Vous êtes sur la page 1sur 302

Incluye CD-ROM

Gentica Humana
Conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina
Texto multimedia

Francisco Javier Novo Villaverde


www.FreeLibros.me

www.FreeLibros.me

Gentica Humana
Conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina

www.FreeLibros.me

CELL AND MOLECULAR BIOLOGY IN ACTION SERIES

Gentica Humana
Conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina
Texto multimedia
Francisco Javier Novo Villaverde
Departamento de Gentica Universidad de Navarra

Madrid Mxico Santaf de Bogot Buenos Aires Caracas Lima Montevideo San Juan San Jos Santiago So Paulo White Plains

www.FreeLibros.me

Datos de catalogacin bibliogrfica

GENTICA HUMANA. Conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina Francisco Javier Novo Villaverde PEARSON EDUCACIN, S. A., Madrid, 2007 ISBN: 9788483223598 Materia: Gentica, 575 Formato 170 240 Pginas: 000

Todos los derechos reservados. Queda prohibida, salvo excepcin prevista en la Ley, cualquier forma de reproduccin, distribucin, comunicacin pblica y transformacin de esta obra sin contar con autorizacin de los titulares de propiedad intelectual. La infraccin de los derechos mencionados puede ser constitutiva de delito contra la propiedad intelectual (arts. 270 y sgts. Cdigo Penal). DERECHOS RESERVADOS 2007 PEARSON EDUCACIN, S. A. Ribera del Loira, 28 28042 Madrid GENTICA HUMANA. Conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina Francisco Javier Novo Villaverde ISBN: 9788483223598 Deposito Legal: MPEARSON PRENTICE HALL es un sello editorial autorizado de PEARSON EDUCACIN, S. A. Equipo editorial Editor: Miguel Martn-Romo Tcnico editorial: Marta Caicoya Equipo de produccin: Director: Jos Antonio Clares Tcnico: Mara Alvear Diseo de cubierta: Equipo de diseo de Pearson Educacin, S. A. Composicin: Claroscuro Servicio Grfico, S. L. Impreso por: IMPRESO EN ESPAA - PRINTED IN SPAIN

Este libro ha sido impreso con papel y tintas ecolgicos

www.FreeLibros.me

Utilizacin de este texto

Las figuras son un elemento fundamental en este texto multimedia. Por lo tanto, se aconseja vivamente seguir a la vez el texto y las figuras. El mtodo habitual de estudio comenzar con la lectura de un apartado para intentar comprender los conceptos y mecanismos mostrados. A continuacin, el lector deber observar atentamente las figuras correspondientes a ese apartado, volviendo despus al texto para repasar y fijar los contenidos que no hubiesen quedado claros en la primera lectura. En la pgina web www.unav.es/genetica/GH/ estarn disponibles actualizaciones, noticias, enlaces, etc., relacionados con este texto.

www.FreeLibros.me

ndice de contenido

Prlogo A) Introduccin 1. El flujo de la informacin gentica 1.1 Los cidos nucleicos 1.2 Visin general del proceso de expresin gnica 1.3 La transcripcin 1.4 Regulacin de la transcripcin en eucariotas 1.5 Maduracin del ARN mensajero 1.6 El ayuste (splicing) y su regulacin 1.7 Traduccin y cdigo gentico en eucariotas 2. El ADN en el ncleo de la clula eucariota 2.1 La cromatina durante el ciclo celular 2.2 Replicacin de la cromatina en interfase 2.3 Formacin y segregacin de los cromosomas durante la mitosis 2.4 Gametognesis y meiosis 2.5 Recombinacin a nivel molecular 3. Tcnicas bsicas de gentica molecular 3.1 Tecnologa del ADN recombinante: mtodos y usos ms frecuentes 3.2 Enzimas de restriccin 3.3 Tcnicas bsicas de hibridacin de cidos nucleicos 3.4 Amplificacin in vitro de ADN (PCR) 3.5 Secuenciacin del ADN 3.6 Microarrays B) El genoma humano 4. La geografa del genoma humano 4.1 Historia y desarrollo del Proyecto Genoma Humano

IX

3 3 5 6 8 9 10 13 17 17 19 23 25 29 33 33 37 38 40 44 47

51 51

www.FreeLibros.me

VIII

4.2 Estructura del genoma humano y variacin inter-individual 4.3 El ADN repetitivo 4.4 El genoma mitocondrial 5. El genoma humano en accin 5.1 La secuencia influye en el estado funcional de la cromatina 5.2 Modificaciones epigenticas y su importancia en la regulacin del estado funcional de la cromatina 5.3 Relacin entre secuencia, estructura y funcin de la cromatina: territorios cromosmicos 6. Origen de la variacin gentica en humanos 6.1 Variacin en el ADN: polimorfismos y mutaciones 6.2 Mecanismos de reparacin del ADN en humanos. Enfermedades causadas por alteraciones en los mecanismos de reparacin C) La transmisin de los caracteres hereditarios 7. Gentica mendeliana 7.1 Planteamiento experimental de Mendel 7.2 Monohbridos: primera Ley de Mendel 7.3 Segunda Ley de Mendel: dihbridos y trihbridos 7.4 Redescubrimiento del trabajo de Mendel 7.5. Dnde estn los factores unitarios? La teora cromosmica de la herencia 8. Herencia relacionada con el sexo 8.1 Cada sexo tiene distinta constitucin cromosmica 8.2 Los genes situados en el cromosoma X muestran un modo especial de herencia 8.3 Determinacin gentica del sexo en humanos 8.4 Compensacin de dosis: hiptesis de Lyon 8.5 Estructura de los cromosomas sexuales humanos 9. Modificaciones de las proporciones mendelianas 9.1 Modo de estimar si se cumplen las proporciones mendelianas esperadas 9.2 Modificaciones de las proporciones mendelianas al estudiar un carcter 9.3 Modificaciones del dihibridismo. Interaccin gnica y epistasia 10. Gentica de los caracteres cuantitativos 10.1 Gentica de los caracteres cuantitativos: experimentos de Johannsen, Nilsson-Ehle y East 10.2 Modelo poligenes-ambiente y enfermedades multifactoriales 10.3 Heredabilidad en sentido amplio y en sentido restringido. Clculo de la heredabilidad en Gentica Humana

58 62 66 69 69 71 78 81 81 82

Gentica Humana

93 94 95 99 102 103 107 107 108 109 111 114 117 117 120 123 129 129 133 135

www.FreeLibros.me

11. Ligamiento gentico en humanos 11.1 El concepto de ligamiento gentico: fraccin de recombinacin y distancia gentica 11.2 Informatividad de los marcadores utilizados en estudios de ligamiento 11.3 El clculo del LOD score 11.4 Ligamiento no paramtrico y su utilizacin en Gentica Humana 12. Los genes en las poblaciones 12.1 El equilibrio de Hardy-Weinberg 12.2 Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios 12.3 Cambios en las condiciones que mantienen el equilibrio: efectos del tamao poblacional 12.4 Cambios en las condiciones que mantienen el equilibrio: migracin o flujo gentico 12.5 Cambios en las condiciones que mantienen el equilibrio: recombinacin y mutacin 12.6 Cambios en las condiciones que mantienen el equilibrio: seleccin 12.7 Aplicaciones en Gentica Humana 12.8 Formacin de la Teora Sinttica de la Evolucin 12.9 Explicacin actual del proceso evolutivo y sus limitaciones D) Patologa gentica 13. Citogentica 13.1 El estudio de los cromosomas humanos 13.2 Anomalas del nmero de los cromosomas 13.3 El fenmeno de no disyuncin meitica 13.4 Anomalas estructurales de los cromosomas 14. Mutaciones simples como causa de enfermedad 14.1 Caractersticas generales de las mutaciones 14.2 Mutaciones simples: tipos y nomenclatura 14.3 Potencial patognico de las mutaciones en el ADN codificante y en el ADN no-codificante intragnico e intergnico 14.4 Potencial patognico de las mutaciones en el ADN no-codificante 14.5 Nomenclatura general de mutaciones 15. Potencial patognico de las secuencias repetidas 15.1 Mutaciones en secuencias que estn repetidas en tndem 15.2 Expansin de trinucletidos: neuropatas por expansiones de CAG y enfermedades por expansin de otros trinucletidos 15.3 Neuropatas por expansiones de CAG 15.4 Enfermedades por expansin de otros trinucletidos 15.5 Otras enfermedades por expansin de secuencias repetidas 15.6 Mutaciones debidas a repeticiones dispersas 15.7 Desrdenes genmicos

139 139 142 144 147 153 153 155 158 160 160 161 165 167 169

IX

ndice de contenido

177 177 180 183 185 189 189 190 190 192 195 199 199 200 201 202 204 205 206

www.FreeLibros.me

16. Efectos fenotpicos de las mutaciones 16.1 Prdida de funcin, fenotipos recesivos y haploinsuficiencia 16.2 Fenotipos dominantes por ganancia de funcin 16.3 Alteraciones de la impronta genmica 16.4 Mutaciones que afectan a la morfognesis 17. Diagnstico de enfermedades genticas 17. 1 Estrategias generales de diagnstico de enfermedades genticas 17. 2 Mtodos de deteccin de mutaciones 17. 3 Aplicacin del ligamiento gentico al diagnstico: el proceso de diagnstico indirecto de enfermedades genticas 18. Gentica clnica 18.1 Gentica clnica y consejo gentico 18.2 Enfermedades de herencia autosmica 18.3 Enfermedades de herencia ligada al cromosoma X 18.4 Teorema de Bayes y su aplicacin al clculo de riesgos genticos 18.5 Enfermedades por alteracin del ADN mitocondrial 18.6 Diagnstico prenatal E) Nuevas herramientas de la gentica moderna 19. Terapia gnica 19.1 Componentes de un sistema de terapia gnica y vas de administracin 19.2 Naturaleza del cido nucleico teraputico 19.3 Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica 19.4 Aplicaciones clnicas de la terapia gnica en el momento actual 20. Bioinformtica del genoma humano 20.1 La Bioinformtica 20.2 Bases de datos en Gentica Humana: bases de datos de secuencias 20.3 Bases de datos en Gentica Humana: bases de datos relacionadas con enfermedades 20.4 Bsquedas en bases de datos con BLAST 20.5 Navegadores del genoma humano ndice analtico

211 212 213 215 221 227 227 228 234 237 237 239 243 246 248 252

Gentica Humana

257 257 258 260 270 273 273 274 276 277 279 281

www.FreeLibros.me

Prlogo

La generalizacin del uso de Internet y de las computadoras domsticas permite concebir libros de texto cada vez ms interactivos, con tutoriales multimedia y enlaces a los abundantsimos sitios educativos disponibles en la Red. Esto es especialmente til en una materia como la Gentica, en la que la percepcin grfica de los procesos es imprescindible para la adecuada comprensin de los conceptos y mecanismos implicados. Este libro de texto es fruto de mi reflexin acerca del modo de impartir la docencia de Gentica a alumnos de disciplinas biomdicas que se enfrentan por primera vez con el apasionante mundo de los genes. Durante aos he venido impartiendo la asignatura de Gentica Humana a alumnos de las licenciaturas de Biologa y Bioqumica de la Universidad de Navarra, y esto me ha permitido preparar poco a poco un manual detallado y abundante material grfico que han constituido el esqueleto del presente texto. Sobre este esqueleto inicial he aadido nuevos captulos y gran cantidad de material multimedia que han dado como resultado este texto de Gentica Humana: conceptos, mecanismos y aplicaciones de la Gentica en el campo de la Biomedicina. Quizs lo que ms llame la atencin sobre este texto es que se presenta en un formato novedoso: slo se incluyen algunas tablas e ilustraciones que ayudan a mantener la fluidez de la lectura, pero todos los materiales grficos se han incluido en un CD que contiene todas las figuras a las que se hace referencia en el texto. El CD est compuesto por una serie de pginas web que se pueden visualizar con cualquier navegador, y que van guiando al alumno paso a paso a travs de tutoriales propios o de enlaces a vdeos o figuras de especial inters para comprender algn concepto. Por tanto, el mayor aprovechamiento se conseguir si el alumno va estudiando el texto y siguiendo al mismo tiempo, con calma, las figuras del CD. Este mtodo permitir, o al menos eso espero, una comprensin rpida de los conceptos y mecanismos, ya que ste es el enfoque que he pretendido dar al texto. En mi opinin, ninguna figura esttica puede suplir la informacin aportada por un video o una animacin comentada, y por ello la mayora de los tutoriales estn grabados con una voz en off que

www.FreeLibros.me

XII

explica lo que se est viendo. Esto supone que el alumno debe utilizar una computadora con tarjeta de sonido y altavoces (o auriculares); para los enlaces externos necesita tambin conexin a Internet. Confo en que la mayora de los hogares cuentan hoy en da con esta tecnologa. Una ventaja (no despreciable) de esta estructura es que permite abaratar significativamente el coste final del producto, al no requerir figuras a color dentro del propio texto; espero que esto ayude tambin a conseguir una amplia difusin del libro. Sin duda, algunos de los que han ledo las lneas precedentes (en especial, colegas en la docencia universitaria de Gentica) habrn pensado que este libro de texto supone una especie de autotexto que podra hacer innecesarias las clases tericas. Nada ms lejos de mi intencin. De todas formas, al elaborar este mtodo he tenido en mente las directrices sobre el nuevo Espacio Europeo de Educacin Superior, y en especial el sistema de transferencia de crditos europeos (ECTS) de reciente implantacin en la Unin Europea. Este sistema est basado en la cantidad de trabajo que a juicio del profesor debe invertir un alumno para la adecuada comprensin y aprendizaje de la materia respectiva, y por eso el concepto de crdito incluye tambin las horas de trabajo personal del alumno. El presente libro, que exige al alumno una inversin sustancial de tiempo mientras navega por las figuras al tiempo que estudia el texto, se adapta especialmente bien a este nuevo concepto. En cualquier caso, como es lgico, las clases presenciales siguen siendo un pilar bsico de la docencia universitaria, puesto que en ellas el alumno recibe una visin diferente de los mismos conceptos que se exponen en el libro, puede adems aclarar las dudas que le hayan surgido (si ha ledo el captulo correspondiente antes de la clase, como es aconsejable) y puede tambin fijar los conceptos clave que poco a poco le irn ayudando a pensar como un genetista. Como he dicho, el principal destinatario de este texto es el alumno que cursa una asignatura general de Gentica en una licenciatura biomdica (Medicina, Farmacia), y que se enfrenta por primera vez con esta materia. De todas formas, tambin puede ser til para alumnos de la licenciatura de Biologa que ya hayan cursado una asignatura de Gentica General (y, quizs, Ingeniera Gentica) y se enfrentan con una asignatura ms especfica de Gentica Humana, especialmente los captulos incluidos en los bloques B, D y E. En este caso, los captulos correspondientes al bloque A y al bloque C ya habrn sido estudiados con mucho ms detalle en esas otras asignaturas, pero lo presentado aqu puede servir como resumen que ayude a recordar los conceptos fundamentales. Lgicamente, espero que este texto tambin resulte til a mdicos y otros profesionales del mundo biomdico que quieran ponerse al da, o que necesiten un compendio claro, actualizado y moderno de los conceptos, mecanismos y aplicaciones que ofrece la Gentica en el siglo XXI.

Gentica Humana

www.FreeLibros.me

www.FreeLibros.me

A) Introduccin

Se incluyen en esta seccin tres temas que servirn para repasar los aspectos fundamentales de la estructura de los cidos nucleicos y la biologa molecular del gen, as como la estructura bsica de la cromatina y sus cambios durante el ciclo celular.

www.FreeLibros.me

CAPTULO 1

El flujo de la informacin gentica

Contenidos
1.1 Los cidos nucleicos 1.2 Visin general del proceso de expresin gnica 1.3 La transcripcin 1.4 Regulacin de la transcripcin en eucariotas 1.5 Maduracin del ARN mensajero 1.6 El ayuste (splicing) y su regulacin 1.7 Traduccin y cdigo gentico en eucariotas

1.1 Los cidos nucleicos


La informacin gentica se transmite a travs de unas molculas llamadas cidos nucleicos, polmeros formados por unidades denominadas nucletidos. Un nucletido es una molcula formada por una pentosa, una base nitrogenada y un grupo fosfato. Al conjunto formado por la pentosa y la base nitrogenada se le denomina nuclesido. Por tanto, un nucletido es el ster fosfato de un nuclesido. Dependiendo de la naturaleza de la pentosa, se distinguen dos tipos de cidos nucleicos: el cido ribonucleico (ARN) lleva D-ribosa, y el cido desoxi-ribonucleico (ADN) contiene 2-desoxi-D-ribosa. Las bases nitrogenadas que forman parte de los cidos nucleicos pueden ser monocclicas (pirimidinas) o bicclicas (purinas). Las bases que intervienen en la formacin del ADN se denominan Adenina (A), Citosina (C), Guanina (G) y Timina (T). El ARN contiene las tres primeras y Uracilo (U) en vez de Timina. Fue Friedrich Miescher el primero en identificar, en 1869, un material que llam nuclena. Estudios posteriores fueron caracterizando progresivamente la naturaleza qumi-

www.FreeLibros.me

ca de esta sustancia, as como su importancia biolgica. Despus de bastante controversia, Avery, MacLeod y McCarthy demostraron en 1944 que la introduccin de ADN purificado en bacterias hace que stas cambien su fenotipo y es, por tanto, la molcula transmisora de la informacin gentica. En 1953, Rosalind Franklin, Maurice Wilkins, James Watson y Francis Crick describieron la estructura tridimensional del ADN.
La Figura 1.1 contiene enlaces a los artculos originales de estos autores.

El flujo de la informacin gentica

El ADN y el ARN son cadenas de polinucletidos. Como los nucletidos tienen direccionalidad debido a la posicin del grupo fosfato en el carbono 5 y del grupo hidroxilo en el carbono 3 de la pentosa, las molculas de ADN y ARN tambin tienen una polaridad concreta que viene definida por la direccin 53. El ADN es una molcula formada por dos cadenas antiparalelas, es decir, con polaridad contraria. Cada cadena est formada por un esqueleto desoxi-ribosa-fosfato, en el que alternan molculas de desoxi-ribosa unidas a los grupos fosfato mediante enlaces fosfo-dister. De este esqueleto protruyen las bases nitrogenadas, unidas a la pentosa mediante enlaces glucosdicos. Adems, la molcula de ADN est formada por dos cadenas complementarias, lo que significa que la secuencia de bases nitrogenadas de una cadena es complementaria a la de la otra cadena. Esto se debe al hecho de que las bases nitrogenadas forman slo dos tipos de parejas: Citosina se empareja con Guanina y Adenina se empareja con Timina. Erwin Chargaff fue el primero en demostrar en 1950 que el ADN de doble cadena tiene relaciones equimolares de purinas y pirimidinas; la cantidad total de desoxi-adenina (dA) es igual a la de desoxi-timina (dT), y la de desoxi-guanina (dG) igual a la de desoxi-citosina (dC). Por tanto, una conclusin derivada de esto es que siempre se emparejan una purina con una pirimidina del mismo modo, siendo los pares dA con dT y dG con dC. Watson y Crick, en su modelo de doble hlice, establecieron el modo exacto en que se forman los enlaces en cada par de bases, con tres puentes de hidrgeno en un par dGdC y dos puentes de hidrgeno en un par dAdT. Aunque hay muchos ms tipos posibles de enlaces entre cada uno de estos nucletidos, los enlaces tipo Watson-Crick tienen una propiedad importante: ocupan el mismo espacio dentro de la doble cadena y pueden intercambiarse sin distorsionar la molcula. Finalmente, el hecho de que slo se formen dos tipos de pares de bases explica que las dos cadenas sean complementarias, ya que la secuencia de bases de una puede convertirse fcilmente en la secuencia de bases de la otra cadena sustituyendo cada base por su complementaria.
La Figura 1.2 contiene un enlace a animaciones en las que se explica la estructura de los cidos nucleicos y de la doble hlice.

Por tanto, en la molcula completa de ADN, las cadenas polinucleotdicas se mantienen unidas entre s gracias a los puentes de hidrgeno que se forman entre bases pertenecientes a cada una de las cadenas. Adems, esta doble hebra no es lineal (como una escalera de mano), sino que adopta una configuracin helicoidal en la que las bases nitrogenadas ocupan el interior y se disponen perpendicularmente a las cadenas laterales. Este fenmeno se denomina apilamiento de las bases (base stac-

www.FreeLibros.me

king) y es muy importante para mantener la estabilidad global de la doble hlice. Existen distintos tipos de configuraciones que puede adoptar la doble hlice dependiendo de las condiciones del medio, pero la ms relevante desde el punto de vista biolgico es la forma B, ya que es la ms frecuente en condiciones fisiolgicas. En esta configuracin, la hlice es dextrgira, con un dimetro de 2 nm, tiene 10 pares de bases por vuelta y una distancia de 0,34 nm entre cada par de bases. Las dos molculas de desoxi-ribosa a las que se unen cada una de las bases del mismo par forman dos surcos en la superficie externa de la hlice. Adems, como estas dos desoxi-ribosas no estn situadas simtricamente, sino que miran hacia la misma cara de la doble hlice, los dos surcos que se forman no son iguales: uno de ellos es ms ancho (surco mayor) y otro ms estrecho (surco menor).
La Figura 1.3 permite visualizar la forma B del ADN en tres dimensiones.

Visin general del proceso de expresin gnica

1.2 Visin general del proceso de expresin gnica


La secuencia de nucletidos de determinados fragmentos del ADN contiene informacin para la fabricacin de protenas, que son los principales elementos estructurales y funcionales de las clulas. De hecho, la secuencia de nucletidos determina el tipo de aminocidos y el orden en que se aaden en el proceso de sntesis de protenas, y esa informacin est contenida de un modo codificado en la secuencia de bases del ADN. El proceso por el que dicha informacin es descodificada y traducida para dar lugar a la sntesis de protenas especficas se conoce como expresin gnica. Este proceso comprende varios pasos de descodificacin, que en lneas generales son la transcripcin y la traduccin. En lenguaje coloquial, transcribir significa pasar algn tipo de informacin de un medio a otro. Por ejemplo, se transcribe una conversacin al ponerla por escrito. El primer paso en la lectura de la informacin contenida en la secuencia de nucletidos consiste en la sntesis de una cadena de ARN a partir de un segmento de ADN. Este proceso de copia de una secuencia molde de ADN en un ARN se denomina transcripcin. El ARN mantiene la informacin que estaba contenida en el ADN precisamente porque lleva la misma secuencia de nucletidos (con la excepcin de las timinas, que son sustituidas por uracilos). Esta cadena de ARN puede intervenir directamente en algn proceso celular, pero lo ms habitual es que transmita la informacin al siguiente elemento de la cadena de descodificacin, y por eso se llama ARN mensajero (abreviado como ARNm). El ARNm es, por tanto, la molcula que va a llevar la informacin contenida en un segmento concreto de ADN (es decir, un gen) hasta la maquinaria de fabricacin de protenas. Como esta maquinaria est en el citoplasma, el ARNm debe salir del ncleo celular a travs de los poros nucleares y llegar a los ribosomas. All, mediante un proceso denominado traduccin, la informacin gentica contenida originalmente en la secuencia de nucletidos del ADN ser finalmente traducida en una serie de instrucciones que permiten al ribosoma sintetizar una protena concreta. En los siguientes apartados veremos con detalle cada uno de estos procesos.
La Figura 1.4 contiene un vdeo en el que se ve el proceso general de expresin gnica.

www.FreeLibros.me

1.3 La transcripcin
El proceso general de transcripcin consiste en la sntesis de una cadena de ARN por la accin de una polimerasa de ARN, que lee la secuencia de nucletidos contenida en el ADN molde y sintetiza la nueva cadena de ARN utilizando nucletidos libres. En este proceso, la polimerasa se desliza por la cadena molde de ADN. La transcripcin es un proceso cclico que se repite, en el que hay varias fases esenciales: i) determinar la regin molde de ADN que ha de ser copiada, ii) iniciar la sntesis de ARN, iii) estabilizar y modular la elongacin del ARNm naciente, iv) terminar el proceso. En eucariotas, la molcula encargada de la sntesis es una polimerasa de ARN dependiente de ADN, es decir una polimerasa que usa un molde de ADN para sintetizar un ARN. Este enzima es en realidad un complejo enzimtico formado por mltiples subunidades proteicas al que se unen tambin factores accesorios sin los cuales no puede reconocer el lugar correcto de inicio de la sntesis. En eucariotas se distinguen tres tipos de ARN polimerasas en funcin del tipo de genes que transcriben. Los genes tipo I de eucariotas son los que codifican los ARN ribosomales que veremos ms adelante, y la polimerasa encargada de transcribir estos genes es la ARN polimerasa I. La mayora de los genes son genes tipo II, que codifican protenas y algunos ARN pequeos con funciones concretas; su transcripcin corre a cargo de la ARN polimerasa II. Finalmente, otros ARN pequeos, algunos ARN ribosomales y los ARN transferentes son sintetizados por la ARN polimerasa III. El primer paso en la transcripcin es determinar en qu punto comienza. Esto viene determinado por la existencia de unas secuencias que definen la regin del gen en la que se une el complejo enzimtico responsable de la sntesis. Estas secuencias se llaman promotores, y son necesarios para que la transcripcin pueda tener lugar. Un promotor consta de varios pequeos motivos de secuencia, dispersos a lo largo de varios cientos de pares de bases, a los que se unen los distintos factores proteicos necesarios para la transcripcin. De hecho, la ARN polimerasa no se une al promotor directamente, sino a travs de otro complejo proteico denominado complejo de preiniciacin. Por ejemplo, una de las secuencias ms constantes en promotores de eucariotas es la caja TATA, cuya secuencia consenso es 5-TATATAAAT-3; a esta secuencia se une un factor proteico llamado protena de unin a TATA (en ingls TATA-binding protein, abreviado TBP). Sobre este factor se unen otros factores accesorios y dan lugar a un factor de transcripcin llamado TFIID. De modo similar, se forman otros factores de transcripcin, que en el fondo no son ms que protenas con algn dominio de unin al ADN, que reconocen especficamente las secuencias presentes en los promotores y se unen a ellas. En el promotor eucariota tpico de genes tipo II se forma un complejo con TFIID, TFIIA, TFIIB y TFIIF, al que se une la ARN polimerasa II. La unin posterior de TFIIH y TFIIE aade otras actividades al complejo, como la actividad helicasa necesaria para abrir la doble hlice y permitir el copiado de una cadena, y hace que comience la transcripcin. Por tanto, la formacin del complejo de preiniciacin sobre promotores especficos es la forma de controlar que la ARN polimerasa comience a sintetizar en el lugar correcto. Adems, los promotores eucariotas estn tambin modulados por otros elementos ms lejanos del punto de inicio de la transcripcin, llamados potenciadores (enhancers en ingls) o silenciadores. Estos elementos son secuencias de ADN sobre las que se

El flujo de la informacin gentica

www.FreeLibros.me

unen factores proteicos que contribuyen a estabilizar y potenciar el complejo de preiniciacin, en el caso de los potenciadores, o a impedir la transcripcin en el caso de los silenciadores. Existen muchos otros elementos de secuencia que forman parte de promotores y que permiten regular dnde o cundo se transcribe un gen. Muchos de estos elementos tienen una localizacin precisa respecto al inicio de la transcripcin: por ejemplo, la caja TATA suele estar 25 nucletidos en direccin 5 al inicio de la transcripcin (es decir, en posicin 25, ya que se considera como posicin +1 la del nucletido donde se inicia la sntesis). Otros elementos frecuentes son la caja GC (secuencia consenso GGGCGG) o la caja CAAT (CCAAT) en posicin 100, a las que se unen factores de transcripcin especficos.

La transcripcin

PROMOTOR INICIO DE LA TRANSC RIPCIN

Exon 1

CAJA TATA

5ACGtataa GATCTCGATCGAGACTAGCTAGCTAGCT AgCGATCGAGCTA-3 |||||||||||||||||||||||||||| ||||||||||||||||||||| 3-TGCTAGCTAGATAGCTAGCTCTGAT CGATCGATCGATCGCTAGCTCGAT-5

DOBLE CADENA DE ADN (GEN)

La Figura 1.5 muestra una secuencia de ADN en la que se representan las principales secuencias implicadas en la transcripcin de un gen.

Con la fosforilacin del extremo carboxilo-terminal de la ARN polimerasa II, comienza el desplazamiento de la misma por la cadena molde de ADN y la sntesis del ARN naciente. En este proceso, la polimerasa lee la secuencia de nucletidos de una de las cadenas de la doble hebra de ADN y sintetiza un polinucletido complementario, reemplazando las timinas del ADN por uracilos. De este modo, se conserva perfectamente la informacin que estaba contenida en el ADN. En este sentido, tiene importancia saber cul es la hebra de la doble hlice que es utilizada como molde, y a veces existe cierta confusin sobre la nomenclatura de las dos hebras del ADN bicatenario. Es importante recordar que los polinucletidos se sintetizan en direccin 53, y lo mismo sucede con la sntesis del ARN mensajero. Por tanto, la hebra molde se lee en sentido 35 (es decir, antisentido) al tiempo que la transcripcin procede en sentido 53. Por eso, el convenio es llamar hebra codificante o hebra sentido a la hebra de la doble cadena de ADN que contiene exactamente la misma secuencia de nucletidos que el futuro ARNm transcrito (excepto por los uracilos). A la hebra complementaria, que es la que se utiliza como molde, se le llama hebra molde o hebra antisentido.

www.FreeLibros.me

El proceso de elongacin del transcrito naciente, al menos en eucariotas, est sujeto a numerosas pausas o paradas, debido a diversos obstculos que la polimerasa se puede encontrar al avanzar por el ADN molde. Como veremos en el siguiente captulo, la doble hlice est empaquetada en forma de cromatina, y esto crea obstculos importantes a los procesos de transcripcin; adems, el ADN puede haber sufrido daos que a veces impiden el paso del complejo transcripcional. Por eso, es importante la presencia de factores que favorecen la elongacin, tales como algunos factores de transcripcin (TFIIF y TFIIS) o la elongina. La fosforilacin de la ARN polimerasa tambin favorece significativamente el proceso de elongacin. La ltima fase del proceso de transcripcin es la terminacin de la sntesis. As como en procariotas la terminacin est mediada por unas secuencias especficas en el ADN molde, en eucariotas la terminacin no sigue este modelo, sobre todo en el caso de la ARN polimerasa tipo II. La sntesis habitualmente sigue hasta que se ha sobrepasado el punto que constituir el extremo 3 del ARN mensajero, y la terminacin est ligada a los procesos de maduracin del transcrito que se describen a continuacin.
La Figura 1.6 contiene un enlace a un vdeo que muestra esquemticamente el proceso de transcripcin.

El flujo de la informacin gentica

1.4 Regulacin de la transcripcin en eucariotas


As como los mecanismos que regulan la expresin gnica son bastante bien conocidos en procariotas, y se han identificado distintos tipos de ARN polimerasas y de factores de transcripcin implicados en el inicio de la transcripcin, el panorama en eucariotas es mucho ms complejo. Slo en los ltimos aos ha comenzado a conocerse con cierto detalle el modo en que se regula la intensidad de la expresin gnica, su restriccin a determinados tejidos y su variacin en respuesta a estmulos extracelulares. Aunque esta regulacin se puede dar a varios niveles de complejidad, en este apartado estudiaremos nicamente el nivel basal, que es el compuesto por las secuencias promotoras, potenciadoras y silenciadoras del inicio de la transcripcin y los factores proteicos que se unen a ellas. El complejo basal de iniciacin es una maquinaria molecular gigante, con distintas actividades, cuyo ensamblaje es necesario para la transcripcin correcta tanto de genes constitutivos como de genes que se expresan slo en determinados tejidos. Hasta hace unos 10 aos, se conocan seis factores generales de iniciacin de la transcripcin de genes clase II en eucariotas, llamados TFIIA, TFIIB, TFIID, TFIIE, TFIIF y TFIIH. stos, junto con la ARN polimerasa II, son suficientes para iniciar la transcripcin de algunos genes in vitro, es decir, en el tubo de ensayo. Pronto se vio que algunos de estos factores generales eran en realidad complejos formados por varios componentes, y se identificaron un total de 23 protenas adems de las 12 subunidades de la ARN polimerasa II; con esto, se propuso un modelo por el que todos estos factores se ensamblan durante la iniciacin de la transcripcin. Los progresos de los ltimos aos han revelado que en realidad el transcriptosoma es un complejo mucho mayor de lo que se crea, con muchos otros componentes proteicos que llevan a cabo otras funciones, como la remodelacin de la cromatina o la reparacin del

www.FreeLibros.me

ADN. La regulacin de la expresin gnica se ejerce, a este nivel basal, mediante la regulacin del ensamblaje de la maquinaria proteica necesaria para la transcripcin, y en este sentido se ha estudiado especialmente el papel de los potenciadores y los activadores. Los potenciadores (enhancers en ingls) son pequeos elementos de secuencia del ADN a los cuales se unen unos factores proteicos llamados activadores, y dicha unin estimula la transcripcin. Dado que distintos genes tienen distintos elementos potenciadores y que no todas las clulas poseen los mismos activadores, este sistema permite cierta especificidad en la respuesta a estmulos fisiolgicos que recibe las clulas de distintos tejidos. Adems, los activadores son protenas modulares, es decir, poseen distintos dominios de unin a potenciadores diferentes, lo cual regula la afinidad y especificidad de las interacciones con los elementos de ADN. El modo en que la unin de los activadores a los potenciadores es capaz de promover la trancripcin, ha sido estudiado con profundidad en los ltimos aos. Estos estudios han permitido aislar otro complejo proteico llamado mediador, constituido tambin por varias subunidades, que interacciona con los activadores y con la ARN polimerasa II y as transduce las seales proporcionadas por los potenciadores al promotor basal de la transcripcin. Se han identificado varios mediadores en humanos, como TRAP, DRIP y otros; adems de ayudar a estabilizar el complejo de iniciacin gracias a las interacciones con los activadores y los factores generales de transcripcin, los mediadores tambin pueden regular directamente la actividad de la ARN polimerasa II.
La Figura 1.7 muestra el ensamblaje del complejo basal de transcripcin por la accin de activadores y mediadores.

Maduracin del ARN mensajero

1.5 Maduracin del ARN mensajero


En los genes transcritos por la ARN polimerasa tipo II, que en su inmensa mayora son genes codificantes de protenas, el ARN mensajero primitivo debe ser procesado para mejorar su estabilidad y para eliminar las regiones que no son codificantes. Adems, en algunos casos es sometido a un proceso de correccin de errores o edicin. En primer lugar, el ARN naciente es estabilizado mediante la adicin de distintos grupos en sus extremos 5 y 3, ya que los extremos libres de la molcula de ARN son los ms vulnerables a la degradacin por unas enzimas llamadas exonucleasas. El extremo 5 es modificado mediante la adicin del capuchn o caperuza (cap en ingls), que consiste en la adicin al primer nucletido del ARN de una guanina modificada. Podemos representar el extremo 5 de un ARN recin transcrito por 5pppNpN-3, siendo cada p un grupo fosfato y N un nucletido cualquiera (como es habitual, el primer nucletido de la cadena tiene tres grupos fosfato unidos al carbono 5 de la ribosa). La caperuza consiste en una guanina metilada en posicin 7, que se une por su carbono 5 al primer grupo fosfato de la cadena. Por tanto, el enlace entre la 7-metil-guanina y el primer nucletido es atpico, ya que es un enlace 55 en vez del enlace 53 habitual. El otro tipo de modificacin del ARN mensajero tiene lugar en el extremo 3 del mismo, y consiste en el corte por un punto concreto y la posterior adicin de una

www.FreeLibros.me

10

cola de poli-adeninas. Es importante recordar que dicha cola no se aade al extremo final del transcrito primario, sino que previamente tiene lugar un corte interno. El punto de corte viene definido por la presencia de una seal de poli-adenilacin en el ARNm (cuya secuencia consenso es 5-AAUAAA-3) y un tracto rico en guaninas y uracilos (tracto GU) localizado unos 30-40 nucletidos por debajo de la seal de poli-adenilacin (es decir, en direccin 3). El proceso est mediado por unos factores proteicos que se unen a cada una de estas seales, cortan al ARN mensajero unos 20 nucletidos por debajo de la seal de poli-adenilacin, y comienzan a aadir adeninas. La formacin de esta cola poli(A) es muy importante para mantener la estabilidad del ARNm y asegurar que ste pueda seguir siendo procesado y llegue a traducirse correctamente.
La Figura 1.8 contiene un enlace a un vdeo educativo que muestra esquemticamente la adicin de la caperuza y la formacin de la cola poli(A).

El flujo de la informacin gentica

Un ltimo tipo de modificacin que pueden sufrir algunos ARNm es la correccin o edicin. La edicin del ARN es un mecanismo de modificacin co- o post-transcripcional mediante el cual se cambian uno o varios nucletidos de un ARNm, con el resultado de que la secuencia del mensajero es ligeramente distinta de la que vena codificada en la secuencia genmica. Este fenmeno, bastante comn en otras especies pero ms raro en humanos, permite generar diversos ARNm a partir de un mismo gen. Por ejemplo, la apolipoprotena ApoB48, que se produce en el intestino para entrar a formar parte de los quilomicrones, se origina por efeco de un cambio CU en el que una citosina se des-amina para dar lugar a un uracilo; este cambio crea un codn de parada en el ARNm de la ApoB100 y se produce una protena ms corta de lo que sera esperado segn la secuencia inicial. Un mecanismo similar est implicado en el origen de enfermedades como la neurofibromatosis tipo I o el tumor de Wilms, debidas a alteraciones en los genes NF1 y WT1, respectivamente.
La Figura 1.9 muestra esquemticamente la edicin del ARN que da lugar a la ApoB48.

1.6 El ayuste (splicing) y su regulacin


Los ARN mensajeros de eucariotas tienen una caracterstica muy importante: no son codificantes en su totalidad, desde el principio al fin, sino que las regiones codificantes estn interrumpidas por otras regiones no-codificantes. Es decir, no todos los nucletidos del ARN mensajero son ledos para sintetizar protenas, sino que existen regiones codificantes llamada exones que alternan con otras regiones no-codificantes llamadas intrones. Debido a esta configuracin, el siguiente paso en la maduracin de un ARNm consiste en eliminar los intrones y pegar los exones para formar un mensajero maduro que pueda ser traducido desde el principio hasta el fin y sin interrupciones. Este proceso de corte y eliminacin de intrones con empalme de los exones se denomina en ingls splicing, trmino natico que corresponde al castellano ayuste: la unin de dos cabos por sus chicotes. El ayuste es un proceso complejo, porque hay que tener en cuenta que el nmero de exones e intrones de un gen

www.FreeLibros.me

puede ser muy grande, y requiere una maquinaria proteica bastante sofisticada. En primer lugar, es importante definir el punto exacto que delimita la frontera entre un exn y un intrn, para que la maquinaria encargada del ayuste pueda actuar. Estos puntos vienen determinados por secuencias especficas del ARNm. Por ejemplo, los intrones de eucariotas comienzan en la prctica totalidad de los casos por los nucletidos Guanina-Uracilo (secuencia 5 de ayuste, GU) y terminan en AdeninaGuanina (secuencia 3 de ayuste, AG). Estas secuencias se localizan dentro de unas regiones ms amplias que cumplen un consenso de secuencia concreto. Por ejemplo, la secuencia de ayuste 5 est formada por el consenso 5AG|GU[A/G]AGU-3 (la barra vertical indica el sitio de corte donde termina el exn precedente y comienza el intrn; [A/G] significa que en esa posicin puede haber una A o una G). Por su parte, la secuencia de ayuste 3 se ajusta al consenso 5NCAG|G-3 (siendo N cualquier nucletido). Adems, es importante la presencia de una adenina 20-40 nucletidos por arriba (es decir, en direccin 5) de la secuencia 3 de ayuste. Esta adenina se encuentra en la secuencia consenso 5CU[A/G]A[C/U]-3 (es la adenina en negrita y subrayada), es decir, precedida por A o G y seguida por C o U, y se denomina punto de ramificacin (en ingls, branch point). Entre el punto de ramificacin y la secuencia de ayuste 3 se encuentra un tracto rico en pirimidinas, es decir, formado casi exclusivamente por timinas o citosinas. Finalmente, se han identificado pequeos elementos de secuencia en exones o en intrones que actan como potenciadores o silenciadores del proceso de ayuste, y que tienen gran importancia en la modulacin y regulacin fina del proceso.

11

El ayuste (splicing) y su regulacin

Exn 1

Exn 2

Intrn 1

ARNn p U1

GUC CAUUCA CAG GUA AGU

UGAC...[C/T] [C/T][C/T][C/T] [C/C/T]AG G

La Figura 1.10 muestra esquemticamente las distintas secuencias que son importantes en el proceso de ayuste.

www.FreeLibros.me

12

El proceso de ayuste implica varias reacciones enzimticas que realizan cortes endonucleolticos y unin de extremos libres. El primer paso del proceso es el corte en el sitio de ayuste 5, justo por delante de la guanina del GU inicial del intrn. Este extremo libre se une a la Adenina del punto de ramificacin mediante un enlace fosfo-dister 5-2, creando una estructura en lazo. Finalmente, se corta la secuencia de ayuste 3 por detrs de la guanina del sitio AG, lo que resulta en la liberacin del intrn; los extremos libres de los dos exones flanqueantes son entonces religados. Las molculas que llevan a cabo estos procesos son unas ribonucleoprotenas nucleares pequeas (RNPnp), formadas por un ARN nuclear pequeo (ARNnp) y varias subunidades proteicas. Aunque hay varios tipos de ARNnp, los que participan en el proceso de ayuste se llaman U1, U2, U4, U5 y U6, y adems dan su nombre a las correspondientes RNPnp. La RNPnp U1 se une a la secuencia de ayuste 5 por complementariedad de bases, ya que uno de sus extremos es complementario a la secuencia consenso que rodea a la GU del extremo 5 del intrn. Las otras ribonucleoprotenas implicadas actan en los siguientes pasos del proceso. La RNPnp U2 se une al punto de ramificacin y esto hace que ambas RNP entren en contacto y facilita la formacin del lazo. A continuacin, un complejo formado por la RNPnp U4/6 y la RNPnp U5 se une a la regin de ayuste 3 y estabiliza la formacin de todo el complejo, llamado ayusteosoma (spliceosome en ingls), y lleva a cabo el corte 3 y la unin de los exones.
La Figura 1.11 contiene un enlace a un vdeo educativo que muestra esquemticamente el proceso de ayuste.

El flujo de la informacin gentica

Como se puede suponer, en un genoma eucariota hay miles de sitios que cumplen el consenso de secuencia necesario para funcionar como sitios de ayuste, pero sin embargo slo unos pocos participan en el procesamiento normal de los genes. De hecho, uno de los temas ms interesantes en la regulacin del ayuste es cmo se definen exactamente los lmites de exones e intrones, de modo que la maquinaria de ayuste los reconozca como tales. Aunque todava quedan incgnitas por resolver, hoy en da sabemos que hay otros elementos que cooperan para estabilizar el ayusteosoma y permitir que se lleve a cabo el proceso. Entre estos elementos destacan la protenas SR (llamadas as por ser ricas en los aminocidos Serina y Arginina), que interaccionan con distintos componentes del ayusteosoma y se unen a secuencias moduladoras como son los potenciadores exnicos del ayuste. Todas estas interacciones tienen lugar antes de la unin de las RNPnp U4/6 y RNPnp U5, y son muy importantes para definir los lmites de exones e intrones y para regular el ayuste alternativo, que es el fenmeno por el cual un mismo gen puede sufrir distintos patrones de ayuste dependiendo del tejido o del tipo celular en que se lleva a cabo. El ayuste alternativo es un fenmeno muy comn en humanos, y hace que los ARNm resultantes de los distintos tipos de ayuste sean diferentes y por tanto tengan la capacidad de codificar protenas distintas, lo que aade un nivel ms de complejidad en la funcin del genoma.
La Figura 1.12 muestra esquemticamente los complejos que intervienen en la definicin de los exones e intrones, as como el fenmeno de ayuste alternativo.

www.FreeLibros.me

1.7 Traduccin y cdigo gentico en eucariotas


El paso final en el proceso de la expresin gnica es la fabricacin de una protena a partir de la informacin contenida en la secuencia del ARNm. Conceptualmente, este proceso es parecido a la interpretacin de unas instrucciones escritas en un idioma, siguiendo un cdigo de interpretacin concreto. Por eso, el proceso se denomina traduccin. Si queremos traducir un lenguaje, en primer lugar necesitamos conocer el diccionario para entender el significado de las palabras. En este caso, el diccionario se conoce como cdigo gentico, que es la correspondencia entre la informacin contenida en el ARNm y el tipo de aminocido que se aade a la protena durante su sntesis. En el ARNm, las instrucciones estn compuestas por palabras de tres letras, es decir, cada tres nucletidos forman una palabra que instruye a la maquinaria de sntesis proteica a aadir un aminocido concreto. Estas palabras de tres letras se denominan codones. Es fcil calcular el nmero posible de palabras de tres letras que se pueden formar con un alfabeto de cuatro letras (A, C, G y T): 43, es decir 64 palabras distintas. Sin embargo, slo hay 20 aminocidos esenciales en las protenas, por lo que en teora slo seran necesarios 20 codones. Teniendo en cuenta las palabras necesarias para la instruccin de iniciar la transcripcin (AUG) y de terminarla (UAG, UAA, UGA), todava tenemos la posibilidad de codificar un mismo aminocido con varios codones distintos. Para indicar este fenmeno se dice que el cdigo gentico es degenerado, en el sentido de que varias palabras a veces codifican el mismo aminiocido. Por ejemplo, algunos aminocidos como la leucina estn codificados por seis codones diferentes.
La Figura 1.13 muestra el cdigo gentico, con la tabla de equivalencias entre los distintos aminocidos y los codones que los codifican.

13

Traduccin y cdigo gentico en eucariotas

El hecho de que el cdigo gentico utilice palabras de tres letras implica que cualquier secuencia annima, cuyo significado no conocemos, podra dar lugar al menos a tres protenas distintas dependiendo del punto de inicio de la traduccin. En efecto, cualquier secuencia (supongamos la secuencia 5-ACGACTGCGTACACGTC-3, por ejemplo) puede dividirse en bloques de tres palabras que configurarn instrucciones distintas si comenzamos a contar desde el primer nucletido (ACG, ACT, GCG, etc. en nuestro ejemplo), desde el segundo (CGA, CTG, CGT, etc.) o desde el tercero (GAC, TGC, GTA, etc.). Como puede observarse, las protenas codificadas en cada caso tienen una secuencia de aminocidos diferente. Cada una de estas posibles formas de leer una secuencia codificante se denomina marco de lectura, y siempre existen tres marcos de lectura posibles (en secuencias de una sola hebra) porque el cuarto marco de lectura es idntico al primero, el quinto al segundo, etc. Esto plantea el problema de cmo reconoce la clula cul es el marco de lectura que debe usar para sintetizar la protena correcta. Esto se soluciona de dos formas: en primer lugar, por la existencia de un codn de inicio (AUG, que codifica para el aminocido metionina), y en segundo lugar porque slo uno de los tres marcos de lectura (llamado por eso abierto) da lugar a una protena de longitud adecuada, ya que en los otros dos marcos de lectura aparecen codones de parada y las protenas codificadas resultaran muy cortas y sin funcionalidad. En eucariotas, el codn de inicio est inclui-

www.FreeLibros.me

14

do en una secuencia consenso definida por Marilyn Kozak, que es 5C[A/G]CCAUGG-3. El marco de lectura abierto quedar definido, por tanto, cuando el codn de inicio vaya seguido por un nmero suficiente de codones codificantes hasta llegar a un codn de parada. Es importante tener en cuenta que la traduccin no comienza al principio del ARNm, y tampoco termina al final del mensajero. De hecho, en el gen y en el ARNm se pueden definir dos regiones no-traducidas, una en direccin 5 al inicio de la traduccin y otra desde el codn de parada hasta el final, que flanquean la regin codificante (el marco de lectura abierto). La regin no traducida 5 (RNT-5, en ingls UnTranslated Region o 5-UTR) se extiende desde el inicio del ARNm (la caperuza) hasta el inicio de la traduccin (codn de iniciacin); la RNT-3 (en ingls 3-UTR) se extiende desde el codn de parada hasta el inicio de la cola poli(A).

El flujo de la informacin gentica

70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| atgTGGTTTTCTGTCCACTTCCCCTatgCAGGTGTCCAACGGATGTGTGAGTAAAATTCT M W F S V H F P Y A G V Q R M C E * N S C G F L S T S P M Q V S N G C V S K I L V V F C P L P L C R C P T D V * V K F W 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAAACCGAG G Q V L R D W L H Q T Q G N R W * * T E G R Y Y E T G S I R P R A I G G S K P R A G I T R L A P S D P G Q S V V V N R E
La Figura 1.14 muestra una secuencia de ADN con los distintos marcos de lectura posibles en el ARNm, sealando adems las regiones no traducidas.

La maquinaria que lleva a cabo la traduccin est constituida bsicamente por dos elementos: los ribosomas y los ARN de transferencia. El ribosoma es una partcula compleja formada por subunidades de naturaleza ribonucleoproteica. En eucariotas, el ribosoma consta de una subunidad pequea (coeficiente de sedimentacin 40S) formada por un ARN y unas 30 protenas, y otra subunidad grande (60S) formada por 3 ARN y unas 50 protenas. Los ARN transferentes (ARNt) son pequeas molculas de ARN que llevan en uno de sus extremos un aminocido, y actan como los adaptadores que leen la informacin de cada codn y la transforman en un aminocido especfico. Aunque se representan habitualmente con forma de trbol, en realidad estn doblados en forma de L. Las dos regiones ms importantes de un ARNt son el anticodn y el extremo 3, que termina en los nucletidos 5-CCA-3 y lleva el aminocido correspondiente. El anticodn est formado por los tres nucletidos que se emparejan con el codn por complementariedad, ya que la secuencia del codn y la del anticodn son complementarias (ambas en direccin 53). Este emparejamiento no necesita ser siempre perfecto, sino que en ocasiones se permite un

www.FreeLibros.me

cierto tambaleo cuando uno de los tres nucletidos no forma un emparejamiento perfecto tipo Watson-Crick; precisamente, esto es lo que permite que varios codones sean ledos por un mismo anticodn.
La Figura 1.15 muestra un ARNt, sealando el anticodn unido al codn.

15

Traduccin y cdigo gentico en eucariotas

El proceso de traduccin comienza con la fase de iniciacin, mediante la unin de la subunidad pequea del ribosoma a la caperuza del ARNm maduro que proviene del proceso de ayuste. A continuacin, la misma subunidad ribosomal se desplaza por el ARNm hasta encontrar el codn de iniciacin apropiado, momento en que se unen el ARNtMet (el ARN transferente que lleva el aminocido Metionina) y la subunidad ribosomal grande. El bolsillo del ribosoma donde est unido este primer ARNt se llama sitio A (aminoacil). En este proceso participan tambin varios factores de iniciacin (eIF1 a eIF6, del ingls eukaryotic initiation factor). La segunda fase de la traduccin se llama elongacin, y consiste en un proceso cclico por el que el ribosoma se desplaza tres nucletidos y el ARNt que ocupaba el sitio A pasa a ocupar otra regin del ribosoma llamada sitio P (peptidil). Gracias a este movimiento, el siguiente codn del ARNm queda dentro del sitio A, a donde acude otro ARNt con un anticodn complementario al nuevo codn. A continuacin, la cadena peptdica que cuelga del ARNt que ocupa el sitio P es transferida al aminocido del ARNt que ocupa el sitio A, con lo que la cadena polipeptdica se alarga en un aminocido. Estos procesos estn ayudados y catalizados por los propios ARN ribosomales y por dos factores de elongacin (eEF1 y eEF2, del ingls eukaryotic elongation factor). La terminacin de la traduccin tiene lugar cuando alguno de los tres codones de parada ocupa el sitio A, porque en vez de unirse un ARNt acude un factor de terminacin (eRF1 y eRF3 en eucariotas, del ingls eukaryotic release factor).
La Figura 1.16 contiene un enlace a un vdeo que muestra el proceso de traduccin.

La traduccin completa el proceso de expresin gnica. Aunque actualmente se est reconociendo el papel de los ARN no codificantes, que se transcriben y son procesados pero no se traducen en protenas, el aforismo un gen, una protena sigue siendo vlido en la mayora de los casos. Igualmente, el dogma central de la biologa molecular (es decir, la va ADNARNProtena) no siempre se cumple, porque algunos virus y otros organismos tienen un genoma con ARN que se retro-transcribe a ADN. En cualquier caso, las nociones y mecanismos que se han repasado en este captulo constituyen el punto bsico de arranque para comprender la naturaleza molecular de los genes y su funcin como portadores de informacin biolgica.

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 2

El ADN en el ncleo de la clula eucariota

Contenidos
2.1 La cromatina durante el ciclo celular 2.2 Replicacin de la cromatina en interfase 2.3 Formacin y segregacin de los cromosomas durante la mitosis 2.4 Gametognesis y meiosis 2.5 Recombinacin a nivel molecular

2.1 La cromatina durante el ciclo celular


En las clulas somticas que tienen ncleo, la molcula de ADN est presente en una forma peculiar llamada originalmente cromatina. Por la estructura de la doble hlice del ADN, sabemos que la distancia entre nucletidos es de 0,34 nm; si el genoma humano haploide tiene 3 109 pares de bases, la longitud total del genoma en forma de doble hlice lineal sera algo superior a un metro, y adems cada ncleo contiene dos copias del genoma. Todo este material debe entrar en el ncleo de una clula eucariota, cuyo dimetro medio es de 5 m. Esto significa que el ADN ha de adoptar un alto grado de empaquetamiento para poder alojarse dentro del ncleo. Este empaquetamiento se lleva a cabo mediante la unin de la doble hlice con varios tipos de protenas para dar lugar a una estructura que es, precisamente, la cromatina. Las clulas eucariotas, al proliferar, siguen una serie de etapas en las que se llevan a cabo los procesos necesarios para dar lugar a dos clulas hijas: duplicar los componentes celulares, segregarlos espacialmente y dividir la clula de modo que las dos clulas resultantes lleven todos los ingredientes necesarios para su correcto funcionamiento. Estas etapas deben completarse en orden, de un modo altamente regulado, y constituyen lo que

www.FreeLibros.me

18

se llama ciclo celular. En cada ciclo celular se distinguen por tanto varias fases: la interfase (etapa en la que la clula duplica su contenido), la mitosis (etapa en la que los componentes se separan a polos opuestos de la clula) y citoquinesis (separacin fsica de las dos clulas hijas). Probablemente sea la cromatina el componente celular en el que es ms importante la duplicacin y segregacin correctas, ya que esto va a asegurar que la informacin gentica se transmita sin alteraciones. Por tanto, es importante saber cmo se comporta la cromatina en las distintas etapas del ciclo celular.
La Figura 2.1 muestra las distintas fases del ciclo celular de una clula eucariota y los cambios que sufre la cromatina.

El ADN en el ncleo de la clula eucariota

Durante la interfase, que es la etapa ms larga del ciclo, la cromatina est sujeta a un grado de empaquetamiento de unas 2 000 veces, es decir, lo que en su estado natural ocupara un tamao de 2 000 mm se reduce a un tamao de 1 mm. Esto se consigue por la unin de la doble hebra de ADN con unas protenas bsicas llamadas histonas, cuyos grupos positivos interaccionan con los grupos negativos del esqueleto fosfato del ADN. Hay cinco tipos principales de histonas, llamadas H1, H2A, H2B, H3 y H4, que se asocian entre s para formar un octmero: dos molculas de H3 junto con dos molculas de H4 forman un tetrmero, y dos dmeros H2A/H2B forman otro tetrmero; ambos tetrmeros se asocian para formar un ncleo proteico (octmero) alrededor del cual se enrolla la molcula de ADN. En concreto, 146 pares de bases de ADN dan 1,65 vueltas alrededor del octmero, y sobre este complejo se une la histona H1. Esta estructura, de unos 10 nm de dimetro, es lo que se conoce con el nombre de nucleosoma, y es la unidad bsica de organizacin de la cromatina. Los nucleosomas estn unidos entre s por el filamento de ADN que se va enrollando a su alrededor, como bolas en una cuerda, y esto da lugar a la fibra de cromatina de 10 nm. En esta estructura, unos 200 pares de bases ocupan 10 nm, lo que significa un grado de empaquetamiento de unas seis veces respecto al tamao lineal que ocupara un fragmento de ADN de esa longitud (200 0,34 nm = 64 nm).
La Figura 2.2 muestra algunos modelos tridimensionales de un nucleosoma.

