhlet dichlorométhane 25 L, 15H

Extrait
Dichlorométhane Marc
4,2 %
Macération EtOH-H2O 50:50 30 L, 4J, TA

Extrait
Hydroalcoolique Marc
14,3 %

Figure 17 : Extraction solide – liquide des feuilles

Extrait EtOH-H2O
30L

Concentration

Extrait H2O
Prélèvement d’ 1L lyophylisé
10 L

CH2Cl2 1 x 25 L

Extrait concentration Phase


Dichlorométhane H2O
0,7 %
EtOAc 3 x 20 L
Concentration
Extrait Lyophylisation Phase
Acétate d’éthyle H2O
3,8 %
BuOH 5 x 8 L
Concentration
Extrait Lyophylisation
Concentration
Butanol Lyophylisation
1,5 %

Extrait
Aqueux final
Figure 18 : Extraction liquide – liquide 3,6 %

86
Chapitre II - Isolement des composés

I- Extrait hexanique

Cet extrait visqueux et vert foncé contient beaucoup de pigments chlorophylliens.


Pour cela, nous avons chromatographié 20 g de cet extrait sur une colonne ouverte (CO) de
charbon afin de fixer ces pigments sur le support. L’extrait est élué au dichlorométhane. Deux
fractions principales sont obtenues A et B qui seront chacune chromatographiée sur des
colonnes de silice normale et de silice greffée C-18 sous moyenne pression (CLMP). Cet
extrait hexanique conduit à la purification de 7 composés de nature terpénique (Terp-1 à
Terp-7). De plus, le fractionnement classique de 5g d’extrait a conduit à l’isolement de Terp-
2.
5g
Extrait hexanique

CO charbon
20 g CO Si
E1
E2

A B C
CLMP Si CLMP Si
E3 E3 CLMP C18
E4

Terp-5 Aa Ab Terp-5 Ba Ca
(1g) (500mg)
CCMP Si CLMP Si CLMP Si CLMP C18 CCMP Si
C7 E5 E5 E4 C1

Baa Terp-2
Aaa Aba
Terp–7 CLMP C18 (25mg)
Visiprep Si
(6mg) CLMP C18
E4 E6
E4
Terp-3
(9mg)
Aaaa Terp-1 Abaa
(20mg)
CLMP C18 E1 CH2Cl2
E4 CCMP Si
C2 E2 CHCl3
Terp-4 Visiprep Si
E3 gradient cHex-CHCl3-MeOH
E7
(20mg)
E4 gradient MeOH-CHCl3

E5 gradient cHex-CHCl3
Terp-6 112B Terp-3 E6 gradient cHex-EtOAc
(9mg) (1mg) E7 CHCl3-MeOH 9:1
C1 cHex
Figure 19 : Isolement des composés de l’extrait hexanique
C2 cHex-EtOAc 7:3
C7 cHex-EtOAc 9 :1

87
II- Extrait dichlorométhane

Cet extrait verdâtre a subit dans un premier temps une chromatographie sous vide afin
d’obtenir deux fractions enrichies A et B. Une chromatographie d’exclusion diffusion sur
Sephadex© LH-20 de la fraction A conduit à deux fractions importantes Aa et Ab. La fraction
Aa riche en chlorophylle est passée sur charbon avant d’être chromatographiée sur une colonne
de silice. La fraction Ab est chromatographiée sur un support inverse pour conduire à deux
composés. La fraction B, plus polaire subit différentes chromatographies classiques. Ainsi, de
l’extrait dichlorométhane sont isolés 3 composés, un hydrocarbure (AG-1), un ester
phénolique (Ac Ph-2) et un flavonoïde (Flav-7).

E8 gradient cHex-CH2Cl2-MeOH
Extrait
E9 CHCl3-MeOH 5:5 dichlorométhane
E10 gradient CHCl3-MeOH
6g VLC silice
E11 gradient H2O-MeOH E8

E13 H2O-MeOH 5:5


E14 MeOH
E15 gradient CH2Cl2-EtOAc A B
CO Sephadex LH20 CLMP Si
C5 EtOAC-MeOH-H2O 100:16,5:13,5 E10
E9

Aa Ab Ba Bb
CO Charbon CLMP C18
E10 E11 CLMP C18
E13

Aaa Ac Ph-2 Aba Bba


(4mg) CO Sephadex LH20
CLMP Si
E14
E15

Aaaa Aaab Bbaa Bbab


AG-1
(30mg)
CCMP Si
C5

Flav-7
Figure 20 : Isolement des composés de l’extrait dichlorométhane(3mg)

88
III- Extrait à l’acétate d’éthyle

10 g de cet extrait brunâtre sont chromatographiés sur une colonne de silice sous
moyenne pression, et permettent d’obtenir un composé et 3 fractions majoritaires A, B et C.
Ces fractions subissent ensuite des chromatographies classiques en phase inverse et des CCM
préparatives afin de purifier 5 composés, un acide phénol (Ac Ph-1) et 4 flavonoïdes (Flav-1
à Flav-4).

Extrait acétate d’éthyle

10 g CLMP silice
E17

A B C
Flav-1
(36mg) CLMP C18
E11
CLMP C18
CLMP C18 E11
E18

Aa Ac Ph-1 Ba Bb Bc Ca
(30mg) CMMP Si CMMP Si CO Sephadex LH20
C5 C5 E14
CMMP Si
CO Sephadex LH20 C5
E9

Flav-3 Flav-4 Flav-3 Flav-2 Caa


Ac Ph-1
(50mg) (20mg) (30mg) (50mg)
Visiprep C18
E11

Flav-3
Flav-4
E9 CHCl3-MeOH 5:5
(8mg)
E11 gradient H2O-MeOH
E14 MeOH
E17 gradient EtOAc-MeOH
E18 gradient H2O-MeOH-CHCl3
C5 EtOAC-MeOH-H2O 100:16,5:13,5

Figure 21 : Isolement des composés de l’extrait acétate d’éthyle

89
IV- Extrait butanolique

Une chromatographie sous vide sur 2 g de cet extrait butanolique conduit à deux
fractions A et B. Celles-ci sont alors chromatographiées sur un gel de Sephadex LH20 et si la
purification n’est pas suffisante, elle est poursuivie par une CLMP en C18. Nous purifions ainsi
3 flavonoïdes (Flav-4 à Flav-6).

Extrait butanol

2g VLC silice
E20

A B

CO Sephadex LH20
E14
CO Sephadex LH20
E14

Flav-4 Flav-5 Aa Ba
(6mg) (20mg)
CLMP C18
E11
CLMP C18
E11

Flav-6 Flav-5
(6mg) (3mg) Baa

CLMP C18
E21
E11 gradient H2O-MeOH
E14 MeOH Flav-6
E20 gradient CH2Cl2-MeOH (3mg)
E21 H2O

Figure 22 : Isolement des composés de l’extrait butanolique

90
V- Extrait aqueux

4 g de cet extrait après une chromatographique rapide sous vide, conduit à l’obtention
d’un composé pur et d’une fraction A qui après une CLMP C-18 conduit à une autre fraction
Aa et à deux composés purs. La fraction Aa est alors purifiée sur Sephadex LH20 pour obtenir
un dernier composé. De cet extrait aqueux nous obtenons 3 composés appartenant à la classe
des flavonoïdes (Flav-2, 5 et 6).

Extrait aqueux

4g VLC silice
E22

Flav-5 A
(6mg) CLMP C18
E11

Aa Flav-5 Flav-2

CO Sephadex LH20
E14

E11 gradient H2O-MeOH

Flav-6 E14 MeOH


(11mg) E22 CH2Cl2-MeO-H2O

Figure 23 : Isolement des composés de l’extrait aqueux

91
Chapitre III - Etude Phytochimique - Analyse Structurale

A- Etude des composés volatils

I- Analyse

L’analyse de la composition de ces distillats est réalisée par chromatographie en


phase gazeuse couplée à la spectrométrie de masse (CG/SM).
La méthodologie ainsi que les caractéristiques de l’appareil sont décrites en
annexe : Matériels et Méthodes p 176.

Ac. myristique
Ac. Laurique
Ac. nonanoïque

Ac. caprique

(a)

Figure 24 : Profil chromatographique des composés volatils de bois (a).

92
Hexahydrofarnésylacétonee
Acide myristique
Naphtalène

Acide nonanoïque
Anethole

géranylacétone

Acide laurique
Acide caprique
(b)

Figure 24 (suite) : Profil chromatographique des composés volatils des feuilles (b).

Au total, 69 composés volatils sont recensés. Ils ont été identifiés par leur indice de
rétention [Jenings 1980, Kondjoyan 1996, Davies 1990], leur spectre de masse [Jennings
1980, McLafferty 1989, Stenhagen 1974, Banque informatisée de l’INRA 1997], et après
comparaison avec les données de la littérature [Kim Ha 1989].

On peut remarquer que, pour chaque échantillon, l’huile volatile est un mélange
complexe de plusieurs composés. La classe la plus représentée est celle des hydrocarbures et
de leurs dérivés (51,5% et 39,2% respectivement pour le bois et les feuilles). On retrouve
beaucoup d’acides gras et d’esters (37,3% et 28,7% au total) avec notamment les acides
nonanoïque, caprique, laurique, myristique et pentadécanoïque. Nous avons aussi, dans cette
classe, des alcanes, des alcools, des aldéhydes et des composés cétoniques.

Les autres classes sont celles des terpénoïdes (17,6% et 46,7% comprenant mono-, di-
et sesquiterpénoïdes), des phénylpropanoïdes rencontrés uniquement dans le bois et des
composés divers (9,1% et 0,7%).

93
Tableau 17 : Composés volatils de bois et de feuilles de L. guineensis
Composés Indice de Bois Feuilles
Rétention % rel. % rel.

Dérivés d’hydrocarbures
a) alcanes, alcools
Undécanol* 1381 - 2,4
Tétradécanol* 1677 - 0,4
Heptadécane 1700 - 0,2
Σ 0,0 Σ 3,0
b) aldéhydes
Heptanal 882 0,2 -
n-octanal 989 0,2 0,2
(E)-2-octènal 1042 0,5 -
Nonanal 1089 1,2 1,3
(E)-2-nonènal 1146 - 0,3
Décanal 1188 1,4 0,8
(E, E)-2,4-nonadiènal 1193 - 0,8
(E)-2-décènal 1249 - 0,5
(E, Z)-2,4-décadiènal 1274 0,4 -
(E, E)-2,4-décadiènal 1294 10,3 0,4
(E)-2-undécènal 1345 - 0,9
Pentadécanal 1698 - 0,3
Σ 14,2 Σ 5,5
c) cétones
(E)-3-nonèn-2-one 1122 - 0,2
Undécan-2-one 1288 - 0,2
Dodécan-2-one 1389 - 0,9
Pentadécan-2-one 1683 - 0,3
Heptadécan-2-one 1887 - 0,4
Σ 0,0 Σ 2,0
d) acides gras et esters
Acide caproïque (hexanoïque) 1008 1,6 -
Acide heptanoïque 1091 0,4 -
Caprilate de méthyle 1175 0,3 -
Acide caprilique (octanoïque) 1183 1,9 -
Acide nonanoïque 1278 4,3 3,8
Acide (E)-non-2-ènoïque 1321 0,8 -
Acide caprique (décanoïque) 1371 5,3 2,7
Acide undécanoïque 1469 1,0 1,0
Laurate de méthyle 1508 - 0,5
Acide laurique (dodécanoïque) 1566 3,3 7,4
Acide tridécanoïque 1668 - 1,0
Acide myristique (tétradécanoïque) 1765 10,0 7,3
Acide pentadécanoïque 1866 5,1 2,1
Palmitate de méthyle 1908 0,9 2,4
Acide (Z)-hexadéc-9-ènoïque 1939 2,4 -
Acide palmitique 1965 - 0,5
Σ 37,3 Σ 28,7
Terpènoïdes
6-méthyl-hept-5-èn-2-one 973 0,3 0,2
1,8-cinéole 1024 0,2 -
(Z)-linalyloxide 1066 0,4 -
(E)-linalyloxide 1079 0,6 0,3
6-méthyl-3,5-heptadièn-2-one* 1085 0,3 -
Linalol 1094 2,9 0,8
α-terpinéol 1181 1,8 0,3
β-cyclocitral 1197 - 0,3
Vitispirane 1270 - 1,2
α-ionone 1408 0,7 4,2
Géranylacétone 1433 2,3 3,4

94
(E)-β-ionone 1466 0,3 2,3
Dihydroactinidiolide 1490 - 0,5
(E, E)-pseudoionone 1563 - 0,3
4-oxo-β-ionone 1635 - 0,7
Cadalène 1662 - 1,2
Hexahydrofarnésylacétone 1836 5,4 28,2
6,10,14-triméthylpentadéc-3-èn-2-one* 1877 - 1,5
Farnésylacétone* 1895 0,4 0,5
Isophytol 1943 2,0 0,3
(E)-phytol 1950 - 0,5
Σ 17,6 Σ 46,7
Phénylpropanoïdes
Estragole 1181 1,8 -
Anisaldéhyde 1221 1,0 -
(E)-cinnamaldéhyde 1239 2,1 -
(E)-anéthole 1267 3,5 -
Anisylacétone 1350 0,2 -
Σ 8,6 Σ 0,0
Composés divers
Naphthalène 1165 4,8 -
Salicylate de méthyle 1174 0,4 -
γ-heptalactone 1324 0,5 -
Triméthyldihydronaphthalène* 1338 - 0,3
Dibenzofurane 1490 0,2 -
Benzoate de benzyle 1730 - 0,4
Muskolactone 1846 3,2 -
Σ 9,1 Σ 0,7

total Σ 86,8 Σ 86,6


69 composés 43 47
*
isomères non déterminés

HE BOIS HE FEUILLES

Divers Divers
Phénylpropanoï de 1%
10%
s Hydrocarbures
10% Hydrocarbures
45%
60%
Terpenoï des
Terpenoï des 54%
20%

Figure 25 : Répartition des différentes classes de constituants des distillats

Ainsi, nous pouvons constater que l’huile volatile du bois diffère significativement de
celle des feuilles. La composition respecte bien les données de la littérature en ce qui concerne
les taux de terpénoïdes et de phénylpropanoïdes en fonction de la partie végétale étudiée
[Engel 1998]. On observe une quantité appréciable de phénylpropanoïdes (8,6%) dans l’huile
volatile de bois, parmi lesquels figurent l’estragole (1,8%), l’anisaldéhyde (1,0%), le
cinnamaldéhyde (2,1%), l’E-anéthole (3,5%) et l’anisylacétone (0,2%). Ceux-ci sont absents
dans le distillat de feuilles.

95
Par contre, le distillat de feuilles est bien plus riche en terpénoïdes (46,7% contre
17,6%). On note un fort taux d’hexahydrofarnésylacétone (28,2%), et la présence de deux
composés à 13 carbones, qui sont des composés rares d’huiles essentielles, le
triméthyldihydronaphthalène (0,3%) et le vitispirane (1,2%).
Ce dernier est un composé important de l’arôme de vanille [Schulte-Elte 1978]. Il a
aussi été identifié dans les composés volatils du jus de raisin, de vin de table et de spiritueux de
vin [Simpson 1977,Tattje 1979].

Pour les calculs, l’analyse est classiquement arrêtée à l’acide palmitique. Cependant,
nous avons pu, après celui-ci, identifier (Rt, SM ) 4 acides gras. Ce sont : l’acide margarique
(C-17), l’acide stéarique (C-18), l’acide oléique (C-18:1) et l’adipate de dioctyle.

II- Discussion

L’analyse des composés volatils de L. guineensis (Leeaceae) a été réalisée car une HE a
été décrite dans une autre espèce de Leea, L. hirta Roxb. La composition de celle-ci n’est pas
connue, par contre, elle aurait une activité tuberculostatique [Gupta 1953].
L’analyse des distillats de feuilles et de bois permet l’identification d’un grand nombre
de composés qui n’ont jamais été décrits dans cette plante, ni même dans la famille. On
remarque toutefois que les acides gras sont les composés majoritaires du bois, contrairement
aux feuilles, où la fraction en terpénoïdes est la plus importante même si on retrouve aussi en
grande quantité ces acides gras.
Par ailleurs, l’identification du vitispirane est un élément important. Ce composé rare,
présent dans les distillats de vin (Vitis vinifera (Vitaceae)) montre une fois de plus la proximité
des deux familles Leeaceae et Vitaceae.

96
α-terpinéol vitispirane

OH

linalol α-ionone

OH

Hexahydrofarnésylacétone E-anéthole
OCH 3

Figure 26 : Quelques exemples de spectres SM obtenus

97
estragol isophytol

OH

OCH3

Géranylacétone E-cinnamaldéhyde

Anisaldéhyde

OCH3

Figure 26 (suite) : Quelques exemples de spectres SM obtenus

98
B- Etude des Terpénoïdes

I- Identification de Terp-1

Ce composé purifié de l’extrait hexanique se présente sous la forme d’une huile


opalescente (20 mg). Sa faible polarité sur CCM et sa coloration violette, après révélation à
l’acide sulfurique et chauffage, laissent penser qu’il s’agit d’un terpénoïde.

Le spectre de masse en DCI indique l’adduit à m/z 314 [M+NH4]+ et l’ion pseudo-
moléculaire à m/z 297 [M+H]+ correspondant à la formule brute C20H40O. Cette formule
indique la présence d’une insaturation ou d’un cycle, DIC de 1 [McLafferty 1980].
Nous observons différents pics identifiables tels que les pics à m/z 296 [M+NH4-H2O]+ et m/z
279 [M-H2O+H]+ qui correspond à la perte d’un hydroxyle par α-clivage. Plusieurs pics sont
caractéristiques d’un squelette de type phytol : m/z 81 (C6H9+), 83 (C6H11+), 97 (C7H13+) et 123
(C9H15+) [Rasool 1991].
Par ailleurs, nous avons un pic m/z 85 (C5H9O+) qui résulte d’un clivage alpha d’un alcène.

L’allure générale du spectre RMN 1H ci-dessous, suggère que le composé est de nature
terpénique.
Me-3 H-16
H-1 Me-15
Me-7
Me-11

H-4

H-2

H-15

Figure 27 : Spectre 1H de Terp-1 (200 MHz, CDCl3)


Nous observons à δ 5,39 (tq, J = 6,9 et 1,2 Hz, 1H), le proton éthylénique H-2
(Tableau 18 p 82). Ce déplacement chimique indique une double liaison trisubstituée. On note
un couplage trans-allylique de 1,2 Hz avec le méthyle déblindé en 3 à 1,65 ppm (sl, 3H) et un

99
couplage vicinal avec H-1 à 4,13 ppm (d, J = 6,9 Hz, 2H) dont le carbone est hydroxylé. Ces
couplages sont confirmés par le spectre COSY. La troisième substitution est un CH2 déblindé à
1,97 ppm (H-4, t, J = 7,4 Hz) qui couple lui-même avec un RCH2.
Nous pouvons donc dessiner le motif suivant :
4
3 CH3
R
OH
H 2
1

On devine vers 1,53 ppm un heptuplet (J = 6,4 Hz, 1H) relatif au proton H-15, qui couple avec
2 méthyles H-16 et Me-15. Parallèlement, ces deux méthyles résonnent sous forme de doublets
caractéristiques à 0,85 ppm (d, J = 6,5 Hz, 6H).
Les méthyles en 7 et en 11 résonnent quant à eux à 0,83 ppm (d, J = 6,3 et 6,2 Hz, 6H).
En outre, la zone à 1,5-1,0 ppm correspond à 20 protons.

Sur le spectre RMN 13C, de nombreux carbones ont le même déplacement chimique.
Nous confirmons la présence d’une double liaison par les carbones à 140,3 ppm (C-3), 123,1
ppm (C-2) et par le carbone déblindé à 39,9 ppm (C-4) qui est en alpha de celle-ci.
La configuration E de la double liaison est confirmée par les valeurs spectrales et la
comparaison faite avec le géraniol (E) et le nérol (Z) [Breitmeier 1990]. Notons que le méthyle
en position 3 est significativement moins déblindé dans l’isomère E, alors que le carbone 4 est
au contraire plus déblindé.

OH

Géraniol Nérol
OH

Carbones Terp-1 Géraniol Nérol


(E) (Z)
C-1 59,5 59,3 58,9
C-4 39,9 39,6 32,0
Me-3 16,2 16,2 17,6

Nous observons aussi, un carbone hydroxylé (56,5 ppm), 3 groupes de méthyles à 22,7, 

19,8   et   16,2   ppm   correspondant   aux   méthyles   C­16   et   Me­15,   Me­7   et   Me­11,   et   Me­3 

respectivement.

Tableau 18 : données RMN de Terp-1 (200/50 MHz, CDCl3) :

100
Position 13
C H 1

δ (ppm), mult, J (Hz)


1 59,5 4,13 (d, 6,9, 2H)
2 123,1 5,39 (tq, 6,9, 1,2, 1H)
3 140,3
4 39,9 1,97 (tl, 7,4, 2H)
5 25,2
6 36,7
7, 11 32,8
8, 10, 12 37,4
9 24,5
13 24,8
14 39,4
15 28,0 1,53 (hept, 6,4, 1H)
16, Me-15 22,7 0,85 (d, 6,5, 6H)
Me-3 16,2 1,65 (sl, 3H)
Me-7, Me-11 19,8 0,83 (d, 6,3, 6H)

Toutes ces données comparées à celles de la littérature [Rasool 1991, Hasan 1991] permettent
d’identifier Terp-1 au E-Phytol :

OH
11 7 1

15

Rappelons par ailleurs, qu’il a été caractérisé dans le distillat des feuilles avec son
homologue l’isophytol.
Il a été isolé pour la première fois en 1907 par Willstätter [Merck Index]. C’est un
diterpène acyclique largement répandu dans le règne végétal qui provient de la décomposition
de la chlorophylle. Il sert à la préparation des vitamines E et K1 [Harborne 1999]. Il est
cependant recensé pour la première fois chez les Leeaceae.

101
II- Identification de Terp-2

Issue de l’extrait hexanique, cette huile incolore, réagit sur CCM comme un dérivé
terpénique (25mg).

Le spectre de masse en mode DCI révèle 2 pics caractéristiques à m/z 411 [M+H]+ et
m/z 428 [M+NH4]+ qui conduisent à une formule brute de C30H50 (6 insaturations ou cycles).
De plus, par clivage alpha-allylique, on identifie différents fragments caractéristiques de la
perte du même motif en C5, à m/z 342 [M-C5H9+H]+, m/z 274 [M-C10H17+H]+, m/z 206 [M-
C15H25+H]+, m/z 138 [M-C20H33+H]+, m/z 70 [M-C25H41+H]+. Ce type de fragmentation est
rencontré dans des structures de type squalène.

PM = 410

m/z 341 m/z 205 m/z 137 m/z 69


m/z 273
Figure 28 : Fragmentation du squalène

L’allure générale du spectre RMN 1H présente 3 régions distinctes (Figure 29, Tableau
19 p 86) :

Figure 29 : Spectre 1H de Terp-2 (200 MHz, CDCl3)

- une zone de protons éthyléniques à 5,10 ppm (m) qui intègre pour 6H,

102
- une zone des CH2 à δ 2,10-1,90 (m) qui intègre pour 20H,
- enfin, une zone pour les méthyles avec, à 1,66 ppm, un singulet large qui correspond aux
méthyles trans en bout de chaîne C-1, C-24, intégrant pour 6H, et à 1,58 ppm un singulet qui
intègre pour 18H correspondant aux méthyles Me-2, -6, -10, -15, -19 et -23.

Sur le spectre 13C (J modulé), on observe 12 signaux qui laissent penser que les motifs
en C5 intramoléculaires sont équivalents (Figure 30, Tableau 19 p 86).

C-5, C-9, C-12C-4, C-21


C-16, C-20 C-13C-8, C-17
C-6, C-19
C-10, C-15

C-2
C-23

Me-6
Me-10
Me-15
Me-19

Me-2
C-1 Me-23
C-3, C-22 C-24
C-7, C-11, C-14, C-18

Figure 30 : Spectre 13C J modulé de Terp-2 (50 MHz, CDCl3)

On distingue :
-trois carbones quaternaires oléfiniques à 135,1, 134,9 et 131,2 ppm
correspondant à C-6, C-10 et C-2 respectivement,
-deux signaux éthyléniques dont un à 124,4 ppm attribuable à C-3 et un à 124,3
ppm relatif à C-7 et C-11,
-quatre CH2 à 39,7 ppm (C-5 et C-9), 28,3 ppm (C-12), 26,8 ppm (C-4) et 26,7
ppm (C-8),
-trois signaux caractéristiques de carbones méthyliques : le premier à 25,7 ppm
correspond aux méthyles trans (C-1 et C-24) en bout de chaîne qui sont les plus déblindés, le
second à 17,7 ppm est attribuable au Me-2 et enfin celui à 16,0 ppm aux Me-6 et Me-10.

103
L’expérience XHCORR permet d’attribuer à partir des protons éthyléniques les
carbones correspondant, et montre également l’existence de deux groupes de méthyles. Le
premier correspondant à C-1 et C-24, le second aux méthyles en -2, -6, -10, -15, -19 et -23.

1.5 ppm

C-6
C-2
C-10
C-23
C-15
C-1 C-19
C-24

2.0 ppm

Figure 31 : XHCORR de Terp-2 (CDCl3)

Avec l’expérience COSY45, on ne peut pas attribuer de manière précise les corrélations
observées du fait de la superposition des signaux. Cependant, des corrélations existent entre
des protons éthyléniques et des CH2. On remarque également un couplage trans-allylique entre
le méthyle en 1 et le proton éthylénique H-3 (4JH1-H3). Comme pour Terp-1, cela confirme la
présence de fragments en C5, et l’enchaînement suivant :

H3C

Tableau 19 : Données RMN de Terp-2 (200/50 MHz, CDCl3) :

104
Position C
13 1
H
1, 24 25,7 CH3 1,66 (s, 6H)
2, 23 131,2 C
3, 22 124,4 CH 5,10 (m)
4, 21 26,8 CH2 2,0-2,1 (nd)
5, 9, 16, 20 39,7 CH2 1,9-2,0 (nd)
6, 19 135,1 C
7, 11, 14, 18 124,3 CH 5,10 (m)
8, 17 26,7 CH2 2,0-2,1 (nd)
10, 15 134,9 C
12, 13 28,3 CH2 1,95-2,05 (nd)
Me-2, 23 17,7 CH3 1,58 (s, 18H)
Me-6, 10, 15, 19 16,0 CH3

Les différents éléments apportés par la RMN confirment les résultats de la


spectrométrie de masse et permettent d’identifier Terp-2 au squalène qui de par son origine
biosynthétique est la répétition d’un même motif isoprénoïde (6 unités). Ces données sont en
accord avec la littérature [Breitmeier 1990] :

19 23

15

6 10

C’est un produit cité pour la première fois dans le genre et l’espèce, alors qu’il est
présent dans tout le règne végétal. Il est le précurseur de tous les triterpènes via son
époxydation, sa cyclisation et son réarrangement [Bruneton 1993]. Isolé en 1926 par Heilbron,
il est utilisé dans la synthèse d’un grand nombre de composés pharmaceutiques [Merck Index].

Notons que le squalène est présent dans l’huile d’olive à 0,1­0,7% [Harborne 1999].

105
III- Identification de Terp-3

Il est isolé sous forme d’aiguilles blanches (10 mg) dans la phase hexanique. Sa
coloration rose puis violette après acide sur CCM laisse penser qu’il s’agit d’un triterpénoïde.

Le spectre de masse en DCI montre l’ion pseudo-moléculaire à m/z 427 [M+H]+


caractéristique de la formule brute C30H50O (6 insaturations ou cycles). Le pic m/z 444
[M+NH4]+ est l’adduit. La présence d’un hydroxyle est signalée par l’observation du pic dû à la
perte d’un hydroxyle par α-clivage m/z 409 [M-H2O+H]+. Puis nous constatons la perte d’un
méthyle grâce au pic à m/z 394 [M-H2O-Me+H]+.
[M+H]+

[M-H2O+H]+

[a-OH+H]+

Figure 32 : Spectre DCI de Terp-3

Par ailleurs, le spectre montre les fragments classiques des squelettes du type lupane
[Shiojima 1992] (Figure 33). Ainsi, le fragment « a » (m/z 207), par perte de l’hydroxyle
conduit au fragment m/z 190 [a-OH+H]+ et le fragment « g » (m/z 218) perd à son tour un
méthyle et donne le fragment « g-15 » à m/z 203. Nous rencontrons aussi la coupure au niveau
du cycle D qui conduit à un fragment à m/z 136 qui perd un proton pour donner un fragment à
m/z 135 qui perd lui-même un méthyle pour donner le fragment à m/z 121.

106
CH2

a
a-OH m/z 207
m/z 190

- Me m/z 121
m/z 394 m/z 409
-Me
-H m/z 135
m/z 136
HO g g-15
m/z 218 m/z 203

Figure 33 : Fragmentations classiques d’un squelette de type lupane

Le spectre RMN 1H rappelle bien un squelette de nature triterpénique avec la


particularité de présenter deux protons d’une double liaison disubstituée qui résonnent à 4,67
ppm (H-29a, dl, J = 2,5 Hz, 1H) et 4,55 ppm (H-29b, dd, J = 2,5 et 1,2 Hz, 1H). Notons que
l’expérience COSY révèle un couplage trans-allylique entre le signal à 4,55 ppm et un méthyle
à 1,66 ppm.
Nous observons un proton en alpha d’un hydroxyle à δ 3,18 (H-3, dm, 10 Hz, 1H), un proton
très déblindé à δ 2,34 (1H, m, H-19) et 7 méthyles dont un à δ 1,66 (Me-30, sl, 3H) déblindé
du fait de la double liaison. Ils sont attribués grâce aux données de la littérature [Reynolds
1986].

13
Le spectre C (J modulé) confirme le squelette triterpénique avec 30 carbones
correspondant à la série des lupanes avec deux carbones éthyléniques caractéristiques à 151,0
ppm (C-20, C) et à 109,3 ppm (C-29, CH), un carbone hydroxylé à 79,0 ppm (C-3 CHOH), 27
signaux entre 14 et 56 ppm correspondant à 6 C, 5 CH, 9 CH2 et 7 CH3 (Tableau 22 p 102).

Ces données spectrales sont comparables avec celles de la littérature [Mahato 1994], et
confirment ainsi les données 1H et SM. Ces résultats nous permettent d’identifier Terp-3 au
lupéol :
29
30 CH2
20
21
19

22

25 26 28

3 27

HO

24 23

C’est un produit nouvellement cité dans le genre qui est très répandu dans le monde végétal. Il
a été isolé la première fois par Cohen en 1909 [Merck Index].

107
IV- Identification de Terp-4

Ce sont des aiguilles blanches (20 mg) isolées de l’extrait hexanique, qui sur CCM
présente toutes les caractéristiques d’un triterpène.