En condiciones fisiolgicas, la fibra de 10 nm sufre un segundo grado de enrollamiento sobre s misma para dar lugar a una estructura en forma de solenoide, con seis nucleosomas por vuelta. Esta configuracin constituye la fibra de 30 nm, en la que el grado de empaquetamiento del ADN es de unas 40 veces. La fibra de 30 nm sufre diferentes grados de empaquetamiento durante interfase y, especialmente, en la mitosis, en la que la cromatina alcanza su empaquetamiento mximo (unas 10 000 veces) y da lugar a las estructuras visibles que llamamos cromosomas. Estos tipos de alto grado de enrollamiento se consiguen porque la fibra de 30 nm forma asas que se unen por su base a una estructura proteica que sirve como andamio. El andamio (scaffold en ingls) est constituido por protenas no histonas, de las que las principales son la Sc1 (idntica a la topoisomerasa II) y la Sc2 o SMC2, que pertenece a una familia de protenas llamada SMC (Structural Maintenance of Chromosomes, en ingls). Estas protenas cumplen tambin un papel importante en el mantenimiento

www.FreeLibros.me

de la condensacin de la cromatina (de ah que tambin se les llame condensinas). Las asas de la fibra de 30 nm se unen al andamio mediante unas secuencias ricas en Adeninas y Timinas llamadas SAR (Scaffold Attachment Region en ingls), que tienen gran afinidad por las protenas del andamio. La estructura que resulta de este enrollamiento da lugar a una fibra de unos 300 nm de grosor, en la que el grado total de empaquetamiento del ADN es de unas 2 000 veces. Las SAR son regiones importantes, dispersas por el genoma, que flanquean genes y a menudo se asocian con los orgenes de replicacin que veremos ms adelante, por lo que se piensa que pueden jugar un papel importante en la funcin y estructura de la cromatina. Finalmente, el empaquetamiento mximo de la cromatina durante la mitosis se consigue al espiralizarse la fibra de 300 nm para dar lugar a una estructura de 600 nm de grosor (una cromtide) en la que el ADN alcanza ya un grado de empaquetamiento de 10 000 veces.

19

Replicacin de la cromatina en interfase

Doble hlice (2 nm) Nucleosoma

Fibra de 10 nm Fibra de 30 nm

Solenoide

La Figura 2.3 muestra los distintos grados de empaquetamiento de la cromatina.

2.2 Replicacin de la cromatina en interfase


La interfase se subdivide en tres fases, de las que la ms importante es la fase de sntesis (fase S). En esta fase tiene lugar la duplicacin de los componentes celulares, incluyendo la cromatina. La fase S viene precedida y seguida por dos breves fases G (de gap, hueco o hiato), fase G1 y fase G2 respectivamente. Uno de los principales procesos que tienen lugar durante la fase S es la duplicacin del contenido total de ADN del ncleo, que se lleva a cabo mediante la replicacin del ADN y el ensamblaje en nucleosomas para dar lugar a la nueva cromatina. El proceso de replicacin del ADN ya haba sido sugerido por Watson y Crick en su descripcin del ADN, al darse cuenta de que la estructura de la doble hlice y la complementariedad de bases permita un mecanismo sencillo de copia. Aunque durante algunos aos se discuti cmo podra funcionar este mecanismo, Matthew Meselson y Franklin Stahl demostraron que el ADN se replica de modo semi-conservativo, es decir, que cada

www.FreeLibros.me

20

una de las nuevas molculas lleva una cadena de la molcula original y otra cadena nueva, sintetizada tomando como molde la cadena complementaria. Posteriormente se fueron descubriendo los detalles del proceso, e identificando los distintos componentes que lo llevan a cabo.
La Figura 2.4 muestra esquemticamente la replicacin semiconservativa, y contiene un enlace a un sitio educativo que explica los experimentos de Meselson y Stahl.

El ADN en el ncleo de la clula eucariota

En eucariotas, la replicacin comienza en mltiples sitios de una misma molcula de ADN a la vez, llamados orgenes de replicacin. Dada la velocidad de copia de las polimerasas, una sola molcula de ADN polimerasa tardara varios das en replicar un cromosoma completo, por lo que de hecho la replicacin de la cromatina se lleva a cabo en varios miles de orgenes de replicacin a la vez. De todas formas, aunque todos los orgenes funcionan durante la fase S, no todos se ponen en marcha a la vez: en algunos orgenes la replicacin comienza al principio de la fase S (replicacin temprana) y en otros comienza hacia el final (replicacin tarda). En cada origen de replicacin se forma una burbuja de replicacin, por accin de unas helicasas que abren la doble hlice para permitir la unin de las enzimas que llevarn a cabo la sntesis, que son las polimerasas de ADN. Este primer paso est sujeto a una fina regulacin, ya que un mismo origen slo se replica una vez en cada ciclo celular. De hecho, aunque la replicacin a partir de un origen ya haya terminado y se mismo origen pudiese volver a iniciar otro ciclo de replicacin en la misma fase S, esto nunca sucede. Esta regulacin se lleva a cabo por la accin de varios complejos proteicos como el ORC (del ingls Origin Recognition Complex), el complejo de protenas MCM, y la geminina. En cada burbuja se forman dos horquillas de replicacin, apuntando en direcciones contrarias. Como los eventos que tienen lugar en cada horquilla son idnticos, basta estudiar lo que sucede en una de ellas. En primer lugar, una protena de unin a ADN mono-catenario, llamada RPA (Replication Protein A, en ingls) se une a las cadenas que han sido separadas por las helicasas, y esto ayuda a mantener la burbuja de replicacin abierta. A continuacin, a cada una de las cadenas se une una enzima llamada primasa, que es una ARN polimerasa dependiente de ADN (es decir, sintetiza ARN tomando como molde ADN). La primasa sintetiza un pequeo ARN que acta como cebador (primer, en ingls, de ah su nombre) para iniciar la sntesis de ADN. Las polimerasas de ADN dependientes de ADN llevan a cabo la sntesis de ADN elongando la cadena a partir del cebador de ARN generado previamente. Esta sntesis tiene lugar de modo diferente en cada una de las cadenas, debido a la distinta orientacin que tienen. En la cadena que discurre en sentido 35, el cebador y la nueva cadena sintetizada sobre ella discurrirn en sentido 53, que es el nico modo en que pueden sintetizar ADN las polimerasas. Por tanto, en esta cadena, llamada cadena gua (leading strand en ingls) se puede sintetizar el nuevo ADN de modo continuo. Por el contrario, la otra cadena de la molcula original discurre en sentido 53, por lo que la nueva cadena sintetizada a partir de sta (cadena retrasada, o lagging strand en ingls) debera crecer en sentido 35. Como esto no es posible, ya que las polimerasas son incapaces de sintetizar ADN de esta forma, lo que sucede es que se generan varios cebadores de ARN a pequeas distancias, sinteti-

www.FreeLibros.me

zndose el ADN a partir de cada uno de ellos en sentido 53. El resultado neto es la sntesis semi-discontinua de la cadena retrasada en sentido 35 gracias a la sntesis de pequeos fragmentos (cada uno de los cuales fue sintetizado en sentido 53). Estos fragmentos se denominan fragmentos de Okazaki, y tienen una longitud entre 100 y 1 000 nucletidos en eucariotas. A medida que la horquilla de replicacin avanza, las helicasas continan abriendo la doble hlice (ayudadas por otras enzimas llamadas topoisomerasas, que relajan la tensin generada por delante de la horquilla). Tras la sntesis en ambas cadenas, otras enzimas eliminan los fragmentos de ARN que haban servido de cebadores, rellenan los huecos que quedan, y finalmente unas ligasas sellan los ltimos enlaces fosfo-di-ster para obtener una cadena sin solucin de continuidad.
Figura 2.5. En estas animaciones se muestra esquemticamente el proceso de sntesis de la cadena gua y de la cadena retrasada durante la replicacin del ADN.

21

Replicacin de la cromatina en interfase

Aunque los complejos proteicos que intervienen en la replicacin del ADN en eucariotas no han sido caracterizados con tanta profundidad como en procariotas, hoy en da se conocen bastantes detalles. De entre las diferentes ADN polimerasas identificadas en eucariotas, la sntesis de los cebadores de ARN es obra de la primasa, que acta junto con la ADN polimerasa . sta prolonga el cebador de ARN unos pocos nucletidos. El factor C de la replicacin (RFC) desplaza la polimerasa -primasa, una vez que se ha formado el cebador de ARN, y trae consigo otra protena llamada PCNA (Proliferating Cell Nuclear Antigen, en ingls), que a su vez es la responsable de reclutar la polimerasa que lleva a cabo la sntesis de ADN. stas son la ADN polimerasa (en la cadena retrasada) y la ADN polimerasa (en la cadena gua). El complejo PCNA-Polimerasa tambin incluye una endonucleasa (FEN1 en eucariotas) que es la responsable de degradar los cebadores de ARN que son desplazados por la polimerasa. Finalmente, la ligasa que culmina el proceso en eucariotas es la ADN ligasa I.
La Figura 2.6 contiene un vdeo que explica el proceso de replicacin de la cadena retrasada, con los distintos complejos proteicos implicados.

Es importante entender que la replicacin del ADN no se refiere slo a la duplicacin de la doble cadena, sino que implica tambin el ensamblaje de la cromatina a medida que el ADN se va replicando. De hecho, durante la replicacin slo se altera el empaquetamiento de la cromatina en una pequea regin: se estima que slo los dos nucleosomas por delante de la horquilla de replicacin se ven afectados por el avance de la maquinaria replicativa, y que unos 300 nucletidos por detrs de la horquilla ya se vuelven a ensamblar los nuevos nucleosomas para comenzar a formar las dos nuevas fibras de cromatina. Este re-ensamblaje de la cromatina se produce en varias etapas, comenzando con la unin del tetrmero H3-H4 en primer lugar, seguida de la deposicin del tetrmero H2A/H2B; finalmente se aade la histona H1. Lgicamente, es muy importante mantener la memoria acerca del estado en que estaba una regin de cromatina, para que las fibras hijas que se producen tras la replicacin mantengan el mismo estado que tena la fibra original. Como veremos, esto

www.FreeLibros.me

22

se consigue por modificaciones qumicas de algunos aminocidos de las histonas, que se distribuyen por igual desde los nucleosomas de la fibra original a los nucleosomas de las fibras recin formadas. En el caso de molculas lineales de ADN, como los cromosomas, la replicacin de los extremos terminales presenta un problema particular, puesto que el cebador de ARN localizado en el extremo de la cadena retrasada no puede ser reemplazado por ADN (como ocurre en la replicacin normal). Por tanto, los cromosomas estaran sujetos a una degradacin progresiva de sus extremos con cada divisin celular, y esto sera letal en clulas que se dividen muchas veces a lo largo de la vida de un individuo. Para evitar esto, los cromosomas de eucariotas tienen en sus extremos unas estructuras especiales, llamadas telmeros, que protegen los extremos libres y evitan la erosin asociada con la replicacin. Estas estructuras estn formadas por la repeticin una pequea secuencia que est repetida mltiples veces al final del extremo 3 de una de las cadenas de la doble hlice, cadena que por tanto ser ms larga que la otra. Estas repeticiones, que en humanos estn formadas por el hexanucletido TTAGGG, son aadidas por la accin de un enzima denominado telomerasa, que consta de un componente ARN y de un componente enzimtico con actividad polimerasa de ADN dependiente de ARN. Usando el componente ARN como molde, la telomerasa va aadiendo nuevas repeticiones TTAGGG al extremo 3 de una de las cadenas del cromosoma. Esto posibilita que, durante la replicacin, se sintetice el cebador de ARN sobre las repeticiones telomricas y no se pierda material gentico propio del cromosoma. Las repeticiones que se pierden por causa de la replicacin, son despus aadidas por accin de la telomerasa, lo que asegura la integridad de los cromosomas durante toda la vida de la clula.
La Figura 2.7 incluye un vdeo que ilustra el problema de la replicacin de los extremos y la accin de la telomerasa.

El ADN en el ncleo de la clula eucariota

Una consecuencia importante de la replicacin es que el contenido total de ADN de la clula se duplica antes de que los cromosomas se hagan visibles y se separen en la mitosis, como veremos a continuacin. Esto es precisamente lo que hace que cada cromosoma, durante la mitosis, est compuesto por dos cromtides hermanas pegadas. En este sentido, es importante evitar la confusin entre el nmero de cromosomas y el contenido total de ADN de una clula. El nmero haploide de cromosomas (nmero de cromosomas distintos, que es caracterstico de cada especie) se representa por la letra n; una clula somtica tiene un nmero diploide (2n) de cromosomas, ya que tiene dos copias de cada cromosoma (n parejas de cromosomas homlogos). Antes de entrar en la fase S, una clula somtica tiene un nmero 2n de cromosomas (aunque no se ven en su forma tpica, por estar la cromatina poco condensada) y un contenido total de ADN correspondiente a una cromtide por cromosoma: esto se representa por la cantidad de ADN 2C. Al final de la replicacin del ADN, esa clula sigue teniendo 2n cromosomas (todava invisibles) pero ahora tiene un contenido de ADN igual a 4C, ya que tenemos dos cromtides por cromosoma. Tras la mitosis, la segregacin de las cromtides hermanas tiene como resultado que cada una de las clulas hijas lleva otra vez 2n cromosomas y un contenido de ADN

www.FreeLibros.me

igual a 2C. De este modo, se mantiene el nmero de cromosomas y la cantidad total de ADN tras las sucesivas divisiones celulares.

23

Formacin y segregacin de los cromosomas durante la mitosis

2.3 Formacin y segregacin de los cromosomas durante 2.3 la mitosis


La cromatina es una estructura dinmica cuyo grado de empaquetamiento es mximo durante la mitosis, y por eso en esta fase del ciclo celular se puede ver en una forma especialmente condensada que da lugar a los cromosomas. Como hemos visto, esta condensacin se produce porque la fibra de cromatina de 300 nm se enrolla en forma de espiral, proporcionando un grado de empaquetamiento unas cinco veces mayor al observado durante la interfase. La mitosis es el proceso de divisin de las clulas somticas, fundamental en la proliferacin celular que tiene lugar durante el desarrollo embrionario, el crecimiento y el mantenimiento de los tejidos. Supone una reorganizacin drstica de todos los componentes celulares, pero muy especialmente de los cromosomas, cuya segregacin a cada una de las clulas hijas debe ser muy precisa y estar finamente regulada y coordinada con la separacin fsica de las nuevas clulas (citoquinesis). Durante la mitosis, la maquinaria celular se especializa en llevar a cabo los distintos procesos que tienen lugar en la clula: condensacin de la cromatina, formacin del huso mittico, segregacin de los componentes y fisin celular. La primera fase de la mitosis (profase), comienza con la condensacin de la cromatina, la ruptura de la envuelta nuclear y el desarrollo del huso mittico. Es importante recordar que la cromatina ha sido replicada en la fase S de la interfase previa, por lo que cada cromosoma est ahora formado por dos cromtides hermanas. Los microtbulos se unen a los quinetocoros, estructuras proteicas formadas sobre los centrmeros de cada cromosoma, y comienzan a transportar a los cromosomas hacia el plano ecuatorial del huso. En la fase siguiente (metafase) cada cromosoma est unido a microtbulos procedentes de los dos polos de la clula, de modo que todos los cromosomas estn en el ecuador del huso mittico sometidos a fuerzas tensionales opuestas. Los mecanismos moleculares que regulan la cohesin de cromtides hermanas comienzan a conocerse cada vez mejor, y su implicacin en patologa humana est adquiriendo mayor relevancia. Por ejemplo, se han identificado las protenas cromosmicas necesarias para mantener la cohesin de cromtides hermanas, que se denominan cohesinas. En eucariotas funcionan como cohesinas al menos cuatro miembros de la familia SMC (Structural Maintenance of Chromosomes), y en Xenopus (sapo) se ha identificado un complejo que es necesario para la cohesin y que est formado por SMC1 y SMC3 junto con SCC1 (Sister Chromatid Cohesion 1). La cohesin se establece en la fase S del ciclo celular, durante la replicacin del ADN, aunque las cohesinas estaban ya presentes en la cromatina. Al replicarse el ADN, ambas cromtides quedan unidas por las cohesinas en toda su longitud, distinguindose dos tipos de cohesin: la cohesin en los centrmeros y la cohesin en los brazos cromosmicos. Ambos tipos de cohesin estn mediados por cohesinas, pero los procesos que los regulan son algo diferentes. El mantenimiento de esta cohesin durante metafase es muy importante, porque es precisamente el balance entre las fuerzas de los microtbulos y la cohesin de

www.FreeLibros.me

24

ambas cromtides lo que permite el alineamiento de los cromosomas en el plano ecuatorial: la tendencia de los microtbulos a separar las cromtides se ve contrarrestada por la cohesin que las mantiene unidas, y gracias a esta cohesin se genera la tensin necesaria para formar la placa metafsica. Es precisamente la prdida brusca de cohesin lo que permite la separacin de las cromtides. Lgicamente, un componente fundamental en estos procesos es el quinetocoro, que en definitiva es el punto de cada cromosoma donde se anclan los microtbulos. Existe en clulas eucariotas un sistema que comprueba que todos los quinetocoros estn unidos a microtbulos y activa un punto de control que impide la separacin de las cromtides antes de conseguir la perfecta unin de todos los quinetocoros a sus microtbulos respectivos. La metafase va seguida por la anafase, en la que tiene lugar la segregacin de las cromtides hermanas de cada cromosoma hacia polos opuestos de la clula. La separacin simultnea de 46 pares de cromtides hermanas en la transicin metafaseanafase es un momento crucial del ciclo celular, y por tanto est finamente regulado. Por ejemplo, es crtico que la cohesin se pierda en el momento adecuado, para que cada cromtide pueda migrar a una clula hija sin errores. En general, se observa que primero se pierde la cohesin en los centrmeros, y a medida que los microtbulos van tirando de los quinetocoros se va perdiendo la cohesin en los brazos. La separacin se lleva a cabo mediante la degradacin de las cohesinas. La ltima fase de la mitosis es la telofase, en la que los cromosomas vuelven a descondensarse y se forma la envoltura nuclear alrededor de cada uno de los nuevos ncleos que se han formado en cada polo de la clula. Terminada la mitosis, el proceso de divisin celular se completar con la citoquinesis, en la que los componentes celulares se reordenan y se reorganiza el citoesqueleto para facilitar la divisn fsica de la clula en dos clulas hijas.
La Figura 2.8 contiene un vdeo que ilustra las principales fases de la mitosis.

El ADN en el ncleo de la clula eucariota

Dada la importancia de la separacin de las cromtides hermanas en anafase, se ha investigado mucho en torno a su regulacin. Se sabe que la degradacin de las cohesinas se lleva a cabo por dos mecanismos distintos: fosforilacin (mediada por la quinasa Polo) de algunos componentes, y proteolisis de otros. Las protenas implicadas en la proteolisis de la cohesinas se llaman separinas (o separasas). Se ha comprobado que las separinas son capaces de romper el complejo cohesina porque degradan la protena SCC1 (una cohesina) durante el comienzo de la anafase, permitiendo la separacin de las cromtides por la fuerza que ejercen los microtbulos. Cmo se activan las separinas en el momento exacto de la anafase? Esto se ha resuelto gracias a la identificacin de las securinas, protenas que inhiben la accin proteoltica que ejercen las separinas sobre las cohesinas. Por tanto, durante la mitosis las securinas estn unidas a las separinas y as inhiben su accin, de modo que el complejo cohesina permanece intacto y las cromtides permanecen unidas. La disociacin de las cohesinas se produce por la degradacin sbita de las securinas al comienzo de la anafase, de manera que las separinas quedan libres y pueden cortar por proteolisis el complejo cohesina. El evento crucial, por tanto, es la degradacin de securinas, degradacin que est mediada por un complejo proteico llamado APC (Anaphase Promoting Complex) que posee actividad ubiquitina-protein-ligasa y promueve

www.FreeLibros.me

la degradacin de diversas protenas al comienzo de la anafase. Lgicamente, estos procesos no deben comenzar hasta que todos los quinetocoros estn correctamente unidos a los microtbulos del huso, pues de lo contrario la segregacin de las cromtides no sera correcta. Por tanto, existe tambin un mecanismo de sealizacin que detecta si todos los quinetocoros han sido correctamente unidos por microtbulos y enva una seal de activacin del APC, para que d comienzo la prdida de cohesin.
En la Figura 2.9 se explica el mecanismo de degradacin de las cohesinas.

25

Gametognesis y meiosis

2.4 Gametognesis y meiosis


En organismos de reproduccin sexual, la formacin de los gametos implica un modo de divisin celular diferente al de las clulas somticas. Los gametos debern poseer una sola copia de cada cromosoma, de modo que el cigoto resultante de la unin del gameto masculino y del gameto femenino en la fertilizacin sea diploide (con un cromosoma de origen paterno y otro cromosoma de origen materno en cada par cromosmico). Para obtener un nmero haploide (n) de cromosomas en los gametos, el proceso de formacin de los mismos (gametognesis) tiene unas caractersticas especiales. La principal peculiaridad es la existencia de un tipo distinto de divisin celular en el que una clula diploide (2n) replica su ADN una vez (duplicando su contenido total en ADN de 2C a 4C) pero experimenta dos divisiones cromosmicas; esto tiene como consecuencia que los gametos masculino (espermatozoide) y femenino (oocito) llevan un nmero haploide de cromosomas (n) y un contenido total de ADN igual a C (una cromtide por cromosoma). Este modo de divisin celular se denomina meiosis, y tiene adems otras caractersticas muy importantes para la transmisin de la variabilidad gentica. En ambas lneas germinales, masculina o femenina, la gametognesis comienza cuando los gonocitos experimentan una serie de divisiones mitticas tpicas en las que las clulas van madurando hasta llegar a formar las gonias (espermatogonias u oogonias, respectivamente) y los gametocitos primarios, que son clulas diploides (2n). A partir de este momento, las clulas replican su ADN en la fase S y a continuacin entran en meiosis, en vez de dividirse por mitosis. La meiosis incluye en realidad dos distintas divisiones cromosmicas, por lo que suele separarse en dos fases llamadas meiosis I (o primera divisin meitica) y meiosis II (segunda divisin meitica). La meiosis I es la ms importante de las dos, y comienza con una profase larga, complicada y claramente distinta de la profase de la mitosis. Esta profase de la meiosis I (llamada, por tanto, profase I) comienza con la condensacin de la cromatina que, no lo olvidemos, se haba replicado en la fase S precedente. Ambas cromtides estn ntimamente unidas formando un nico filamento, que se une por sus extremos a la membrana nuclear. Esta primera parte de la profase I se llama leptoteno. En la siguiente etapa, llamada cigoteno, los cromosomas homlogos se emparejan longitudinalmente con gran exactitud, de manera que las secuencias de cada uno de los dos homlogos quedan perfectamente alineadas. La unin entre los cromosomas de cada par se hace progresivamente ms fuerte, dando lugar a un fenmeno que se conoce como sinapsis. La sinapsis se mantiene gra-

www.FreeLibros.me

26

El ADN en el ncleo de la clula eucariota

GAMETOGNESIS
Gametocitos Primarios 2n / 4C

Gametocitos Secundarios

n / 2C Corpsculo Polar Primario

Espermatocitos Secundarios Gametos

Oocito Secundario

n/C Corpsculo Polar Secundario

Espermatozoides

vulo

En la Figura 2.10 se presenta un esquema de la gametognesis.

cias a la formacin del complejo sinaptonmico. La profase I contina con la siguiente etapa, paquiteno, en la que los cromosomas se condensan todava ms y cada par de homlogos apacece como un bivalente (una estructura formada por dos cromosomas) o ttrada (por estar formada por cuatro cromtides). De todas formas, el evento ms importante de la etapa de paquiteno es el intercambio de material gentico entre cromosomas homlogos, a travs del proceso de recombinacin que estudiaremos ms adelante. En la siguiente etapa, la de diploteno, desaparece el complejo sinaptonmico y los cromosomas homlogos comienzan a separarse. Recordemos que hasta este momento la clula es diploide (2n) con contenido 4C de ADN, al tener dos cromtides por cromosoma. Durante la separacin de los cromosomas homlogos en diploteno, las dos cromtides de cada cromosoma permanecen todava unidas entre s. Sin embargo, debido al intercambio de material gentico precedente, la separacin pone de manifiesto los puntos en los que se produjo un sobrecruzamiento, ya que esas regiones forman puentes que mantienen unidos a los

www.FreeLibros.me

dos homlogos de cada par e impiden la separacin total. Estos puntos se denominan quiasmas, y han de resolverse de algn modo para que la separacin de los cromosomas pueda completarse. Por tanto, la profase I termina con una etapa corta denominada diaquinesis, en la que la cromatina alcanza su grado mximo de condensacin y los cromosomas aparecen ms cortos y gruesos. Tras la profase I, los espermatocitos primarios entran ahora en metafase I, en la cual desaparece la membrana nuclear, se forma el huso y los microtbulos traccionan por los quinetocoros. Esto hace que los bivalentes, que llevan los cromosomas parcialmente separados (unidos nicamente por los quiasmas), se orienten en el ecuador de la clula. Debido a esta configuracin, los cromosomas homlogos se sitan en la placa metafsica con los centrmeros apuntando cada uno hacia uno de los polos de la clula. En la anafase I, la traccin de los microtbulos y la activacin del Complejo Promotor de la Anafase permiten la separacin total de cada cromosoma homlogo hacia uno de los polos, fenmeno llamado disyuncin. Finalmente, en la telofase I se han formado ya dos grupos de cromosomas en cada polo de la clula: cada uno de estos grupos consta de un nmero haploide (n) de cromosomas, cada uno de los cuales posee dos cromtides (contenido total de ADN igual a 2C). La meiosis I termina con la citoquinesis, la divisin fsica de las dos clulas hijas. Esta ltima fase es diferente en la lnea germinal masculina y femenina, porque as como las clulas hijas del espermatocito primario son iguales, en el caso de la lnea femenina una de las dos clulas hijas se lleva casi todo el citoplasma mientras que la otra es mucho menor. Por tanto, en la espermatognesis cada esperamatocito primario da lugar a dos espermatocitos secundarios, mientras en la oognesis cada oocito primario da lugar a un oocito secundario y a un corpsculo polar de primer orden. La segunda divisin meitica, o meiosis II, es prcticamente igual a una mitosis. La nica diferencia estriba en que la clula que se divide es haploide, mientras que en el caso de la mitosis la clula es diploide. Por tanto, esta divisin celular va a separar las dos cromtides que componen cada cromosoma de un gametocito secundario, para generar gametos con un nmero haploide de cromosomas (n), cada uno de los cuales est formado por una sola cromtide (contenido total de ADN igual a C). Como decamos al principio, esto asegura que la fecundacin da lugar a un cigoto diploide (2n) con contenido de ADN igual a 2C, al recibir un complemento cromosmico de cada gameto. El modo en que se completa la meiosis es tambin diferente en ambos sexos. As como la espermatognesis discurre de un modo continuo desde que se alcanza la madurez sexual, la oognesis se detiene en profase I, de manera que un alto nmero de oocitos primarios permanecen en un estado prolongado de diploteno, llamado dictioteno. Estos oocitos slo proseguirn su maduracin al llegar la madurez sexual, cuando con cada ciclo menstrual un oocito culmina la meiosis I y completa tambin la meiosis II para dar un oocito secundario (vulo) y un segundo corpsculo polar.
La Figura 2.11 incluye un vdeo en el que se muestran esquemticamente las distintas fases de la meiosis.

27

Gametognesis y meiosis

www.FreeLibros.me

28

Es importante fijarse en un hecho distintivo de la anafase de la meiosis I, que no comparten ni la anafase de la meiosis II ni la anafase de la mitosis. Este hecho consiste en que los cromosomas homlogos se separan pero, al mismo tiempo, las dos cromtides de cada cromosoma, por la accin de unas molculas llamadas shugoshinas, deben permanecer unidas por los centrmeros. Esto se consigue porque las cohesinas centromricas no son degradadas por las separasas. Las shugoshinas se unen especficamente a los centrmeros y, por su asociacin con una fosfatasa, impiden la fosforilacin de las cohesinas a ese nivel, lo cual a su vez impide que las cohesinas sean degradadas por las separasas. Despus, en la meiosis II, la ausencia de shugoshinas permite una segunda ola de activacin de separasas que finalmente llevar a la separacin completa de las dos cromtides de cada cromosoma homlogo. Al margen de lo dicho en relacin con la reduccin del nmero total de cromosomas en los gametos, la gran importancia de la meiosis reside en que es uno de los principales mecanismos de creacin de variabilidad gentica. Esto sucede a dos niveles, primero por la segregacin aleatoria de los cromosomas de cada progenitor a los gametos, y en segundo lugar por el intercambio de material gentico que tiene lugar durante los procesos de recombinacin. Respecto a lo primero, es fcil comprender que cada divisin meitica producir gametos con distintas combinaciones de los cromosomas que estaban en la clula diploide original, ya que la segregacin se produce al azar. Para entender esto es til imaginarse todos los cromosomas de una clula diploide como la suma de dos conjuntos haploides, el paterno y el materno. As, cada pareja de cromosomas homlogos consta de un homlogo de origen paterno y otro de origen materno. Cuando los homlogos se separan en la meiosis, no pasan todos los de origen paterno a una de las clulas hijas, y todos los de origen materno a la otra; por el contrario, se distribuyen aleatoriamente. Como los homlogos pueden tener pequeas diferencias en los alelos presentes para algunos genes, el resultado es que cada gameto lleva una combinacin nica de cromosomas de origen paterno y materno mezclados. La variabilidad que se puede generar por este sencillo mecanismo es altsima, porque con 23 parejas de cromosomas el nmero de combinaciones posibles es igual a 223, o lo que es lo mismo 8.388.608. Por lo que respecta al segundo tipo de variabilidad introducida durante la meiosis, en la especie humana se ha calculado que se producen unos 55 sobrecruzamientos por clula, porque ese es el nmero medio de quiasmas que se observan. Esto supone una media de al menos dos sobrecruzamientos por par cromosmico, incluidos los cromosomas sexuales. La presencia de estos quiasmas es importante para mantener los bivalentes unidos hasta anafase I, y asegurar que la disyuncin se produce de modo correcto. Pero adems, es probable que el nmero total de eventos de recombinacin sea todava mayor al nmero de quiasmas, porque no todas las recombinaciones producen un sobrecruzamiento (como se ver en el apartado siguiente). Por tanto, el grado de intercambio de material gentico entre cromtides de cromosomas homlogos es bastante alto, y hace que los cromosomas que finalmente llegan a un gameto sean ligeramente distintos a los cromosomas que estaban presentes en la clula inicial. Como resultado de esto, la variabilidad gentica generada durante la meiosis es alta, y por eso la probabilidad de que dos individuos tengan dos descendientes genticamente idnticos es prcticamente nula. Esto es precisamente lo que persigue la reproduccin sexual: generar descendientes distintos a sus progenitores y distintos entre s.

El ADN en el ncleo de la clula eucariota

www.FreeLibros.me

2.5 Recombinacin a nivel molecular


Uno de los temas ms importantes en gentica es la caracterizacin de los mecanismos moleculares por los que se produce intercambio de material gentico entre cromtides durante la meiosis. Distintos modelos han intentado explicar cmo dos molculas de ADN homlogas pueden entrecruzarse e intercambiar material gentico. El paso inicial comn a todos los modelos propuestos es el alineamiento preciso de ambas molculas, precisamente debido a que son cadenas de ADN homlogas, es decir, pertenecientes a cromosomas homlogos y por tanto con la misma secuencia de nucletidos. En realidad, hoy sabemos que ambas molculas no son absolutamente idnticas, ya que pueden existir diferencias allicas en su secuencia (por ejemplo, pequeas diferencias de un nucletido). En cualquier caso, el alineamiento de dos secuencias homlogas es un requisito imprescindible para que se inicie el proceso de recombinacin, que se denomina por eso recombinacin homloga. Dicho alineamiento, como es lgico, se produce durante la profase I de la meiosis merced al complejo sinaptonmico que mantiene estrechamente unidos los cromosomas homlogos en toda su longitud. Es lgico pensar que dicha configuracin permite que dos molculas de ADN de secuencia homloga se mantengan en contacto. Los primeros modelos de recombinacin proponan que, tras el alineamiento, ambas molculas de ADN sufren una mella en una de sus cadenas, exactamente en la misma posicin, y esto deja dos cadenas libres que se intercambian entre s y se unen a la molcula homloga por complementariedad de bases. Dado que la generacin de dos mellas simultneas en la misma posicin es un evento muy improbable, Meselson y Radding propusieron otro modelo en el que una sola mella en una de las dos molculas es suficiente para iniciar el proceso de recombinacin, ya que la cadena libre puede invadir la doble hlice homloga. Los estudios llevados a cabo en distintas especies de eucariotas en los ltimos aos han demostrado que la recombinacin se inicia por la aparicin de una rotura completa de una de las dos molculas homlogas, es decir, una rotura bi-catenaria (de las dos cadenas de una doble hlice). Dichas lesiones, llamadas DSB (Double-Strand Break, en ingls), se generan con cierta frecuencia en el ADN celular en respuesta a diversas causas; parece comprobado que la creacin especfica de un DSB durante profase I es el proceso iniciador de la recombinacin. Segn el modelo actual de recombinacin homloga, en este proceso intervienen una serie de complejos proteicos:

29

Recombinacin a nivel molecular

Complejo RAD50, formado por las molclulas MRE11, RAD50 y NBS1. El complejo RAD52, que incluye varios componentes (RAD51, RAD52, RAD54, RAD55 y RAD57 entre otros). La molcula RPA (la misma protena A de la replicacin).

Tras la creacin de un DSB, los extremos libres son procesados mediante la actividad exonucleasa del complejo RAD50, que acta en direccin 53 y, por tanto, genera extremos libres ms largos en la hebra 3. Este extremo protruyente se recubre de RPA, RAD51 y otras molculas del complejo RAD52 para formar un filamento nucleo-proteico. Este filamento tiene la capacidad de invadir la doble hebra homloga, abriendo en ella una burbuja, y se empareja a la cadena complementaria que

www.FreeLibros.me

30

discurre en direccin antiparalela. A partir de este extremo 3 se extiende la cadena usando la hebra complementaria como molde, al tiempo que se extiende tambin el otro extremo que haba quedado libre. Tras una corta extensin, los extremos libres se unen por accin de una ligasa y esto genera dos estructuras en las que una hebra salta de una molcula de ADN a la molcula homloga. Dichas estructuras se denominan estructuras de Holliday, que fue el primero en proponer su existencia. Es importante tener en cuenta que si las dos molculas de ADN no son inicialmente idnticas en su secuencia, durante el proceso de recombinacin se pueden formar molculas hbridas, en las que ambas cadenas no son idnticas. Dichas molculas de ADN se llaman heteroduplex, y son muy importantes porque los desemparejamientos son corregidos por un mecanismo de reparacin que se estudiar en otro captulo; dicha correccin hace que una de las dos cadenas se modifique para hacerse perfectamente complementaria a la otra, en un proceso llamado conversin gnica. Como veremos en otras partes de este texto, la conversin gnica es un mecanismo que da lugar a varias enfermedades genticas en humanos. Las estructuras de Holliday dan lugar unas estructuras cruciformes formadas por dos molculas de ADN, llamadas tambin estructuras chi, que han de resolverse de algn modo para permitir la separacin de las dos cromtides. La resolucin de las estructuras de Holliday puede hacerse segn un plano vertical o segn un plano horizontal, y es precisamente el tipo de resolucin que se lleva a cabo lo que determina el tipo de molculas que se generan. Por ejemplo, si las dos estructuras de Holliday se resuelven segn el mismo plano, las molculas resultantes van a dar lugar a un sobrecruzamiento (la configuracin que da lugar a los quiasmas que se ven en la meiosis); en cambio, cuando las dos estructuras de Holliday se resuelven segn planos distintos se producir recombinacin sin sobrecruzamiento. A su vez, cada una de estas dos posibilidades puede darse con o sin conversin gnica, dependiendo de la presencia de heteroduplex y del modo en que se reparan. Curiosamente, el modelo de recombinacin iniciado por una rotura bicatenaria en una cadena es fruto de los estudios de reparacin de este tipo de lesiones en eucariotas. Como veremos en otro captulo, las roturas bicatenarias son un tipo frecuente de agresin al ADN, y son reparados en clulas somticas precisamente por un mecanismo de recombinacin homloga que tiene lugar durante la fase S del ciclo celular. En los ltimos aos se ha visto que este mismo mecanismo explica tambin las predicciones acerca de la recombinacin durante la meiosis, y que de hecho la maquinaria proteica responsable es bsicamente la misma. Por tanto, hoy en da se considera como un mismo mecanismo que se ha adaptado a dos funciones celulares importantes como la reparacin del ADN y la generacin de variabilidad gentica durante la formacin de los gametos. Ms recientemente, se ha sugerido que la recombinacin homloga tambin puede tener otra funcin importante: la reiniciacin de la replicacin del ADN. A menudo, la horquilla de replicacin se para prematuramente durante la sntesis de ADN y toda la maquinaria replicativa se desensambla; antes se pensaba que estas horquillas interrumpidas se reinician por el ensamblaje de un nuevo complejo de replicacin en ese punto, pero cada vez hay ms datos a favor de la hiptesis de que la replicacin se reinicia en esas horquillas por un fenmeno de recombinacin homloga. Dicha recombinacin podra darse entre las dos cromtides hermanas idnticas (la cromtide con la horquilla interrumpida y

El ADN en el ncleo de la clula eucariota

www.FreeLibros.me

31
C G h G C h/h T A G C h/v v

Recombinacin a nivel molecular

C G G C

T A G C

C G G C

T A G C

SI conversin NO conversin

NO sobrecruzamiento

SI sobrecruzamiento

La Figura 2.12 muestra esquemticamente el modelo de recombinacin iniciado por una rotura bicatenaria en uno de los cromosomas homlogos, as como la resolucin de las estructuras de Holliday y los posibles resultados de los procesos de recombinacin.

la que se ha originado por la replicacin hasta ese punto), que sera lo normal, o bien puede darse entre cromtides de cromosomas homlogos, en cuyo caso se originara un fenmeno de recombinacin homloga con posible sobrecruzamiento. De hecho, algunos autores han sugerido que, originalmente, la principal funcin del mecanismo de recombinacin fue precisamente la reparacin de horquillas de replicacin interrumpidas.

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 3

Tcnicas bsicas de gentica molecular

Contenidos
3.1 Tecnologa del ADN recombinante: mtodos y usos ms frecuentes 3.2 Enzimas de restriccin 3.3 Tcnicas bsicas de hibridacin de cidos nucleicos. 3.4 Amplificacin in vitro de ADN (PCR) 3.5 Secuenciacin del ADN 3.6 Microarrays.

3.1 Tecnologa del ADN recombinante: mtodos y usos 3.1 ms frecuentes


A principios de los aos 1970 se desarrollaron una serie de tcnicas que dieron lugar a lo que se llam ingeniera gentica, clonacin molecular o tecnologa del ADN recombinante. Bsicamente, esta tecnologa naci como respuesta a la necesidad de obtener grandes cantidades de un gen o genes, o incluso genomas completos, para poder llevar a cabo los estudios que permitiesen obtener la secuencia de nucletidos de un gen concreto, estudiar sus mutaciones, analizar su funcin, etc. El nombre de clonacin molecular sugiere precisamente la idea de un nmero grande de copias idnticas, y se utilizaba ya en biologa para designar poblaciones de bacterias o clulas idnticas (clones). Al aplicarlo a la obtencin de copias idnticas de un cido nucleico, se convirti en clonacin molecular. El primer experimento que mostr la posibilidad de propagar un fragmento de ADN de eucariotas en una bacteria fue la clonacin de fragmentos del ADN ribosomal de Xenopus laevis dentro de la bacteria E. coli. Desde entonces, la tecnologa del

www.FreeLibros.me

34

ADN recombinante se ha utilizado con xito en muchos campos, desde aplicaciones con fines industriales (dando lugar a la Biotecnologa), hasta la deteccin de alteraciones genticas, pasando por la modificacin gentica de organismos, la terapia gnica y un largo etctera. En este captulo recordaremos los principios generales de las tcnicas bsicas de biologa molecular; otras tecnologas ms especficas utilizadas en Gentica Humana, como el diagnstico molecular de alteraciones genticas o la terapia gnica, se vern con ms detalle en los captulos correspondientes. En lneas generales, la obtencin de grandes cantidades de un fragmento especfico de ADN (es decir, de un gran nmero de copias idnticas) se lleva a cabo en varios pasos: i) obtencin de un pequeo nmero de copias de dicho fragmento, habitualmente mediante la digestin del ADN celular con algn enzima que corte especficamente el genoma en el punto deseado; ii) la insercin de esas copias en un vector de clonacin, que es un fragmento de ADN con unas propiedades especiales que le permiten multiplicarse dentro de un husped apropiado; iii) la propagacin del nuevo fragmento recombinante (es decir, el fragmento hbrido formado por la unin del inserto y el vector) dentro del husped, obteniendo un gran nmero de copias del mismo. Esta metodologa puede tambin aplicarse a genomas completos, de forma que es posible cortar un genoma en pequeos fragmentos y clonar cada uno de esos fragmentos por separado; la coleccin completa de clones que representan un genoma se denomina genoteca (o biblioteca genmica). Aunque las genotecas pueden representar genomas completos, tambin es habitual crear genotecas de fragmentos genmicos (un cromosoma, por ejemplo, o una regin cromosmica de inters) cuando no sea posible clonar ese fragmento debido a su gran tamao. Tambin es posible construir genotecas especializadas, en las que los fragmentos insertados en los vectores tienen una naturaleza especfica; por ejemplo, son muy comunes las genotecas de ADNc, en las que cada clon lleva un ADN complementario (una copia en ADN de un ARN mensajero).
Figura 3.1. Estrategia general de clonacin molecular de un fragmento de ADN en un vector para su propagacin en bacterias.

Tcnicas bsicas de gentica molecular

Por tanto, en toda estrategia de clonacin molecular son necesarios tres elementos bsicos: un inserto, un vector y un husped. Como hemos dicho, el inserto es el fragmento de ADN que queremos obtener en grandes cantidades, para despus proceder a estudiarlo. Por lo que respecta al husped, lo ms habitual es que se trate de alguna cepa de la bacteria Escherichia coli, especialmente modificada para permitir el crecimiento de vectores con gran eficacia y fidelidad. Respecto a los vectores de clonacin, existe una gran variedad de posibilidades, cada una con caractersticas distintas que los hacen adecuados para aplicaciones concretas. Los primeros vectores utilizados fueron los plsmidos, que son elementos bacterianos extracromosmicos, circulares, que se replican dentro de la bacteria husped con independencia de la replicacin del cromosoma bacteriano. Los plsmidos utilizados en clonacin molecular son variaciones de plsmidos nativos, que han sido modificados con el objeto de conseguir que se repliquen con mayor eficacia (hasta cientos de copias por bacteria). Adems, tambin se ha creado en ellos una regin que se puede cortar fcilmente con enzimas de restriccin (ver ms adelante) para introducir en ella el fragmento de ADN de inters (es decir, el inserto). Tambin se ha introducido en ellos el gen de resistencia a algn antibitico, que permita se-

www.FreeLibros.me

leccionar las bacterias que llevan el plsmido dentro: cuando al cultivo en el que crecen las bacterias se aade el antibitico, slo crecern aquellas que tienen el plsmido y expresan los genes del mismo. Los plsmidos tienen una capacidad limitada, ya que permiten albergar insertos de unas 5-10 kilobases de tamao, como mximo. La necesidad de clonar fragmentos de mayor tamao hizo que se desarrollasen otros tipos de vectores derivados del genoma del fago lambda, un virus bacterifago que infecta bacterias introduciendo en ellas el genoma viral. Modificando el genoma nativo del fago lambda, se han creado diversos vectores de clonacin con una capacidad mayor que la de los plsmidos (permiten albergar insertos de tamaos en torno a las 15 kilobases), que tambin se replican en bacterias con gran eficacia. La necesidad de clonar fragmentos todava mayores llev a desarrollar otros tipos de vectores. Por ejemplo, los csmidos son vectores artificiales con caractersticas de plsmidos y de fagos, y tienen una capacidad de unas 40 kilobases. Posteriormente aparecieron vectores derivados de los cromosomas de levaduras, incluyendo secuencias necesarias para la replicacin y la estabilidad de los brazos cromosmicos. Estos vectores se denominan Cromosomas Artificiales de Levaduras (en ingls YAC, Yeast Artificial Chromosome), crecen dentro de levaduras y tienen una gran capacidad porque pueden albergar insertos de hasta dos megabases (2 106 pares de bases). Como veremos ms adelante, los vectores tipo YAC fueron muy importantes para crear los primeros mapas del genoma humano, pero tienen algunos inconvenientes en su manejo ya que los insertos a veces sufren alteraciones a medida que se multiplican dentro de las levaduras. Por tanto, se desarrollaron otros vectores con menos capacidad pero mucho ms estables y de manejo ms fcil, como son los vectores derivados del fago P1 o del mismo cromosoma bacteriano. Estos vectores se denominan, respectivamente PAC (del ingls, P1-phage Artificial Chromosome) y BAC (Bacterial Artificial Chromosome); crecen tambin dentro de bacterias y son capaces de albergar insertos de tamaos entre 100-150 kilobases. Aunque existen muchos otros tipos de vectores que se utilizan en tcnicas de clonacin molecular, estos son los ms usados en Gentica humana, y aparecern en otros captulos de este texto. El proceso general de clonacin molecular se desarrolla en varios pasos. En primer lugar, es necesario preparar el inserto y el vector de modo adecuado. Esto supone cortarlos de modo que los extremos libres del inserto puedan unirse a los extremos del vector. De hecho, como los vectores suelen ser circulares es necesario abrirlos en un lugar especfico en el que introducir el inserto. Todos estos cortes se llevan a cabo con unas enzimas especiales llamadas enzimas de restriccin, cuya caracterstica principal es precisamente la capacidad de cortar el ADN en regiones especficas. Debido a la importancia de las enzimas de restriccin en ingeniera gentica, les dedicaremos el siguiente apartado de este captulo; por ahora, es suficiente comprender que constituyen las tijeras moleculares que nos permiten realizar cortes especficos en el inserto y en el vector para que ambos tengan extremos compatibles que se puedan unir. El siguiente paso es, precisamente, la unin de inserto y vector para formar la molcula recombinante o hbrida. Esta unin la realiza un enzima denominada ADN ligasa, habitualmente procedente del fago T4. Este enzima tiene la capacidad de catalizar la formacin de enlaces fosfo-di-ster entre el grupo 5 fosfato y el grupo 3 hidroxilo de dos cadenas nucleotdicas yuxtapuestas, y por tanto puede unir dos molculas de ADN bicatenario cuyos extremos sean compatibles. Tras la reaccin de ligacin se obtiene una molcula circular de ADN conteniendo el inserto dentro del

35

Tecnologa del ADN recombinante: mtodos y usos ms frecuentes

www.FreeLibros.me

36

vector, y capaz de replicarse dentro de un husped apropiado merced a las secuencias especficas del vector. Por tanto, el siguiente paso del proceso de clonacin molecular consiste en la introduccin de la molcula recombinante en el husped, habitualmente E. coli. Este proceso se denomina transformacin, y puede hacerse por mtodos qumicos o fsicos. El mtodo qumico ms empleado es el golpe de calor en una solucin de cloruro de calcio, tras el cual las bacterias son capaces de permitir el acceso de molculas de ADN a su interior. Este proceso es muy ineficaz, ya que slo una bacteria de cada 500 o cada 1000 incorporar la molcula de ADN recombinante con xito; sin embargo, las bacterias se multiplican varios rdenes de magnitud cuando crecen en cultivo, por lo que en teora basta que la transformacin sea eficaz en tan slo unas pocas bacterias para que podamos crecerlas en condiciones de seleccin (utilizando antibiticos especficos dependiendo del tipo de vector que usemos) y obtener una poblacin en la que todas las bacterias contienen la molcula de ADN recombinante. Los mtodos fsicos son ms eficaces que los qumicos, y se basan en la apertura de poros en la pared bacteriana mediante la aplicacin de un shock elctrico, por lo que la tcnica se denomina electroporacin. Al final del proceso, por tanto, contamos con una poblacin bacteriana compuesta por millones de bacterias, cada una de las cuales lleva varios cientos de copias de una molcula recombinante que contiene un fragmento especfico de ADN (el inserto original). Utilizando mtodos sencillos de extraccin de ADN de las bacterias, es posible obtener preparaciones muy puras que contienen millones de copias del fragmento, y esto nos permite llevar a cabo cualquier tipo de anlisis o de estudios funcionales.

Tcnicas bsicas de gentica molecular

ADN GENMICO

GENOTECA
La Figura 3.2 incluye enlaces a animaciones que muestran el proceso de transformacin y la obtencin de alto nmero de copias de molculas recombinantes.

www.FreeLibros.me

3.2 Enzimas de restriccin


En los aos 1950 se descubri que algunos bacterifagos (virus que infectan y destruyen bacterias) podan infectar algn tipo concreto de bacterias pero no otros, debido a que algunas bacterias eran capaces de digerir el ADN del fago y por tanto impedan su crecimiento. Como el fago ve restringido el rango de huspedes que puede infectar, a dicho sistema se le llam sistema de restriccin. Posteriormente se descubri que dicha restriccin se lleva a cabo gracias a unas enzimas del tipo endonucleasas, que digieren el ADN de doble cadena tras el reconocimiento y unin a secuencias especficas en el genoma invasor. Por tanto, dichas enzimas reciben el nombre genrico de enzimas de restriccin. Las enzimas de restriccin tienen gran importancia para la supervivencia de las bacterias, y por ello son muy abundantes y aparecen en todos los gneros de bacterias que se han estudiado. El descubrimiento de las primeras enzimas de restriccin de tipo II en los aos 1970 fue clave para el desarrollo de las tecnologas del ADN recombinante. Las enzimas de restriccin se clasifican en tres tipos: tipo I, tipo II y tipo III. Las enzimas de tipo I y las de tipo III son complejos multiproteicos que reconocen secuencias especficas de ADN asimtricas, y digieren al ADN en otra regin inespecfica alejada de la secuencia de reconocimiento, bastante alejadas en el caso de las tipo I (desde 50 hasta varios miles de pares de bases) o menos alejadas en el caso de las tipo III (unos 25 pares de bases). De todas formas, las enzimas de restriccin de inters en ingeniera gentica son las de tipo II, que estn codificadas por un nico gen bacteriano y que suelen actuar en forma de dmeros. Su caracterstica principal es que el corte endonucleoltico tiene lugar dentro de la misma secuencia de reconocimiento por la que se unen al ADN, llamadas tambin dianas o sitios de restriccin. Hoy en da se conocen ms de 3 000 endonucleasas de restriccin de tipo II, que reconocen ms de 200 dianas distintas. Las enzimas que reconocen la misma diana pero proceden de bacterias distintas se denominan isosquizmeros; es importante conocer su existencia para no confundir endonucleasas que tienen la misma secuencia de reconocimiento. En este sentido, es importante conocer la nomenclatura de estas enzimas, que depende del nombre de la cepa bacteriana de la que se aslan. Por ejemplo, las enzimas de restriccin purificadas a partir de Escherichia coli se denominan EcoXX: las tres primeras letras (en cursiva) designan la especie, y uno o ms caracteres en mayscula (letras o numeros romanos, nunca en cursiva) designan la cepa o distinguen varias enzimas de una misma bacteria. Por lo general, las dianas de reconocimiento de las enzimas tipo II tienen una longitud de cuatro a ocho pares de bases. Lgicamente, el nmero de posibles sitios de corte para una endonucleasa de restriccin vara inversamente a la longitud de la diana de reconocimiento, ya que por azar es ms fcil encontrar secuencias de cuatro nucletidos que de ocho, por poner un ejemplo. Esto es importante a la hora de predecir si un enzima concreto presentar muchas o pocas dianas en un fragmento de ADN. Una caracterstica importante de las enzimas de tipo II es que las secuencias de reconocimiento son idnticas cuando se leen en direccin 53 en cada una de las dos cadenas de la doble hlice. Es decir, las dianas de reconocimiento de las enzimas tipo II son secuencias palindrmicas. Existen algunas excepciones a esta regla general, sobre todo cuando las dianas de reconocimiento tienen alguna posicin degenerada, es decir, que puede ser ocupada por dos o ms nucletidos indistintamente.

37

Enzimas de restriccin

www.FreeLibros.me

38

Finalmente, una caracterstica comn a la mayora de las enzimas tipo II es que cortan la cadena de ADN dentro de la secuencia de reconocimiento. Dependiendo del sitio exacto donde corten, los extremos libres generados por el corte pueden ser de varios tipos. En primer lugar, si la secuencia de reconocimiento est constituida por un nmero par de nucletidos y el corte se produce exactamente en el centro, los extremos sern romos, es decir, las dos cadenas de la molcula de ADN tendrn la misma longitud. En cambio, en otras enzimas el punto de corte est desplazado respecto del eje de simetra de la secuencia de reconocimiento; dada la naturaleza palindrmica de dicha secuencia, esto genera extremos libres en los que una de las dos cadenas de la doble hlice es ms larga que la otra, que se denominan extremos cohesivos. En las enzimas que generan extremos cohesivos, se distinguen adems dos tipos segn cul de las dos cadenas de la molcula de ADN es ms larga, la cadena 5 o la 3; as se habla de extremos cohesivos con salientes 5 o 3, respectivamente. El tipo de extremos que genera cada enzima es un factor importante en los experimentos de clonacin molecular, porque las ligasan slo pueden unir extremos que sean compatibles, y adems los extremos cohesivos habitualmente son ligados con mucha mejor eficacia que los extremos romos.

Tcnicas bsicas de gentica molecular

AluI NlaIII Sau3AI TCGACAGCTGACGCATGTATAGCTAGCGATCTAGC ||||||||||||||||||||||||||||||||||| AGCTGTCGACTGCGTACATATCGATCG CTAGATCG

5 GACAG CTGAC ||||| ||||| CTGTC GACTG


Extremos romos

5AGC GATCTAG ||| ||| TCGCTAG ATC

Extremos cohesivos (salientes 5)

5ACGCATG TAT ||| ||| TGC GTACATA


Extremos cohesivos (salientes 3)

En la Figura 3.3 se muestran ejemplos de dianas de restriccin con extremos romos y cohesivos, as como una animacin del proceso de corte.

3.3 Tcnicas bsicas de hibridacin de cidos nucleicos


El desarrollo del concepto de hibridacin entre molculas de cidos nucleicos ha tenido gran importancia en el desarrollo de la ingeniera gentica, como veremos al ha-

www.FreeLibros.me

blar de algunas tcnicas concretas en otros apartados de este captulo. En sentido general, hibridacin se refiere al proceso por el que dos cadenas de cidos nucleicos que son complementarias se unen para dar una molcula bicatenaria. Las cadenas originales pueden ser de ADN o de ARN, de modo que la hibridacin puede ser ADN-ADN o ADN-ARN (es ms infrecuente trabajar con dobles cadenas de ARN). La hibridacin es un proceso con una cintica que se puede estudiar por las curvas de desnaturalizacin del ADN. Cuando una doble hlice se desnaturaliza hasta la separacin completa de ambas cadenas y se retiran las condiciones desnaturalizantes, las cadenas vuelven a reasociarse buscando las regiones complementarias: a mayor nmero de nucletidos complementarios, la renaturalizacin es ms rpida (y la desnaturalizacin ms difcil). Como hemos visto, la desnaturalizacin se realiza habitualmente por calor; si medimos el porcentaje de molculas desnaturalizadas a medida que aumentan la temperatura, obtenemos una curva sigmoidea que permite calcular la temperatura a la cual el 50 por ciento de las molculas estn desnaturalizadas. Dicha temperatura se conoce como temperatura de fusin, abreviada Tm (de melting en ingls). Un fragmento de ADN tendr una Tm caracterstica que depender de su tamao y de la composicin de bases: como los pares entre citosina y guanina forman tres puentes de hidrgeno frente a los dos que forman los pares adenina-timina, un fragmento con muchos pares G:C ser ms estable y ms difcil de desnaturalizar, por lo que su Tm ser ms alta que la de un fragmento rico en pares A:T. Estas propiedades de desnaturalizacin e hibridacin de dobles hlices de ADN han sido explotadas para desarrollar mtodos de laboratorio que permitan identificar la naturaleza de fragmentos de cidos nucleicos en mezclas complejas. Por ejemplo, la digestin de ADN celular total con un enzima de restriccin produce miles de fragmentos de distintos tamaos en el tubo de reaccin; en esas circunstancias, es posible identificar cul de esos fragmentos es portador de una secuencia especfica utilizando tcnicas de hibridacin. Para ello, se aade a la mezcla otro pequeo fragmento de ADN que represente la regin que queremos identificar, se desnaturalizan todos los fragmentos y se dejan hibridar libremente. La mayor parte de las cadenas complementarias se reasociarn para reconstruir los fragmentos originales; en cambio, la presencia de pequeas cadenas que son perfectamente complementarias con una regin de un fragmento grande permitir la formacin de hbridos entre la cadena pequea y la correspondiente cadena larga complementaria. De hecho, esta reaccin se ve favorecida respecto de la reasociacin de cadenas largas entre s, precisamente porque los fragmentos pequeos hibridan ms rpidamente. Por tanto, un pequeo fragmento de ADN es capaz de identificar los fragmentos de una mezcla compleja que contienen secuencias complementarias al mismo. Por este motivo, estos pequeos fragmentos se denominan sondas (probe en ingls), y suelen estar constituidas por molculas de ADN de varios cientos de pares de bases. De todas formas, en un tubo de ensayo no se ven las molculas de ADN, por lo que una sonda de ADN no ser de gran utilidad si no es fcilmente detectable. Por este motivo, las sondas utilizadas en biologa molecular llevan algn tipo de marcaje que permita detectar su presencia: marcaje con algn istopo radioactivo, con un fluorocromo o con una molcula con actividad enzimtica detectable por alguna reaccin qumica. La utilizacin de sondas de ADN marcadas ha sido uno de los pilares bsicos de la ingeniera gentica en los ltimos decenios, y su utilizacin sigue estando

39

Tcnicas bsicas de hibridacin de cidos nucleicos

www.FreeLibros.me

40

muy extendida; de hecho, algunas de las tecnologas ms recientes, como los microarrays de ADN, se basan todava en la hibridacin de sondas con fragmentos diana.
La Figura 3.4 muestra el proceso de hibridacin de una sonda sobre una molcula complementaria de ADN.