Le spectre DCI montre l’ion pseudo-moléculaire à m/z 427 [M+H]+, qui correspond à
une formule brute de C30H50O (6 insaturations ou cycles). Le fragment à m/z 409 [M-H2O+H]+
indique la perte d’un hydroxyle par α-clivage. De même, nous rencontrons la perte d’un
méthyle à m/z 412 [M-CH3+H]+.
De plus, nous observons les clivages classiques de triterpènes, caractéristiques d’une structure
oléanène [Shiojima 1992] (Figure 34). Il y a cassure de la liaison C-8-C-14. Le C-14 voisin de
la double liaison est alors chargé positivement. Puis il y a clivage allylique entre C-9-C-11. Cela
conduit aux fragments « g’ » à m/z 218 et « a » à m/z 207. La double liaison semble se trouver
en C-12-C-13 du fait de l’important fragment « g’ ».

a-18 a
m/z 189 m/z 217

m/z 409

g' g'-15 g'-29


HO m/z 218 m/z 203 m/z 189

- CH3

m/z 412

Figure 34 : Fragmentations classiques du squelette oléanène

Ce fragment « g’ » perd un groupe méthyle par migration d’un proton et conduit au fragment
« g’-15 » à m/z 203, puis la migration d’un proton entraîne la perte de C-11 d’où le fragment
« g’-29 » à m/z 189. Ce fragment est aussi dû à la perte d’un hydroxyle du fragment « a » d’où
ce même fragment « a-18 » à m/z 189.

108
Me-26
Le spectre RMN 1H suggère également une structure oléanène hydroxylée. Me-25
Me-23

Me-27 Me-29, Me-30


Me-28
Me-24

H-12
H-3

Figure 35 : Spectre 1H de Terp-4 (200 MHz, CDCl3)

En effet, le proton éthylénique à 5,17 ppm (H-12, t, J = 3,6 Hz, 1H) est très
caractéristique ainsi que le proton porté par un carbone hydroxylé à 3,21 ppm (H-3, dd, J =
5,4 et 9,9 Hz, 1H). La présence de 7 signaux de méthyles angulaires est caractérisée par des
singulets entre 1,15 et 0,75 ppm (Tableau ci-dessous).

Tableau 20 : Données RMN 1H des méthyles de Terp-4 (200 MHz, CDCl3)


Protons δ ppm (M, I)
Me-23 0,92 (s, 3H)
Me-24 0,78 (s, 3H)
Me-25 0,95 (s, 3H)
Me-26 0,98 (s, 3H)
Me-27 1,12 (s, 3H)
Me-28 0,82 (s, 3H)
Me-29 0,85 (s, 6H)
Me-30

Le spectre 13C montre 30 carbones répartis dans des zones caractéristiques (Tableau p
102). Notamment nous avons à 145,2 ppm (C-13, C) et 121,7 ppm (C-12, CH) les
déplacements chimiques des carbones éthyléniques qui correspondent à une structure de type
oléan-12-ène, dont le carbone à 79,0 ppm (C-3, CHOH) est β-hydroxylé [Mahato 1994].

109
Tableau 21 : Différences essentielles entre le noyau oléan-12-ène et urs-12-ène
Carbones Oléan-12-ène Urs-12-ène
3β 78,8 78,8
3α 76,4 76,0
12 121,8 124,3
13 145,1 139,3

Toutes ces données spectrales correspondent avec celles de la littérature et nous


permettent d’identifier Terp-4 comme étant la β-amyrine :
30 29

12

25 26 28

3 27

HO

24 23

Bien que très largement répandue, la β-amyrine est citée pour la première fois dans le
genre. Il semble qu’elle ait été isolée pour la première fois en 1835 de Manila elemi
(Burseraceae) par Rose, et redécouverte par Tschirch en 1902 de Amyris elemi (Rutaceae)
[Radt 1940].

V- Identification de Terp-5

Ce composé se présente sous forme de cristaux en feuillets blancs (+1 g). Produit très
apolaire, il est isolé de l’extrait hexanique et présente sur CCM toutes les caractéristiques d’un
triterpéne.

Le spectre de masse en EI montre l’ion moléculaire à m/z 665 [M]+. Cette erreur de 1
uma est due à un problème de décalage en masse qui a été confirmé par le spectre effectué en
FAB mode négatif où l’on obtient bien le fragment m/z 663 pour [M-H]-. De même, le spectre
en DCI montre l’ion pseudo-moléculaire à m/z 665 [M+H]+ et l’adduit à m/z 682 [M+NH4]+.
Ces données sont cohérentes pour une formule brute de C46H80O2 (7 insaturations ou cycles).

110
g’

Palm+
a-18
g’-29

[M]+
[M-Palm] +

Figure 36 : Spectre EI de Terp-5

Nous observons la perte d’un méthyle grâce au fragment à m/z 650 [M-CH3+H]+. Le
fragment à m/z 409 indique la perte de 255 uma correspondant à une chaîne hydrocarbonée en
C16. De plus, nous observons les clivages classiques de la β-amyrine rencontrés précédemment,
qui conduisent aux fragments « g’ » à m/z 218, « a » à m/z 207, « g’-15 » à m/z 203, et enfin
« a-18 » et « g’-29 » à m/z 189.
Notons que l’on observe bien la chaîne aliphatique avec les fragments à m/z 257 et 239
relatifs dans un premier temps à une chaîne palmitoyle qui perd un hydroxyle. De plus, on
distingue les premiers fragments dus aux clivages successifs des liaisons C-C du côté Cterminal de
C2H5+ à C10H41+.

a-18 a
m/z 189 m/z 217

m/z 409

g' g'-15 g'-29


m/z 218 m/z 203 m/z 189
C15H31COO
m/z 256
- CH3
-OH

m/z 650
m/z 239

Figure 37 : Fragmentations de Terp-5


Sur le spectre RMN 1H, nous observons les signaux obtenus pour la β-amyrine avec
entre autres :

111
- le proton éthylénique H-12 à δ 5,16 (t, J = 3,5 Hz),
- le proton en alpha d’un hydroxyle, H-3, à δ 4,49 (dd, J = 7,6 et 8,3 Hz), qui
est plus déblindé que dans la β-amyrine. Ce déblindage est caractéristique d’une
estérification de l’hydroxyle géminal.

Me-16’

Me-27

H-2’

H-12 H-3

Figure 38 : Spectre 1H de Terp-5 (200 MHz, CDCl3)

Par ailleurs, les déplacements chimiques des méthyles sont perturbés par cette chaîne.
Nous avons un méthyle à δ 1,11 (s, Me-27), 2 méthyles à δ 0,95 (sl, Me-25 et Me-24 ou Me-
26), 5 méthyles à δ 0,85 (sl, Me-23, Me-24 ou Me-26, Me-28 , Me-29 et Me-30), et enfin le
méthyle de fin de chaîne du palmitate à δ 0,81 ppm (Me-16’, s, 3H).
La présence de cette chaîne est très bien indiquée par le triplet caractéristique H-2’ en α
de l’ester bien déblindé (δ 2,27, t, J = 7,5 Hz, 2H) par rapport aux autres CH2 (δ 1,1-2,0, m).

En ce qui concerne le spectre 13C, seuls les carbones du cycle A de la β-amyrine sont
perturbés par la chaîne palmitoyle (Tableau 22 p 102). L’estérification est caractérisée par le C-
1’ à 173,5 ppm et le carbone C-3 qui est plus déblindé à 80,6 ppm que dans la β-amyrine.

112
C-12 C-3 C-5

C-16’

C-1’

C-13

Figure 39 : Spectre 13C de Terp-5 (50 MHz, CDCl3)

L’expérience XHCORR a permis de confirmer l’attribution de certains carbones comme


par exemple C-2’ (JC2’-H2’). L’attribution des carbones quaternaires C-4, C-8, C-10, C-13, C-14,
C-17, C-20 et C-1’ est en accord avec l’acétate de β-amyrine [Mahato 1994]. De plus, ces
données de la littérature ont permis également, grâce aux déplacements des carbones
méthyliques, d’attribuer les signaux correspondants sur le spectre 1H, CH3-27 à 1,1 ppm, CH3-
25, CH3-24 ou CH3-26 à 0,95 ppm, CH3-16’ à 0,81 ppm et les autres à 0,85 ppm.

Sur le spectre COSY 1H-1H, nous observons plusieurs systèmes de spins, H1-H2-H3,
H5-H6-H7, H9-H11-H12, H15-H16, H18-H19, H21-H22. Ces corrélations confirment la
structure de l’amyrine. Nous voyons aussi les premières corrélations (H2’-H3’-H4’-...) qui
appartiennent au grand système de spin que constitue le reste palmitoyle.

21

12
18

15
H
3
5
CH3(CH2)12CH2CH2COO
2'

Figure 40 : Corrélations COSY de Terp-5

113
L’hydrolyse alcaline de Terp-5 a conduit à l’obtention de la β-amyrine et de l’acide
palmitique (Annexe p 186) isolés et caractérisés par CCM comparative avec des témoins et les
techniques spectrales RMN, SM.

A la lumière de toutes ces données et par comparaison avec la littérature [Subarnas


1992], nous identifions Terp-5 comme étant le palmitate de β-amyrine.

Ce composé majoritaire de l’extrait hexanique est un produit nouveau dans le genre


bien qu’assez répandu dans le monde végétal. Il est aussi appelé balanophorine car il a été isolé
du Balanophora elongata (Balanophoraceae) par Ultée en 1926. C’est un composé que l’on
rencontre souvent dans les plantes à latex [Radt 1940].

VI- Identification de Terp-6

Ce composé très apolaire est isolé sous forme de poudre blanchâtre (10 mg) de l’extrait
hexanique. Son comportement CCM rappelle les caractéristiques des triterpénes acylés.

Terp-6 présente un maximum d’absorption à λ 236 nm dans le CHCl3. Cette


absorbance est révélatrice d’un système diène conjugué [Tallent 1966].

L’ion pseudo-moléculaire à m/z 705 [M+H]+ et l’adduit à m/z 722 [M+NH4]+ sur le
spectre DCI conduisent à la formule brute C48H80O3 (9 insaturations ou cycles).
Nous rencontrons la perte d’un méthyle à m/z 690 [M-CH3+H]+ ainsi que probablement une
déshydratation suivie d’un réarrangement à m/z 685 relative à un produit hydroxylé. Comme
pour le palmitate de β-amyrine, nous observons les fragments m/z 409, « g’ » à m/z 218, « a »
à m/z 207, « g’-15 » à m/z 203, et enfin « a-18 » et « g’-29 » à m/z 189 qui signent la présence
d’une génine de type oléanène [Shiojima 1992].

114
M-Cor+

[M+H]+

C18H31O3+ [M+NH4]+
g’

Figure 41 : Spectre DCI de Terp-6

Les fragments à m/z 409 et 425 de la génine indiquent bien la perte d’une chaîne en C18.
Cette chaîne est clivée au niveau de sa jonction avec la génine et conduit aux fragments à m/z
295 (C18H31O3+) et 279 (C18H31O2+) par coupure anté ou post-oxygène. L’α-clivage au niveau
des doubles liaisons conduit à deux fragments m/z 167 pour la coupure du côté de la génine et
m/z 71 pour celle du côté C-terminale. Ce dernier fragment à m/z 71 (C5H11+) implique une
position Cterm de type CH3-(CH2)4-CHR’-R. De plus, on observe que les premiers fragments
provenant de clivages successifs des liaisons carbone-carbone du côté Cterminal tels que C2H5+ à
C5H11+.
a-18 a
m/z 189 m/z 207

m/z 409
m/z 279

OH
CH2(CH2)6CO-O
m/z 295 g'
m/z 218
CH3-(CH2)3-CH2

m/z 167 g'-15


m/z = 71 m/z 203

g'-29
m/z 189

Figure 42 : Fragmentations de Terp-6

115
La démarche et l’analyse des spectres 1H et 13C sont identiques à celles du palmitate de
β-amyrine Terp-5. En effet, le spectre 1H a la même allure générale avec, H-12 à 5,16 ppm (t,
J = 3,5 Hz, 1H), H-3 à 4,49 ppm (dd, J = 7,6 et 8,2 Hz, 1H) et H-2’ à 2,27 ppm (t, J = 7,3 Hz,
2H).
Cependant, des signaux supplémentaires sont observés. Ainsi, entre 6,5 ppm et 5,6 ppm
quatre protons éthyléniques révèlent la présence d’un système diénique conjugué sur cette
chaîne latérale.

H-2’

H-11’ H-10’ H-12’ H-9’ H-12 H-3 H-13’

Figure 43 : Spectre 1H de Terp-6 (200 MHz, CDCl3)

H-11’ est le plus déblindé à 6,47 ppm (dd, 3J10’-11’ = 11,2 et 3J11’-12’ = 15,1 Hz, 1H). Ce couplage
vicinal de 15 Hz est relatif à une configuration E [Stadler 1994].
H-10’ résonne à 5,95 ppm (dd, 3J10’-11’ = 11,1 et 3J10’-9’ = 11,4 Hz, 1H). Ce couplage vicinal de
11 Hz est relatif à une configuration Z [Stadler 1994].
H-12’ est à 5,65 ppm (dd, 3J11’-12’ = 15,2 et 3J12’-13’ = 8,2 Hz, 1H),
H-9’ est à 5,48 ppm (dd, 3J9’-10’ = 11,5 et 3J8’-9’ = 7,5 Hz, 1H).

Ces données 1H comparées au E, E coriolate de méthyle [Kann 1990] et au 9-hydroxy-


5(Z),7(E)-tridécadiènoate de méthyle [de Montarby 1988] suggèrent un diène conjugué de
configuration Z, E.

116
H-12

H-3

H-11’ H-10’ H-12’ H-9’ H-11’

Figure 44 : Agrandissement du spectre 1H entre 4,0 et 6,7 ppm de Terp-6 (500 MHz, CDCl3)
(Rem : à 500 MHz, on aperçoit des signaux indiquant que Terp-6 est en mélange avec d’autres composés !)

Parallèlement à ces protons éthyléniques, nous observons un proton à 4,11 ppm (H-13’,
m, 1H) caractéristique d’un proton en alpha d’un hydroxyle. Le spectre COSY révèle un
couplage entre ce dernier proton et un des protons du diène conjugué à δ 5,65 (H-12’) et des
corrélations successives de H-8’ à H-14’, ce qui confirme l’enchaînement suivant :

OH H

H H H

Ce type de fragment est rencontré dans l’acide coriolique [Stadler 1994].

Le spectre COSY permet de mieux visualiser ces différents couplages ainsi que ceux
déjà observés pour les amyrines acylées.

117
H-11’ H-10’ H-12’ H-9’ H-12 H-3 H-13’ H-8 H-11 H-2a H-2b
H-14’

H-13’

H-3

H-12

H-9’
H-12’

H-10’

H-11’

Figure 45 : Agrandissement de la COSY de Terp-6 (200 MHz, CDCl3)

13
En ce qui concerne le spectre C (J modulé), les déplacements chimiques sont
comparables à ceux du dérivé palmitoylé (Tableau 22 p 102). De plus, nous observons les
carbones éthyléniques du système conjugué de configuration Z, E, à 135,8, 133,0, 127,7, et
125,8 ppm ainsi que celui du carbone hydroxylé CHOH (C-13’) à 72,9 ppm. Par comparaison,
les déplacements chimiques des carbones éthyléniques du E, E coriolate de méthyle résonnent
à 135,9, 133,7, 130,9, 129,5 ppm [Kann 1990].
C-13 C-19

C-1’

C-18’
C-13’
C-9’
C-5 C-9
C-18
C-12 C-3
C-12’

Figure 46 : Spectre 13C J modulé de Terp-6 (50 MHz, CDCl3)

118
Carbones
Z, E Z, E E, E
# Terp-6 *
1
H 1
H 13
C 1
H 13
C
9’ 5,41 5,48 125,8 5,68 129,5°
10’ 6,02 5,95 127,7° 6,01 130,9°
11’ 6,46 6,47 133,0° 6,17 133,7°
12’ 5,69 5,65 135,8 5,57 135,9°
13’ 4,16 4,11 72,9 4,11 72,9°
* [Kann 1990] 13-hydroxy-9(E),11(E)-octadecadiènoate de méthyle
# [de Montarby 1988] 9-hydroxy-5(Z),7(E)-tridécadiènoate de méthyle
° interchangeable

Les attributions de la β-amyrine acylée comparées à Terp-5 ainsi que la présence d’une
chaîne de type acide coriolique [Stadler 1994, Kann 1990, de Montarby 1988] nous permettent
d’identifier Terp-6 au coriolate de β-amyrine. Il est, à notre connaissance, isolé pour la
première fois du règne végétal :

30 29

12

25 26 28

1' 3 27
9' COO
Z
13' 23
18' 24
E
11'
OH

VII- Identification de Terp-7

Isolé sous forme de cristaux blancs, ce composé est issu de l’extrait hexanique (6 mg).
Très apolaire sur CCM, il possède un Rf comparable à celui des triterpènes acylés comme
Terp-5 ou Terp-6.

Le spectre de masse en DCI indique l’ion pseudomoléculaire à m/z 665 [M+H]+ qui est
le même que Terp-5, d’où une formule brute de C46H80O2. On retrouve les mêmes fragments
d’un triterpène acylé comme Terp-5 dont le pic à m/z 409 [M-palm+H]+.

119
Le spectre proton ressemble aussi à celui de Terp-5 avec les signaux du proton
éthylénique H-12 à δ 5,11, du proton H-3 à δ 4,48 et le signal caractéristique de la chaîne en
alpha de l’ester avec le CH2 à δ 2,27.

La différence entre Terp-7 et Terp-5 se trouve dans le spectre 13C (Figure 47). En effet,
les carbones de la double liaison C-12 à 124,4 ppm et C-13 à 139,6 ppm sont significatifs d’un
noyau de type urs-12-ène (Tableau 21 p 91) [Mahato 1994]. Après comparaison avec les
données de la littérature, nous pouvons attribuer tous les carbones de la génine, l’α-amyrine
estérifiée et quelques carbones de la chaîne palmitoyle (Tableau 22 p 102).

C-1’
C-13

C-3
C-12

Figure 47 : Spectre 13C J modulé de Terp-7 (50 MHz, CDCl3)

Comparé avec les données de la littérature [Shankaranarayana 1980], Terp-7 est le


palmitate d’α-amyrine. Ce composé est nouvellement recensé chez les Leea. Le palmitate
d’α-amyrine et de β-amyrine sont souvent rencontrés chez les plantes à latex [Radt 1940].

12

3
1'
C15H31CO-O

Tableau 22 : Récapitulatif des données 13C des triterpènes et de leurs esters (50 MHz, CDCl3)

120
Carbones Lupéol β-amyrine Palmitate Coriolate Palmitate
de de d’
δ en ppm β-amyrine β-amyrine α-amyrine
1 38,7 38,6 38,3 38,3 38,5
2 27,5 27,3 23,5 23,5 23,7
3 79,0 79,0 80,6 80,6 80,6
4 38,8 38,8 37,7 37,8 37,8
5 55,4 55,2 55,3 55,3 55,3
6 18,4 18,4 18,3 18,3 18,3
7 34,3 32,7 32,6 32,6 32,9
8 40,8 39,8 39,8 39,8 40,1
9 50,5 47,7 47,6 47,6 47,7
10 37,2 37,0 36,9 36,9 36,8
11 21,0 23,6 23,6 23,6 23,4
12 25,2 121,7 121,7 121,7 124,4
13 38,1 145,2 145,2 145,2 139,8
14 42,8 41,7 41,7 41,7 42,1
15 27,5 26,2 26,2 26,2 29,3
16 35,6 27,0 26,9 27,0 26,6
17 43,0 32,5 32,5 32,5 33,8
18 48,4 47,3 47,3 47,3 59,1
19 47,8 46,9 46,8 46,8 39,6
20 151,0 31,1 31,1 31,1 39,6
21 29,7 34,8 34,8 34,8 31,3
22 40,0 37,2 37,2 37,3 41,6
23 28,0 28,1 28,1 28,1 28,7
24 15,4 15,6 16,8 16,8 16,8
25 16,1 15,6 15,5 15,5 15,7
26 16,0 16,8 16,8 16,8 16,8
27 14,5 26,0 25,9 26,0 23,3
28 18,0 28,4 28,4 28,4 28,1
29 109,3 33,3 33,3 33,3 17,5
30 19,4 23,7 23,7 23,7 21,4
1’ 173,5 173,6 173,6
2’ 34,8 34,8 34,9
3’ 25,2 25,3 25,2
4’ 29,7 29,7
5’
6’
7’
8’
9’ 125,8
10’ 127,7*
11’ 133,0*
12’ 135,8
13’ 29,6 72,9 29,2
14’ 31,9 31,9
15’ 22,7 22,7
16’ 14,1 14,1
17’ 22,6
18’ 14,0
* interchangeable

121
C- Etude des Flavonoïdes

I- Identification de Flav-1

Composé isolé sous forme de laque jaune (36 mg) de l’extrait à l’acétate d’éthyle. Sur
CCM, l’apparence du spot présente toutes les caractéristiques d’un flavonol. En effet, ce
composé est très jaune sous UV à 366 nm, révélateur d’un 3-OH libre [Mabry 1970].

Cela est confirmé par le spectre UV qui indique une absorbance à λmax 365 nm pour la
bande I dans le MeOH (Tableau 28 p 124). De plus, le déplacement bathochromique de la
bande II de 9 nm après l’ajout de NaOAc apporte la preuve d’un hydroxyle libre en 7.
L’hydroxyle libre en 4’ est suggéré par le déplacement bathochromique de la bande I de 50 nm
qui se décompose rapidement suite au système 3,4’-dihydroxylé [Mabry 1970].

L’ion pseudo-moléculaire à m/z 285 [M-H]- sur le spectre de masse en FAB mode
négatif indique une formule brute de C15H10O6 (11 insaturations ou cycles).

Le spectre 1H correspond à deux noyaux aromatiques différents (Tableau 26 p 123). Le


cycle A avec deux protons aromatiques respectivement à 6,18 ppm (H-6, d, J = 1,9, 1H) et
6,43 (H-8, d, J = 2,0, 1H) ppm. La faible constante de couplage est due à un couplage meta
entre ces deux protons. Quant au cycle B, on remarque deux signaux intégrant chacun pour
deux protons identiques à 8,03 ppm (H-2’ et H-6’, dd, J = 8,9 et 2,6 Hz, 2H) et à 6,91 ppm
(H-3’ et H-5’, dd, J = 8,9 et 2,7 Hz). La grande constante est un couplage ortho alors que la
petite correspond à une constante meta. Au-delà de 9 ppm, on observe les protons des
hydroxyles. La liaison hydrogène de OH-5 avec la cétone en 4 entraîne un fort déblindage
caractéristique localiser à 12,46 ppm.

122
H-3’
H-2’ H-5’
H-6’

H-6

OH-5 H-8

OH
OH

OH-7

Figure 48 : Spectre 1H de Flav-1 (200 MHz, DMSO-d6)

Le spectre 13C montre 13 carbones. Ceci est dû à la symétrie du cycle B. Ainsi C-2’ et
C-6’ sont à 129,4 ppm et C-3’ et C-5’ à 115,4 ppm. Les autres CH aromatiques résonnent à
98,1 ppm (C-6) et 93,4 ppm (C-8). Les carbones phénoliques, quaternaires résonnent entre
135 et 165 ppm, la fonction cétonique est à 175,9 ppm (C-4) (Tableau 27 p 123). Ces données
sont en accord avec la littérature [Harborne 1982].

Ainsi, nous pouvons identifier Flav-1 comme étant le kaempferol :


OH
4'

HO O

3
OH
5

OH O

Flavonoïde très courant, isolé la première fois de Delphinium consolida


(Renonculaceae) en 1902, il est déjà connu dans le genre [Umadevi 1991, Bates-Smith 1959].

123
II- Identification de Flav-2

Isolé sous forme de laque jaune (50 mg) de l’extrait à l’acétate d’éthyle, son
comportement chromatographique révèle aussi une structure de type flavonol.

La bande I du spectre UV, à 369 nm, dans le MeOH indique un flavonol polyhydroxylé.
La décomposition rapide après addition de base est révélatrice d’un système
3,3’,4’-trihydroxylé. D’ailleurs, le retour de bande de 30 nm suite à l’ajout d’HCl dans AlCl3
indique bien le système ortho-dihydroxyl en 3’,4’ [Mabry 1970].

Le spectre de masse en FAB montre l’ion pseudo-moléculaire que ce soit en mode


positif à m/z 303 [M+H]+ ou en mode négatif à m/z 301 [M-H]-. Cela correspond à une formule
brute de C15H10O7 (11 insaturations ou cycles).

Cette structure est vérifiée avec les données du spectres RMN 1H où l’on observe 2
protons aromatiques H-6 (δ 6,17, d, J = 1,6 Hz, 1H) couplant avec une constante meta à H-8
(δ 6,40, d, J = 1,7 Hz, 1H) sur le cycle A, ainsi que 3 protons aromatiques sur le cycle B, H-2’
(δ 7,66, d, J = 1,8 Hz, 1H) qui a un couplage meta avec H-6’ (δ 7,53, dd, J = 8,4 et 2 Hz, 1H),
lui-même ayant un couplage ortho avec H-5’ (δ 6,87, d, J = 8,5 Hz, 1H) (Tableau 26 p 123).

124
OH-5

H-6
OH
H-2’ H-5’ H-8
OH

OH-7 OH
H-6’

Figure 49 : Spectre 1H de Flav-2 (200 MHz, DMSO-d6)


C-6’ C-6
C-5’ C-8
C-2’

C-7
C-3
C-5 C-4’
C-3’

C-1’
C-2
C-4
C-9
C-10

Figure 50 : Spectre 13C de Flav-2 (50 MHz, DMSO-d6)

125
Tout comme Flav-1, le spectre 13C de Flav-2 est en accord avec la littérature [Harborne
1982, Agrawal 1989], et confirme la structure quercétine.

OH

3'
OH

HO O

3
OH
5

OH O

Flavonol très commun, la quercétine est déjà connue dans le genre [Umadevi 1991,
Bates-Smith 1959].

III- Identification de Flav-3

Issu de l’extrait à l’acétate d’éthyle sous forme de laque jaune (20 mg), son
comportement chromatographique laisse supposer un flavonoïde glycosylé. La fluorescence
sous UV à 366 nm en violet sombre suggère une position 3 substituée [Mabry 1970].

Le spectre de masse en DCI indique l’ion pseudo-moléculaire à m/z 449 [M+H]+. Ce


pic, que l’on retrouve en FAB– à m/z 447 [M-H]– (ou FAB+ à m/z 449 [M+H]+) correspond à
un PM de 448, pour une formule brute de C21H20O11 (12 insaturations ou cycles). Après perte
d’un désoxyhexose, on obtient le fragment de la génine correspondante c’est-à-dire la
quercétine à m/z 303 [M-146+H]+. En DCI, on observe également le pic à m/z 146 relatif au
désoxyhexosyl et à son adduit à m/z 164 [M-H2O+NH4]+.

L’analyse des spectres UV conduit à un flavonol tétrahydroxylé (Tableau 28 p 124). La


bande I à λMeOH = 347,5 nm confirme la fixation d’un glycosyl en position 3. Les différences
d’absorbance entre MeOH/NaOAc+H3BO3 et AlCl3/AlCl3+HCl certifient la présence du
système 3’,4’-dihydroxylé [Mabry 1970].

Sur le spectre 1H dans le DMSO-d6, on retrouve les données spectrales relatives à la


quercétine où l’on observe cependant que le proton H-2’ (δ 7,29 ppm, d, J = 1,9 Hz, 1H) est

126
moins déblindé et se retrouve plus proche de H-6’ (δ 7,24 ppm, dd, J = 8,4 et 2,2 Hz, 1H)
(Tableau 26 p 123).
OH-7 Rha-6

OH-5

H-2’ H-8
H-6’ H-6

OH
H-5’ Rha-1 Rha-4 Rha-5
OH

Rha-3

Rha-2

Figure 51 : Spectre 1H de Flav-3 (200 MHz, DMSO-d6)

Cette perturbation est due à la fixation en 3 d’un glycosyle et, comme attendu, nous
n’observons plus le proton de l’hydroxyle en 3. Cette unité osidique est confirmée par son
proton anomérique à 5,24 ppm (Rha-1, d, J = 1,1 Hz, 1H), les protons osidiques entre 4 et 3
ppm et un méthyle doublet à 0,81 ppm (Rha-6, d, J = 5,5 Hz, 3H). Les différentes constantes
de couplage indiquent qu’il s’agit de l’α-rhamnose (Tableau 26 p 123).

13
Le spectre C confirme, avec ses 21 carbones, le rhamnose et la présence de la
quercétine comme génine (Tableau 27 p 123). Les carbones C-2 et C-4 en alpha du C-3 sont
plus déblindés que pour la quercétine, alors que ce dernier est plus blindé, indiquent la fixation
en 3 du rhamnose sur une génine de type quercétine.

127
C-3’ C-2’ Rha-2
C-5’
C-4’ Rha-3
Rha-5
C-5
Rha-1
C-6’ C-8 Rha-4
C-7 C-1’
C-2 C-3
C-6
C-10 Rha-6
C-4
C-9

Figure 52 : Spectre 13C de Flav-3 (50 MHz, DMSO-d6)

Ces données spectrales sont en accord avec la littérature [Harborne 1982] et nous
permette d’identifier Flav-3 comme étant la quercitrine :
OH

3'
OH

HO O

O
5

OH O 1''
OH
OH
O
OH
CH3
6''

Ce composé est nouveau dans le genre bien que très répandu dans le règne végétal.
C’est le deuxième flavonol glycosylé isolé des Leea après son homologue la myricitrine ou 3-
O-rhamnosyl-myricétine [Yem Yok Siv 1971]

IV- Identification de Flav-4

Plus polaire que Flav-3, ce composé isolé des extraits à l’acétate d’éthyle, et
butanolique a été isolé sous forme de laque jaune (30 mg). Le spot de Flav-4 sur CCM a

128
tendance à « traîner ». Il est aussi violet foncé sous UV à 366 nm, ce qui est significatif d’une
substitution en 3.

Le spectre de masse haute résolution enregistré avec la technique FAB– sur le pic
pseudo-moléculaire à m/z 527 [M-H]– a permis de déterminer la formule moléculaire comme
étant C21H20O14S. Le fragment à m/z 447 correspond à la perte d’un groupe sulfate alors que le
pic à m/z 300 indique les pertes d’un groupe sulfate et d’une unité desoxyhexosyl (Tableau 29
p 124). Il est bien établi qu’en technique FAB négative, nous observons ces fragmentations
typiques des flavonoïdes sulfatés [Barron 1988a].

[M-SO3-Rha-H]-

[M-H]-

[M-SO3-H]-

Figure 53 : Spectre FAB- de Flav-4

L’analyse   des   spectres   UV   de   ce   flavonoïde   conduit   à   un   flavonol   substitué   en   3 

[Mabry 1970] (Tableau 28 p 124). L’addition d’HCl entraîne un déplacement bathochromique 

de   13   nm   de   la   bande   I   révélateur   d’une   position   3’­O­substituée   par   un   groupe   sulfate 

[Barron 1988a, 1988b].
Par ailleurs, le fort effet bathochrome de 50 nm sur la bande I avec la base NaOMe indique
clairement que l’hydroxyle en 4’ est libre. L’ajout de H3BO3 après NaOAc ne change rien et
montre que la position 3’ est bien substituée [Mabry 1970].

129
Sur le spectre RMN 1H on observe les 5 protons aromatiques relatifs au flavonol
tétrasubstitué entre 6 et 8 ppm, ainsi que les protons osidiques de 5,2 à 0,81 ppm avec, entre
autres le proton anomérique Rha-1 à δ 5,2 et le groupe méthyle sous forme de doublet à δ 0,80
caractéristiques d’un α-rhamnopyranosyl (Tableau 26 p 123). Ceci est confirmé par
l’expérience COSY qui attribue totalement les protons osidiques.