Tcnicas bsicas de gentica molecular

Aunque los fenmenos de hibridacin se dan en solucin, la utilizacin ms habitual de sondas de ADN es la deteccin de fragmentos de cidos nucleicos que han sido previamente inmovilizados sobre un soporte slido. El ejemplo ms sencillo es la deteccin de un fragmento especfico de ADN celular que ha sido digerido con un enzima de restriccin. La separacin de los fragmentos generados por la digestin puede hacerse fcilmente mediante electroforesis en gel de agarosa o de acrilamida, sustancias porosas en las que la velocidad de migracin electrofortica vara en funcin del tamao de los fragmentos. Una vez que los fragmentos han sido separados, el uso de una sonda marcada nos permitir detectar el fragmento o fragmentos que contienen la secuencia de la sonda, ya que sta hibridar especficamente en esas regiones. Para llevar a cabo de modo sencillo la reaccin de hibridacin entre la sonda y los fragmentos digeridos que se han separado en el gel, Edwin Southern ide un mtodo sencillo para transferir todos los fragmentos del gel a un soporte slido de nitrocelulosa o de nylon, ms resistente y fcilmente manejable que un gel. La transferencia crea una rplica del gel en el soporte slido (llamado filtro, por utilizarse inicialmente papel de filtro), ya que mantiene la posicin relativa que tenan los fragmentos en el gel. Tomando nombre de su creador, la transferencia de fragmentos de ADN de un gel a un filtro se denomina transferencia southern; cuando los fragmentos son de ARN, en vez de ADN, las condiciones en que se realiza la transferencia cambian un poco, y se denomina transferencia northern (juego de palabras con Southern, que significa sureo; northern es norteo). Posteriormente, esta tcnica tambin se aplic a las protenas, tomando entonces el nombre de transferencia western (occidental).
La Figura 3.5 ilustra el proceso de electroforesis en gel de agarosa, as como la transferencia de fragmentos a una membrana rgida.

Los mtodos de transferencia de cidos nucleicos a soporte slido junto con la hibridacin con sondas marcadas han sido y siguen siendo muy utilizados en biologa molecular. Estos mismos principios se han combinado tambin con las tcnicas clsicas de citogentica para el estudio de cromosomas, dando lugar a las tcnicas de citogentica molecular que veremos en un captulo posterior. Otras aplicaciones de estas tcnicas al diagnstico de alteraciones genticas en Gentica humana sern abordadas en los captulos correspondientes.

3.4 Amplificacin in vitro de ADN (PCR)


Aunque las tcnicas de clonacin molecular proporcionan altas cantidades de un fragmento de ADN, son tcnicas laboriosas, con incubaciones largas: un experimen-

www.FreeLibros.me

to tpico de clonaje lleva unos dos das. Hacia finales de los aos 1980 se describi una metodologa nueva que permita amplificar selectivamente una regin concreta de ADN, de modo que partiendo de cantidades iniciales pequesimas (tericamente, una sola copia del fragmento) podran obtenerse varios miles de millones de copias. El mtodo se desarrolla en un periodo de pocas horas y no incluye ningn paso de digestin, ligacin ni transformacin, sino que se basa en la accin cclica de una polimerasa de ADN que amplifica selectivamente la regin de inters y ninguna otra. Por este motivo, el mtodo se conoce como reaccin en cadena de la polimerasa (abreviado PCR, en ingls Polymerase Chain Reaction). El punto central de la tcnica de PCR es la sntesis de ADN desde un punto concreto, repetida durante un nmero elevado de veces (ciclos). Por tanto, hay dos elementos esenciales de la tcnica: i) conseguir que la amplificacin se limite exclusivamente a la regin genmica de inters, y ii) utilizar algn tipo de polimerasa que permita repetir el proceso de sntesis de ADN muchas veces. Por lo que respecta al primer punto, la tcnica utiliza algo que ya era conocido, como es la capacidad de las polimerasas de ADN de catalizar la sntesis de ADN a partir del extremo 3 libre de un oligonucletido que est unido a una cadena complementaria ms larga, la cual acta como molde de la sntesis. Este proceso, habitual en la replicacin del ADN celular, puede reproducirse en el laboratorio utilizando pequeas molculas de ADN complementarias a una regin concreta de una doble cadena ms larga. Como es sabido, una de las formas de desnaturalizar el ADN (es decir, separar las dos cadenas de una doble hlice) es mediante calor; como sabemos, la temperatura necesaria para alcanzar dicha desnaturalizacin depende de la secuencia de la molcula, pero a partir de los 92-94 C la prctica totalidad de las molculas estarn desnaturalizadas. Si se desnaturaliza una molcula de ADN, obtendremos dos cadenas libres; al dejar enfriar la preparacin, ambas molculas vuelven a unirse por complementariedad de bases hasta que el ADN se re-naturaliza por completo. Este proceso es lento, por lo que si la re-naturalizacin se lleva a cabo en presencia de pequeos oligonucletidos cuya secuencia es complementaria a alguna porcin de la molcula larga original, estas pequeas molculas se unirn rpidamente a la regin complementaria de la molcula larga antes de que sta llegue a re-naturalizarse. El resultado es que cada una de las cadenas originales se mantiene monocatenaria excepto en la regin en que se ha unido el oligonucletido. En esa regin, una polimerasa de ADN puede sintetizar a partir del extremo 3 libre de la molcula pequea, usando como molde la secuencia de la molcula grande. Por este motivo, las molculas cortas que inician la sntesis de ADN se llaman cebadores (primers, en ingls). Si utilizamos dos cebadores, cada uno de ellos complementario a cada una de las dos cadenas de la molcula original de ADN, habr dos procesos de sntesis simultneos en direcciones opuestas, y al final tendremos dos cadenas bicatenarias de ADN con la misma secuencia que la molcula original. Es fcil ver que, precisamente, es la posicin de los cebadores la que determina qu regin de la molcula larga se va a amplificar, ya que slo la secuencia que queda comprendida entre los dos cebadores va a ser amplificada.
El vdeo de la Figura 3.6 muestra la desnaturalizacin, unin y extensin de un cebador sobre una regin especfica de ADN.

41

Amplificacin in vitro de ADN (PCR)

www.FreeLibros.me

42

Los elementos necesarios para llevar a cabo una reaccin de PCR, por tanto, son el ADN molde original que se quiere amplificar, los cebadores, la polimerasa de ADN y nucletidos libres que se incorporan a la cadena naciente durante la sntesis. Por lo que respecta al ADN molde, una de las grandes ventajas de la PCR es que puede utilizarse ADN relativamente impuro, e incluso es posible usar clulas o bacterias completas, sangre impregnada en papel de filtro, etc. En cualquier caso, la pureza del ADN molde asegura un buen funcionamiento de la reaccin. Adems, las cantidades necesarias son pequeas, no deben superar los 100-200 ng por reaccin; se estima que con estas cantidades de ADN genmico total se puede amplificar un gen que est en una sola copia en el genoma. Los cebadores son oligonucletidos sintticos monocatenarios, con un grupo hidroxilo 3 a partir del que se sintetiza la nueva cadena de polinucletidos. La caracterstica ms crucial de un cebador es su especificidad, es decir, que slo se pueda unir a una regin concreta del ADN molde. Esto va a asegurar que slo se amplifique la regin de inters; por el contrario, si los cebadores se unen inespecficamente en zonas distintas a la deseada, la PCR produce resultados difcilmente interpretables. Esto es especialmente importante cuando el ADN molde representa un genoma completo, o fragmentos cromosmicos grandes. Para asegurar este parmetro, se utilizan cebadores con una tamao mnimo de 17 nucletidos, ya que se estima que esta longitud es suficiente para reconocer una sola secuencia en un genoma eucariota. En efecto, la probabilidad de encontrar por azar una secuencia de 17 nucletidos es 417 = 1,7 1010. Como los genomas de mamferos tienen en torno a 3 109 nucletidos, esto supone que un cebador de 17 nucletidos en teora puede identificar una secuencia nica dentro de un genoma de ese tamao. Evidentemente, pueden utilizarse cebadores ms largos, dependiendo de otros factores que se comentarn ms adelante, pero los cebadores utilizados en reacciones de PCR tpicas estn en un rango de tamaos entre los 17 y 25 nucletidos. La polimerasa de ADN utilizada es la responsable de la extensin de la nueva cadena de ADN a partir de un cebador. El tipo de polimerasa utilizado viene determinado por las caractersticas de la propia reaccin de PCR. Como la reaccin ha de someterse a numerosos ciclos de desnaturalizacin-renaturalizacin, la actividad enzimtica de la polimerasa se destruye con cada etapa de calentamiento para desnaturalizar el ADN, por lo que sera necesario aadirla nuevamente al comienzo de cada ciclo. Esta dificultad se ha superado por el descubrimiento de polimerasas de ADN que son termoestables, es decir, pueden soportar elevadas temperaturas durante largo tiempo sin perder su actividad. Las bacterias que viven en aguas termales, como la especie Thermus aquaticus, sobreviven en temperaturas cercanas a los 100 C y contienen polimerasas termoestables. De ah que la polimerasa ms frecuentemente utilizada en las reacciones de PCR se denomine polimerasa Taq, para indicar su origen. La polimerasa Taq requiere la presencia de in magnesio como cofactor, por lo que todas las soluciones utilizadas deben llevar este elemento. La temperatura ptima de polimerizacin de la Taq es de 72 C: a esa temperatura se incorporan unos 100 nucletidos por segundo. Adems, la Taq carece de la actividad exonucleasa 35 que tienen otras polimerasas. Finalmente, los nucletidos libres, necesarios para sintetizar las nuevas cadenas, tienen una buena resistencia al calor y su vida media es de ms de 40 ciclos de calentamiento. Como se trata de sintetizar

Tcnicas bsicas de gentica molecular

www.FreeLibros.me

ADN, se utilizan desoxi-nucletidos trifosfato (dATP, dCTP, dGTP y dTTP), que pueden incorporarse al extremo 3 de una cadena creciente por su grupo fosfato 5. Teniendo en cuenta todo lo dicho hasta el momento, podemos esquematizar una reaccin de PCR como un proceso cclico, repetitivo, en el que cada uno de los ciclos est constituido por tres fases: desnaturalizacin, hibridacin y extensin. La fase de desnaturalizacin, como su nombre indica, consiste en someter la reaccin a una temperatura de 94 C durante un minuto, para asegurar que todas las molculas de ADN molde se han desnaturalizado y estn en estado monocatenario. Realmente, la desnaturalizacin es prcticamente instantnea cuando toda la mezcla alcanza esa temperatura, pero la inercia trmica hace que haya que mantener la temperatura de desnaturalizacin durante unos segundos. No es bueno prolongarla demasiado, porque esto daa el ADN molde y reduce la actividad de la Taq. La siguiente fase de cada ciclo debe permitir la hibridacin de los cebadores con sus secuencias complementarias en el ADN molde, y por eso se llama fase de hibridacin. En este sentido, hibridar es formar una molcula bicatenaria de ADN a partir de la unin de dos molculas monocatenarias que tienen secuencias complementarias. Para llevar esto a cabo, es necesario disminuir la temperatura de la reaccin, de modo que los cebadores se unan a sus dianas pero las cadenas largas de la molcula original no lleguen a reasociarse entre s. La temperatura a la que se realiza la hibridacin depende de la secuencia de los cebadores, pero suele estar entre 55 C y 65 C, y se mantiene en torno a un minuto. La ltima etapa de un ciclo tpico se denomina fase de extensin, porque en ella la polimerasa extiende los dos cebadores tomando como molde las secuencias de las cadenas originales, incorporando los desoxi-nucletidos que estn presentes en la mezcla de reaccin. Por la temperatura ptima de la polimerasa, esta fase se realiza a 72 C, durante un tiempo variable dependiendo de la longitud del fragmento amplificado (entre 30 segundos y dos minutos, en condiciones estndar). Una reaccin tpica de PCR consta de 30-35 ciclos como el descrito. Adems, suele ir precedida por un breve periodo de desnaturalizacin de unos tres a cinco minutos, para asegurar que todo el ADN est desnaturalizado antes del primer ciclo, y una fase final de extensin (unos cinco a 10 minutos a 72 C) para extender todas las molculas que hayan quedado incompletas. Es fcil ver que, tericamente, en cada ciclo se duplica el nmero de molculas de ADN de la regin especfica que queremos amplificar; por tanto, el nmero de molculas presentes en un ciclo dado es 2n, siendo n el nmero de ciclo. Por ejemplo, si partimos de una sola molcula inicial de ADN, tras 10 ciclos tendremos 1 024 copias, tras 20 ciclos tendremos 1 048 576 copias, y tras 30 ciclos tendremos 1 073 741 824 de copias de la molcula original. De todas formas, no todas las molculas sern idnticas, porque en cada ciclo se generan molculas que llevan cadenas largas que sobrepasan el lmite de uno de los cebadores. Estas molculas aumentan en progresin aritmtica (se crean dos con cada ciclo), mientras que los fragmentos especficos comprendidos por los dos cebadores aumentan exponencialmente a partir del tercer ciclo. Por ejemplo, en una PCR de 35 ciclos tendremos 34 359 738 368 copias (235), de las que 70 corresponden a molculas largas y el resto corresponden al fragmento de inters. Este aumento exponencial se observa tambin experimentalmente, cuando se cuantifica la cantidad de ADN total despus de cada ciclo; tras

43

Amplificacin in vitro de ADN (PCR)

www.FreeLibros.me

44

una fase inicial ms lenta, tiene lugar una fase de aumento exponencial (una lnea recta cuando se representa en escala logartmica), y una fase final (a partir del ciclo 32-35, ms o menos) en la que se alcanza una meseta y la amplificacin se detiene por agotamiento de los reactivos y prdida de actividad de la polimerasa.
La Figura 3.7 lleva a una animacin que muestra los primeros ciclos de una PCR y permite calcular el nmero de molculas que se generan por ciclo.

Tcnicas bsicas de gentica molecular

Lgicamente, la realizacin de una reaccin de PCR requiere un equipamiento apropiado que permita llevar a cabo los ciclos de modo automtico. Inicialmente, se utilizaban baos separados, cada uno a una temperatura distinta (desnaturalizacin, hibridacin y extensin) y los investigadores deban pasar los tubos de reaccin de un bao a otro a los tiempos apropiados. Pronto se desarrollaron mquinas que tienen una placa metlica, con capacidad para un alto nmero de tubos, cuya temperatura puede variarse con gran rapidez y precisin, estando todo el proceso controlado por un microprocesador. Estas mquinas, llamadas termocicladores (o cicladores trmicos), permiten programar las condiciones de tiempo, temperatura, nmero de ciclos, etc, de modo que el operador slo tiene que introducir los tubos y esperar al final de la reaccin, que suele durar en torno a los 60-90 minutos con los termocicladores modernos. Las aplicaciones de la tcnica de PCR han sido mltiples desde su aparicin; a lo largo de este libro veremos su uso en la deteccin de alteraciones genticas que causan enfermedades. La descripcin de los posibles usos en diferentes estrategias de anlisis gentico y en biotecnologa, est ms all del objetivo de este apartado, en el que se ha pretendido nicamente introducir en esta tcnica a aquellos que no la conocen. En cualquier caso, es importante resear una de las variantes ms utilizadas, como es la amplificacin de fragmentos de ARN mensajero. En este caso, en vez de utilizar ADN como molde para la amplificacin, se usa una molcula de ADN que es copia de un ARNm, obtenida por un proceso que se llama retrotranscripcin: gracias a la actividad transcriptasa reversa de la polimerasa de algunos virus (una ADN polimerasa dependiente de ARN), se puede sintetizar una molcula de ADN complementaria a una molcula de ARN. Por tanto, si queremos amplificar selectivamente un ARNm, es preciso obtener primero un ADN complementario (llamado ADNc) haciendo una retrotranscripcin del ARNm, y despus ese ADNc ya se puede amplificar por PCR como cualquier otro fragmento de ADN. Por este motivo, esta variante de la tcnica se llama RT-PCR (retrotranscripcin-PCR). Es una tcnica muy utilizada y de gran inters cuando se quiere trabajar con las secuencias de los genes ya procesados, prescindiendo de los intrones, y supuso un gran avance porque hasta su aparicin era muy difcil estudiar ARN mensajeros.

3.5 Secuenciacin del ADN


Desde el descubrimiento de la estructura del ADN y del cdigo gentico, una de las herramientas ms importantes para identificar genes y predecir su funcin ha sido la determinacin de la secuencia de nucletidos que constituye cada gen. En las ltimas dcadas, la tecnologa de secuenciacin del ADN ha sido determinante para poder

www.FreeLibros.me

llevar a cabo los distintos proyectos genoma, cuya finalidad es obtener la secuencia completa de nucletidos del genoma completo de una especie. Hoy en da, adems, un aspecto crucial de la investigacin gentica es la determinacin de pequeas variaciones interindividuales, lo que requiere la secuenciacin de una misma regin en distintos individuos. Por tanto, los mtodos actuales de determinacin de la secuencia de nucletidos de un fragmento de ADN son muy variados, y los desarrollos tecnolgicos recientes han dado lugar a un gran abanico de tcnicas diseadas para responder a distintas necesidades. De todas formas, todas las tecnologas son de algn modo tributarias del mtodo original ideado por Fred Sanger y Alan Coulson a finales de los aos 1970. Este mtodo se conoce como el mtodo de terminacin de cadenas o di-desoxi, porque se basa en la interrupcin del proceso de extensin de un cebador, dando lugar a cadenas de todas las posibles longitudes, puesto que cada una ha sido interrumpida en una posicin distinta; la separacin de las cadenas de distintos tamaos y la deteccin de qu nucletido llevan en su extremo 3 nos permite deducir la secuencia de la molcula original. El primer elemento de toda reaccin de secuenciacin es, lgicamente, el fragmento de ADN cuya secuencia queremos leer; precisamente, este fragmento sirve como molde para la sntesis de ADN a partir de un cebador especfico que se une a l por complementariedad de bases, y esto es lo que nos va a permitir deducir la secuencia de nucletidos del fragmento. Aunque inicialmente era necesario convertir el fragmento de ADN a su forma monocatenaria, clonndolo en un tipo especial de vectores, hoy en da puede utilizarse ADN de doble cadena, bien sea en forma de plsmidos (cuyo inserto queremos secuenciar) o como productos de PCR. Al igual que en el caso de la PCR, otro elemento necesario es el cebador que va a iniciar la sntesis de ADN desde el punto donde queremos empezar a leer la secuencia del fragmento original. Ntese que aqu slo vamos a utilizar un cebador (en vez de dos, como en la PCR) ya que no queremos amplificar una regin, sino simplemente sintetizar nuevas cadenas de ADN a partir de un punto concreto. Como toda reaccin de sntesis de ADN, tambin es necesaria la presencia de una polimerasa de ADN que tenga buena procesividad y fidelidad (es decir, que no introduzca errores en la nueva cadena). El punto clave de este mtodo de secuenciacin est en los nucletidos libres presentes en la reaccin, que se van a ir incorporando a la nueva cadena sintetizada por la polimerasa a partir del extremo 3 del cebador; adems de 2-desoxi-nucletidos tpicos en su forma tri-fosfato, este mtodo incorpora a la mezcla de reaccin unos nucletidos especiales que actan como terminadores de la sntesis. Los terminadores son nucletidos modificados qumicamente que carecen adems del grupo hidroxilo 3 por el que crece la cadena, de ah su nombre de di-desoxi-NTP (abreviado como ddNTP), ya que corresponden a la forma 2,3-di-desoxi de cada nucletido tri-fosfato.
La Figura 3.8 contiene enlaces a animaciones que ilustran el mtodo original de secuenciacin de Sanger.

45

Secuenciacin del ADN

La reaccin de secuenciacin, una vez que tenemos los distintos componentes mezclados en cantidades adecuadas, procede del siguiente modo. En primer lugar, el fragmento a secuenciar se desnaturaliza para separar las dos cadenas y permitir que

www.FreeLibros.me

46

el cebador acceda a su regin complementaria especfica. Tras permitir la hibridacin del cebador con la cadena molde respectiva, la polimerasa comienza a extender el cebador incorporando nucletidos complementarios a los de la cadena molde. Como en la reaccin estn presentes desoxi-NTPs y didesoxi-NTPs, en cada posicin es posible incorporar uno u otro. En el caso de incorporar un dNTP, la cadena seguir extendindose normalmente, ya que el nuevo nucletido proporciona el grupo hidroxilo 3 necesario para formar un nuevo enlace fosfo-di-ster con el grupo fostato de un nuevo nucletido; en cambio, si el nucletido incorporado es un ddNTP, la sntesis de la cadena terminar en esa posicin, ya que no existe el grupo hidroxilo 3 necesario para continuar la elongacin. Lgicamente, esto suceder para cada posicin, de modo que mientras la sntesis avanza (porque se han incorporado dNTPs) en cada nueva posicin existe la posibilidad de que la cadena se termine en ese punto. Al final, tendremos una coleccin de fragmentos de todos los posibles tamaos, con una diferencia de longitud de un nucletido; cada fragmento estar terminado por el nucletido complementario al que estaba en la cadena molde original en esa posicin. Cuando la reaccin de secuenciacin ha sido completada, slo nos resta separar de alguna forma todos los fragmentos de los distintos tamaos y ver en qu nucletido est terminado cada uno de ellos, de modo que as podremos reconstruir la secuencia original. Los mtodos para separar los fragmentos y leer el nucletido terminal han cambiado bastante desde la descripcin original del mtodo. Hoy en da, lo ms habitual es utilizar terminadores marcados con algn fluorocromo especfico: se trata de ddNTPs que llevan unido un grupo qumico que produce fluorescencia cuando es excitado por una luz de una determinada longitud de onda. Como cada terminador lleva un fluorocromo distinto, es fcil saber en qu nucletido termin una cadena concreta, dependiendo del tipo de fluorescencia que produzca. Para la separacin de los fragmentos se utilizan tcnicas de electroforesis capilar, en la que la mezcla de reaccin va pasando por unos finos capilares que contienen una matriz porosa capaz de resolver fragmentos de ADN que se diferencian en tamaos de tan slo un nucletido. De este modo, cuando la reaccin de secuenciacin ya completada pasa por el capilar, los fragmentos ms pequeos pasan ms facilmente y salen del capilar antes que los fragmentos mayores, que tienen ms dificultad para atravesar los poros y por eso quedan retenidos temporalmente. El resultado es que todos los fragmentos de la mezcla de reaccin van saliendo del capilar ordenados por tamaos, comenzando por el ms corto, con diferencias de tamao un solo nucletido. A la salida del capilar se sita una fuente de luz (habitualmente un lser) que excita los fluorocromos y produce un tipo de fluorescencia especfico de cada ddNTP, lo cual es detectado por un dispositivo especial. As, viendo el orden en que van apareciendo los cuatro distintos colores correspondientes a los cuatro nucletidos, podemos saber la secuencia de la cadena que se ha sintetizado, que ser exactamente la secuencia complementaria a la cadena molde original.
El vdeo de la Figura 3.9 muestra con detalle el mtodo moderno de secuenciacin con terminadores fluorescentes y separacin de los fragmentos mediante electroforesis capilar.

Tcnicas bsicas de gentica molecular

Aunque en la actualidad se estn desarrollando metodologas nuevas ms rpidas y baratas, en dispositivos miniaturizados que permiten determinar la secuencia de un

www.FreeLibros.me

fragmento en segundos, el mtodo de secuenciacin de Sanger ha tenido una influencia crucial en el desarrollo de la biologa molecular y la gentica moderna.

47

Microarrays

3.6 Microarrays
La cuantificacin del nivel de expresin de un gen, la intensidad con la que se transcribe, puede medirse utilizando las tcnicas explicadas en los apartados precedentes. Inicialmente se utilizaba la tcnica de Northern blot, en la que la intensidad de la seal obtenida es proporcional a la cantidad de ARNm presente en la muestra. Ms recientemente se han desarrollado tcnicas de PCR cuantitativa que consiguen cuantificar la cantidad de ARNm presente en la muestra: utilizando ADNc (ADN complementario) como molde, se puede realizar RT-PCR cuantitativa para determinar la abundancia relativa del ARNm y comparar varios tejidos o condiciones experimentales. Con la llegada de los grandes proyectos de secuenciacin, se plante la posibilidad de determinar la expresin gnica a nivel genmico, es decir, analizar el perfil de expresin de todos los genes de un genoma en distintas situaciones, para as identificar los genes implicados en distintos procesos fisiolgicos o en el desarrollo de enfermedades. La cuantificacin de la expresin de miles de genes es impracticable por los mtodos tradicionales, por lo que se desarroll una metodologa nueva que permitiese hacer este tipo de experimentos a bajo coste y en poco tiempo. Dicha tecnologa se conoce como la tecnologa de microarrays, tambin llamados a veces chips de ADN, porque se basa en la utilizacin de unos dispositivos slidos miniaturizados en los que se puede medir la expresin de miles de genes a la vez. Aunque existen distintos tipos de microarrays en funcin de la tecnologa de fabricacin, el fundamento de todos ellos es la hibridacin de una mezcla de dos clases de ADNc, marcados con fluorocromos distintos, sobre una fase slida que contiene miles de sondas inmobilizadas, cada una de ellas especfica para un gen distinto. Por tanto, a diferencia de los experimentos tradicionales de hibridacin sobre filtros, en los que el ADN est fijado sobre la fase slida y la sonda est presente en la solucin de hibridacin, en la tecnologa de microarrays son las sondas las que estn inmovilizadas sobre el soporte slido, y son los ADNc los que buscan las sondas complementarias a su secuencia e hibridan con ellas. De modo general, un microarray es un portaobjetos de vidrio al que se han adherido, por mtodos fsicos o qumicos, sondas de ADN en posiciones fijas y ordenadas, cada una ocupando un punto o spot. Cada punto contiene entre 107-108 molculas de una sonda concreta, que puede ser de distintos tamaos y que debera reconocer especficamente un solo gen del genoma.
La Figura 3.10 muestra ejemplos de varios tipos de microarrays, cmo se fabrican y una imagen de hibridacin.

Aunque los microarrays fueron originalmente diseados para realizar estudios de expresin gnica a escala genmica, tambin se pueden utilizar para detectar pequeas deleciones o duplicaciones en un genoma. En este caso se habla de microarrays

www.FreeLibros.me

48

genmicos, en los que las sondas son fragmentos de un genoma. Por ejemplo, un microarray genmico humano tendr varios miles de sondas que representan todo el genoma humano ordenado en los distintos puntos del array; la hibridacin se realiza con una mezcla de dos ADN genmicos, con la finalidad de detectar regiones genmicas que estn en distinto nmero de copias en uno de los genomas respecto al otro. En cualquier caso, la metologa experimental es similar en los distintos tipos de microarrays. En primer lugar es necesario obtener los ADN que se van a hibridar sobre el microarray (ADNc si se van a hacer estudios de expresin gnica o ADN genmico total si se trata de microarrays genmicos). Cada una de las dos muestras que se van a comparar es marcada con un fluorocromo distinto, habitualmente uno que da fluorescencia verde y otro con fluorescencia roja. A continuacin se realiza la reaccin de hibridacin y se detecta la fluorescencia que emite cada punto del microarray. Dependiendo de la intensidad de la fluorescencia de cada color en cada punto, es posible deducir si el gen representado por esa sonda se expresa o no en las muestras. Lgicamente, un experimento con microarrays genera cantidades masivas de datos, al tratarse de miles de puntos analizados simultneamente; por ello, las herramientas de anlisis de imagen y de procesamiento de los datos son bastante sofisticadas. Gracias a esto, los estudios de microarrays estn permitiendo avanzar en el diagnstico de enfermedades, ya que permiten detectar firmas de expresin especficas para enfermedades concretas. Estas firmas son patrones caractersticos formados por los genes que tienen su expresin ms alterada en un proceso concreto; al detectar el subgrupo de genes que se alteran con mayor intensidad, podemos utilizar esa informacin para diagnosticar si un individuo sufre ese mismo proceso. En algunos casos, la utilizacin de estas firmas moleculares ha ayudado a distinguir procesos que antes se agrupaban juntos, identificando enfermos que tienen distintas posibilidades de respuesta a tratamientos, distinta supervivencia, etc.
La Figura 3.11 nos lleva a unas animaciones que muestran cmo se lleva a cabo y se interpreta un experimento con microarrays.

Tcnicas bsicas de gentica molecular

Actualmente se estn generando bases de datos que archivan los resultados de mltiples estudios de microarrays, con lo que es posible acceder a esos datos y elaborarlos para obtener informacin sobre los niveles de expresin de un gen en distintos tipos celulares y en distintas condiciones experimentales. El anlisis de estos datos permitir establecer cmo varan los patrones de expresin gnica de un genoma en distintos procesos metablicos y fisiolgicos, as como tambin en diversas situaciones patolgicas. As podremos identificar las variaciones tpicas de los distintos tipos de cncer, de enfermedades cardiovasculares, neurodegenerativas, etc; esto, a su vez, permitir identificar nuevas dianas teraputicas para restablecer esos patrones de expresin alterados.

www.FreeLibros.me

www.FreeLibros.me

B) El genoma humano

En tres temas se cubre la organizacin general del genoma humano y la relacin entre estructura y funcin, adems de prestar atencin a las bases moleculares del cambio gentico y a los mecanismos correctores de los errores introducidos en la secuencia.

www.FreeLibros.me

CAPTULO 4

La geografa del genoma humano

Contenidos
4.1 Historia y desarrollo del Proyecto Genoma Humano 4.2 Estructura del genoma humano y variacin inter-individual 4.3 El ADN repetitivo 4.4 El genoma mitocondrial

4.1 Historia y desarrollo del Proyecto Genoma Humano


En 1986, el Departamento de Energa de los Estados Unidos lider la Iniciativa del Genoma Humano, tras varios aos de contactos y reuniones, y puso en marcha el mayor proyecto biomdico de la historia con el objetivo final de conseguir la secuencia completa del genoma humano en el ao 2005. El Proyecto Genoma Humano comenz oficialmente en Estados Unidos en octubre de 1990, siguiendo un plan a cinco aos para desarrollar las herramientas que permitiesen conseguir esa meta. Estas herramientas eran principalmente la construccin de mapas genticos (de ligamiento) y de mapas fsicos (de clones) de todo el genoma humano, al tiempo que se desarrollaba la tecnologa necesaria para realizar secuenciacin a gran escala. La estrategia general consisti en construir mapas genticos y fsicos e integrarlos, para aumentar cada vez ms en resolucin desde el cromosoma hasta la secuencia de ADN. Los mapas genticos describen la organizacin cromosmica de caracteres (un rasgo fenotpico, una enfermedad) o de marcadores genticos, mediante estudios de ligamiento gentico.

www.FreeLibros.me

52

El concepto de ligamiento gentico y la forma en que se cuantifica son objeto del Captulo 11. Si el lector no est familiarizado con la construccin de mapas de ligamiento, se aconseja estudiar el Captulo 11 antes de seguir leyendo.

La geografa del genoma humano

Los primeros xitos de mapeo gentico en humanos fueron los que consiguieron asociar un carcter a un cromosoma, como por ejemplo el ligamiento del daltonismo al cromosoma X, o ligamiento del grupo sanguneo Duffy al cromosoma 1. Este ltimo fue el primer rasgo hereditario mapeado a un autosoma (en 1968) gracias a que, en una familia concreta, se observ que este rasgo se heredaba junto con un heteromorfismo del cromosoma 1. Esto puso de manifiesto la utilidad de contar con marcadores de ADN que estuviesen distribuidos por todo el genoma, fuesen fciles de estudiar en un nmero alto de individuos y tuviesen una posicin cromosmica conocida, ya que as se podran realizar estudios de ligamiento gentico en familias que padecen una determinada enfermedad gentica para determinar si esa enfermedad est en ligamiento con alguno de estos marcadores, lo que facilitara la identificacin del gen responsable.

Distancia en centimorgans (cM) DS16C4 DS16B3 DS16A2 DS16A1


MAPA GENTICO DE LIGAMIENTO 4 marcadores posicionados por estudios de ligamiento

STS 8 STS 6 STS 7 STS 5

STS 4 STS 3

STS 1 STS 2

MAPA FSICO 8 marcadores tipo STS cuya posicin es conocida

Distancia fsica en pares de bases (bp)


La Figura 4.1 explica cmo son los mapas fsicos y los mapas de ligamiento gentico, y su utilizacin en el Proyecto Genoma Humano.

Los tipos de marcadores ms utilizados en estudios de ligamiento en Gentica Humana son:

Polimorfismos de Longitud de Fragmentos de Restriccin (en ingls, las siglas son RFLP). Un RFLP es un polimorfismo originado por un cambio de un nucletido que crea o destruye una diana de restriccin, de manera que encontraremos alelos con esa diana y alelos sin ella. Por tanto, un RFLP es por definicin un marcador biallico (slo hay dos alelos posibles). La presencia

www.FreeLibros.me

o ausencia de esa diana hace que los fragmentos originados por la digestin del ADN con esa enzima de restriccin sean de distinto tamao. En general, un polimorfismo tipo RFLP puede detectarse de dos modos: a) digerir directamente el ADN genmico, separar los fragmentos en un gel, hacer un Southern blot e hibridarlo con una sonda especfica para detectar cada uno de los fragmentos polimrficos; b) amplificar la regin del polimorfismo mediante PCR y digerir directamente el producto de PCR para separar los fragmentos en un gel. Los marcadores tipo VNTR (acrnimo ingls de Nmero Variable de Repeticiones en Tndem) son polimorfismos originados por pequeas secuencias de ADN que estn repetidas en tndem. El nmero de repeticiones es diferente en los distintos individuos de la poblacin, por lo que en principio pueden existir ms de dos alelos distintos para cada marcador (aunque cada individuo slo lleve dos alelos, en la poblacin general pueden existir ms). Los marcadores en los que la secuencia repetida es corta (dos a cuatro nucletidos) se denominan tambin microsatlites o STR (Short Tandem Repeats, Repeticiones Cortas en Tandem), y estn homogneamente distribuidos por todo el genoma. Los marcadores en los que la secuencia repetida es ms larga (decenas a cientos de nucletidos) se denominan minisatlites, y han sido muy importantes en los estudios de gentica forense ya que permiten establecer una huella gentica nica para cada individuo. Los minisatlites son ms abundantes hacia las regiones telomricas de los cromosomas, y debido a su tamao en principio deben detectarse mediante Southern blot e hibridacin. En cambio, los marcadores de tipo microsatlite pueden detectarse mediante PCR y estn distribuidos uniformemente por el genoma, por lo que su anlisis es ms rpido y sencillo y proporcionan mayor informacin. Los SNP (pronunciado snip) son polimorfismos de un solo nucletido (Single Nucleotide Polymorphisms) en los que el simple cambio de un nucletido en una secuencia genmica da lugar a distintos alelos. Lgicamente, para cada posicin slo puede haber cuatro alelos como mximo (A, C, G o T), aunque lo habitual es que un SNP tenga dos alelos en la poblacin general. Se estima que, como promedio, hay al menos un SNP cada 500-1 000 pares de bases, de los cuales un porcentaje importante son polimorfismos codificantes (es decir, cambian un aminocido en la protena codificada por el gen) y constituyen la principal fuente de variabilidad gentica inter-individual, puesto que dos individuos cualesquiera tienen alrededor de un 0,1 por ciento de sus nucletidos distintos. La gran ventaja de los SNP sobre los dems tipos de marcadores, adems de ser tan abundantes y estar muy uniformemente distribuidos por todo el genoma humano, es la posibilidad de analizarlos mediante mtodos automatizables a gran escala, como los microarrays, de manera que se pueden determinar cientos o miles de SNPs a la vez en un mismo experimento.

53

Historia y desarrollo del Proyecto Genoma Humano

La Figura 4.2 ilustra los tipos de marcadores ms utilizados en la construccin de mapas de ligamiento gentico en humanos.

www.FreeLibros.me

54

El objetivo inicial del PROYECTO GENOMA era crear un mapa gentico (de ligamiento) con marcadores distribuidos por todo el genoma con una distancia media de 1 cM entre marcadores. Los mapas genticos se basaron en un primer mapa publicado en 1987, hecho con 393 marcadores tipo RFLP agrupados en 23 grupos de ligamiento, con una distancia media entre marcadores superior a 10 cM. El primer mapa gentico de todo el genoma fue el realizado por un centro de investigacin francs llamado Gnthon en 1992, e inclua 803 marcadores tipo microsatlite. Los mapas fsicos, en cambio, reconstruyen la estructura de un segmento de ADN, determinando los tipos y orden relativo de las distintas secuencias que lo componen, sus tamaos, y las distancias entre ellas. Para la construccin de mapas fsicos se utiliza un tipo de marcador distinto, que veremos ms adelante. Lgicamente, el mapa fsico de mayor resolucin posible es la secuencia completa de ese segmento (resolucin de un nucletido), pero tambin es posible realizar mapas de menor resolucin (un ejemplo, mapas de restriccin). El tipo de marcador utilizado en la creacin de mapas fsicos se denomin STS (Sequence-Tagged Site = Sitio Etiquetado por su Secuencia). Un STS es un pequeo fragmento de ADN (unos pocos cientos de pares de bases) de secuencia y localizacin genmica conocidas, fcilmente amplificable mediante PCR. Durante aos se haban identificado un buen nmero de marcadores STS, mediante la secuenciacin parcial de clones previamente mapeados por otros mtodos. Adems, los microsatlites utilizados en la creacin de mapas de ligamiento tambin pueden convertirse fcilmente en STS, leyendo la secuencia que flanquea las repeticiones del microsatlite. Gracias a esto, hoy contamos con una lista ordenada de STS que estn distribuidos por todo el genoma humano, cuya secuencia y condiciones de amplificacin mediante PCR son fcilmente accesibles a todo investigador. El PROYECTO GENOMA se propuso inicialmente conseguir mapas de marcadores tipo STS distribuidos por todo el genoma y con una distancia media entre marcadores en torno a 0,1 Mb (es decir, 100kb). Utilizando estos marcadores STS, se pudieron construir mapas fsicos, es decir mapas compuestos por clones de bibliotecas genmicas, capaces de albergar insertos de gran tamao. Existen distintos vectores de este tipo, entre los que destacan los vectores tipo YAC (Yeast Artificial Chromosome), PAC (P1-phage Artificial chromosome) y BAC (Bacterial Artificial Chromosome). Cada uno de estos vectores de clonacin tiene caractersticas especficas, ventajas e inconvenientes. En concreto, los YAC son los vectores que permiten albergar un mayor tamao de inserto (hasta dos megabases), pero son bastante inestables (tienden a perder fragmentos del inserto cuando se replican) y tienen un porcentaje relativamente alto de clones quimricos (es decir, clones en los que el inserto est en realidad formado por dos fragmentos procedentes de cromosomas distintos). Los PACs y BACs, en cambio, slo permiten clonar insertos de unas 100 a 150 kilobases de tamao (por lo que son necesarios muchos ms clones para cubrir completamente un segmento genmico determinado), pero en cambio son muy estables y el porcentaje de quimerismo es muy pequeo. Aunque los YACs han sido el vector principalmente utilizado al principio de los aos 90, hoy en da han sido desplazados por PACs y BACs.

La geografa del genoma humano

www.FreeLibros.me

DS16C4

DS16B3

DS16A2

DS16A1

55

Historia y desarrollo del Proyecto Genoma Humano

STS 8

STS 6 STS 5

STS 4

STS 3

STS 1 STS 2

STS 7

CONTIG: CONTIG: conjunto conjunto de clones de clones solapantes solapantes quecubren cubren una regin del genoma que una regin del genoma

La secuenciacin La secuenciacin de cada de cada clon clon permite permite reconstruir reconstruir la original de esa genmica la secuencia secuencia original de regin esa regin genmica

GGAGACTACGGAGATTACCTACGGGACTACAGAAGGAGACTACGGAGAGTACCTACGGGACTGT CT

La Figura 4.3 explica la utilizacin de marcadores STS para crear un contig de clones que cubran una regin del genoma.

Los primeros mapas fsicos del genoma humano estaban compuestos por contigs de YACs que cubran parcialmente el genoma humano, siendo el mejor ejemplo el mapa creado tambin por Gnthon en 1993. Este mapa supuso un avance enorme porque aunque slo cubra algunas regiones genmicas sirvi como punto de partida para elaborar mapas ms completos con vectores ms fiables y manejables, como BACs y PACs. El PROYECTO GENOMA hizo una revisin de sus objetivos en 1993, teniendo en cuenta los progresos realizados en los tres aos anteriores, y estableci nuevas metas para los siguientes cinco aos (1993-1998). En resumen, estos nuevos objetivos fueron:

Conseguir un mapa gentico con resolucin de dos a cinco cM entre marcadores. Conseguir un mapa fsico con STS espaciados regularmente cada 0,1 Mb (lo que significaba identificar y localizar la posicin de como mnimo unos 30 000 STS). Desarrollar nuevas tecnologas para la identificacin de genes a partir de ADN genmico. Desarrollar nuevas tecnologas de secuenciacin y completar 80 Mb de secuencia confirmada para todos los organismos que estaban siendo secuenciados por los distintos proyectos. Potenciar la genmica comparada: completar las secuencias de E. coli, S. cerevisiae y C. elegans, y comenzar los proyectos de secuenciacin de los genomas de Drosophila y de ratn.

www.FreeLibros.me

56

Cuando en 1998 se revisaron los avances realizados en esos cinco aos, con el fin de disear un nuevo plan quinquenal, los resultados haban sido realmente prometedores: en septiembre de 1994 se public un mapa gentico de todo el genoma humano integrado por 4 000 marcadores tipo microsatlite y 1 800 marcadores tipo RFLP, con una distancia media entre marcadores de 0,7 cM. Esto superaba en ms de tres aos el objetivo propuesto inicialmente. Por su parte, Gnthon public en 1995 otro mapa fsico de YACs que estaba formado por 255 contigs (con un tamao medio de 10 Mb cada contig) y cubra el 75 por ciento del genoma humano. Durante esos aos se continuaron desarrollando nuevos marcadores tipo STS, hasta llegar en 1998 a un mapa que contena 52 000 STS (casi el doble de los inicialmente propuestos). Por lo que respecta a la secuenciacin, en octubre de 1998 se haba obtenido un total de 180 Mb de secuencia del genoma humano (6 por ciento del total), adems de 111 Mb de secuencia de otros organismos, muy por encima de lo previsto en el plan 1993-1998. Adems, se haba completado la secuencia de E. coli y de S. cerevisiae, ste ltimo el primer organismo eucariota en ser secuenciado totalmente. Esto fue posible gracias a importantes avances en la tecnologa de secuenciacin, que se hizo progresivamente ms rpida, fiable y barata. Posteriormente, en diciembre de 1998, se complet la secuencia de C. elegans, el primer organismo multicelular secuenciado en su totalidad con un genoma de unas 97 Mb. Por tanto, en 1998 el PROYECTO GENOMA se fij un nuevo plan de objetivos hasta el ao 2003, en el que se incluan ocho metas concretas: 1. Completar la secuencia del genoma humano para 2003 (ao que coincida con el 50 aniversario del descubrimiento de la doble hlice por Watson y Crick), creando un primer borrador de trabajo en 2001. Este objetivo se aceler enormemente por la competencia de la empresa privada Celera Genomics, que se propuso secuenciar todo el genoma humano, utilizando una estrategia distinta al consorcio internacional del PROYECTO GENOMA, con el fin de obtener la propiedad intelectual y poder explotar esa informacin con fines comerciales. A pesar de los problemas suscitados inicialmente por la fuerte competencia entre ambos proyectos, el 26 de junio de 2000 se produjo el anuncio oficial de que se haba alcanzado un primer borrador del 87 por ciento de la secuencia del genoma humano. Este primer borrador fue publicado el 15 de febrero de 2001 en las revistas Nature (el mapa del Consorcio Internacional) y Science (el mapa de Celera Genomics).

La geografa del genoma humano

La Figura 4.4 muestra el proceso general utilizado por el Consorcio Internacional para la secuenciacin del Genoma Humano.

2.

3.

Continuar el desarrollo y la innovacin de las tecnologas de secuenciacin. Como ya se ha comentado, ste ha sido un factor determinante en el avance del PROYECTO GENOMA. Estudiar la variacin en el genoma humano. Como hemos visto, los SNP se encuentran en el genoma humano a razn de uno por cada kilobase, como promedio, y representan las diferencias genticas entre individuos de una misma especie. Como se ver en el Captulo 11, la creacin de mapas densos de SNP permitir llevar a cabo estudios de asociacin para detectar los genes

www.FreeLibros.me

4.

5.

6.

que estn implicados en enfermedades complejas, debidas a alteraciones en muchos genes siendo la contribucin de cada gen a la enfermedad pequea y, por tanto, difciles de detectar por otros mtodos de ligamiento. Desarrollar tecnologa para la genmica funcional, es decir, identificar todos los genes y determinar cul es la funcin de cada gen. La gran revolucin en las estrategias de identificacin de regiones codificantes (es decir, genes) comenz con la idea de Craig Venter de secuenciar al azar y a gran escala fragmentos de ADNc de bibliotecas obtenidas a partir de diversos tejidos. Estos fragmentos de secuencia se denominaron Etiquetas de Secuencia Expresada (EST, Expressed Sequence Tags), ya que en el fondo cada una representa un fragmento de un ARNm (una secuencia expresada en un tejido concreto). En pocos aos, la base de datos de EST creci de manera exponencial, con cientos de miles de secuencias expresadas procedentes de distintas bibliotecas de ADNc. Como algunos de estos EST proceden de un mismo ARNm, se cre una coleccin no redundante llamada UNIGENE que agrupa los EST por familias, siendo cada familia representativa de un nico ARNm. Poco despus comenzaron tambin proyectos internacionales para mapear secuencias de UNIGENE, de manera que en 1994 se public un primer mapa con la localizacin de 16 000 EST correspondientes a genes distintos, y en 1998 se public un segundo mapa de 41 664 EST, que representaban 30 181 genes distintos. Cuando se conozca el catlogo completo de genes de nuestro genoma, ser necesario estudiar la expresin de cada gen en distintos tejidos y en distintas situaciones fisiolgicas y patolgicas, en respuesta a distintos factores ambientales, etc. Lgicamente, esto ser el objeto de la investigacin biomdica de buena parte del siglo XXI. Genmica Comparada. El anlisis comparado de los genomas de varias especies es de gran utilidad para identificar mecanismos biolgicos conservados durante la evolucin (por lo que son especialmente importantes), estructura y funcin de genes ortlogos, etc. Aunque el plan para 1998-2003 se propuso conseguir la secuencia completa del genoma de Drosophila para el ao 2002, esta meta se cumpli en abril del ao 2000 gracias a la colaboracin de laboratorios y Universidades con Celera Genomics, descifrando unas 120 Mb de secuencia que comprenden la prctica totalidad de la eucromatina de este insecto. El nuevo gran reto ahora es conseguir la secuencia completa del genoma de otras especies de mamferos: el primer borrador completo del genoma de ratn se obtuvo en 2002 y el del genoma de chimpanc en 2005. Implicaciones ticas, legales y sociales del PROYECTO GENOMA. Es importante tener consciencia de la influencia que va a tener el Proyecto Genoma y sus aplicaciones sobre los individuos y las sociedades. Cuestiones como el diagnstico de enfermedades que no tienen tratamiento, la extensin de una mentalidad eugensica que lleve a la discriminacin por razn de deficiencias genticas, el diagnstico prenatal de alteraciones genticas que confieren predisposicin a sufrir enfermedades que se manifestarn en la edad adulta, la deteccin de rasgos psicolgicos con base gentica, la confidencialidad de la informacin gentica de los individuos (y la posible discriminacin

57

Historia y desarrollo del Proyecto Genoma Humano

www.FreeLibros.me

58

laboral) sern una constante en los debates sociales de este siglo, y es importante llevar a cabo una labor de divulgacin seria para que la sociedad pueda discutir de modo sosegado y bien fundamentado las bases ticas sobre las que sostener las aplicaciones biomdicas de la biotecnologa en los aos que se avecinan. 7. Desarrollo de herramientas bioinformticas (bases de datos y herramientas de anlisis de datos) que puedan ser compartidas por la comunidad cientfica. Ser especialmente importante el desarrollo de herramientas informticas que permitan identificar exones y predecir la estructura de genes en grandes secuencias genmicas, as como plataformas de genmica funcional para el anlisis de la expresin de miles de genes a la vez. 8. Formacin en genmica: favorecer que cientficos y acadmicos se dediquen a la investigacin genmica y a divulgar y aumentar el conocimiento pblico de los distintos aspectos del PROYECTO GENOMA. Finalmente, la primera versin esencialmente completa del genoma humano fue anunciada oficialmente el 14 de abril de 2003, cubriendo un total de 3 069 Mb (92,3 por ciento del total estimado del genoma humano) con un 99,99 por ciento de fiabilidad en cada posicin secuenciada. El anlisis de la secuencia publicada permite hacerse una idea bastante aproximada de la estructura de nuestro genoma, su composicin y algunas de sus caractersticas funcionales, como se explica a continuacin.

La geografa del genoma humano

4.2 Estructura del genoma humano y variacin inter-individual


El genoma humano nuclear tiene un tamao aproximado de 3 200 Mb (megabases), es decir tres mil doscientos millones de pares de bases. Esta cifra total incluye unas 2 950 Mb de eucromatina y unas 250 Mb de heterocromatina (formada, como veremos, por ADN satlite). Esta cifra se refiere al genoma haploide, de manera que las clulas somticas (diploides) contienen el doble.
La Figura 4.5 muestra una visin general de los distintos tipos de secuencias que constituyen el genoma humano.

Una primera clasificacin del genoma humano distingue, por un lado, los genes y secuencias relacionadas con genes (exones, intrones, regiones no traducidas que contienen elementos reguladores, etc.), y por otro todo el ADN que est entre los genes, llamado ADN extragnico o de relleno y que no codifica ninguna protena ni contiene ningn elemento funcional. Curiosamente, la mayor parte del genoma humano (un 70 por ciento) est formada por este ltimo, de forma que slo un 30 por ciento del genoma humano incluye secuencias relacionadas con genes. Lo ms sorprendente es que de este 30 por ciento slo un cinco por ciento est constitudo por ADN codificante (exones), siendo el resto ADN no-codificante asociado a genes. Por tanto, resulta que slo un 1,5-2 por ciento del total del genoma humano es ADN codificante. El ADN extragnico est formado, sobre todo, por los componentes repetitivos del genoma humano que se explicarn ms adelante, aunque tambin hay secuencias nicas o en bajo nmero de copia.

www.FreeLibros.me

Desde la publicacin del primer borrador del Genoma Humano en febrero de 2001, podemos dar unos valores promedio estimados a partir de los datos publicados:

59

Estructura del genoma humano y variacin inter-individual

Se estima que el genoma humano contiene en torno a los 20 000-25 000 genes. Alrededor de un 50 por ciento del genoma humano est constituido por ADN repetitivo. Se puede estimar que la densidad media de genes es de un gen cada 100 kb, aunque existen regiones ricas en genes (algunas zonas del cromosoma 19, por ejemplo) y otras regiones que son muy pobres en genes (como el cromosoma Y). Por tanto, se puede deducir una frecuencia media de 10 genes por cada Mb de secuencia. El tamao promedio de un gen humano es de 20-30 kb, aunque hay grandes diferencias de unos genes a otros. El nmero de exones que forman un gen es muy variable (desde genes que tienen un solo exn hasta algunos genes con 100 exones o ms), pero podemos establecer un valor promedio de siete-ocho exones por gen. El tamao medio de un exn es de 150 nucletidos. Por lo que respecta a los intrones, en cambio, existe una enorme variabilidad de tamaos, y no es infrecuente encontrar en casi todos los genes algn intrn de gran tamao. El tamao medio de un ARNm es de 1,8-2,2 kb incluyendo las regiones no-traducidas flanqueantes. La longitud media de una regin codificante es de 1,4 kb.

Una de las caractersticas ms evidentes del borrador de nuestro genoma es su heterogeneidad. En efecto, la secuencia no es uniforme, sino que muchas de sus caractersticas (riqueza en C+G frente a A+T, riqueza en genes, etc.) se distribuyen heterogneamente, con regiones de gran abundancia flanqueadas por regiones en que esos parmetros son ms escasos. As por ejemplo, el contenido medio de G+C del genoma humano es del 41 por ciento, menor de lo tericamente esperado. Adems, si el genoma se divide en ventanas de 20 kb se observan regiones con valores muy alejados del promedio, con una dispersin 15 veces mayor de lo que sera esperable si la distribucin fuese uniforme. La distribucin de %G+C de estas ventanas no se ajusta a una distribucin normal, sino que est desviada hacia valores bajos. Adems, se ha comprobado que los genes tienden a concentrarse en las ventanas ms ricas en G+C. Esto se conoca ya de antiguo, y de hecho se haba acuado el trmino isocoro para designar las regiones genmicas que son homogneas en cuanto al contenido en G+C y que pueden separarse mediante gradientes de densidad. Se distinguen isocoros L e isocoros H, segn su contenido en G+C sea bajo (Low) o alto (High), y dentro de cada isocoro hay varios subgrupos. La tabla que se presenta a continuacin resume algunas caractersticas importantes de los distintos isocoros: Isocoro L1 L2 H1 H2 H3 % GC 38 41 44 49 53 % del genoma 30 32 19 10 9 Contenido Genes % 48 27 25 Mb ADN 1,860 870 270 Densidad de genes 1 cada 130 kb 1 cada 100 kb 1 cada 35 kb

www.FreeLibros.me

60

Como puede apreciarse, existe una relacin directa entre el contenido de una regin genmica en nucletidos G+C y su riqueza en genes. Es decir, hay en el genoma humano unas regiones con mayor riqueza de genes, regiones que a su vez son las que tienen un mayor porcentaje de nucletidos G+C. Otro hallazgo inesperado en nuestro genoma ha sido la presencia de mayor nmero de duplicaciones del que se haba estimado hasta entonces. De hecho, el anlisis muestra alrededor de un cinco por ciento de duplicaciones segmentarias, definidas como dos o ms segmentos cromosmicos >1 kb con >90 por ciento de identidad de secuencia; dicho nivel de homologa corresponde a una antigedad de unos 40 millones de aos. Las duplicaciones intracromosmicas (las copias estn en el mismo cromosoma) tienen un tamao medio de unas 100 kb, mientras que las duplicaciones intercromosmicas (entre cromosomas distintos) son ms pequeas (1050 kb). Las duplicaciones segmentarias son ms frecuentes en regiones centromricas y cerca de los telmeros (donde pueden llegar a constituir un 25 por ciento de la secuencia). Los centrmeros, en concreto, estn flanqueados por regiones ricas en duplicaciones intercromosmicas procedentes de regiones eucromticas de otros cromosomas, que se han ido transponiendo a zonas pericentromricas a una velocidad de seis-siete eventos por milln de aos durante la evolucin de primates. Las duplicaciones intracromosmicas pueden dar lugar a alteraciones genmicas, como veremos ms adelante.
La Figura 4.6 muestra esquemticamente los tipos de duplicaciones segmentarias.