Rha-6

Rha-4
H-5’ H-8 Rha-3 Rha-5
H-2’ Rha-1
H-6
OH-5
H-6’
Rha-2

OH-7 OH-4’

Figure 54 : Spectre 1H de Flav-4 (200 MHz, DMSO-d6)

La présence du sulfate en 3’ influence les protons en ortho et meta, qui sont plus
déblindés que dans la quercitrine. Notons qu’il y a aussi absence du signal du OH-3’ et que, par
rapport à la quercitrine (Flav-3), les protons aromatiques du cycle A et les protons osidiques ne
sont pas influencés.

D’ailleurs, les déplacements chimiques en 13C des 6 carbones osidiques sont en accord
avec ceux de Flav-3 : 1 carbone anomérique à δ 102,0, 4 carbones osidiques entre δ 71,4 et
70,1 et le méthyle à δ 17,4. Les 15 autres carbones sont comparables à ceux de la génine, avec
pour seules différences significatives, les déplacements chimiques des carbones du noyau B
(Tableau 27 p 123).

130
Rha-2
C-7
C-2’ Rha-3 Rha-5
C-5
C-1’ C-8
C-4’
C-6’ Rha-1
C-5’ Rha-6
C-3’
Rha-4
C-6
C-2
C-4
C-9 C-3

C-10

Figure 55 : Spectre 13C de Flav-4 (DMSO-d6, 50 MHz)

Ces variations sont connues, et sont attribuées à la présence du groupe sulfate qui
provoque un blindage du carbone qui le porte (C-3’) et un déblindage des carbones ortho (C-2’
et C-4’). Cet effet étant moindre pour les carbones en meta (C-1’ et C-5’) [Barron 1986,
1987a et 1988a].

Tableau 23 : Effet de la sulfatation en 3’


Carbones cycle B ∆ = δQuercitrine -δQuercitrine-3’-sulfate
1’ -2,3
2’ -5,4
3’ +4,4
4’ -3,3
5’ -1,2
6’ -4,6

Les expériences RMN bidimensionnelles confirment les attributions des spectres 1H et


13
C. Ainsi, l’expérience XHCORR permet d’identifier tous les carbones porteurs de protons.

131
Rha-6

Rha-4, Rha-5

Rha-3
Rha-2

Rha-1

H-6-C-6
H-8-C-8
H-5’-C-5’

H-6’-C-6’
H-2’-C-2’

Figure 56 : Spectre XHCORR de Flav-4 (50 MHz, CD3OD)

L’expérience COLOC quant à elle avec ces couplages longues distances à travers 2 ou
3 liaisons, confirme l’attribution des carbones protonés et des carbones quaternaires,
« noyaute » la structure, et surtout, précise la fixation d’un rhamnopyranosyl en position 3 par
la tache de corrélation 3JH-1’’-C-3.

L’expérience COSY comme nous l’avons dit, présente les trois systèmes de spins bien
distincts de la molécule.

132
H-2’ H-6’ H-5’ H-8 H-6 Rha-1 Rha-2 Rha-3 Rha-4 Rha-6
Rha-5

Rha-6

Rha-4
Rha-5
Rha-3
Rha-2

Rha-1

H-6
H-8

H-5’
H-6’
H-2’

Figure 57 : Spectre COSY de Flav-4 (200 MHz, CD3OD)

La comparaison faite avec la quercétine 3-O-glucosyl-3’-sulfate [Sebra 1988] et la


quercétine 3’-sulfate [Sebra 1991], toutes deux isolées chez Hypericum elodes (Guttiferae),
confirme cette sulfatation en 3’ et permet de caractériser Flav-4 comme étant la quercitrine
3’-sulfate :
OSO3-

3'
OH

HO O

O
5

OH O 1''
OH
OH
O
OH
CH3
6''

Ce composé est isolé pour la première fois du règne végétal. C’est aussi la première
fois que l’on rencontre des flavonoïdes sulfatés dans la famille des Leeaceae [Op de Beck
1998].

133
V- Identification de Flav-5

C’est une laque jaune (20 mg) isolée de l’extrait butanolique et retrouvée également
dans l’extrait aqueux. Produit très polaire, il montre sur CCM toutes les caractéristiques d’un
flavonoïde sulfaté. Il « traîne » sur CCM et semble sous UV être substitué en 3.

De par le pic pseudo-moléculaire en FAB–, à m/z 461 [M-H]–, et comparativement aux


spectres obtenus pour le premier flavonoïde sulfaté isolé (Flav-4), nous pouvons envisager la
formule brute C15H10O13S2. La présence des deux atomes de soufre est suggérée par deux
groupes sulfates qui, génèrent successivement les deux pics à m/z 381 [M-SO3-H]– et m/z 301
[M-2SO3-H]– (Tableau 29 p 124).

[M-SO3-H]-

[M-2SO3-H]-

[M-SO3+Na-2H]-

[M+Na-2H]-

[M-H]-

Figure 58 : Spectre FAB- de Flav-5

Cette filiation est confirmer par une expérience SM/SM où l’on observe la cascade de
désulfatation successive.

Pour les spectres UV, l’addition des différents réactifs et l’analyse des résultats obtenus
permettent de conclure à un flavonol tétrasubstitué [Mabry 1970] (Tableau 28 p 124). Le
déplacement bathochromique de 7 nm par l’ajout d’une base faible (NaOAc) montre bien que
l’hydroxyle en 7 est libre, alors qu’après l’addition d’une base forte (NaOMe) le déplacement

134
bathochromique de 56 nm indique que l’hydroxyle en 4’ est libre [Mabry 1970]. L’ajout d’HCl
conduit à un déplacement bathochromique de 27 nm, significatif d’une substitution en 3 et 3’
par des groupements sulfates [Barron 1987b, 1988b].

Sur le spectre RMN 1H, les 5 protons aromatiques du noyau quercétine sont visibles
(Tableau 26 p 123). Les protons H-6 et H-8 ont bien le même déplacement chimique que ceux
de la quercétine alors que H-2’ et H-6’ sont déblindés. Cela est dû à la présence des groupes
sulfates.

H-5’
H-8 H-6

H-6’

H-2’

Figure 59 : Spectre 1H de Flav-5 (200 MHz, DMSO-d6)

De même, sur le spectre 13C, les 15 carbones du noyau quercétine sont identifiables,
avec, comme pour Flav-4, des variations provoquées par les groupements sulfates en 3 et 3’.

135
C-1’
C-5’ C-8
C-6

C-3’
C-6’
C-5

C-7 C-9
C-2’
C-4 C-2
C-4’ C-10
C-3

Figure 60 : Spectre 13C de Flav-5 (50 MHz, DMSO-d6)

Tableau 24 : Effet de la sulfatation en 3,3’


Carbones cycle B ∆ = δQuercétine -δQuercétine-3.3’-disulfate
2 -9,0
3 +6,1
4 -1,8
10 -1,2
1’ -1,1
2’ -6,7
3’ +4,5
4’ -4,0
5’ -1,3
6’ -7,0

Ces différentes données spectrales, sont identiques à celle de la quercétine 3,3’-disulfate


isolée en mélange avec de la patulétine 3,3’-disulfate chez Flaveria chloraefolia (Compositae)
[Barron 1987b], et permettent d’identifier Flav-5 à la quercétine-3,3’-disulfate :
OSO3-

3' OH

HO O

3 OSO3-
5

OH O

Ce composé rare est isolé pour la deuxième fois du règne végétal, puisque déjà isolé de
Flaveria chloraefolia (Compositae) [Barron 1987b].

136
VI- Identification de Flav-6

Ce composé a été isolé sous forme d’une laque jaune (6 mg) à partir des extraits
butanolique et aqueux. Tout comme Flav-5, il s’agit d’un flavonol polysulfaté, celui-ci étant
plus polaire.

Le pic pseudo-moléculaire en FAB– à m/z 541 [M-H]– conduit à la formule brute


C15H10O16S3. Comme précédemment les trois groupes sulfates sont perdus successivement
produisant les trois pics caractéristiques à m/z 461 [M-SO3-H]–, 381 [M-2SO3-H]– et 301 [M-
3SO3-H]– (Tableau 29 p 124). Cette filiation a été également validée par un couplage SM/SM.

[M-3SO3-H]-

[M+2Na-3H]-

[M-2SO3-H]- [M-SO3+K-2H]-

[M+Na-2H]-

[M+2K-4H]-
[M-H] -

[M-SO3-H]- [M+3K-4H]-

Figure 61 : Spectre FAB- de Flav-6

Outre le fait que l’analyse des spectres UV de ce flavonoïde conduise à un flavonol


tétrasubstitué [Mabry 1970], et que le déplacement bathochromique de 7 nm après addition de
NaOAc montre bien que l’hydroxyle en 7 est libre, c’est la vérification de la trisulfatation qui
est prépondérante (Tableau 28 p 124). En effet, l’ajout d’HCl conduit à un fort déplacement
bathochromique de 57 nm, celui-ci est caractéristique d’une 3,3’,4’-trisulfatation [Barron
1988b].
Le spectre 1H montre aussi les 5 protons aromatiques de la quercétine. Les protons H-6
et H-8 ont sensiblement le même déplacement chimique que pour la quercétine alors que les

137
protons du noyau B (H-2’, H-5’ et H-6’) sont fortement déblindés par la présence des groupes
sulfates tout comme Flav-5 (Tableau 26 p 123).

H-6
H-8
H-2’ H-5’

H-6’

Figure 62 : Spectre 1H de Flav-6 (200 MHz, DMSO-d6)

Sur le spectre 13C, les 15 carbones du noyau quercétine sont identifiables (Tableau 27 p
123). Là aussi, les variations sont dues aux trois groupes sulfates en 3, 3’ et 4’, groupements
électroattracteurs.

Tableau 25 : Effet de la sulfatation en 3,3’,4’


Carbones cycle B ∆ = δQuercétine -δQuercétine-3.3’, 4’-trisulfate
2 -0,8
3 +6,5
4 -1,8
10 -0,1
1’ -1,6
2’ -3,6
3’ +3,3
4’ +2,5
5’ -1,9
6’ -2,6

138
C-5
C-1’ C-2’
C-7 C-9
C-4’ C-5’
C-3’ C-6
C-10 C-8
C-6’
C-4 C-2
C-3

Figure 63 : Spectre 13C de Flav-6 (100 MHz, DMSO-d6)

Ce composé, comparé à la rhamnétine 3,3’,4’-trisulfate issu de la synthèse chimique


[Barron 1988c], a permis d’identifier Flav-6 comme étant la quercétine 3,3’,4’-trisulfate :
OSO3-

3'
OSO3-

HO O

3 OSO3-
5

OH O

Ce composé est isolé pour la première fois du règne végétal. Il est le troisième
flavonoïde sulfaté isolé chez Leea.

VII- Identification de Flav-7

Ce composé a été isolé sous forme d’une laque jaune (3 mg) à partir de l’extrait
dichlorométhane. Son comportement chromatographique rappelle un flavonol glycosylé
comme Flav-3.

Le spectre de masse en DCI confirme cette hypothèse. Nous avons en effet en plus du
pic pseudomoléculaire à m/z 479 [M+H]+, un fragment dû à une perte d’un groupement
desoxyhexosyl à m/z 333 [M-146+H]+. Ce glycosyl est aussi mis en évidence par le pic à m/z
164 [Rha-H2O+NH4]+.

139
L’analyse des spectres UV confirme le squelette de type flavonol hexahydroxylé
(Tableau 28 p 124). La bande I à λMeOH à 337 nm confirme comme pour Flav-3, la fixation du
glycosyl en position 3. Mais contrairement à celui-ci, l’ajout de base indique que l’hydroxyle en
4’ n’est pas libre. De plus, l’ajout de H3BO3 à NaOAc ne modifie pas le spectre et montre que
nous n’avons pas de système ortho-dihydroxyl sur le cycle B [Mabry 1970].

Le spectre RMN 1H dans le DMSO-d6 est comparable une nouvelle fois à Flav-3 avec
en plus, un méthoxy à 3,72 ppm (s, 3H, 4’-OMe). Les deux protons du cycle A à δ 6,20 (H-6,
d, J=2 Hz) et δ 6,37 (H-8, d, J=2 Hz) sont identiques à ceux de Flav-3 (Tableau 26 p 123).
Seuls changent les protons du cycle C. L’apparition du singulet à δ 6,82 (H-2’ et H-6’, 2H)
montre la symétrie du cycle B et donc la fixation du méthoxy en position 4’. Notons qu’un
méthoxy fixé en 3’ entraîne deux signaux bien distincts pour H-2’ et H-6’ comme dans la
larycitrine par exemple [Hoffmann-Bohm 1992]. Le proton anomérique à 5,13 ppm (Rha-1, d,
J=1,5 Hz, 1H), les protons osidiques entre 4,1-3,0 ppm et un méthyl doublet à 0,79 (d, J=5,4
Hz, 3H) sont comparables à ceux de Flav-3 et appartiennent à l’α-rhamnose.

H-2’ 4’-OMe
H-6’

Rha-3
Rha-4
OH-3’ Rha-5
OH-5’

H-8 H-6 Rha-2 Rha-6


OH-5
Rha-1

Figure 64 : Spectre 1H de Flav-7 (300 MHz, DMSO-d6)

OH-5 140
Le spectre 13C obtenu dans CD3OD permet d’attribuer notre produit à une génine myricétine
qui a, en position 3, la fixation d’un rhamnose et en position 4’, la présence d’un méthoxy à δ
60,9 ppm [Noreen 1998] (Tableau 27 p 123). Ce déplacement est significatif d’une fixation en
4’ [Agrawal 1989], alors qu’une fixation en 3’ comme pour la larycitrine, aurait entraîné un
signal plus blindé vers 56 ppm [Guo 1998].

Nos données spectrales sont comparables avec celles de la littérature (UV [Gabetta
1973, Jay 1978], RMN 1H [Hoffmann-Bohm 1992], RMN 13C [Noreen 1998]) aussi, nous
pouvons conclure à l’identification de Flav-7 à la méarnsitrine ou 4’-méthoxy-myricétrine.
OH

OMe
4'

HO O
OH

3
O

OH O
OH
OH
O
OH
CH3

Ce flavonol glycosylé et méthoxylé est rare dans le monde végétal, et est nouvellement

identifié dans la famille Leeaceae. Il a été isolé la première fois de chez  Acacia mearnsii 

(Fabaceae) [Mackenzie 1969].

141
Tableau 26 : RMN 1H des flavonoïdes (200 MHz, DMSO-d6)
Protons Kaempferol Quercétine Quercitrine Méarnsitrine Quercitrine Quercétine Quercétine
-3’-sulfate -3,3’-disulfate -3,3’,4’-trisulfate
H-6 6,18 6,17 6,20 6,20 6,20 6,16 6,16
d (1,9) d (1,6) d (2,0) d (2,0) d (2,1) d (2,1) d (2,0)
H-8 6,43 6,40 6,38 6,37 6,39 6,39 6,33
d (2,0) d (1,7) d (2,0) d (2,1) d (2,0) d (2,1) d (2,0)
H-2’ 8,03 7,66 7,29 6,82 7,76 7,85 8,12
dd (2,6, 8,9) d (1,8) d (1,9) s d (2,0) d (2,1) d (2,2)
H-3’ 6,91
dd (2,7, 8,9)
H-5’ 6,9 6,87 6,86 6,96 6,87 7,59
dd (2,7, 8,9) d (8,5) d (8,3) d (8,1) d (8,7) d (8,9)
H-6’ 8,03 7,53 7,24 6,82 7,52 8,04 8,03
dd (2,6, 8,9) dd (8.4, 2,0) dd (2,2, 8,4) s dd (2,3, 8,5) dd (2,3, 8,6) dd (2,2, 8,9)
OH-3 10,06 9,55
OH-5 12,46 12,46 12,64 12,56 12,59
OH-7 10,73 10,76 10,83 10,83
OH-3’ 9,26 9,29 9,46
OH-4’ 9,33 9,30 9,66 9,62
Rha-1 5,24 5,13 5,20
d (1,1) d (1,5) sl
Rha-2 3,96 3,98 3,98
sl sl sl
Rha-3 3,50 3,5-3,0 3,55
dd (3,1, 8,6) nd m
Rha-4 3,29-3,21 3,5-3,0 3,1
nd nd nd
Rha-5 3,21-3,08 3,5-3,0 3,0-3,3
nd nd nd
Rha-6 0,81 0,79 0,80
d (5,5) d (5,4) d (5,7)
4’-OMe 3,72
s

Tableau 27 : RMN 13C des flavonoïdes (50 MHz, DMSO-d6)


Carbones Kaempferol Quercétine Quercitrine Méarnsitrine Quercitrine Quercétine Quercétine
* -3’-sulfate -3,3’-disulfate -3,3’,4’-trisulfate
2 146,8 146,7 156,4 160,0 156,4 155,7 147,5
3 135,6 138,6 134,2 136,7 134,5 132,5 132,1
4 175,9 175,8 177,7 179,6 177,6 177,6 177,6
5 160,7 160,7 161,2 nd 156,7 161,2 160,2
6 98,1 98,1 98,6 100,0 98,7 98,4 97,3
7 163,8 163,6 164,1 166,2 164,2 163,9 162,8
8 93,4 93,3 93,6 94,9 93,6 93,3 92,0
9 156,1 156,1 157,2 158,7 161,2 156,0 154,8
10 103,0 102,9 104,0 nd 104,1 104,1 103,0
1’ 121,6 121,9 120,7 127,1 123,0 123,0 123,5
2’ 129,4 114,9 115,4 109,8 120,8 121,6 118,5
3’ 115,4 145,0 145,1 151,9 140,7 140,5 141,7
4’ 159,1 147,8 148,4 139,4 151,7 151,8 145,3
5’ 115,4 115,5 115,8 151,9 117,0 116,8 117,4
6’ 129,4 119,9 121,0 109,8 125,6 126,9 122,5
Rha-1 101,8 103,7 102,0
Rha-2 70,3 71,9° 70,1
Rha-3 70,5 72,1° 70,6
Rha-4 71,1 73,3 71,4
Rha-5 70,0 72,1° 70,1
Rha-6 17,4 17,8 17,4
4’-OMe 60,9
* dans CD3OD, ° interchangeable

142
Tableau 28 : UV des flavonoïdes avec λmax dans MeOH
Flavonols bande MeOH +NaOAc +NaOAc +NaOMe +AlCl3 +AlCl3 +HCl
+H3BO3 +HCl
Kaempferol II 265 274 269 278 268 268,5 -
I 365 302,5, 389 375 415 352, 427 350,5, 427
déc
Quercétine II 255 267,5 259 252 271 268
I 369 322,5, 389,5 386 325 339, 456 365, 429
déc déc
Quercitrine II 255 270,5 259,5 269,5 273,5 270 255
I 347,5 369 365 388,5 383, 429,5 399,5 350
Méarnsitrine II 263 271,5 264 272 272,5 273
I 337,5 360 330 361 300s, 337, 391 338,5, 389
Quercitrine II 265 268 269 272 273 274 256
-3’-sulfate I 342 344 342 324, 392 357, 395 341, 389,5 355
Quercétine II 268 275 268 275 276 277 255
-3,3’-disulfate I 342 307s, 387 349 328s, 398 308s, 364, 396s 349, 395s 369
Quercétine II 268 275 268 276 279 277 325
-3,3’,4’-trisulfate I 311 356 313 360 307s, 389 337 368
déc=décomposition

Tableau 29 : SM des flavonoïdes en FAB (mode négatif, matrice glycérol)


Composés Kaempferol Quercétine Quercitrine Quercitrine Quercétine Quercétine
Fragments -3’-sulfate -3,3’-disulfate -3,3’,4’-trisulfate
[M-H]– 285 301 447 527 461 541

[M-SO3-H]– 447 381 461


[M-2SO3-H]– 301 381
[M-3SO3-H]– 301

[M+K-2H]– 499
[M+2K-3H]– 617
[M+3K-4H]– 655

[M+Na-2H]– 483 563


[M+2Na-3H]– 585

[M-Rha-H]– 301
[M-SO3-Rha-H]– 300

[M-SO3+K-2H]– 499
[M-SO3+Na-2H]– 403

143
C- Etude de composés divers

I- Identification de Ac Ph-1

Ce composé a été isolé dans l’extrait à l’acétate d’éthyle sous forme d’aiguilles
blanches. Sur CCM, après pulvérisation à l’acide, il développe une coloration bleue qui vire au
violet.

En DCI, l’adduit à m/z 188 [M+NH4]+ et le pic pseudo-moléculaire à m/z 171 [M+H]+
permettent de déduire un PM de 170 et par conséquent une formule brute de C7H6O5 (5
insaturations ou cycles). On retrouve aussi un pic dû la perte d’un hydroxyle à m/z 153 [M-
H2O+H].

Les absorbances UV à λ 271,5 et 215 nm sont significatives de l’acide gallique


[Ribéreau-Gayon 1968].

Le spectre 1H révèle un seul singulet aromatique à 7,05 ppm (H-2 et H-5, s), révélateur
de la symétrie de la molécule.

Cette même symétrie entraîne sur le spectre 13C, l’apparition de 5 carbones seulement,
dont la fonction acide libre à δ 170,4 (C-1’) et 4 carbones aromatiques à δ 146,4 (C-3 et C-5),
δ 139,6 (C-4), à δ 122,0 (C-1, Q) et à δ 110,3 (C-2 et C-6, 2 CH).
C-2
C-6

C-3
C-5

C-1’
C-1
C-4

Figure 65 : Spectre 13C de AC Ph-1 (50 MHz, CD3OD)

144
Ces données sont en accord avec la littérature [Aldrich 1993], et nous permettent
d’identifier Ac Ph-1 à l’acide gallique :
1'
COOH

HO OH
4

OH

Composé très courant, il est déjà répertorié dans le genre [Umadevi 1991, Bates-Smith
1959, Yem Yok Siv 1971, Hegnauer 1990].

II- Identification de Ac Ph-2

Isolé de l’extrait au dichlorométhane, sous forme d’aiguilles brunâtres, ce composé


réagit sur CCM comme Ac Ph-1 tout en étant moins polaire.

La formule brute de C9H10O5 est suggérée par l’ion moléculaire à m/z 198 [M]+ en EI
(5 insaturations ou cycles). Le pic à m/z 170 est obtenu après la perte d’un radical éthoxy
(C2H5+). Celui à m/z 153 correspond à la perte du groupe ester COOEt.

Les absorbances UV à λ 273,5 et 215,5 nm rappellent celles rencontrées pour l’acide


gallique.

Par ailleurs, en plus du singulet aromatique caractéristique à δ 7,01 (H-2 et H-6, s, 2H),
on retrouve sur le spectre 1H, le système classique d’un groupe éthoxy : un quadruplet à δ 4,24
(H-2’, q, J = 7 Hz, 2H) et un triplet à δ 1,31 (H-3’, t, J = 7 Hz, 3H).

145
H-2
H-6
H-3’

H-2’

Figure 66 : Spectre 1H de Ac Ph-2 (200 MHz, CD3OD)

13
Sur le spectre C, hormis les signaux phénoliques du gallate (Tableau 30), nous
n’observons plus de fonction acide libre (170 ppm), mais plutôt un carbone caractéristique
d’une fonction ester à δ 168,6 (C-1’) et les deux carbones de la chaîne éthoxy à δ 61,7 (C-2’)
et δ 14,6 (C-3’).

Ces données confirment que Ac Ph-2 est le gallate d’éthyle :


1'
COOCH2CH3

HO OH
4

OH

Ce composé est nouveau dans le genre.

Tableau 30 : Données RMN des acides phénols (200/50 MHz, CD3OD)


Positions Acide gallique Gallate d’éthyle
Carbones Protons Carbones Protons
δ ppm δ ppm δ ppm δ ppm
1 122,0 121,8
2, 6 110,3 7,05, s 110,0 7,01, s
3, 5 146,4 146,5
4, 139,6 139,7
1’ 170,4 168,6
2’ 61,7 4,24, q J = 7 Hz
3’ 14,6 1,31, t, J = 7 Hz

146
III- Identification de AG-1

Isolé sous forme d’huile blanche (50 mg), AG-1 est issu de l’extrait au
dichlorométhane.

Le spectre EI présente le pic moléculaire à m/z 256 [M]+ confirmant la formule brute
C16H32O2 (1 insaturation ou cycle). On observe une cascade de coupures radicalaires dues à des
pertes successives de 14 uma correspondant à un CH2 comme C3H7+, C4H9+, C5H11+, etc. Cela
confirme par ailleurs la structure linéaire d’une chaîne grasse [McLafferty 1980].

[M]+

Figure 67 : Spectre EI de AG-1

Cette chaîne est de nouveau mise en évidence par l’allure générale du spectre 1H, où
seuls les protons en alpha de la fonction acide à δ 2,33 (H-2, t, J = 7,3 Hz, 2H) sont bien
distincts. Puis le groupe des CH2 et le méthyle de fin de chaîne sont observés respectivement
entre 1,7-1,0 ppm et à δ 0,86 (H-16, t, J = 7 Hz, 3H).

147
Cette chaîne aliphatique entraîne une mauvaise résolution du spectre 13C, où les signaux
de la plupart des carbones se trouvent concentrés entre 29,7 et 29,1 ppm. Néanmoins, le
carbone quaternaire de la fonction acide résonne à δ 175,6 (C-1) ppm, le méthyle à δ 14,1 (C-
16), le CH2 en alpha de la fonction acide à δ 33,7 (C-2) et celui en alpha du méthyle à δ 24,7
(C-15).

Ce composé, AG-1 est l’acide palmitique :


OH

1 O
16

Cet acide gras fait partie des constituants les plus majoritaires obtenus par
hydrodistillation.

148
Chapitre IV - Activités Biologiques

Pour compléter l’étude phytochimique de L. guineensis, il semblait intéressant de


pouvoir vérifier les données ethnopharmacologiques qui lui sont attribuées dans les domaines
cardiovasculaire et anti-inflammatoire, afin d’apporter des éléments pour confirmer l’usage de
la plante en médecine traditionnelle. Ainsi, nous avons eu l’opportunité de rechercher
notamment, après une étude de cytotoxicité, une éventuelle activité anti-inflammatoire sur les
kératinocytes. Précisons qu’il s’agit ici de résultats préliminaires.

A Evaluation des extraits EtOAc, BuOH et H2O sur la viabilité cellulaire

I Introduction

L’effet d’un composé sur la viabilité cellulaire peut être étudié in vitro sur culture
cellulaire à l’aide de plusieurs techniques comme l’inclusion de colorants vitaux ou la
métabolisation de réactifs par les cellules vivantes. Parmi ces méthodes, nous avons employé la
technique de métabolisation d’un sel de tétrazolium, le XTT.
Le principe du test est basé sur la transformation enzymatique du XTT, en un produit
coloré, le formazan. Le XTT est réduit par les déshydrogénases mitochondriales des cellules
vivantes en présence d’un agent couplant d’électrons, le coenzyme Q, en un composé
hydrosoluble jaune/orangé, le formazan, dosable par spectrométrie à 450 nm.

NO2
SO3

NO2
H3CO
H3CO SO3 NH SO3
N N N
H H
N C N C C N N NO2
O N N Transformation par O
les cellules viables H3CO
H3CO SO3

NO2
XTT Formazan

Figure 68 : Métabolisation du XTT en formazan

149
Nous nous sommes proposés de tester les extraits EtOAc, BuOH et H2O à l’aide du
test du XTT, sur une microplaque, afin d’estimer la population cellulaire vivante, après
l’application durant 48 heures de diverses concentrations de produit.

II Résultats

La métabolisation du XTT exprimée par la Densité Optique (DO) du formazan de


chaque puits, est proportionnelle à la population cellulaire vivante.
Le pourcentage de variation de DO du lot traité par les extraits, retrace les
modifications de la population cellulaire, par rapport à la population cellulaire témoin.

Le pourcentage de variation par rapport à la population témoin est ainsi calculé :

DO témoin - DO traité X 100


DO témoin

Tableau 31 : Taux de viabilité des kératinocytes en culture après 48H d’incubation avec les extraits
Viabilité cellulaire
Concentrations Extrait Extrait Extrait
EtOAc BuOH H2 O

0,01 µg/ml 5,65 8,19 0,22

0,1 µg/ml 2,71 2,34 -1,07

1 µg/ml -4,43 -2,95 -0,60

10 µg/ml -32,39 -21,94 -10,38

100 µg/ml -75,58 -61,19 -28,86

150
0.01 µg/ml

0.1 µg/ml

1 µg/ml

10 µg/ml

100 µg/ml

0.01 µg/ml

0.1 µg/ml

1 µg/ml

10 µg/ml

100 µg/ml

0.01 µg/ml

0.1 µg/ml

1 µg/ml

10 µg/ml

100 µg/ml
20
10
0
-10
% d’activité

-20
-30
-40
-50
-60
-70
-80

EtOAc BuOH H2O

Figure 69 : Activité des extraits EtOAc, BuOH et H2O sur la viabilité des kératinocytes humains SVK14
en culture pendant 48H

III Conclusion

Les résultats relatifs à l’activité des trois extraits sont comparables.


L’étude de la viabilité cellulaire effectuée sur les extraits EtOAc, BuOH et H2O révèle
une activité prolifératrice très faible des kératinocytes humains SVK 14 aux concentrations de
0,01 à 1 µg/ml. Par contre, à 10 et 100 µg/ml, les extraits présentent une cytotoxicité.
Cette évaluation de la viabilité des cellules est indispensable à toute étude ultérieure. Il
est en effet nécessaire de connaître les concentrations cytotoxiques des échantillons, afin de
travailler en dessous de ce seuil pour évaluer d’autres propriétés. De plus cette étude pourrait,
en transposant la méthode sur des cellules tumorales, être la première étape vers la recherche
de principes cytotoxiques [Scudiero 1988].

151
B Activité du palmitate de β-amyrine et des extraits EtOAc, BuOH, H2O sur
la production de prostaglandines 6KF1α.

I Introduction

Le kératinocyte est la cellule la plus représentée au niveau de l'épiderme. En réponse à


de nombreux facteurs extracellulaires présents dans son environnement, il libère divers
médiateurs biologiquement actifs, notamment les prostaglandines et les leucotriènes qui jouent
un rôle important dans l'initiation et la modulation des réactions inflammatoires cutanées, et qui
interviennent également dans la régulation de la réponse immune.

Le kératinocyte se révèle être un bon modèle d'étude en pharmacologie cutanée ; ce


modèle cellulaire permet de déterminer, in vitro, les capacités de diverses molécules à moduler
la production de ces médiateurs issus du métabolisme de l'acide arachidonique.

Dans cette étude, nous nous sommes intéressés à une prostaglandine particulière, la
PG6KF1α qui est un des métabolites majeurs produits par le kératinocyte stimulé, et
représentatif de la modulation de la production des métabolites de l'acide arachidonique issus
de la voie de la cyclo-oxygénase.

Nous avons ainsi évalué l'activité de trois extraits et d’un composé purifié majoritaire
de l’extrait hexanique :

- l’extrait acétate d’éthyle


- l’extrait butanolique
- l’extrait aqueux
- le palmitate de β-amyrine,

sur la production de PG6KF1α induite chez le kératinocyte par un stimulant de la cascade de


l'acide arachidonique, l’ionophore calcique A23187.

152
II Résultats

Les résultats sont exprimés en picogrammes de prostaglandine 6KF1α pour 1x106


kératinocytes et par ml de culture.
L'analyse statistique des résultats est réalisée par une analyse de variance et par le test de
Dunnett.

Tableau 32 : Production de prostaglandines 6KF1α après 5 heures de culture avec le palmitate de β-amyrine
TRAITEMENTS pg PG6KF1α / 1x106 % Activité/
kératinocytes/ml A23187
Témoin n =3 32 + 4 -
A23187 5µM n =3 182 + 25 -
Palmitate de β-amyrine 10µg/ml n =3 130 + 5 *** -28%
+A23187 5µM
Palmitate de β-amyrine 50µg/ml n =3 116 + 7 *** -36%
+A23187 5µM
Palmitate de β-amyrine 100µg/ml n =3 96 + 3 *** -47%
+A23187 5µM
*** = Valeurs significativement différentes, au seuil 0,05, du témoin A23187.