La geografa del genoma humano

El anlisis de la secuencia tambin ha mostrado la alta cantidad de pseudogenes que hay en el genoma humano. Como su nombre indica, los pseudogenes son versiones incorrectas de genes, que contienen diversos tipos de mutaciones y habitualmente no se transcriben. Se dividen en pseudogenes no procesados y pseudogenes procesados. Los primeros son copias de un gen, habitualmente originadas por duplicacin del gen original y posteriores mutaciones que hacen que la copia pierda su capacidad codificante. Contienen exones e intrones, pero carecen de promotor y habitualmente tienen codones de parada prematuros. En cambio, los pseudogenes procesados son copias del ARN mensajero de un gen, que se ha retrotranscrito e insertado en otra posicin del genoma (de ah que se denominen tambin retropseudogenes). No tienen intrones, y tampoco tienen capacidad codificante por la ausencia de promotor y por la presencia de codones de parada. Se han identificado unos 11 000 pseudogenes en el genoma humano, de los que la mayor parte (unos 8 000) son pseudogenes procesados. En total, se estima que el nmero de pseudogenes en nuestro genoma puede llegar a unos 20 000. De todas formas, todos los pseudogenes detectados se originan a partir de tan slo unos 2 500 genes funcionales, de modo que la mayor parte de los genes no tienen ningn pseudogen en el genoma.
La Figura 4.7 muestra la estructura de los distintos tipos de pseudogenes.

Recientemente se han encontrado 481 segmentos >200 pares de bases totalmente conservados (100 por ciento de identidad sin gaps) en regiones ortlogas de humano, rata y ratn, y la gran mayora estn tambin conservados en pollo y perro (95

www.FreeLibros.me

y 99 por ciento de identidad, respectivamente). Muchas tambin estn conservadas en pez. Estos elementos ultraconservados se solapan con exones de genes implicados en el procesamiento de ARN, y tambin son abundantes en intrones de genes relacionados con el desarrollo o con la regulacin de la transcripcin. Junto con las ms de 5 000 secuencias >100 nucletidos que estn totalmente conservadas en los tres mamferos secuenciados, estos fragmentos constituyen una nueva clase de elementos genticos cuya funcin est por determinar, pero el hecho de que estn ms conservados que las protenas indica que deben jugar algn papel importante. Tambin es importante dedicar unas lneas a describir la presencia de genes que dan lugar a microARN. Como es sabido, el estudio del mecanismo de interferencia de ARN ha llevado a la identificacin de ARN interferentes endgenos en los genomas de eucariotas, incluido el genoma humano. Estos ARN se denominan microARN (miARN) y se transcriben a partir de genes con un promotor de ARN-polimerasa II. Estos genes tienen un segmento palindrmico, de modo que el ARNm primario forma un pri-miARN que contiene una horquilla de ARN bicatenario; este pri-miARNm es procesado dentro del ncleo de la clula por una ARNasa tipo III llamada DROSHA y esto da lugar a un pre-miARN, una ARN bicatenario con forma de horquilla de unos 70 nucletidos de tamao. El pre-miARN sale del ncleo y es procesado en el citoplasma por Dicer, originando un miARN de unos 22 nucletidos. ste entra a formar parte del complejo RISC (denominado miRISC para los miARN) y regula la expresin de genes diana mediante degradacin de sus mensajeros o por represin de la traduccin. Actualmente se han identificado ms de 300 genes de miARN en el genoma humano, y se calcula que puede haber en torno a 500. La mayora de estos genes se localizan en intrones de genes codificantes, y adems estn bastante conservados en primates. Dado que cada uno de estos miARN puede regular la expresin de varios genes diana, se estima que hasta un 20-30 por ciento de todos los genes del genoma humano pueden estar regulados por miARN, lo que les confiere una extraordinaria importancia. La secuenciacin del genoma humano ha permitido tambin estudiar la variacin gentica inter-individual, es decir, las diferencias genticas que estn en la base de las diferencias fenotpicas entre individuos. Esto tiene gran relevancia mdica, porque muchas de estas variantes pueden ser tambin causa de la distinta susceptibilidad a desarrollar enfermedades o la diferente respuesta a frmacos que tienen personas distintas. Uno de los tipos ms importantes de variabilidad gentica es el constituido por los cambios en un nucletido de la secuencia, conocidos con el nombre de SNP. Uno de los objetivos del PROYECTO GENOMA HUMANO era el estudio de la diversidad gentica, y esto ha cristalizado en otro proyecto internacional denominado Proyecto HapMap que se propone precisamente identificar los SNP ms frecuentes en el genoma humano en individuos de diferentes grupos tnicos. En octubre de 2005, el Proyecto Hapmap public un primer mapa que contiene 1 007 329 SNP con una distancia media entre ellos de cinco kb, con una frecuencia del alelo menos frecuente igual o superior al cinco por ciento (es decir, presentes en al menos el cinco por ciento de la poblacin). Todos estos SNP fueron genotipados en 269 individuos de cuatro grupos raciales: 90 de raza yoruba, de Nigeria; 90 caucasianos de Utah; 45 de raza han, de China; y 44 japoneses. La segunda fase de este Proyecto se propone genotipar otros cinco millones de SNP. La inspeccin de estos mapas permite hacerse una idea

61

Estructura del genoma humano y variacin inter-individual

www.FreeLibros.me

62

de la variacin en el genoma, tanto entre individuos como entre distintos grupos raciales. Adems, estos datos han permitido comprobar que esta variacin se agrupa en bloques, de modo que todos los SNP de un mismo bloque se heredan juntos. En un captulo posterior veremos la importancia de estos bloques para estudiar la asociacin de SNP concretos con la susceptibilidad a padecer enfermedades.
La Figura 4.8 muestra la estructura de los haplotipos formados por los alelos de varios SNP cercanos.

La geografa del genoma humano

Otro tipo de variacin que se ha descubierto al analizar la secuencia del genoma humano es la originada por diferencias en el nmero de copias de grandes segmentos genmicos. Al analizar genomas de distintos individuos, se ha visto que existen unas 200-300 regiones genmicas de tamao grande (entre 10 y 50 kilobases) cuyo nmero de copias en el genoma es diferente de unos individuos a otros. Este tipo de variaciones, llamadas LCV (Large-scale Copy number Variations) o CNP (Copy Number Polymorphisms) pueden ser deleciones o repeticiones en tndem. Una caracterstica de todas estas regiones es que estn flanqueadas por duplicaciones segmentarias, y esto hace pensar que la variacin en el nmero de copias es el resultado de reordenaciones entre esos elementos flanqueantes. Aunque su papel biolgico todava no est claro, los CNP pueden tener importancia en la variacin gentica inter-individual que explica las diferencias en la predisposicin a desarrollar enfermedades. Finalmente, se ha catalogado tambin otro tipo de variacin consistente en polimorfismos de insercin/delecin pequeos (de tamaos entre un nucletido a 10 kb). Se han detectado varios cientos de miles, y se estima que en total hay alrededor de 1,5 millones de estos polimorfimos en el genoma humano. Aunque se distribuyen por todo el genoma, se ha visto que en algunas regiones son especialmente frecuentes. Muchos de ellos estn dentro de genes, y pueden causar alteraciones cuando afectan al promotor o a la regin codificante (exones).

4.3 El ADN repetitivo


Como hemos visto al principio de este captulo, hasta un 50 por ciento del genoma humano est constituido por ADN repetitivo, antiguamente conocido como ADN basura. Por su importancia, a continuacin estudiamos con mayor detalle su composicin y los distintos tipos de secuencias que lo forman. Ya se ha mencionado que podemos encontrar ADN repetitivo tanto en el ADN codificante (en los genes y secuencias relacionadas) como en el ADN no-codificante, pero la mayor parte se encuentra en el ADN no-codificante. Quizs el nico ejemplo de ADN repetitivo codificante que merece la pena resear es el correspondiente al ADN ribosomal, que se concentra en los brazos cortos de los cromosomas acrocntricos (13, 14, 15, 21 y 22) y est formado por tres genes que dan lugar a los tres ARN ribosomales de 5,8S, de 18S y de 28S. Los tres genes estn juntos formando un bloque que mide unas 13 kilobases. Estos bloques se encuentran repetidos unas 50 veces, separados entre s por un espaciador intergnico que mide unas 30 kilobases. En conjunto, el ADN ribosomal ocupa un tamao de unas dos megabases.

www.FreeLibros.me

En el ADN no-codificante, tanto intragnico (es decir, intrones y otras regiones no-codificantes relacionadas con genes) como extragnico, podemos encontrar diversos tipos de elementos repetidos. En general, se trata de una secuencia de ADN que se repite en el genoma cientos o miles de veces. Estas repeticiones pueden encontrarse en tndem (es decir, seguidas una detrs de otra) o dispersas. El ADN repetido en tndem se divide en varios grupos segn el tamao total que origina la repeticin:

63

El ADN repetitivo

El genoma humano contiene en total unas 250 Mb de ADN satlite (llamado as porque al separar el ADN genmico en gradientes de densidad aparece como tres bandas satlites de la banda principal). El ADN satlite est formado por la repeticin de una secuencia de ADN miles de veces en tndem, es decir unas copias pegadas a otras. Esto da lugar a regiones repetidas con tamaos que van desde 100 kb hasta varias megabases. Por ejemplo, el ADN Satlite 1 es una secuencia de 42 nucletidos, mientras que en el Satlite 2 la secuencia repetida es (ATTCCATTCG) y en el Satlite 3 se repite el pentmero (ATTCC). Un tipo de ADN satlite muy importante es el ADN alfoide o Satlite alfa, en el que la secuencia repetida tiene un tamao de 171 nucletidos, y que forma parte del ADN de los centrmeros de los cromosomas humanos. Otros tipos de ADN satlite son el Satlite beta (repeticin de 68 nucletidos) y el Satlite gamma (repeticin de 220 nucletidos), que tambin se encuentran en la cromatina centromrica de varios cromosomas. El ADN de tipo Minisatlite est formado por secuencias de 6-25 nucletidos que se repiten en tndem hasta dar un tamao total entre 100 nucletidos y 20 kb. Un ejemplo de ADN Minisatlite es la repeticin que forma los telmeros de los cromosomas humanos, en los que el hexanucletido (TTAGGG) se repite miles de veces en tndem dando lugar a bloques de 5-20 kb de tamao. Algunas repeticiones de este tipo son polimrficas, y dan lugar a los marcadores de tipo VNTR que hemos mencionado en un apartado anterior. El ADN de tipo Microsatlite est formado por secuencias de dos, tres o cuatro nucletidos que se repiten hasta dar bloques con un tamao total habitualmente no superior a 150 nucletidos. Hay repeticiones de este tipo por todo el genoma humano, y muchas de ellas son muy tiles como marcadores genticos porque el nmero de repeticiones vara entre individuos. Ejemplos de ADN microsatlite son los dinucletidos (CA), o las repeticiones de trinucletidos (CAG).

El ADN repetido disperso est formado por secuencias que se repiten miles de veces en el genoma humano, pero no en tndem sino de manera dispersa. Este tipo de repeticiones constituyen un 45 por ciento de todo el genoma humano y se clasifican en funcin del tamao de la unidad repetida:

Los SINE (Short Interspersed Nuclear Elements, elementos nucleares dispersos cortos) suponen un 13 por ciento del genoma humano. Son secuencias cortas repetidas miles de veces en el genoma humano de forma dispersa. El principal SINE es la familia de elementos Alu, que es especfica de primates y constituye un 10 por ciento de nuestro genoma. Un elemento Alu est formado por una secuencia de 250-280 nucletidos, con unas 1 500 000 copias por genoma y

www.FreeLibros.me

64

una repeticin cada cuatro kb como promedio. Es un elemento relativamente rico en guaninas+citosinas (56 por ciento de contenido en CG, mientras que el contenido promedio del genoma humano es del 41 por ciento). Se localiza predominantemente en la bandas R de los cromosomas humanos. Est flanqueado por pequeas repeticiones directas (en la misma orientacin). Su estructura es la de un dmero no idntico, ya que el segundo monmero es 30 nucletidos mayor que el primero. Contiene colas poli-A al final de cada monmero, y se transcribe por la ARN polimerasa III a partir de un promotor interno, pero no codifica ninguna protena. Acta como un retrotransposn, ya que puede copiarse e insertarse en otras regiones del genoma. Los LINE (Long Interspersed Nuclear Elements, o elementos nucleares dispersos largos) constituyen un 20 por ciento del genoma humano. Son secuencias con un tamao de varias kilobases, agrupados en distintas familias. El principal LINE es el llamado LINE-1 o L1, formado por una secuencia de unas seis kb repetida unas 800 000 veces en el genoma (aunque muchos de estos elementos no estn completos, sino truncados y les falta la parte 5), llegando a constituir alrededor de un 15 por ciento del genoma. Estos elementos, al contrario que los SINE, no son ricos en guaninas+citosinas (tienen un 42 por ciento de citosinas+guaninas, que es cercano al contenido promedio del genoma humano) y se localizan predominantemente en las bandas G de los cromosomas. Un elemento L1 codifica dos protenas: una ARN-binding protein en el marco de lectura ORF1 y una protena con actividad endonucleasa y retrotranscriptasa en el marco de lectura ORF2. Est flanqueado por unas pequeas repeticiones directas (en la misma orientacin) y termina en una cola poli-A. Los elementos LINE son retrotransposones, puesto que pueden copiarse a s mismos a travs de un intermediario ARN y transponerse a otras localizaciones genmicas. Segn el modelo ms aceptado, el elemento se transcribe por la ARN polimerasa II a partir de un promotor interno, sus productos proteicos se unen a la cola poli-A de su propio ARN mensajero y el complejo se inserta en el ADN genmico por la accin combinada de la endonucleasa (que corta dentro de regiones ricas en AT que llevan la secuencia TTTTA) y de la retrotranscriptasa. Las protenas codificadas por los LINE son utilizadas tambin para la retrotransposicin de elementos SINE y de pseudogenes procesados, por lo que pueden jugar un importante papel como elemento modificador del genoma. De hecho se ha visto que la secuencia propia de los L1 tiene la propiedad de inhibir la transcripcin, de ah que los niveles de ARNm y protenas codificadas por los L1 en las clulas sea muy bajo. Lo ms interesante es que tambin pueden modificar la transcripcin de los genes en cuyos intrones hay abundancia de estos elementos: un 80 por ciento de los genes humanos tienen L1 en sus intrones, y la densidad en L1 correlaciona negativamente con los niveles de expresin de estos genes. Por tanto, su papel tanto en la evolucin de genomas como en la regulacin gnica le confiere una gran importancia. Se acab el mito del ADN basura. Los HERV (retrovirus endgenos humanos), representan copias de los retrovirus humanos que se han ido integrando en el genoma humano en el curso

La geografa del genoma humano

www.FreeLibros.me

65
LINE Nuevo LINE (copia en otra localizacin)

El ADN repetitivo

transcripcin
ARNm

Reparacin traduccin

Unin de las protenas a su propio ARNm

Rotura endonucleoltica

Retrotranscripcin

La Figura 4.9 ilustra el mecanismo de retrotransposicin de los LINE.

de la evolucin y con frecuencia son el origen de proto-oncogenes celulares. Habitualmente representan copias truncadas del genoma de estos virus, y constituyen alrededor de un ocho por ciento del genoma (hay unas 450 000 copias). Como habitualmente conservan alguna de las repeticiones terminales largas de estos genomas, se denominan tambin repeticiones tipo LTR (Long Terminal Repeat). Nuestro genoma tambin contiene unas 300 000 copias de elementos repetidos originados por transposones ADN, lo que supone un tres por ciento del total del genoma. Estos elementos contienen el gen (habitualmente truncado) de la transposasa, flanqueado por repeticiones invertidas. De entre las distintas familias que existen cabe destacar el tipo MER1 o MER2 y los elementos mariner (Hsmar2), responsables de algunas reordenaciones cromosmicas importantes en patologa humana.

La Figura 4.10 muestra la estructura de los distintos tipos de repeticiones dispersas del genoma humano.

Es importante hacer algn comentario sobre la movilidad de los retroelementos dispersos. Tanto los LINE como los Alu que estn completos pueden, en teora, copiarse e insertarse en otra posicin del genoma a travs de un intermediario ARNm. De hecho, esto sucede habitualmente, aunque por fortuna con muy baja frecuencia. Se calcula que uno de cada 100-200 nuevos nacimientos lleva una insercin nueva de un Alu o de un L1, que pueden ser causa de enfermedades por diversos mecanismos.

www.FreeLibros.me

66

Esta tasa de nuevas inserciones es mucho ms baja que en otros mamferos. Por lo que respecta a los L1, se calcula que existen actualmente unos 5 000 elementos completos en el genoma humano, de los cuales unos 90 son activos (capaces de retrotransposicin). El potencial patognico de estos elementos viene dado por la propia capacidad de insertarse aleatoriamente en el genoma (e interrumpir genes), por la desregulacin de la expresin de genes cercanos (por los elementos promotores de los LINE y SINE), pero sobre todo por recombinacin ilegtima entre copias de Alu o L1 que estn en localizaciones cromosmicas distintas. Curiosamente, los elementos Alu causan este tipo de recombinacin con ms frecuencia que los L1, especialmente en algunos genes que sufren duplicaciones o deleciones por recombinacin entre secuencias Alu. Para finalizar, es interesante tener una visin de conjunto de la localizacin de los distintos tipos de elementos repetidos en el genoma humano, representados sobre un cariotipo convencional. Como ya se ha dicho, el ADN ribosomal se localiza en el brazo corto de los cromosomas acrocntricos. El satlite alfa puede verse en todos los centrmeros. El satlite beta, en cambio, est en localizacin pericentromrica en los cromosomas acrocntricos y en la constriccin secundaria del cromosoma 1. El satlite gamma es pericentromrico en los cromosomas 8 y X. El satlite 1 est en los centrmeros de los cromosomas 3 y 4, adems de encontrarse tambin en el brazo corto de los cromosomas acrocntricos (distal al ADN ribosomal). El satlite 2 es pericentromrico en los cromosomas 2 y 10, adems de formar la constriccin secundaria de los cromosomas 1 y 16. Finalmente, el satlite 3 est en la constriccin secundaria de los cromosomas 9 e Y, as como en el brazo corto de los cromosomas acrocntricos (proximal al ADN ribosomal). Los elementos dispersos se encuentran distribuidos por todo el genoma, siendo los LINE ms abundantes en bandas G y los elementos SINE ms abundantes en bandas R (bandas claras); microsatlites y minisatlites tambin estn dispersos, aunque stos ltimos tienden a concentrarse en torno a los telmeros.
En la Figura 4.11 se ven dos ejemplos de la distribucin de elementos repetidos de tipo satlite en cromosomas humanos.

La geografa del genoma humano

4.4 El genoma mitocondrial


La mitocondria es un orgnulo de probable origen endosimbintico que se ha adaptado a su nicho intracelular: para aumentar su tasa de replicacin y asegurar la transmisin a las clulas hijas despus de cada divisin mittica, el genoma de las mitocondrias de mamferos se ha ido reduciendo de tamao hasta alcanzar las 16 569 kb en el caso del genoma mitocondrial humano. Las mitocondrias son las verdaderas centrales trmicas de nuestro organismo ya que en ellas tiene lugar la fosforilacin oxidativa (OXPHOS), es decir, la respiracin celular acoplada a la produccin de energa en forma de ATP. El funcionamiento del sistema OXPHOS tiene, adems, importancia mdica por la generacin de especies reactivas de O2 (Reactive Oxygen Species, ROS) y por la regulacin de la muerte celular programada o apoptosis. Las protenas incluidas en el OXPHOS se localizan dentro de la membrana mitocon-

www.FreeLibros.me

drial interna, e incluyen: (1) componentes de la cadena transportadora de electrones (Cadena respiratoria mitocondrial, CRM); (2) ATPasa de membrana; (3) Translocador de nucletidos de Adenina (ANT). El ADNmt humano es una molcula circular de 16 569 pares de bases. El nmero de molculas de ADNmt por clula vara entre unos pocos cientos en los espermatozoides a unas 200 000 copias en el oocito, pero en la mayor parte de los tejidos el rango est comprendido entre unas 1 000 y 10 000 copias por clula, con 2-10 molculas de ADN por mitocondria. Este genoma contiene informacin para 37 genes:

67

El genoma mitocondrial

Genes que codifican las dos subunidades 12S y 16S del ARNr (ARN ribosomal) de la matriz mitocondrial. Los genes para los 22 ARNt (ARN transferente), requeridos para la sntesis de protenas mitocondriales en la misma matriz mitocondrial. Genes que codifican 13 polipptidos que forman parte de los complejos multienzimticos del sistema OXPHOS. En concreto, en el genoma mitocondrial se codifican siete subunidades del Complejo I, una subunidad del Complejo III, tres subunidades del Complejo IV, y dos subunidades de la ATPasa (Complejo V).

Es importante no perder de vista que el resto de las subunidades polipeptdicas de estos complejos, as como el Complejo II completo, estn codificados en el genoma nuclear, de manera que no todas las enfermedades mitocondriales estn necesariamente causadas por alteraciones en el ADN mitocondrial.
La Figura 4.12 muestra los complejos proteicos de la membrana de la mitocondria que estn codificados por genes del propio genoma mitocondrial.

La caracterstica estructural ms sorprendente del ADNmt es que los genes se encuentran situados uno a continuacin del otro, sin apenas intrones ni regiones no codificantes entre los genes. Al contrario que el genoma nuclear, en el que las regiones no codificantes son mayoritarias, el ADN mitocondrial slo posee un tres por ciento de secuencias no codificantes. Veintiocho de los genes mitocondriales (dos ARNr, 14 ARNt y 12 polipptidos) se encuentran en una de las cadenas (cadena H o pesada), mientras que los nueve genes restantes (un polipptido y ocho ARNt) estn en la cadena complementaria (cadena L o ligera). La nica zona del ADNmt que no codifica ningn gen es la regin del bucle de desplazamiento (bucle-D), localizada alrededor del origen de replicacin de la cadena H. Esta regin contiene tambin los promotores de la transcripcin y los elementos reguladores de la expresin gnica. Otra de las peculiaridades de la organizacin gentica del ADNmt es que los genes de los ARNt se distribuyen entre los genes de los ARNr y los codificantes de protenas; esta disposicin tiene consecuencias muy importantes para el procesamiento del ARN. Para la replicacin del ADNmt hacen falta dos orgenes diferentes, uno para cada cadena (OH y OL). Ambos orgenes de replicacin estn muy separados, haciendo que el proceso sea unidireccional y asimtrico. La sntesis del ADN se inicia en OH y es realizada por una polimerasa especfica de la mitocondria, la ADNpol , que alarga un ARN iniciador fruto del procesamiento de un transcrito primario que se sintetiza a partir del promotor L. La replicacin contina de modo unidireccional

www.FreeLibros.me

68

hasta alcanzar OL, momento en el cual comienza la sntesis de la segunda cadena del ADN, alargando tambin un pequeo iniciador de ARN.
La Figura 4.13 muestra la estructura del ADN mitocondrial.

La geografa del genoma humano

En la transcripcin del ADNmt intervienen una polimerasa de ARN, al menos un factor de transcripcin implicado en la iniciacin (mtTFA), y uno de terminacin (mTERF). Las dos cadenas del ADNmt se transcriben completamente a partir de tres puntos de iniciacin diferentes, dos para la cadena pesada (H1 y H2) y uno para la cadena ligera (L), originando tres molculas policistrnicas que se procesan posteriormente por cortes endonucleolticos precisos en los extremos 5 y 3 de las secuencias de los ARNt, para dar lugar a los ARNr, ARNt y ARNm maduros. De esta forma los ARNt, situados entre los genes de los ARNr y ARNm, actan como seales de reconocimiento para los enzimas de procesamiento. En particular, la cadena H se transcribe mediante dos unidades de transcripcin solapadas en la regin de los ARNr: la primera de estas unidades comienza delante del gen para el ARNtPhe (lugar de iniciacin H1), termina en el extremo 3 del gen para el ARNr 16S y es responsable de la sntesis de los ARNr 12S y 16S, del ARNtPhe y del ARNtVal. El factor de terminacin (mTERF) se une a una secuencia situada en el gen del ARNtLeu y provoca la terminacin de esta unidad. La segunda unidad de transcripcin comienza cerca del extremo 5 del gen del ARNr 12S (lugar de iniciacin H2) y transcribe la casi totalidad de la cadena pesada; el procesamiento de este ARN policistrnico origina los ARNm de 12 pptidos y los otros 12 ARNt codificados en esta cadena. La transcripcin de la cadena ligera comienza cerca del extremo 5 del ARN 7S (en el bucle-D) y da lugar al iniciador de la replicacin de la cadena pesada, ocho ARNt y un pptido (ND6). La sntesis de las protenas mitocondriales tiene lugar en ribosomas especficos de la mitocondria, cuyos componentes estn codificados en el ADNmt (ARNr 12S y 16S) y en el genoma nuclear (84 protenas ribosomales). En este sistema de traduccin se sintetizan las trece protenas codificadas en el ADNmt utilizando un cdigo gentico que difiere ligeramente del cdigo gentico universal. As, UGA codifica el aminocido triptfano (Trp) en vez de ser un codn de terminacin, y los codones AUA y AUU se utilizan tambin como codones de iniciacin. La biognesis de la mitocondria depende de la expresin coordinada de los genomas mitocondrial y nuclear, pero hasta ahora se conoce muy poco acerca de los mecanismos que regulan la interaccin de ambos sistemas genticos. La expresin del ADNmt parece estar regulada por el factor de iniciacin de la transcripcin mtTFA, codificado en el genoma nuclear. Este factor podra ser el responsable tanto de los niveles de ARN como del nmero de copias de ADNmt, ya que la replicacin depende de la sntesis de un iniciador de ARN a partir del promotor de la cadena ligera. La regulacin de la relacin entre los ARNr y los ARNm mitocondriales se realiza fundamentalmente mediante la seleccin del lugar de iniciacin de la transcripcin de la cadena pesada, que a su vez est relacionada con el factor mtTERF (que causa terminacin de la transcripcin despus de la sntesis de los ARNr) y con el procesamiento de los ARN primarios. Asimismo, la actividad transcripcional puede estar regulada por estmulos hormonales, especialmente por hormonas tiroideas que actan tanto de un modo indirecto (por activacin de genes nucleares) como directamente sobre el propio ADNmt.

www.FreeLibros.me

CAPTULO 5

El genoma humano en accin

Contenidos
5.1 La secuencia influye en el estado funcional de la cromatina 5.2 Modificaciones epigenticas y su importancia en la regulacin del estado funcional de la cromatina 5.3 Relacin entre secuencia, estructura y funcin de la cromatina: territorios cromosmicos

5.1 La secuencia influye en el estado funcional de la cromatina


Como ya se ha dicho, el grado de empaquetamiento no es uniforme a lo largo de todo el genoma. De hecho, en el ncleo en interfase siempre se distingui una cromatina denominada eucromatina, poco condensada, y otra llamada heterocromatina, con un mayor grado de condensacin. Hoy sabemos que estas categoras morfolgicas tienen un correlato funcional, ya que la eucromatina es transcripcionalmente ms activa mientras que los genes incluidos en heterocromatina tienen un bajo nivel de expresin. La heterocromatina, a su vez, puede ser de dos tipos: constitutiva, que nunca se transcribe y se localiza en los centrmeros y en la constriccin secundaria de algunos cromosomas; o facultativa, que en el fondo es un tipo de eucromatina que se heterocromatiniza en situaciones concretas, como es el caso del cromosoma X inactivo en las mujeres. Adems de estas dos grandes categoras de cromatina, es importante comprender que dentro de las regiones eucromticas la cromatina tampoco es totalmente homognea, como queda reflejado, por ejemplo, en su distinta repuesta a varias tinciones. Este comportamiento es precisamente la base del patrn de bandas caracterstico de cada cromosoma y que permite la creacin del cariotipo convencional. Como veremos en un captulo posterior, la tincin con un colorante llamado Giemsa produce unas bandas oscuras (bandas G) separadas por bandas claras (bandas R). La tincin con otra sustancia llamada Quinacrina (que se une especficamente a regiones ricas en adeninas y timinas) produce un patrn de bandas similar a las bandas G, mientras que la tincin con Cromomicina-A (que se une preferentemente a regiones ricas en guaninas y citosinas) genera un patrn similar a las bandas R.

www.FreeLibros.me

70

Por tanto, las peculiaridades morfolgicas de la cromatina son debidas, al menos en parte, a diferencias en la secuencia de nucletidos del genoma; el modelo del andamio (scaffold) que vimos en el Captulo 2 permite explicar esta relacin, ya que las bandas G representan regiones con un mayor grado de empaquetamiento del ADN, lo que implica una mayor densidad de las regiones de unin al andamio (llamadas SAR). Como las SAR son relativamente ricas en adenina y timina, esto explica que estas regiones genmicas se tian ms intensamente por Quinacrina y Giemsa, mientras las bandas R, ms ricas en guanina y citosina, tienen un menor grado de empaquetamiento, menor densidad de SAR y se tien dbilmente por estos colorantes. Por tanto, las distintas bandas del cariotipo reflejan no slo diferencias en la condensacin de la cromatina, sino tambin diferencias en su composicin: ya hemos visto que el genoma humano tiene un contenido medio en G+C del 41 por ciento, pero que esto no se distribuye de manera uniforme por todo el genoma. A su vez, las diferencias en condensacin y en composicin de las distintas regiones de cromatina se correlacionan con otra variable importante: la riqueza en genes y su actividad transcripcional. Por ejemplo, se estima que un 80 por ciento de los genes se localizan en bandas R (las ms ricas en nucletidos G+C), que son las menos condensadas. Tambin se ha observado que, en general, las bandas R son de replicacin temprana, mientras que las bandas G son de replicacin ms tarda. Como se recordar del Captulo 2, la replicacin del ADN en eucariotas comienza en muchos orgenes de replicacin durante la fase S del ciclo celular, pero no todos los orgenes de replicacin comienzan a funcionar a la vez: hay unos orgenes que siempre comienzan al principio de la fase S (replicacin temprana) y otros que van comenzando a funcionar ms tarde (replicacin tarda). Asimismo, se sabe que los genes constitutivos (housekeeping en ingls), que son los que se expresan en todos los tejidos, se replican temprano; por el contrario, los genes que estn en regiones heterocromticas (el cromosoma X inactivo, por ejemplo) son de replicacin ms tarda. Parece por tanto que regiones con alta densidad de genes, ricas en C+G y descondensadas se replican antes que regiones silenciadas o con baja densidad de genes. Otro aspecto que diferencia los distintos tipos de bandas es la acetilacin de las histonas. Como se ver a continuacin, se ha podido comprobar que la acetilacin de las histonas que forman los nucleosomas lleva a la formacin de una cromatina ms abierta, que permite mejor el acceso de factores de transcripcin y la expresin de los genes contenidos en esas regiones. Esto se debe a que las colas amino-terminales de las histonas interaccionan con ms fuerza entre s y con el ADN cuando los grupos psilon-amino de las lisinas estn en su forma des-acetilada; la acetilacin relaja esas interacciones y descondensa parcialmente la fibra de 30 nm y la unin del ADN con los nucleososmas. Curiosamente, se ha comprobado que las histonas de las bandas G estn menos acetiladas que las histonas de las bandas R. Esto ayudara tambin a explicar la menor condensacin de la cromatina en las bandas R, y nos proporciona un mecanismo para entender por qu las bandas R se replican antes y son ms activas transcripcionalmente: por un lado, no necesitan descondensarse para que se lleve a cabo la replicacin, y por otro constituyen unos dominios en los que el ADN es ms accesible a los factores de transcripcin.
Figura 5.1 La acetilacin de colas amino-terminales de las histonas influye en la condensacin de la cromatina.

El genoma humano en accin

www.FreeLibros.me

En resumen, es importante darse cuenta de que los mecanismos bsicos de regulacin de la expresin gnica estudiados en el Captulo 1 estn sometidos a un nivel superior de regulacin, dependiente de la situacin de un gen dentro del genoma y del estado funcional de la cromatina en que se encuentra, que a su vez est influido por el tipo de secuencias que la componen. Generalizando, podemos resumir las principales caractersticas de los dos estados de cromatina ms frecuentes, representados por los dos tipos principales de bandas citogenticas (banda G, oscuras, y bandas R, claras): Bandas G Densidad en genes Porcentaje de G+C Replicacin Composicin Acetilacin Histonas Repeticiones predominantes Baja Bajo Tarda Ricas en A+T Baja LINE Bandas R Alta Alto Temprana Ricas en G+C Alta SINE

71

Modificaciones epigenticas y su importancia en la regulacin del estado funcional

5.2 Modificaciones epigenticas y su importancia 5.2 en la regulacin del estado funcional de la cromatina
Es muy importante comprender que los aspectos estructurales y funcionales se integran en un modelo dinmico, segn el cual una regin de cromatina estar en un estado ms o menos favorable a la expresin gnica dependiendo del tipo de secuencias que la forman y tambin de las modificaciones epigenticas a ese nivel. Por modificaciones epigenticas se entienden todos aquellos cambios que sufre la cromatina pero que no afectan a la secuencia de nucletidos: por eso no son modificaciones genticas, sino que estn por encima (que es lo que significa epi en griego). En los ltimos aos se ha comprobado experimentalmente la gran importancia que tienen los mecanismos que regulan la actividad de la cromatina mediante cambios epigenticos. Para entender esto, es importante recordar que la actividad transcripcional basal en eucariotas es esencialmente restrictiva, en el sentido de que los promotores estn en estado inactivo hasta que se ponen en marcha por la accin de los elementos llamados activadores y el ensamblaje del complejo basal de transcripcin. Para que estos factores proteicos se unan a sus dianas en el ADN es necesario que la cromatina de esa regin est relativamente descondensada, para exponer ms fcilmente la doble hlice y permitir el acceso de factores proteicos. De hecho, los genes que son transcripcionalmente activos se asocian habitualmente con sitios hipersensibles a DNAsa I, regiones cortas (unos pocos cientos de pares de bases) formadas por ADN que no est asociado a nucleosomas, precisamente porque se encuentra unido a factores de transcripcin.
La Figura 5.2 ilustra esquemticamente la distinta accesibilidad a una regin de cromatina dependiendo del grado de condensacin.

www.FreeLibros.me

72

Los nucleosomas son, por tanto, un elemento fundamental para mantener este estado basal restrictivo, al impedir el acceso de la maquinaria transcripcional a los promotores. La represin transcripcional mediada por nucleosomas se debe tanto a las interacciones directas del octmero de histonas con el ADN, como a las interacciones que se originan entre nucleosomas vecinos para dar lugar a la fibra de cromatina. Como hemos visto ms arriba, las colas N-terminales de las histonas de los nucleosomas quedan libres hacia fuera, y son las regiones ms susceptibles de ser modificadas qumicamente para variar su carga y alterar las interacciones, tanto entre histonas y ADN como entre nucleosomas vecinos. Por tanto, si conseguimos relajar alguna de estas interacciones conseguiremos favorecer la transcripcin de los genes que estn incluidos en esas regiones. Esta relajacin se puede conseguir gracias a que las colas N-terminales de las histonas tienen una serie de aminocidos (lisinas y serinas, principalmente) que pueden sufrir modificaciones covalentes del tipo acetilacin, metilacin o fosforilacin, y que van a ser cruciales en la regulacin de estos fenmenos. A su vez, estos cambios se coordinan con otras modificaciones epigenticas que sufre la propia cadena de ADN en forma de metilacin de algunos nucletidos concretos, y en su conjunto ambos procesos constituyen un importante mecanismo de regulacin de la actividad transcripcional. A continuacin veremos por separado las modificaciones epigenticas que sufre la cromatina, por una parte, y el ADN por otra. A. Modificacin de la cromatina. Para superar la represin basal debida a la presencia de nucleosomas y facilitar la expresin de un gen, los activadores de la transcripcin pueden potenciar la actividad transcripcional alterando, en primer lugar, la propia estructura de la cromatina: aunque el activador no se una directamente al promotor de un gen, puede reclutar distintas actividades modificadoras de la cromatina cuya accin sea conferir a esa regin un estado que facilite la transcripcin. Estas actividades pueden ser de varios tipos:

El genoma humano en accin

Complejos proteicos implicados en el remodelamiento nucleosomal: son capaces de mover los nucleosomas de su posicin para dejar expuesta una regin promotora y permitir la expresin gnica. Este tipo de actividad est mediada por complejos multiproteicos con actividad ATPasa, de los cuales el primero en ser aislado fue el complejo SWI/SNF (primero se identific en levaduras, despus en humanos). Este complejo desestabiliza el nucleosoma al romper los contactos del ADN con el octmero, que queda libre para moverse y asociarse con una regin vecina de la molcula de ADN. Todos los remodeladores de nucleosomas pertenecen a la familia SNF2 de ATPasas, y pueden dividirse en siete subgrupos dependiendo de los dominios proteicos que contienen.

En la Figura 5.3 se ilustra el movimiento de nucleosomas por la accin de remodeladores de la cromatina.

Complejos implicados en la acetilacin de histonas: el factor Gcn5 de levadura fue el primer activador transcripcional con actividad acetilasa de histonas descubierto, en 1996. Posteriormente se vio que otros co-activadores de la transcripcin de mamferos tambin posean actividad acetil-transferasa,

www.FreeLibros.me

factores tales como p300, CBP (CREB-BP) y P/CAF, de ah que hoy se conozcan en conjunto con el nombre de HAT (Histone AcetylTransferase). stos actan como factores de transcripcin integradores de diversas vas de transduccin de seales implicadas en el control del ciclo celular y de los procesos de diferenciacin, reparacin y apoptosis. Otros activadores transcripcionales con actividad HAT son el factor de transcripcin TAFII250 (que forma parte del complejo TFIID), SRC-1 y ACTR (coactivadores de receptores nucleares). Al igual que la acetilacin de las histonas conduce a la activacin transcripcional, la des-acetilacin de las histonas crea una estructura cromatnica ms condensada que impide la transcripcin de los genes incluidos en la esa regin genmica. En este sentido, se ha comprobado que los factores HDAC1 y HDAC2 (Histone De-Acetylase), cuya funcin es des-acetilar las histonas, estn presentes en el complejo Sin3-NcoR, un co-represor transcripcional que regula la expresin de genes importantes en el ciclo celular y en el desarrollo embrionario. En conjunto, acetilasas y des-acetilasas actan sobre los mismos aminocidos de las colas amino-terminales de las histonas H3 y H4, especialmente las lisinas 9, 14, 18 y 23 de la histona H3 y las lisinas 5, 8, 12 y 16 de la histona H4. En la Figura 5.1 ya se ha visto el posible mecanismo por el que la des-acetilacin de las histonas favorece la compactacin de nucleosomas vecinos e impide la transcripcin en esa regin. De hecho, se ha comprobado que la desacetilacin de la lisina 16 en la histona H4 provoca la condensacin de la fibra de 10 nm, mientras que la acetilacin de este residuo impide la formacin de la fibra de 30 nm y permite la interaccin con co-activadores de la transcripcin. Otras modificaciones muy importantes son la fosforilacin de la histona H3 en la serina 10 y la metilacin de las lisinas 4, 9, 27, 36 y 79 en la histona H3 y de la lisina 20 de la histona H4, metilacin catalizada por unos complejos proteicos que tienen actividad metil-transferasa. Se ha comprobado que estas modificaciones actan en coordinacin con la acetilacin, estableciendo lo que ahora se conoce como el Cdigo de Histonas. Segn este cdigo, una regin se comportar como eucromatina o como heterocromatina dependiendo de las modificaciones epigenticas de las histonas que conforman los nucleosomas de la regin; las regiones limtrofes, en las que se da una transicin de un tipo de cromatina al otro, muestran caractersticas propias de ambos tipos de cromatina, y son capaces de unir complejos proteicos llamados aisladores (en ingls insulator), que forman una especie de barrera fsica e impiden que un tipo de cromatina se extienda ms all del lmite de la regin e invada la regin vecina. De modo general, el cdigo de histonas establece que una regin de eucromatina se caracteriza por tener la lisina 4 de la histona H3 metilada (con uno, dos o tres grupos metilo), y las lisinas 9 y 14 de la misma histona acetiladas. Se ha comprobado que esta configuracin tiene la propiedad de unirse a un dominio proteico llamado bromodominio, que est presente en muchos activadores de la transcripcin. Una regin con estas caractersticas puede heterocromatinizarse si sufre una cascada de alteraciones: la prdida de la metilacin de la lisina 4, la desacetilacin progresiva de las lisinas 9 y 14, y

73

Modificaciones epigenticas y su importancia en la regulacin del estado funcional

www.FreeLibros.me

74

finalmente la metilacin de la lisina 9 constituyen una marca de heterocromatina, a la que se unen protenas que contienen un dominio de silenciamiento llamado cromodominio que recluta factores de silenciamiento como la protena HP1 (protena de heterocromatina-1). Estas interacciones estn influidas tambin por la fosforilacin de la serina 10 de la histona H3; por ejemplo, dicha fosforilacin generada por la quinasa Aurora B inhbe la unin de HP1 con la lisina 9 metilada durante la mitosis.

El genoma humano en accin

Chromo

Me 4

Ac Me 9

T-K-Q-T-A-R-K-S-T T-G-GG-G-K-A
P Ac
Bromo
La Figura 5.4 ilustra el concepto del Cdigo de histonas y su utilidad para definir distintas regiones de cromatina.

14

B. La metilacin del ADN juega un papel fundamental en el mantenimiento del silenciamiento transcripcional. El ADN de vertebrados se metila en el carbono 5 de las citosinas que estn en el dinucletido CpG (la p indica el grupo fosfato que une una citosina con una guanina, en direccin 53). Curiosamente, la abundancia de este dinucletido en el genoma de vertebrados es slo un 25 por ciento de lo esperado, es decir, el porcentaje normalizado de este dinucletido es de 0,25. En efecto, si el contenido en C+G del genoma es del 41 por ciento, la probabilidad esperada de encontrar un dinucletido CpG es (0,205 0,205) = 0,042 (o sea, 4,2 por ciento); en cambio, la frecuencia observada de este dinucletido est en torno al uno por ciento en el genoma humano, de ah que el porcentaje normalizado sea 1/4 = 0,25. Adems, los dinucletidos CpG no estn distribuidos homogneamente a lo largo del genoma, sino que son ms abundantes en los genes, tanto en los exones como, sobre todo, alrededor del inicio de la transcripcin. Pues bien, los dinucletidos CpG que tienen metilada la citosina son los que estn distribuidos a lo largo de la secuencia de genes. Por el contrario, los dinucletidos CpG que no estn metilados tienden a concentrarse en regiones que se denominan islas CpG. Aunque estas islas se han definido tradicionalmente como las regiones de un tamao igual o superior a 500 pb, con un contenido total de G+C superior a 50 por ciento y con un cociente de dinucletidos CpG observados frente a esperados superior a 0,6, hoy en da se pueden definir por su porcentaje normalizado de CpG. De

www.FreeLibros.me

hecho, el anlisis de todos los promotores del genoma humano identifica dos tipos de genes: los que tienen un promotor con un porcentaje normalizado de CpG en torno al 0,61 y los que tienen un promotor con un porcentaje normalizado de CpG en torno al 0,23. Los primeros constituyen un 70 por ciento de todos los promotores, y corresponden a los genes constitutivos o domsticos (housekeeping, en ingls). Por el contrario, los promotores con bajo porcentaje normalizado de CpG constituyen un 30 por ciento del total de los promotores, y corresponden a los genes que se expresan en tejidos especficos. Los promotores que contienen una isla CpG estn habitualmente hipometilados en la lnea germinal, lo cual les protege frente a las transiciones CT que sufren las citosinas metiladas.
En la Figura 5.5 se representa la distribucin de dinucletidos CpG a lo largo de un gen, mostrando el concepto de isla CpG.

75

Modificaciones epigenticas y su importancia en la regulacin del estado funcional

La metilacin del ADN est catalizada por unas metil-transferasas especficas de las citosinas que forman parte de dinucletidos CpG, y se conocen bsicamente dos tipos de estas metil-transferasas de ADN. Las DNMT3A y DNMT3B son responsables de la metilacin de novo, es decir, la metilacin de dinucletidos CpG que no estaban previamente metilados. En cambio, la DNMT1 (ADN-metil-transferasa-1) es responsable de mantener la metilacin durante la replicacin. En efecto, dado que en la doble cadena de ADN un dinucletido CpG tiene realmente dos citosinas metilables (ya que existe un CpG en cada una de las cadenas de la doble hlice), un sitio totalmente metilado tendr realmente dos citosinas metiladas. Tras la replicacin del ADN, ambas dobles hlices conservarn una cadena con el CpG metilado (la proveniente de la molcula original), mientras que la cadena de nueva sntesis estar sin metilar. Esto genera dinucletidos CpG hemi-metilados, es decir, metilados en una de las citosinas pero no en la otra; la DNMT1 tiene la funcin de re-metilar precisamente estos dinucletidos para restablecer el estado inicial de metilacin completa que tena la molcula original.
La Figura 5.6 muestra el proceso de re-metilacin de dinucletidos CpG que han quedado hemi-metilados tras la replicacin.

Numerosos estudios han mostrado el significado biolgico de la metilacin del ADN: 1) es un importante mecanismo epigentico de silenciamiento gnico a nivel transcripcional, y permite mantener el silenciamiento de ciertos genes durante los procesos de diferenciacin celular; 2) la metilacin es un mecanismo de defensa frente a elementos mviles del genoma, cuyos promotores estn habitualmente silenciados por metilacin; y 3) la metilacin es un mecanismo estabilizador de la cromatina, especialmente de la heterocromatina pericentromrica, ya que la des-metilacin de este tipo de cromatina conduce a la aparicin de reordenamientos cromosmicos severos. Los mecanismos moleculares por los que la metilacin conduce al silenciamiento transcripcional pueden ser mltiples:

Impidiendo la unin de factores de transcripcin al promotor. Por ejemplo, algunos factores de transcripcin generales como Sp1, CREB, E2F o NF-kB

www.FreeLibros.me

76

se unen a dominios que contienen CpG, y esta unin disminuye cuando estos dominios estn metilados. Sin embargo, este mecanismo no se puede aplicar de modo general a todos los genes. Mediante la unin especfica de represores transcripcionales al ADN metilado. Existen varias protenas de unin a los dinucletidos CpG metilados, denominadas genricamente MeCP (Methyl-Cytosine binding Protein) o MDB (Methyl Binding Domain), que forman parte de complejos con actividad represora de la transcripcin. Por ejemplo, MeCP-2 es una protena que contiene un dominio de unin a dinucletidos CpG metilados, as como otro dominio por el que se une a un represor transcripcional llamado Sin3. Curiosamente, Sin3 reprime la transcripcin a travs de su unin con HDAC2 (que, como ya hemos visto, des-acetila las lisinas de la histona H3). De esta manera, la represin transcripcional debida a la metilacin de los dinucletidos CpG se produce gracias a la asociacin entre metilacin del ADN y acetilacin de la cromatina, ya que el dominio de represin transcripcional de MeCP-2 es capaz de reclutar el complejo Sin3-NCoR-HDAC2 y as iniciar un foco de cromatina hipoacetilada en una regin especfica del genoma. Esto explica que las regiones en las que el ADN est metilado sean capaces de silenciar genes cercanos (aunque stos no tengan sus dinucletidos CpG metilados), al englobarlos en una regin genmica silenciada por des-acetilacin.

El genoma humano en accin

El vdeo incluido en la Figura 5.7 ilustra la interaccin entre metilacin del ADN y modificacin de las histonas.

Una propiedad muy importante del silenciamiento por metilacin es que es reversible: se ha comprobado que los promotores que han sido silenciados por metilacin pueden reactivarse si se des-metila esa regin. Un mecanismo posible para explicar esta reactivacin es la prdida de la metilacin durante la replicacin: esto sucedera si ciertos factores de transcripcin o activadores nucleares consiguieran unirse a sus promotores inmediatamente despus de la replicacin y antes de que acte la DNMT1 de mantenimiento en los sitios hemi-metilados. Una vez que se estabiliza el complejo basal de transcripcin sobre esa regin, ste atraera algunos componentes con actividad HAT, que a su vez actuaran manteniendo la cromatina abierta y permitiendo la transcripcin. Esto, adems, impedira la accin de la DNMT1 y terminara por eliminar la metilacin en esa regin tras varios ciclos de replicacin. Este mecanismo se conoce como des-metilacin pasiva. Otro mecanismo alternativo para explicar la re-expresin de genes silenciados por metilacin, sobre todo en clulas diferenciadas que ya no se replican, es la desmetilacin activa, aunque todava no se ha aislado de modo concluyente ninguna des-metilasa de ADN. En resumen, la metilacin del ADN constituye un importantsimo mecanismo epigentico de regulacin de la expresin gnica, debido a su interaccin con los mecanismos que modifican la estructura de la cromatina. El mantenimiento de los patrones de metilacin explica tambin que las modificaciones epigenticas sean heredadas establemente tras la replicacin del ADN. Adems, como ya se ha mencionado, la metilacin tiene importantes implicaciones biolgicas, y por tanto la alteracin de los procesos normales de metilacin de la cromatina puede pertur-

www.FreeLibros.me

bar procesos fisiolgicos importantes. En primer lugar, por ser un mecanismo fundamental en el silenciamiento de retrovirus endgenos, transposones y ADN satlite, las alteraciones en la metilacin de estos elementos puede provocar numerosas anomalas genticas. Adems, la metilacin es la base molecular de los fenmenos de impronta genmica (imprinting) que se estudiarn ms adelante, y es un mecanismo fundamental en la regulacin de la expresin gnica durante el desarrollo embrionario. De hecho, el embrin sufre una onda de des-metilacin genmica global en la fase de mrula de ocho clulas, seguida por la re-metilacin gradual que vuelve a fijar los patrones de metilacin en la fase de blastocisto. Tambin la inactivacin del cromosoma X en mujeres es un proceso bsicamente controlado por procesos de metilacin, acetilacin y silenciamiento. Por tanto, cada vez est ms claro que la des-regulacin de las modificaciones epigenticas de la cromatina est en la base de algunas enfermedades humanas. El caso ms claro es una enfermedad neurolgica hereditaria llamada Sndrome de Rett, en el que se han identificado mutaciones en el gen que codifica la protena de unin a metilcitosinas MECP2. Probablemente, esto origine un exceso de ruido transcripcional por falta de silenciamiento global de muchos genes, con efectos ms marcados en el cerebro que en otros rganos. Por otra parte, el papel de la metilacin en cncer tambin est cobrando cada vez ms importancia, ya que se ha visto que muchos tipos de tumores tienen alteraciones importantes en los procesos de metilacin de la cromatina:

77

Modificaciones epigenticas y su importancia en la regulacin del estado funcional

La desaminacin de citosinas metiladas (debida habitualmente a la accin de una citidn-desaminasa, o bien por desaminacin hidroltica espontnea) provoca un cambio de Citosina por Timina, haciendo que los dinucletidos CpG metilados sean puntos calientes (hotspots) para la generacin de mutaciones de este tipo. De hecho, se ha estimado que el 30 por ciento de las mutaciones encontradas en tumores en el gen TP53 (que codifica la protena p53, un supresor tumoral importante) son transiciones CT que tienen lugar dentro de dinucletidos CpG. Se ha comprobado que durante el proceso de iniciacin tumoral hay una hipometilacin global del genoma de la clula pre-maligna, lo que provoca un aumento en la inestabilidad genmica y la aparicin de anomalas cromosmicas. Por ejemplo, los ratones en los que el gen DNMT1 ha sido inactivado muestran una elevada tasa de deleciones o duplicaciones de regiones cromosmicas. Adems, algunos oncogenes concretos se sobreexpresan en algunos tumores por des-metilacin de sus promotores (por ejemplo el oncogn BCL2). Del mismo modo, se ha identificado una enfermedad (Sndrome ICF, siglas de Inmunodeficiencia, inestabilidad Centromrica y defectos Faciales) en la que los pacientes tienen mutaciones en el gen DNMT3B, que codifica una metil-transferasa que metila especficamente los satlites centromricos 2 y 3; la desmetilacin de esas regiones de heterocromatina provoca fusiones entre cromosomas. En conjunto, estos datos sugieren que la metilacin es un mecanismo muy importante para mantener la estabilidad del genoma. Al mismo tiempo, la hipermetilacin puntual de algunos genes supresores tumorales, con el consiguiente silenciamiento y prdida de funcin, es un mecanismo muy frecuente de generacin de distintos tipos de cncer. Por ejem-

www.FreeLibros.me

78

plo, el gen RB1 est frecuentemente metilado en un tipo de tumores llamados retinoblastomas espordicos. Tambin es frecuente la hipermetilacin (y silenciamiento) del gen supresor tumoral p16 en varios tipos de tumores; la hipermetilacin del gen VHL (Von Hippel-Lindau) en 20 por ciento de los carcinomas de clulas renales espordicos; la inactivacin, por hipermetilacin, del gen de reparacin de desemparejamientos hMLH1 en tumores de colon espordicos que muestran inestabilidad de microsatlites. En conjunto, se estima que en tejido tumoral hasta un 10 % de las islas CpG estn metiladas, en contraste con clulas normales en las que este porcentaje es mucho ms bajo. Por su parte, algunos complejos con actividad modificadora de la cromatina se han asociado tambin con el desarrollo de cncer. Por ejemplo, el gen AIB1, que tiene actividad acetilasa de histonas, est amplificado en cncer de mama y por tanto se expresa a niveles ms altos de lo normal. Por otro lado, el co-activador transcripcional CBP, que tambin funciona como una acetilasa de histonas, est fusionado con el gen MOZ o con el gen MLL en pacientes con leucemia mieloide aguda; esta fusin hace que la actividad acetilasa est aumentada en determinadas clulas de la mdula sea y esto desencadena la leucemia. Adems, otro co-activador transcripcional con actividad acetilasa de histonas (la protena p300) est mutado en cncer colorrectal y delecionado en el 80 por ciento de los glioblastomas, un tipo de tumor cerebral. Lo mismo puede decirse de los complejos con actividad des-acetilasa de histonas (HDAC): ya hemos visto que la supresin de Myc y la unin de Rb con el factor de transcripcin E2F dependen en gran medida de su unin con complejos que tienen actividad des-acetilasa. Adems, se ha demostrado que algunas oncoproteinas

RAR

RAR

El genoma humano en accin

Gen Gen que que responde responde

al Retinoico alcido cido Retinoico

Translocacin Translocacin con con Protena dede fusin Protena fusin PML/ PML/RARa RARa

Sin3 NCOR HDAC HAT

Sin3 NCOR HDAC

Sin3 NCOR HDAC

Ausencia Ausencia dede ligando ligando


Desacetilacin Desacetilacin (Represin) (Represin)

La Figura 5.8 muestra la regulacin de la transcripcin de un gen que responde al cido retinoico, mostrando la importancia de los complejos modificadores de la cromatina y su alteracin en un tipo de leucemia.

RXR

RXR

RXR

PML/RAR

Ac

Ac

Ac

Ac

Unin Unin del del ligando ligando (cido retinoico ) (cido retinoico)

Forma Forma anmala anmala del delreceptor receptor Impide Impide unin del del unin ligando ligando

Acetilacin Acetilacin ( Transcripcin ) (Transcripcin

www.FreeLibros.me

virales como HPV E7 o el antgeno T de SV40 inactivan el gen RB1 al impedir su unin con complejos que tienen actividad HDAC. Finalmente, las translocaciones asociadas con la leucemia promieloctica producen fusiones entre factores de transcripcin que interaccionan con diversas acetilasas y des-acetilasas de histonas, con complejos remodeladores de la cromatina y con protenas que tienen actividad metil-transferasa de histonas. Considerando todos los ejemplos citados en los prrafos anteriores, podemos concluir que los procesos que regulan la metilacin de la cromatina estn implicados en la iniciacin y progresin tumoral; esto, adems, abre nuevas posibilidades teraputicas en muchos tipos de cncer, ya que el estado de metilacin es potencialmente modificable mediante frmacos.