Tableau 33 : Production de prostaglandines 6KF1α après 5 heures de culture


TRAITEMENTS pg PG6KF1α / 1x106 % Activité/
kératinocytes/ml A23187
Témoin n=3 33 + 5 -
A23187 5µM n=3 138 + 6 -
Extrait EtOAc 0,1 µg/ml n=3 -10%
+A23187 5µM 125 + 8
Extrait EtOAc 1 µg/ml n=3
+A23187 5µM 162 + 19 17%
Extrait EtOAc 5 µg/ml n=3
+A23187 5µM 168 + 7*** 22%
Extrait BuOH 0,1 µg/ml n=3
+A23187 5µM 138 + 16 0%
Extrait BuOH 1 µg/ml n=3
+A23187 5µM 151 + 4*** 9%
Extrait BuOH 5 µg/ml n=3
+A23187 5µM 163 + 22 18%
Extrait H2O 0,1 µg/ml n=3
+A23187 5µM 138 + 12 0%
Extrait H2O 1 µg/ml n=3
+A23187 5µM 137 + 8 -1%
Extrait H2O 5 µg/ml n=3
+A23187 5µM 137 + 14 -2%
*** = Valeurs significativement différentes, au seuil 0,05, du témoin A23187.

153
Pg PG6KF1α/.106 kératinocytes/ml

Témoin A23187 10 µg/ml 50 µg/ml 100 µg/ml


5 µM
Palmitate de β-amyrine
Figure 70 : Activité du palmitate de β-amyrine sur la production de prostaglandine 6KPGF1α par les
kératinocytes humains SVK14 stimulés par l’ionophore calcique 5 µM.

180
160
Pg PG6KF1α/.106 kératinocytes/ml

140
120
100
80
60
40
20
0
Témoin

5 µM
A23187

0.1 µg/ml

1 µg/ml

5 µg/ml

0.1 µg/ml

1 µg/ml

5 µg/ml

0.1 µg/ml

1 µg/ml

5 µg/ml

EtOAc BuOH
H2O
Figure 71 : Activité des extraits EtOAc, BuOH et H2O sur la production de prostaglandine 6KPGF1α par les
kératinocytes humains SVK14 stimulés par l’ionophore calcique 5 µM.

154
III Conclusion

Cette étude in vitro de la modulation de la libération de la prostaglandine 6KF1α par


les kératinocytes stimulés, après exposition à chacun des 3 extraits et du palmitate de β-
amyrine, à des concentrations non cytotoxiques, montre que :

- Les extraits EtOAc, BuOH et H2O ne présentent pas d’activité anti-inflammatoire


significative sur ce modèle.
Ce problème peut être dû à une concentration trop faible d’extraits testés, mais nous ne
pouvons pas, comme nous l’avons vu, aller au-delà sans induire une cytotoxicité. Ce résultat
peut paraître même étonnant quand on connaît les vertus anti-inflammatoires de la plante.
L’activité soupçonnée pourrait utiliser un autre mécanisme, pour cela, il conviendrait
d’envisager un modèle anti-inflammatoire plus global.

- Le palmitate de β-amyrine présente une activité inhibitrice significative de la


production de PG6KF1α ; cette activité est dose-dépendante : 28%, 36% et 47% d’inhibition à
10, 50 et 100 µg/ml respectivement ; soit une activité inhibitrice de 47% à 150 µM.
Dans les mêmes conditions expérimentales, l’hydrocortisone présente 45% d’inhibition à 7,5 µ
M.

De plus, il est intéressant de remarquer que le palmitate de β-amyrine inhibe la


libération de prostaglandines contrairement au palmitate d’α-amyrine, qui, lui, n’a pas
d’activité anti-cyclooxygénase mais a une activité sur les collagénases et sur la prolifération des
fibroblastes [Kweifio-Okai 1994b]. Il est d’ailleurs utilisé comme antiarthritique [Kweifio-Okai
1994a].

Cette activité sur les collagénases mérite d’être rechercher pour le palmitate de β-
amyrine.

155
C Activité du palmitate de β-amyrine sur l’expression de l’ARNm de la
métalloprotéinase MMP-1

I Introduction

Les métalloprotéinases (MMPs) sont des enzymes impliquées dans tout processus
normal ou pathologique de remodelage de la matrice extracellulaire. Leurs principales
fonctions concernent leur capacité à dégrader les composants de la matrice. Elles permettent
aussi le détachement des cellules de leur support, la libération et l’activation de cytokines
inflammatoires et de facteurs de croissance. Les métalloprotéinases de la matrice sont classées
selon la nature de la matrice extracellulaire qu’elles dégradent, en collagénases, gélatinases ou
stromélysines. Les collagènes fibrillaires sont dégradés, entre autres, par la collagénase
interstitielle exprimée par les fibroblastes dermiques et sécrétés dans la matrice extracellulaire
du derme. Dans le système cutané, l’expression basale des MMPs est relativement faible mais,
est, par contre, induite à la suite d’exposition à divers stimuli comme certaines cytokines,
certains facteurs de croissance (IL1, IL6, TNFα) ou une exposition UV.

Dans la présente étude, nous avons suivi, par la technique de Reverse Transcriptase-
Polymerase Chain Reaction (RT-PCR) semi-quantitative, l’expression de l’ARN messager de la
collagénase MMP-1, dans un modèle cellulaire in vitro de fibroblastes humains normaux,
soumis à une stimulation inflammatoire chimique, au "Phorbol Meristate Acetate" (PMA).

Nous avons montré précédemment que le palmitate de β-amyrine, présente une activité
anti-inflammatoire significative, en régulant le métabolisme de l’acide arachidonique. Dans
cette étude, nous avons évalué le pouvoir inhibiteur du palmitate de β-amyrine, sur
l’induction de l’ARN messager de MMP-1, suite à une stimulation inflammatoire.

156
II Résultats

Figure 72 : Effet du palmitate de β-amyrine sur l’expression de l’ARNm de la MMP1 à la suite d’une
stimulation inflammatoire

Les différents taux d’expression des ARNm de la MMP-1 selon les traitements, sont
représentés sur la figure ci-dessus. Il s’agit d’une observation semi-quantitative.
Le niveau basal d’expression de l’ARNm de la MMP-1 est relativement faible. Sous
stimulation inflammatoire au PMA, nous pouvons observer une induction du taux d’ARNm.
Dans ces conditions expérimentales de préincubation de 24 heures, le palmitate de β-
amyrine ne présente aucun effet.

III Conclusion

Cette étude in vitro montre que le palmitate de β-amyrine ne semble pas agir
significativement sur l’expression de l’ARNm de la métalloprotéinase MMP-1 à la suite d’une
stimulation inflammatoire.

157
D Activité antiradicalaire des extraits EtOAc, BuOH et H2O et des composés
phénoliques

I Introduction

Les radicaux libres sont présents dans le monde vivant, où ils sont associés au
métabolisme de l’oxygène et aux réactions d’oxydoréduction.
En général, les radicaux sont piégés par des systèmes enzymatiques tels que superoxyde
dismutase, catalase ou glutathion peroxidase.

O2 + O2 + 2H Superoxyde dismutase H2O2 + O2

H2O2 + H2O2 Catalase 2 H 2 O + O2

H2O2 + GSH Glutathion peroxidase 2 H O + GSSG


2

Figure 73 : Principales réactions dans l’organisme

Des antioxydants non enzymatiques interviennent aussi dans la défense antiradicalaire


comme la vitamine E, la vitamine C, la vitamine A ou le glutathion.

Mais au cours du vieillissement, par suite d’une diminution de l’activité enzymatique,


ou d’une production radicalaire exagérée par les rayonnements UV, les radiations ionisantes,
les phénomènes de pollution, ou lors de situations pathologiques comme les ischémies, les
cancers ou les inflammations, les systèmes de défenses de l’organisme contre le stress oxydatif
sont débordés, ce qui entraîne les effets toxiques.

Nous nous sommes proposés d’évaluer le pouvoir antiradicalaire de nos extraits et de


composés polyphénoliques isolés. Pour cela, nous avons utilisé la méthode utilisant le DPPH
(2-2-diphényl-1-picrylhydrazyl). C’est un test colorimétrique très utilisé [Blois 1958].

Le DPPH est un radical stable qui présente une absorbance caractéristique entre 500 et
560 nm (violet). Cette couleur violette, disparaît rapidement quand le DPPH rencontre un
piégeur de radicaux libres et devient alors jaune.

158
O2N
N
N
NO2
O2N

Structure du DPPH

II Résultats

L’activité antiradicalaire est exprimée par le pourcentage de DPPH dégradé. Celle-ci est
évaluée par comparaison de la Densité Optique (DO) de l’échantillon avec celle de
l’échantillon standard mesurée dans le MeOH :

% de dégradation du DPPH =DO témoin - DO échantillon X 100


DO témoin

Tableau 34 : Pourcentage de dégradation du DPPH par les composés testés en microplaque 96 puits :
Concentrations
Composés CI50 (µM) 2 µM 10 µM 50 µM 100 µM 200 µM
Trolox (témoin positif) 100
Kaempferol 120 0 0 19 41 90
Quercétine 49 0 7 51 91 94
Quercitrine 88 0 7 29 57 84
Quercitrine 3’-sulfate >>200 0 0 0 2 6
Quercétine 3,3’-disulfate >>200 0 0 0 2 10
Quercétine 3,3’,4’-trisulfate 150 1 2 20 30 70
Acide gallique 35 4 16 67 90 92
Gallate d’éthyle 67 0 7 39 72 92

159
80
75 74

69
70 67

Rutine
60 Extrait EtOAc
Extrait BuOH
% de dégradation du DPPH

50 Extrait H2O
Acide gallique

40

30

20
20

10

0
Echantillons testés à 20mg/L

Figure 74 : Activité antiradicalaire des différents extraits à 20 mg/ml

100
% de dégradation du DPPH

Trolox

Kaempferol

75 Quercétine

Quercitrine
Tro
lox 50 Quercitrine 3'-sulfate

Quercétine 3,3'-disulfate

Quercétine 3,3',4'-trisulfate
25
Acide gallique

Gallate d'éthyle
0
0 50 100 150 200 250

Concentration (µM)

Figure 75 : Activité antiradicalaire des composés isolés

160
La majorité des composés sont plus actifs que le Trolox.
Le kaempferol, avec un hydroxyl en 4’ sur le cycle B, est moins actif que le Trolox
alors qu’un système ortho-dihydroxyl sur le cycle B (la quercétine), permet une meilleure
activité antiradicalaire.
Mais la glycosylation sur la position 3 diminue cet effet (la quercitrine), et l’annule
quand on perturbe le système ortho-dihydroxyl 3’,4’ (quercitrine 3’-sulfate, quercétine
3,3’-disulfate, quercétine 3,3’,4’-trisulfate). Notons que l’on retrouve une légère activité avec
le flavonoïde trisulfaté. L’activité observée est un artefact. En effet, l’analyse sur CCM montre
que le dérivé trisulfaté s’est hydrolysé en partie en quercétine. On retrouve donc le système
ortho-dihydroxyl sur le cycle B responsable de cette activité.

Cela tend donc à montrer que la présence du système ortho-dihydroxyl sur le cycle B et
l’hydroxyle libre en 3 sont nécessaires pour avoir une forte activité antiradicalaire.

Quant aux acides phénoliques, c’est l’acide gallique qui est le plus actif. La présence de
la chaîne éthoxy dans le gallate d’éthyle réduit de moitié son activité antiradicalaire.

III Conclusion

L’étude montre que les trois extraits EtOAc, BuOH, H2O ont une activité
antiradicalaire. Hormis les flavonoïdes sulfatés, cette activité se retrouve dans la plupart des
composés isolés de ces mêmes extraits. Ainsi, l’acide gallique, la quercétine, le gallate
d’éthyle, la quercitrine et le kaempferol ont une activité antiradicalaire.

Cette activité est à rapprocher d’une éventuelle activité anti­inflammatoire. En effet, 

l’activité   antiradicalaire, en  piégeant   les  radicaux  libres,  est  fortement   impliquée  dans  les 

processus   anti­inflammatoires   au   même   titre   que   les   inhibitions   enzymatiques   des 

lixopygénases,   des   cyclooxygénases   ou   de   la   xanthine   oxydase   par   exemple. Rappelons

d’ailleurs que la xanthine oxydase qui génère des radicaux O2­, est inhibée par les flavonoïdes 

sulfatés non actifs ici [Yagi 1994].

161
Discussion

162
DISCUSSION

Deux méthodes ont été utilisées pour l’étude phytochimique de Leea guineensis G.
Don (Leeaceae).
La première est l’hydrodistillation. Elle a permis d’identifier 47 composés des distillats
de feuilles, et 43 composés des distillats de bois, ainsi que 4 acides gras, soit au total 73
composés. Nous avons montré que la classe la plus représentative des distillats de bois et de
feuilles était celle des hydrocarbures (60% et 45 % respectivement) essentiellement dû au fort
taux d’acides gras et d’esters. Pour les feuilles, la fraction la plus importante est tout de même
celle des terpénoïdes (54%), où l’on rencontre un composé peu commun : le vitispirane.
La seconde a consisté en l’extraction et en l’isolement des composés à partir des
extraits héxanique, dichlorométhane, acétate d’éthyle, butanolique et aqueux des feuilles. Elle a
conduit après fractionnement sur différents supports chromatographiques à l’isolement de 17
composés qui se répartissent dans quatre classes que sont : les terpènoïdes (7), les flavonoïdes
(7), les acides phénols (2) et les acides gras (1).
Si un bon nombre de ces composés identifiés sont connus (kaempferol, quercétine,
quercitrine, acide gallique, E-phytol, squalène, lupéol, β-amyrine), ceux-ci, du point de vue
chimiotaxonomique, sont intéressants.

Chimiotaxonomie

Quatre composés sont déjà connus chez les Rhamnaceae et les Vitaceae. Il s’agit du
kaempferol, de la quercétine, de la quercitrine et de l’acide gallique. Le rapprochement des
Leeaceae des Vitaceae semble justifier par l’existence de composés rares comme le vitispirane,
provenant de l’hydrodistillation, et de raphides (oxalate de calcium). Quant à la distinction
entre les Leeaceae et les Vitaceae, celle-ci pourrait s’expliquer par le fait que l’on retrouve
chez les Leeaceae à la fois des triterpènes à noyaux lupanes, oléananes et ursanes et qu’ils
peuvent être acylés. A notre connaissance, il n’est pas répertorié de noyau lupane chez les
Vitaceae, ni de triterpène acylé. Les Rhamnaceae produisent pour leur part, des triterpènes
majoritairement à noyaux lupanes et dammaranes [Hegnauer 1973]. La présence de
flavonoïdes sulfatés est aussi un argument en faveur de la séparation actuelle des Leeaceae des
Vitaceae, (même si, nous l’avons vu, leur répartition fait plus référence à la nature du biotope).

163
Pour répondre à cette hypothèse, une étude plus vaste, sur d’autres Leea d’Asie et d’Afrique
semble indispensable. Elle permettrait de savoir si la famille possède ou non des flavonoïdes
sulfatés, et si c’est le cas, on pourra peut-être parler de traceur chimiotaxonomique spécifique
pour les Leeaceae.

Tableau 35 : Différents composés rencontrés chez les Rhamnales


Composés Leeaceae Vitaceae Rhamnaceae
Acide gallique
Kaempferol
Quercétine
Quercitrine
α et β-amyrine
Lupéol
Vitispirane
Triterpènes acylés
Flavonoïdes sulfatés
Oxalate de calcium

Intérêt biologique des composés isolés

Il nous paraît intéressant de recenser les activités des composés isolés au travers des
publications de ces dernières années. Ceci pour deux raisons. La première permet en
connaissant les activités biologiques des composés de comprendre les différentes utilisations de
la plante en médecine traditionnelle. La seconde est de montrer que de petites biomolécules
peuvent être douées de propriétés intéressantes (acide gallique par exemple).

Il serait certes prématuré de relier les activités potentielles des extraits ou des
métabolites purifiés à l’utilisation traditionnelle de Leea guineensis, mais bon nombre de ces
composés ont des activités qui recoupent le champ d’application de cette plante en
ethnopharmacologie, notamment dans les domaines anti-inflammatoire ou cardiovasculaire.

164
Tableau 36 : Liste des terpénoïdes et de leurs propriétés biologiques
Nouveau dans
Composés Propriétés biologiques
Famille Règne
végétal
E-phytol Antibactérienne [Rajab 1988]
Anti-inflammatoire [Shimizu 1994]
Antispasmodique [Pongprayon 1992]
Hypolipémiante [Watanabe 1983]
Squalène Antibactérienne,
Antitumorale,
Immunostimulante [Harborne 1999]
Chimiopréventive (cancers du colon) [Rao 1998]
Lupéol Cytotoxique pour les cellules tumorales Hep­G2, A­431 et H­
411E par inhibition de la topoisomérase II [Moriarity 1998]
Antitumorale contre le carcinome de Walker,
Antihypoglycémiante,
Hypotensive [Harborne 1999]
Inhibiteur de la protéine kinase [Hasmeda 1999]
Anti-inflammatoire [Geetha 1998, Akihisa 1996]
β-amyrine Aléxitérique [Pereira 1994]
Anti-inflammatoire [Harborne 1999, Akihisa 1996]
Palmitate Antidépressive et sédative [Kitada 1981, Subarnas 1992,
de β-amyrine 1993a-b]
Inhibiteur α1-adrénergique [Subarnas 1993c]
Palmitate Anti-inflammatoire et anti-arthritique [Kweifio-Okai 1993,
d’α-amyrine 1994a-b, 1995]
Pesticide inhibiteur de croissance [Shankaranarayana 1980]
Inhibiteur de la protéine kinase [Hasmeda 1999]
Mélange de Protecteur hépatique [Lin 1988]
palmitate d’α et de
β-amyrine
Coriolate Non déterminées
de β-amyrine

165
Tableau 37 : Liste des polyphénols et de leurs propriétés biologiques
Composés Nouveau dans Propriétés biologiques
Famille Règne
végétal
Kaempferol Anti-inflammatoire,
Antibactérienne,
Antimutagène,
Inhibiteur lipoxygénase,
Antiradicalaire [Harborne 1999]
Quercétine Comme le kaempferol mais plus actif
Antihépatotoxique,
Antivirale [Harborne 1999]
Aléxitérique [Pereira 1994]
Anti-inflammatoire [Robak 1996]
Vasorelaxante [Chen 1996]
Quercitrine Comme la quercétine
Inhibe l’aldose réductase (10-7M)
Antimutagène,
Anti-ulcéreuse [Harborne 1999]
Antidiarrhéique [Gálvez 1995]
Méarnsitrine Inhibe l’aldose réductase [Yoshikawa 1998]
Quercitrine Non déterminées
3’-sulfate
Quercétine Non déterminées
3,3’-disulfate
Quercétine Non déterminées
3,3’,4’-trisulfate
Acide gallique Antibactérienne,
Antivirale,
Antifongique,
Antitumorale,
Anti-anaphylactique,
Antimutagène,
Cholérétique,
Bronchodilatatrice,
Inhibe la dégradation de l’insuline,
Relaxante du muscle lisse,
Astringent [Harborne 1999]
Anti-inflammatoire,
Antimutagène,
Anticarcinogène [Kroes 1992]

Gallate d’éthyle Antiradicalaire [Masaki 1997]


Antibactérienne [Kayser 1997, Sato 1997]
Antitumorale [Serrano 1998]
Antinociceptive [Filho 1996]
Inhibiteur de la 12- et 15-lipoxygénase, ainsi que de la
prostaglandine-synthase [Luther 1991, Christow 1991]
Inhibiteur de la protéine tyrosine kinase [Serrano 1998]
Anti-inflammatoire [Kroes 1992]

166
Les terpénoïdes

Tous les composés de cette classe sont nouvellement identifiés dans la famille
Leeaceae.
Nous avons isolé, entre autres, le E-phytol, le squalène, le lupéol et la β-amyrine. Ces
composés sont très répandus dans le règne végétal.
Pour cela, nous discuterons essentiellement des triterpènes acylés que nous avons
isolés : le palmitate de β et d’α-amyrine et du coriolate de β-amyrine. On peut en effet se poser
la question de l’origine des triterpènes acylés. Sont-ils naturels ? Pour certains auteurs,
l’acylation d’alcools triterpéniques en présence de glycérides peut avoir lieu en milieu acide
donnant ainsi à ces composés une origine artefactuelle [Massiot 1996]. Ce n’est pas le cas ici,
car l’extraction à l’hexane ne fait pas intervenir d’acide. Par ailleurs, l’obtention de composés
sensibles à l’acide (flavonoïdes sulfatés) nous laisse penser qu’une augmentation de l’acidité au
cours du processus de séchage de la plante ou du mouillage de celle-ci avant extraction n’a pu
avoir lieu. D’autre part, dans le latex de différentes espèces d’Euphorbia (Euphorbiaceae), la
présence naturelle d’esters de triterpènes a été démontrée par une hypothèse biogénétique
[Warnaar 1987].

Les dérivés palmitoylés d’amyrine ont deux propriétés principales :


Le palmitate d’α-amyrine (Terp-7) présente une activité antiarthritique [Kweifio-
Okai 1994a]. L’action antiarthritique est expliquée par une inhibition de la prolifération des
fibroblastes et des collagénases. Cependant, elle n’est pas due à une activité
anticyclooxygénase (car la production de prostaglandines par le test de l'oedème de la patte
induite par la carragennine n'est pas affectée) [Kweifio-Okai 1994b]. De plus, l’examen
histologique de l’articulation des interphalanges proximales de pieds de rats montre une
diminution de la prolifération et de l’invasion synoviale du hyaluronate et des granulocytes
[Kweifio-Okai 1995].
Cette activité anti-inflammatoire et plus particulièrement anti-arthritique du
palmitate d’α-amyrine a fait l’objet d’un brevet international [Kweifio-Okai 1993].

Quant au palmitate de β-amyrine (Terp-5), il montre une activité antidépressive et


sédative. Cette activité est montrée en mesurant la perte de la mobilité des souris ou des rats
selon le test de la nage forcée [Subarnas 1992, 1993a]. D'après d’autres données
pharmacologiques, le palmitate de β-amyrine est un antidépresseur au même titre que

167
l'imipramine et la mianserine [Kitada 1981, Subarnas 1993b]. Ce composé possède des
propriétés sédatives justifiées par une action "mianserin-like" [Subarnas 1993b]. Pour préciser
son mode d’action, le palmitate de β-Amyrine a été testé en association avec d’autres
composés :
- phényléphrine (agoniste α1)
- clonidine (agoniste α2)
- apomorphine (agoniste dopaminergique)
- prazosine (antagoniste α1)
- yohimbine (antagoniste α2)
Il ressort de cette étude que le palmitate de β-amyrine se comporte comme un inhibiteur α1-
adrénergique [Subarnas 1993c].

Sachant que la β-amyrine et le palmitate d’α-amyrine possédaient une activité anti-


inflammatoire, nous avons voulu savoir si le palmitate de β-amyrine, isolé majoritairement de
l’extrait hexanique dont nous disposions en grande quantité, possédait cette même activité anti-
inflammatoire. Nous avons ainsi pu montrer que le palmitate de β-amyrine possédait une
activité anti-inflammatoire modérée et dose dépendante. En effet sur le modèle des
kératinocytes stimulés par l’ionophore calcique, le palmitate de β-amyrine inhibe la production
de prostaglandines PG6KF1α. Nous avons une réponse représentative à la modulation de la
voie des cyclooxygénases qui métabolise l’acide arachidonique.

De plus, le palmitate de β-amyrine peut être extrait d’une suspension de culture


cellulaire, d’Apium graveolens (Umbelliferae) et Tabernaemontana divaricata (Apocynaceae)
[Dyas 1994]. Une transposition de la méthode à l’échelle industrielle peut par conséquent être
envisagée, puisque ce composé représente 33% des terpénoïdes totaux.

Par ailleurs, dans ce groupe des triterpènes acylés, nous avons pu isoler le coriolate de
β-amyrine (Terp-6). Ce composé est nouveau dans le règne végétal, il n’a par conséquent pas
d’activité recensée. Cependant, l’acide coriolique isolé d’une culture de Pleurotus
pulmonarius possède une activité nématicide contre Caenorhabditis elegans (DL50 de 5-10
ppm) et antibactérienne contre Bacillus brevis et B. subtilis (CMI de 50 µg/ml et 100 µg/ml

168
respectivement) [Stadler 1994]. Il serait intéressant de savoir si le couplage β-amyrine et
coriolate potentialise cet effet, ou fait apparaître d’autres propriétés ?
Le coriolate ou acide (9Z, 11E)-13-hydroxy-9,11-octadécadiènoïque est un acide gras
assez répandu dans le règne végétal au même titre que l’acide dimorphécolique (9Z, 11Z)
[Rama Rao 1985, Tallent 1966]. Cependant, c’est la première fois que ce type d’acide gras est
fixé à un triterpène.

Les flavonoïdes

La classe des flavonoïdes, est une classe très importante dans la famille des Leeaceae.

Le kaempferol et la quercétine que nous avons isolés sont déjà répertoriés dans la
famille. Ils sont connus pour avoir sensiblement les mêmes activités. Bon nombre de
publications font état de leur activité antiradicalaire. Nous avons montré cette même activité
par le test au DPPH. Par ailleurs, ces composés sont impliqués dans les processus
antimutagène et anticarcinogène. Aussi, il est bon de se rappeler qu’ils sont retrouvés dans
notre alimentation, nous retrouvons par exemple la quercétine dans l’oignon (284-486 mg/kg),
le chou (110 mg/kg), et le kaempferol dans le chou (211 mg/kg) … [Hertog 1992].

La quercitrine et la méarnsitrine sont deux flavonols 3-O-rhamnosylé isolés pour la


première fois dans cette famille. La méarnsitrine est un flavonol rare dans le règne végétal.
Isolée pour la première fois de Acacia mearnsii (Fabaceae) [Mackenzie 1969], nous l’avons
recensé seulement dans 7 autres espèces : Landolphia kirkii (Apocynaceae) [Gabetta 1973],
Doliocarpus spraguei (Dilleniaceae) [Gurni 1981], Flemingia stricta (Fabaceae) [Rao 1983],
Lysimachia nummularia (Primulaceae) [Yasukawa 1990], Allophyllus edulis (Sapindaceae)
[Hoffmann-Bohm 1992], Myrcia multiflora (Myrtaceae) [Yoshikawa 1998] et enfin Syzygium
malaccense (Myrtaceae) [Noreen 1998].
Il n’est pas surprenant de trouver ce composé trisubstitué sur le noyau B, avec un méthoxy en
4’ et deux hydroxyles en 3’ et 5’. En effet, nous avons recensé sa génine, la myricétine, dans 5
Leea [Bates-Smith 1959, Umadevi 1991], et un dérivé de la myricétine rhamnosylé en position
3, la myricitrine, chez Leea rubra [Yem Yok Siv 1971].

169
Toutefois, le groupe le plus intéressant que nous avons rencontré reste celui des
flavonoïdes sulfatés. C’est la première fois que l’on rencontre des flavonoïdes sulfatés dans la
famille des Leeaceae. Son biotope est un argument pour ce type de constituants. Rappelons
que notre échantillon provient d’une espèce qui pousse dans une forêt à raphiales
marécageuses ou périodiquement inondées du Cameroun.
La quercitrine 3’-sulfate et la quercétine 3,3’,4’-trisulfate (Flav-4 et Flav-6) sont
recensées pour la première fois dans le règne végétal.
La quercitrine 3’-sulfate (Flav-4) a fait l’objet d’une publication [Op de Beck 1998].
Avec la 3-glucuronyl-3’-sulfate de quercétine isolé de Hypericum elodes (Guttifrae) [Seabra
1988], la quercitrine 3’-sulfate est le deuxième flavonoïde sulfaté en position 3’ et possédant
une unité osidique en 3. On ne recense d’ailleurs que 9 flavonols qui sont à la fois sulfaté et
glycosylé.
C’est aussi la deuxième fois que l’on rencontre la quercétine 3,3’-disulfate (Flav-5).
Celle-ci a été isolée de Flaveria chloraefolia (Compositae) [Barron 1987b]. Les génines
disulfatées sont rares, on en dénombre 8, dont 3 sont sulfatées sur la quercétine en [3,7], [3,3’]
et [3,4’].
En ce qui concerne la quercétine 3,3’,4’-trisulfate (Flav-6), son intérêt est lié à la
position de ces groupements sulfates. En effet, d’après la littérature, on recense que 7 flavonols
tri- ou tétra-sulfatés [Barron 1988a, Harborne 1994] (Tableau 10 p 45 ) :
- le kaempferol 3,7,4’-trisulfate (Acrotema uniflorum (Dilleniaceae)),
- la quercétine 3,7,3’ trisulfate (Flaveria bidentis (Compositae)),
- la quercétine 3,7,4’ trisulfate (Flaveria bidentis (Compositae)),
- la quercétine 3,7,3’,4’-tétrasulfate (Flaveria bidentis (Compositae)),
- la quercétine 3-acétyl-7,3’,4’-trisulfate (Flaveria bidentis (Compositae)),
- la rhamnétine 3’-glucuronique-3,5,4’-trisulfate (Tamarix aphylla (Tamaricaceae)),
- l’isorhamnétine 3,7,4’-trisulfate (Acrotema uniflorum (Dilleniaceae)).

Notre composé doit son originalité à la position des groupements sulfates (3, 3’ et 4’).
Généralement, les flavonoïdes trisulfatés ont toujours la position 7 sulfatée et si ce n’est pas le
cas, cette position n’est pas libre mais est le plus souvent méthoxylée (rhamnétine). La
sulfatation s’effectuant dans l’ordre 3>>7>4’>3’pour les flavonols (et 7>>3’>4’>6>8 pour les
flavones) (Varin 1992a).

En terme d’activité biologique, nous avons pu voir que les substitutions en 3, 3’ et 4’


par des sulfates diminuent considérablement l’activité antiradicalaire mesurée par le test au

170
DPPH et sont en accord avec la littérature. Le système ortho-dihydroxyl libre sur le cycle B
ainsi que l’hydroxyl libre en 3 sont indispensables pour l’activité anti-radicalaire. Cependant,
ces flavonols sulfatés mériteraient d’être testés sur l’aldose réductase du cristallin ou sur la
xanthine oxydase, qui rappelons-le, sont fortement inhibés par ce genre de composés. Il
semblerait même que les données biologiques au sujet des flavonoïdes fassent plus référence à
leurs dérivés sulfatés. De plus, l’hydrosolubilité des flavonoïdes sulfatés est d’un grand intérêt
pour envisager des applications biologiques pour lesquelles le problème de solubilité est
souvent une barrière importante. Il convient par contre d’être séléctif sur les positions à
sulfater.

L’intérêt général pour les flavonoïdes restent le domaine anti-inflammatoire. En effet,


ces composés sont impliqués dans plusieurs processus [Robak 1996] :
- Ils sont inhibiteurs d’enzymes (comme la lipoxygénase, la cyclooxygénase) ce qui
entraîne la diminution des produits de la cascade de l’acide arachidonique
(prostaglandines, leucotriènes…),
- Ils chélatent les ions métalliques, la chélation du Fe2+ empêche la réaction de
Fenton qui génère les radicaux oxygénés extrêmement réactifs (OH, O2-),
- Ils ont une action vitaminique P, veino-toniques, ils diminuent la perméabilité
capillaire.
Ce sont ainsi des agents thérapeutiques connus pour palier les problèmes
inflammatoires ou cardiovasculaires.