79

Relacin entre secuencia, estructura y funcin de la cromatina: territorios cromosmicos

5.3 Relacin entre secuencia, estructura y funcin 5.3 de la cromatina: territorios cromosmicos
Al ocuparnos de los mecanismos que regulan la funcin del genoma a nivel global, es importante tener en cuenta el nivel superior de organizacin de un genoma dentro del ncleo. En los ltimos aos se ha puesto en evidencia que distintas regiones de la fibra de cromatina tienden a ocupar posiciones concretas en el ncleo, dependiendo de la secuencia subyacente, del estado transcripcional de los genes de esa regin y de sus modificaciones epigenticas, del tiempo de replicacin del ADN implicado, etc. Por tanto, cada vez est ms claro que si queremos tener una imagen completa de cmo se regula la funcin del genoma, no podemos ignorar aspectos estructurales tales como la composicin en nucletidos o la posicin dentro del ncleo. Uno de los aspectos ms intrigantes de la biologa genmica de los ltimos aos es la organizacin espacial de la cromatina dentro del ncleo de la clula eucariota, dando lugar a lo que se han denominado territorios cromosmicos. Este concepto ha venido a completar la imagen del ncleo eucariota como una estructura compartimentalizada, en la que distintas regiones contienen maquinarias especficas que llevan a cabo funciones concretas. Esta nocin debe integrarse con la presencia de dominios cromatnicos definidos y ms o menos estables a lo largo de la vida de una clula. Diversos estudios han mostrado de forma convincente que la cromatina correspondiente a cada uno de los cromosomas tiende a ocupar unas posiciones concretas en el ncleo en interfase, y que esas posiciones tienden a mantenerse durante el ciclo celular. Por ejemplo, la posicin de un cromosoma concreto dentro del ncleo est relacionada con el tamao del cromosoma y con su riqueza en genes, que como hemos visto se correlaciona tambin con la secuencia de nucletidos subyacente. En general, se considera que los cromosomas pequeos tienden a localizarse hacia el interior del ncleo; igualmente, cromosomas ricos en genes tienden a ocupar posiciones centrales. Tambin existen datos que muestran que las regiones pobres en genes y en secuencias Alu se asocian con la periferia del ncleo, dejando la cromatina rica en genes en el interior. De todas formas, todava se desconoce cmo se establecen estos territorios y cmo se mantienen tras la mitosis.
En la Figura 5.9 se ilustra el concepto de territorio cromosmico.

www.FreeLibros.me

80

La replicacin del ADN y la transcripcin gnica son dos procesos que tienen lugar dentro del ncleo y que exigen una remodelacin importante de la fibra de cromatina para permitir el acceso de las maquinarias proteicas que los llevan a cabo. Adems, se ha visto que ambos procesos no tienen lugar al azar, en cualquier lugar del ncleo, sino en compartimentos especializados a los que acuden las fibras de cromatina que estn en la vecindad. Se habla as de fbricas de replicacin o de fabricas de transcripcin, regiones nucleares ocupadas por regiones genmicas que se replican o transcriben simultneamente aunque pertenezcan a territorios cromosmicos distintos. Lgicamente, las asas de cromatina que ocupan una fbrica determinada tendrn una configuracin similar, en cuanto al grado de condensacin de la cromatina, la secuencia de nucletidos, la riqueza en genes, etc.; esto explica que el genoma se organice como un mosaico de regiones que comparten caractersticas similares, ya que esas regiones podran interaccionar dentro del ncleo al situarse en una misma fbrica de replicacin o de transcripcin. Por ejemplo, se ha visto que en el genoma humano existen unas regiones llamadas RIDGES (Regions of IncreaseD Gene Expression, en ingls) en las que son ms abundantes los genes que se transcriben activamente, y son regiones ricas en G+C, pobres en repeticiones tipo LINE y con densidad gnica alta. Junto a stas, se observan tambin regiones con poca densidad en genes, bajo nivel transcripcional y relativamente pobres en G+C, que se llaman por tanto anti-RIDGES. Pues bien, los genes presentes en RIDGES tienden a localizarse, dentro del ncleo, en torno a las fbricas de transcripcin. Lo mismo sucede con los genes de replicacin temprana, que se asocian significativamente con las fbricas de replicacin nucleares. Por tanto, los modelos actuales postulan que los genes que son replicados o transcritos residen en regiones cromatnicas relativamente descondensadas, las cuales salen de sus propios territorios cromosmicos hacia fbricas de replicacin o transcripcin vecinas. En esas fbricas, por tanto, pueden interaccionar regiones alejadas de un mismo cromosoma, o incluso asas de cromatina de territorios cromosmicos distintos; esto permite explicar, en el caso de la transcripcin, la accin de potenciadores de la expresin que actan a larga distancia o incluso en trans. Como es lgico, en todas estas interacciones son importantes las modificaciones epigenticas de la cromatina y del ADN que hemos estudiado en este captulo, que en el fondo constituyen la base molecular que permite los fenmemos de condensacin y descondensacin necesarios para la replicacin, transcripcin y desplazamiento fsico de las asas de cromatina. Conjugando todos estos elementos, obtenemos una visin dinmica de la cromatina nuclear en la que la estructura del ncleo se integra con la funcin y secuencia del genoma. Esta visin es mucho ms rica que los modelos anteriores, que no tenan en cuenta todos estos factores, y adems permite explicar mucho mejor la regulacin fina de la expresin gnica durante el desarrollo embrionario o la diferenciacin celular. La otra cara de la moneda es que se trata de procesos tremendamente complicados y, por ello, potencialmente frgiles, de modo que pequeas perturbaciones en estos mecanismos pueden dar lugar a alteraciones genticas y enfermedades humanas. En este sentido, el cncer es un ejemplo tpico de proceso complejo de des-regulacin de la diferenciacin celular, en el que se observan importantes alteraciones epigenticas y una fuerte desorganizacin de la estructura nuclear.

El genoma humano en accin

www.FreeLibros.me

CAPTULO 6

Origen de la variacin gentica en humanos

Contenidos
6.1 Variacin en el ADN: polimorfismos y mutaciones 6.2 Mecanismos de reparacin del ADN en humanos. Enfermedades causadas por alteraciones 6.3 en los mecanismos de reparacin

6.1 Variacin en el ADN: polimorfismos y mutaciones


La variacin observable en los individuos se debe en gran medida a la variacin gentica, sobre la que se aade la variacin producida por la influencia del ambiente. La variacin gentica se debe a la presencia de cambios genticos heredables (de una clula a sus clulas hijas), que adems son transmitidos a la siguiente generacin si afectan a la lnea germinal (pero no son transmitidos si solamente afectan a clulas somticas). Como es sabido, un gen localizado en un locus puede presentarse en formas diferentes debidas a variaciones en la secuencia. Cada forma alternativa se denomina alelo, y el porcentaje de ese alelo en la poblacin general se denomina frecuencia allica. Cuando un locus se presenta, al menos, en dos formas allicas y la frecuencia allica del alelo ms raro es del uno por ciento o mayor, ese locus se llama locus polimrfico, y esa variacin se denomina polimorfismo. La variacin inter-individual garantiza la adaptacin de una especie a condiciones ambientales cambiantes, a expensas de producir algunos individuos con mutaciones ms graves, que desencadenan una enfermedad. En humanos, la variacin entre individuos se genera principalmente durante el proceso de reproduccin sexual (por recombinacin meitica). Adems, durante la vida de un individuo se van introduciendo muchas nuevas mutaciones en el genoma de sus clulas, aunque slo un pequeo porcentaje de estos cambios afectan a las clulas germinales y quedan fijados en el genoma de la especie. La tasa de nuevas mutaciones es re-

www.FreeLibros.me

82

sultado del equilibrio entre mutacin y reparacin de las mutaciones. En efecto, en cada divisin celular se incorporan 6x109 nucletidos, y se estima que se producen unas 1017 divisiones celulares durante la vida media de un individuo: por tanto, un sistema sin errores debera tener una exactitud de 6x1026, lo que es virtualmente imposible. De hecho, se sabe que la ADN polimerasa produce un error cada 104 nucletidos incorporados, aunque est dotada de un sistema de edicin que mejora esta tasa hasta 107. Adems, los sistemas de deteccin y reparacin de errores consiguen que, al final, la replicacin del ADN celular slo origine un error cada 1010 nucletidos. De hecho, se estima que en una clula somtica aparecen unas 10-7 mutaciones por gen por divisin, es decir, una mutacin por cada 300 divisiones celulares (asumiendo un total de 30 000 genes). Esta es una tasa extremadamente baja (insuficiente para explicar todas las mutaciones que se producen en cncer, por ejemplo), lo que implica la existencia de sistemas celulares de reparacin del ADN que se ocupan de reparar la inmensa mayora de las mutaciones introducidas en el genoma, contribuyendo a mantener una fidelidad alta. Adems, muchas de estas mutaciones sern silenciosas porque no afectan a ADN codificante; otras, las ms dainas, sufrirn una fuerte presin selectiva y su frecuencia allica ser muy baja. Como se ve, la presencia de polimorfismos y mutaciones en las poblaciones humanas es resultado del juego entre mutacin-reparacin-seleccin.

Origen de la variacin gentica en humanos

6.2 Mecanismos de reparacin del ADN en humanos. 6.2 Enfermedades causadas por alteraciones 6.2 en los mecanismos de reparacin
A) Reparacin de desemparejamientos entre nucletidos normales
Los mecanismos de reparacin mencionados actan reparando tipos especficos de dao al ADN. Los desemparejamientos entre bases normales pueden originarse por la tautomera de las bases (la forma imina de Citosina empareja con Adenina, o la forma enlica de Timina empareja con Guanina), por desaminacin de citosinas metiladas (las citosinas metiladas de los dinucletidos CpG se desaminan a Timina), y principalmente por los errores de la ADN polimerasa durante la replicacin del ADN. Tambin se producen desemparejamientos durante la formacin de heteroduplexes en los procesos de recombinacin. Adems, el deslizamiento de la cadena nueva sobre la cadena molde durante la replicacin tambin puede producir bucles de insercin/delecin (IDLs). Todos estos tipos de desemparejamiento se corrigen por el sistema MMR (mismatch repair), cuyos componentes conocidos en humanos son hMLH1, hMSH2, hMSH3, hMSH6, hPMS1, hMLH3 y hPMS2 (homlogos de MutS y MutL de E. coli). Estas subunidades actan como heterodmeros hMSH2/hMSH6, que reconocen tanto los bucles (loops) de inserciones/deleciones de uno a ocho nucletidos como los desemparejamientos simples de una base; o bien actan como heterodmeros hMSH2/hMSH3, que reconoce slo bucles. Cada uno de estos dmeros, a su vez,

www.FreeLibros.me

acta junto con los homlogos de MutL, que son hMLH1/hPMS2 y hMLH1/hPMS1 (recientemente se ha descrito tambin hMLH1/hMLH3). En concreto, los heterodmeros hMSH2/hMSH6 junto con hMLH1/hPMS2 reparan los desemparejamientos simples, mientras que cualquiera de los dos complejos (hMSH2/hMSH3 o hMSH2/hMSH6) en combinacin con hMLH1/hPMS2 son capaces de reparar stem-loops (tallo-bucle) producidos por IDLs, como se muestra en la figura.
La Figura 6.1 muestra algunos ejemplos de desemparejamientos entre nucletidos normales y el funcionamiento del sistema de reparacin de desemparejamientos MMR.

83

Mecanismos de reparacin del ADN en humanos

En E. coli, este sistema acta unindose al desemparejamiento y a una base metilada adyacente, corta la cadena no metilada (recin sintetizada) hasta una distancia de 1-2 kb del mismatch, una endonucleasa corta los nucletidos contenidos en el asa, y la polimerasa rellena el hueco. En mamferos el mecanismo no est todava totalmente explicado, pero se ha encontrado una protena (MBD4 o MED1) que se une a metil-citosinas, tiene actividad N-glicosilasa y forma complejos con MLH1, adems de modular el sistema de MMR. Cuando hay defectos en este proceso de reparacin aparecen errores durante la replicacin del ADN, errores que se pueden ver al analizar secuencias repetidas cortas tipo microsatlite. Por tanto, los defectos en el sistema de reparacin de desemparejamientos dan lugar al fenmeno conocido como Inestabilidad de Microsatlites (MIN = Microstallite INstability) o fenotipo mutador. Se conocen algunas enfermedades debidas a mutaciones en componentes de estos sistemas de reparacin. Por ejemplo el 90 por ciento de los pacientes con cncer colo-rectal no-polipsico hereditario (HNPCC o Sndrome de Lynch) tienen mutaciones en uno de los genes hMSH2, hMLH1, hPMS1, hPMS2 o hMSH6, de forma que los individuos que han heredado una mutacin tienen una alta probabilidad de sufrir una segunda mutacin en el otro alelo en alguna de sus clulas somticas, por lo que el riesgo global de desarrollar este tipo de cncer es del 80-85 por ciento (o del 75 por ciento a los 55 aos) en estos sujetos. Estos tumores muestran inestabilidad de microsatlites, pero adems la inestabilidad tambin afecta a genes que tienen repeticiones en sus secuencias codificantes (BAX, TGFBRII). Son las mutaciones en estos genes las que a menudo llevan al desarrollo de neoplasias. Curiosamente, los pacientes homocigotos para mutaciones en MLH1 (dos mutaciones en la lnea germinal) desarrollan en la infancia neoplasias hematolgicas adems de otros tumores (neurofibromatosis, meduloblastoma), lo que sugiere la existencia de genes implicados en la hematopoyesis y en el control del crecimiento celular que son dianas del sistema MMR.

B) Reparacin de nucletidos daados


Otros sistemas detectan la presencia de bases anormales tales como, por ejemplo, los uracilos que aparecen por la des-aminacin de una citosina. En general, estas modificaciones estn debidas a la accin de mutgenos: benzopirenos del tabaco, agentes alquilantes, diversos agentes qumicos de la dieta, el dao causado por especies reactivas de oxgeno, as como las alteraciones debidas a la radiacin ultravioleta. Los procesos qumicos que con mayor frecuencia provocan mutaciones son 1) las

www.FreeLibros.me

84

oxidaciones por radicales libres, especialmente la formacin de 8-oxoguanina, que se empareja con T en vez de C (se calcula que se forman unas 10 000 al da en cada clula) y 2) las reacciones hidrolticas, ya que la molcula de ADN sufre una hidrlisis espontnea lenta que hace que se pierdan unas 10 000 purinas al da en un genoma humano, con la consiguiente creacin de otros tantos sitios apurnicos. Tambin la radiacin UV produce sitios apurnicos, pero sobre todo provoca dmeros de pirimidinas.
La Figura 6.2 muestra la estructura de algunos nucletidos anormales y la formacin de lesiones por accin de la luz ultravioleta.

Origen de la variacin gentica en humanos

En general, todas estas lesiones son graves, ya que impiden la replicacin correcta del ADN y, a la larga, llevan a la muerte celular. Podemos generalizar diciendo que las lesiones del ADN producidas por la presencia de nucletidos anormales se corrigen por cuatro mecanismos: reversin directa, BER (Base Excision Repair), NER (Nucleotide Excision Repair) o por polimerasas capaces de pasar por encima de la lesin.
Figura 6.3. Visin general de los mecanismos de reparacin de lesiones que incluyen nucletidos daados.

A continuacin se ve con ms detalle cada uno de estos mecanismos: 1. Al contrario que otras especies, la reversin directa por enzimas fotoreactivadoras no existe en humanos. Nuestro nico recurso en este sentido consiste en un enzima llamado MGMT (metil-guanina metil-transferasa), que puede eliminar el metilo introducido por agentes alquilantes en la guanina (el cual dara lugar a transiciones GA, pues la O6-metilguanina se empareja con Timina). La reparacin por escisin de bases (BER) elimina las bases que han sufrido ataques hidrolticos (des-aminacin, por ejemplo) por ROS o la 8-oxo-guanina producida por el tabaco. El paso crtico en este tipo de reparacin es la rotura del enlace N-glicosdico que une la base al esqueleto desoxi-ribosa-fosfato, catalizado por ADN glicosilasas (especficas para determinados tipos de lesin: UDG, OGG, etc.). Posteriormente, el sitio AP (apurnico o apirimidnico) es roto por una AP endonucleasa que cataliza la incisin del enlace fosfodiester en posicin 5 al sitio AP. La escisin del azcar se completa con la eliminacin del residuo desoxi-ribosa-fosfato por la accin de una desoxi-ribosa-fosfodiesterasa que corta el otro enlace fosfodister. Finalmente, se rellena el hueco mediante la accin de ADN pol y una ADN ligasa. Este mecanismo de reparacin parece necesario para la viabilidad, ya que el ratn knock-out para ADN pol es letal embrionario. Un proceso paralelo es crucial en la diversificacin de los genes de las inmunoglobulinas, ya que los linfocitos B expresan un enzima llamado AID (Activation-Induced Deaminase) que desamina citosinas y las convierte en uracilos; dichos uracilos crean sitios AP que pueden ser procesados por un complejo llamado RAD50

2.

www.FreeLibros.me

(que veremos ms adelante) cuya actividad liasa rompe el esqueleto desoxiribosa-fosfato y rompe el ADN. Dichas roturas son necesarias para que los genes de la inmunoglobulinas se reordenen y puedan dar lugar a la diversidad necesaria para una adecuada respuesta inmune.
El vdeo de la Figura 6.4 muestra el funcionamiento del sistema de reparacin por escisin de bases (BER).

85

Mecanismos de reparacin del ADN en humanos

3.

La reparacin por escisin de nucletidos (NER) elimina fotoproductos producidos por UV y otros aductos que confieren estructuras anormales a la cadena de ADN. El mecanismo de actuacin de este sistema de reparacin no est totalmente claro, pero se sabe que requiere la formacin de un complejo entre XPC (protena que es esencial para NER) y RPA (protena de unin a ADN monocatenario) con la regin lesionada. Sobre este foco tambin se unen XPA y el complejo TFIIH (que contiene, entre otras, las protenas XPB (ERCC3) y XPD (ERCC2), ambas con actividad helicasa necesaria para llevar a cabo NER). El paso clave es la creacin de dos incisiones, flanqueando la lesin, en la cadena de ADN que est daada: una incisin tiene lugar tres a nueve bases en direccin 3 de la lesin y la otra incisin se produce 16 a 25 bases en direccin 5 de la lesin, comprendiendo unas 25-30 bases en total. En mamferos, la incisin 3 la lleva a cabo una nucleasa llamada XPG, y la incisin 5 la realiza el heterodmero XPF/ERCC1. Tras las incisiones y eliminacin de la regin daada, tiene lugar la resntesis de esa regin mediante la accin de un holoenzima que contiene PCNA y DNApol o .

La Figura 6.5 incluye un video que muestra esquemticamente el funcionamiento del sistema de reparacin por escisin de nucletidos (NER).

3.

Un aspecto especialmente interesante es la relacin del NER con la transcripcin, a travs de la presencia de XPB y XPD en TFIIH (que es uno de los factores de transcripcin generales), dando lugar al concepto de Reparacin acoplada a la transcripcin (TCR = Transcription-Coupled Repair). De hecho, se ha comprobado que el dao por UV se repara con ms eficacia y ms rpido en la cadena que se transcribe y en genes transcripcionalmente activos. Tambin se ha visto que ciertos tipos de dao oxidativo pueden repararse por TCR incluso cuando el NER no funciona. Adems de los citados XPB y XPD, otras dos protenas con actividad helicasa (CSA y CSB) son responsables de TCR, y tambin se ha implicado a hMLH1 en TCR. Las mutaciones que destruyen el sistema TCR dan lugar a una enfermedad llamada Sndrome de Cockayne. Las mutaciones en genes que codifican otras protenas asociadas con NER dan lugar a varias enfermedades (Xeroderma pigmentosum, Tricotiodistrofia), que en su conjunto cursan con fotosensibilidad e inestabilidad cromosmica, y aumento del riesgo de aparicin de melanoma (un tipo de cncer de piel). Finalmente, algunos pacientes tienen una variante de Xeroderma Pigmentosum sin defectos en NER (llamada XP variante, o XP-V),

www.FreeLibros.me

86

que est debida a mutaciones en el gen humano homlogo del gen RAD30 de levadura. Este gen codifica la polimerasa eta (Pol), que puede replicar el ADN correctamente incluso en la presencia de dmeros de pirimidinas. 4. Respecto al ltimo mecanismo de reparacin de nucletidos daados (es decir, las polimerasas capaces de saltarse la lesin), recientemente se ha visto que Pol (polimerasa zeta) o Pol (polimerasa eta) son capaces de sintetizar ADN frente a dmeros TT. Sin embargo, as como Pol suele introducir dos Adeninas, Pol introduce bases incorrectas y por tanto es un mecanismo de reparacin de baja fidelidad.

Origen de la variacin gentica en humanos

C) Reparacin de roturas de la doble hebra del ADN


La creacin de roturas bicatenarias del ADN (DSB=Double-Strand Breaks) es un paso necesario para la recombinacin homloga en meiosis y mitosis, y para la reordenacin V(D)J de genes de las inmunoglobulinas y receptores de clulas T. Adems, este tipo de roturas aparecen durante la replicacin del ADN y tambin son causadas por diferentes agentes genotxicos: radiacin ionizante (rayos X), ROS originados por el metabolismo celular. Los DSB se reparan por dos vas principales, en diferentes fases del ciclo celular: Fusin no homloga de extremos (NHEJ), que funciona sobre todo en G1/S (antes de la replicacin del ADN) y Recombinacin homloga (HR), que tericamente actuara en S/G2, cuando ya hay dos cromtides hermanas (de manera que se utiliza la doble hebra homloga como molde para la reparacin).
La Figura 6.6 muestra las posibilidades de respuesta celular a la aparicin de roturas bicatenarias en el ADN (DSB) y sus efectos.

1.

1.

Recombinacin Homloga: como ya hemos comentado en el Captulo 2, la maquinaria responsable del mecanismo molecular de recombinacin meitica se utiliza tambin para reparar DSB a partir de una cromtide hermana. El mecanismo general es bien conocido, e incluye el procesamiento de los extremos mediante una exonucleasa 53 para dejar extensiones 3 libres, invasin de la doble hebra homloga por parte del filamento de ADN monocatenario recubierto de protenas, sntesis de nuevo ADN usando la cadena homloga como molde, ligacin y resolucin de la recombinacin. Da lugar a conversin gnica con o sin sobrecruzamiento, segn sea la resolucin de las estructuras de Holliday. RAD51 (homlogo del gen RecA, que en E. coli es fundamental en la respuesta SOS) forma filamentos sobre el extremo monocatenario de ADN que resulta de la digestin de los extremos libres, y es necesario para que se pueda realizar la invasin de la cadena libre a la doble cadena homloga. RAD51 es indetectable en G1 y se expresa en S/G2. Los ratones RAD51-/son letales embrionarios y sus clulas muestran inestabilidad cromosmica. Una lnea celular de pollo, en la que RAD51 est bajo el control de un promotor represible, muestra inestabilidad cromosmica y muerte celular cuan-

www.FreeLibros.me

1.

1.

1.

do se reprime la expresin de RAD51, lo que muestra la necesidad de este gen para la viabilidad celular. Hay otros genes implicados en reparacin de DSB que tienen cierta homologa con RAD51 y que podran modular la accin de ste. Por ejemplo, se ha visto que la ausencia del gen XRCC2 (20 por ciento de homologa con Rad51) disminuye la eficacia de la recombinacin homloga en la reparacin de DSB, pero no es letal; lo mismo podra suceder con RAD55 o RAD57. Por otra parte, se ha comprobado en levadura que la protena RPA altera la eficacia con la que se forman los filamentos de RAD51. RAD52 parece actuar como el portero del mecanismo de recombinacin homloga. Esta protena interacciona con RPA y con RAD51, favoreciendo la formacin del filamento de RAD51 en presencia de RPA. Como el ratn RAD52-/- no es letal (slo se observa una ligera disminucin en la eficacia de recombinacin homloga), se postula la existencia de genes homlogos de RAD52 que complementen la ausencia de ste. La expresin del complejo RAD50 no vara durante el ciclo celular, por lo que debe regularse post-traduccionalmente (mediante fosforilacin o por compartimentalizacin en el ncleo). Este complejo tiene actividad 53 exonucleasa, y parece transducir seales de dao de ADN hacia la parada del ciclo celular. Experimentos de irradiacin en bandas han mostrado, mediante anticuerpos monoclonales contra un componente de este complejo, que RAD50 se asocia a los DSB muy pronto tras la irradiacin. En humanos, los pacientes con el llamado Sndrome de Roturas de Nimega tienen mutaciones en un componente de este complejo llamado NBS1, muestran sensibilidad a radiacin ionizante e inestabilidad cromosmica, y las clulas de estos pacientes no son capaces de formar focos despus de la irradiacin con rayos X ultrablandos; por tanto, lo ms probable es que la protena NBS1 sea responsable de dirigir el complejo RAD50 a los lugares de dao del ADN. Una observacin muy interesante es la implicacin de BRCA1 y BRCA2 (genes mutados en ciertos tipos de cncer de mama familiar) con la reparacin de DSB, ya que se ha visto que las protenas codificadas por estos genes interaccionan con RAD51, bien directamente (BRCA2) o de manera indirecta (BRCA1). Ambas son protenas nucleares que se expresan en S/G2, funcionan como activadores transcripcionales, y los ratones knock out de ambas son letales embrionarios. En cambio, un ratn que lleva una copia de BRCA2 truncada (BRCA2tr/tr) sufre linfomas del timo, alta inestabilidad cromosmica y estimulacin de la va de sealizacin de p53. BRCA1 se fosforila tras dao al ADN, y se ha descrito la asociacin de BRCA1 con el complejo RAD50 en el momento del ciclo celular en que BRCA1 est fosforilado (S/G2). Por otra parte, en estudios de colocalizacin tras irradiacin similares a los descritos arriba, se ha visto que BRCA1 est presente en focos nucleares que contienen RAD50 en unas clulas o en focos que contienen RAD51 en otras clulas, pero no hay clulas en las que se asocie con ambos a la vez. Una hiptesis atractiva es que durante la reparacin de DSB por recombinacin homloga BRCA1 coopera con RAD50 en el procesamiento de los extremos del ADN daado y que, mediante la interaccin entre

87

Mecanismos de reparacin del ADN en humanos.

www.FreeLibros.me

88

BRCA1 y BRCA2 (que se asocia fsicamente a RAD51), facilita el acoplamiento con los procesos de recombinacin mediados por RAD51.
La Figura 6.7 ilustra la presencia de focos de reparacin en clulas que han sido previamente irradiadas para generar roturas bicatenarias (DSB) en el ADN.

Origen de la variacin gentica en humanos

2.

1.

Fusin no homloga de extremos (NHEJ): el proceso general de reparacin es similar pero sin recombinacin, ya que en este caso no existe una doble cadena homloga: simplemente se fusionan los extremos libres. Tras la generacin del DSB, los extremos libres tambin son procesados por una nucleasa; posteriormente se procede a la unin de los mismos y a la ligacin, perdindose siempre algunas bases en la regin de unin. Este mecanismo tiene lugar fisiolgicamente en linfocitos, donde es responsable de la reordenacin de segmentos V(D)J de los genes de inmunoglobulinas. Un componente principal de este sistema es el complejo ADN-PK (DNAPK), una serina/treonina kinasa nuclear que consta de una subunidad cataltica (DNAPKcs) y de un heterodmero de unin a ADN llamado KU (que a su vez se compone de KU70 y KU80). El complejo ADN-PK se asocia a los extremos rotos, ayuda al alineamiento de los extremos y facilita su ligacin. Este sistema de reparacin es importante, sobre todo en clulas del sistema inmune, y de hecho las mutaciones en el gen que codifica la DNAPKcs provocan la enfermedad llamada Inmunodeficiencia Combinada Severa (SCID). Adems, el complejo ADN-PK fosforila y activa una nucleasa llamada Artemis, que es la responsable de llevar a cabo el procesamiento de los extremos libres para que se puedan religar. Este ltimo paso, la unin de los extremos ya procesados, es realizado por una ligasa (ADN ligasa IV) que acta junto con XRCC4, una fosfoprotena nuclear que tambin es sustrato de ADN-PK in vitro.

El vdeo de la Figura 6.8 muestra, paso a paso, el funcionamiento del sistema de reparacin por fusin de extremos (NHEJ).

1.

1.

Es muy interesante la asociacin que se ha encontrado en levaduras entre Ku70 y protenas silenciadoras de la transcripcin de telmeros (Sir2, Sir3 y Sir4), sugiriendo la posibilidad de que Ku reclute protenas Sir a los DSB para inducir un estado de cromatina condensada que evite la transcripcin o replicacin y facilite el proceso de reparacin, o bien evite que los extremos libres de ADN puedan interaccionar con otras molculas de ADN. Dado que la disrupcin de Ku o del complejo RAD50 lleva al acortamiento de telmeros en levaduras, es lgico pensar que Ku se una al ADN telomrico e interaccione con Sir4 para inhibir la replicacin a ese nivel. Tradicionalmente se ha considerado que el principal mecanismo de reparacin de DSB en mamferos es la fusin de extremos (NHEJ), ya que se ha visto que la frecuencia de recombinacin homloga en mitosis es muy baja. Esto es lo contrario de lo que sucede en levaduras, donde el principal mecanismo de reparacin de DSBs es la recombinacin homloga. Actualmente, en cam-

www.FreeLibros.me

bio, esto est en discusin. Por un lado, parece que la recombinacin mittica en mamferos es ms alta de lo que se crea: del orden de 10-4 a 10-5; por otro lado, los ratones incapaces de llevar a cabo NHEJ (DNAPK -/-) no son letales, mientras que los ratones incapaces de recombinacin homloga (RAD51-/- o los RAD54-/-) s son letales. Esto indica que HR puede de alguna forma complementar la ausencia de NHEJ, pero en cambio NHEJ no puede complementar la ausencia de HR en clulas somticas.

89

Mecanismos de reparacin del ADN en humanos

D)

Mecanismos de reparacin presentes en mitocondrias

Un tema reciente en patologa gentica humana es la alteracin de los mecanismos de reparacin del ADN mitocondrial. Tradicionalmente se ha considerado que las mitocondrias de mamferos no son capaces de llevar a cabo ningn tipo de reparacin, ya que los dmeros de pirimidinas no son reparados con eficacia. Esto explicara adems la mayor tasa de mutaciones del ADN mitocondrial (ADNmt) respecto al ADN nuclear. Hoy se sabe que hay ciertos tipos de dao que s pueden repararse en mitocondrias (por ejemplo, los sitios AP originados por dao oxidativo) y en general parece que las mitocondrias de organismos superiores son capaces de llevar a cabo BER pero no NER ni MMR. El tipo de dao que puede repararse mediante BER va a estar limitado por la presencia de ADN glicosilasas en la mitocondria, y hasta el momento se ha demostrado la presencia de uracil-ADN-glicosilasa (UDG) y de 8oxo-guanina-glicosilasa (OGG). Adems, otras glicosilasas tienen seales de localizacin mitocondrial en sus extremos N-terminal. Una diferencia del BER que se lleva a cabo en mitocondrias con el BER nuclear es que la polimerasa presente en mitocondrias es la ADN pol , que adems posee actividad liasa (fosfodiesterasa). Tambin existe dentro de la mitocondria una actividad ADN ligasa, que se origina a partir del gen de la ADN ligasa III por un codn de iniciacin alternativo que crea una seal de localizacin mitocondrial.

www.FreeLibros.me

www.FreeLibros.me

C) La transmisin de los caracteres hereditarios

Esta seccin incluye seis temas en los que se tratan los aspectos fundamentales del mendelismo y sus principales excepciones, dando paso al estudio del ligamiento gentico, la gentica de caracteres cuantitativos y de las enfermedades multifactoriales, as como unas nociones de gentica de poblaciones y evolucin.

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 7

Gentica mendeliana

Contenidos
7.1 Planteamiento experimental de Mendel 7.2 Monohbridos: primera Ley de Mendel 7.3 Segunda ley de Mendel: dihbridos y trihbridos 7.4 Redescubrimiento del trabajo de Mendel 7.5 Dnde estn los factores unitarios? La teora cromosmica de la herencia

A finales del siglo XIX, las observaciones de Gregor Mendel sentaron las bases biolgicas de la herencia, dando lugar a lo que hoy conocemos como Gentica. Es muy importante estudiar el desarrollo histrico de las ideas en torno a la herencia, para poner en el contexto adecuado las ideas propuestas por Mendel y comprender la gran novedad que supusieron en su momento. Ya los antiguos haban observado que muchos caracteres pasan de padres a hijos, y se haban preguntado cmo podra ser esto. Hipcrates fue el primero en elaborar una teora, llamada pangnesis, segn la cual cada parte del cuerpo produce algn tipo de partcula que es recogida en lo que l denomin semen (hoy diramos gametos) y transmitida a la descendencia. La pangnesis fue criticada por Aristteles, que la desech por varias razones. En primer lugar, constat que en ocasiones unos individuos tienen rasgos ms parecidos a abuelos o ancestros remotos que a sus padres, lo que no encaja bien con el hecho de que la herencia se transmita nicamente de padres a hijos. Adems, tambin observ que a veces se transmiten caracteres que an no se poseen en el momento de tener descendencia (como la tendencia a tener canas o la calvicie, por ejemplo). Por otro lado, apunt el hecho fcilmente comprobable de que las mutilaciones en animales y plantas no se heredan. Esto es algo fundamental, porque Aristteles admita como hecho cierto la herencia de los caracteres adquiridos, algo universalmente aceptado hasta muchos siglos despus. Como la pangnesis no poda explicar estas discrepancias, el filsofo propuso que lo que se hereda no son los rasgos en s mismos, sino la potencialidad

www.FreeLibros.me

94

de producirlos. Hoy en da esto nos parece un concepto evidente, y se asemeja extraordinariamente a la idea de gen que actualmente tenemos, pero en su tiempo fue una propuesta revolucionaria a la que no se le dio toda la importancia que requera. No hay que olvidar que algunas nociones bsicas como la existencia de gametos, la meiosis o la reproduccin sexual eran totalmente desconocidas, por lo que era difcil formular teoras que explicasen la transmisin de caracteres a lo largo de generaciones sucesivas. Mendel no podra haber explicado sus resultados sin comprender un concepto bsico que hoy expresaramos diciendo que, tanto en animales como en plantas, un gameto masculino y un gameto femenino se unen para formar un cigoto. En este sentido, un avance fundamental fue la demostracin de que las plantas superiores tienen reproduccin sexual, siendo el polen el elemento masculino. Fue un botnico llamado Klreuter, un siglo antes de Mendel, el que elabor y sistematiz el trabajo sobre hbridos en plantas: modos de polinizacin, la obtencin de hbridos con caracteres intermedios entre los progenitores (aunque un pequeo porcentaje de la descendencia expresa un rasgo que slo se encuentra en uno de los progenitores), etc. Adems, pocos aos antes de Mendel ya se haba propuesto la idea de que un solo grano de polen es suficiente para fecundar una planta, aunque este concepto todava sera objeto de debate durante algn tiempo. En 1859, Charles Darwin publica El Origen de las especies, proponiendo la evolucin de las especies mediante un proceso de seleccin natural. Sin embargo, Darwin no pudo proponer una explicacin biolgica coherente porque no conoca las bases biolgicas de la variacin y de la herencia. Darwin aceptaba la pangnesis porque era la teora que mejor explicaba la herencia de caracteres adquiridos (lo cual le ayudaba a explicar la seleccin natural) y llam gmulas a las partculas somticas que un individuo transmite a su descendencia. En su libro The Variation in Animals and Plants under Domestication, de 1868, Darwin recoge las ideas ms prevalentes en ese momento, y reconoce la existencia de dos tipos de variacin: variacin continua (caracteres cuantitativos) y variacin discontinua (caracteres cualitativos). Sin embargo, consideraba que esta ltima era relativamente rara y no tena tanta importancia como la variacin continua, que poda modificarse mediante seleccin y por tanto era ms til para explicar el concepto de seleccin natural. Aunque parece que Darwin lleg a recibir una copia de los trabajos de Mendel publicados dos aos antes, nunca lleg a leerlos y por tanto no pudo comprender la importancia de la variacin discontinua.

Gentica mendeliana

7.1 Planteamiento experimental de Mendel


Gregor Mendel naci el 22 de julio de 1822 en Heinzendorf. Hijo de labradores, se hizo sacerdote agustino en 1847. En 1850 suspendi el examen que le permitira ensear ciencias naturales, por lo que se march a Viena a estudiar fsica, qumica, zoologa y botnica durante dos aos. En 1853 se traslada al monasterio de los agustinos en Brno (en lo que hoy es la repblica Checa) y all comienza a hacer sus experimentos con plantas. En 1865 presenta sus resultados y conclusiones en la reunin de la Sociedad de Historia Natural de Brno, que son publicadas un ao despus

www.FreeLibros.me

en las Actas de dicha Sociedad en un artculo que lleva el ttulo de Versuche ber Pflanzenhybriden (Experimentos sobre Hbridos de Plantas). En 1868 fue nombrado abad del monasterio, por lo que desde entonces no pudo dedicar tanto tiempo a sus experimentos. Muri el 6 de enero de 1884 a causa de una glomerulonefritis. Fruto de sus observaciones trabajando con hbridos de plantas, Mendel lleg al convencimiento de que el nico modo de comprender las bases biolgicas de la transmisin de caracteres hereditarios era mediante el estudio de variaciones discontinuas, es decir, aquellos caracteres que se presentan nicamente en dos formas alternativas. Como explica en su artculo, considera que es necesario: 1) determinar con exactitud el nmero de las diferentes formas que aparecen en la descendencia de los hbridos; 2) agrupar estas formas por separado en las distintas generaciones; 3) describir sus relaciones matemticas exactas. Por ejemplo, en el artculo original de 1866 dice ...Entre los numerosos experimentos hechos hasta el momento, ninguno ha sido realizado de manera que sea posible determinar el nmero de las diferentes formas en que aparecen los descendientes de hbridos, o agrupar estas formas con certeza segn generaciones separadas, o determinar exactamente sus relaciones estadsticas. Gracias a esta aproximacin metodolgica, que le supuso analizar unas 28 000 plantas, Mendel pudo observar que las proporciones obtenidas en la descendencia de las distintas clases de hbridos se mantenan y se repetan para varios caracteres distintos. Esto le permiti elaborar una teora que explicase cmo podran darse esas proporciones y llevar a cabo experimentos concretos que validasen las predicciones formuladas por dicha teora. Veamos con ms detalle la manera en que desarroll sus experimentos.

95

Monohbridos: primera Ley de Mendel

7.2 Monohbridos: primera Ley de Mendel


Mendel escogi la planta del guisante Pisum sativum (aunque haba cultivado y estudiado tambin otras especies) porque es fcilmente cultivable, tiene un ciclo corto y los cruzamientos son fciles de controlar. Seleccion siete caracteres que mostraban variacin claramente discontinua, es decir, representados cada uno por dos formas alternativas en lneas puras. Estas lneas puras eran el resultado de autofecundar plantas durante varias generaciones, hasta conseguir que esos caracteres se mantuviesen constantes. Los siete caracteres fueron:

Guisantes rugosos/lisos. Guisantes amarillos/verdes. Vainas en posicin axial/terminal. Vainas hinchadas/arrugadas. Vainas verdes/amarillas. Flores violetas/blancas (o la envuelta de la semilla gris/blanca, respectivamente). Tallo de la planta alto/enano.

La Figura 7.1 contiene enlaces a recursos educativos que ilustran los conceptos bsicos del mendelismo.

www.FreeLibros.me

96

En primer lugar, Mendel llev a cabo cruces monohbridos, es decir, para cada uno de los siete caracteres por separado cruz plantas que se comportaban como variedades puras. Observ que slo una de las dos formas alternativas estaba presente en el 100 por ciento de la F1 (la primera generacin filial), mientras que la otra forma haba desaparecido. Curiosamente, al autofecundar individuos de la F1, observ que esa forma desaparecida volva a aparecer en la F2. Lo ms importante, y esta fue la aportacin ms novedosa de Mendel, estableci las proporciones en que se daba cada una de las formas en cada generacin (en la F1 y en la F2). Por ejemplo, al analizar la forma del guisante, cruz la variedad pura que produca guisantes rugosos con la variedad pura que produca guisantes lisos. En la F1 todas las plantas producan guisantes lisos, pero al autofecundar estas plantas de la F1 observ que en la F2 resultante haba 5.474 guisantes lisos y 1.850 guisantes rugosos, lo que supone una relacin de 2,96:1 lisos frente a rugosos. Al repetir esto para los siete caracteres, observ que se repeta el mismo fenmeno, siendo las proporciones obtenidas muy parecidas y siempre en torno a una relacin 3:1, por lo que Mendel concluy que se trataba de un fenmeno general que deba tener una explicacin coherente. Mendel razon que estos datos numricos podran explicarse suponiendo que cada carcter est controlado por un factor que puede presentarse en dos formas alternativas. Por ejemplo, habra un factor responsable de la forma del guisante, con una forma que produce guisantes lisos y otra forma que produce guisantes rugosos. Adems, cada planta debera tener dos copias de ese factor, que podran ser idnticas o distintas (por ejemplo, podra haber plantas con dos copias de la forma que produce plantas rugosas, o con una copia de cada forma). En las variedades puras iniciales, cada planta tendra dos copias idnticas: las plantas con guisantes lisos tendran dos copias de la forma que produce guisantes lisos, las plantas con guisantes rugosos tendran dos copias de la forma que produce guisantes rugosos. Con estos presupuestos, si cada planta pasa a la descendencia slo una de sus copias, todas las plantas de la F1 tendran una copia de cada progenitor, por lo que todas tendran una copia del factor que produce guisantes lisos y otra copia del factor que produce guisantes rugosos. Ahora bien, si una de las formas domina sobre la otra, todas las plantas de esta generacin seran iguales (por ejemplo, si la forma que produce guisantes lisos domina sobre la forma que produce guisantes rugosos, todos los guisantes de la F1 seran lisos, como de hecho suceda). As pues, si estos factores se transmiten a la descendencia de forma totalmente aleatoria, la F2 resultante de autofecundar plantas de la F1 (que tienen dos copias distintas del factor), estara compuesta por 25 por ciento de plantas con las dos copias idnticas e iguales a las de una de las variedades puras iniciales, 25 por ciento de plantas con dos copias idnticas iguales a las de la otra variedad pura inicial, y el 50 por ciento de plantas con dos copias distintas (como las plantas de la F1). Como una copia domina sobre la otra, realmente veramos 75 por ciento de las plantas con la conformacin de una de las variedades inciales (la que estaba presente en la F1) y 25 por ciento de las plantas con la conformacin de la otra variedad inicial (la que haba desaparecido en la F1). Es decir, veramos una proporcin 3:1 tal y como Mendel haba encontrado experimentalmente. Como hemos visto, para que esta explicacin sea coherente han de darse varias condiciones que se han marcado en negrita en el prrafo anterior. Estas condiciones constituyen los tres principios que Mendel propuso que deban cumplirse para poder

Gentica mendeliana

www.FreeLibros.me

explicar las proporciones encontradas, y que a veces se agrupan en lo que se conoce como Primera Ley de Mendel: i) los factores que determinan la herencia se encuentran en dos formas alternativas y cada individuo lleva dos copias (idnticas o distintas), de las cuales slo una se transmite a la descendencia; ii) cada una de esas dos copias tiene la misma probabilidad de pasar a la descendencia, es decir, se transmiten de modo totalmente aleatorio; iii) una de las formas de cada factor domina sobre la otra, de modo que cuando las dos copias son distintas, el carcter se manifiesta como si las dos copias fuesen iguales para la forma dominante. Lgicamente, en la nomenclatura moderna podemos expresar estos conceptos de un modo mucho ms preciso, pero en la poca de Mendel esta nomenclatura todava no exista. Hoy podemos decir que los factores unitarios de los que hablaba Mendel son lo que llamamos genes; las formas distintas que puede presentar cada gen se llaman alelos (o formas allicas); la transmisin de uno de los dos alelos a la descendencia se conoce como segregacin; los distintos tipos de parejas que se pueden dar son los tres posibles genotipos (dos homocigotos y un heterocigoto). Por tanto, hoy diramos que un carcter fenotpico est controlado por un gen que se presenta en dos formas allicas alternativas, una dominante y otra recesiva. Las variedades puras iniciales son homocigotos para cada uno de los alelos, las plantas de la F1 son todas heterogicotos y slo manifiestan el carcter determinado por el alelo dominante; las plantas de la F2 son 25 por ciento homocigotos dominantes, 50 por ciento heterocigotos y 25 por ciento homocigotos recesivos (es decir, hay una relacin genotpica 1:2:1). Los homocigotos dominantes y los heterocigotos son fenotpicamente idnticos, por lo que encontraremos una relacin fenotpica 3:1 en la F2. Para expresar esto de un modo ms grfico, hoy en da usamos una letra para indicar cada forma allica y representamos los cruces de manera esquemtica. Por ejemplo, podemos designar el alelo que produce guisantes lisos como R y el alelo que produce guisantes rugosos como r, siendo R dominante sobre r. Las dos variedades puras iniciales seran homocigotos, RR en el caso de las que producen guisantes lisos y rr las que producen guisantes rugosos. El cruce inicial se puede representar como RR X rr. Si cada alelo segrega al azar, cada alelo R puede combinarse con un alelo r, pero en la descendencia (generacin F1) todas las plantas tendrn genotipo Rr. Como R es dominante, su fenotipo ser de guisantes lisos. Al cruzar plantas de la F1 entre s, tendremos cruces del tipo Rr X Rr. Ahora tenemos cuatro posibles combinaciones de alelos en la descendencia (RR, Rr, rR y rr), cada una de ellas con la misma probabilidad de producirse. Es decir, en la F2 tendremos 25 por ciento de plantas con genotipos RR, 25 % con genotipo Rr, 25 por ciento con genotipo rR y 25 por ciento con genotipo rr. Como los genotipos Rr y rR son iguales desde el punto de vista funcional (heterocigotos, da igual el orden), tendremos un 25 por ciento de homocigotos dominantes (RR), 50 por ciento de heterocigotos (Rr) y 25 por ciento de homocigotos recesivos (rr). Como R es dominante, los heterocigotos y los homocigotos RR son idnticos (todos producen guisantes lisos), y por tanto el 75 por ciento de las plantas producirn guisante lisos y el 25 por ciento rugosos. Es muy til utilizar mtodos grficos para representar los cruzamientos, porque eso simplifica el clculo de las proporciones genotpicas en la descendencia. El mtodo ms sencillo es quizs el de los cuadrados de Punnett (ideados por Reginald Punnett), que consisten en representar los alelos de un progenitor en horizontal y los

97

Monohbridos: primera Ley de Mendel

www.FreeLibros.me

98

del otro progenitor en vertical, formando unas cuadrculas que se rellenan con los genotipos resultantes.
Los enlaces de la Figura 7.2 ayudan a comprender grficamente las proporciones genotpicas y fenotpicas del cruce monohbrido.

Gentica mendeliana

Tambin se puede utilizar un mtodo ramificado, tanto para calcular los genotipos como los fenotipos. Por ejemplo, en un cruce del tipo Rr X Rr estableceramos la probabilidad de cada alelo de uno de los progenitores (1/2 R y 1/2 r, en este caso) y despus, para cada uno de ellos, establecemos la probabilidad de cada alelo del otro progenitor. Al tratarse de sucesos independientes, las probabilidades se multiplican para calcular la probabilidad de cada genotipo en la descendencia. As, en nuestro ejemplo, 1/2 R (del primer progenitor) puede combinarse por igual con cualquiera de los alelos del segundo progenitor (con 1/2 R o con 1/2 r). Por tanto, podramos representarlo esquemticamente de modo ramificado:
1

/2 R

/2 r

{ {

/2 R = 1/2 X 1/2 = 1/4 RR /2 r = 1/2 X 1/2 = 1/4 Rr

/2 R = 1/2 X 1/2 = 1/4 rR /2 v = 1/2 X 1/2 = 1/4 rr

Como Rr y rR son iguales, tenemos las proporciones genotpicas 1/4 RR, 1/2 Rr y /4 rr, o lo que es lo mismo 1:2:1. Impresiona bastante seguir el razonamiento de Mendel, cmo a partir de una simple proporcin fenotpica deduce los principios generales que la explican. De todas formas, esto no era ms que una hiptesis plausible, por lo que Mendel se propuso disear los experimentos que pudiesen confirmar las predicciones que se derivaban de su teora. Para ello hizo dos tios de experimentos. Por un lado, llev a cabo cruzamientos prueba, que es un tipo de retrocruzamiento (cruzar una planta con uno de sus progenitores). El cruzamiento prueba consiste en fecundar una planta de la F1 con el progenitor homocigoto recesivo, es decir, con la variedad pura cuyo fenotipo desapareca en la F1. Si los postulados son ciertos, este cruzamiento entre un heterocigoto y un homocigoto recesivo debera dar descendencia con 50 % de plantas heterocigotos y 50 % homocigotos recesivos. Siguiendo con el ejemplo de la forma del guisante, si r es el alelo recesivo y R el dominante, tendramos que todas las plantas de la F1 son Rr. Si hacemos el cruzamiento prueba con plantas rr, tendramos un cruce Rr X rr en el que el 50 % de la descendencia ser Rr y el 50 % ser rr: es decir, la mitad de los guisantes sern lisos (R domina sobre r) y la mitad rugosos. La otra comprobacin que hizo Mendel fue autofecundar plantas de la F2. Como hemos visto, 25 % de stas deberan ser RR (guisantes lisos), 50 % Rr (tambin lisos) y 25 % rr (rugosos). Al autofecundar plantas rugosas (rr), todos los guisantes resultantes deberan ser tambin rugosos. En cambio, de todas las plantas de la F2 con guisantes lisos un tercio deberan ser homocigotos y dos tercios heterocigotos. Por eso, al autofecundar plan1

www.FreeLibros.me

tas con guisantes lisos, un tercio de los cruces deberan ser RR X RR y dar descendencia con 100 % de guisantes lisos en la F3; dos tercios de los cruces deberan ser del tipo Rr X Rr y dar descendencia en las proporciones fenotpicas 3:1 tpicas de este cruce. Pues bien, en todos los casos Mendel encontr que las proporciones encontradas experimentalmente se ajustaban perfectamente a lo esperado, para todos los caracteres estudiados. Con esto, concluy que los principios propuestos eran correctos y explicaban la transmisin hereditaria de la variacin discontinua.

99

Segunda Ley de Mendel: dihbridos y trihbridos

ALTAS 3 :

ENANAS 1

{
50% Tt 25% TT Tt X Tt
50% Tt 3 25% TT : 25% tt

F2

25% tt

autofecundacin TT X TT 100% TT tt X tt 100% tt

F3

La Figura 7.3 ilustra las pruebas utilizadas para confirmar la validez de los postulados de la primera Ley de Mendel.

7.3 Segunda Ley de Mendel: dihbridos y trihbridos


No contento con lo que haba encontrado al analizar cada uno de los caracteres por separado, Mendel se pregunt qu sucedera al estudiarlos conjuntamente. En primer lugar llev a cabo cruces dihbridos, es decir, entre plantas que se comportaban como variedades puras para dos caracteres distintos a la vez. Por ejemplo, estudi el color y la forma del guisante, obteniendo plantas con guisantes amarillos y lisos simultneamente, y plantas con guisantes verdes y rugosos. Estas plantas podan considerarse variedades puras para ambos caracteres, porque siempre se daban esas mismas combinaciones de forma y color. Al cruzar plantas de ambas variedades puras, Mendel observ que en la F1 todos los guisantes eran iguales: amarillos y lisos a la vez; es decir, manifestaban los dos caracteres dominantes. La autofecundacin de

www.FreeLibros.me

{
1

100

estas plantas de la F1 dio como resultado una F2 con proporciones de 9/16 de dobles dominantes (amarillos/lisos), 3/16 para cada una de las dos combinaciones de un dominante con un recesivo (3/16 amarillos/rugosos y 3/16 verdes/lisos) y 1/16 de dobles recesivos (verdes/rugosos). Al analizar estos resultados, Mendel se dio cuenta de que ste sera precisamente el resultado esperado si consideramos el cruce dihbrido como dos cruces monohbridos independientes. En estas circunstancias, cada planta de la F1 producira cuatro posibles tipos de gametos: si denominamos R/r a los alelos liso/rugoso y V/v a los alelos amarillo/verde, las plantas de la F1 (con guisantes amarillos y lisos) seran heterocigotos para ambos caracteres, con genotipo VvRr. Por tanto, cada una de estas plantas puede transmitir cuatro posibles combinaciones allicas: VR, Vr, vR y vr. De este modo, al cruzar dos plantas de la F1 tendramos 16 posibles tipos de cruces: VR X VR VR X Vr VR X vR VR X vr Vr X VR Vr X Vr Vr X vR Vr X vr vR X VR vR X Vr vR X vR vR X vr vr X VR vr X Vr vr X vR vr X vr

Gentica mendeliana

Podemos calcular fcilmente los genotipos resultantes de cada cruce usando cuadrados de Punnett o con el mtodo ramificado genotpico (VR X VR tendr descendencia con genotipo VVRR, etc.). Como algunos cruces son idnticos (por ejemplo, los dos que estn en negrita), podemos agrupar los genotipos resultantes y obtenemos nueve posibles genotipos distintos en la descendencia, en las siguientes proporciones: 1/16 VVRR, 2/16 VVRr, 2/16 VvRR, 4/16 VvRr, 1/16 VVrr, 2/16 Vvrr, 1/16 vvRR, 2/16 vvRr y 1/16 vvrr. Debido a la dominancia del liso y del amarillo, estos nueve genotipos dan lugar solamente a cuatro fenotipos en las siguientes proporciones: 9/16 amarillos/lisos, 3/16 amarillos/rugosos, 3/16 verdes/lisos y 1/16 verdes/rugosos. Esto lo vemos muy bien usando el mtodo ramificado fenotpico: si la probabilidad de amarillos:verdes en la F2 es de 3:1, observaremos 3/4 amarillos y 1/4 verdes. Ahora bien, si de cada uno de estos hay 3/4 lisos y 1/4 rugosos, al final las probabilidades de cada fenotipo se pueden calcular:
1

/4 amarillos

/4 verdes

{ {

/4 lisos = 9/16 amarillos y lisos /4 rugosos = 3/16 amarillos y rugosos /4 lisos = 3/16 verdes y lisos /4 rugosos = 1/16 verdes y rugosos

1 3

Pues bien, stas fueron precisamente las proporciones que Mendel encontr al realizar estos cruces, la proporcin fenotpica 9:3:3:1 de dobles dominantes : dominante/recesivo : recesivo/dominante : doble recesivo. Dado que sus resultados se ajustaban al modelo terico, Mendel formul su cuarto principio tambin conocido hoy como la Segunda Ley que establece que las parejas de factores segregan no slo al azar, sino adems de manera independiente para caracteres distintos.
La Figura 7.4 contiene un enlace que ayuda a comprender los cruces dihbridos.

www.FreeLibros.me

Mendel tambin quiso comprobar este postulado realizando cruzamientos prueba de las plantas de la F2 con el progenitor doble homocigoto recesivo. Por ejemplo, los 9 /16 de plantas con guisantes amarillos y lisos de la F2 son el resultado de sumar todas las plantas con cuatro genotipos distintos: VVRR (1/16), VVRr (2/16), VvRR (2/16) y VvRr (4/16). Es decir, de todas las plantas de la F2 con guisantes amarillos y lisos, 1/9 sern VVRR, 2/9 sern VVRr, 2/9 sern VvRR y 4/9 sern VvRr. Cmo saber los genotipos de estas plantas? Al igual que en el monohibridismo, mediante los cruzamientos prueba de cada una de ellas con una variedad pura doble homocigota recesiva (vvrr). Mendel predijo cmo debera ser la descendencia resultante de cada uno de estos cruces. Por ejemplo, al cruzarse los dobles homocigotos dominantes de la F2 (VVRR) con una planta vvrr darn un 100 por ciento de descendencia de tipo doble heterocigoto VvRr y por tanto con fenotipo amarillo y liso. Las plantas con genotipo VVRr en la F2 darn, en cambio, dos tipos posible de gametos (VR y Vr), por lo que el cruce prueba VVRr X vvrr dar como resultado un 50 por ciento de plantas VvRr y un 50 por ciento de plantas Vvrr (o, lo que es lo mismo, 50 por ciento con guisantes amarillos y lisos y 50 por ciento con guisantes amarillos y rugosos). Lo mismo puede hacerse para los otros dos cruzamientos prueba, los de plantas VvRR y VvRr y calcular las proporciones fenotpicas esperadas en la descendencia. Pues bien, cuando Mendel hizo todos estos cruces de prueba, comprob que los resultados obtenidos coincidan con las predicciones de su modelo, por lo que concluy que este cuarto postulado era tambin cierto. Mendel todava fue ms lejos y demostr que estos principios se cumplan tambin al cruzar plantas que se comportaban como variedades puras para tres factores a la vez (cruce trihbrido). El cruce de una variedad pura triple dominante con otra triple recesiva dar como resultado 100 por ciento de triples heterocigotos en la F1 (todos manifiestan los tres fenotipos dominantes). Para calcular la descendencia resultante de la autofecundacin de stos, hay que tener en cuenta que cada planta producir ocho tipos posibles de gametos. Por ejemplo, para tres genes A, B y C con alelos dominante (mayscula) o recesivo (minscula), cada triple heterocigoto (AaBbCc) dar lugar a gametos del tipo ABC, ABc, AbC, Abc, aBC, aBc, abC, o abc. Si hacemos un cuadrado de Punnett para calcular los genotipos resultantes y sus proporciones, vemos que el cruce AaBbCc X AaBbCc origina 64 combinaciones diferentes. Usando el mtodo ramificado genotpico o fenotpico, vemos que todas estas posibles combinaciones se pueden agrupar en 27 genotipos distintos, que dan lugar a ocho fenotipos diferentes en proporciones 27:9:9:9:3:3:3:1. Una vez ms, lo que Mendel encontr se corresponda exactamente con lo que debera suceder de acuerdo con sus postulados.
La Figura 7.5 muestra el diagrama ramificado genotpico de un cruzamiento trihbrido.

101

Segunda Ley de Mendel: dihbridos y trihbridos

Lgicamente, es fcil darse cuenta de que la interpretacin de los resultados aumenta notablemente al estudiar varios caracteres a la vez, ya que las posibles combinaciones de genotipos (y, por tanto, de fenotipos) son mayores. En cualquier caso, hay una regla sencilla para calcular el nmero de posibles gametos, genotipos y fenotipos que se pueden generar al estudiar cualquier nmero de genes simultneamente. Si n es el nmero de caracteres distintos que estudiamos, cada uno de ellos

www.FreeLibros.me

102

controlado por un gen con dos alelos, el nmero de gametos posible ser 2n, el nmero de posibles genotipos es 3n, y el nmero de posibles fenotipos es tambin 2n. As, para tres genes tendramos ocho gametos posibles que originan 64 combinaciones agrupadas en 27 genotipos y ocho fenotipos distintos.

Gentica mendeliana

7.4 Redescubrimiento del trabajo de Mendel


Como hemos visto, Mendel comenz sus experimentos en 1856, ley los resultados en la reunin de la Sociedad de Historia Natural de Brno en 1865, y el trabajo fue publicado el ao siguiente. En el perodo que transcurre entre 1866 y el 1900, la figura ms influyente fue sin duda August Weismann, un discpulo de Darwin. En primer lugar, Weismann crea que la pangnesis no era correcta, y dise experimentos para probarlo. Por ejemplo, cort la cola de ratones durante 22 generaciones sucesivas, comprobando que el tamao de la cola no disminua al nacer. Adems, teniendo en cuenta los avances cientficos de esos aos, Weismann reconoci la existencia de clulas germinales, la importancia del ncleo y la existencia de cromosomas. Su gran contribucin fue la elaboracin de la teora del germoplasma como material hereditario. Frente a la creencia en las gmulas de origen somtico, Weismann propuso que la herencia se transmite nicamente a travs de las clulas germinales y que las unidades hereditarias residen en los cromosomas. Lgicamente, esas ideas eran bastante tericas y no tenan comprobacin experimental, pero prepararon el camino para que a principios del siglo XX pudiesen comprenderse los trabajos de Mendel. Se sabe que del artculo original de Mendel se imprimieron 40 copias, aunque slo hay constancia de tres que fueron enviadas a sus maestros y colegas. De todas formas, la Sociedad de Historia Natural de Brno enviaba sus Actas a unas 130 bibliotecas de toda Europa y Amrica, por lo que sus hallazgos tuvieron una difusin adecuada. Sin embargo, llama la atencin que durante aos nunca fuesen citados, probablemente porque no fueron comprendidos del todo. La clave para que se prestase atencin al trabajo original de Mendel fue una referencia de Focke en 1881, que en una revisin de la literatura sobre hibridaciones en plantas cita el artculo de Mendel (bajo el epgrafe Pisum) y dice que Mendel crey haber encontrado relaciones numricas constantes. Esta frase llam la atencin de Karl Correns, que haba llegado independientemente a las conclusiones mendelianas en 1899 haciendo hibridaciones en varias especies. Al leer la alusin de Focke a las relaciones numricas constantes, Correns cit el trabajo original de Mendel y fue probablemente el primero en comprender su verdadero alcance. Al mismo tiempo, en el ao 1900, Hugo de Vries public tres artculos en los que tambin llegaba a conclusiones parecidas, encontrando la relacin 3:1 en varias especies distintas. En uno de esos trabajos se cita tambin el artculo de Mendel (aunque no se citaba en la versin original francesa, se cita en la versin posterior en alemn: parece que de Vries no haba tenido noticia del trabajo de Mendel, pero incluy la referencia al saber que Correns lo citaba en su artculo). Tshermak tambin public dos artculos en 1900 llegando a conclusiones mendelianas, pero con resultados ms limitados que los dos anteriores. William Bateson era un zologo de Cambridge que ya en 1894 era consciente de la importancia de estudiar la variacin discontinua con una aproximacin ms ma-

www.FreeLibros.me

temtica. En mayo de 1900 dio una conferencia en la Royal Horticultural Society en Londres, describiendo los resultados de Mendel y su confirmacin por De Vries, y se convirti en el defensor ms entusiasta del mendelismo. Junto a Reginald Punnett fue desarrollando los principios de la herencia segn las leyes mendelianas. Poco a poco los principios de Mendel se fueron confirmando en otras plantas y en animales, y as se fue introduciendo y fijando la nomenclatura que utilizamos hoy en da. Por ejemplo, Bateson acu el trmino gentica (del griego genetikos) al usarlo por vez primera en una carta del 18 de abril de 1905, dirigida a Adam Sedgewick. Tambin invent los trminos homocigoto, heterocigoto o alelomorfo (hoy reemplazado por alelo). Johannsen, otro botnico del que hablaremos ms adelante, introdujo en 1909 los trminos gen, genotipo y fenotipo.

103

Dnde estn los factores unitarios? La teora cromosmica de la herencia

7.5 Dnde estn los factores unitarios? La teora 7.5 cromosmica de la herencia
La aceptacin de las leyes de Mendel a principios del siglo XX supuso que se iniciara la bsqueda de las bases celulares de la herencia, es decir, dnde residen los factores que controlan los caracteres hereditarios, cul es la naturaleza de los distintos alelos, en qu estructuras se transmiten de una generacin a la siguiente, etc. Hacia el ao 1900, los conocimientos de Citologa en plantas y animales permitan aventurar alguna hiptesis al respecto. Por ejemplo, se saba que el ncleo de las clulas contiene una sustancia (cromatina) que se condensa en forma de cromosomas. Se aceptaba que cada especie tiene un nmero fijo de cromosomas, definido por el nmero de cromosomas presente en los gametos, y que en especies de reproduccin sexual los gametos tienen una copia de cada cromosoma, mientras que las clulas somticas tienen dos copias. Tambin se haba observado (al menos en plantas) que la reduccin en el nmero de cromosomas se produce en las ltimas fases de la formacin de los gametos. En esos primeros aos del siglo, por tanto, era generalmente aceptado que el material hereditario resida en los cromosomas, aunque la naturaleza amorfa y esttica de la cromatina no permita explicar cmo podra ser esto. De hecho, algunas cuestiones citolgicas que entonces se crean ciertas distaban mucho de la realidad. Por ejemplo, exista la creencia general de que los cromosomas formaban un largo filamento continuo (el espirema) que se divida transversalmente al final de la interfase, de modo que todos los cromosomas eran esencialmente iguales unos a otros excepto por su tamao. Aunque tambin se haba observado la meiosis, se pensaba que en la divisin reductora los cromosomas se dividan transversalmente, estando unidos por los extremos. En general, la mecnica de estos procesos no estaba clara y esta falta de detalle no permita establecer las bases citolgicas de los principios mendelianos de transmisin de la herencia. Aunque ya Correns y Cannon haban propuesto en los primeros aos del siglo XX la hiptesis de que los genes (los factores de Mendel) residen en los cromosomas, sus modelos eran poco claros. El citlogo que dio mayor impulso a este campo fue sin duda Theodor Bovery, que en 1902 lleg a la conclusin de que los cromosomas no son equivalentes, sino que son distintos unos de otros y todos son necesarios para dar lugar a un embrin

www.FreeLibros.me

104

viable. En sus estudios con embriones monosprmicos y polisprmicos de erizo de mar, pudo observar formas anormales de desarrollo embrionario cuando el nmero de cromosomas no era el adecuado. Adems, esto le llev a formular la teora cromosmica del cncer, que tanta influencia tendra en aos posteriores. Pero la mayor evidencia experimental de que los procesos citolgicos permitan explicar las leyes de Mendel la produjo Walter Sutton en 1902. Sutton era un estudiante de Medicina que dedic sus primeros aos a estudiar cromosomas de clulas somticas de saltamontes, demostrando irrefutablemente por primera vez que los cromosomas se presentan en pares homlogos en las clulas somticas y que los gametos tienen una sola copia, procedente de uno de los progenitores. En un trabajo de 1903 (The chromosomes in heredity) elabora ms esta teora mostrando que distintos pares cromosmicos se orientan al azar en el huso meitico, y as sugiri que la divisin reduccional no era transversal sino longitudinal. Todos estos procesos permitan explicar perfectamente lo que Mendel haba propuesto: la segregacin al azar de factores que estn en parejas, de las que slo una copia pasa a la descendencia. De hecho, Sutton escribi en uno de sus trabajos: I may finally call attention to the probability that the association of paternal and maternal chromosomes in pairs and their subsequent separation during the reducing division may constitute the physical basis of the Mendelian law of heredity. A pesar de la clarividencia de sus afirmaciones y de su evidente inters por la ciencia, Sutton no termin su doctorado, sino que se hizo mdico y se dedic a la ciruga. En cualquier caso, su contribucin permiti explicar la base fsica de la herencia y el comportamiento de los factores mendelianos, dando lugar a la teora cromosmica de la herencia. De todas formas, no todos aceptaban fcilmente que los factores mendelianos viajasen en los cromosomas. La demostracin formal no llegara hasta aos ms tarde gracias al trabajo de Morgan, Sturtevant, Muller y Bridges en la mosca Drosophila melanogaster. Durante aos, estos genetistas fueron estableciendo la posicin de los genes responsables de distintos caracteres en los cromosomas de la mosca. Vieron que algunos caracteres se comportaban como si viajasen juntos, porque no segregaban al azar, y llamaron a este fenmeno ligamiento. Establecieron as varios grupos de ligamiento y demostraron que coincidan con los tres pares de autosomas que tiene la Drosophila, es decir, que los genes se localizan en los cromosomas y se agrupan de modo lineal. En 1916 publicaron The Mechanism of Mendelian Heredity, que se convierti en el primer tratado detallado de las leyes mendelianas, sus excepciones y sus bases citolgicas. Aun as, la aceptacin no fue unnime, y mendelistas tan brillantes como Bateson mostraban sus reservas. Por ejemplo, en una revisin sobre The Mechanism of Mendelian Heredity que hace el propio Bateson en 1916, dice: it is inconceivable that particles of chromatin or of any other substance, however complex, can possess those powers which must be assigned to our factors The supposition that particles of chromatin, indistinguisable from each other and indeed almost homogeneous under any known test, can by their material nature confer all the properties of life surpasses the range of even the most convinced materialism. Evidentemente, en aquellos aos no se conoca la naturaleza qumica de la cromatina y era impensable que pudiese estar compuesta por una molcula como el ADN, tan simple en su estructura pero tan rica en su capacidad codificante y en sus funciones.

Gentica mendeliana

www.FreeLibros.me

En cualquier caso, hacia 1920 la citologa y la gentica se haban encontrado definitivamente. El mendelismo poda ya explicarse sobre la base de la teora cromosmica, es decir: i) los dos alelos de cada gen se localizan en la misma posicin (locus) en cromosomas homlogos, y segregan al azar a los gametos gracias a la separacin de los cromosomas durante la meiosis; ii) genes distintos segregan de manera independiente (4 postulado de Mendel) porque se localizan en cromosomas distintos. Adems, estos conceptos se fueron ampliando progresivamente con las nociones de recombinacin e intercambio de material gentico entre cromosomas homlogos, ligamiento, etc.

105

Dnde estn los factores unitarios? La teora cromosmica de la herencia

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 8

Herencia relacionada con el sexo

Contenidos
8.1 Cada sexo tiene distinta constitucin cromosmica 8.2 Los genes situados en el cromosoma X muestran un modo especial de herencia 8.3 Determinacin gentica del sexo en humanos 8.4 Compensacin de dosis: hiptesis de Lyon 8.5 Estructura de los cromosomas sexuales humanos

8.1 Cada sexo tiene distinta constitucin cromosmica


En 1891, Hermann Henking describi un corpsculo en el ncleo de las clulas de insectos machos de la especie Pyrrhocoris (un tipo de chinche). Dicho corpsculo se formaba durante la meiosis, y Henking lo denomin cuerpo X por su naturaleza desconocida. Cuando se observ la meiosis con detenimiento, se comprob que 22 de los 23 cromosomas de esta especie se emparejaban durante la meiosis para formar 11 parejas, pero otro cromosoma quedaba condensado y daba lugar al cuerpo X en uno de los polos en algunas clulas. Al reconocerse que se trataba de un cromosoma, dicho corpsculo pas a llamarse cromosoma X. A principios del siglo XX, en 1905, Edmund B. Wilson y una de sus estudiantes de doctorado, Nettie M. Stevens, comprobaron que el nmero de cromosomas X difiere entre machos y hembras. Estudiando insectos del gnero Protenor (saltamontes) y el Lygaeus turicus, observaron que cada sexo tiene configuraciones cromosmicas distintas, y llegaron a la conclusin de que el sexo est determinado por el nmero de cromosomas X presentes en las clulas. En Protenor comprobaron que las hembras tienen dos ejemplares de este cromosoma (XX) y en cambio los machos slo tienen uno (XO). A este tipo de de-

www.FreeLibros.me

108

terminacin cromosmica del sexo le llamaron modo XX/XO. En Lygaeus, en cambio, vieron que la situacin era ligeramente distinta, ya que las hembras son XX y los machos tienen adems de un cromosoma X otro cromosoma ms pequeo llamado cromosoma Y. A este tipo de configuracin le llamaron modo XX/XY. Estas observaciones pusieron de manifiesto el hecho fundamental de que uno de los sexos produce dos clases distintas de gametos: con o sin cromosoma X en el caso del modo Protenor; con cromosoma X o con cromosoma Y, en el modo Lygaeus. Al sexo que produce gametos distintos se le llama, por tanto, sexo heterogamtico. Aunque lo ms habitual es que el sexo heterogamtico sea el masculino, como en la especie humana, esto no siempre es as. Por ejemplo, en muchas especies de aves el sexo heterogamtico es el femenino, y siguen un modo distinto de determinacin cromosmica del sexo, que se llama ZZ/ZW. En humanos se sigue el modo XX/XY, mientras que en la mosca Drosophila melanogaster, a pesar de que tiene un cromosoma Y, se sigue el modo XX/XO.

Herencia relacionada con el sexo

8.2 Los genes situados en el cromosoma X muestran un modo 8.2 especial de herencia
Como hemos visto, en el laboratorio de Tomas H. Morgan, conocido como la Fly Room (Habitacin de las Moscas), se establecieron los principios del mendelismo estudiando diversos caracteres y mutaciones en Drosophila. Morgan observ en 1910 que en el caso de la mutacin white del ojo de Drosophila a veces no se cumplan las proporciones mendelianas esperadas. Observ que el patrn de herencia de esta mutacin dependa del sexo del progenitor que transmita la mutacin. As, el cruce entre un mutante white macho y una hembra silvestre daba una F1 con 100 por cien de ojos silvestres (rojo ladrillo) y una F2 con la proporcin 3:1 (rojo:blanco), que sera la proporcin esperada si el alelo silvestre (rojo) es dominante sobre el mutante white. En cambio, el cruce recproco, en el que la mutacin white estaba en el progenitor hembra, daba una F1 con una proporcin 1:1 en la que todos los machos tenan ojos blancos. Adems, esta misma proporcin se repeta en la F2, teniendo el 50 por ciento de los machos ojos blancos. Basndose en la teora cromosmica de la herencia de Sutton y Boveri y, sobre todo, en la hiptesis propuesta por Stevens y Wilson pocos aos antes, Morgan concluy que el gen de esta mutacin (el locus white) estaba localizado en el cromosoma X de Drosophila. Si esto era cierto, las hembras llevaran dos copias del gen y slo manifiestaran el fenotipo cuando ambos alelos estn mutados (es decir, la mutacin sera recesiva y slo se manifestara en homocigosis). Los machos, en cambio, slo llevan un cromosoma X; esta situacin se describe como hemicigosis (un solo alelo, en vez de los dos que suele ser habitual en genes autosmicos), y por eso se dice que los machos son hemicigotos para todos los genes del cromosoma X. En estas circunstancias, los machos siempre manifestarn el fenotipo aunque sea recesivo, ya que el nico alelo que tienen es el alelo mutante.

www.FreeLibros.me

La Figura 8.1 ilustra los cruces entre moscas con ojos de color silvestre (rojo ladrillo) y moscas con la mutacin white (ojos blancos). Tambin se muestra un ejemplo de herencia ligada al cromosoma X en humanos.

109

Determinacin gentica del sexo en humanos

Este hallazgo constituy el primer ejemplo de ligamiento de un carcter a un cromosoma concreto, y adems fue decisivo para respaldar la teora cromosmica de la herencia. Todos los caracteres controlados por genes situados en el cromosoma X siguen este tipo de herencia, que pas a llamarse ligada al sexo. Sin embargo, un nombre ms adecuado es el de ligada al cromosoma X, ya que hay caracteres cuya herencia est influida por el sexo sin estar controlados por genes situados en ninguno de los cromosomas sexuales. Por ejemplo, existen rasgos controlados por genes autosmicos que slo se expresan en un sexo por razones hormonales. Dichos caracteres, influidos o limitados por el sexo, pueden confundirse a veces con caracteres ligados al cromosoma X. Aunque la herencia ligada al X puede ser de tipo recesivo o dominante, lo ms frecuente es la de tipo recesivo, que se caracteriza porque slo los individuos hemicigotos (XY) manifiestan el fenotipo recesivo, ya que las hembras (XX) son habitualmente heterocigotos. Como veremos ms adelante, la herencia ligada al X recesiva es muy importante en Gentica Humana, y tiene unas caractersticas que permiten reconocerla y proporcionar un consejo gentico muy valioso.

8.3 Determinacin gentica del sexo en humanos


El hallazgo de que el sexo est determinado por el tipo de cromosomas sexuales que se heredan puso en marcha la bsqueda de los mecanismos por los que estos cromosomas influyen en la determinacin del sexo. Estos mecanismos se fueron conociendo gracias a los trabajos de Calvin Bridges, un discpulo de Morgan. Bridges demostr que el sexo de Drosophila viene determinado por el nmero total de cromosomas X que estn presentes, o ms exactamente por el cociente entre el nmero de cromosomas X y el nmero de autosomas. Esta especie tiene tres pares de autosomas y un par de cromosomas sexuales, por lo que habitualmente el cociente X/autosomas de las moscas hembra es igual a 1 (dos copias del cromosoma X y dos copias de cada autosoma) y el de los machos es igual a 0,5 (un cromosoma X y dos copias de cada autosoma). Sin embargo, Bridges estudi el sexo de moscas con diferentes composiciones cromosmicas y encontr que las moscas XXY son hembras normales (cociente = 1), mientras que las moscas XO son machos estriles (cociente = 0,5). Esto le llev a concluir que el cromosoma Y en Drosophila no tiene genes necesarios para la determinacin del sexo masculino, pero s genes necesarios para la fertilidad de los machos. Esta misma conclusin se confirmaba al estudiar la progenie de moscas con tres cromosomas X y con un nmero variable de autosomas. Bridges observ que un cociente X/autosomas = 1 produce hembras normales y frtiles; un cociente >1 produce metahembras infrtiles; un cociente = 0,5 corresponde a machos; un cociente = 0,33 produce metamachos infrtiles. Otros cocientes intermedios producen moscas con genitales ambiguos y estriles, denominados intersex. Por tanto, la conclusin fue que los genes que de-

www.FreeLibros.me

110

terminan el sexo en Drosophila estn en los autosomas, pero el cromosoma X debe tener algn gen necesario para determinar el sexo femenino cuando est en doble dosis gnica. Aunque no es el momento de explicar a fondo el proceso gentico de determinacin del sexo en Drosophila, nos sirve para introducir esta cuestin en relacin con nuestra propia especie. En mamferos, la determinacin del sexo tiene su origen embriolgico en la diferenciacin de la gnada primitiva, bien hacia la gnada femenina (ovario) o hacia la gnada masculina (testculo). En el caso de que se inicie la va de diferenciacin testicular, este rgano comienza a producir Sustancia Inhibitoria Mlleriana (en las clulas de Sertoli) y andrgenos (en las clulas de Leydig), que determinan el desarrollo de los caracteres sexuales secundarios. Lo fundamental, por tanto, es la diferenciacin inicial de la gnada primitiva en los primeros momentos del desarrollo embrionario. Desde que se conoci la implicacin del cromosoma Y en la determinacin del sexo por el modo XX/XY, se postul que el cromosoma Y deba contener algn factor necesario para la diferenciacin de la gnada primitiva hacia testculo, y se denomin TDF (testis-determining factor) a ese hipottico factor cuya identidad permaneci oculta durante aos. Posteriormente se descubri ZFY (Zincfinger on the Y), un gen del cromosoma Y que codifica un factor de transcripcin del tipo dedo de zinc, y se pens que poda ser el buscado TDF. Sin embargo, la bsqueda del gen responsable del desarrollo sexual masculino concluy en 1993, al comprobarse que ratones hembras en los que se haba insertado en uno de los cromosomas X una copia de un gen llamado Sry (localizado en el cromosoma Y) eran fenotpicamente machos. SRY (Sex-determining Region on the Y) es el gen iniciador de una cascada en la que tambin participan otros genes del cromosoma Y junto con otros genes localizados en autosomas. Bsicamente, el proceso comienza cuando la cresta genital es poblada por clulas del mesonefros y del saco vitelino, que aportan las clulas somticas y germinales respectivamente. La cresta genital se desarrolla hacia la gnada indiferenciada por accin de dos factores de transcripcin llamados WT1 (Wilms Tumor 1) y SF1 (Steroidogenic Factor 1). A partir de este momento, la diferenciacin hacia ovario o testculo ser fruto de la accin de diversos genes. Si SRY est presente (como sucede en individuos con un cromosoma Y) la accin de ste factor de transcripcin y de otro llamado SOX9 hace que la gnada primitiva se desarrolle hacia testculo. ste, a su vez, producir factores que inhiben el desarrollo de los conductos de Mller, estabilizan el desarrollo de los conductos de Wolff y promueven el desarrollo de los genitales externos masculinos. Otros genes implicados son MIS-R, el receptor de andrgenos, INSL3 y LGR8. En ausencia de SRY, como ocurre en mujeres con dos cromosomas X, los genes DAX1 y WNT4 promueven la diferenciacin de la gnada primitiva hacia tejido ovrico; la ausencia del receptor andrognico y la presencia de WNT4 promueven la regresin de los conductos de Wolff y el desarrollo de las estructuras derivadas de los conductos de Mller. Por tanto, en el desarrollo sexual intervienen gran cantidad de genes que actan a distintos niveles de la va, y mutaciones en cualquiera de ellos puede dar lugar a alteraciones en el desarrollo sexual y por tanto a varones con cariotipo XX o a mujeres con constitucin cromosmica XY.

Herencia relacionada con el sexo

www.FreeLibros.me

Clulas somticas (mesonefros)

111

Compensacin de dosis: hiptesis de Lyon

Cresta genital
(gnada indiferenciada)
WT1 SF1 WNT4 DAX1

Clulas germinales (saco vitelino)

SRY SOX9

OVARIO
WNT4 Conductos de Mller AR Regresin de conductos de Wolff Conductos de Wolff

TESTCULO
MIS -R Regresin de conductos de Mller

Genitales externos

AR

Genitales externos

En la Figura 8.2 se muestra esquemticamente la va de determinacin del sexo en humanos.

8.4 Compensacin de dosis: hiptesis de Lyon


La distinta dotacin cromosmica de ambos sexos supone que las mujeres (XX) tienen doble dosis gnica de los genes presentes en el cromosoma X, respecto de los varones XY. El distinto nmero de cromosomas X que lleva cada tipo de gameto (uno en el gameto femenino y ninguno en el masculino), plantea una cuestin fundamental: cmo es posible que la distinta dosis de los genes contenidos en el cromosoma X no provoque grandes problemas en varones? De hecho, mujeres con un solo cromosoma X (cariotipo 45,X0) desarrollan el Sndrome de Turner. Por qu no sucede esto en varones, que tienen un solo cromosoma X? Murray Barr describi en 1949 que las clulas femeninas se podan distinguir por la presencia en su ncleo de un corpsculo de cromatina, pegado a la pared interna del ncleo, que pas a conocerse como corpsculo de Barr. Posteriormente, se comprob que el corpsculo de Barr se ajusta a la llamada regla (n1), segn la cual el nmero de corpsculos de Barr de una clula es igual al nmero de cromosomas X que posee esa clula (n) menos 1. Estas observaciones se completaron cuando Susumu Ohno demostr en 1959 que el corpsculo de Barr corresponde a un cromosoma X condensado en forma de heterocromatina y propuso que uno de los dos cromosomas X est inactivo en clulas somticas, de manera que slo se expresan los genes del cromosoma X que permanece activo. En 1961 Mary Lyon formul la hiptesis de que dicha inactivacin se lleva a cabo al azar en fases precoces del periodo embrionario, y queda fijada una vez que se establece. Segn esta hiptesis, todas las clulas hijas procedentes de una clula en la que se ha producido la inactivacin tendrn el mismo patrn de inactivacin que la clula original.

www.FreeLibros.me

112

Esta hiptesis permita explicar la expresin de algunos rasgos ligados al cromosoma X, tales como el color del pelaje en los gatos, en el que las gatas (que se conocen como gatas calico) muestran a veces manchas o bandas de color negro, naranja y blanco, mientras los gatos macho son de color totalmente negro o totalmente naranja. El proceso de inactivacin tambin explicara el patrn en mosaico de algunas enfermedades dermatolgicas causadas por genes que estn en el cromosoma X, como la displasia ectodrmica anhidrtica (fenmeno ya descrito por Darwin en 1875). El estudio de las isoformas de glucosa-6-fosfato deshidrogenasa en fibroblastos aislados de mujeres permiti confirmar la hiptesis de Lyon, al observarse la presencia de una sola isoforma en las clulas de mujeres heterocigotas (que deberan tener dos isoformas distintas). Hoy en da, el fenmeno de inactivacin temprana y aleatoria de un cromosoma X en mujeres es universalmente aceptado, y se conoce tambin con el nombre de Lyonizacin en honor a Mary Lyon. Mediante este mecanismo, las clulas somticas femeninas tienen uno de sus cromosomas X en estado inactivado, es decir, transcripcionalmente silenciado y altamente compactado en forma de heterocromatina. La inactivacin del X se realiza al azar mediante un mecanismo de recuento que determina el cociente entre el nmero de cromosomas X y el nmero de autosomas. Si se detecta ms de un cromosoma X, el proceso contina con la inactivacin, inicialmente temporal e inestable, de todos los cromosomas X menos uno. Finalmente, el proceso termina con el silenciamiento estable y definitivo de esos cromosomas. Aunque los mecanismos moleculares que regulan estos procesos no se entienden completamente, se conocen las regiones cromosmicas implicadas y los genes ms importantes en el proceso de inactivacin, como se describe a continuacin. Los procesos de inactivacin se ejecutan gracias un locus multifuncional denominado XIC, que est localizado en Xq13 y que contiene los elementos necesarios para el recuento del nmero de cromosomas X, para la eleccin del X que ser silenciado y para el propio mecanismo de silenciamiento. Este locus incluye el gen XIST, un gen de 32 kb que se transcribe en un ARN de 19 kb, es procesado y poliadenilado pero no se traduce. XIST es necesario para iniciar el silenciamiento del cromosoma X, pero no para los mecanismos de contaje, eleccin ni para el posterior mantenimiento del estado silenciado. En XIC tambin se encuentra el mecanismo de contaje y posiblemente un mecanismo de eleccin, que dependen del locus XCE.

Herencia relacionada con el sexo

XIC

Xist

Tsx

Brx

Cdx4

TsiX

Xce

La Figura 8.3 muestra un ejemplo del fenmeno de inactivacin del X. Tambin se incluye un esquema del locus XIC.

www.FreeLibros.me

Todos estos procesos comienzan en los estadios iniciales del desarrollo embrionario. As, en la mrula de cuatro-ocho clulas se detecta expresin de XIST a bajo nivel en ambos cromosomas X, tanto en el de origen paterno (Xp) como en el de origen materno (Xm). A partir de ese momento, XIST deja de expresarse en uno de los cromosomas X (en el caso de embriones XX), o en el nico cromosoma X (en embriones XY). Por tanto, la expresin inicial de XIST es transitoria y slo se estabiliza en torno a la fase de blastocisto en uno de los dos cromosomas X (en aqul que quedar finalmente inactivado). Recientemente se ha descubierto un gen antisentido, denominado TSIX, cuyo transcrito se solapa parcialmente con el ARN codificado por XIST. Curiosamente, TSIX sigue un patrn de expresin similar a XIST: inicialmente se expresan ambos alelos, pero al comienzo de la inactivacin nicamente se expresa el alelo del cromosoma X que permanecer activo. Esto sugiere que la expresin de TSIX juega un papel importante en la expresin transitoria de XIST y en la eleccin del cromosoma que finalmente ser inactivado. En este proceso participa el factor CTCF, que se une a la regin de metilacin diferencial cercana a TSIX. Dicha unin slo se produce cuando esa regin est des-metilada, y tiene dos posibles efectos: o bien impide la accin de un enhancer sobre XIST (porque CTCF es un elemento aislador o insulator); o bien estimula la transcripcin de TSIX, con el consiguiente silenciamiento de XIST. Tras la eleccin, tiene lugar el proceso de iniciacin del silenciamiento, seguida de otros cambios que permiten mantener el estado silenciado. En este proceso, el ARN codificado por XIST recubre todo el cromosoma y desencadena los cambios que caracterizarn al cromosoma X inactivo: metilacin de las islas CpG, desacetilacin de las histonas, replicacin tarda en la fase S, presencia de una histona especial (macroH2A) en vez de H2A. Recientemente tambin se ha visto que la lisina 27 de la histona H3 est metilada en el cromosoma X inactivo. En cambio, el ARN codificado por XIST no llega a estabilizarse en el X que permanecer activo, y finalmente el propio gen XIST se silencia y deja de expresarse. Lgicamente, en un embrin XY slo hay expresin baja y transitoria de XIST en el cromosoma X de origen materno, que nunca se inactiva porque el mecanismo de contaje detecta la presencia de un solo cromosoma X.
El vdeo de la Figura 8.4 sirve para ilustrar el proceso de inactivacin del cromosoma X.

113

Compensacin de dosis: hiptesis de Lyon

Mary Lyon tambin ha propuesto que la propagacin del estado inactivado a partir del XIC se ve facilitada por la presencia de elementos distribuidos a lo largo de todo el cromosoma X y que actuaran como estaciones repetidoras del proceso de inactivacin. Unos elementos que podran cumplir esta funcin son los LINE, que son especialmente abundantes en el cromosoma X respecto a los autosomas (forman un 30 por ciento de la secuencia de este cromosoma). Adems, al estudiar pacientes con translocaciones entre el cromosoma X y un autosoma, se ha comprobado que la inactivacin del X se propaga a los autosomas pero slo parcialmente, y que esta propagacin es directamente proporcional a la riqueza en LINEs de cada autosoma. La secuenciacin del cromosoma X apoya esta hiptesis, ya que se ha comprobado que los LINE se distribuyen a lo largo del X de manera coherente con la inactivacin: son especialmente abundantes en las zonas que flanquean el XIC y disminuyen en

www.FreeLibros.me

114

abundancia en las regiones ms distales del brazo corto, precisamente la regin donde la inactivacin es ms dbil. Es muy importante tener claro que la inactivacin del cromosoma X no es completa, es decir, no afecta a todos los genes del cromosoma. De hecho, se estima que slo un 65 por ciento de los genes presentes en el cromosoma X se inactivan; un 20 por ciento de los genes se inactivan slo parcialmente (es decir, no estn inactivados en todas las clulas) y un 15 por ciento escapan totalmente al proceso de inactivacin. Esto quiere decir que, para esos genes, existen dos copias funcionales en mujeres XX pero slo existe una copia en varones XY. Para evitar las diferencias de dosis gnica en estos casos, algunos de estos genes que escapan a la inactivacin tienen un gen homlogo funcional en el cromosoma Y, lo que hace que ambos sexos tengan la misma dosis gnica funcional. Se piensa que el fenotipo de mujeres X0 con Sndrome de Turner se debe precisamente a la disminucin de dosis de todos o algunos de los genes que escapan la inactivacin, ya que estas pacientes slo tienen una dosis funcional de estos genes (cuando deberan tener dos).

Herencia relacionada con el sexo

8.5 Estructura de los cromosomas sexuales humanos


Lo que ahora conocemos como cromosomas X e Y, formaban una pareja de autosomas hace aproximadamente 300 millones de aos. Los datos ms recientes apoyan la ley de Ohno (formulada por Susumu Ohno en 1967), que dice que el primer paso en el proceso de creacin del dimorfismo de los cromosomas sexuales fue la fijacin del gen responsable del desarrollo del sexo masculino en uno de los cromosomas (el que se convertira en el futuro cromosoma Y) y su prdida en el otro cromosoma del par (el futuro X). Despus, la limitacin progresiva de recombinacin entre ellos condujo a una evolucin separada de ambos cromosomas: el Y perdi material rpidamente por la falta de recombinacin, sufri varias duplicaciones y se qued con pocos genes, de los cuales un gran porcentaje tienen homlogos en el X. El cromosoma X, en cambio, se conserv mejor gracias a la existencia de recombinacin entre las dos copias presentes en mujeres, y fue evolucionando progresivamente desde metaterios (mamferos sin placenta, como los marsupiales) a euterios (mamferos con placenta). Al final, en el cromosoma X actual conserva una regin del autosoma ancestral de prototerios (mamferos que ponen huevos), adems de otra regin aadida despus de la separacin de los metaterios. Actualmente, ambos cromosomas sexuales slo se recombinan entre ellos en las dos pequeas regiones pseudoautosmicas que estn en los extremos de cada brazo. La reciente secuenciacin completa del cromosoma X en el ao 2005 ha aclarado la estructura de los cromosomas X e Y: En el cromosoma X se pueden distinguir:

Dos regiones pseudoautosmicas PAR1 y PAR2, por las que se recombinan los cromosomas X e Y (al menos una recombinacin en PAR1 es necesaria en la meiosis masculina). PAR1 (en Xp e Yp) tiene un tamao de 2,7 Mb, mientras que PAR2 (en el extremo del brazo largo de ambos cromosomas) mide 330 kb. Una gran regin conservada (XCR, X-conserved region) que ocupa la mayor parte del brazo largo del cromosoma X. Esta es la secuencia ms antigua y representa los restos del autosoma original de prototerios del que se originaron

www.FreeLibros.me

los cromosomas X e Y actuales. Una pequea porcin de esta regin se encuentra transpuesta al cromosoma Y (XTR, X-transposed region), calculndose que dicha transposicin tuvo lugar hace 5 millones de aos, despus de la separacin de humanos y chimpancs. Una regin aadida (XAR, X-added region) ms joven que XCR, al parecer incorporada al cromosoma X a partir de otro autosoma hace unos 100 millones de aos en mamferos placentarios (euterios). Esta regin representa la mayor parte del brazo corto del cromosoma X actual. Algunos fragmentos de la porcin ms distal de este brazo, cercanos a la PAR1, estn tambin presentes en el cromosoma Y, distinguindose hasta 12 bloques de homologa entre ambos cromosomas.

115

Estructura de los cromosomas sexuales humanos

De los aproximadamente 1 000 genes que hay en el cromosoma X, 54 tienen un homlogo funcional en el Y: 24 de ellos estn en PAR1, cinco en PAR2 y 25 en las regiones no-recombinantes de ambos cromosomas. De stos 25, 15 estn en la XAR y tres en XTR; los siete genes restantes se localizan en la XCR y por eso se piensa que descienden del autosoma ancestral.

PAR1 PAR1

XTR

PAR1

XAR

XTR

Genes que escapan a la inactivacin

XTR XCR

PAR2 PAR2

La Figura 8.5 muestra la estructura de los cromosomas X e Y humanos.

El cromosoma Y es el ms peculiar de todos los cromosomas humanos, ya que slo 23 megabases (de un total estimado de 50 Mb) estn formadas por eucromatina. Por ello, este cromosoma es tambin el ms pobre en genes. La peculiar estructura del cromosoma Y actual se debe a su comportamiento durante la meiosis: lgicamente, no puede quedar sin emparejar durante la meiosis, y de hecho se empareja con el cro-

www.FreeLibros.me

116

mosoma X a travs de las dos regiones pseudoatosmicas que contiene en los extremos del brazo corto y del brazo largo, respectivamente. El resto del cromosoma Y no se recombina nunca, y por esto ha ido acumulando mutaciones y degenerando con el tiempo. La regin eucromtica del Y comprende unas 22 Mb (el resto del cromosoma es heterocromatina) y est constituida por tres tipos de secuencias: i) un bloque de 3,4 Mb fruto de una transposicin procedente del X (XTR, regin transpuesta desde el X); ii) un total de 8,6 Mb de secuencias derivadas del cromosoma X, que representan las regiones derivadas del cromosoma ancestral; y iii) un total de 10,2 Mb de regiones palindrmicas, distribuidas en siete bloques. En total, en el cromosoma Y slo se han encontrado 158 unidades transcripcionales, entre las que destacan 27 genes que tienen homlogos claros en el cromosoma X. De stos, 13 estn degenerados y se han convertido en pseudogenes; los 14 restantes son autnticos genes que se expresan en varios tejidos, con la excepcin de SRY (que slo se expresa en clulas germinales masculinas). Todos estos genes se localizan fundamentalmente en las regiones derivadas del X. Por el contrario, en las regiones palindrmicas hay unos 60 genes, agrupados en nueve familias, que slo se expresan en el tejido testicular y que no tienen un homlogo claro en el cromosoma X: estos genes parecen codificar protenas necesarias para la fertilidad masculina. Por lo que respecta al papel de las regiones palindrmicas, parecen tener una importancia clave en el mantenimiento de la secuencia y estructura del cromosoma Y: la recombinacin entre los brazos de cada palndromo y la conversin de secuencias entre ellos evita la rpida degeneracin que tendra lugar por la ausencia de recombinacin entre los cromosomas X e Y en esta regin.

Herencia relacionada con el sexo

www.FreeLibros.me

CAPTULO 9

Modificaciones de las proporciones mendelianas

Contenidos
9.1 Modo de estimar si se cumplen las proporciones mendelianas esperadas 9.2 Modificaciones de las proporciones mendelianas al estudiar un carcter 9.3 Modificaciones del dihibridismo. Interaccin gnica y epistasia

Ya desde el inicio de los experimentos con plantas, diversos naturalistas haban encontrado proporciones fenotpicas en la F2 de monohbridos o dihbridos que no se correspondan con lo que cabra esperar segn las leyes mendelianas (3:1 y 9:3:3:1, respectivamente). Como acabamos de ver, la bsqueda de las causas de estas desviaciones permiti descubrir la herencia ligada al sexo en los caracteres controlados por genes situados en el cromosoma X. Adems, se descubrieron fenmenos como el multialelismo o la interaccin gnica en aquellos caracteres que estn controlados por ms de un gen. Aunque todas estas situaciones dan lugar a proporciones fenotpicas distintas a las esperadas por las leyes de Mendel, el anlisis detallado de lo que sucede viene a confirmar que, efectivamente, los postulados mendelianos tambin explican estas situaciones.

9.1 Modo de estimar si se cumplen las proporciones 9.1 mendelianas esperadas


Antes de pasar al estudio de estas cuestiones, es imprescindible estudiar la metodologa empleada para poder afirmar con fiabilidad si unas proporciones fenotpicas dadas se apartan significativamente de lo esperado segn las leyes mendelianas. Lgicamente, los

www.FreeLibros.me

118

porcentajes esperados nunca se cumplen perfectamente porque el tamao de las muestras no es lo suficientemente grande. Por ejemplo, en un cruce monbrido tpico en el que analizamos 100 plantas en la F2, esperaramos encontrar 75 con el fenotipo dominante y 25 con el fenotipo recesivo. Sin embargo, lo ms probable es que nunca encontremos exactamente estos nmeros, sino 74 y 26, o 77 y 23, por ejemplo. En el caso de especies con generaciones menos numerosas, como sucede en las familias humanas, las desviaciones pueden ser todava mayores debido al pequeo nmero de individuos que se estudia. Por tanto, es imprescindible contar con un mtodo cuantitativo que nos permita concluir con certeza estadstica si los porcentajes encontrados se ajustan a lo esperado. El mtodo utilizado es el clculo del Chi cuadrado, un estadstico que se ajusta a una distribucin concreta y que permite calcular la bondad del ajuste de unas proporciones a un modelo terico. El mtodo calcula la probabilidad de que la diferencia observada entre las proporciones experimentales y las proporciones tericas sea atribuible al azar. La hiptesis nula es que las proporciones tericas se cumplen y la diferencia es explicable por el azar, sobre todo cuando el tamao de la muestra es pequeo. Si el estadstico 2 (chi cuadrado) supera un cierto valor, se puede rechazar la hiptesis nula con una fiabilidad especfica (5 por ciento, 1 por ciento, 0,1 por ciento) y por tanto se puede afirmar que las proporciones fenotpicas experimentales se alejan significativamente de las esperadas segn el modelo terico. Es fcil comprender la mecnica de este razonamiento con un ejemplo. En un cruce monohbrido tpico analizamos 1 000 individuos de la F2 y encontramos 760 con el fenotipo dominante y 240 con el fenotipo recesivo. Esto se aparta de los 750:250 que esperaramos encontrar si este carcter se heredase de forma mendeliana, pero tenemos que comprobar si esta desviacin es atribuible al azar (de modo que si hubisemos analizado 10 000 individuos las proporciones hubiesen sido ms cercanas al 3:1 terico), o si efectivamente este carcter no sigue las leyes de Mendel. El primer paso es el clculo del estadstico 2 con arreglo a la frmula 2 = [ (O E)2/E], siendo O el nmero de casos observados y E el nmero de casos esperados para cada categora. En nuestro ejemplo, para el fenotipo dominante esperaramos encontrar 750 casos, pero hemos encontrado 760. As, calculamos (760 750)2/750 = 0,133. Hacemos lo mismo para el fenotipo recesivo: (240 250)2/250 = 0,4. Ahora podemos obtener el sumatorio, de modo que 2 = 0,133 + 0,4 = 0,533. El ltimo paso es comprobar este valor en una tabla que represente los valores mximos del 2 a los que se puede rechazar la hiptesis nula con distintos niveles de probabilidad y para varios grados de libertad. Si buscamos en una de estas tablas, vemos que para un grado de libertad se puede rechazar la hiptesis nula, con un error del cinco por ciento, cuando el valor del 2 es igual o superior a 3,841. Como el valor calculado por nosotros es inferior, no podemos rechazar la hiptesis nula y, por tanto, las proporciones experimentales no se apartan significativamente de lo esperado segn un modelo mendeliano de herencia. En cambio, si hubisemos obtenido 780 dominantes y 220 recesivos, el 2 resultante sera de 4,8. Como este valor rebasa el valor de la tabla para un grado de libertad y p = 0,05 (3,841) pero es inferior al valor de la tabla para p = 0,025 (5,024), podramos rechazar la hiptesis nula con un nivel de confianza del 95 por ciento (p < 0,05) y afirmar

Modificaciones de las proporciones mendelianas

www.FreeLibros.me

que las proporciones obtenidas no se ajustan a un modelo mendeliano de herencia. El nmero de grados de libertad siempre es igual al nmero total de clases menos uno: como en nuestro caso slo tenamos dos clases fenotpicas, hemos utilizado un grado de libertad. En el caso de un cruce dihbrido, en el que tendremos cuatro clases fenotpicas distintas en la F2, deberamos calcular el 2 total y buscar en la tabla el valor correspondiente para tres grados de libertad.
La Figura 9.1 muestra el uso del 2 para estimar si unas proporciones fenotpicas se ajustan a las esperadas segn las leyes mendelianas.

119

Modo de estimar si se cumplen las proporciones mendelianas esperadas

Otra consideracin previa a los temas que vamos a tratar en este captulo hace referencia a la manera de nombrar los diferentes alelos de cada gen. Es bastante evidente que al principio cada genetista utilizaba distintas nomenclaturas, y se tard un tiempo en alcanzar un consenso sobre la notacin de los alelos. Aunque hoy en da se pueden utilizar distintas formas de denominar los alelos, podemos dar unas reglas generales. Como ya vimos al explicar los experimentos de Mendel, lo ms habitual es denominar los alelos con la letra inicial del carcter recesivo (por ejemplo, vimos que los alelos para el color del guisante se llamaban V y v por ser sta la inicial de verde, que es el carcter recesivo). As, podemos utilizar una sola letra tanto para el alelo dominante (ponindola en mayscula) como para el recesivo (en minscula). En otros casos, se estudian mutaciones respecto a un carcter normal, y hay que establecer nombres para los alelos que causan las mutaciones y para el alelo normal. Un buen ejemplo es el color del ojo de Drosophila, para el que hay un alelo que causa el color normal rojo ladrillo y otros alelos mutantes que dan lugar a ojos de distintos colores. En general, a los alelos normales se les denomina alelos silvestres o salvajes, porque son los que se encuentran en la naturaleza. Cada alelo mutante se representa por una o varias letras que describen la mutacin (br para brown, ojos marrones, por ejemplo) y el alelo salvaje se representa entonces por esas mismas letras aadiendo el superndice +. Por ejemplo, una mosca heterocigota para la mutacin brown tendra un genotipo br+/br. En ocasiones se eliminan las letras del alelo silvestre, dejando nicamente el +. As, el genotipo anterior tambin podra representarse como +/br. Dependiendo del estado dominante o recesivo del alelo mutante, ste se representa con maysculas o minsculas, respectivamente. En los casos en que no hay dominancia o en las series allicas (en las que hay varios alelos para un mismo carcter y las relaciones de dominancia entre ellos son complejas) se suelen utilizar superndices para designar los distintos alelos, como por ejemplo en el color del plumaje de patos Mallard. Para este carcter hay tres alelos denominados M, MR y md, siendo la dominancia: MR (Restricted) > M (Mallard) > md (Dusky). En el caso concreto de la Gentica Humana, las recomendaciones actuales indican que los alelos se designen mediante un nmero o una letra, precedido por un asterisco, a continuacin del smbolo del gen. Por ejemplo, la variante Constant Spring de la hemoglobina alfa-2 se puede denominar HBA2*0001 (alelo 0001 del gen HBA2).

www.FreeLibros.me

120

9.2 Modificaciones de las proporciones mendelianas 9.2 al estudiar un carcter


Como hemos visto, tras los trabajos de Bateson, Morgan y muchos otros genetistas los principios mendelianos se aceptaron como algo de aplicacin general. Sin embargo, tambin desde el principio se reconocieron excepciones que no podan ser explicadas por estos principios, al menos aparentemente. Por ejemplo, observaciones en plantas haban revelado casos en los que la F1 de un cruce monohbrido tena un fenotipo intermedio entre el dominante y el recesivo de los progenitores, y ese fenotipo intermedio estaba presente tambin en el 50 por ciento de la F2. Este era el caso del color de la flor en algunas especies, en las que al cruzar una variedad pura de flores rojas con otra variedad pura de flores blancas se obtena en la F1 un 100 por ciento de flores rojas (color intermedio entre el rojo y el blanco). En la F2 resultante de la autofecundacin de flores de la F1 se obtenan 25 por ciento de flores rojas, 50 por ciento de flores rosas y 25 por ciento de flores blancas. Es fcil darse cuenta de que estas proporciones fenotpicas de la F2 (1:2:1) coinciden con las proporciones genotpicas esperadas, en vez de las proporciones fenotpicas 3:1 que son habituales en este tipo de cruces. Estos resultados sugieren que no se est cumpliendo la condicin de dominancia completa de un alelo sobre el otro, de modo que los heterocigotos muestran un fenotipo distinto (un poco menos fuerte) que los homocigotos dominantes. La explicacin para esta dominancia dbil est en que el carcter fenotpico obedece a efectos de dosis, es decir, el fenotipo depende de la dosis en que aparece el alelo dominante. En el ejemplo del color de las flores, podemos imaginar que el alelo recesivo da lugar a flores blancas (cuando se trata de plantas homocigotos recesivos) porque no produce ninguna cantidad de pigmento rojo; el alelo que da lugar al color rojo hace que se produzca una cantidad determinada de pigmento rojo, y por tanto la presencia de dos alelos rojos (homocigoto dominante) tendr como resultado flores ms rojas que la presencia de un solo alelo rojo (heterocigoto rojo/blanco), en cuyo caso las flores sern de un color rojo dbil o rosa. Este fenmeno se denomina dominancia incompleta o semidominancia, y es muy comn en caracteres fenotpicos que son el resultado de la accin de algn enzima, ya que la actividad enzimtica total depender del nmero de alelos capaces de producir el enzima correspondiente. Otra circunstancia que puede modificar las proporciones fenotpicas mendelianas por relaciones anmalas entre alelos es la co-dominancia, en la que cada uno de los alelos da lugar a un producto funcional que se expresa con independencia del otro. En estas condiciones, el heterocigoto tendr un fenotipo distinto a cualquiera de los dos homocigotos, que tambin sern distintos entre s. Por eso, las proporciones fenotpicas de la F2 sern tambin del tipo 1:2:1, como en el caso anterior. Un ejemplo tpico de co-dominancia en un carcter codificado por un gen es el grupo sanguneo MN en la especie humana. El locus que codifica este carcter puede presentarse en dos formas allicas llamadas LM y LN, las cuales codifican unas glicoprotenas de la membrana de los eritrocitos que dan lugar a los antgenos M y N respectivamente. Los individuos homocigotos LM/LM tienen fenotipo M, los homocigotos LN/LN tienen fenotipo N, y los heterocigotos LM/LN tienen fenotipo MN. Por tanto, un cruzamiento entre heterocigotos LM/LN X LM/LN producir proporciones fenotpicas 1:2:1 (25 por ciento MM, 50 por ciento MN, 25 por ciento NN). En el fondo, se trata de la misma

Modificaciones de las proporciones mendelianas

www.FreeLibros.me

situacin que veamos para la dominancia incompleta, con la diferencia de que aqu los dos alelos producen una protena funcional y por tanto ambos son igualmente dominantes. Ponindolo en los mismos trminos del ejemplo anterior, sera como una planta con un alelo que produce un pigmento que genera flores de color rojo y otro alelo que produce un pigmento para el color amarillo: todas las plantas de la F1 sern de color naranja (heterocigotos) y en la F2 se producirn 25 por ciento de flores rojas, 50 por ciento naranjas y 25 por ciento amarillas.

121

Modificaciones de las proporciones mendelianas al estudiar un carcter

Los vdeos de la Figura 9.2 ilustran los conceptos de codominancia y dominancia incompleta.

Aunque en especies diploides cada individuo slo tiene dos alelos en cada locus autosmico, esto no quiere decir que esos dos alelos sean los dos nicos alelos posibles que se pueden encontrar en la naturaleza para ese carcter. De hecho, para muchos rasgos fenotpicos es habitual que haya ms de dos alelos posibles, sobre todo si se incluyen todos los alelos mutantes que se pueden encontrar. Este fenmeno se conoce como alelismo mltiple y el conjunto de alelos se denomina serie allica. La presencia de alelos mltiples es otro motivo por el que en ocasiones las proporciones mendelianas no se cumplen. El ejemplo ms ilustrativo en gentica humana es el del grupo sanguneo ABO, originado por unos antgenos de la membrana de los eritrocitos. Estos antgenos estn derivados de la sustancia H, que es una glicoprotena de membrana que termina con los residuos N-acetil-GlucosaminaGalactosaFucosa (NacGlu>Gal>Fucosa). El antgeno 0, codificado por el alelo IO o i, mantiene intacta la sustancia H; el antgeno A, codificado por el alelo IA, aade un resto N-acetil-Galactosamina a la Galactosa de la sustancia H, y el antgeno B, codifica-

www.FreeLibros.me

122

do por el alelo IB, aade una Galactosa a la Galactosa de la sustancia H. Los alelos IA e IB son codominantes entre s, pero lgicamente ambos son dominantes sobre IO ya que ste no produce ningn antgeno distinto a la sustancia H. Teniendo en cuenta estas relaciones de dominancia, esta serie allica puede dar lugar a cuatro posibles fenotipos (A, B, AB y O) a partir de una gran variedad de genotipos. Por ejemplo, el cruce entre un individuo de fenotipo A y otro de fenotipo B puede dar lugar a distintos tipos de descendencia, dependiendo de los genotipos de los progenitores. Si el cruce es del tipo IA IA X IB IB toda la descendencia sern heterocigotos IA IB con fenotipo (grupo sanguneo) AB. Sin embargo, si se trata de un cruce IA IO X IB IO (en el que los progenitores tambin son de grupo sanguneo A y B respectivamente) la descendencia tendr proporciones fenotpicas 1/4 A, 1/4 B, 1/4 AB y 1/4 O. Estos porcentajes, a primera vista, pueden confundir y llevar a pensar que este carcter no se hereda de forma mendeliana. El anlisis detallado de cada tipo de cruzamiento confirma que tambin se cumplen los postulados de Mendel, aunque la presencia de ms de dos alelos distintos, con diferentes relaciones de dominancia entre s, puede confundir la interpretacin de las proporciones halladas en la descendencia.

Modificaciones de las proporciones mendelianas

N Acetilgalactosamina N - Acetilgalactosamina

FENOTIPO A A FENOTIPO

Alelo I A
(aade N-acetilgalactosamina)

Alelo i
(no aade nada)
Fucosa Fucosa Galactosa Galactosa N - Acetilglucosamina

FENOTIPO FENOTIPO O O

Sustancia Sustancia HH

Alelo I B
(aade galactosa)
Galactosa Galactosa

FENOTIPO FENOTIPO B B

La Figura 9.3 muestra la estructura de los grupos sanguneos ABO y las consecuencias del alelismo mltiple.

La ltima situacin en la que no se obtienen las proporciones mendelianas esperadas cuando se estudia un carcter fenotpico es aquella en la que uno de los alelos es letal, es decir, impide el desarrollo embrionario de los individuos que llevan una o dos copias de ese alelo. Cuando la letalidad se produce slo en individuos homocigo-

www.FreeLibros.me

tos para ese alelo, se habla de un alelo letal recesivo, mientras que si basta con la presencia de un solo alelo para causar letalidad se habla de letal dominante. Un ejemplo tpico de alelos letales es el del locus que controla el pelaje amarillo de ratones, estudiado por Cuenot en 1904. Al alelo que produce un pelaje normal se le llama agouti (o agut) en referencia a un roedor de ese nombre que vive en Sudamrica. El pelaje agut normal se debe a que cada pelo tiene pequeas bandas transversales negras y amarillas, de modo que la apariencia final es de un pelaje castao. Adems del alelo agut normal (A) y de su correspondiente recesivo a, existe un alelo que origina un pelaje de color completamente amarillo (AY), que es dominante respecto al alelo agut A. Por tanto, los cruces entre un ratn agut y otro amarillo, o entre dos ratones agut, producen las proporciones mendelianas esperadas en al descendencia. Por ejemplo, el cruce AA X AYA (ratn agut con ratn amarillo) tendr una descendencia con 50 por ciento de ratones agut y 50 por ciento amarillos. En cambio, los cruces entre ratones amarillos tienen descendencia con 1/3 de ratones agut y 2/3 de ratones amarillos, lo cual no se corresponde con las proporciones fenotpicas esperadas. Si el cruce fuese del tipo AYA X AYA, en la descendencia deberamos encontrar 1/4 AA, 1/4 AYAY y 1/2 AYA, lo cual se debera traducir en 3/4 amarillos y 1/4 agut (proporcin 3:1 tpica). La explicacin reside precisamente en que el alelo AY es letal recesivo, y provoca la muerte embrionaria de ratones homocigotos AYAY. Por eso, al descontar el 25 por ciento de ratones AYAY nos quedamos slo con descendencia de genotipos AA o AYA y de ah las proporciones encontradas. El alelo amarillo (AY) es, por tanto, un ejemplo de un alelo letal, recesivo en cuanto a la letalidad pero dominante en cuanto al carcter fenotpico que controla (el color amarillo del pelaje). En el caso de humanos es ms difcil descubrir genes con alelos letales, porque habitualmente no tienen otro efecto fenotpico que permita reconocerlos. A veces se ven proporciones ligeramente distintas a las esperadas, y en esos casos se sospecha que uno de los alelos es subvital o subletal, es decir, que causa cierta mortalidad durante el desarrollo embrionario. Al llegar al final de este apartado, es muy importante recordar que todas las posibles desviaciones de las proporciones fenotpicas mendelianas que hemos visto hasta ahora estn causadas por problemas en los alelos de un nico gen que controla un carcter fenotpico, bien por falta de dominancia completa, por la existencia de mltiples alelos o por la presencia de alelos letales. Por eso las hemos agrupado bajo el epgrafe de modificaciones del monohibridismo, porque son situaciones que surjen al analizar un nico gen.