Les composés phénoliques

On retrouve particulièrement ces composés chez les Leea (nous avons recensé dans la
littérature les acides gentisique, p-hydroxybenzoïque, vanillique, syringique, protocatéchuique
et gallique). De ce fait, l’acide gallique a déjà été trouvé dans la famille, ce qui n’est pas le cas
pour le gallate d’éthyle.

Nous pourrions nous poser la question de savoir si ce dernier ne pourrait pas être un
artefact d’extraction ! En effet, l’extrait CH2Cl2 provient d’une extraction liquide-liquide contre
l’extrait hydroalcoolique de départ et obtenu à température ambiante (sur les feuilles
préalablement traitées à l’hexane et au dichlorométhane), puis concentré et lyophilisé.

171
Des travaux antérieurs ont montré que la formation de différents esters galliques peut
apparaître au cours du procédé d’extraction [Güven 1974]. Ainsi, en utilisant comme solvant
d’extraction l’éthanol, il y a formation de gallate d’éthyle, avec le méthanol, de gallate de
méthyle, et avec le propanol, de gallate de propyle.
L’analyse d’un extrait en CLHP couplée à la SM d’un extrait préparé à partir des
feuilles à l’aide d’un solvant approprié permettrait de lever ce doute.

Rappelons aussi, que les esters galliques sont utilisés depuis longtemps comme additifs
alimentaires. Ils servent d’agents antioxydants dans la prévention du rancissement des graisses,
il s’agit des additifs E310, E311 et E312 qui correspondent aux gallates de propyle, octyle et
lauryle respectivement.

Les extraits acétate d’éthyle, butanolique et aqueux n’ont pas montré d’activité anti-
inflammatoire sur la voie des prostaglandines libérées par les kératinocytes. Mais d’après
l’usage en médecine traditionnelle et leurs fortes activités antiradicalaires, il serait intéressant
de poursuivre cette voie avec un modèle d’évaluation plus global. De même, la recherche de
l’activité cardiovasculaire est à rechercher.
Il apparaît aussi que les composés isolés ont contribué à l’étude phytochimique de la
famille. Il conviendrait cependant de faire une recherche plus large des constituants des
différentes espèces et partie de plante dans la famille des Leeaceae. L’étude des baies et des
fleurs pour rechercher la nature de leurs pigments ainsi que la recherche de flavonoïdes
sulfatés sont notamment à étudier.

172
Conclusion

173
CONCLUSION

Notre travail avait pour objet l’étude phytochimique et biologique de Leea guineensis
G. Don (Leeaceae).
Pour cela, un travail bibliographique a permis de situer la plante et la famille dans la
systématique moderne. Nous avons montré que les Leeaceae bien qu’ayant de très fortes
affinités avec les Vitaceae, ont suffisamment de caractères distinctifs pour être considérées
comme une famille monogénérique à part entière, elle-même appartenant à l’ordre des
Rhamnales.
Nous avons aussi pu remarquer que cette famille a été très peu étudiée tant sur le plan
chimique que biologique. Nous retiendrons cependant la présence dans cette famille de
flavonoïdes, d’acides phénoliques et de tanins. L’utilisation en médecine traditionnelle montre
que le genre a des propriétés essentiellement calmante, astringente, anti-infectieuse, anti-
inflammatoire, antidysentérique et cardiovasculaire.
La découverte de flavonoïdes sulfatés dans Leea guineensis nous a conduit à effectuer
une mise à jour, et nous a permis de recenser, à ce jour, 134 flavonoïdes sulfatés, dont 32 sont
nouveaux dans le règne végétal, et d’ajouter 3 nouvelles familles renfermant ces produits.

Nos travaux personnels qui ont porté sur l’étude phytochimique et biologique de Leea
guineensis (Leeaceae) ont conduit à l’identification de 90 composés. 73 proviennent des
distillats de bois et de feuilles et 17 composés ont été isolés à partir des extraits hexanique,
dichlorométhane, acétate d’éthyle, butanolique et aqueux des feuilles.
Ceux-ci ont été caractérisé par des analyses spectrales faisant appel au pouvoir
rotatoire, l’UV, la SM, et surtout la RMN 1D et 2D (COSY, COLOC, XHCORR).
On recense 7 terpénoïdes, 1 diterpène acyclique (E-phytol), 1 triterpène acyclique
(squalène), 2 triterpènes (lupéol et β-amyrine), 3 triterpènes acylés (palmitate et coriolate de β-
amyrine, palmitate d’α-amyrine), tous nouvellement recensés dans la famille.
A ceux-ci, s’ajoute 9 polyphénols, dont 2 flavonols (kaempferol, quercétine) déjà
connus dans la famille, 2 flavonols glycosilés (quercitrine, méarnsitrine) et 3 flavonoïdes
sulfatés (quercétine 3,3’-disulfate, quercétine 3,3’,4’-trisulfate, quercitrine 3’-sulfate)
nouveaux dans la famille ainsi que 2 acides phénols (acide gallique, gallate d’éthyle). Seul ce
dernier est nouveau dans la famille avec l’acide gras (acide palmitique).

174
3 composés sont isolés pour la première fois du règne végétal, ce sont le coriolate de β-
amyrine, la quercétine 3,3’,4’-trisulfate et la quercitrine 3’-sulfate. Ce dernier a fait l’objet
d’une publication [Op de Beck 1998].

Du point de vue phytochimique, nos travaux confirment la présence d’acides


phénoliques et de flavonols déjà rencontrés dans la famille des Leeaceae. Ceux-ci semblent être
importants pour la cohésion du genre Leea. C’est aussi un argument qui montre l’étroite
relation de cette famille avec les Vitaceae, et ce d’autant plus que nous avons caractérisé dans
le distillat des feuilles le vitispirane. Ce composé est très rare et se retrouve essentiellement
dans les composés volatils de jus de raisin et de distillat de vin.
Par ailleurs, nous avons pu identifier pour la première fois des composés volatils chez
les Leea par entraînement à la vapeur d’eau provenant des feuilles et du bois. La
caractéristique principale est que les distillats sont constitués en grande partie d’hydrocarbures.
Cette étude a fait l’objet d’une publication [Op de Beck soumis].
Mais c’est la première fois que l’on montre l’existence de terpénoïdes dans cette
famille. C’est aussi la première fois que l’on met en évidence la présence de flavonoïdes
sulfatés chez les Leeaceae. Ceci est un argument supplémentaire à l’heure actuelle pour séparer
les Leeaceae des Vitaceae.

En ce qui concerne les activités biologiques, nous avons montré que les extraits EtOAc,
BuOH et H2O des feuilles présentent une cytotoxicité à partir de 10 µg/ml sur la viabilité des
kératinocytes humains SVK14 en culture pendant 48H, une forte activité antiradicalaire, mais
n’ont pas d’activité anti-inflammatoire significative sur la production de prostaglandines 6KF1
α par les kératinocytes humains SVK14 stimulés par l’ionophore calcique. En revanche, le
palmitate de β-amyrine a, quant à lui, une activité anti-inflammatoire dose dépendante (47%
d’inhibition à 100 µg/ml), il régule le métabolisme de l’acide arachidonique, mais il ne semble
pas agir sur l’expression de l’ARNm de la collagénase MMP-1.
D’autre part, les flavonoïdes non sulfatés et les acides phénols sont de très bons
piégeurs de radicaux libres. Cette propriété en fait des candidats potentiels pour palier aux
problèmes impliqués dans le stress oxydatif (peroxidations lipidiques, vieillissement, désordre
cardiovasculaire, etc.).

175
Aussi, nos résultats, associés aux recherches antérieures, et l’intérêt croissant pour les
traitements utilisant la phytothérapie ces dernières années, ne peuvent qu’encourager à
poursuivre les investigations dans cette famille Leeaceae.
Cette famille mériterait bien de sortir des vrilles des Vitaceae !

176
Bibliographie

177
Bibliographie

Adjanohoun E.J., Aké Assi L., Chibon P., de Vecchy H., Duboze E., Eymé J., Gassita J.­N., 
Goudote  E.,  Guinko  S.,  Keita  A., Koudogbo  B., Le  Bras   M.,  Mourambou  I.,   Mve­
Mengome   E.,   Nguéma   M.­G.,   Ollome   J.­B.,   Posso   P.   and   Sita   P.,  in  Médecine 
traditionnelle et pharmacopée. Contribution aux études ethnobotaniques et floristiques 
au Gabon, Agence de Coopération Culturelle et Technique (A.C.C.T.), Paris, (1984), 22­
23.

Adsersen A. and Adsersen H., Plants from Réunion Island with alleged antihypertensive and 
diuretic   effects   ­   an   experimental   and   ethnobotanical   evaluation,  Journal   of  
Ethnopharmacology, (1997), 58, 189­206.

Agrawal P.K., Carbon-13 NMR of flavonoids, in Studies in organic chemistry n° 39, Elsevier
Science Publishers, USA, (1989).

Aké Assi L., Abeye J., Guinko S., Giguet R. and Bangavou X., in Médecine traditionnelle et 
pharmacopée. Contribution aux études ethnobotaniques et floristiques en République 
Centrafricaine,   Agence   de   Coopération   Culturelle   et   Technique   (A.C.C.T.),   Paris, 
(1985), 19­20.

Akihisa T., Yasukawa K., Oinuma H., Kasahara Y., Yamanouchi S., Takido M., Kumaki K. 
and  Tamura   T.,   Triterpene   alcohols   from   the   flowers   of   Compositae   and   their   anti­
inflammatory effects, Phytochemistry, (1996), 43 (6), 1255­1260.

Aldrich library of 13C and 1H FT NMR spectra, vol. 1, Aldrich Chemical Compagny, USA,
(1993).

Ali A.M., Mackeen M.M., El­Sharkawy S.H., Hamid J.A., Ismail N.H., Ahmad F.B.H. and 
Lajis N.H., Antiviral and cytotoxic activities of some plants used in Malaysian indigenous 
medicine, Pertanika J. Trop. Agric. Sci., (1996), 19 (2/3), 129­136.

Barron D., Colebrook L.D. and Ibrahim R.K., An equimolar mixture of quercetin 3-sulphate
and patuletin 3-sulphate from Flaveria chloraefolia, Phytochemistry, (1986), 25 (7),
1719-1721.

Barron D. and Ibrahim R.K., Synthesis of flavonoid sulfates: I. Stepwise sulfation of positions
3,7 and 4’ using N,N’-dicyclohexylcarbodiimide and tetrabutylammonium sulfate,
Tetrahedron, (1987a), 43 (22), 5197-5202.

Barron D. and Ibrahim R.K., Quercetin and patuletin 3,3’-disulphate from Flaveria
chloraefolia, Phytochemistry, (1987b), 26 (4), 1181-1184.

178
Barron D., Advances in the phytochemistry, organic synthesis, spectral analysis and enzymatic
synthesis of sulfated flavonoids, Ph. D. Thesis, Concordia University, Montréal, (1987c).

Barron D., Varin L., Ibrahim R.K., Harborne J.B. and Williams C.A., Review, Sulphated
Flavonoids-An update, Phytochemistry, (1988a), 27 (8), 2375-2395.

Barron D. and Ibrahim R.K., Hydrochloric acid and aryl-sulphatase as reagents for UV-spectral
detection of 3- and 4’-sulphated flavonoids, Phytochemistry, (1988b), 27 (7), 2335-
2338.

Barron D. and Ibrahim R.K., Synthesis of flavonoid sulfates. III. Synthesis of 3’,4’-ortho
disulfates using sulfur trioxyde-trimethylamine complex, and of 3’-sulfates using aryl
sulfatase, Z. Naturforsch, (1988c), 43c, 631-635.

Bate­Smith  E.C., The phenolic constituents of plants and their taxonomic significance,  J.  


Linn. Soc. (Bot.), (1959), 58.

Behnke H.­D. and Dahlgren R., The distribution of characters within an angiosperm system, 
2. Sieve­element plastids, Bot. Notiser, (1976), 129 (3), 287­296.

Bin Rahmani M., Kiew R., Lajis N. HJ., Othman R. and Toia R.F., A contribution to the 
phytochemical survey of Peninsular Malaysia, Pertanika, (1985), 8 (3), 347­357.

Blasco   F.,   in   Montagnes   du   sud   de   l’Inde:   forêts,   savanes,   écologie,   Tome   X,   Inst.   fr. 
Pondichery, Trav. Sec. sci. tech., Pondichery, India, (1971), 157­159.

Blois M.S., Antioxydant determination by the use of a stable free radical, Nature, (1958), 181
(4617), 1199-1200.

Bouquet A. and Debray M., in Plantes Médicinales de la Côte d’Ivoire, travaux et documents 
de l’O.R.S.T.O.M. N°32, O.R.S.T.O.M., Paris, (1974), 15­16.

Brahman M. and Saxena H.O., Phytochemical screening of the plants of Gandhamardan hills 
of   Orissa   (India)   for   tannins,   saponins,   flavonoids   and   alkaloids,  Asian   Jour.   Pl.   Sci., 
(1989), 1, 89­92.

Brasseur T., Angenot L., Pincemail J. et Deby C., La troxérutine et la rutine sulfate sodique
possèdent-elles encore les propriétés de la rutine ?, Ann. pharm. Fr., (1987), 45 (4), 329-
334.

Breitmeier E. and Kelter W., Carbon-13 NMR spectroscopy, third ed., VCH, Weinheim,
(1990), 327.

Bruneton J., Pharmacognosie Phytochimie Plantes médicinales, 2ème edition, Technique et


Documentation - Lavoisier, Paris, (1993).

179
Cadet T., in La végétation de l’Ile de la Réunion, Orphy, Livry, (1980).

Chen C.K., Pace­Asciak C.R., Vasorelaxing activity of resveratrol and quercetin in isolated rat 
aorta, Gen. Pharmac., (1996), 27 (2), 363­366.

Chopra R.N., Nayar S.L. and Chopra I.C., in Glossary of Indian Medicinal Plants, Concil of 
Scientific & Industrial Research, New Delhi, (1956), 151­152.

Christow S., Luther H., Ludwig P., Gruner S. and Schewe T., Actions of gallic esters on the 
arachidonic   acid   metabolism   of   human   polymorphonuclear   leukocytes,  Pharmazie, 
(1991), 46, 282­283.

Corner E.J.H., in The seeds of Dicotyledons, Cambridge University Press, Cambridge, (1976).

Cronquist A., in The Evolution and Classification of Flowering Plants, Second Edition, The 
New York Botanical Garden, Bronx, New York, USA, (1988).

da Silva E.L., Piskula M.K., Yamamoto N., Moon J. and Terao J., Quercetin metabolites
inhibit copper ion-induced lipid peroxidation in rat plasma, FEBS Letters, (1998), 430
(3), 405-408.

Dahlgren R., General concept in botany : botanical classification,  Rev. Latinoamer. Quim., 
(1989), Suppl. 1, 10­36.

Davies N.W., Review, Gas chromatographic retention indices of monoterpenes and


sesquiterpenes on methyl silicone and Carbowax 20M phases, Journal of
Chromatography., (1990), 503, 1-24.

Del Pero Martìnez M.A. and Martìnez A.J., Flavonoid distribution in Tradescantia,
Biochemical Systematics and Ecology, (1993), 21 (2), 255-265.

de Montarby L., Mosset P. and Grée R., Sorbic acid iron tricarbonyl complex as resolving
agent. Chiral syntheses of 4-hydroxy nonenal and coriolic acid, Tetrahedron Letters,
(1988), 29 (32), 3937-3940.

Descoings   B.,  in  Flore  de  Madagascar   et  des   Comores  (plantes  vasculaires) 124e  Famille 
Vitacées   Famille   124   bis   Leeacées,   Muséum   National   d’Histoire   Naturelle,   Paris, 
(1967).

Descoings   B.,  in  Flore   du   Cameroun,   Vitacées,   Leeacées,   Muséum   National   d’Histoire 
Naturelle, Paris, (1972), 133­137.

Douk P., Contribution à l’étude des Plantes Médicinales du Cambodge, Thèse de Docteur en 
Pharmacie, Paris, (1966), 82.

180
Dyas L., Threlfall D.R. and Goad L.J., The sterol composition of five plant species grown as
cell suspension cultures, Phytochemistry, (1994), 35 (3), 655-660.

El-Sayed N.H., Norris J.A., Ahmed A.A. and Mabry T.J., Flavonoids of Brickellia longifolia,
Phytochemistry, (1990), 29 (7), 2364-2365.

Engel R., Gutman M., Hartisch C., Kolodziej H. and Nahrstedt A., Study on the composition
of the volatile fraction of Hamamelis virginiana, Planta Medica, (1998), 64, 251-258.

Falany C.N., Sulfation and sulfotransferase, Introduction : Changing view of sulfation and the
cytosolic sulfotransferase, FASEB Journal, (1997), 11, 1-2.

Faulkner I.J. and Rubery P.H., Flavonoids and flavonoid sulphates as probes of auxin-transport
regulation in Cucurbita pepo hypocotyl segments and vesicles, Planta, (1992), 186, 618-
625

Filho V.C., Santos A.R.S., De Campos R.O.P., Miguel O.G., Yunes R.A., Ferrari F., Messana 
I. and Calixto J.B., Chemical and pharmalogical studies of Phyllanthus caroliniensis in 
mice, J. Pharm. Pharmacol., (1996), 48, 1231­1236.

Fourneau C., Laurens A., Hocquemiller R. and Cavé A., Radical scavenging evaluation of
Green Tea extracts, Phytotherapy Research, (1996), 10, 529-530.

Fukuoka M., Yoshihira K., Natori S., Sakamoto K., Iwahara S., Hosaka S. and Hirono I.,
Characterization of mutagenic principles and carcinogenicity test of dill weed and seeds,
J. Pharm. Dyn., (1980), 3, 236-244.

Gabetta B., Martinelli E.M. and Mustich G., Plants of Mozambique. III. Flavonoids of
Ladolphia kirkii, Fitoterapia, (1973), 44 (3), 93-94.

Gagnepain F., Essai d’une classification des  Leea  asiatiques,  Bull. Soc. bot. Fr., (1910),  57, 


331­336.

Gagnepain F., Révision des Ampélidacées asiatiques et malaises, Bull. Soc. Hist. nat. Autun, 
(1911), 24, 1­41.

Gálvez J., Sánchez de Medina F., Jiménez J., Torres M.I., Fernández M.I., Núñez M.C., Ríos 
A., Gil A. and Zarzuelo A., Effect of quercitrin on lactose­induced chronic diarrhoea in 
rats, Planta medica, (1995), 61, 302­306.

Ganesan T., Antifungal Properties of wild plants, Adv. Plant Sci., (1994), 7 (1), 185­187.

Garnier P., Noms de plantes en : langue mandingue langue baoulé. Essai de classification
logique des noms populaires de plantes, Thèse de l’Université, Marseille, (1976), 52 et
55.

181
Geetha T. and Varalakshmi P., Anti-inflammatory activity of lupeol and lupeol linoleate in
adjuvant-induced arthritis, Fitoterapia, (1998), 69 (1), 13-19.

Gerrath J.M., Lacroix C.R., Gerrath J.M., and Posluszny U., The developmental morphology 
of Leea guineensis. II. floral development, Bot. Gaz., (1990), 151 (2), 210­220.

Gerrath   J.M.   and   Lacroix   C.R.,   Heteroblastic   sequence   and   leaf   development   in  Leea 
guineensis, Int. J. Plant Sci., (1997), 158 (6), 747­756.

Grandmaison J. and Ibrahim R.K., Evidence for nuclear protein binding of flavonol sulfate
esters in Flaveria chloraefolia, J. Plant Physiol., (1996), 147, 653-660.

Gudej J., Flavonoids, phenolic acids and coumarins from the roots of Althaea officinalis,
Planta Medica, (1991), 57, 284-285.

Guo J., Yu D.-L., Xu L., Zhu M. and Yang S.-L., Flavonol glycosides from Lysimachia
congestiflora, Phytochemistry, (1998), 48 (8), 1445-1447.

Gupta K.C. and Chopra I.C., Tuberculostatic activity of Leea hirta Roxb. (Kaka Jangan), Ind.  
Jour. Med. Res., (1953), 41 (4), 427­429.

Gurni   A.A.   and   Kubitzki   K.,   Flavonoid   chemistry   and   systematics   of   the   Dilleniaceae, 
Biochem. Syst. Ecol., (1981), 9 (2/3), 109­114.

Güven K.C., Koyuncuoglu H., Ulubelen A. and Güven N., Studies on gallic acid esters formed 
by the extraction of Paeonia peregrina Mill., Pharmazie, (1974), 29, 350.

Hannoufa A., Varin L. and Ibrahim R.K., Spatial distribution of flavonoid conjugates in relation
to glucosyltransferase and sulfotransferase activities in Flaveria bidentis, Plant Physiol.,
(1991), 97, 259-263.

Hannoufa A., Brown R.H. and Ibrahim R.K., Variations in flavonoid sulphate patterns in
relation to photosynthetic types of five Flaveria species, Phytochemistry, (1994), 36 (2),
353-356.

Haraguchi H., Ohmi I., Sakai S., Fukuda A., Toihara Y., Fujimoto T., Okamura N. and Yagi A.,
Effect of Polygonum hydropiper sulfated flavonoids on lens aldose reductase and related
enzymes, Journal of Natural Products, (1996), 56, 443-445.

Harborne J.B., Review Flavonoid sulphates: a new class of sulphur compounds in higher
plants, Phytochemistry, (1975a), 14, 1147-1155.

Harborne J.B., Flavonoid bisulphates and their co-occurrences with ellagic acid in the
Bixaceae, Frankeniaceae and related families, Phytochemistry, (1975b), 14, 1331-1337.

Harborne J.B., Flavonoid sulphates: a new class of natural product of ecological significance in
plants, in Progress in Phytochemistry, Pergamon Press, New York, (1977), 4, 189-208.

182
Harborne J.B. and Mabry T.J., in The Flavonoid advances in research, Chapman and Hall,
London (1982).

Harborne J.B., in The Flavonoids advances in research since 1980, Chapman and Hall Ltd.,
London, (1988), 310.

Harborne J.B., in The Flavonoids advances in research since 1986, Chapman and Hall Ltd.,
London, (1994).

Harborne J.B., Baxter H. and Moss G..P., in Phytochemical Dictionnary, a handbook of


bioactive compounds from plants, second edition, Taylor & Francis Ltd, London,
(1999).
Harriman N.A., Leeaceae, in a revised handbook to the flora of ceylon Dassanayake, M.D.,
New Dehli, (1991), 391-393.

Hasan M. and Burdi D.K., Diterpene fatty acid ester from Leucas nutans, Journal of Natural
Products, (1991), 54 (5), 1444-1446.

Hasmeda M., Kweifio-Okai G., Macrides T. and Polya G.M., Selective inhibition of eukaryote
protein kinases by anti-inflammatory triterpenoids, Planta Medica, (1999), 65, 14-18.

Hegnauer   R.,  in  Chemotaxonomie   der   Pflanzen,   vol.   VI,   Birkhäuser   Verlag   Basel, 
Switzerland, (1973), 56­76.

Hegnauer   R.,  in  Chemotaxonomie   der   Pflanzen,   vol.   IX,   Birkhäuser   Verlag   Basel, 
Switzerland, (1990), 689­699.

Hertog   M.G.L.,   Hollman   P.C.H.   and   Katan   M.B.,   Content   of   potentially   anticarcinogenic 
flavonoids of 28 vegetables and 9 fruits commonly consumed in the Netherlands,  J.  
Agric. Food Chem., (1992), 40, 2379­2383.

Hoffmann-Bohm K., Lotter H., Seligmann O. and Wagner H., Antihepatotoxic C-


Glycosylflavones from the leaves of Allophyllus edulis var. edulis and gracilis, Planta
Medica, (1992), 58, 544-548.

Hutchinson J., in The Families of Flowering Plants, Third Edition, Museums of Botany Royal 
Botanic Garen, Oxford, (1973).

Ibrahim A., and Abul-Hajj Y.J., Aromatic hydroxylation and sulfation of 5-hydroxyflavone by
Streptomyces fulvissimus, Applied and Environmental Microbiology, (1989), 55 (12),
3140-3142.

Ibrahim R.K., Ananvoranich S., Varin L. and Gulick P.J., The flavonol sulfotransferase family :
from metabolites to genes, Polyphenols 94, INRA, Paris, (1995), 79-87.

Iwu M.M., in Handbook of African Medicinal Plants, CRC press, United States, (1993), 40.

183
Jay M., Hasan A., Voirin B., Favre-Bonvin J. et Viricel M.R., Les flavonoïdes de Dorycnium
suffruticosum et de tetragonolobus siliquosus (Leguminosae), Phytochemistry, (1978),
17, 1196-1198.

Jennings. W.G. and Shibamoto T., Qualitative Analysis of Flavor and Fragrance Volatiles by
Glass Capillary Gas Chromatography, Académic Press, New York, (1980).

Kann N., Rein T., Akermark B. and Helquist P., New functionalized Horner-Wadsworth-
Emmons reagents : Useful building blocks in the synthesis of polyunsaturated aldehydes.
A short synthesis of (+)-(E,E)-coriolic acid, J. Org. Chem., (1990), 55, 5312-5323.

Kayser O. and Kolodziej H., Antibacterial activity of extracts and constituents of Pelargonium 
sidoides and Pelargonium reniforme, Planta Medica, (1997), 63, 508­510.

Kerharo J. et Bouquet A., in Plantes Médicinales et Toxiques de la Côte­d’Ivoire­Haute­Volta, 
Vigot Frères, Paris, (1950), 146.

Kim Ha J. and Lindsay R.C., J. Food Comp. Anal., (1989), 2, 118.

Kirtikar K.R. and Basu B.D.,  in  Indian Medicinal Plants, vol I second edition, M/S, Delhi, 


(1975), 616­621.

Kitada Y., Miyauchi T., Satoh A. and Satoh S., Effects of antidepressants in the rat forced
swimming test, European J. of Pharmacology, (1981), 72, 145-152.

Koizumi M., Shimizu M. and Kobashi K., Enzymatic sulfation of quercetin by


arylsulfotransferase from a human intestinal Bacterium, Chem. Pharm. Bull, (1990), 38
(3), 794-796.

Kondjoyan N. and Berdagué J.L., A Compilation of Relative Retention Indices for the
Analysis of Aromatic Compounds, Laboratoire Flaveur, INRA de Theix, France, (1996).

Kroes B.H., van den Berg A.J.J., Quarles van Ufford H.C., van Dijk H. and Labadie R.P.,
Anti-inflammatory of gallic acid, Planta medica, (1992), 58, 499-504.

Kweifio­Okai G., Triterpene compounds having antiinflammatory and antiarthritic activity, 
Patent Cooperation Treaty (PCT) Int. Appl. 35p., WO 93/09129, (1993).

Kweifio­Okai   G.,   Bird   D.,   Carroll   A.R.,   Ambrose   R.   and   Field   B.,   Effect   of  α­amyrin 
palmitate on adjuvant arthritis, Drugs exptl. Clin. Res., (1994a), 20 (1), 1­5.

Kweifio­Okai G., De Munk F., Rumble B.A., Macrides T.A. and Cropley M., Antiarthritic 
mechanisms of amyrin triterpenes, Research Comm. in Mol. Path. and Pharm., (1994b), 
85 (1), 45­55.

184
Kweifio­Okai   G.,   Bird   D.,   Field  B.,   Ambrose   R.,   Carroll   A.R.,   Smith   P.  and   Valdes   R., 
Antiinflammatory activity of a Ghanaian antiarthritic herbal preparation : III,  Journal  
of Ethnopharmacology, (1995), 46, 7­15.

Lacroix   C.R.,   Gerrath   J.M.   and   Posluszny   U.,   The   developmental   morphology   of  Leea  
guineensis. I. vegetative development, Bot. Gaz., (1990), 151 (2), 204­209.

Lavergne R.,  in  Tisaneurs et Plantes Médicinales Indigènes de l’île de La Réunion, Orphie, 


Livry Gargan, (1990), 276­278.

Le Maout E. et Decaisne J., in Traité Général de Botanique Descriptive et analytique, Firmin­
Didot et Cie, Paris, (1876).

Li C.J., Elgamal M.H., Sharker K.H., Ahmed A.A., Mabry T.J., A new sulfated flavonoid from
Zygophyllum dumosum, Natural Product Letters, (1996), 8, 281-284.
Lin C.-N. and Tome W.-P., Antihepatoxic principles of Sambucus formosana, Planta Medica,
(1988), 223-224.

Luther   H.,   Jordanov   D.,   Ludwig   P.   and   Schewe   T.,   Inhibition   of   rabbit   erythroid   15­
lipoxygenase   and   sheep   vesicular   gland   prostaglandin   H   synthase   by   gallic   esters, 
Pharmazie, (1991), 46, 134­136.

Mabry T.J., Markham K.R. and Thomas M.B., The systematic identification of flavonoids,
Springer-Verlag, Berlin, (1970).

Mackeen M.M., Ali A.M., Abdullah M.A., Nasir R.M., Mat N.B., Razak A.R. and Kawazu K., 
Antinematodal   Activity   of   Some   Malaysian   Plant   Extracts   against   the   Pine   Wood 
Nematode,  Bursaphelenchus xylophilus, Pest. Sci., (1997), 51 (2), 165­170.

MacKenzie A.M., The flavonoids of the leaves of Acacia mearnsii, Phytochemistry, (1969), 8,
1813-1815.

Mahato S.B. and Kundu A.P., Review article number 98, 13C NMR spectra of pentacyclic
triterpenoids-a compilation and some salient features, Phytochemistry, (1994), 37(6),
1517-1575.

Mann P., Tofern B. Kaloga M. and Eich E., Flavonoid sulfates from the Convolvulaceae,
Phytochemistry, (1999), 50, 267-271.

Marsolais F. and Varin L., Mutational analysis of domain II of flavonol 3-sulfotransferase, Eur.
J. Biochem., (1997), 247 (3), 1056-1062.

Marsolais F. and Varin L., Recent developments in the study of the structure-function
relationship of flavonol sulfotransferases, Chemico-Biological Interactions, (1998), 109,
117-122.

185
Masaki H., Okamoto N. Sakaki S. and Sakurai H., Protective effects of hydroxybenzoic and 
their esters on cell damage induced by hydroxyl radicals and hydrogen peroxides, Biol.  
Pharm. Bull., (1997), 20 (4), 304­308.

Massiot   G.,   Dijoux   M.G.   and   Lavaud   C.,  in  Saponins   Used   in   Food   and   Agriculture, 
Advances in experimental medicine and biology vol. 405, Waller and Yamasaki, Plenum 
Press, New York, (1996), 183­192.

McLafferty F.W., Interpretation of mass spectra, Third edition, University Science Books,
USA, (1980).

McLafferty F.W. and Staufer D.B., The Wiley/NBS Registry of Mass Spectral Data, John
Wiley Interscience, USA, (1989).

Mérat   F.V.   et   De   Lens   A.J.,  in  Dictionnaire   Universel   de   Matière   Médicale   et   de 
Thérapeutique Générale, tome I, Baillière J.­B., Paris, (1829).

Merck Index, The Merck Index, an encyclopedia of chemicals, drugs, and biologicals, ed. by
Budavari S., O’Neil M. J., Smith A. and Heckelman P. E., Merck & CO., Inc., USA,
(1989), eleventh ed.