123

Modificaciones del dihibridismo. Interaccin gnica y epistasia

9.3 Modificaciones del dihibridismo. Interaccin gnica 9.3 y epistasia


En ocasiones, cuando se estudian dos caracteres fenotpicos tambin se obtienen proporciones distintas a las esperadas segn los principios mendelianos, que predicen una descendencia con proporciones 9:3:3:1 al cruzar dos individuos heterocigotos para cada uno de los caracteres. Lgicamente, las circunstancias estudiadas en el apartado anterior tambin afectarn a estas proporciones si uno de los genes que analizamos est sujeto a codominancia, dominancia incompleta, letalidad, etc. Por

www.FreeLibros.me

124

ejemplo, podemos considerar dos caracteres distintos tales como el grupo sanguneo ABO (cuyo sistema allico ya ha sido explicado) y el albinismo. ste ltimo es un carcter mendeliano controlado en ratones por un solo gen, con un alelo silvestre A y un alelo recesivo a que provoca albinismo en homocigotos aa. Si cruzamos ratones dobles heterocigotos Aa/IAIB, la descendencia no se ajustar a las proporciones tpicas 9:3:3:1, sino que obtendremos ratones pigmentados con grupo sanguneo A, B o AB, y tambin ratones albinos con cualquiera de los tres grupos sanguneos. Las proporciones fenotpicas sern 3:6:3:1:2:1, que en el fondo es una modificacin de la relacin 9:3:3:1. La razn de este fenmeno es que los alelos que determinan el grupo sanguneo son co-dominantes (los alelos IA y IB) y por eso distorsionan las proporciones fenotpicas esperadas. Habitualmente, las anomalas en las proporciones del dihibridismo se detectan cuando se estudia un carcter fenotpico que est controlado por dos o ms genes, debido a un fenmeno llamado interaccin gnica. En efecto, aunque cada gen por separado se comporte de acuerdo a los principios mendelianos y los genotipos sean los esperados, puede suceder que las proporciones fenotpicas sean aberrantes porque ambos genes estn controlando un mismo carcter y la accin de uno enmascara los genotipos del otro. La interaccin gnica no significa que ambos genes o sus productos interaccionen directamente, sino que participan en una misma va o proceso biolgico (como puede ser la generacin de un pigmento en varios pasos metablicos, por ejemplo). Si cada gen acta a distintos niveles de esa va, uno de ellos puede afectar la expresin del otro y dar lugar a proporciones fenotpicas inesperadas en la descendencia. El principal obstculo que nos encontramos para interpretar las proporciones es que, si nicamente estamos analizando un carcter fenotpico, es imposible saber a priori si dicho carcter est controlado por un gen o por varios. En efecto, en el caso de dos caracteres era fcil porque podamos agrupar la descendencia en las cuatro posibles categoras fenotpicas que surjen al considerar dos caracteres a la vez, pero aqu estamos observando un carcter solamente. La pista que nos indica el nmero de genes implicados es el denominador de las proporciones fenotpicas encontradas: si stas se expresan en dieciseisavos, podemos suponer que nos encontramos ante un carcter fenotpico controlado por dos genes, si son sesentaycuatroavos se tratar de tres genes, etc. Los efectos de la interaccin gnica pueden ser bsicamente de dos tipos: la aparicin de fenotipos nuevos (que no estaban presentes en los progenitores) y la modificacin de las proporciones tpicas del dihibridismo. Por lo que respecta al primero, recordemos que segn los principios mendelianos el carcter recesivo de uno de los progenitores desaparece en la F1 y reaparece en el 25 por ciento de la F2. En cambio, si un carcter est controlado por dos genes distintos, a veces el resultado es que en la F2 aparecen fenotipos nuevos que no estaban presentes en la F1 ni en los progenitores. Tal es el caso, por ejemplo, del color del pimiento Capsicum annuum, que es un rasgo fenotpico determinado por dos loci: uno de ellos determina la produccin o no de pigmento rojo, con un alelo R que produce pigmento rojo y es dominante sobre el alelo r que no produce pigmento. El otro gen controla la degradacin de la clorofila (de color verde), con un alelo dominante C que degrada la clorofila para dar un color amarillento (sin pigmento), y un alelo recesivo c que no de-

Modificaciones de las proporciones mendelianas

www.FreeLibros.me

grada la clorofila y por tanto da el color verde tpico. En estas circunstancias, un cruce de variedades puras RRCC (de color rojo) X rrcc (de color verde) da lugar al 100 por cien de plantas RrCc (de color rojo) en la F1. Hasta aqu todo parecera indicar que el color del pimiento est controlado por un solo gen. En cambio, el cruce RrCc X RrCc produce en la F2 unas proporciones genotpicas con 9/16 R_C_ de color rojo, 3 /16 R_cc de color marrn (por la presencia simultnea del rojo y el verde), 3/16 rrC_ de color amarillento por la ausencia de pigmentos y 1/16 rrcc de color verde. Esto va contra los principios del monohibridismo mendeliano tpico, ya que tenemos cuatro fenotipos distintos. Aunque esto podra sugerir la presencia de alelos mltiples para un solo locus, las proporciones encontradas para las cuatro clases fenotpicas (expresadas en dieciseisavos) sugieren que este carcter est controlado por dos loci. Otro ejemplo de este fenmeno es el color de los ojos de la Drosophila, en el que el tipo silvestre de color rojo ladrillo est controlado por dos genes: brown (marrn) y scarlet (escarlata). El locus brown tiene un alelo silvestre bw+ dominante sobre el recesivo marrn (br) y el locus scarlet tiene un alelo silvestre st+ dominante sobre el recesivo (st) que produce ojos de color rojo escarlata. Las moscas con ojos de color silvestre tienen un genotipo bw+bw+/st+st+. Al cruzar una mosca mutante con ojos de color marrn (bwbw/st+st+) con otra de ojos escarlata (bw+bw+/stst), toda la F1 es doble heterocigtica (bw+bw/st+st) y por tanto con ojos del color silvestre rojo ladrillo. En la F2 resultante del cruce entre moscas de la F1, se obtiene un nuevo fenotipo (ojos de color blanco) en 1/16 del total, y proporciones 9:3:3:1 de los fenotipos silvestre, marrn, escarlata y blanco respectivamente. Nuevamente, la presencia de 4 clases fenotpicas expresadas en dieciseisavos nos alerta sobre la presencia de dos loci controlando este carcter. De hecho, lo que sucede es que el locus brown controla la produccin de un pigmento de color rojo brillante llamado drosopterina, mientras que el locus scarlet controla la produccin de otro pigmento de color marrn llamado xantomatina. En situaciones normales, el color silvestre es el resultado de la mezcla de ambos pigmentos. En cambio, mutaciones en el locus brown hacen que no se produzca drosopterina y el nico pigmento del ojo sea la xantomatina (de ah el color marrn del ojo). Las mutaciones en el locus scarlet hacen que no se produzca xantomatina, siendo el color del ojo rojo escarlata por la presencia de drosopterina. Los dobles mutantes recesivos (1/16) del total de la F2, carecen de ambos pigmentos y por tanto tienen ojos de color blanco. El otro efecto de la interaccin gnica es la distorsin de las proporciones mendelianas esperadas al analizar un carcter. Dicha distorsin puede ser debida a la presencia de dos genes que controlan dicho carcter, de modo que uno de los genes enmascara la expresin del otro. Este fenmeno se conoce con el nombre de epistasia y puede ser de distintos tipos, como veremos a continuacin. Al gen que modifica la expresin del otro se le denomina gen episttico, y al gen cuya expresin es modificada se le denomina gen hiposttico. Un buen ejemplo para entender la epistasia, utilizando los grupos sanguneos humanos, es el llamado fenotipo Bombay. Como se recordar, los isoantgenos A y B resultan de la adicin de N-acetil-galactosamina o de galactosa, respectivamente, a la sustancia H. Por tanto, slo los individuos que tienen sustancia H en la membrana de los eritrocitos pueden expresar antgenos A o B. La produccin de sustancia H (la adicin de la ltima fucosa a la cadena glicosdica) est controlada por otro locus distinto que presenta un alelo do-

125

Modificaciones del dihibridismo. Interaccin gnica y epistasia

www.FreeLibros.me

126

minante H (produce sustancia H completa) y otro alelo recesivo h (no la produce). Por tanto, los individuos homocigotos hh no producirn sustancia H y no podrn expresar ningn isoantgeno aunque tengan alelos IA o IB para el locus del sistema ABO. Este fenmeno se encontr por primera vez en una mujer del grupo O hija de padres A y AB, lo cual es imposible segn la herencia del sistema ABO. Esta mujer, casada con un individuo del grupo A (genotipos posibles Iai o IAIA) tuvo descendencia del grupo A, B y AB, lo cual tambin es imposible si ella fuese realmente del grupo O (genotipo ii). La explicacin es que la mujer en realidad tena genotipo IBi y por tanto debera ser del grupo B, pero como es homocigota para el alelo recesivo h y no produce sustancia H su fenotipo es del grupo O. Podemos imaginar un cruce entre individuos dobles heterocigotos para el grupo ABO y para la sustancia H, del tipo IAIB/Hh X IAIB/Hh. Segn el locus ABO, la descendencia debera ser 1/4 del grupo A, 1/4 del grupo B y 1/2 del grupo AB. Sin embargo, al tener en cuenta el locus H vemos que 1/4 de cada una de esas categoras sern homocigotos hh (sin sustancia H) y por tanto del grupo O. Al considerar ambos loci, las proporciones fenotpicas sern 3 /16 del grupo A, 6/16 del grupo AB, 3/16 del grupo B y 4/16 del grupo O, lo cual se desva de las proporciones esperadas 9:3:3:1. Como vemos, la presencia de un gen episttico (el que controla la produccin de sustancia H) enmascara la expresin del locus ABO (que en este ejemplo es el gen hiposttico) porque ambos genes estn implicados en procesos bioqumicos que interaccionan en un mismo carcter fenotpico. Como las proporciones fenotpicos se expresan en dieciseisavos, esto nos alertara inmediatamente sobre la presencia de dos genes interactuando de modo episttico aunque no supisemos nada de la existencia de la sustancia H.
La Figura 9.4 muestra un ejemplo del fenotipo Bombay.

Modificaciones de las proporciones mendelianas

En general, la epistasia puede ser recesiva o dominante, segn el gen episttico deba estar en homocigosis o no, respectivamente, para enmascarar la expresin del gen hiposttico. A su vez, la epistasia puede ser simple (uno de los genes es episttico sobre el otro) o doble (ambos loci son epistsicos el uno sobre el otro). Veamos algunos ejemplos de los tipos de epistasia ms comunes: Epistasia simple recesiva: ya vimos que el color del pelaje de ratones est controlado por el gen agut, con un alelo A dominante sobre a, de forma que los ratones A- (AA o Aa) son de fenotipo agut y los ratones aa tienen pelaje negro (carecen de las pequeas bandas amarillas). Existe otro gen que controla la presencia o no de pigmentacin, con alelo dominante C (pigmentacin) y un alelo recesivo Ca que impide cualquier tipo de pigmentacin. Los ratones de genotipo homocigoto recesivo CaCa son, por tanto, albinos, mientras que los ratones C (CC o CCa) son del color especificado por el locus agut. La F1 de un doble homocigoto dominante AA/CC (agut) con un doble homocigoto recesivo aa/CaCa (albino) son todos heterocigotos dobles de pelaje agut (genotipo Aa/CCa). La F2 resultante de cruzar ratones de la F1 muestra una proporcin 9:4:3 (agut:albino:negro) por epistasia de C sobre A. En este caso, hablamos de epistasia recesiva porque el alelo Ca es recesivo (slo CaCa modifica el fenotipo

www.FreeLibros.me

determinado por A). El ejemplo anterior del fenotipo Bombay es tambin una epistasia de este tipo, pero al ser codominantes los grupos sanguneos los 9/16 se descomponen en 6/16 y 3/16 (de ah las proporciones 3:6:4:3 que veamos). La epistasia simple recesiva es muy comn entre genes que actan a distintos pasos de una misma va metablica, y por eso es frecuente en enfermedades del metabolismo. Por ejemplo, cuando la produccin de un pigmento se lleva a cabo en dos pasos metablicos, de modo que el producto de la primera reaccin es el sustrato de la segunda reaccin, las mutaciones que afectan al enzima responsable de la primera reaccin sern epistticas sobre el gen que controla el segundo paso. Epistasia simple dominante: en este caso el alelo del gen episttico es dominante, y basta con una sola copia para que enmascare el efecto del gen hiposttico. Un ejemplo tpico es el color de la calabaza comn, en el que interviene un gen que controla el primer paso metablico en la produccin de un pigmento. El alelo normal (w) permite la reaccin qumica, pero es recesivo frente al alelo W que impide dicha reaccin. El producto de este primer paso es el sustrato de una segunda reaccin controlada por otro gen (con alelos Y e y) que da lugar al color final de la calabaza. Las plantas con genotipo ww para el primer gen (es decir, se lleva a cabo el primer paso de la va) pueden ser amarillas (genotipos YY o Yy para el segundo gen) o verdes (genotipo yy). En cambio, basta la presencia de un alelo W en el primer locus para que todas las plantas sean blancas, porque no se completa la primera reaccin y no hay pigmentacin. En este tipo de espistasia, la F2 resultante del cruce de dobles heterocigotos muestra proporciones fenotpicas 12:3:1, con 12/16 del fenotipo determinado por el alelo dominante del gen episttico. Epistasia doble recesiva: este tipo de epistasia fue observada por primera vez por Bateson y Punnett al estudiar el color de las flores de Lathyrus odoratus (guisante oloroso). Vieron que al cruzar dos flores blancas todas las plantas de la F1 eran prpuras y en la F2 apareca una proporcin 9:7 de prpuras:blancas. Las proporciones en dieciseisavos confirman la presencia de dos loci P y Q que controlan este carcter. La proporcin 9:7 se puede explicar si consideramos que ambos genes tienen un alelo dominante (P o Q) y otro recesivo (p o q) y actan sobre dos pasos sucesivos en la va metablica que genera el pigmento de las flores. Si el pigmento que da el color prpura slo se produce cuando estn presentes al menos un alelo dominante de cada uno de los genes implicados, la descendencia de un cruce del tipo PPqq x ppQQ (en el que ambas plantas tienen flores blancas), ser del 100 por ciento de dobles heterocigotos PpQq en la F1 (todas con flores prpuras, pues tienen un alelo dominante de cada par gnico). El cruce de estas plantas dar en la F2 9/16 de plantas con genotipo homocigoto recesivo para alguno de los dos genes (blancas); el resto sern prpuras por tener genotipos con un alelo dominante para ambos genes. Se denomina doble recesiva porque la presencia de cualquiera de los dos homocigotos recesivos para uno de los genes es episttico sobre el otro gen. Otros tipos de espistasia. Se conocen muchos otros ejemplos de epistasia en las que las relaciones entre el gen episttico y el hiposttico pueden ser distintas. Por ejemplo, cuando un fenotipo requiere la presencia de al menos un alelo dominante para cualquiera de los dos loci que controlan un carcter, el fe-

127

Modificaciones del dihibridismo. Interaccin gnica y epistasia

www.FreeLibros.me

128

notipo alternativo aparecer nicamente en individuos dobles homocigotos, y las proporciones obtenidas en la F2 de un cruce entre dobles heterocigotos sern 15:1. Este tipo de epistasia se denomina doble dominante porque los dos alelos epistticos son dominantes de modo recproco, y es tpica de genes que se han originado por duplicacin a partir de un gen ancestral y controlan un mismo carcter fenotpico. Otra situacin distinta es la que origina epistasia doble dominante/recesiva, debida a la supresin dominante de un gen sobre el efecto del otro y que produce proporciones fenotpicas 13:3.
El vdeo de la Figura 9.5 ilustra el concepto de epistasia.

Modificaciones de las proporciones mendelianas

Como conclusin a este captulo, conviene recordar que todas las desviaciones que hemos visto de las proporciones fenotpicas esperadas segn los principios mendelianos no invalidan las conclusiones de Mendel, sino que en el fondo las confirman. Sin embargo, estas excepciones sirven para recordarnos que los caracteres hereditarios que estn controlados por un solo locus con dos alelos son, en realidad, una minora. Curiosamente, los siete caracteres descritos por Mendel en su artculo original cumplan estos requisitos, pero la mayor parte de los rasgos genticos son ms complejos y estn sometidos a alguno de los fenmenos descritos (codominancia, alelismo mltiple, interaccin, etc.). Como veremos ms adelante, los rasgos de mayor importancia en Gentica Humana estn controlados por dos o ms genes, y generan muchas veces variacin fenotpica continua. Aunque las leyes de Mendel son todava aplicables incluso en estos casos, la interpretacin se complica tremendamente al aumentar el nmero de loci, al aparecer alelos mutantes y al aadirse los efectos de la interaccin entre los genes y el ambiente.

www.FreeLibros.me

CAPTULO 10

Gentica de los caracteres cuantitativos

Contenidos
10.1 Gentica de los caracteres cuantitativos: experimentos de Johannsen, Nilsson-Ehle y East 10.2 Modelo poligenes-ambiente y enfermedades multifactoriales 10.3 Heredabilidad en sentido amplio y en sentido restringido. Clculo de la heredabilidad en Gentica 10.3 Humana

10.1 Gentica de los caracteres cuantitativos: experimentos 10.1 de Johannsen, Nilsson-Ehle y East
Hemos visto que Mendel se centr en el estudio de caracteres cualitativos (es decir, caracteres que slo aparecen en dos posibles formas alternativas), que generan un tipo de variacin llamada variacin discontinua. Sin duda alguna, la gran intuicin de Mendel fue que slo el estudio de la variacin discontinua le permitira desentraar las leyes de la herencia y los factores implicados en la misma. Sus experiencias le haban mostrado que este tipo de caracteres eran los nicos que reaparecan en la F2 despus de haber desaparecido en la F1. Por el contrario, los caracteres cuantitativos o continuos (que admiten muchos valores posibles y en los que los valores individuales se agrupan en torno a una media, como el caso la altura de una planta, el peso de los frutos, etc.) no mostraban este comportamiento. La importancia de esta decisin fue extraordinaria, sobre todo teniendo en cuenta que la teora prevalente en ese momento era contraria a esta manera de pensar. Por ejemplo, Darwin daba preferencia a los caracteres cuantitativos respecto a los cualitativos (que consideraba de menor importancia) y aceptaba una teora llamada pangnesis. Segn esta teora, la herencia sera el resultado de la mezcla de gmulas, unas partculas somticas que de algn modo llegaran a la descendencia y

www.FreeLibros.me

130

determinaran que los caracteres de la descendencia fuesen intermedios a lo encontrado en ambos progenitores. Es curioso que Darwin no se fijase en la importancia de la variacin discontinua, porque de hecho un modelo de herencia basado en caracteres cualitativos favoreca ms su teora evolutiva. Probablemente fue muy importante la influencia del pensamiento de Francis Galton, que estaba convencido de que los caracteres cuantitativos constituyen la base de la variacin entre individuos y no entenda que stos pudiesen ser explicados por medio de variaciones discontinuas. De hecho, Galton haba estudiado el tamao de la planta del guisante y haba encontrado evidencias de variacin continua (una F1 con altura intermedia a la de ambos progenitores). Estos experimentos tenan sus antecedentes en Klreuter, un botnico que en 1766 haba hecho numerosos cruces en plantas y haba encontrado caracteres (como la altura de la planta Nicotiana, por ejemplo) que mostraban variacin continua. No es de extraar, pues, que se generase una fuerte controversia a principios del siglo XX entre los partidarios del mendelismo y los biometricistas (discpulos de Galton, defensores de la variacin continua). Por desgracia, la influencia de Galton y la aplicacin de las ideas de los biometricistas a sujetos humanos ocasionaron una de las pginas ms oscuras de la Gentica a principios del siglo XX, ya que cristalizaron en el movimiento eugensico, que floreci en los Estados Unidos de la mano de Charles Davenport en el laboratorio de Cold Spring Harbor. Con la idea de mejorar la raza humana mediante apareamientos selectivos, los eugenistas pretendan eliminar de la sociedad rasgos negativos como la criminalidad, el analfabetismo o la prostitucin; su presin fue suficiente para que el gobierno de los Estados Unidos aprobase entre 1910 y 1939 legislacin eugensica en tres reas: restriccin de la inmigracin europea; impedir matrimonios entre individuos de razas distintas; esterilizacin de los individuos genticamente infradotados. El auge del movimiento nazi con la aplicacin de la solucin final contribuy al descrdito del movimiento eugenista americano, llevando al cierre de su principal laboratorio en 1939. Por desgracia, muchas de las leyes aprobadas siguieron vigentes durante aos, y la esterilizacin de los deficientes mentales continu en Estados Unidos hasta los aos 1970; para entonces, unos 60 000 norteamericanos haban sido esterilizados sin consentimiento propio o de los responsables legales.
En la Figura 10.1 se puede encontrar un enlace a los archivos del movimiento eugensico americano.

Gentica de los caracteres cuantitativos

Las disputas en torno a las bases genticas de la variacin continua se resolvieron por los experimentos de varios genetistas en las primeras dcadas del siglo XX. El primero en abordar la utilizacin de metodologa estadstica en el estudio de la variacin continua fue el botnico dans Johannsen, que tuvo una gran importancia en la Gentica (a l se deben los trminos gen, genotipo y fenotipo, por ejemplo). En sus trabajos, que se extendieron de 1903 a 1909, intent estudiar el efecto de la herencia y del ambiente sobre la variacin, siguiendo la idea inicial de Galton de nature versus nurture. Johannsen estudi sobre todo el peso de las alubias de Phaseolus vulgaris en una cepa comercial y detect la presencia de variacin continua, con alubias de distintos pesos que se agrupaban en torno a un valor medio. Autopolinizando durante va-

www.FreeLibros.me

rias generaciones, consigui lneas puras para minimizar el efecto gentico y estudi la F1. A pesar de tratarse de lneas puras, los pesos de las semillas de cada una de estas lneas siguen una distribucin normal, con valores ligeramente distintos. Al plantar semillas de pesos diferentes (pero todas procedentes de una misma lnea pura y por tanto genticamente iguales), encontr que el peso medio de la progenie de las distintas semillas era idntico (no significativamente distinto) y coincida con la media de pesos de la lnea pura original. Por ejemplo, en su lnea pura nmero 13 las semillas se distribuan en torno a un peso medio de 0,45 g, pero haba semillas de pesos mayores y menores a esta media, como es lgico. Al plantar algunas de estas semillas y estudiar el peso de la alubia en la progenie, encontr que una semilla de 0,28 g produca alubias con un peso medio de 0,45 g, una semilla de 0,48 g produca alubias con un peso medio de 0,43 g, y una semilla de 0,58g produca plantas que daban alubias con un peso medio de 0,46 g. Esto demostraba la presencia de factores genticos (responsables de que el peso medio de las alubias sea igual a la media del peso de las semillas originales, como es de esperar en una lnea pura); pero adems tambin demostraba la presencia de otros factores (presumiblemente ambientales) que hacen que las semillas no sean todas idnticas, sino que el peso vare en torno a un valor medio. Adems, cada lnea pura tena un peso medio de alubia caracterstico, con una media que se repeta en la F1 aunque se plantasen semillas con pesos dispares. Fue, por tanto, Johannsen el primero en sugerir experimentalmente que la variacin continua podra explicarse por una combinacin de factores genticos y ambientales.
La Figura 10.2 explica los experimentos de Johannsen.

131

Gentica de los caracteres cuantitativos

De todas formas, esto no demostraba que los factores genticos implicados en la herencia de caracteres continuos fuesen de tipo mendeliano. Algunos biometricistas, sobre todo el matemtico Pearson, seguan negando la posibilidad de que los factores mendelianos pudiesen explicar la variacin continua. Sin embargo, Bateson y Yule elaboraron en 1906 una argumentacin matemtica para explicar que la presencia de varios factores mendelianos con dominancia incompleta puede originar la variacin continua propia de los caracteres cuantitativos. De todas formas, la demostracin experimental de esto no llegara hasta los estudios de Herman Nilsson-Ehle en 1909. Nilsson-Ehle tena varias lneas puras de trigo, en las que estudi caracteres cuantitativos con variacin continua, tales como el color de las espigas. En sus lneas, las espigas tenan colores que iban desde el blanco al rojo oscuro pasando por estados intermedios (rojo claro, rojo). Cruz en primer lugar una planta de espiga blanca con una de color rojo claro y obtuvo F1 en la que todas las espigas eran de color intermedio (rosa); en la F2 obtuvo tres clases fenotpicas con proporciones 1:2:1, siendo 1/4 de plantas con espigas blancas, 1/2 espigas rosas y 1/4 espigas de color rojo claro. En principio, como ya hemos visto al hablar del mendelismo, estas proporciones pueden explicarse perfectamente mediante un modelo mendeliano de dominancia incompleta del rojo sobre el blanco. Sin embargo, cuando cruz plantas de espigas blancas con plantas de espigas rojas (ms oscuras que el rojo claro) obtuvo cinco clases de plantas: 1/16 rojas, 4/16 intermedio entre rojo y rojo claro, 6/16 rojo claro, 4/16 rosa y 1/16 blancas. Estas proporciones (1:4:6:4:1) sugieren un modelo de dos pares g-

www.FreeLibros.me

132

nicos con epistasia doble dominante (15:1) y dominancia incompleta (todos los rojos suman 15). De hecho, el cruce de plantas de espiga blanca con plantas de color rojo oscuro dio lugar a siete clases fenotpicas, con proporciones expresadas en sesentaycuatroavos: 1/64 de plantas con espigas blancas y el resto de las plantas con espigas de seis clases de rojos (rojo claro, rojo y rojo oscuro ms las categoras intermedias entre cada una de estas tres). Estas proporciones y el nmero de clases fenotpicas sugieren un modelo de epistasis triple dominante: tres loci con dominancia incompleta (y efecto aditivo de dosis), y el resultado fenotpico es la distribucin del color de la espiga como una variable continua. Esta fue la primera demostracin experimental de que un carcter controlado por varios genes puede mostrar variacin continua aunque cada uno de los genes se herede de forma mendeliana, si cada uno de ellos tiene un pequeo efecto aditivo sobre el carcter fenotpico. Faltaba por demostrar que la variacin debida a efectos ambientales puede ser responsable de las diferencias observadas entre individuos con genotipos idnticos. La demostracin formal no llegara hasta los estudios de Edward East en 1916, nuevamente con plantas. Estudiando la longitud de la corola en dos lneas puras de Nicotiana longiflora, vio que la F1 mostraba un tamao intermedio a los fenotipos parentales, con arreglo a una distribucin normal. En la F2, el valor medio se mantena pero la varianza se ampliaba notablemente, aunque sin llegar a los valores extremos que se vean en las clases parentales. Esto se explica porque las plantas de la F1 son heterocigotos para todos los genes que intervienen en el tamao de la flor, de modo que las plantas de la F2 tendrn varias combinaciones distintas de genotipos y de ah la mayor dispersin de los resultados. De hecho, East observ que la F3 resultante de cruces seleccionados (entre plantas de la F2 que tenan el mismo tamao de corola) reproduca exactamente el tamao de las plantas cruzadas, con una dispersin de tamaos debida a factores ambientales. Por ejemplo, cruz inicialmente dos variedades puras de 40 mm y 93 mm de media, respectivamente. En la F1, el tamao medio de corola fue de 64 mm (con valores entre 61 y 67 mm). En la F2 resultante de cruzar dos plantas de la F1 se mantuvo el tamao medio de corola (67 mm) pero aument la dispersin (valores entre 52 y 82 mm), indicando la presencia de nuevos genotipos que estn originando tamaos distintos. Al cruzar dos plantas de esta F2 que tenan corolas del mismo tamao (58mm), vio que la descendencia tena un tamao medio cercano a 58 mm; al cruzar dos plantas de 70 mm obtuvo una descendencia con tamao medio cercano 70 mm, etc. Es decir, comprob que efectivamente hay factores genticos responsables de los distintos tamaos medios en los distintos cruces, al tiempo que los factores ambientales son los responsables de la dispersin de valores que se observa en las plantas que tienen un mismo genotipo. Con estos experimentos, East pudo demostrar el efecto simultneo de la variacin gentica y la variacin ambiental, cuyos efectos combinados contribuyen a crear variacin continua. Por tanto, un par de dcadas despus del re-descubrimiento de Mendel se haba llegado a la explicacin de cmo los principios mendelianos, que afectan a caracteres discretos (variacin discontinua) pueden dar lugar a variacin continua de caracteres cuantitativos: cuando un carcter fenotpico est controlado por dos o ms genes y los efectos de cada gen sobre ese carcter se suman. Esto se conoce como herencia polignica. En estos casos, es de gran inters determinar el nmero de loci que intervienen. Lo ms habitual es determinar el porcentaje de individuos de la F2

Gentica de los caracteres cuantitativos

www.FreeLibros.me

Lnea pura A
Longitud corola (x): 40 mm

Lnea pura B
94 mm

133

Modelo poligenes-ambiente y enfermedades multifactoriales

F1
61 64 67

F2
52 67 82

F3
54 72 79

El vdeo de la Figura 10.3 ilustra los experimentos de H. Nilsson-Ehle y de E. East.

que tienen valores en torno a cualquiera de los dos parentales. As, para un solo gen esto sera 1/4, para dos loci sera 1/16, para tres loci sera 1/64, etc. Se puede ver que esto es igual a (1/4)n, donde n es el nmero de loci distintos. Por ejemplo, ya vimos que el experimento de Nilsson-Ehle sugera tres loci (1/64 = [1/4]3), mientras que en el experimento de East ninguna de las 444 flores de la F2 tena una corola de tamao similar a la media de los progenitores, por lo que el nmero de poligenes debe ser al menos superior a 4 ([1/4]4 = 1/256).

10.2 Modelo poligenes-ambiente y enfermedades 10.1 multifactoriales


Hemos visto cmo se lleg a explicar la variacin continua por la accin de varios genes sobre un mismo carcter (herencia polignica), y cmo la existencia de variacin ambiental aadida hace que las diferencias entre las clases fenotpicas se suavicen y la variacin sea ms gradual. A la combinacin de herencia polignica con la variacin introducida por factores ambientales se le llama herencia multifactorial, para indicar la multiplicidad de factores que intervienen en la expresin del carcter fenotpico. En el campo de la Gentica Humana la herencia multifactorial es de gran

www.FreeLibros.me

134

importancia, porque la mayora de los fenotipos y muchas enfermedades, llamadas tambin enfermedades complejas, siguen este tipo de herencia. De hecho, las enfermedades multifactoriales o complejas son las ms importantes desde el punto de vista epidemiolgico, por lo que actualmente son objeto de investigacin con el fin de identificar los factores genticos y ambientales implicados. Fruto del trabajo de estos ltimos aos, se ha detectado un alto nmero de loci relacionados con el desarrollo de enfermedades como cncer, diabetes, hipertensin, esquizofrenia, enfermedades neuro-degenerativas, etc. Algunas de las enfermedades multifactoriales se manifiestan en rasgos fenotpicos claramente cuantitativos, como por ejemplo la presin arterial o los niveles de glucosa en sangre. Como hemos visto en el apartado anterior, se puede demostrar que los rasgos cuantitativos que se encuentran en la poblacin mostrando una distribucin normal pueden explicarse por la interaccin de varios genes (cada uno de los cuales se heredara de forma mendeliana). Por ejemplo, podemos imaginar un modelo sencillo de dos loci que regulan la presin sangunea, de forma que cada uno de ellos se hereda de modo mendeliano y provoca un aumento de 20 mm de presin arterial cuando se encuentra en estado homocigoto para el alelo dominante (mayscula), 10 mm en los heterocigotos o no provoca ningn aumento en los homocigotos para el alelo recesivo (minscula). Representando estos valores en un grfico de barras, se puede comprobar que 1/16 de la poblacin tendr un genotipo AA/BB (aumento de 40 mm de presin arterial), 4/16 de la poblacin tendr genotipos que provocan un aumento de 30 mm, 6/16 tendr genotipos con 20 mm, 4/16 con 10 mm y 1/16 sern genotipo aa/bb (0 mm de aumento). Como se ve, estos valores se aproximan a una distribucin normal. Lgicamente, la presencia de ms loci hace que aparezcan ms categoras (ms barras) y que la curva de distribucin se suavice cada vez ms. La variacin debida a factores ambientales (ingesta de sal, ejercicio fsico, etc.) sobreaadidos a los factores genticos producir la curva gaussiana tpica de muchos de estos rasgos cuantitativos.
La Figura 10.4 incluye un vdeo que ilustra la importancia de la herencia polignica en las enfermedades complejas.

Gentica de los caracteres cuantitativos

Hay otro tipo de enfermedades que no tienen una herencia mendeliana reconocible, sino que se ajustan al modelo de enfermedades multifactoriales, y sin embargo no se presentan como rasgos cuantitativos tpicos, sino que originan fenotipos cualitativos. Por ejemplo, algunas malformaciones frecuentes, como el labio leporino, forman parte de esta categora. Una explicacin bastante aceptada de estos rasgos propone que es la predisposicin a manifestar la enfermedad o malformacin lo que tiene un origen multifactorial (mezcla de factores genticos mendelianos y de factores ambientales). Por tanto, aunque esta predisposicin s que se ajusta a una distribucin normal en la poblacin, la enfermedad slo se desarrolla cuando se supera un cierto umbral de predisposicin. En estos casos se presupone que los familiares directos de estos enfermos comparten con ellos algunos factores genticos y/o ambientales, por lo que tendrn mayor predisposicin que la poblacin general a sufrir la misma enfermedad. Esto explica que el riesgo de recurrencia de la enfermedad

www.FreeLibros.me

(probabilidad de que haya otro miembro afectado en una misma familia) sea mayor en los familiares de un enfermo que en la poblacin general. Ejemplos clsicos de este tipo de enfermedades son la estenosis pilrica, que adems muestra diferencias en cuanto al sexo (hay ms varones que mujeres afectados por la enfermedad, lo que sugiere que el umbral de predisposicin es ms bajo en varones), o el paladar hendido (fisura del paladar/labio leporino). Para calcular el riesgo de recurrencia en estas enfermedades (la aparicin de otro caso en una familia en la que ya hay un enfermo) se utilizan siempre riesgos empricos, basados en la observacin de los datos de prevalencia de la enfermedad en la poblacin, datos que pueden variar considerablemente de una poblacin a otra. Una propiedad a tener en cuenta es que en estos casos el riesgo es variable, al contrario de lo que ocurre en enfermedades con herencia mendeliana simple, en las que el riesgo es fijo. As, cuando hay varios miembros de una misma familia afectados por una enfermedad multifactorial, el riesgo de que aparezca un nuevo caso en la misma familia es mayor que si hay un solo miembro enfermo; igualmente, cuando el individuo enfermo es del sexo que se afecta con menor frecuencia, el riesgo tambin aumenta. Esto se explica porque, en estos casos, se supone que en esa familia concreta concurren ms factores genticos y/o ambientales y su curva de predisposicin est desplazada a la derecha.
El vdeo de la Figura 10.5 ilustra la herencia polignica de algunos rasgos cualitativos.

135

Heredabilidad en sentido amplio y en sentido restringido. Clculo de la heredabilidad

10.3 Heredabilidad en sentido amplio y en sentido restringido. 10.2 Clculo de la heredabilidad en Gentica Humana
La determinacin de la influencia de factores genticos en caracteres cuantitativos tiene consecuencias importantsimas en la explotacin de especies vegetales o animales (tamaos, pesos, produccin de leche, de huevos, de uvas, etc.). La aplicacin ms importante en Gentica Humana es la posibilidad de determinar la importancia relativa de los factores genticos y de los factores ambientales en las enfermedades multifactoriales, por las implicaciones que esto tiene para la prevencin y tratamiento de estas dolencias. Una forma de resolver este problema es estimar la parte de la variacin total de una variable que es debida a factores ambientales, para de ah deducir la variacin atribuble a factores genticos. En el caso de los caracteres cuantitativos, esto es relativamente sencillo porque pueden estudiarse con mtodos estadsticos, analizando los parmetros que definen las variables poblacionales y sus relaciones (media, varianza, covarianza, regresin). De todos stos, la varianza es el parmetro que mejor define la dispersin de una variable continua en torno a la media y por tanto podemos estimar la variacin fenotpica calculando la varianza total de ese rasgo en la poblacin. Esta varianza fenotpica total (VP ) ser la suma de la varianza debida a factores genticos (VG), ms la varianza debida a factores ambientales (VE ), ms la varianza debida a las interacciones entre genes y ambiente (VGE ). A su vez, la variacin gentica viene determinada por tres componentes: la varianza debida a efectos aditivos (VA), la varianza debida a efectos de dominancia (VD) y la varianza debida a efectos de interaccin gnica (VI ). Usando esta metodologa podemos estimar la

www.FreeLibros.me

136

heredabilidad (H 2) de un rasgo fenotpico cuantitativo. En sentido amplio, la heredabilidad indica qu proporcin de la variacin fenotpica total VP de una variable continua es atribuible a factores genticos. Siguiendo las definiciones precedentes, esta heredabilidad en sentido amplio se calcula con arreglo a la frmula: H 2 = VG/VP siendo VP = VG + VE + VGE (aunque VGE suele despreciarse). Para calcular H2 necesitamos usar especies puras (genotipos iguales), que nos permiten calcular la varianza ambiental VE variando las condiciones ambientales de forma que toda la variacin sea debida al ambiente. Adems de esta dificultad de tipo prctico, este concepto de heredabilidad en sentido amplio es poco til porque no nos indica exactamente el porcentaje de la variacin que es debida a factores genticos aditivos, que son los ms interesantes. Por eso, otra forma ms habitual de calcular la heredabilidad (heredabilidad en sentido estricto, h2) se basa en calcular especficamente la parte de la varianza gentica que es debida a factores aditivos (VA), respecto a la debida a diferencias en la dominancia (VD) y a efectos de interaccin (VI ). Habitualmente, esta ltima es despreciable y se considera que la varianza genotpica total es VG = VA + VD. En especies que lo permiten, el clculo se realiza mediante experimentos de seleccin artificial, para evaluar el posible beneficio derivado de tal seleccin. Por ejemplo, en una poblacin en la que una variable continua tiene una media M, se toma una submuestra de individuos con una media significativamente diferente (esa diferencia se denomina diferencial de seleccin, D), y se determina la media en la progenie de esos individuos seleccionados. La diferencia de la media en la descendencia con la media poblacional inicial se denomina ganancia G (o respuesta R). La heredabilidad en sentido estricto h2 se calcula como G/D, e incluye nicamente los factores genticos aditivos. Se puede comprobar que con la seleccin prolongada, la heredabilidad va disminuyendo progresivamente, al haber cada vez menos factores genticos aditivos que puedan seguir modificando el fenotipo.
En la Figura 10.6 se incluye un vdeo y varias ilustraciones que muestran el concepto de heredabilidad y su cuantificacin en Gentica Humana.

Gentica de los caracteres cuantitativos

Lgicamente, este tipo de aproximacin experimental no es posible en el caso de la Gentica Humana. Sin embargo, la enorme importancia socio-sanitaria de las enfermedades multifactoriales hace que sea de gran utilidad determinar cunto influye el ambiente y cunto la herencia en la gnesis de esas enfermedades. Para cuantificar la magnitud del componente gentico de una enfermedad, concepto anlogo a la heredabilidad, se utilizan actualmente dos procedimientos:

Clculo del riesgo relativo. Si calculamos el riesgo relativo de padecer la enfermedad que tienen distintos grupos de personas relacionadas genticamente, como por ejemplo los hermanos de individuos enfermos, y vemos que el riesgo de padecer la enfermedad en ese grupo es significativamente mayor que en la poblacin general, podemos deducir que existen factores genticos que determinan la aparicin de esta enfermedad. El riesgo relativo se calcula

www.FreeLibros.me

como R, en el que el subndice R indica el grado de parentesco del grupo que estamos estudiando con los individuos enfermos. Por ejemplo lo (la O viene del ingls offspring, que significa descendencia) indicara la prevalencia de la enfermedad en los hijos e hijas de individuos enfermos; s (la S viene del ingls sibs, que significa hermanos y hermanas) sera la prevalencia de la enfermedad en los hermanos y hermanas de individuos enfermos, etc. Calculando el cociente de cada uno de estos riesgos entre el riesgo poblacional general podemos calcular el riesgo relativo. Un concepto similar al de riesgo relativo es el de odds ratio (cociente del producto cruzado), que se calcula de otro modo pero nos da prcticamente la misma informacin. La interpretacin de estos clculos es la misma: si los parientes de los individuos enfermos tienen un riesgo significativamente aumentado de padecer la enfermedad frente al riesgo de la poblacin general, se puede suponer que la enfermedad tiene un componente gentico importante. Clculo de las tasas de concordancia en parejas de gemelos. Si una enfermedad tiene un componente gentico significativo, aparecer con mayor frecuencia en individuos con mayor parecido gentico que en individuos genticamente ms distantes. Un modo elegante de estudiar esto en la prctica es comparar los gemelos dicigticos (cuyo grado de identidad gentica es igual al de una pareja cualquiera de hermanos) y los gemelos monocigticos, ya que stos son prcticamente idnticos desde el punto de vista gentico. Este tipo de estudios, que han dado abundantes frutos en Gentica Humana, se basan en el clculo de las tasas de concordancia, es decir, el porcentaje de parejas de gemelos que concuerdan para un mismo rasgo fenotpico (una enfermedad, en este caso), de manera que simplemente calculamos el porcentaje de parejas de gemelos en las que ambos padecen la misma enfermedad. Estas parejas seran concordantes para esa enfermedad, mientras que las parejas en las que un gemelo est enfermo pero el otro est sano seran parejas discordantes. Pues bien, si una enfermedad tiene un fuerte componente gentico, la tasa de concordancia en parejas de gemelos monocigticos (MC) ser claramente ms alta que en parejas de gemelos dicigticos (DC), pues aquellos comparten mayor nmero de genes que stos. Adems, este tipo de anlisis tiene la ventaja de que corrige la influencia de los factores ambientales, ya que en la mayora de los casos ambos hermanos gemelos tanto MC como DC han estado sometidos a las mismas influencias ambientales. En el caso de rasgos cuantitativos (la presin arterial, por ejemplo) la estimacin de la concordancia puede realizarse mediante el clculo del coeficiente de correlacin intraclase (correlacin de los valores de presin arterial de un hermano con su gemelo respectivo), de forma que un coeficiente de correlacin R = 1 equivale al 100 por cien de concordancia. La comparacin de concordancias entre gemelos MC y DC se hace del mismo modo que se comparan dos coeficientes de correlacin. En el caso de rasgos cualitativos (presencia o ausencia de una enfermedad) simplemente calculamos el porcentaje de parejas de gemelos que concuerdan para esa enfermedad y as obtenemos la tasa de concordancia (porcentaje de parejas concordantes respecto al total de parejas). Con estos datos podemos estimar la heredabilidad (h), me-

137

Heredabilidad en sentido amplio y en sentido restringido. Clculo de la heredabilidad

www.FreeLibros.me

138

diante la frmula h = 2 (Cmc Cdc), en la que C es la tasa de concordancia (Cmc en monocigticos y Cdc en dicigticos). Los valores de heredabilidad calculados de este modo tienen un rango terico entre +1.5 (que correspondera a un rasgo monognico autosmico recesivo, con Cmc = 1 y Cdc = 0,25) y 0 (Cmc = Cdc, en el caso de un rasgo influido slo por el ambiente). En general, se considera que las enfermedades con una heredabilidad en torno a 1 (o superior) tienen un componente gentico importante.

Gentica de los caracteres cuantitativos

h = 2 x (CMC CDC) Tasa de concordancia Gemelos MC Enf. bipolar Autismo Sarampin Diabetes tipo I Diabetes tipo II Hipertensin 0,79 0,92 0,95 0,40 0,50 0,70 Gemelos DC 0,24 0,24 0,87 0,04 0,37 0,40 Heredabilidad >1 >1 0,16 0,72 0,26 0,60

www.FreeLibros.me

C APTULO 11

Ligamiento gentico en humanos

Contenidos
11.1 El concepto de ligamiento gentico: fraccin de recombinacin y distancia gentica 11.2 Informatividad de los marcadores utilizados en estudios de ligamiento 11.3 El clculo del LOD score 11.4 Ligamiento no paramtrico y su utilizacin en Gentica Humana

11.1 El concepto de ligamiento gentico: fraccin 11.1 de recombinacin y distancia gentica


Aunque algunos autores ya haban sugerido la presencia de determinados genes en cromosomas concretos, no hubo evidencia clara de esto hasta el descubrimiento del ligamiento del locus white de Drosophila al cromosoma X (como se ha explicado en el Captulo 8), descubrimiento hecho por Morgan en torno a 1910. Poco despus, Morgan identific nuevos mutantes, entre ellos otro llamado rudimentary, que tambin mostraba ligamiento al cromosoma X. Esto llev a Morgan a estudiar la segregacin simultnea de estos dos genes: si siempre se heredan juntos, esto sugerira que estn cerca en el mismo cromosoma, ya que no ha habido recombinacin entre ellos. En efecto, segn las leyes de la herencia mendeliana dos loci que estn en cromosomas distintos segregarn de manera independiente, es decir, los dos alelos de cada locus se distribuirn en los gametos de modo aleatorio. En cambio, cuando los dos loci estn en el mismo cromosoma (se dice entonces que son sintnicos), cabe pensar que siempre se heredar la misma combinacin de alelos y un miembro de la descendencia que herede un alelo concreto de uno de los loci tambin heredar el alelo del otro locus que estaba en el mismo cromosoma parental. Por el contrario, si se produce una recombinacin (con sobrecruzamiento) en algn punto in-

www.FreeLibros.me

140

termedio entre ambos loci durante la meiosis, los gametos llevarn combinaciones allicas que no estaban presentes en ninguno de los progenitores, es decir, se formen gametos recombinantes. Morgan comprob que poda darse recombinacin entre el locus white y el locus rudimentary en Drosophila, pero al estudiar otras mutaciones (especialmente el color amarillo del cuerpo y el color blanco de los ojos) observ que nunca se detectaba recombinacin con otros loci localizados en el mismo cromosoma, y llam ligamiento a ese fenmeno. Alfred Sturtevant, un estudiante de Morgan, demostr que la probabilidad de que haya una recombinacin entre dos loci depende de la distancia fsica que los separa, y por tanto la frecuencia con que aparecen recombinantes puede utilizarse para deducir la distancia que separa dos genes que estn en el mismo cromosoma; Sturtevant construy en una noche el primer mapa gentico de ligamiento, en el que se representaba el orden y la distancia de cinco genes localizados en el cromosoma X de Drosophila. Poco despus, Calvin Bridges detect los primeros casos de ligamiento entre genes localizados en autosomas, y poco a poco se fueron describiendo distintos grupos de ligamiento. El concepto de ligamiento gentico, por tanto, va intrnsecamente unido al de distancia fsica entre genes, que es la que origina distintas proporciones de individuos recombinantes en la descendencia. Cuando ambos loci estn suficientemente alejados (aunque estn en el mismo cromosoma) existe una probabilidad tan alta de que haya un sobrecruzamiento entre ellos que segregarn de manera similar a una segregacin independiente, produciendo gametos recombinantes en la mitad de la descendencia (50 por ciento de gametos recombinantes y 50 por ciento de gametos no-recombinantes). En este sentido, es importante recordar que el sobrecruzamiento tiene lugar entre dos cromtides, cada una perteneciente a un cromosoma homlogo; las otras dos cromtides no se recombinan, de ah que un sobrecruzamiento da lugar a cuatro gametos de los cuales dos son recombinantes y los otros dos son idnticos a los cromosomas originales. Sin embargo, a medida que dos loci sintnicos se sitan ms cerca uno del otro, la probabilidad de que haya un sobrecruzamiento entre ellos es cada vez menor, y por tanto la probabilidad de formacin de gametos recombinantes tambin va decreciendo. Puede llegarse a un punto en que los loci estn tan juntos que nunca se d un sobrecruzamiento entre ellos, de modo que no se originarn gametos recombinantes y no se encontrarn individuos recombinantes en la descendencia. Por tanto, la cuantificacin del nmero de eventos de recombinacin entre dos loci nos permite estimar la distancia gentica entre ellos: a mayor proximidad, menor probabilidad de recombinacin y por tanto el porcentaje de individuos recombinantes ser menor.
La Figura 11.1 ilustra por qu la probabilidad de recombinacin entre dos loci es funcin de su distancia fsica.

Ligamiento gentico en humanos

En Gentica Humana, la cuantificacin de la frecuencia de recombinacin se hace estudiando la segregacin de dos secuencias de ADN en los individuos de una familia, e identificando aquellos individuos cuyo genotipo slo pueda explicarse por una recombinacin en la meiosis de uno de los progenitores. Las secuencias que se utilizan en estudios de ligamiento se denominan marcadores genticos, que son secuencias que se encuentran en distintas formas (distintos alelos) en la poblacin general, ya que para detectar si ha habido recombinacin debemos ser capaces de dis-

www.FreeLibros.me

tinguir los distintos alelos. Adems, los estudios de ligamiento entre marcadores sirven para establecer mapas de ligamiento en los que estos marcadores estn en un orden determinado, separados por distancias precisas. Por tanto, los marcadores utilizados en estudios de ligamiento son polimorfismos genticos, es decir, secuencias que se encuentran en la poblacin en varias formas posibles. Diferentes individuos de la poblacin pueden tener, por tanto, distintos genotipos (distintas combinaciones de alelos) para un marcador concreto. Los principales tipos de polimorfismos genticos que se utilizan como marcadores en estudios de ligamiento han sido explicados con detalle al hablar del genoma humano en el Captulo 4. Para realizar mapas de ligamiento entre marcadores, es necesario ante todo genotipar cada uno de los marcadores en todos los miembros de una o varias familias. Al analizar los genotipos de cada individuo y la segregacin de los diferentes alelos, se pueden identificar los individuos recombinantes, aquellos cuyo genotipo slo puede explicarse por una recombinacin en uno de sus progenitores. La cantidad de individuos recombinantes en la descendencia nos permite calcular la fraccin de recombinacin (representada por la letra griega ), que se define como el nmero de individuos recombinantes dividido por el nmero total de individuos en la descendencia. Adems de estudiar la distancia entre marcadores, en los estudios de ligamiento que se realizan en Gentica Humana es frecuente buscar cul es la distancia entre un marcador y el locus responsable de una enfermedad gentica. En estos casos, el anlisis de ligamiento nos permitir calcular la distancia entre el marcador y el gen responsable de una enfermedad. Utilizando esta metodologa se han identificado los genes responsables de muchas enfermedades genticas, mediante una estrategia denominada clonaje posicional: al conocer la distancia que separa el locus responsable de una enfermedad de varios marcadores genticos concretos, se simplifica enormemente la tarea de identificar el gen causal.

141

El concepto de ligamiento gentico: fraccin de recombinacin y distancia gentica

1-2

2-4

1-2

1-4

1-4

2-2

2-4

1-4

= 1/6 = 0,17 = 17% DISTANCIA GENTICA = 17 cM


La Figura 11.2 muestra el modo de calcular la fraccin de recombinacin entre el locus responsable de una enfermedad autonmica dominante y un marcador gentico.

www.FreeLibros.me

142

La fraccin de recombinacin, calculada tal y como se ha explicado en la figura anterior, nos permite estimar la distancia gentica entre dos loci, distancia que se mide en centimorgans (cM): cuando entre dos loci se detecta una fraccin de recombinacin = 0,01 (uno por ciento de individuos recombinantes), se dice que ambos loci estn a una distancia gentica de 1 cM. Esta distancia gentica (1 cM) equivale aproximadamente a 1 Mb (megabase) de distancia fsica, aunque esta equivalencia vara a lo largo del genoma y hay funciones matemticas ms exactas para convertir la distancia gentica en distancia fsica. En cualquier caso, es importante comprender que la fraccin de recombinacin nunca podr ser mayor a 0,5 (50 por ciento), ya que ste es precisamente el porcentaje de individuos recombinantes que se producen en ausencia de ligamiento (cuando siempre hay una recombinacin, como se ha explicado ms arriba) o en el caso de que ambos loci estn situados en cromosomas distintos.

Ligamiento gentico en humanos

11.2 Informatividad de los marcadores utilizados en estudios 11.2 de ligamiento


Como acabamos de explicar, para poder realizar estudios de ligamiento es necesario identificar los individuos recombinantes para determinar la fraccin de recombinacin. Por desgracia, en ocasiones es imposible establecer si un individuo de la descendencia es recombinante o no, bien porque el individuo que transmite la enfermedad es homocigoto para el marcador analizado, o bien porque es heterocigoto idntico al otro progenitor; estas situaciones dan lugar a lo que denominamos familias no-informativas o semi-informativas, respectivamente.
La Figura 11.3 muestra algunos ejemplos de falta de informatividad de un marcador.

Lo posibilidad de perder informatividad subraya la importancia de usar marcadores para los que todos los rboles analizados sean informativos, lo cual depender directamente de la informatividad de los marcadores utilizados. La informatividad de un marcador refleja la probabilidad de encontrar individuos heterocigotos para ese marcador en la poblacin general, y es funcin del nmero de alelos posibles para el marcador y de las frecuencias relativas de cada alelo en la poblacin. Teniendo en cuenta las caractersticas de cada tipo de marcador, es posible calcular dos parmetros que definen la informatividad de un marcador gentico: el ndice de heterocigosidad y el PIC (contenido de informacin de un polimorfismo, Polymorphism Information Content en ingls). Estos parmetros se calculan mediante la siguiente frmula: PIC = 1 pi2
i=1 n n1

i = 1 j =i + 1

2 pi2 pj2

heterocigosidad % heterocigotos idnticos

El primer miembro (1 - pi 2) es la heterocigosidad, es decir, el porcentaje de individuos de la poblacin general que son heterocigotos para ese marcador.

www.FreeLibros.me

Ya hemos visto que si el individuo que transmite la enfermedad es homocigoto para un marcador, esa familia no ser informativa para ese marcador, de ah que la heterocigosidad sea una medida de la informatividad de un marcador gentico. Como pi2 es la frecuencia de homocigotos para cada alelo del marcador, el sumatorio de todos los posibles homocigotos se le resta a 1 y se obtiene as el porcentaje de heterocigotos. Como criterio general, se puede decir que la heterocigosidad de un marcador aumenta: (a) con el nmero de alelos que ese marcador presenta en la poblacin general; y (b) cuanto ms parecidas son las frecuencias de los distintos alelos de ese marcador. El segundo miembro de la ecuacin le resta a la heterocigosidad la probabilidad de que una familia no sea informativa debido a que ambos padres son heterocigotos idnticos (en cuyo caso, como hemos visto antes, la mitad de la descendencia ser informativa (homocigotos) y la mitad ser no-informativa (los heterocigotos). Como es sabido, para dos alelos i y j con frecuencias allicas pi y pj la frecuencia de heterocigotos es 2pi pj. Por tanto, la probabilidad 2p 2 , de que dos individuos sean heterocigotos idnticos es 2pi pj 2pi pj = 4 (pi i) pero como slo se pierde informatividad en la mitad de la descendencia, en la 2p 2 . ecuacin se resta slo 2 (pi i)

143

Informatividad de los marcadores utilizados en estudios de ligamiento

Algunos ejemplos del clculo del PIC ilustrarn la informatividad de los distintos tipos de marcadores genticos. Por ejemplo, un marcador biallico (el caso tpico sera un RFLP) con frecuencias allicas iguales ( p1 = p2 = 0,5) tendra:
2 + p 2)] = [1 (0,52 + 0,52)] = 1 0,5 = 0,5 Heterocigosidad = [1 (p1 2 2 + p 2) 2 (p 2 p 2) = 1 (0,52 + 0,52) 2 (0,52 0,52) = 0,375 PIC = 1 (p1 2 1 2

En cambio, un marcador con cuatro alelos (alelos 1, 2, 3 y 4) en el que cada alelo tiene una frecuencia p = 0,25, presentar en principio seis posibles combinaciones de heterocigotos, con genotipos (1-2), (1-3), (1-4), (2-3), (2-4) y (3-4). Por tanto, para calcular todos los posibles casos de heterocigotos idnticos en la poblacin, habr 2 p 2)] + [2 (p 2 p 2)] + [2 (p 2 p 2)] + [2 (p 2 p 2)] + hasta completar que sumar [2 (p1 2 1 3 1 4 2 3 las seis posibles combinaciones de heterocigotos. Aplicando la frmula general: Heterocigosidad = [1 (0,252 + 0,252 + 0,252 + 0,252 )] = 0,75 PIC = 1 (0,252 + 0,252 + 0,252 + 0,252 ) 6 [2 (0,252 0,252 )] = 0,703 Como se ve, el hecho de que un marcador tenga cuatro posibles alelos en vez de dos aumenta su informatividad casi al doble. De hecho, un marcador con 10 alelos arrojara, aplicando la frmula anterior, un PIC de 0,891 si las frecuencias allicas son iguales. Por tanto, de los distintos marcadores que se han mencionado ms arriba, los ms informativos son los de tipo microsatlite, seguidos por SNP y RFLP. De todas formas, como ya se ha comentado, la posibilidad de estudiar a la vez miles de SNPs de forma automatizada (algo que no es posible con los microsatlites), junto con su alta densidad a lo largo del genoma, hace que los SNP sean hoy en da los marcadores de mayor utilidad en la construccin de mapas de ligamiento gentico de todo el genoma. Sea cual sea el tipo de marcador utilizado, los estudios de ligamiento requieren genotipar a todos los miembros de una familia para detectar la presencia de individuos

www.FreeLibros.me

144

recombinantes y as poder calcular la fraccin de recombinacin. En el ejemplo de la familia con una enfermedad autosmica dominante presentado en la Figura 11.2, hemos podido establecer que el individuo transmisor de la enfermedad transmita a la vez el alelo 2 del marcador, ya que ambos se localizan a poca distancia en el mismo cromosoma. Sabemos esto porque este individuo, a su vez, hered la enfermedad de su padre, que tambin le transmiti el alelo 2 del marcador. Cuando en un individuo que transmite una enfermedad podemos determinar inequvocamente el origen parental tanto del alelo que causa la enfermedad como de los alelos del marcador es decir, podemos determinar qu alelos de cada uno de los dos loci van en el mismo cromosoma se dice que conocemos la fase de ligamiento de ese individuo. Precisamente es el hecho de conocer la fase de ligamiento en el individuo transmisor lo que hace que todas las meiosis de este individuo sean informativas, y nos permite determinar con certeza si los individuos de la descendencia son recombinantes o no. Se recordar que en el caso concreto de esta familia haba un individuo recombinante de un total de seis, lo que sugiere que ambos loci (el marcador y el gen de la enfermedad) estn en ligamiento a una distancia que produce un recombinante de cada seis individuos (fraccin de recombinacin = 1/6 = 0,17, es decir a una distancia gentica de 17 cM). El principal problema es que este resultado podra haberse dado por azar: tericamente es posible que no haya ligamiento y que una descendencia ms numerosa nos mostrase una fraccin de recombinacin ms cercana al 50 por ciento de individuos recombinantes. Frente a esta hiptesis nula (no ligamiento) tenemos una hiptesis alternativa de que existe ligamiento entre ambos loci, a una distancia tal que origina una = 0,17. Cmo podemos determinar cul de las dos hiptesis es la verdadera o, al menos, la que mejor explica los datos obtenidos en esta familia?