Moriarity D.M., Huang J., Yancey C.A., Zhang P., Setzer W.N., Lawton R.O., Bates R.B. and
Caldera S., AN 128 : 326392 CA, Lupeol is the cytotoxic principle in the leaf extract of
Dendropanax, Planta Medica, (1998), 64(4), 370-372.

Nagai H., Osuga K. and Koda A., Inhibition of hypersensitivity reactions by soluble derivatives
of baicalein, Japan J. Pharmacol., (1975), 25, 763-772.

Nair N.C. and Nambisan P.N.N., Contribution to the floral morphology and embryology of 
Leea sambucina Wild, Bot. Notiser, (1957), 110 (2), 160­172.

Nair N.C., Contribution to the floral morphology and embryology of two species of Leea with 
a   discussion   on   the   taxonomic   position   of   the   genus,  The   Journal   of   the   Indian  
Botanical Society, (1968), XLVII, 193­205.

Nissen P. and Benson A.A., Absence of selenate esters and « selenolipid » in plant, Biochim.  
Biophys. Acta, (1964), 82, 400­402.

Nonaka G.-I., Muta M. and Nishioka I., Myricatin, a galloyl flavanonol sulfate and
prodelphinidin gallates from Myrica rubra, Phytochemistry, (1983), 22 (1), 237-241.

Noreen Y., Serrano G., Perera P. and Bohlin L., Flavan-3-ols isolated from some medicinal
plants inhibiting COX-1 and COX-2 catalysed prostaglandin biosynthesis, Planta
Medica, (1998), 64, 520-524.

186
Öksüz S. and Topcu G., Triterpene fatty acid esters and flavonoids from Inula britannica,
Phytochemistry, (1987), 26(11), 3082-3084.

Op de Beck P., Dijoux M.G., Cartier G. and Mariotte A.M., Quercitrin 3’-sulphate from leaves
of Leea guinnensis, Phytochemistry, (1998), 47 (6), 1171-1173.

Pal D.C., Observations on folklore about plants used in veterinary medicine in Bengal, Orissa 
and Bihar, Bull. Bot. Sur. India, (1980), 22 (1­4), 96­99.

Patil S.G. and Patil V.P., Inter­specific Variations in Stomatal Characters in Vitis, Cissus and 
Leea, Biovigyanam, (1984), 10, 13­20.

Pereira   N.A.,   Ruppelt   Pereira   B.M.,   do   Nascimento   M.C.,   Parente   J.P.   and   Mors   W.B., 
Pharmacological screening of plants recommended by folk medicine as snake venom 
antidotes ;IV.   Protection   against   Jararaca   venom   by   isolated   constituents,  Planta  
Medica, (1994), 60, 99­100.

Pérez L.M., Rojas C.V. and Cori O., The use of quercetin sulphates from Flaveria bidentis as 
inhibitors of the enzymic reduction of carbonyl groups, Phytochemistry, (1986), 25 (7), 
1587­1589.

Peterson T.G., Coward L., Kirk M., Falany C.N. and Barnes S., The role of metabolism in
mammary epithelial cell growth inhibition by the isoflavones genistein and biochanin A,
Carcinogenesis, (1996), 17 (9), 1861-1869.

Pharmacopée Française Xème Edition, Maisonneuve SA, Moulins, Les Metz, (1983).

Phou Ngeun Souk­Aloun, in La médecine bouddhique traditionnelle en pays Theravada, Roger 
Jollois, Limoges, (1995), 112.

Pongprayoon U., Baeckström P., Jacobsson U., Lindström M. and Bohlin L., Antispasmodic
activity of β-damascenone and E-phytol isolated from Ipomoea pes-caprae, Planta
Medica, (1992), 58, 19-21.

Radt F., Triterpenes, in Elseviers’s encyclopedia of organic chemistry, Elsevier, USA, (1940),
528-593.

Rajab M.S., Cantrell C.L., Franzblau S.G. and Fischer N.H., Antimycobacterial activity of (E)-
Phytol and derivatives : A preliminary structure-activity study, Planta Medica, (1998),
64, 2-4.

Rama Rao A.V., Rajarathnam Reddy E., Sharma G.V.M., Yadagiri P. and Yadav J.S., A
stereoselective synthesis of coriolic acid and dimorphecolic acid, Tetrahedron Letters,
(1985), 26 (4), 465-468.

Rao C.P., Hanumaiah T., Vemuri V.S.S. and Jagannadha Rao K.V., Flavonol 3-glycosides from
the leaves of Flemingia stricta, Phytochemistry, (1983), 22 (2), 621-622.

187
Rao C.V., Newmark H.L. and Reddy B.S., AN 128 :278727 CA, Chemopreventive effect of
squalene on colon cancer, Carcinogenesis, (1998), 19(2), 287-290

Rasool N., Ahmad V.U. and Malik A., Terpenoids from Pentatropis spiralis, Phytochemistry,
(1991), 30 (4), 1331-1332.

Robak J. and Gryglewski R.J., Review Bioactivity of flavonoids, Polish Journal of


Pharmacology, (1996), 48, 555-564.

Reynolds W.F., McLean S., Poplawski J., Enriquez R.G., Escobar L.I. and Leon I., Total
assignment of 13C and 1H spectra of three isomeric triterpenol derivatives by 2D NMR :
An investigation of the potential utility of 1H chemical shifts in structural investigations
of complex natural products, Tetrahedron, (1986), 42, 3419-3428.

Ribéreau-Gayon, Les composés phénoliques des végétaux, Dunod, Paris, (1968).

Ridsdale C.E., A revision of the family Leeaceae, Blumea, (1975), 22 (1), 57­100.

Sakai W.S., Shiroma S.S. and Nagao M.A., A study of raphide microstructure in relation to 
irritation, Scanning electron microscopy, (1984), 11, 979­986.

Saleh N.A.M., El-Sissi H.I. and Nawwar M.A.M., A rhamnetin glucuronide trisulphate from
the leaves of Tamarix aphylla, Phytochemistry, (1975),14, 312-313.

Sato   Y.,   Oketani   H.,   Singyouchi   K.,   Ohtsubo   T.,   Kihara   M.,   Shibata   H.   and   Higuti   T., 
Extraction and purification of effective antimicrobial constituents of Terminalia chebula 
Rets. against Methicillin­Resistant  Staphylococcuc aureus,  Biol. Pharm. Bull., (1997), 
20 (4), 401­404.

Schulte-Elte K.H., Gautschi F., Renold W., Hauser A., Fankhauser P., Limacher J. and Ohloff
G., Vitispirane, important constituents of vanilla aroma, Helvetica Chimica Acta,
(1978), 61 fasc.3, 1125-1133.

Scudiero D.A., Shoemaker R.H., Paull K.D., Monks A., Tierney S., Nofziger T.H., Currens
M.J., Seniff D. and Boyd M.R., Evaluation of a soluble tetrazolium/formazan assay for
cell growth and drug sensitivity in culture using human and other tumor cell lines,
Cancer Research, (1988), 48, 4827-4833.

Seabra R.M. and Correia Alves A., Quercetin 3-glucuronide-3’-sulphate from Hypericum
elodes, Phytochemistry, (1988), 27 (9), 3019-3020.

Seabra R.M. and Correia Alves A., Quercetin 3’-sulphate from Hypericum elodes,
Phytochemistry, (1991), 30 (4), 1344-1345.

Serrano A., Palacios C., Roy G., Cespòn C., Villar M.L., Nocito M. and Gonzàlez­Porqué P., 
Derivatives of gallic acid induce apoptosis in tumoral cell lines and inhibit lymphocyte 
proliferation, Archives of biochemistry and biophysics, (1998), 350 (1), 49­54.

188
Shali N.A., Curtis C.G., Powell G.M. and Roy A.B., Sulphation of the flavonoids quercetin
and catechin by rat liver, Xenobiotica, (1991), 21 (7), 881-893.

Shankaranarayana K.H., Ayyar K.S. and Krishna Rao G.S., Insect growth inhibitor from the
bark of Santalum album, Phytochemistry, (1980), 19, 1239-1240.

Shimamura H., Suzuki H., Hanano M., Suzuki A and Sugiyama Y., Identification of tissues
responsible for the conjugative metabolism of liqiritigenin in rats : An analysis based on
metabolite kinetics, Biol. Pharm. Bull., (1993), 16 (9), 899-907.

Shimizu M. and Tomoo T., Anti-inflammatory constituents of topically applied crude drugs. V.
Constituents and anti-inflammatory effect of Aoki, Aucuba japonica Thunb., Biol.
Pharm. Bull., (1994), 17 (5), 665-667.

Shiojima K., Arai Y., Masuda K., Takase Y., Ageta T. and Ageta H., Mass Spectra of
pentacyclic triterpenoids, Chem. Pharm. Bull., (1992), 40(7), 1683-1690.

Simpson R.F., Strauss C.R. and Williams P.J., Vitispirane : a C13 spiro-ether in the aroma
volatiles of grape juice, wines and distilled grape spirits, Chemistry and Industry, (1977),
663-664.

Stadler M., Mayer A., Anke H. and Sterner O., Fatty acids and other compounds with
nematicidal activity from culture of Basidiomycetes, Planta Medica, (1994), 60, 128-
132.

Staples G.W. and Herbst D.R., Nomenclatur Changes Affecting Cultivated Plants I., Baileya, 
(1996), 23 (4), 169­183.

Stenhagen E., Abrahamsson S. and McLafferty F.W., Registry of Mass Spectral Data . John
Wiley, New York, (1974).

Subarnas A., Oshima Y. and Ohizumi Y., An antidepressant principle of Lobelia inflata L.
(Campanulaceae), Journal of Pharmaceutical Sciences, (1992), 81 (7), 620-621.

Subarnas A., Tadano T., Nakahata N., Arai Y., Kinemuchi H., Oshima Y., Kisara K. and
Ohizumi Y., A possible mechanism of antidepressant activity of beta-amyrin palmitate
isolated from Lobelia inflata leaves in the forced swimming test, Life Sciences, (1993a),
52 (3), 289-296.

Subarnas A., Tadano T., Oshima Y., Kisara K. and Ohizumi Y., Pharmalogical properties of β-
amyrin palmitate, a novel centrally acting compound, isolated from Lobelia inflata
leaves, J. Pharm. Pharmacol., (1993b), 45, 545-550.

Subarnas A., Tadano T., Kisara K. and Ohizumi Y., An α-adrenoceptor-mediated mechanism of
hypoactivity induced by β-amyrin palmitate, J. Pharm. Pharmacol., (1993c), 45, 1006-
1008.

189
Suessenguth K.,  in  Die Natürlichen Pflanzenfamilien, Engler A. und Prantl K., Duncker & 
Humblot, Berlin, (1953), Zweite Auflage, Band 20d, 372­390.

Suwal P.N., Rajbhandari T.K., Malla S.B.and Shrestha T.B.,  in  Medicinal Plants of Nepal, 


Bull. Dept. Med. Plants No.3,H. M. G. of Nepal, Kathmandu Nepal, (1970), p. 22­23, 
38­39, 132.

Takhtajan   A.,  in  Floristic  Regions  of  the  World, University  of   California  press,   Berkeley, 
(1986).

Takhtajan A., in Diversity and classification of flowering plants, California University press, 
New York, (1997).

Tallent   W.H.,   Harris   J.,   Wolff   I.A.   and   Lundin   R.E.,   (R)­13­hydroxy­cis­9,  trans­11­
octadecadienoic   acid,   the   principal   fatty  acid   from  Coriaria   nepalensis  Wall.  seed   oil, 
Tetrahedron Letters, (1966), 36, 4329­4334.

Tarnavschi I.T. and Petria E., Contribution to the knowledge of the miscrosporal structure in 
the fam. Leeaceae., Pollen et Spores, (1968), 10 (2), 221­249.

Tattje D.H.E. and Bos R.,Valeranone, valeranal and vitispirane in the leaf oil of Liquidambar
styraciflua, Phytochemistry, (1979), 18, 876.

Thorne R.F., Classification and geography of flowering plants, Botanical Review, (1992), 58, 
225­348.

Toki K., Saito N., Ueda T., Chibana T., Shigihara A. and Honda T., Malvidin 3-glucoside-5-
glucoside sulphates from Babiana Stricta, Phytochemistry, (1994), 37 (3), 885-887.

Tomás Lorente F. and Ferreres F., Nota. Sulfatos de flavonoides en frutos de Phoenix
dactilifera, Rev. Agroquìm. Tecnol. Aliment., (1988), 28 (4), 581-585.

Tomás-Barberán F.A., Iniesta-Sanmartín E., Ferreres F., Tomás-Lorente F., Trowitzsch-Kienast


W and Wray V., Trans-coniferyl alcohol 4-O-sulphate and flavonoid sulphates from some
Tamarix species, Phytochemistry, (1990), 29 (9), 3050-3051.

Umadevi I. and Daniel M., Taxonomy of the Vitaceae – A chemical approach, Acta Botanica  
Indica, (1991), 19, 168­170.

Varin L. and Ibrahim R.K., Partial purification and characterization of three flavonol-specific
sulfotransferase from Flaveria chloraefolia, Plant Physiol., (1989), 90, 977-981.

Varin L. and Ibrahim R.K., Partial purification and some properties of flavonol 7-
sulfotransferase from Flaveria bidentis, Plant Physiol., (1991), 95, 1254-1258.

190
Varin L., Chapter 8 : Flavonoid sulfation : phytochemistry, enzymology and molecular biology,
in Phenolic metabolism in plants, ed. by Stafford H.A. and Ibrahim R.K., Plenum press,
New York, (1992a), 233-254.

Varin L. and Ibrahim R.K., Novel flavonol-3-sulfotransferase, The Journal of biological


chemistry, (1992b), 267 (3), 1858-1863.

Varin L., Marsolais F., Richard M. and Rouleau M., Sulfation and sulfotransferase 6,
Biochemistry and molecular biology of plant sulfotransferase, FASEB Journal, (1997),
11, 517-525.

Varma S.D., Inhibition of aldose reductase by flavonoids: possible attenuation of diabetic


complications, in Progress in clinical and biological research volume 213, Plant
flavonoids in biology and medicine: biochemical, pharmacological, and structure-activity
relationships, Alan R. Liss, Inc, New York, (1986), 343-358.

Verdcourt B.,  in  Flora of Tropical East Africa, Polhill R.M., A.A. Balkema / Rotterdam / 


Brookfield, (1993).

Warnaar F., Triterpene ester synthesis in latex of Euphorbia species, Phytochemistry, (1987), 
26 (10), 2715­2721.

Watanabe T. and Suga T., Effects of Phytol, a branched, long-chain aliphatic alcohol, on
biochemical values and on hepatic peroxisomal enzymes of rats, Chem. Pharm. Bull.,
(1983), 31, 2756-2761.

Williams C.A., Harborne J.B., Greenham J., Briggs B.G. and Johnson L.A.S., Flavonoid
patterns and the revised classification of australian Restionaceae, Phytochemistry,
(1998), 49 (2), 529-552.

Wong C.-K. and Keung W.M., Daidzein sulfoconjugates are potent inhibitors of sterol sulfatase
(EC 3.1.6.2), Biochemical and Biophysical Research Communications, (1997), 233,
579-583.

Yagi A., Uemura T., Okamura N., Haraguchi H., Imoto T. and Hashimoto K., Antioxidative
sulphated flavonoids in leaves of Polygonum hydropiper, Phytochemistry, (1994), 35
(4), 885-887.

Yasuda T., Mizunuma S., Kano Y., Saito K.-I. and Ohsawa K., Urinary and biliary metabolites
of genistein in rats, Biol. Pharm. Bull., (1996), 19 (3), 413-417.

Yasukawa K., Ogawa H. and Takido M., Two flavonol glycosides from Lysimachia
nummularia, Phytochemistry, (1990), 29 (5), 1707-1708.

Yem Yok Siv, Etude de quelques plantes médicinales du Cambodge, Thèse de l’Université 
René Descartes, Paris, (1971).

Yoshikawa M., Shimada H., Nishida N., Li Y., Toguchida I., Yamahara J. and Matsuda H.,
Antidiabetic principles of natural medicines. II. Aldose reductase and α-glucosidase

191
inhibitors from brazilian natural medicine, the leaves of Myrcia multiflora DC.
(Myrtaceae) : Structure of myrciacitrins I and II and myrciaphenones A and B, Chem.
Pharm. Bull., (1998), 46 (1), 113-119.

Banque informatisée de spectres de masse pour composés aromatiques, INRA Dijon, France,
(1997).

Cancer cell line screening data,
 http://epnws1.ncifcrf.gov    :2345/dis3d/FTP/NATPROD/LEEACEAE.HTML 

GRIN database
www.ars­grin.gov/cgi­bin/npgs/html/tax_search.pl ?Leeaceae

Image Leea
arboretum.harvard.edu/kalimantan/key/ENGLISH/WWW/leea.gif

Phytochemical and Ethnobotanical Database,
http://www.ars-grin.gov/cgi-bin/duke/ethnobot.pl

192
Annexe :

Matériels et méthodes
Fiches produits
Liste des noms usuels des flavones
Liste des noms usuels des flavonols
Liste des figures
Liste des tableaux

193
MATERIELS ET METHODES

I Lyophilisation

La lyophilisation a été effectuée sur les extraits aqueux, acétate d’éthyle et butanolique,
ainsi que pour des fractions aqueuses. Cependant, les extraits EtOAc et BuOH ont été
concentrés sous pression réduite, et repris progressivement à l’eau jusqu’à l’élimination des
solvants organiques. Les phases aqueuses sont alors congelées à –50°C et lyophilisées sur les
appareils USIFROID® et AIRLIQUID LY5®.

II Matériel Chromatographique

A) Chromatographie analytique en couche mince (CCM)

Les analyses sur plaque CCM sont réalisées en grande partie sur des plaques de silice
60 F254 (200x200x0,15 mm) sur feuilles aluminium (SDS). Plus rarement, nous avons utilisé
des plaques en verre (10x10 cm nano) HPTLC Diol F254, et RP18 F254 (Merck).
L’élution est adaptée en fonction des extraits ou composés analysés. La migration se
faisant dans des cuves de type Desaga Heildelberg.
Les révélateurs utilisés pour mettre en évidence les composés ont été la lumière UV
(254 et 366 nm), l’acide sulfurique dilué à 50% dans du MeOH avec observation sous UV
avant et après chauffage.

B) Chromatographie préparative

a) Chromatographie préparative sur couche mince (CCM prép)

Elles sont réalisées sur des plaques de verre (200 X 200 mm) préparées au laboratoire
avec de la silice 60 F254 (2,5-5 mm d’épaisseur) avec un dépôt d’échantillon inférieur de 10 mg
à 30 mg selon l’épaisseur de la plaque.

194
Les plaques sont lavées par élution successive dans du cHex, MeOH et solvant
d’élution chromatographique avant de déposer l’échantillon. L’observation des bandes est fait
sous lampe UV (parfois avec révélation à l’acide d’un coté de la plaque).

b) Chromatographie sur colonne ouverte (CO)

L’appareillage utilisé est classique, cependant nous avons fait en sorte d’utiliser des
dimensions de colonne adéquate à la quantité d’échantillon à séparer (en général le poids de
support sec est de 50 fois celui de l’échantillon).
Plusieurs supports ont été utilisés
Charbon végétal (SDS®)
Silice 60 de granulométrie 63-200 µm (SDS®)
Sephadex LH-20 (Pharmacia®)
Les fractions sont collectées et rassemblées si nécessaire après visualisation CCM.

c) Chromatographie sous vide (VLC)

Les échantillons sont déposés après empattage sur un gel de silice 60 placé dans un
verre fritté N°4.

d) Chromatographie liquide de type SPE (Visiprep®)

Ce sont des colonnes prête à l’emploi sous forme de seringue commercialisé sous le
nom de Visiprep® et remplies par deux types de support différent : silice normale et en silice
greffée C18.

e) Chromatographie sur colonne moyenne pression (CLMP)

Les purifications sont réalisées sur silice (35-70 µm) ou sur silice greffée RP-18 (40-63
µm) dans des colonnes Büchi®. La pression est fournie par une pompe moyenne pression de
type Büchi 688. Les colonnes utilisées dépendent de la complexité et de la masse de la fraction
à purifier. La sortie de colonne est couplée à un détecteur UV (Knauer ®). La détection se
faisant pour la plupart du temps à λ 254 nm. Les solvants d’élution sont dégazés avant
utilisation.

195
C) Chromatographie en phase gazeuse (CPG)

Cette méthode a été utilisée avec un couplage à la spectrométrie de masse (SM) afin d’analyser
les composés volatiles des feuilles et du bois.
Ces analyses en CG/SM ont été réalisées à l’Ecole Nationale Supérieure de Chimie de
Montpellier par le Pr. J.M. BESSIERE.
L’appareillage est constitué d’un chromatographe HP 5890 en phase gazeuse équipé d’un
détecteur d’ionisation de flamme et d’une colonne Optima 1 (Macherey-Nagel®) 25 m X 0,20
mm X 0,25 µm, phase stationnaire polydiméthylsiloxane.
Le gaz vecteur est l’hélium avec un débit constant de 0,6 ml/min.
La température de l’injecteur est de 220°C, celle du détecteur de 250°C. La température de la
colonne est programmée à 50°C pendant 3 min puis augmente jusqu’à 250°C à raison de 3
°C/min.
Le volume d’injection est en général de 0,2 ml.
Le spectromètre de masse couplé est un HP 5791 à potentiel d’ionisation de 75 eV, de vitesse
de balayage de 1,1 s.décade-1 (réitérée dans tout le passage).

Les composés détectés sont présentés dans un tableau en fonction de leurs indices de rétention
de Kováts. Cet indice est établi en comparant le temps de rétention d’un composé à ceux des
deux hydrocarbures les plus proches.
I= 100 X lg[VI/VHi] / lg[VHi+1/VHi] + 100i
I est l’indice de rétention du composé I
Hi est le pic de l’hydrocarbure qui sort immédiatement avant celui du composé I et dont le
nombre d’atomes de carbone est i,
Hi+1 est le pic d’hydrocarbure qui sort immédiatement après celui du composé I.

196
III Méthodes chromatographiques

Toutes les fractions obtenues avec les différentes techniques chromatographiques, pour
la séparation, les regroupements et l’isolement des composés ont été contrôlées par CCM.

A) Extrait hexanique – Purification des triterpènes

20 g de l’extrait Hex sont déposés sur une colonne ouverte de charbon (260 X 80 mm)
et élués au CH2Cl2 par fractions de 500 ml. Les 3 premiers litres sont regroupés dans la
fraction A et les 4 autres dans la fraction B.

Chromatographie de A (9,64g) sur CLMP Si (460 X 70 mm, fractions 500 ml)

Solvants Fractions
cHex CHCl3 MeOH
100 0 0 1-2
90 10 3-4
80 20 5-6
70 30 7-10
60 40 11-12
50 50 13-14
40 60 15-16
30 70 17-18
20 80 19-20
10 90 21-22
0 100 23-24

Après contrôle CCM et regroupement, la fraction [3] donne Terp-5 (1 g) ; les fractions
[4-9] purifiées de nouveau sur CCMprép Si (cHex-EtOAc 9:1) conduisent à Terp-7 (6 mg) ;
les fractions [11-15] donnent Aa et la fraction [16-19] Ab.

Chromatographie de Aa (760 mg) sur CLMP Si (460 X 15 mm, fractions 20 ml)

Solvants Fractions
cHex CHCl3
7 3 1-20
6 4 21-40

Le regroupement de [16-20] conduit à Aaa.

Chromatographie de Aaa (60 mg) sur CLMP C-18 (230 X 15 mm, fractions 20 ml)

Solvants Fractions
MeOH CHCl3
9 1 1-15
8 2 16-25

Les fractions [14-21] rassemblées conduisent à Aaaa.


Chromatographie de Aaaa (30 mg) de nouveau sur CLMP C-18 (230 X 15 mm,
fractions 10 ml)

197
Solvants Fractions
MeOH CHCl3
90 10 1-6
85 15 7-15
80 20 16-21

Les fractions [11-14] conduisent à Terp-6 (9 mg).

Chromatographie de Ab (744 mg) sur CLMP Si (460 X 15 mm, fractions 20 ml)

Solvants Fractions
cHex CHCl3
7 3 1-10
6 4 11-20
5 5 21-40

La fraction [30] conduit à Aba.

Chromatographie de Aba (45 mg) sur CLMP C-18 (230 X 15 mm, fractions 20 ml)

Solvants Fractions
MeOH CHCl3
9 1 1-10
8 2 11-30

La fraction [5] conduit à Terp-1 (20 mg) ; les fractions [9-10] à Terp-4 (20 mg) et les
fractions [11-12] à Abaa.

Chromatographie de Abaa (6 mg) sur CCMP Si (CHCl3-MeOH 9:1) qui conduit à


Terp-3 (1mg).

Chromatographie de B (3,5 g) sur CLMP Si (460 X 70 mm, fraction 40 ml jusqu'à la


fraction 186, après fractions de 100 ml)

Solvants Fractions
cHex CHCl3 MeOH
100 0 0 1-36
95 5 37-55
90 10 56-75
80 20 76-94
70 30 95-113
65 35 114-174
60 40 175-186
50 50 187-191
40 60 192-196
20 80 197-201
0 100 202-205
50 50 206-209

Le regroupement, des fractions [86-119] conduit à Terp-5 (500 mg) et les fractions
[206-207] à Ba.

Chromatographie de Ba (200 mg) sur CLMP C-18 (230 X 15 mm, fractions 10 ml)

Solvants Fractions
MeOH CHCl3

198
9 1 1-16
8 2 17-27

La fraction [14-18] permet d’obtenir Baa.

La chromatographie de Baa (11 mg) sur Visiprep Si avec un gradient cHex-EtOAc,


conduit à Terp-3 (9 mg).

5 g d’extrait cHex sont déposés sur une CO Si (400 X 25 mm), et élué au CHCl3. Les
2 premières fractions de 15 ml conduisent à C.

Chromatographie de C (250 mg) sur CLMP C-18 (230 X 15 mm, fraction 15 ml)

Solvants Fractions
MeOH CHCl3
70 30 1-19
65 35 20-

Les fractions [6-7] sont rassemblées et donnent Ca et purifiées sur CCMprép Si (cHex)
pour avoir Terp-2 (25 mg).

B) Extrait dichlorométhane – Purification de polyphénols

6 g de l’extrait CH2Cl2 sont chromatographiés par VLC sur verre fritté (60 X 130 mm,
fractions de 1 L).

Solvants Fractions
cHex CH2Cl2 MeOH
100 0 0 1
70 30 2
50 50 3
30 70 4
0 100 5
70 30 6
50 50 7
30 70 8

La fraction [6] conduit à A et la fraction [7] à B.

Chromatographie de A (850 mg) sur CO sephadex LH-20 (300 X 70 mm), éluée par
CHCl3-MeOH (50:50), fractions de 20 ml.

Les fractions [21-28] conduisent à Aa, et les fractions [34-41] à Ab.

Chromatographie de Aa (530 mg) sur CO charbon (70 X 55 mm, fraction 50 ml)

Solvants Fractions
CHCl3 MeOH
10 0 1-10
9 1 11-20

Après regroupement, les fractions [11-25] conduisent à Aaa.

199
Chromatographie de Aaa (460 mg) sur CLMP Si (460 X 15 mm, fractions de 20 ml)

Solvants Fractions
CH2Cl2 EtOAc
10 0 1-10
9 1 11-20
8 2 21-30
7 3 31-40

Les fractions [9-10] correspond à AGr-1 (30 mg) ; les fractions [15-19] à Aaaa et les
fractions [20-24] à Aaab.

Chromatographie de Ab (30 mg) sur CLMP C-18 (230 X 15 mm, fractions 20 ml)

Solvants Fractions
H2O MeOH
6 4 1-10
5 5 11-20

Les fractions [6-10] conduisent à AcPh-2 (4 mg) et la fraction [16] à Aba.

Chromatographie de B (140 mg) sur CLMP Si (460 X 15 mm, fractions de 100 ml)

Solvants Fractions
CHCl3 MeOH
10 0 1
9 1 2-4

La fraction [2] conduit à Ba, les fractions [3-4] à Bb.

Chromatographie de Bb (60 mg) sur CLMP C-18 (230 X 15 mm), avec un mélange
isocratique MeOH-H2O (50:50), fractions de 20 ml. Les fractions [7-9] conduisent à Bba.

Chromatographie de Bba (20 mg) sur CO Sephadex LH-20 (320 X 50 mm), élué au
MeOH, fraction de 50 ml. Les fractions [1-3] donnent Bbaa et [8-11] Bbab.

Les fractions Aba et Bbab sont regroupées et chromatographiée sur CCMprép Si


(EtOAc-MeOH-H2O 100:16,5:13,5) pour donner Flav-7 (5 mg).

C) Extrait à l’acétate d’éthyle – Purification de polyphénols

10 g de l’extrait EtOAc sont chromatographiés sur CLMP Si (460 X 70 mm),


fractions de 500 ml.

Solvants Fractions
EtOAc MeOH
100 0 1-14
90 10 15-28
80 20 29-36
70 30 37-44

200
Les fractions [7-16] après regroupement mènent à A, la fraction [19] correspond à
Flav-1 (36 mg), les fractions [23-28] à B et les fractions [29-37] à C.

Chromatographie de A (420 mg), sur CLMP C-18 (460 X 15 mm, fractions 100 ml)

Solvants Fractions
H2O MeOH
100 0 1-5
90 10 6-9

Les fractions [5-6] conduisent à Aa ;

Chromatographie de Aa (50 mg) sur CO Sephadex LH-20 (190 X 10 mm) et éluée


dans un mélange isocratique CHCl3-MeOH (1:1 ), fractions de 10 ml. Les fractions [4-6]
conduisent à Ac Ph-1 (25 mg).

Chromatographie de B (580 mg) sur CLMP C-18 (460 X 15 mm, fractions 250 ml)

Solvants Fractions
H2O MeOH
100 0 1-3
90 10 4-6
80 20 7-11
70 30 12-14
65 35 15-17
60 40 18-24
50 50 25-31
45 55 32-35

La fraction [4] conduit à Ac Ph-1 (30 mg), les fractions [21-22] à Ba, les fractions [29-
30] à Bb et les fractions [31-35] à Bc.

Chromatographie de Ba (70 mg) sur 2 CCMprép Si (EtOAc-MeOH-H2O


100:16,5:13,5 v:v:v), donne Flav-3 (20 mg) et Flav-4 (30 mg).

Chromatographie de Bb (20 mg) sur CCMprép Si (EtOAc-MeOH-H2O


100:16,5:13,5), donne Flav-3 (6 mg) ;

Chromatographie de Bc (150 mg) sur CO Sephadex LH-20 (120 X 60 mm), élution


MeOH, fractions de 20 ml. La fraction [3] donne Flav-3 (10 mg), et la fraction [4] Flav-2 (50
mg).

Chromatographie de C (1 g) sur CLMP C-18 (460 X 70 mm, fractions 100 ml)

Solvants Fractions
H2O MeOH
60 40 1-9
50 50 10-15

Les fractions [6-11] conduisent à Ca (30 mg) qui donne après CCMprép Si (EtOAc-
MeOH-H2O 100:16,5:13,5), Caa qui est purifiée sur Visiprep C-18 pour donner Flav-4 (8
mg).

201
D) Extrait butanolique – Purification des flavonoïdes

2 g de l’extrait BuOH sont chromatographiés sur VLC Si (130 X 60 mm, fractions


500 ml)

Solvants Fractions
CH2Cl2 MeOH
80 20 1
60 40 2-3
50 50 4
40 60 5-7
20 80 8

Les fractions [2-5] donnent A, et les fractions [6-9] donnent B.

Chromatographie de A (500 mg) sur CO Sephadex LH-20 (120 x 60 mm), fractions 20


ml, élution MeOH. La fraction [3] conduit à Flav-4 (6 mg), la fraction [4] donne Flav-5 (20
mg) et les fractions [5-8] donnent Aa.

Chromatographie de Aa sur CLMP C-18 (230 X 15 mm, fraction 20 ml)

Solvants Fractions
H2O MeOH
100 0 1-10
90 10 11-20
80 20 21-30
70 30 31-40

Les fractions [16-19] donnent Flav-6 (6 mg) et les fractions [22-38] donnent Flav-5 (3
mg).

Chromatographie de B (800 mg) sur CO Sephadex LH-20 (120 X 60 mm) et éluée au


MeOH, fractions 100 ml. Les fractions [5-7] conduisent à Ba.

202
Chromatographie de Ba (80 mg) sur CLMP C-18 (230 X 15 mm, fractions 100 ml)

Solvants Fractions
H2O MeOH
100 0 1-3
90 10 4-7

Les fractions [3-5] donnent Baa.

Chromatographie de Baa (15 mg) sur CLMP C-18 (230 X 15 mm, fractions 10 ml)

Solvants Fractions
H2O MeOH
100 0 1-13
95 5 14-17

Les fractions [7-9] conduisent à Flav-6 (3 mg).

E) Extrait aqueux – Purification de flavonoïdes

4 g de l’extrait H2O sont chromatographiés sur VLC Si (130 X 60 mm), fractions de


500 ml.

Solvants Fractions
CH2Cl2 MeOH H2O
20 80 0 1
0 100 2-3
80 20 4

La fraction [2] correspond à Flav-5 (6 mg), et les fractions [3-4] donnent A.

Chromatographie de A (380 mg) sur CLMP C-18 (230 X15 mm, fractions 100 ml)

Solvants Fractions
H2O MeOH
100 0 1-4
95 5 5-10
90 10 1-17
80 20 18-23
70 30 24-28
60 40 29-33
40 60 34-42
20 80 43-48

Les fractions [24-29] donnent Aa, les fractions [31-37] conduisent à Flav-5 et les
fractions [38-43] à Flav-2.

Chromatographie de Aa (30 mg) sur CO Sephadex LH-20 (320 X 50 mm) et éluée au


MeOH, fractions de 100 ml. Les fractions [20-22] correspondent à Flav-6 (11 mg).

203
IV Mesures spectrales

A) Spectres UV

Les spectres sont enregistrés sur un spectrophotomètre U-2000 (Hitachi®). En général


les spectres sont enregistrés dans le MeOH avec ajout de réactifs spécifiques préparés selon
Mabry [1970].

B) Spectres de masse (SM)

Plusieurs techniques ont été employées : impact électronique (EI), désorption et


ionisation chimique (DCI), matrice NH3+isobutane, bombardement par atomes accélérés
(FAB), matrice glycérol. Les spectres sont enregistrés sur un spectromètre de masse
quadripolaire R 210C couplé à un ordinateur IPC (P2A) MSCAN WALLIS. Les spectres sont
réalisés par le Dr BOSSO (service de spectrométrie de masse du Centre d’Etude et de
Recherche sur les Macromolécules Végétales CERMAV - Grenoble).

C) Spectres de résonance magnétique nucléaire (RMN)

Les spectres RMN sont enregistrés pour la plupart sur un appareil Bruker AC 200 de
l’UFR de Pharmacie de Grenoble, dont la fréquence nominale du proton est de 200,13 MHz et
celle du carbone 13 de 50,03 MHz. Quelques spectres ont été enregistrés sur un appareil
Bruker AMX 400 (400,13 MHz proton 100,61 MHz carbone 13) (Laboratoire de biophysique
du Centre de Recherche du Service de Santé des Armées CRSSA - Grenoble), sur unappareil
Bruker 500 MHz à Reims, ou sur un 300 MHz (C.E.A. de Grenoble).
Les mesures sont réalisées dans les solvants deutériés suivant : CDCl3, CD3OD,
DMSO-d6 ou D2O. Les valeurs de déplacements chimiques, δ en ppm, sont exprimées par
rapport au signal du tétraméthylsilane (TMS).

D) Mesure du pouvoir rotatoire [α] 20


D

Les [α] 20 ®
D (c = 0,2) sont mesurés sur un polarimètre Perkin Elmer , de type PE-341,

contre la raie D du sodium à λ 589 nm à 20,0°C, dans une cuve de 1 ml et de 10 cm de


longueur au laboratoire de Chimie organique de l’UFR de Pharmacie.

204
V Méthodes chimiques

A) Recherche de tanins

50 mg d’extrait EtOAc, BuOH, H2O sont placés respectivement dans un ballon de 100
ml avec 15 ml H2O distillé et 7 ml du réactif de Stiasny (mélange formol-HCl 2:1 v:v). Les
ballons sont portés à ébullition 30 min. L’apparition d’un précipité rouge indique la présence de
tanins condensés. La solution refroidie est filtrée sur papier. Le filtrat recueilli est saturé en
acétate de sodium. Par ajout de quelques gouttes de fer, la solution se colore en bleu-noir,
indiquant la présence de tanins hydrosolubles.

B) Recherche d’alcaloïdes

20g de feuilles sèches sont mouillées dans 25ml de NH4OH aqueux à 20%. Puis, on
ajoute 200ml d’acétate d’éthyle et on laisse macérer 24H. Après lixiviation, les marcs sont
épuisés par trois fois 100ml d’EtOAc. Cette phase EtOAc est extraite à trois reprises par
H2SO4 à 5%. La phase acide est alors alcalinisée par NH4OH jusqu’à pH = 8 puis est extraite à
trois reprise par du CHCl3. La phase chloroformique est rincée à l’eau distillée jusqu’à pH = 7,
filtrée sur Na2SO4 et concentrée. De cet extrait (20mg), la mise en évidence des alcaloïdes par
les réactifs classiques de Dragendorff et de Mayer s’avère négative.

C) Recherche de saponines

L’extrait butanolique a la propriété de former après agitation, une mousse persistante


qui signe la présence de saponosides. Or, la présence de tanins et de polysaccharides dans cet
extrait peut être à l’origine de faux positifs. Pour le vérifier, l’extrait butanolique sec a été
repris dans 500ml d’eau distillée et épuisé, trois fois, par 1L de butanol saturé en H2O. Cette
phase butanolique concentrée (4g) est reprise dans un minimum d’eau (30ml). Une
précipitation est alors effectuée par ajout d’acétone (500ml). Sur CCM, la fraction soluble et le
précipité ne montrent pas la présence de saponines, après révélation à l’acide (H 2SO4 50% dans
EtOH).

D) Hydrolyse du palmitate β-amyrine

50 mg de palmitate β-amyrine sont hydrolysés par une solution de KOH à 5% dans


l’EtOH, à reflux pendant 2H. Une extraction au CHCl3 permet d’obtenir 9,4 mg β-amyrine. La
phase alcaline est alors acidifiée par ajout de quelques gouttes d’HCl 1N. Une nouvelle
extraction au CHCl3 conduit à l’obtention de 2,5 mg d’acide palmitique.

205
VI Tests biologiques

A) Evaluation des extraits EtOAc, BuOH et H2O sur la viabilité cellulaire

Test effectué à l’Institut de Recherche Pierre Fabre (Toulouse)


Département Evaluation et Exploration Fonctionnelle et Cutanée
Laboratoire de Biologie Cellulaire
Par Mme M.-F. ARIES

Matériel :

Hotte à flux d’air laminaire vertical / GELAIRE® BSB 4A Labo FWW


Incubateur à CO2 / Hereaus type B 5060 EK/CO2
Centrifugeuse CRKR BECKMAN®
Microscope inversé Nikon®
Microspectrophotomètre MULTISKAN®
Flacons de culture CORNING®
Plaques de culture 96 puits NUNCLON® Delta
Pipettes automatiques de distribution (GILSON® - MICROMAN® / BIOHIT – PROLINE®)
Pointes stériles (GILSON® – MICROMAN® Capillaires et Pistons / TREFF)
Tubes à centrifuger 50ml : Réf 132593 – 73660 NUNC POLYLABO®

Matériel biologique:

Lignée cellulaire de kératinocytes humains SVK14

Réactifs :

Milieu de culture MEM : Réf 041-01095 M / GIBCO BRL


Milieu de culture DMEM sans rouge de phénol : Réf 041-01880M / GIBCO BRL
SDS : Sodium dodécyl sulfate : Réf 13760-1000 / MERCK
SVF : Sérum de veau fœtal : réf 013967 EUROBIO
Tampon phosphate PBS sans Ca++ : réf 076-01300N / GIBCO BRL
XTT : Sodium 3,3[1[(phenylamino)carbonyl]-3,4-tetrazolium bis(4-methoxy-6-nitro)] benzene
sulfonic acid hydrate : Réf X4251 / SIGMA
Coenzyme Q : Réf D9150 / SIGMA
Trypsine EDTA : Réf 043.05300M / GIBCO BRL

Produits testés :

Extrait à l’acétate d’éthyle


Extrait butanolique
Extrait aqueux

Les produits ont été testés aux concentrations suivantes : 0,01 µg/ml, 0,1 µg/ml, 1 µg/ml, 10 µ
g/ml et 100 µg/ml.

Selon les échantillons, une solution mère est préparée dans le DMSO à 1 g/ml ou directement
dans le milieu de culture à 1 mg/ml.

206
Toutes les dilutions sont réalisées dans le milieu de culture à 1% de SVF.

Protocole :

Le protocole suivi est celui décrit par : Neal W. ROEHM et al., Journal of Immunological
Methods, 142, (1991), 257-265.

Le principe du test est basé sur la transformation enzymatique d’un sel de tétrazolium, le XTT,
en un produit coloré, le formazan.
Le XTT est réduit par les déshydrogénases mitochondriales des cellules vivantes en présence
d’un agent couplant d’électrons, le coenzyme Q, en un composé hydrosoluble jaune/orangé, le
formazan dosable par spectrométrie à 450 nm.

Protocole opératoire :

La lignée cellulaire SVK 14 est cultivée dans du MEM avec 10% de SVF.

t-18H :

Ensemencement des cellules à raison de 1,5.104 cellules par puits sous un volume de 100 µl de
milieu de culture à 10% de SVF. Incubation à 37°C durant 18H en présence d’une atmosphère
saturée en H2O et à 5% de CO2.

T=0 :

Elimination du milieu de culture et rinçage des microplaques à l’aide de 100 µl de PBS par
puits.
Introduction des différentes concentrations d’échantillons sous un volume de 100 µl de milieu
de culture avec 1% de SVF.
Incubation à 37°C pendant 48H.

T+48H :

Révélation de la viabilité cellulaire,


Elimination des surnageants de culture.
Rinçage des microplaques à l’aide de 100 µl de PBS par puits.
Introduction de 50 µl par puits d’une solution de XTT (0,5 mg/ml) en présence de coenzyme
Q (40 µg/ml).
Incubation de 3H à 37°C en atmosphère saturée en H2O et avec 5% de CO2.
Arrêt de la métabolisation du XTT en ajoutant 100 µl par puits d’une solution de SDS à 10%.
Lecture de la densité optique au spectrophotomètre Multiskan à 450 nm.

207
B) Activité du palmitate de β-amyrine et des extraits EtOAc, BuOH, H2O sur la
production de prostaglandine 6KF1α par les kératinocytes humains

Test effectué à l’Institut de Recherche Pierre Fabre (Toulouse)


Département Evaluation et Exploration Fonctionnelle et Cutanée
Laboratoire de Biologie Cellulaire
Par Mmes M.-F. ARIES et C. VAISSIERE

Matériel biologique :

Lignée cellulaire : kératinocytes humains SVK14


Plaques de culture 6 puits : 30 mm de diamètre

Réactifs :

Milieu de culture MEM : Réf GIBCO 041-01095 M


Tampon phosphate PBS pH 7,4 : réf GIBCO 076-01300 N
Trypsine EDTA : réf GIBCO 043.05300 M
Sérum de veau fœtal (SVF) : réf DUTSCHER 300121
Enzyme Immuno Assay (EIA) System :EUROMEDEX
Ionophore calcique A23187 SIGMA : réf C7522

Produits testés :

extrait à l’acétate d’éthyle


extrait butanolique
extrait aqueux
palmitate de β-Amyrine (OPA 77C)

Protocole :

- La suspension de kératinocytes (1x106 cellules/2ml) dans le MEM 10% SVF est distribuée
dans les plaques 6 puits (1x106 cellules/puits) et incubée pendant 16 heures à 37°C dans une
atmosphère à 5% CO2. Les kératinocytes sont alors rincés avec du PBS pour éliminer les
cellules non-adhérentes puis exposés aux produits à tester inclus dans du MEM sans SVF (qui
pourrait interférer dans le dosage).

- Selon les extraits, une solution mère à 1 g/ml d’échantillon est préparée dans le DMSO ou
directement dans le milieu de culture à 1 mg/ml. Des dilutions sont réalisées dans du MEM
sans SVF.
Les extraits sont testés en culture aux concentrations 0,1, 1 et 5 µg/ml.

- Le palmitate de β-Amyrine est solubilisé dans du DMSO à 200 mg/ml. Une solution mère à
500µg/ml est ensuite préparée dans le MEM sans SVF.
L’échantillon est testé en culture aux concentrations de 10, 50 et 100 µg/ml.

Ces concentrations ont été choisies après un test de cytotoxicité et qui n’a révélé aucune
toxicité.

208
Pour chaque lot, 3 puits sont réalisés. Les cellules sont pré-incubées pendant 60 mn avec le
produit à tester puis un agent stimulant de la cascade de l'acide arachidonique, l’ionophore
calcique (A23187 à 5µM), est ajouté pendant 5 heures.
Ce temps écoulé, les milieux de culture de chaque puits sont récupérés, centrifugés à 3000
tr/mn et conservés à -80°C.

La production de prostaglandine 6KF1α pour chacun des essais est mesurée par le Kit Elisa
EUROMEDEX.

Les lots suivants ont été réalisés :

- Lot témoin
- Lot témoin stimulé A23187 5µM
- Extrait acétate d’éthyle 0,1 µg/ml + A23187 5µM
- Extrait acétate d’éthyle 1 µg/ml + A23187 5µM
- Extrait acétate d’éthyle 5 µg/ml + A23187 5µM

- Extrait butanolique 0,1 µg/ml + A23187 5µM


- Extrait butanolique 1 µg/ml + A23187 5µM
- Extrait butanolique 5 µg/ml + A23187 5µM

- Extrait aqueux 0,1 µg/ml + A23187 5µM


- Extrait aqueux 1 µg/ml + A23187 5µM
- Extrait aqueux 5 µg/ml + A23187 5µM

- palmitate de β-amyrine 10 µg/ml + A23187 5µM


- palmitate de β-amyrine 50µg/ml + A23187 5µM
- palmitate de β-amyrine 100µg/ml + A23187 5µM

C) Activité du palmitate de β-amyrine sur l’expression de l’ARNm de la


métalloprotéinase MMP-1

Test effectué à l’Institut de Recherche Pierre Fabre (Toulouse)


Département Evaluation et Exploration Fonctionnelle et Cutanée
Laboratoire de Biologie Cellulaire
Par Mmes A. BEL et M. CHARVERON

Cellules :

Des fibroblastes humains normaux sont isolés à partir de biopsies cutanées issues de plasties
mammaires et cultivés dans du milieu de culture DMEM (Gibco- Ref : 41965-039),
supplémenté en sérum de nouveau-né (SNN) (10%) et en antibiotiques
Pénicilline/Streptomycine (P/S) (1%).

209
Réactifs et Matériel:

Milieu de culture DMEM (Gibco - Réf : 41965-039)


Sérum de nouveau-né (Gibco - Réf : 16010084)
Trypsine EDTA (Gibco - Réf : 043-05300)
Tampon phosphate (PBS) pH 7,4 : (Gibco - Réf : 076-01300)
Phorbol 12-Meristate 13-Acetate (PMA) (Sigma - Réf : P8139)
Boîte de culture 60mm (Falcon - Réf : 3004)
Kit extraction RNA-PLUS (Bioprobe - Réf : RNAPO2)
Kit Access RT-PCR System (Promega - Réf : A1250)
Agarose (Promega - Réf : V312A)
Bromure d’ethidium (Sigma - Réf : E8751)

Echantillon testé :

palmitate de β-amyrine

Protocole :

A confluence, les fibroblastes humains normaux sont décollés à l’aide de la trypsine et sont
réensemencés dans des boîtes de 60 mm à un taux d’ensemencement de 0,8x10 6 cellules dans
du DMEM avec 10% SNN, 1% P/S. Les cellules sont incubées pendant 18 heures à 37°C, 5%
CO2, atmosphère humide. Les cellules, ici à passage P4, sont ainsi prêtes pour les tests.

Le palmitate de β-amyrine est testé à la concentration finale de 100µg/ml. Dans du DMEM,


1% SNN et 1% P/S, concentration déjà testée en activité anti-inflammatoire et présentant des
propriétés anti-inflammatoires significatives. Les cellules sont préincubées avec les actifs
pendant 24 heures. Un témoin est réalisé en parallèle ne contenant que du DMEM avec 1%
SNN et 1% P/S. Au bout de 24 heures, les cellules sont rincées au PBS et sont alors mises en
contact pendant 24 heures supplémentaires avec la stimulation inflammatoire chimique (PMA à
0,1µM), préparée dans du DMEM avec 1% SNN et 1% P/S. En parallèle, un témoin absolu est
réalisé n’ayant reçu aucune stimulation inflammatoire. En fin de stimulation, les ARN totaux
sont extraits.

Extraction des ARN totaux :


L’extraction se fait à l’aide du kit RNA PLUS suivant le protocole indiqué. Les cellules sont
lysées par la solution d’extraction du kit, puis les ARN sont extraits par des traitements
successifs au chloroforme, à l’éthanol 75% et l’isopropanol. L’ARN est récupéré et dosé par
spectrométrie.

RT-PCR :
1µg d’ARN totaux est utilisé pour la réaction de RT-PCR. A cet ARN est ajouté un mélange de
dNTP, d’enzymes Reverse transcriptase et DNA Polymérase, de MgSO4 25mM, de tampon,
issu du kit Access RT-PCR System (Promega) et les deux amorces. Celles-ci, issues de la
séquence de la MMP-a pour la réaction d’hybridation, sont les suivantes :

amorce 5’ : 5’ CGACTCTAGAAACACAAGAGCAAGA 3’
amorce 3’ : 5’ AAGGTTAGCTTACTGTCACACGCTT 3’

210
Après amplification, les divers échantillons sont déposés dans un gel d’agarose 3% soumis à un
champ électrique. En fin de migration, le gel préalablement coloré au bromure d’ethidium est
observé sous UV.

D) Mesure d’une activité antiradicalaire

Matériel :

Spectrophotomètre U-2000 (Hitachi) pour les extraits


Lecteur de plaques 96 puits pour les composés
Microplaque 96 puits Seroawe Réf : 612F96

Réactifs :

DPPH (radical 2,2-diphényl-1-picrylhydrazyl) : Réf 43180 / Fluka®


TROLOX (acide 6-hydroxy-2,5,8-tetramethylchromane-2-carboxylique, dérivé de la vitamine
E) : Réf 56510 / Fluka®

Produits testés :

Extrait EtOAc
Extrait BuOH
Extrait H2O
Acide gallique
Gallate d’éthyle
Kaempferol
Quercétine
Quercitrine
Quercitrine 3’-sulfate
Quercétine 3,3’-disulfate
Quercétine 3,3’,4’-trisulfate

Les extraits sont testés dans le MeOH à une concentration de 20 mg/L. Les composés quant à
eux, ont été testés dans le MeOH aux concentrations suivantes : 200, 100, 50, 10 et 2 µM.

Protocole :

-Pour les extraits, le protocole suivi est celui de : Fourneau C. et al., Phytotherapy Research,
10, (1996), 529-530.

L’évaluation de l’activité antioxydante est évaluée en ajoutant 2 ml d’une solution de DPPH


(0,25 mmole/L dans MeOH) à 2 ml d’une solution de l’échantillon (20 mg/L dans MeOH).
Après agitation, on laisse reposer 1H à l’obscurité puis on mesure à λ 521 nm contre le MeOH.
La dégradation du DPPH est évaluée par comparaison avec l’échantillon standard (2ml de
DPPH et 2 ml de MeOH). Il est procédé à trois mesures par échantillon.

-Pour les composés testés, nous ajoutons dans les plaques 96 puits, 100 µl de la solution à
analyser et 100 µl de solution de DPPH à 0,5 mM dans le MeOH (le témoin est effectuer avec
100 µl de MeOH et 100 µl de solution de DPPH). Après agitation, on place la plaque à

211
l’obscurité à TA pendant 30 min, puis on lit l’absorbance à λ 550 nm. Nous avons procédé à 3
mesures par échantillon.

Les mesures sont effectuées après 30 min, temps au bout duquel l’activité est maximale et
stable.
Le résultat est exprimé en pourcentage de dégradation du DPPH :
DO de la solution X
% de dégradation du DPPH = 1- X 100
DO dans le MeOH

212
VII FICHES

Terp-1 (E-phytol)

2 CH2OH
11 7
1
15

PM = 296 C20H40O

Comportement chromatographique :

CCM SiO2 cHex-EtOAc (9:1 v:v) Rf=0,18

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 5,39 (H-2, 1H, tq, J=1,2 et 6,9 Hz), 4,13 (H-1, 2H, d, J=6,9 Hz), 1,97 (H-4,
2H, t, J=7,4 Hz), 1,65 (Me-3, 3H, sl), 1,53 (H-15, 1H, hept, J=6,4 Hz), 0,85 (H-16
et Me-15, 6H, d, J=6,5 Hz), 0,83 (Me-7 et Me-11, 6H, d, J=6,3 Hz)

C: δ 140,3 (C-3), 123,1 (C-2), 59,5 (C-1), 39,9 (C-4), 39,4 (C-14), 37,4 (C-8, C-
13

10 et C-12), 36,7 (C-6), 32,8 (C-7 et C-11), 28,0 (C-15), 25,2 (C-5), 24,8 (C-13),
24,5 (C-9), 22,7 (C-16 et Me-15), 19,8 (Me-7 et Me-11), 16,2 (Me-3)

Données SM DCI (NH3+ isobutane), mode négatif

m/z : 314 [M+NH4]+, 297 [M+H]+, 296 [M+NH4-H2O]+, 279 [M-H2O+H]+, 123
(C9H15+), 97 (C7H13+), 85 (C5H9O+), 83 (C6H11+), 81 (C6H9+)

213
Terp-2 (squalène)

19 23

15

6 10

PM = 410 C30H50

Comportement chromatographique :

CCM SiO2 cHexane Rf=0,6


CCM C-18 MeOH-CHCl3 (70:30 v:v) Rf=0,6

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 5,10 (H-3, H-22, H-7, H-11, H-14, H-18, m), 2,1-2,0 (H-4, H-21, H-8, H-17),
2,05-1,95 (H-12, H-13), 2,0-1,9 (H-5, H-9, H-16, H-20), 1,66 (Me-1 et Me-24, s,
6H), 1,58 (Me-2, Me-23, Me-6, Me-10, Me-15 et Me-19, 18H, s)

C (J modulé): δ 135,10 (C, C-6, C-19), 134,89 (C, C-10, C-15), 131,22 (C, C-2,C-
13

23), 124,42 (CH, C-3, C-22), 124,31 (CH, C-7, C-11, C-14, C-18), 39,75 (CH2, C-5,
C-9, C-16, C-20), 28,28 (CH2, C-12, C-13), 26,79 (CH2, C-4, C-21), 26,70 (CH2, C-
8, C-17), 25,67 (CH3, Me-1, Me-24), 17,66 (CH3, Me-2, Me-23), 16,03 (CH3, Me-6,
Me-10, Me-15, Me-19)

Données SM DCI (NH3 + isobutane):

m/z : 428 [M+NH4]+, 411 [M+H]+, 428 [M+H]+, 342 [M-C5H9+H]+, 274 [M-
C10H17+H]+, 206 [M-C15H25+H]+, 138 [M-C20H33+H]+, 70 [M-C25H41+H]+

214
Terp-3 (lupéol)
29
30 CH2
20
21
19

22

25 26 28

3 27

HO

24 23

PM = 426 C30H50O

Comportement chromatographique :

CCM SiO2 cHexane-EtOAc (70:30 v:v) Rf=0,5

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 4,67 (H-29a, 1H, dl, J=2,5 Hz), 4,55 (H-29b, 1H, dd, J=2,5 et 1,2 Hz), 3,18
(H-3, 1H, dm, J=10 Hz), 2,34 (H-19, 1H, m), 1,66 (Me-30, 3H, sl), 1,01 (Me-27,
3H, s), 0,95 (Me-25, 3H, s), 0,92 (Me-23, 3H, s), 0,89 (Me-28, 3H, s), 0,85 (Me-26,
3H, s), 0,74 (Me-24, 3H, s)

C (J modulé) : δ 151,0 (C-20), 109,3 (C-29), 79,0 (C-3), 55,4 (C-5), 50,5 (C-9),
13

48,4 (C-18), 47,8 (C-19), 43,0 (C-17), 42,8 (C-14), 40,8 (C-8), 40,0 (C-22), 38,8
(C-4), 38,7 (C-1), 38,1 (C-13), 37,2 (C-10), 35,6 (C-16), 34,3 (C-7), 29,7 (C-21),
28,0 (C-23), 27,5 (C-2, C-15), 25,2 (C-12), 21,0 (C-11), 19,4 (C-30), 18,4 (C-6),
18,0 (C-28), 16,1 (C-25), 16,0 (C-26), 15,4 (C-24), 14,5 (C-27)

Données SM DCI (NH3 + isobutane):

m/z : 444 [M+NH4]+, 427 [M+H]+, 409 [M-H2O+H]+, 394 [M-H2O-Me+H]+, 218
(g), 207 (a), 203 (g-15), 190 [a-OH+H]+, 136, 135, 121

215
Terp-4 (β-amyrine)
29 30

12
H
25 26
28

3 27
HO
24 23

PM = 426 C30H50O

Comportement chromatographique :

CCM SiO2 cHexane - CHCl3 (5:5 v:v) Rf=0,08


cHexane - EtOAc (9:1 v:v) Rf=0,22

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 5,17 (H-12, 1H, t, J=3,6 Hz), 3,21 (H-3, 1H, dd, J=5,4 et 9,9 Hz), 2,1-1,0 nd,
1,12 (Me-27, 3H, s), 0,98 (Me-26, 3H, s), 0,95 (Me-25, 3H, s), 0,92 (Me-23, 3H, s),
0,85 (Me-29 et Me-30, 6H, s), 0,82 (Me-28, 3H, s), 0,78 (Me-24, 3H, s)

C (J modulé): δ 145,2 (Q C-13), 121,7 (CH C-12), 79,0 (CHOH C-3), 55,2 (CH C-
13

5), 47,7 (CH C-9), 47,3 (CH C-18), 46,9 (CH2 C-19), 41,7 (Q C-14), 39,8 (Q C-8),
38,8 (Q C-4), 38,6 (CH2 C-1), 37,2 (CH2 C-22), 37,0 (Q C-10), 34,8 (CH2 C-21),
33,3 (CH3 C-29), 32,7 (CH2 C-7), 32,5 (Q C-17), 31,1 (Q C-20), 28,4 (CH3 C-28),
28,1 (CH3 C-23), 27,3 (CH2 C-2), 27,0 (CH2 C-16), 26,2 (CH2 C-15), 26,0 (CH3 C-
27), 23,7 (CH3 C-30), 23,6 (CH2 C-11), 18,4 (CH2 C-6), 16,8 (CH3 C-26), 15,6 (CH3
C-24 et C-25)

Données SM DCI (NH3 + isobutane):

m/z : 427 [M+H]+, 412 [M-CH3+H]+, 409 [M-H2O+H]+, 218 (g’), 207 (a), 203
(g’-15), 189 (g’-29, a-18)

216
Terp-5 (palmitate de β-amyrine)
29 30

12 H
25 26
28

3 27
C15 H31 COO
24 23

PM = 664 C46H80O2

Comportement chromatographique :

CCM SiO2 cHexane- CHCl3(50:50 v:v) Rf=0,6


cHexane-CH2Cl2-EtOAc (75:20:5 v:v:v) Rf=0,45
CCM C-18 MeOH-CHCl3 (70:30 v:v) Rf=0,63

Pouvoir rotatoire

[α] 20
D = +58° (c 0,2, CHCl3)

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 5,16 (H-12, 1H, t, J=3,5 Hz), 4,49 (H-3, 1H, dd, J=7,6 et 8,3 Hz), 2,27 (H-2’,
2H, t, J=7,5 Hz), 2,2-1,2 nd, 1,11 (Me-27, 3H, s), 0,95 (Me-25 et Me-24 ou Me-26,
6H, s), 0,85 (Me-23, Me-24 ou Me-26, Me-28, Me-29 et Me-30, 15H, sl), 0,81 (Me-
16’, 3H, s)

C (J modulé) : δ 173,5 (COO C-1’), 145,2 (C C-13), 121,7 (CH C-12), 80,6
13

(CHOO C-3), 55,3 (CH C-5), 47,6 (CH C-9), 47,3 (CH C-18), 46,8 (CH2 C-19),
41,7 (C C-14), 39,8 (C C-8), 38,3 (CH2 C-1), 37,7 (C C-4) 37,8, 37,2 (CH2 C-22),
36,9 (C C-10), 34,8 (CH2 C-21 et C-2’), 33,3 (CH3 C-29), 32,6 (CH2 C-7), 32,5 (C
C-17), 31,9 (CH2 C-14’), 31,1 (C C-20), 29,7 (CH2 C-4’), 29,6 (CH2 C-13’), 29,4,
29,3, 29,2, 28,4 (CH3 C-28), 28,1 (CH3 C-23), 26,9 (CH2 C-16), 26,2 (CH2 C-15),
25,9 (CH3 C-27), 25,2 (CH2 C-3’), 23,7 (CH3 C-30), 23,6 (CH2 C-11), 23,5 (CH2 C-
2), 22,7 (CH2 C-15’), 18,3 (CH2 C-6), 16,8 (CH3 C-24 et C-26), 15,5 (CH3 C-25),
14,1 (CH3 C-16’)

Données SM

DCI (NH3 + isobutane):


m/z : 682 [M+NH4]+, 665 [M+H]+, 650 [M-CH3+H]+, 409 [M-palm+H]+, 256
(palmitoyl), 239 (palm-OH), 218 (g’), 207 (a), 203 (g’-15), 189 (a-18 et g’-29)
EI
m/z : 664 [M].+

217
Terp-6 (coriolate de β-amyrine)
30 29

12

25 26 28

1' 3 27
9' COO
Z
13' 24 23
18'
E
11'
OH

PM = 704 C48H80O3

Comportement chromatographique :

CCM SiO2 cHexane - EtOAc (9:1 v:v) Rf=0,22

Données UV (CH2Cl2) et pouvoir rotatoire :

λmax = 236 nm
[α] 20
D = +32° (c 0,2, CHCl3)

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 6,47 (H-11’, 1H, dd, J=11,2 et 15,1 Hz), 5,95 (H-10’, 1H, dd, J=11,1 et 11,4
Hz), 5,65 (H-12’, 1H, dd, J=15,2 et 8,2 Hz), 5,48 (H-9’, 1H, dd, J=11,5 et 7,5 Hz),
5,16 (H-12, 1H, t, J=3,5 Hz), 4,49 (H-3, 1H, dd, J=7,6 et 8,2 Hz), 4,11 (H-13’, 1H,
m), 2,27 (H-2’, 2H, t, J=7,3 Hz), 2,1-1,0 nd, 1,12 (Me-27, 3H, s), 0,98 (Me-26, 3H,
s), 0,95 (Me-25, 3H, s), 0,92 (Me-23, 3H, s), 0,85 (Me-29 et Me-30, 6H, s), 0,82
(Me-28, 3H, s), 0,78 (Me-24, 3H, s)
13
C (J modulé) : δ 173,6 (COO C-1’), 145,2 (C C-13), 135,8 (CH C-12’), 133,0 (CH
C-11’)°, 127,7 (CH C-10’)°, 125,8 (CH C-9’), 121,7 (CH C-12), 80,6 (CHOO C-3),
72,9 (C C-13’), 55,3 (CH C-5), 47,6 (CH C-9), 47,3 (CH C-18), 46,8 (CH2 C-19),
41,7 (C C-14), 39,8 (C C-8), 38,3 (CH2, C-1), 37,8 (C C-4), 37,3 (CH2 C-22), 36,9
(C C-10), 34,8 (CH2 C-21 et C-2’), 33,3 (CH3 C-29), 32,6 (CH2 C-7), 32,5 (C C-
17), 31,1 (C C-20), 28,4 (CH3 C-28), 28,1 (CH3 C-23), 27,0 (CH2 C-16), 26,2 (CH2
C-15), 26,0 (CH3 C-27), 25,3 (CH2 C-3’), 23,7 (CH3 C-30), 23,6 (CH2 C-11), 23,5
(CH2 C-2), 22,6 (CH2 C-17’), 18,3 (CH2 C-6), 16,8 (CH3 C-24 et C-26), 15,5 (CH3
C-25), 14,0 (CH3 C-18’)
° interchangeable

Données SM DCI (NH3 + isobutane):

m/z : 722 [M+NH4]+, 705 [M+H]+, 690 [M-CH3+H]+, 409 [M-H2O+H]+, 295
(C18H31O3+), 279 (C18H31O2+), 218 (g’), 207 (a), 203 (g’-15), 189 (g’-29, a-18), 167,
71 (C4H9+)

218
Terp-7 (palmitate d’α-amyrine)
30

29 19

12
25 26 28

3
27
C15H31COO
1'
24 23

PM = 664 C46H80O2

Comportement chromatographique :

CCM SiO2 cHexane- CHCl3(50:50 v:v) Rf=0,6


CCM C-18 MeOH-CHCl3 (50:50 v:v) Rf=0,5

Pouvoir rotatoire :

[α] 20
D = +53° (c 0,2, CHCl3)

Données RMN en ppm dans CDCl3 à 200 (50) MHz :


1
H: δ 5,11 (H-12, 1H, t, J=3,6 Hz), 4,48 (H-3, 1H, dd, J=7,6 et 9,6 Hz), 2,27 (H-2’,
2H, t, J=7,5 Hz), 2,2-0,80 nd

C (J modulé) : δ 173,6 (COO C-1’), 139,8 (C C-13), 124,4 (CH C-12), 80,6
13

(CHOO C-3), 59,1 (CH C-18), 55,3 (CH C-5), 47,7 (CH C-9), 42,1 (C C-14), 41,6
(CH2 C-22), 40,1 (C C-8), 39,6 (CH C-19 et C-20), 38,5 (CH 2 C-1), 37,7, 37,8 (C
C-4), 36,8 (C C-10), 34,9 (CH2 C-2’), 33,8 (C C-17), 32,9 (CH2 C-7), 31,9 (CH2 C-
14’), 31,3 (CH2 C-21), 29,7 (CH2 C-4’), 29,6 (CH2 C-13’), 29,4, 29,3 (CH2 C-15),
29,2, 28,7 (CH3 C-23), 28,1 (CH3 C-28), 26,6 (CH2 C-16), 26,2, 25,2 (CH2 C-3’),
23,7 (CH2 C-2), 23,4 (CH2 C-11), 23,3 (CH3 C-27), 22,7 (CH2 C-15’), 21,4 (CH3 C-
30), 18,3 (CH2 C-6), 17,5 (CH3 C-29), 16,8 (CH3 C-24 et C-26), 15,7 (CH3 C-25),
14,1 (CH3 C-16’)

Données SM

DCI (NH3 + isobutane):


m/z : 682 [M+NH4]+, 665 [M+H]+, 409 [M-palm+H]+, 256 (palmitoyle), 218 (g’)

219
Flav-1 (kaempferol)
OH
4'

HO O

3
OH
5

OH O

PM = 286 C15H10O6

Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,8

Données UV (MeOH) :

λ max = 265 et 365 nm respectivement bande II et I


+NaOAc 274, 302,5, 389, +NaOAc+H3BO3 269, 375, +NaOMe 278, 415déc, +AlCl3
268, 352, 427, +AlCl3+HCl 268,5, 350,5, 427

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 12,46 (OH-5, s), 10,73 (OH-7, s)°, 10,06 (OH-3, s)°, 9,33 (OH-4’, s)°, 8,03
(H-2’et H-6’, 2H, dd, J=2,6 et 8,9 Hz), 6,91 (H-3’ et H-5’, 2H, dd, J=2,7 et 8,9),
6,43 (H-8, d, J=2,0), 6,18 (H-6, d, J=1,9)
° interchangeable

C: δ 175,9 (C-4), 163,8 (C-7), 160,7 (C-5), 159,1 (C-4’), 156,1 (C-9), 146,8 (C-2),
13

135,6 (C-3), 129,4 (C-2’ et C-6’), 121,6 (C-1’), 115,4 (C-3’ et C-5’), 103,0 (C-10),
98,1 (C-6), 93,4 (C-8)

Données SM FAB: matrice glycérol, mode négatif

m/z : 285 [M-H]-

220
Flav-2 (quercétine)

OH
3'
OH
4'

HO O
9
10 3
5 OH
OH O

PM = 302 C15H10O7

Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,75


EtOAc-AcCOOH-HCOOH-H2O (100:11:11:26 v:v:v:v) Rf=0,9
BAW : BuOH-AcCOOH-H2O (4:1:5 v:v:v) Rf=0,8

Données UV (MeOH) :

λmax = 255 et 369 nm respectivement bande II et I


+NaOAc 267,5, 322,5, 389,5 déc, +NaOAc+H3BO3 259, 386, +NaOMe 252, 325
déc, +AlCl3 271, 339, 456, +AlCl3+HCl 268,365, 429

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 12,46 (OH-5), 10,76 (OH-7)°, 9,55 (OH-3)°, 9,30 (OH-4’)°, 9,26 (OH-3’)°,
7,66 (H-2’, d, J=1,8 Hz), 7,53 (H-6’, dd, J= 8,4 et 2,0 Hz), 6,87 (H-5’, d, J=8,5 Hz),
6,40 (H-8, d, J=1,7 Hz), 6,17 (H-6, d, 1,6 Hz)
° interchangeable

C: δ 175,8 (C-4), 163,6 (C-7), 160,7 (C-5), 156,1 (C-9), 147,8 (C-4’), 146,7 (C-
13

2), 145,0 (C-3’), 138,6 (C-3), 121,9 (C-1’), 119,9 (C-6’), 115,5 (C-5’), 114,9 (C-2’),
102,9 (C-10), 98,1 (C-6), 93,3 (C-8)

Données SM

DCI (NH3+ isobutane), mode négatif


m/z : 303 [M+H]+
FAB: matrice glycérol, mode négatif
m/z : 301 [M-H]-

221
Flav-3 (quercitrine) OH

OH
4'

HO O

3
O

OH O Rha-1
OH
OH
O
OH
CH3
Rha-6

PM = 448 C21H20O11
Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,65


BAW : BuOH-AcCOOH-H2O (40:10:50 v:v:v) Rf=0,75
EtOAc-HCOOH-AcCOOH-H2O (100:11:11:26 v:v:v:v) Rf=0,75

Données UV (MeOH) :

λmax = 255 et 347,5 nm respectivement bande II et I


+NaOAc 270,5, 369, +NaOAc+H3BO3 259,5, 365, +NaOMe 269,5, 388,5, +AlCl3
273,5, 383, 429,5, +AlCl3+HCl 270, 399,5, HCl 255, 350

Pouvoir rotatoire :

[α] 20
D = -158° (c 0,2, MeOH)

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 12,64 (OH-5), 10,83 (OH-7)°, 9,66 (OH-4’)°, 9,29 (OH-3’)°, 7,29 (H-2’, d,
J=1,9 Hz), 7,24 (H-6’, dd, J=2,2 et 8,4 Hz), 6,86 (H-5’, d, J=8,3 Hz), 6,38 (H-8, d,
J=2,0 Hz), 6,20 (H-6, d, 2,0 Hz), 5,24 (Rha-1, d, 1,1 Hz), 3,96 (Rha-2, sl), 3,50
(Rha-3, dd, J=3,1 et 8,6 Hz), 3,29-3,21 (Rha-4, nd), 3,21-3,08 (Rha-5, nd), 0,81
(Rha-6, d, J=5,5 Hz) ° interchangeable

C: δ 177,7 (C-4), 164,1 (C-7), 161,2 (C-5), 157,2 (C-9), 156,4 (C-2), 148,4 (C-
13

4’), 145,1 (C-3’), 134,2 (C-3), 121,0 (C-6’), 120,7 (C-1’), 115,8 (C-5’), 115,4 (C-
2’), 104,0 (C-10), 101,8 (Rha-1), 98,6 (C-6), 93,6 (C-8), 71,1 (Rha-4), 70,5 (Rha-
3), 70,3 (Rha-2), 70,0 (Rha-5), 17,4 (Rha-6)

Données SM

DCI (NH3+ isobutane), mode négatif


m/z : 449 [M+H]+, 303 [M-Rha+H]+, 164 (Rha)
FAB: matrice glycérol, mode négatif
m/z : 447 [M-H]-, 301 [M-Rha-H]-

222
Flav-4 (quercitrine 3’-sulfate)
OSO3-

OH
4'

HO O

3
O

OH O Rha-1
OH
OH
O
OH
CH3
Rha-6

PM = 527 C21H19O14S

Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,4


BAW : BuOH-AcCOOH-H2O (40:10:50 v:v:v) Rf=0,6
EtOAc-HCOOH-AcCOOH-H2O (100:11:11:26 v:v:v:v) Rf=0,5

Données UV (MeOH) :

λmax = 265 et 342 nm respectivement bande II et I


+NaOAc 268, 344, +NaOAc+H3BO3 269, 342, +NaOMe 272, 324, 392, +AlCl3 273,
357, 395, +AlCl3+HCl 274, 341, 389,5, HCl 256, 355

Pouvoir rotatoire :

[α] 20
D = -10° (c 0,2, MeOH)

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 12,59 (OH-5), 10,83 (OH-7), 9,62 (OH-4’), 7,76 (H-2’, d, J=2,0 Hz), 7,52 (H-
6’, dd, J=2,3 et 8,5 Hz), 6,96 (H-5’, d, J=8,1 Hz), 6,39 (H-8, d, J=2,0 Hz), 6,20 (H-
6, d, J=2,1 Hz), 5,20 (Rha-1, sl), 3,98 (Rha-2, sl), 3,55 (Rha-3, m), 3,1 (Rha-4, nd)
3,3-3,0 (Rha-5, nd), 0,80 (Rha-6, d, J=5,7 Hz)

C: δ 177,6 (C-4), 164,2 (C-7), 161,2 (C-9), 156,7 (C-5), 156,4 (C-2), 151,7 (C-
13

4’), 140,7 (C-3’), 134,5 (C-3), 125,6 (C-6’), 123,0 (C-1’), 120,8 (C-2’), 117,0 (C-
5’), 104,1 (C-10), 102,0 (Rha-1), 98,7 (C-6), 93,6 (C-8), 71,4 (Rha-4), 70,6 (Rha-
3), 70,1 (Rha-2 et Rha-5), 17,4 (Rha-6)

Données SM FAB: matrice glycérol, mode négatif

m/z : 527 [M-H]-, 447 [M-SO3-H]-, 300 [M-SO3-Rha-H]-

223
Flav-5 (quercétine 3,3’-disulfate)

OSO3-
3'
OH
4'

HO O
9
10 3
5 OSO3-
OH O

PM = 462 si 2H (506 si 2Na) C15H10O13S2

Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,15


BAW : BuOH-AcCOOH-H2O (4:1:5 v:v:v) Rf=0,38

Données UV (MeOH) :

λmax = 268 et 342 nm respectivement bande II et I


+NaOAc 275, 307s, 387 +NaOAc+H3BO3 268, 349, +NaOMe 275, 328s, 398,
+AlCl3 276, 308s, 364, 396s, +AlCl3+HCl 277, 349, 395s, HCl 255, 369

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :

H: δ 8,04 (H-6’, dd, J=2,3 et 8,6 Hz), 7,85 (H-2’, d, J=2,1 Hz), 6,87 (H-5’, d, J=8,7
1

Hz), 6,39 (H-8, d, J=2,1 Hz), 6,16 (H-6, d, J=2,1 Hz)

C: δ 177,6 (C-4), 163,9 (C-7), 161,2 (C-5), 156,0 (C-9), 155,7 (C-2), 151,8 (C-
13

4’), 140,5 (C-3’), 132,5 (C-3), 126,9 (C-6’), 123,0 (C-1’), 121,6 (C-2’), 116,8 (C-
5’), 104,1 (C-10), 98,4 (C-6), 93,3 (C-8)

Données SM FAB: matrice glycérol, mode négatif

m/z : 499 [M+K-2H]-, 483 [M+Na-2H]-, 461 [M-H]-, 403 [M-SO3+Na-2H]-, 381
[M-SO3-H]-, 301 [M-2SO3-H]-

224
Flav-6 (quercétine 3,3’,4’-trisulfate)

OSO 3 -
3' OSO 3-
4'
HO O
7
3
5 OSO 3-
OH O

PM = 542 (si 3H) C15H10O16S3


Comportement chromatographique :

CCM SiO2 BAW : BuOH-AcCOOH-H2O (4:1:5 v:v:v) Rf=0,1

Données UV (MeOH) :

λmax = 268 et 311 nm respectivement bande II et I


+NaOAc 275, 356 +NaOAc+H3BO3 268, 313, +NaOMe 276, 360, +AlCl3 279, 307s,
389, +AlCl3+HCl 277, 337, HCl 325, 368

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :

H: δ 8,12 (H-2’, d, J=2,2 Hz), 8,03 (H-6’, dd, J=2,2 et 8,9 Hz), 7,59 (H-5’, d, J=8,9
1

Hz), 6,33 (H-8, d, J=2,0 Hz), 6,16 (H-6, d, J=2,0 Hz)

C: δ 177,6 (C-4), 162,8 (C-7), 160,2 (C-5), 154,8 (C-9), 147,5 (C-2), 145,3 (C-
13

4’), 141,7 (C-3’), 132,1 (C-3), 123,5 (C-1’), 122,5 (C-6’), 118,5 (C-2’), 117,4 (C-
5’), 103,0 (C-10), 97,3 (C-6), 92,0 (C-8)

Données SM FAB: matrice glycérol, mode négatif

m/z : 655 [M+3K-4H]-, 617 [M+2K-3H]-, 585 [M+2Na-3H]-, 563 [M+Na-2H]-, 541
[M-H]-, 499 [M-SO3+K-2H]-, 461 [M-SO3-H]-, 381 [M-2SO3-H]-, 301 [M-3SO3-H]-

225
Flav-7 (méarnsitrine)
OH

OMe
4'

HO O
OH

3
O

OH O Rha-1
OH
OH
O
OH
CH3
Rha-6

PM = 478 C22H22O12

Comportement chromatographique :

CCM SiO2 BAW : BuOH-AcCOOH-H2O (40:10:50 v:v:v) Rf=0,80


EtOAc-HCOOH-AcCOOH-H2O (100:11:11:26 v:v:v:v) Rf=0,75

Données UV (MeOH) :

λmax = 263 et 337,5 nm respectivement bande II et I


+NaOAc 271,5, 360, +NaOAc+H3BO3 264, 330, +NaOMe 272, 361, +AlCl3 272,5,
300s, 337, 391, +AlCl3+HCl 273, 338,5, 389

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 12,56 (OH-5), 11,9 (OH-7), 9,46 (OH-3’, OH-5’), 6,82 (H-2’ et H-6’, s, 2H),
6,37 (H-8, d, J=2,1 Hz), 6,20 (H-6, d, 2,0 Hz), 5,13 (Rha-1, d, 1,5 Hz), 3,98 (Rha-2,
sl), 3,72 (4’-OMe, s, 3H), 3,5-3,0 (Rha-3, Rha-4 et Rha-5, nd), 0,79 (Rha-6, d, J=5,4
Hz)

C: δ 150,7 (C-4’), 108,1 (C-2’ et C-6’), 102,1 (Rha-1), 98,2 (C-6), 93,2 (C-8),
13

71,1 (Rha-4), 70,5 (Rha-3), 70,3 (Rha-2), 70,1 (Rha-5), 59,8 (4’-OMe), 17,5 (Rha-
6)

Données RMN en ppm dans CD3OD


13
C: δ 179,6 (C-4), 166,2 (C-7), 160,0 (C-2), 158,7 (C-9), 151,9 (C-3’ et C-5’),
139,4 (C-4’), 136,7 (C-3), 127,1 (C-1’), 109,8 (C-2’ et C-6’), 103,7 (Rha-1), 100,0
(C-6), 94,9 (C-8), 73,3 (Rha-4), 72,1 (Rha-5° et Rha-3°), 71,9 (Rha-2°), 60,9
(4’-OMe), 17,8 (Rha-6)
°
interchangeable, C-5 et C-10 non déterminé

Données SM

DCI (NH3+ isobutane), mode négatif


m/z : 479 [M+H]+, 333 [M-Rha+H]+, 180, 164 (Rha), 152

226
Ac Ph-1 (Acide gallique)
COOH

HO OH
OH

PM = 170 C7H6O5

Comportement chromatographique :

CCM SiO2 EtOAc-MeOH-H2O (100:16,5:13,5 v:v:v) Rf=0,7


CHCl3-MeOH-H2O (60:40:3 v:v:v) Rf=0,6
BAW (4:1:5 v:v:v) Rf=0,8
DIOL Hexane-EtOAc (30:70 v:v) Rf=0,4
C-18 H2O (100 v) Rf=0,7

Données UV (MeOH) :

λmax = 271,5 et 215,0 nm

Données RMN en ppm dans CD3OD à 200 (50) MHz :


1
H: δ 7,05 (H-2 et H-6, s)

C : δ 170,4 (C-1’), 146,4 (C-3 et C-5), 139,6 (C-4), 122,0 (C-1), 110,3 (C-2 et C-
13

6)

Données SM DCI (NH3+ isobutane)

m/z : 188 [M+NH4]+, 171 [M+H]+, 153 [M-H2O+H]+

227
Ac Ph-2 (gallate d’éthyle)

COOCH 2CH 3
1

HO OH
OH

PM = 198 C9H10O5

Comportement chromatographique :

CCM SiO2 CHCl3-MeOH (9:1 v:v:) Rf=0,3

Données UV (MeOH) :

λmax = 273,5 et 215,5

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :

H: δ 7,01 (H-2 et H-6, 2H, s), 4,24 (H-2’, 2H, q, J=7 Hz), 1,31 (H-3’, 3H, t, J=7
1

Hz)

C: δ 168,6 (C-1’), 146,5 (C-3 et C-5), 139,7 (C-4), 121,8 (C-1), 110,0 (C-2 et C-
13

6), 61,7 (C-2’), 14,6 (C-3’)

Données SM EI

m/z : 198 [M].+, 170 (M-C2H5)+, 153 (M-COOEt)+

228
AG-1 (acide palmitique)
OH

1 O
16

PM = 256 C16H32O2

Comportement chromatographique :

CCM SiO2 CHCl3-MeOH (9:1 v:v:) Rf=0,8

Données RMN en ppm dans DMSO-d6 à 200 (50) MHz :


1
H: δ 2,33 (H-2, 2H, t, J=7,3 Hz), 1,7-1,0 (CH2, nd), 0,86 (H-16, 3H, t, J=7 Hz)

C: δ 175,6 (C-1), 33,7 (C-2), 32,0 (C-3 ou C-14), 29,7-29,1 nd, 24,7 (C-15), 22,7,
13

14,1 (C-16)

Données SM EI

m/z : 256 [M].+, et pertes successives de 14 uma

229
VIII Liste des noms usuels pour les flavones

Nom OH OMe C-Gluc


Apigénine 5,7,4’
Hispiduline 5,7,4’ 6
Lutéoline 5,7,3’,4’
Chrysoériol 5,7,4’ 3’
Diosmétine 5,7,3’ 4’
6-hydroxylutéoline 5,6,7,3’,4’
Népétine 5,7,3’,4’ 6
Nodiflorétine 5,6,7,4’ 3’
Jaceosidine 5,7,4’ 6,3’
Hypolaétine 5,7,8,3’,4’
Tricétine 5,7,3’,4’,5’
Tricine 5,7,4’ 3’,5’
Vitexine 5,7,4’ 8
Isovitexine 5,7,4’ 6
Orientine 5,7,3’,4’ 8
Iso-orientine 5,7,3’,4’ 6
Isoscutellaréine 5,7,8,4’

IX Liste des noms usuels pour les flavonols

Nom OH OMe
Kaempferol 3,5,7,4’
Kaempferide 3,5,7 4’
Rhamnocitrine 3,5,4’ 3’
6-hydroxykaempferol 3,5,6,7,4’
Quercétine 3,5,7,3’,4’
Rhamnétine 3,5,3’,4’ 7
Isorhamnétine 3,5,7,4’ 3’
Tamarixétine 3,5,7,3’ 4’
Rhamnazine 3,5,4’ 7,3’
Ombuine 3,5,3’ 7,4’
Myricétine 3,5,7,3’,4’,5’
Patulétine 3,5,7,3’,4’ 6
Eupatolitine 3,5,3’,4’ 6,7
Spinacétine 3,5,7,4’ 6,3’
Jacéidine 5,7,4 3,6,3’
Véronicafoline 3,5,4’ 6,7,3’
Eupatine 3,5,3’ 6,7,4’
Quercétagétine 3,5,6,7,3’,4’
Gossypétine 3,5,7,8,3’,4’

230
X Liste des figures

Page

Figure 1 : Différents types de graines de Vitaceae et Leeaceae 9


Figure 2 : Situation dans la systématique de Leea guineensis G. Don 10
Figure 3 : Répartition géographique des Leea 16
Figure 4 : Représentation de Leea guineensis 17
Figure 5 : Feuille de L. guineensis provenant du Cameroun 20
Figure 6 : Répartition géographique de L. guineensis 21
Figure 7 : Schéma d’une stipule de L. guineensis 22
Figure 8 : Représentation de L. guineensis 23
Figure 9 : Diagramme floral 25
Figure 10 : Les structures chimiques identifiées chez différentes Leea 30
Figure 11 : Anthocyanes sulfatées isolées de Badiana stricta (Iridaceae) 41
Figure 12 : Dihydroflavonol sulfaté isolé de Myrica rubra (Myricaceae) 41
Figure 13 : Structure des nouvelles flavones sulfatées 44
Figure 14 : Structure des nouveaux flavonols sulfatés 47,48
Figure 15 : Modèle biosynthétique pour les flavonoïdes sulfatés chez Flaveria 53
Figure 16 : Métabolisation des polyols 58
Figure 17 : Extraction solide – liquide des feuilles 67
Figure 18 : Extraction liquide – liquide 67
Figure 19 : Isolement des composés de l’extrait hexanique 68
Figure 20 : Isolement des composés de l’extrait dichlorométhane 69
Figure 21 : Isolement des composés de l’extrait acétate d’éthyle 70
Figure 22 : Isolement des composés de l’extrait butanolique 71
Figure 23 : Isolement des composés de l’extrait aqueux 72
Figure 24 : Profils chromatographiques des composés volatiles de bois et de feuilles 73
Figure 25 : Répartition des différentes classes de constituants des distillats 76
Figure 26 : Quelques exemples de spectres SM obtenus 78,79
Figure 27 : Spectre 1H de Terp-1(200 MHz, CDCl3) 80
Figure 28 : Fragmentation du squalène 83
Figure 29 : Spectre 1H de Terp-2 (200 MHz, CDCl3) 83
Figure 30 : Spectre 13C J modulé de Terp-2 (50 MHz, CDCl3) 84
Figure 31 : XHCORR de Terp-2 (CDCl3) 85
Figure 32 : Spectre DCI de Terp-3 87
Figure 33 : Fragmentations classiques d’un squelette de type lupane 88
Figure 34 : Fragmentations classiques du squelette oléanène 89
Figure 35 : Spectre 1H de Terp-4 (200 MHz, CDCl3) 90
Figure 36 : Spectre EI de Terp-5 92
Figure 37 : Fragmentations de Terp-5 92
Figure 38 : Spectre 1H de Terp-5 (200 MHz, CDCl3) 93
Figure 39 : Spectre 13C de Terp-5 (50 MHz, CDCl3) 94
Figure 40 : Corrélations COSY de Terp-5 94
Figure 41 : Spectre DCI de Terp-6 96
Figure 42 : Fragmentations de Terp-6 96
Figure 43 : Spectre 1H de Terp-6 (200 MHz, CDCl3) 97
Figure 44 : Agrandissement du spectre 1H de Terp-6 (500 MHz, CDCl3) 98
Figure 45 : Agrandissement de la COSY de Terp-6 99
Figure 46 : Spectre 13C J modulé de Terp-6 (50 MHz, CDCl3) 99

231
Figure 47 : Spectre 13C J modulé de Terp-7 (50 MHz, CDCl3) 101
Figure 48 : Spectre 1H de Flav-1 (200 MHz, DMSO-d6) 104
1
Figure 49 : Spectre H de Flav-2 (200 MHz, DMSO-d6) 106
Figure 50 : Spectre 13C de Flav-2 (50 MHz, DMSO-d6) 106
Figure 51 : Spectre 1H de Flav-3 (200 MHz, DMSO-d6) 108
13
Figure 52 : Spectre C de Flav-3 (50 MHz, DMSO-d6) 109
Figure 53 : Spectre FAB- de Flav-4 110
Figure 54 : Spectre 1H de Flav-4 (200 MHz, DMSO-d6) 111
13
Figure 55 : Spectre C de Flav-4 (50 MHz, DMSO-d6) 112
Figure 56 : Spectre XHCORR de Flav-4 (200 MHz, DMSO-d6) 113
Figure 57 : Spectre COSY de Flav-4 (DMSO-d6) 114
Figure 58 : Spectre FAB- de Flav-5 115
Figure 59 : Spectre 1H de Flav-5 (200 MHz, DMSO-d6) 116
13
Figure 60 : Spectre C de Flav-5 (50 MHz, DMSO-d6) 117
Figure 61 : Spectre FAB- de Flav-6 118
Figure 62 : Spectre 1H de Flav-6 (200 MHz, DMSO-d6) 119
13
Figure 63 : Spectre C de Flav-6 (100 MHz, DMSO-d6) 120
Figure 64 : Spectre 1H de Flav-7 (300 MHz, DMSO-d6) 121
Figure 65 : Spectre 13C de Ac Ph-1 (50 MHz, CD3OD) 125
1
Figure 66 : Spectre H de Ac Ph-2 (200 MHz, CD3OD) 127
Figure 67 : Spectre EI de AG-1 128
Figure 68 : Métabolisation du XTT en formazan 130
Figure 69 : Activité des extraits EtOAc, BuOH et H2O sur la viabilité des
kératinocytes humains SVK14 en culture pendant 48H 132
Figure 70 : Activité du palmitate de β-amyrine sur la production de prostaglandine 6KPGF1α
par les kératinocytes humains SVK14 stimulés par l’ionophore calcique 5 µM 135
Figure 71 : Activité des extraits sur la production de prostaglandine 6KPGF1α par
les kératinocytes humains SVK14 stimulés par l’ionophore calcique 5 µM 135
Figure 72 : Effet du palmitate de β-amyrine sur l’expression de l’ARNm de la MMP1
à la suite d’une stimulation inflammatoire 138
Figure 73 : Principales réactions dans l’organisme 139
Figure 74 : Activité antiradicalaire des différents extraits à 20 mg/ml 141
Figure 75 : Activité antiradicalaire des composés isolés 141

232
XI Liste des tableaux

Page

Tableau 1 : Classement taxonomique du genre Leea 6


Tableau 2 : Situation des Leeaceae dans la systématique moderne 7
Tableau 3 : Différences essentielles entre les Leeaceae et les Vitaceae 8
Tableau 4 : Classification selon Clarke (1881) 11
Tableau 5 : Classification selon Kirtikar et Basu (1975) 12
Tableau 6 : Criblage de quelques Leea 27
Tableau 7 : Principaux métabolites secondaires identifiés des différentes Leea 29
Tableau 8 : Différentes activités biologiques décrites pour le genre Leea 38
Tableau 9 : Les flavones sulfatées 42
Tableau 10 : les flavonols sulfatés 45
Tableau 11 : Répartition des flavonoïdes sulfatés chez les Magnoliophyta 50
Tableau 12 : Caractéristiques des flavonols sulfotransférases (F-ST) de Flaveria 53
Tableau 13 : Flavonoïdes sulfatés inhibiteurs l’aldose réductase du cristallin obtenus
Par synthèse 58
Tableau 14 : Flavonoïdes sulfatés inhibiteurs de l’aldose réductase du cristallin isolé
de Polygonum hydropiper 59
Tableau 15 : Activité comparée de la rutine et de la rutine sulfate 60
Tableau 16 : Rendements d’extraction 66
Tableau 17 : Composés volatils de bois et de feuilles de L. guineensis 75
Tableau 18 : données RMN de Terp-1 (200/50 MHz, CDCl3) 82
Tableau 19 : données RMN de Terp-2 (200/50 MHz, CDCl3) 86
Tableau 20 : Données RMN 1H des méthyles de Terp-4 (200 MHz, CDCl3) 90
Tableau 21 : Différences essentielles entre le noyau oléan-12-ène et urs-12-ène 91
Tableau 22 : Récapitulatif des données 13C des triterpènes et de leurs esters 102
Tableau 23 : Effet de la sulfatation en 3’ sur Flav-4 112
Tableau 24 : Effet de la sulfatation en 3,3’ de Flav-5 117
Tableau 25 : Effet de la sulfatation en 3,3’,4’ de Flav-6 119
Tableau 26 : RMN 1H des flavonoïdes (200 MHz, DMSO-d6) 123
Tableau 27 : RMN 13C des flavonoïdes (50 MHz, DMSO-d6) 123
Tableau 28 : UV des flavonoïdes (λmax dans MeOH) 124
Tableau 29 : SM des flavonoïdes en FAB (mode négatif, matrice glycérol) 124
Tableau 30 : Données RMN des Acides Phénols (200/50 MHz, CD3OD) 127
Tableau 31 : Taux de viabilité des kératinocytes en culture après 48H d’incubation
avec les extraits 131
Tableau 32 : Production de prostaglandines 6KF1α avec Terp-5 134
Tableau 33 : Production de prostaglandines 6KF1α avec les extraits 134
Tableau 34 : Pourcentage de dégradation du DPPH par les composés testés 140
Tableau 35 : Différents composés rencontrés chez les Rhamnales 145
Tableau 36 : Liste des terpénoïdes isolés et de leurs propriétés biologiques 146
Tableau 37 : Liste des polyphénols isolés et de leurs propriétés biologiques 147

233