Ligamiento gentico en humanos

11.3 El clculo del LOD score


Para cuantificar la significacin de cada una de estas hiptesis, los estudios de ligamiento utilizan un mtodo llamado Estimacin de la Mxima Verosimilitud (verosimilitud es la traduccin del trmino ingls likelihood). Este mtodo consiste en estimar la verosimilitud de cada hiptesis, calculando la probabilidad de encontrarnos con esa fraccin de recombinacin cuando se verifica esa hiptesis. Por ejemplo, para estimar la verosimilitud de la hiptesis de ligamiento, calculamos la probabilidad de obtener un recombinante de cada seis individuos en el caso de que exista ligamiento a una distancia de 17 cM; para estimar la verosimilitud de la hiptesis nula, calculamos la probabilidad de obtener un recombinante de cada seis individuos en el caso de que no exista ligamiento, y as sucesivamente. El razonamiento matemtico para estimar estas probabilidades se puede ilustrar con un ejemplo del lanzamiento de monedas.
La Figura 11.4 ilustra el modo de estimar la verosimilitud de una hiptesis.

Aplicando esta forma de proceder al rbol que hemos venido estudiando, recordamos que hay cinco individuos no-recombinantes y un recombinante, luego formulamos la hiptesis H1 de que la distancia entre el locus de la enfermedad y el locus

www.FreeLibros.me

del marcador es tal que producen una frecuencia de recombinacin = 1/6. Por tanto, bajo esta hiptesis, la probabilidad de encontrar un individuo recombinante es P(R) = 1/6, y la probabilidad de encontrar un no-recombinante es P (NR) = 5/6. La verosimilitud de que esta hiptesis (H1, = 1/6) explique nuestros datos experimentales (5 no-recombinantes y 1 recombinante) se calcula aplicando la frmula general: L (H1) = R (1 )NR Por el contrario, la verosimilitud de la hiptesis nula para explicar nuestros datos sera: L (H0) = (R + NR) Para calcular cuntas veces ms verosmil es nuestra hiptesis que la hiptesis nula, hallamos el cociente de verosimilitudes (likelihood ratio). En Gentica Humana, para que este cociente sea significativo al 95 % se requiere que sea mayor o igual a 1 000. Es fcil darse cuenta de que uno de los principales problemas que nos encontramos es el tamao pequeo de las generaciones, al contrario de los estudios de ligamiento que se hacen en otras especies. Una forma de solventar este problema es repetir el anlisis en varias familias distintas, y combinar los resultados obtenidos en cada una de ellas con el fin de aumentar la potencia estadstica de los estudios de ligamiento. Para poder combinar resultados de familias distintas, Newton Morton ide el concepto del Lod score (que podra traducirse como puntuacin lod y se representa por la letra Z), que es el log del cociente de verosimilitudes. Por tanto, un co10 ciente de verosimilitudes = 1 000 equivale a un lod score igual a 3 (Z = 3), y ste es precisamente el valor mnimo de Z que se requiere para poder afirmar que existe ligamiento significativo entre dos loci. Para hallar el lod score mximo de todos los posibles, es habitual utilizar programas informticos que calculan directamente el lod score que se obtiene para varias hiptesis de ligamiento y a distintos valores de . Adems, como los resultados de una sola familia raras veces sern significativos, necesitamos combinar los resultados obtenidos a partir de los datos de varias familias. Para ello, se suman los lod scores (Z) obtenidos para cada en las distintas familias que estamos analizando, hasta identificar la fraccin de recombinacin a la que obtenemos el lod score mximo en el conjunto de las familias analizadas. ste es el valor que finalmente nos permitir afirmar si existe o no ligamiento significativo entre el gen de la enfermedad y este marcador. Adems, como la Z mxima se obtiene a una fraccin de recombinacin concreta, podemos tambin estimar la distancia gentica ms probable entre ambos loci, expresada como siempre en centimorgans. Por ejemplo, si la Z mxima se obtuvo a una = 0,16, la distancia gentica entre ambos loci estar en torno de 16 cM, con un intervalo de confianza cuyo clculo es tambin sencillo.
La Figura 11.5 incluye un vdeo y varios grficos que explican el modo de calcular el LOD store.

145

El clculo del LOD score

Un problema muy importante en los estudios de ligamiento es que muchas veces no podemos deducir la fase de ligamiento en el progenitor que transmite la enfer-

www.FreeLibros.me

146

medad, al no poder establecer con exactitud si un alelo concreto del marcador est en el mismo cromosoma que lleva el alelo mutado o si est en el cromosoma homlogo. Lgicamente, esto impide establecer si un individuo de la descendencia es recombinante o no, y por tanto complica mucho el clculo de la fraccin de recombinacin. De hecho, hay dos posibles fases de ligamiento que tienen la misma probabilidad, y esto ha de tenerse en cuenta a la hora de estimar la verosimilitud de cada hiptesis. As, se calcula el cociente de verosimilitudes para cada una de las fases de ligamiento alternativas y se halla el lod score promedio de ambas: Z () = log10[1/2[R(1 )NR/0,5(R + NR)] + 1/2[NR(1 )R/0,5(R + NR)]] Lgicamente, el desconocimiento de la fase de ligamiento en el individuo que transmite la enfermedad hace que el valor final del lod score sea ms bajo, por lo que si los loci estudiados estn realmente en ligamiento ser necesario estudiar un mayor nmero de familias para poder alcanzar el valor umbral de Z = 3. Es muy til representar los valores que adopta el lod score Z en funcin de los distintos valores de la fraccin de recombinacin . Cuando se hace esto, podemos observar varios tipos posibles de curva:

Ligamiento gentico en humanos

Si no se ha encontrado ningn individuo recombinante en ninguna de las familias estudiadas, esto quiere decir que los dos loci que estamos estudiando (el locus de la enfermedad y el del marcador) estn en ligamiento y tan cercanos entre s que no se producen sobrecruzamientos entre ellos. El lod score es mximo a = 0, para ir bajando hasta Z = 0 para una = 0,5. Cuando existe ligamiento, lo ms habitual es hallar una curva de forma parablica, con un pico mximo de lod score a una determinada fraccin de recombinacin. En estos casos el lod score a la fraccin de recombinacin = 0 debe ser ( ), ya que hemos encontrado individuos recombinantes en alguna de las familias y esto hace imposible la hiptesis de que la fraccin de recombinacin sea cero. El intervalo de confianza de la fraccin de recombinacin mxima se calcula trazando una horizontal una unidad de lod score por debajo de la Z mxima, y viendo dnde corta ambas ramas de la curva. Como siempre, el lod score Z se hace 0 para una fraccin de recombinacin = 0,5, pues en este caso el cociente de verosimilitudes L(H1)/L(H0) = 1, y el log10 de 1 es igual a 0. En ocasiones, la curva alcanza valores de Z inferiores a 2. En estas circunstancias podemos afirmar que NO existe ligamiento por debajo de una determinada fraccin de recombinacin y por tanto ambos loci necesariamente estn a una distancia gentica superior a la indicada por esa fraccin de recombinacin (si es que efectivamente estn en ligamiento). Finalmente, hay ocasiones en que no encontramos ligamiento significativo, pero tampoco podemos excluirlo para ninguna de las estudiadas, puesto que no hay ningn valor de lod score que sea superior a +3 o inferior a 2. En estos casos no podemos extraer ninguna informacin til de los datos obtenidos de estas familias.

www.FreeLibros.me

11.4 Ligamiento no paramtrico y su utilizacin 11.4 en Gentica Humana


Como acabamos de ver, uno de los requisitos para poder hacer estudios de ligamiento mediante el clculo de lod score es conocer el tipo de herencia de la enfermedad que estamos estudiando, ya que sin esta informacin es imposible detectar la presencia de individuos recombinantes. De hecho, los programas informticos que realizan los clculos para el anlisis de ligamiento exigen que se introduzcan varios parmetros indicando el tipo de herencia (autosmica dominante, recesiva, etc.). Por desgracia, la mayora de las enfermedades complejas (aquellas que estn determinadas por varios genes y por factores ambientales) no siguen un patrn hereditario mendeliano tpico, por lo que los estudios de ligamiento clsicos que se han estudiado hasta ahora no se pueden aplicar. En estos casos hay que acudir a mtodos de ligamiento que no requieren ajuste de la muestra a un modelo concreto de herencia, llamados por tanto mtodos no-paramtricos o independientes de modelo. Hay bsicamente dos tipos de pruebas, las que detectan ligamiento y las que detectan asociacin allica. Es muy importante darse cuenta de la diferencia entre ambos conceptos: el ligamiento es un fenmeno que afecta a loci se dice, por ejemplo, que dos loci estn en ligamiento a una distancia determinada pero el alelo del marcador que viaja con el alelo de la enfermedad puede ser diferente en familias distintas. Por ejemplo, en una familia concreta podemos detectar ligamiento porque la enfermedad siempre segrega junto con el alelo A1 de un marcador, pero en otra familia distinta (con la misma enfermedad) el alelo mutado puede viajar con el alelo A5 de ese mismo marcador. Ambos loci (el marcador y el gen de la enfermedad) estn en ligamiento pero en cambio no siempre se dan las mismas asociaciones de alelos en todas las familias. Esto es as porque existe una situacin de equilibrio de Hardy-Weinberg entre ambos loci, de manera que cada alelo de uno de los locus puede encontrarse con cualquiera de los alelos del otro locus. Los mtodos de anlisis de ligamiento no paramtricos que detectan asociacin allica buscarn precisamente desviaciones de esta situacin de equilibrio, detectando la presencia de un haplotipo (una determinada combinacin de alelos para dos loci distintos, en nuestro caso seran el alelo mutado y un alelo concreto del marcador) que se encuentre con mayor frecuencia de la que cabra esperar si esos loci estuviesen en equilibrio. Si demostramos que, incluso en familias distintas, la enfermedad se asocia significativamente con un alelo concreto del marcador, podemos decir que existe asociacin allica; como la principal causa de asociacin allica es el desequilibrio de ligamiento por cercana fsica de ambos loci (estn tan cercanos uno al otro que no se ha alcanzado todava el equilibrio de Hardy-Weinberg entre ellos), la asociacin allica se traduce en cercana fsica. Por tanto, podemos servirnos de la asociacin allica para localizar genes responsables de enfermedades complejas. A continuacin se explica brevemente cmo funciona cada uno de estos mtodos: 1. Los mtodos que detectan ligamiento buscan alelos compartidos por todos los individuos que estn enfermos en una misma familia. Para comprender cmo se hace esto, es importante aprender a distinguir los alelos que son

147

Ligamiento no paramtrico y su utilizacin en Gentica Humana

www.FreeLibros.me

148

idnticos por descendencia (situacin que se denomina IBD: identical by descent) de los alelos que son idnticos por estado (IBS: identical by state).

Ligamiento gentico en humanos


1. 1.

1-2

3-4

1-2

3-4

1-2

3-4

1-3

1-3 2 IBD 1-4 1 IBD 2-3 2-4 0 IBD

1-3 1-

1-3 2 IBD 1-4 1 IBD

1-3 -

1-3

2 IBD

En la Figura 11.6 se intenta mostrar el concepto de alelos IBD y alelos IBS.

Los estudios de alelos idnticos por descendencia entre individuos enfermos de una misma familia se basan en el hecho de que los hermanos que padecen una misma enfermedad tienen mayor probabilidad de compartir el segmento genmico que contiene el gen causante de esa enfermedad. En ese segmento tambin habr, en la vecindad del gen, algunos marcadores (polimorfismos), y por tanto esas parejas de hermanos tambin sern idnticos por descendencia para los alelos de esos marcadores. En general, se puede demostrar que dos hermanos tienen una probabilidad del 25 por ciento de tener dos alelos cualesquiera idnticos por descendencia (probabilidad de 1/4), una probabilidad del 50 por ciento de compartir un alelo IBD (dos de cuatro posibilidades) y una probabilidad del 25 por ciento de no compartir ningn alelo IBD. En cambio, si ambos hermanos han heredado la enfermedad, compartirn el segmento genmico que contiene el gen causal, incluidos los marcadores cercanos, por lo que encontraremos alelos IBD de esos marcadores en una frecuencia superior a la esperable por el azar. Por ejemplo, en una enfermedad autosmica dominante el 50 por ciento de los hermanos enfermos compartirn en promedio dos alelos IBD, y el 50 por ciento restante compartirn un alelo IBD; en el caso extremo de una enfermedad autosmica recesiva, todos los hermanos afectados compartirn como promedio dos alelos IBD. Por tanto, para realizar estas pruebas es preciso analizar miles de marcadores dispersos por todo el genoma en un nmero bastante grande de parejas de hermanos enfermos, y as detectaremos una frecuencia de alelos IBD significativamente superior a lo que sera esperable por el azar para aquellos marcadores cercanos al gen de la enfermedad. Por esta razn, este mtodo se denomina frecuentemente ASP (affected sib-pair, parejas de hermanos afectados), porque busca regiones que sean idnticas por descendencia en parejas de hermanos afectados por la misma enfermedad. Como a veces no es fcil contar con el nmero suficiente de parejas de hermanos enfermos, otra

www.FreeLibros.me

2.

variante de este mtodo estudia miembros ms distantes de una misma familia, conocido como APM (affected pedigree member, miembro afectado del rbol familiar). Como se ha mencionado, para poder detectar ligamiento utilizando estos mtodos es necesario genotipar un nmero elevado de marcadores distribuidos por todo el genoma y detectar aquellos cuyos alelos son compartidos por parientes enfermos en proporciones significativamente mayores a lo esperable por azar. Estos anlisis se realizan utilizando programas informticos, tales como SIBPAL o GENEHUNTER. Adems, Haseman y Elston desarrollaron un algoritmo para aplicar esto mismo a variables cuantitativas (cualquier variable cuantificable numricamente), haciendo una grfica que representa la diferencia entre hermanos para esa variable elevada al cuadrado (en ordenadas), frente al porcentaje de alelos IBD compartidos por hermanos (en abscisas). Si la pendiente de la recta de ajuste es significativamente negativa, esto indica que hay ligamiento, ya que en ausencia de ligamiento los valores deben distribuirse alrededor de una lnea vertical centrada en torno al 50 por ciento de alelos IBD. Deteccin de asociacin allica. Cuando no se dispone de parejas de hermanos para estudios que buscan alelos idnticos por descendencia, se pueden hacer estudios de asociacin allica para detectar un marcador muy cercano al gen que causa una enfermedad. Aunque los estudios de asociacin allica pueden emplearse tambin en cualquier situacin, resultan especialmente tiles en poblaciones aisladas sometidas a cierto efecto fundador, en las que todava no han pasado el nmero suficiente de generaciones para que todos los alelos presentes en la poblacin hayan llegado a una equilibrio de HardyWeinberg. Por ejemplo, la identificacin del gen que est mutado en una enfermedad llamada Hemocromatosis Hereditaria se identific gracias a que la mutacin especfica se origin en una regin geogrfica concreta, y hoy en da se encuentra especialmente en poblaciones de origen celta. El tipo de familia que se necesita para los estudios de asociacin es muy sencillo: ambos padres y un solo descendiente enfermo. El clculo puede hacerse mediante dos pruebas: TDT (Transmission-Disequilibrium Test, prueba de transmisin del desequilibrio) o HRR (Haplotype Relative Risk, riesgo relativo de un haplotipo), aunque el ms popular y ms usado es el mtodo del TDT. Para realizar este test, se analiza un mismo marcador en varias familias distintas, escogiendo un marcador para el que los progenitores sean heterocigotos; a continuacin se compara la frecuencia con la que se transmite cada alelo de los padres al hijo afectado. Al hacer esto en varias familias, podemos detectar si hay algn alelo concreto del marcador que se transmita preferencialmente a los hijos afectados sobre lo que sera esperable por el azar. Por ejemplo, si a es el nmero de veces que un progenitor transmite el alelo A1 de un marcador, y b es el nmero de veces que transmite un alelo distinto a A1, se puede demostrar que el estadstico (a b)2/(a + b) sigue una distribucin chi-cuadrado con un grado de libertad. Si la frecuencia de transmisin de este alelo a hijos enfermos es significativamente ms alta de lo esperable por azar, podemos concluir que existe asociacin allica y que, por tanto, el gen de la enfermedad est muy cercano a este marcador. Lgicamente, como

149

Ligamiento no paramtrico y su utilizacin en Gentica Humana

www.FreeLibros.me

150

a priori no sabemos dnde est localizado el gen, hay que hacer el anlisis utilizando miles de marcadores distribuidos por todo el genoma, hasta dar con uno que muestre asociacin con la enfermedad.
La Figura 11.7 ilustra el Test de Transmisin de Desequilibrio (TDT) como medida de asociacin allica.

Ligamiento gentico en humanos

Como resumen, a la hora de escoger un mtodo para la deteccin de genes responsables de enfermedades complejas hemos de tener en cuenta el tipo de familias de que disponemos, as como factores de tipo material y econmico (derivados del altsimo nmero de genotipajes que es necesario realizar). Aunque los tests de ASP requieren menos genotipajes, la regin genmica compartida que detectan es bastante grande, por lo que la identificacin posterior del gen que causa la enfermedad sera ms laboriosa. Por eso, lo ideal es complementar un estudio de ASP con estudios de asociacin allica, que requieren el genotipaje de muchos ms individuos, pero revelan regiones genmicas habitualmente menores a 1 megabase. Aunque los estudios que utilizan ligamiento no-paramtrico o asociacin allica suelen dar resultados cuya significacin es difcil de cuantificar, y a menudo los resultados obtenidos en estudios distintos no concuerdan entre s, son los nicos mtodos vlidos para localizar genes implicados en el desarrollo de enfermedades complejas (polignicas y multifactoriales). Precisamente son estas enfermedades las que tienen mayor repercusin socio-sanitaria, por afectar a gran parte de la poblacin. Las nuevas tecnologas de genotipaje que utilizan marcadores tipo SNP (Single Nucleotide Polymorphisms, ya vistos anteriormente) han acelerado enormemente la identificacin de genes que confieren susceptibilidad a enfermedades comunes. Por ejemplo, en los ltimos aos se ha demostrado asociacin entre el gen CAPN10 y la susceptibilidad a desarrollar diabetes tipo 2, as como tambin entre un polimorfismo en el gen de la interleuquina 12 y la diabetes tipo 1. Es previsible que en los prximos aos se identifiquen las principales variantes que confieren susceptibilidad a las enfermedades ms frecuentes. Por ejemplo, podemos pensar que en un futuro no muy lejano un paciente hipertenso que acuda a la consulta gentica ser estudiado para detectar variantes de susceptibilidad en varios genes, y gracias a los resultados se le clasificar dentro de un grupo molecular determinado que permitir asignarle un tratamiento diettico o farmacolgico especfico. Desde este punto de vista, el genotipaje de polimorfismos concretos puede convertirse en un anlisis de rutina en el diagnstico de un nmero creciente de enfermedades humanas en el prximo decenio. En este sentido, es importante detectar los SNP que pueden ser ms informativos en estos estudios: se estima que en toda la poblacin mundial se encuentran unos 10 millones de SNPs en los que ambas variantes allicas tienen una frecuencia mayor o igual a uno por ciento. A pesar del indudable inters que tienen estos polimorfismos para realizar estudios de asociacin allica, genotipar todos estos SNPs en un nmero grande de individuos es, hoy por hoy, impracticable. Podemos salvar este obstculo gracias a que muchos SNP, por estar muy cerca fsicamente, se heredan juntos en pequeos bloques en los que todava no se ha alcanzado el equilibrio de Hardy-Weinberg. Es decir, se pueden identificar bloques de desequilibrio de ligamiento en el genoma, puesto que los alelos de los SNP que estn en un mismo blo-

www.FreeLibros.me

que estn en desequilibrio de ligamiento. La combinacin concreta de alelos de los distintos SNP que estn en un mismo bloque constituye un haplotipo caracterstico de ese bloque. Por tanto, un grupo reducido de SNPs de cada haplotipo pueden ser representativos de todo ese haplotipo (por lo que reciben el nombre de tag-SNPs, o SNP-etiqueta); de este modo, no es necesario genotipar todos los SNPs del genoma, sino slo los SNP-etiqueta. De hecho, se estima que bastara con analizar unos 200 000 para cubrir todos los haplotipos del genoma humano, y esa es una cifra que se puede estudiar con la metodologa actual. Recientemente se ha publicado un mapa de 1,6 millones de SNPs que han sido genotipados en 71 individuos estadounidenses de ascendencia europea, asitica y africana. Este mapa fue completado por el Proyecto Internacional Hapmap, que public en 2005 un mapa con todos los haplotipos de SNPs presentes en diversas poblaciones humanas, como se ha explicado en el Captulo 4. Este mapa permite identificar la estructura y el tamao de los bloques de desequilibrio de ligamiento del genoma, y har posible la realizacin de estudios de asociacin para identificar las regiones donde residen los genes que confieren susceptibilidad a enfermedades comunes.

151

Ligamiento no paramtrico y su utilizacin en Gentica Humana

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 12

Los genes en las poblaciones

Contenidos
12.1 12.2 12.3 12.4 12.5 12.6 12.7 12.8 El equilibrio de Hardy-Weinberg Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios Cambios en las condiciones que mantienen el equilibrio: efectos del tamao poblacional Cambios en las condiciones que mantienen el equilibrio: migracin o flujo gentico Cambios en las condiciones que mantienen el equilibrio: recombinacin y mutacin Cambios en las condiciones que mantienen el equilibrio: seleccin Aplicaciones en Gentica Humana Formacin de la Teora Sinttica de la Evolucin

12.9 Explicacin actual del proceso evolutivo y sus limitaciones

La evolucin biolgica es el resultado de los cambios en los tipos y frecuencias de los alelos existentes en una poblacin de individuos, siempre y cuando dichos cambios son transmitidos a la generacin siguiente. En otras palabras, la evolucin es el cambio en la constitucin gentica de una poblacin a lo largo del tiempo. Es importante comprender que: i) el hecho de que los cambios sean heredables quiere decir que la base molecular de la evolucin est en los genes; ii) la evolucin no afecta a individuos, sino a poblaciones.

12.1 El equilibrio de Hardy-Weinberg


La elaboracin del concepto actual de evolucin se remonta a los orgenes de la gentica de poblaciones, que describe la estructura gentica de una poblacin de individuos y predice sus cambios en el tiempo. G. H. Hardy y W. Weinberg demostraron en 1908 que en una poblacin sometida a unas condiciones determinadas se observa que: i) las frecuencias de los alelos se mantienen estables durante sucesivas generaciones, y ii) las frecuencias genotpicas tambin se mantienen constantes, debido a que dependen exclusi-

www.FreeLibros.me

154

vamente de las frecuencias allicas. Estos postulados se conocen como la Ley del equilibrio de Hardy-Weinberg. Cuando no se dan las condiciones necesarias para que se cumplan estos presupuestos, aparecen alelos nuevos en la poblacin o bien las frecuencias allicas cambian. Esto, a su vez, crea las condiciones bsicas necesarias para que pueda darse evolucin. Las condiciones que deben cumplirse para que una poblacin se encuentre en equilibrio gentico, es decir, para que se cumpla la Ley de Hardy-Weinberg, son:

Los genes en las poblaciones

Poblacin de tamao grande en la que todos los individuos se reproducen. Los cruzamientos entre individuos de la poblacin se producen al azar. Ausencia de mutacin. Ausencia de seleccin natural. Ausencia de flujos migratorios.

Lgicamente, en la prctica es muy improbable encontrar una poblacin en la que se cumplan todas estas condiciones, por lo que la evolucin es un hecho tan frecuente en la naturaleza. La gran aportacin metodolgica de Hardy y Weinberg es que permite abordar el estudio de los cambios en la estructura gentica de una poblacin en trminos matemticos precisos. En primer lugar, dedujeron una ecuacin que permite predecir las frecuencias genotpicas a partir de las frecuencias allicas, y por tanto saber si una poblacin se encuentra en equilibrio. Segn la ecuacin del equilibrio de Hardy-Weinberg, p2 + 2pq + q2 = 1 siendo p y q las frecuencias de los dos alelos A y a de un gen que controla un carcter fenotpico. En estas circunstancias, en una especie diploide, encontraremos individuos con tres posibles genotipos: AA, aa y Aa. Por tanto, es fcil establecer la relacin entre frecuencias allicas y frecuencias genotpicas: p = AA + 1/2 Aa q = aa + 1/2 Aa Lgicamente, al haber slo dos alelos se cumple que p+q=1 p=1q q=1p De aqu se puede deducir que las frecuencias de los genotipos de los individuos de la poblacin se distribuyen segn la expansin del binomio: (p + q)2 = p2 + 2pq + q2 es decir, p2 es la frecuencia de individuos con el genotipo AA, q2 es la frecuencia de individuos con el genotipo aa, y 2pq es la frecuencia de individuos heterocigotos Aa. Lgicamente, el total es el 100 por cien de los individuos de la poblacin, luego p2 + 2pq + q2 = 1 Llegados a este punto es importante recalcar una serie de conceptos fundamentales. En primer lugar, las frecuencias allicas son en s mismas estables. Este concepto es muy importante y fue revolucionario en su momento, porque hasta Hardy y

www.FreeLibros.me

Weinberg se pensaba que los alelos dominantes van desplazando a los alelos recesivos de la poblacin con el transcurso del tiempo, hasta eliminarlos por completo. Hardy y Weinberg demostraron que esto no es as, siempre que se cumplan las condiciones bsicas de equilibrio. De hecho, no todas las desviaciones del equilibrio producen evolucin, porque muchas veces se alteran las frecuencias genotpicas sin que cambien las frecuencias allicas. Como veremos a lo largo de este captulo, cuando no se cumple alguna de las condiciones necesarias para el equilibrio gentico podemos tener cambios en las frecuencias allicas, en las frecuencias genotpicas, o en ambas.

155

Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios

12.2 Cambios en las condiciones que mantienen el equilibrio: 12.2 cruzamientos no aleatorios
Hardy y Weinberg demostraron que, en una poblacin que no est sometida a ninguna fuerza evolutiva, las frecuencias allicas se mantendrn constantes en generaciones sucesivas siempre que los cruzamientos entre individuos sean aleatorios. Por ejemplo, para un carcter determinado por un gen que tiene dos alelos A y a, de modo que la mitad de los alelos sean A y la otra mitad sean a (frecuencias allicas de 0,5 para cada alelo), las frecuencias genotpicas sern 0,25 AA, 0,5 Aa y 0,25 aa. Si los individuos de esta poblacin se reproducen al azar, encontraremos tericamente nueve tipos de cruzamientos, todos en la misma proporcin: AA AA AA AA Aa aa Aa Aa Aa AA Aa aa aa aa aa AA Aa aa

Si ahora calculamos los genotipos de la descendencia que resulta de cada cruzamiento, asignando cuatro descendientes por pareja, tendremos los resultados que se muestran en la siguiente tabla: Cruzamiento aleatorio Cruzamientos posibles AA AA AA AA Aa AA aa Aa AA Aa Aa Aa aa aa AA aa Aa aa aa Total 4 2 2 1 Genotipos esperados en la descendencia Aa aa 2 4 2 2 2 4 2 18 (50 %)

1 2 2 4 9 (25 %)

9 (25 %)

Como se puede comprobar, en la descendencia se mantienen las frecuencias genotpicas que existan en la generacin anterior: 25 por ciento de individuos AA, 50

www.FreeLibros.me

156

por ciento de individuos Aa y 25 por ciento de individuos aa. Si contamos el nmero de alelos A y a que hay en la nueva poblacin, vemos que tambin las frecuencias allicas se han mantenido estables (50 por ciento de alelos A y 50 por ciento de alelos a). En la naturaleza es bastante frecuente que los cruzamientos no se realicen totalmente al azar. En muchas especies, los individuos se cruzan preferencialmente con otros que tienen ciertas caractersticas fenotpicas (y, por tanto, determinados genotipos). Esto rompe las condiciones de equilibrio y cambia las proporciones genotpicas esperadas. En los procesos de mejora animal y vegetal se utilizan a veces cruzamientos dirigidos, con el fin de obtener individuos que tengan determinadas caractersticas fenotpicas (tamao de la flor, cantidad de carne, etc.). En humanos tampoco es raro que se den cruzamientos preferenciales por razones culturales, sociales, tnicas, geogrficas, etc. Se distinguen varios tipos de cruzamientos preferenciales: Cruzamiento preferencial positivo: en este caso, los individuos tienden a cruzarse con otros que comparten sus mismas caractersticas fenotpicas. En el caso ms extremo, slo tendremos cruzamientos de individuos genotpicamente iguales, es decir AA X AA, Aa X Aa y aa X aa. Por tanto, habr un incremento en el porcentaje de homocigotos y una disminucin en la proporcin de heterocigotos: Cruzamiento Preferencial Positivo Cruzamientos posibles AA AA AA AA Aa aa aa Total 4 1 5 (42 %) Genotipos esperados en la descendencia Aa aa 2 2 (17 %) 1 4 5 (42 %)

Los genes en las poblaciones

Ntese que en una sola generacin las frecuencias genotpicas han variado sustancialmente apartndose del equilibrio, aunque las frecuencias allicas se mantienen en 50 por ciento A y 50 por ciento a. Cruzamiento preferencial negativo: es muy raro en humanos, y se da cuando los individuos se cruzan preferencialmente con otros que tienen caractersticas fenotpicas distintas a las suyas. Tericamente, se produciran seis tipos de cruzamientos, con un aumento en la proporcin de heterocigotos y un descenso en las proporciones de homocigotos: Cruzamiento Preferencial Negativo Cruzamientos posibles AA AA Aa 2 Genotipos esperados en la descendencia Aa aa 2 (contina)

www.FreeLibros.me

(continuacin) AA aa Cruzamientos posibles AA Aa AA Aa aa aa AA aa Aa Total 2 4 Cruzamiento Preferencial Negativo Genotipos esperados en la descendencia Aa aa 2 2 4 2 16 (67 %)

157

Cambios en las condiciones que mantienen el equilibrio: cruzamientos no aleatorios

2 2 4 (17 %)

4 (17 %)

Ntese que, nuevamente, las frecuencias genotpicas se apartan del equilibrio pero las frecuencias allicas se mantienen constantes (50 por ciento A y 50 por ciento a). Endogamia: la endogamia (o consanguinidad, como se denomina en poblaciones humanas) es el cruzamiento entre individuos que guardan algn tipo de parentesco, es decir, que comparten un ancestro comn. Constituye una forma extrema de cruzamiento preferencial positivo, ya que los individuos comparten una gran proporcin de sus alelos (1/2 en el caso de hermanos, 1/8 en el caso de primos hermanos, etc.). La endogamia se puede cuantificar mediante el coeficiente de endogamia (F), que mide la probabilidad de que dos alelos en dos individuos de una poblacin procedan de un ancestro comn (es decir, sean idnticos por descendencia). El cociente de endogamia F puede variar entre 0 (cruzamiento aleatorio) y 1 (todos los alelos son idnticos porque proceden del mismo progenitor). Cuando nos encontramos en una situacin de endogamia, las frecuencias genotpicas van a cambiar de tal forma que la frecuencia de homocigotos AA = p2 + Fpq, la frecuencia de heterocigotos Aa = 2pq 2Fpq y la frecuencia de homocigotos aa = q2 + Fpq. Es decir, con cada generacin de cruces endogmicos, la frecuencia de heterocigotos disminuye y la de homocigotos aumenta. En el caso de retrocruzamientos con un progenitor (como suele hacerse para conseguir lneas puras de ratones, por ejemplo), F = 0,5 y la frecuencia de heterocigotos disminuye a la mitad con cada generacin. En general, el cruzamiento preferencial puede hacer que en pocas generaciones aumente enormemente la proporcin de individuos que son homocigotos para un genotipo. El problema es que a veces un carcter resulta deletreo y los individuos homocigotos tienen su viabilidad o su fertilidad reducidas, por lo que toda la poblacin se ve afectada. Este fenmeno se conoce como depresin endogmica. Lgicamente, la endogamia es un fenmeno ms grave que el apareamiento preferencial, ya que en este ltimo slo se alteran las frecuencias genotpicas para uno o varios genes (aquellos que controlan el carcter que condiciona la preferencia del apareamiento). La endogamia, por el contrario, afecta a todo el genoma y tiene consecuencias ms severas. Aunque la gente piensa que los hijos de matrimonios consanguneos tienen una alta probabilidad de sufrir anomalas, esto no es necesariamente as. nicamente

www.FreeLibros.me

158

cuando en la familia hay algn alelo recesivo deletreo, habr mayor frecuencia de homocigotos para ese alelo como fruto de la consanguinidad. Un ejemplo de lo anterior es el de la comunidad Amish de Pennsylvania y Ohio, que llevan varios siglos viviendo aislados por razones culturales y religiosas. Los matrimonios repetidos entre miembros de la misma comunidad han provocado una situacin de endogamia en la que han aflorado algunas enfermedades recesivas que son mucho ms frecuentes en esta poblacin que en la poblacin general. En este sentido, estudios hechos en nios japoneses han encontrado que cada aumento del 10 por ciento de F conlleva una disminucin de seis puntos del cociente intelectual; adems, en ese mismo estudio se vio que la descendencia de primos hermanos (en la que F = 0,0625) sufri una mortalidad 40 por ciento superior a la de nios de matrimonios no endogmicos. De todas formas, estudios hechos en varias poblaciones han determinado que la descendencia de primos hermanos slo tiene un riesgo de sufrir malformaciones congnitas aproximadamente dos por ciento superior al que existe en la poblacin general, y de hecho los matrimonios entre primos hermanos son relativamente frecuentes en ciertas culturas, como en la hind o la rabe. Hemos visto qu sucede cuando no se cumple una de las condiciones necesarias para mantener el equilibrio de Hardy-Weinberg en una poblacin. Recordemos que la ausencia de cruzamientos aleatorios provoca un desvo del equilibrio, con cambios marcados en las frecuencias genotpicas pero sin afectar a las frecuencias allicas. A continuacin estudiaremos otras situaciones que, adems de alterar las frecuencias genotpicas, tambin producen cambios en las frecuencias allicas en la poblacin.

Los genes en las poblaciones

12.3 Cambios en las condiciones que mantienen el equilibrio: 12.3 efectos del tamao poblacional
Con cierta frecuencia se producen cambios aleatorios en el nmero de alelos que pasan de una generacin a la siguiente, por un efecto de error de muestreo. Dicho error se debe a que en una poblacin no siempre se reproducen todos los individuos, por lo que en la siguiente generacin slo tendremos un subgrupo de los alelos que estaban presentes en la generacin anterior, y esto da lugar a oscilaciones aleatorias en las frecuencias allicas de una generacin a la siguiente. Este fenmeno se conoce como deriva gentica aleatoria, y es equivalente a sacar bolas de un saco que contiene, por ejemplo, 50 bolas blancas y 50 bolas negras (100 bolas en total). Si sacamos 40 bolas para formar 20 parejas (lo que sera equivalente a sacar alelos de una poblacin para generar individuos diploides en la generacin siguiente), lo normal es observar pequeas desviaciones respecto a la proporcin terica esperada de 20 bolas blancas y 20 bolas negras. De este modo, con cada generacin (cada vez que sacamos bolas de una bolsa), las frecuencias allicas oscilan por efecto del azar. Adems, estas oscilaciones sern mayores cuanto menor sea el tamao de la poblacin. Por ejemplo, si de la bolsa que contiene 100 bolas sacamos slo 10 bolas, no sera de extraar que obtuvisemos grupos de 10 bolas en los que la mayora fuesen de un mismo color. Incluso, por mero azar, podramos sacar 10 bolas blancas, en cuyo caso el color blanco se habra fijado en la nueva po-

www.FreeLibros.me

blacin ya que habra desaparecido la posibilidad de sacar bolas negras en sucesivas generaciones. Por tanto, en el caso de poblaciones con un pequeo nmero de individuos que se reproducen, la deriva gentica aleatoria puede tener efectos muy marcados sobre las frecuencias allicas, pudiendo incluso hacer que uno de los alelos sustituya completamente al otro (se dice entonces que un alelo ha quedado fijado y el otro ha sido barrido de la poblacin).
La Figura 12.1 ilustra el error de muestreo y la deriva gentica aleatoria.

159

Cambios en las condiciones que mantienen el equilibrio: efectos del tamao poblacional

La deriva gentica se puede estimar a partir de la variacin allica existente en la poblacin, que se cuantifica mediante la varianza estadstica. En una poblacin de 2) se tamao N con frecuencias allicas p y q, la varianza de la frecuencia allica (sp 2 puede calcular mediante la frmula sp = pq/2N. En otras palabras, la deriva observada en una poblacin depende de las frecuencias allicas y del tamao poblacional. Por el numerador, podemos deducir que la deriva ser mayor si las frecuencias allicas son iguales que si son muy dispares. De la frmula se desprende tambin que la deriva ser ms acusada en poblaciones de pequeo tamao. La deriva gentica tiene dos efectos principales: origina cambios en las frecuencias allicas, y puede tambin reducir la variabilidad gentica cuando alguno de los alelos se fija en la poblacin. Adems, como es un fenmeno aleatorio, encontramos que diferentes poblaciones pueden derivar de modo distinto, aunque al principio del proceso tengan el mismo tamao y las mismas frecuencias allicas. Dos circunstancias afectan especialmente a poblaciones humanas y provocan cambios en las frecuencias allicas de la poblacin por deriva gentica aleatoria. En primer lugar, algunas poblaciones humanas actuales han sido fundadas por un pequeo ncleo inicial de pobladores que han dado lugar a la poblacin actual. Puede suceder que en el grupo inicial de pobladores existiese algn alelo concreto (por ejemplo, una mutacin que causa una enfermedad gentica) en baja frecuencia. Si todos los individuos se reproducen, incluyendo los enfermos, el resultado tras muchas generaciones ser que ese alelo (y la enfermedad causada por l, en nuestro ejemplo) sern muy frecuentes en la poblacin actual. Este fenmeno se conoce como efecto fundador. Hay muchos ejemplos de enfermedades o rasgos genticos cuya alta frecuencia en determinadas poblaciones se puede explicar por un efecto fundador. Por ejemplo, la alta frecuencia del grupo sanguneo 0 entre los indios de Amrica del Sur y Central parece deberse a que todos proceden de un pequeo nmero de pobladores que entraron por el estrecho de Behring al final de la ltima glaciacin, entre los que ese grupo sanguneo deba ser predominante. Quizs el caso ms extremo de efecto fundador es el de la enfermedad de Huntington, un desorden neurolgico que se encuentra con una frecuencia mucho ms alta de lo normal en una pequea poblacin del lago Maracaibo, en Venezuela. Parece que la gran mayora de los pobladores actuales de esa regin, unos 20 000, proceden de una misma mujer que lleg a la zona en el siglo XIX y que sufra la enfermedad. Otro fenmeno similar que perturba las frecuencias allicas por deriva gentica aleatoria es el efecto de cuello de botella. En este caso, alguna causa (un desastre natural, epidemias, guerras) lleva a reducir drsticamente el tamao de una poblacin en una generacin, por lo que las frecuencias allicas de la generacin siguien-

www.FreeLibros.me

160

te sern muy distintas a las de la generacin anterior. En casos de cuello de botella muy acentuados, puede llegarse a la prdida de algn alelo, y a menudo los cuellos de botella provocan una reduccin importante en la diversidad gentica de la poblacin que sobrevive. Hasta ahora hemos visto situaciones que alteran el equilibrio de Hardy-Weinberg en una poblacin, produciendo cambios en las frecuencias genotpicas y allicas por diversos mecanismos. De todas formas, los mecanismos ms importantes para generar evolucin son los que introducen nuevos alelos en una poblacin (trasladndolos desde otras poblaciones o generando alelos nuevos a partir de los ya existentes) y la seleccin natural, que elimina o favorece aquellos alelos que permiten la mejor adaptacin de la especie a su medio. En primer lugar veremos los procesos que crean nuevos alelos en una poblacin determinada.

Los genes en las poblaciones

12.4 Cambios en las condiciones que mantienen el equilibrio: 12.4 migracin o flujo gentico
Sin duda, los fenmenos migratorios son actualmente la principal causa de entrada de alelos nuevos en poblaciones humanas. La llegada de individuos con una constitucin gentica distinta (flujo gentico), en la medida en que los nuevos individuos se mezclan con la poblacin existente, hace que las frecuencias allicas de la poblacin receptora cambien o que aparezcan nuevos alelos que antes no estaban presentes. Del mismo modo, la poblacin que sufre la emigracin tambin puede verse sometida a cambios en las frecuencias allicas, si los individuos que la abandonan no son totalmente representativos del acervo gentico de la poblacin. Por ejemplo, si m individuos de una poblacin 1 en la que un alelo tiene una frecuencia q1 migran a otra poblacin 2 en la que ese alelo est en una frecuencia q2, la frecuencia del alelo en la poblacin que resulta despus de la migracin ser q = q1m + q2 (1-m). De esta ecuacin es fcil deducir que el cambio en la frecuencia allica en la poblacin 2 (la poblacin receptora) es igual a m (q1 q2), lo que quiere decir que los efectos sobre las frecuencias allicas dependern del nmero de individuos que migran (m) y de la diferencia inicial en las frecuencias allicas entre ambas poblaciones. Aunque el efecto de la migracin es homogeneizar las diferencias genticas entre poblaciones (al contrario que la deriva o la seleccin natural, como veremos ms adelante), es una causa importante de entrada de nuevos alelos y de aumento de la variabilidad en una poblacin concreta.

12.5 Cambios en las condiciones que mantienen el equilibrio: 12.4 recombinacin y mutacin
Los fenmenos moleculares capaces de crear nuevos alelos o nuevas combinaciones de alelos ya existentes son la mutacin y la recombinacin, respectivamente. La recombinacin tiene lugar en las clulas germinales, durante la meiosis. En el caso de la especie humana, los 23 cromosomas procedentes del gameto masculino se alinean con los procedentes del gameto femenino e intercambian segmentos de material gentico. Esto hace que los cromosomas resultantes lleven combinaciones de alelos

www.FreeLibros.me

(haplotipos) que no estaban presentes en ninguno de los progenitores. Aunque no se crean nuevos alelos sino nuevas combinaciones de los ya existentes, la recombinacin constituye un importantsimo mecanismo de creacin de diversidad gentica. La mutacin es el cambio introducido en el material gentico a nivel molecular, alterando la secuencia de nucletidos. Las mutaciones pueden ser puntuales (si afectan nicamente a un nucletido) o pueden alterar segmentos ms o menos grandes del genoma (alteraciones cromosmicas, por ejemplo). Desde el punto de vista evolutivo, las nicas mutaciones que interesan son las que afectan a las clulas germinales, pues son las nicas que se transmitirn a la generacin siguiente. Lgicamente, adems es necesario que la mutacin se exprese en un fenotipo, es decir, que altere alguna funcin biolgica. Esto no es lo habitual, ya que la mayora de las mutaciones son silenciosas (no alteran la secuencia de aminocidos de la protena codificada por el gen) y, por tanto, son neutras desde el punto de vista evolutivo. Las mutaciones deletreas suelen ser eliminadas por seleccin, aunque a veces quedan en el acervo gentico en forma recesiva y pueden aflorar en generaciones futuras (esto es lo que se conoce como lastre gentico). En definitiva, cuando la mutacin es la nica fuerza evolutiva que acta sobre una poblacin, los cambios en las frecuencias allicas son muy pequeos y seran necesarias muchas generaciones para producir variaciones significativas. Aunque la tasa mutacional (el nmero de mutaciones que se introducen por generacin) vara de una especie a otra y en general es bastante baja, la mutacin es la materia prima sobre la que acta la principal fuerza evolutiva: la seleccin.
Los enlaces de la Figura 12.2 permiten simular el efecto de la migracin y la mutacin sobre las frecuencias allicas.

161

Cambios en las condiciones que mantienen el equilibrio: seleccin

12.6 Cambios en las condiciones que mantienen el equilibrio: 12.4 seleccin


La principal intuicin de Charles Darwin, fruto de las observaciones que le llevaron a escribir El origen de las especies, fue que el principal mecanismo evolutivo es la seleccin natural. El concepto de seleccin natural es simple, y podra definirse como la diferente eficacia biolgica (entendida como viabilidad o capacidad reproductiva) que confieren alelos distintos. As, los alelos que permiten una mejor adaptacin al medio tienden a ser favorecidos, mientras que los alelos deletreos tienden a ser eliminados de la poblacin. Segn esto, los alelos neutros, que no confieren ninguna ventaja ni desventaja, no estarn sometidos a seleccin. Un ejemplo muy citado es el de la polilla Biston betularia, estudiada por H. B. D. Kettlewell en la segunda mitad del siglo XIX en Manchester. Kettlewell observ que antes de 1848 esta especie se encontraba con dos colores distintos, claro u oscuro, y que las polillas oscuras eran menos del dos por ciento de la poblacin de polillas de la zona. Durante los aos siguientes, la proporcin de polillas oscuras fue creciendo hasta llegar a constituir el 95 por ciento del total en el ao 1898. Esto se observaba en las zonas industrializadas, mientras que en las zonas rurales el aumento de polillas oscuras era menos acusado. Como el color de las polillas es un rasgo codificado por un gen, el cambio en

www.FreeLibros.me

162

los colores era el resultado de cambios en las frecuencias allicas. Kettlewell atribuy el cambio al hecho de que la industrializacin de la regin hizo que el holln se depositase en los abedules donde se posaban las polillas, y esto haca que las de color claro destacasen ms y fuesen presa ms fcil de los pjaros depredadores. Las polillas oscuras, en cambio, tenan una mayor probabilidad de pasar desapercibidas y sobrevivir. Por tanto, las polillas oscuras sobrevivan ms que las claras y se reproducan con ms frecuencia, haciendo que los alelos que generan el color oscuro pasaran preferentemente a las generaciones sucesivas. La mejor adaptacin al medio de las polillas oscuras, simplemente por un mecanismo de seleccin, provoc la evolucin de esta especie en esa regin. Para cuantificar los efectos de la seleccin, es necesario calcular la eficacia biolgica relativa o fitness, que es el xito reproductivo relativo de un genotipo concreto. La eficacia se representa por la letra w y su valor vara entre 0 y 1. Por ejemplo, para dos alelos A y a, se puede calcular la descendencia media que produce cada genotipo. Supongamos que los individuos con genotipo AA tienen una media de 10 descendientes, los Aa cinco descendientes y los aa dos descendientes. La eficacia de cada genotipo se calcula como el nmero de descendientes de ese genotipo respecto al genotipo ms eficaz: wAA = 10/10 = 1; wAa = 5/10 = 0,5; waa = 2/10 = 0,2. Una variable relacionada con la eficacia biolgica relativa es el coeficiente de seleccin (s), que indica la intensidad de la seleccin frente a un genotipo determinado. El clculo se hace con arreglo a la frmula s = 1 w, luego en el ejemplo anterior tendramos que sAA = 0; sAa = 0,5; saa = 0,8. Este modelo permite predecir que, en ausencia de otros factores, la diferente eficacia biolgica de cada genotipo provocar cambios en las frecuencias allicas con cada generacin. Estos cambios dependern nicamente de las frecuencias allicas iniciales y de la eficacia biolgica relativa de cada genotipo. As, para genotipos AA, Aa y aa que estn en frecuencias p2, 2pq y q2 respectivamente, con eficacias wAA, wAa y waa, las frecuencias genotpicas tras seleccin durante una generacin sern: f(AA) = p2 wAA f(Aa) = 2pq wAa f(aa) = q2 waa Es importante darse cuenta de que la seleccin, en s misma, no tiene memoria ni es un proceso guiado hacia un fin, no piensa lo que va a suceder dos o tres procesos de seleccin despus. Simplemente consigue la mejor adaptacin a las condiciones ambientales que se dan en un momento dado, pero si esas condiciones cambian los rasgos que haban sido seleccionados pueden volver a perderse. Por eso, la seleccin no es un proceso progresivo de mejora de una poblacin, porque los individuos mejor adaptados en un momento concreto no tienen por qu ser biolgicamente ms perfectos.
En los enlaces de la Figura 12.3 se puede estudiar el efecto de la seleccin en distintas condiciones.

Los genes en las poblaciones

Existen varios tipos de seleccin que tienen distintos efectos sobre las frecuencias allicas y la variabilidad gentica de la poblacin. Si consideramos un rasgo fenot-

www.FreeLibros.me

pico controlado por un gen con dos alelos, podemos distinguir cuatro tipos principales de seleccin: i) seleccin contra uno de los homocigotos. En este caso, uno de los genotipos homocigticos (AA o aa, en los ejemplos que venimos viendo) tiene desventaja adaptativa y por eso la seleccin acta en su contra. La consecuencia es la disminucin progresiva de la frecuencia del alelo presente en ese genotipo. Por ejemplo, en el caso extremo de seleccin completa en contra del genotipo aa, los individuos aa no llegarn a reproducirse y los nicos emparejamientos posibles sern los que se muestran en la siguiente tabla: Seleccin contra un homocigoto (aa) Posibles cruzamientos AA AA AA AA Aa Aa AA Aa Aa Total 4 2 2 1 9 (56 %) Genotipos esperados en la descendencia Aa aa 2 2 2 6 (38 %)

163

Cambios en las condiciones que mantienen el equilibrio: seleccin

1 1 (6 %)

i)

i)

i)

Como se observa, en la siguiente generacin la frecuencia del alelo a habr cado al 25 por ciento (ocho alelos a de un total de 32), y esta tendencia se mantendr mientras dure la seleccin. De todas formas, es importante darse cuenta de que el alelo a nunca llegar a desaparecer de la poblacin, porque siempre ser transmitido por individuos heterocigotos Aa. En las poblaciones humanas, los rasgos recesivos se ven sometidos a este tipo de seleccin, aunque de un modo mucho ms leve. Por una parte, algunos rasgos recesivos, como el albinismo, no suponen una gran desventaja selectiva. Otras enfermedades ms severas, en las que hace aos haba una alta mortalidad antes de llegar a la edad reproductiva, cuentan hoy en da con tratamientos ms eficaces y se consigue que los enfermos vivan ms aos y puedan reproducirse, por lo que el efecto de la seleccin sobre las frecuencias allicas es menor. Si se conocen los valores de eficacia biolgica relativa (w) de cada genotipo (y por tanto los del coeficiente de seleccin s), se puede calcular el cambio que se producir en la frecuencia allica utilizando diversas frmulas para fenotipos recesivos, dominantes o sin dominancia. En la historia reciente de las poblaciones humanas encontramos un ejemplo muy ilustrativo de seleccin contra un homocigoto. Un alelo concreto del gen que codifica el receptor cinco de quimioquinas (alelo denominado CCR5delta32) confiere a las clulas resistencia frente a la invasin por la bacteria causante de la peste bubnica. Los individuos homocigotos para ese alelo son inmunes a la peste, y los heterocigotos tienen cierta inmunidad. Los homocigotos sin ese alelo, en cambio, son los ms susceptibles. Dado

www.FreeLibros.me

164

ii)

ii)

iii)

que las poblaciones europeas fueron sometidas a varias epidemias de peste en los siglos XIV a XVIII, durante las que murieron millones de personas, el alelo CCRdelta32 aument mucho en su frecuencia, y hoy se encuentra en torno al 10 por ciento en poblaciones europeas, muy superior a otras zonas del planeta. Recientemente se ha visto que este alelo tambin protege frente a la infeccin por el virus VIH causante del SIDA. seleccin contra ambos homocigotos. En este caso, ambos homocigotos estn en desventaja selectiva en comparacin con los heterocigotos (wAA < wAa > waa), de ah que se llame seleccin a favor de heterocigotos o tambin sobredominancia. En el caso ms extremo, los individuos AA y aa nunca llegan a reproducirse, por lo que slo hay cruzamientos Aa X Aa. Aunque este tipo de cruzamientos produce 1/4 de homocigotos AA y 1/4 de homocigotos aa, stos no llegan a reproducirse y slo los heterocigotos Aa pasan sus alelos a la generacin siguiente. El efecto neto es que en pocas generaciones se estabilizan las frecuencias de los dos alelos (equilibrio polimrfico estable), por lo que este tipo de seleccin se llama tambin seleccin estabilizante. El ejemplo ms ilustrativo de seleccin contra ambos homocigotos es la relacin entre la anemia falciforme y la malaria en el frica sub-sahariana. La anemia falciforme es una enfermedad recesiva rara, en la se produce un tipo de hemoglobina anormal (hemoglobina S) que hace que sus hemates adquieran una conformacin anmala. Los homocigotos sufren una forma grave de la enfermedad y mueren en la infancia, por lo que habitualmente no llegan a reproducirse. Los heterocigotos, en cambio, sufren una forma leve que no compromete su viabilidad. Curiosamente, la anemia falciforme protege frente a la infeccin por Plasmodium falciparum, el organismo causante de la malaria. El parsito crece dentro de los hemates, pero no puede entrar en hemates que estn deformados como consecuencia de la hemoglobina S. Por tanto, los individuos con hemoglobina normal son mucho ms susceptibles a la infeccin que los individuos con anemia falciforme: los individuos heterocigotos para la hemoglobina S estn relativamente protegidos frente al Plasmodium, aunque no tanto como los homocigotos. Por tanto, tenemos una situacin en la que tanto ambos tipos de homocigotos tienen comprometida su viabilidad: los individuos con dos alelos de hemoglobina S, debido a la anemia falciforme, y los individuos con hemoglobina normal, debido a que son ms fcilmente infectados y mueren de malaria. En cambio, los heterocigotos con un solo alelo falciforme estn relativamente protegidos frente a la malaria y no padecen la forma mortal de anemia, de modo que se ven favorecidos respecto a los homocigotos. El efecto neto es que en las zonas de frica donde hay malaria la frecuencia del alelo falciforme es mucho ms alta que en el resto del planeta. Seleccin contra heterocigotos y uno de los homocigotos. Esto equivale a la seleccin a favor de uno de los genotipos homocigotos (wAA > wAa > waa, por ejemplo). En este caso, los cambios en las frecuencias allicas sern muy rpidos a favor del alelo presente en el genotipo ms eficaz. De hecho, en el caso extremo en que los heterocigotos y un tipo de homocigotos no se re-

Los genes en las poblaciones

www.FreeLibros.me

iv)

produzcan, en una sola generacin puede perderse un alelo y quedar fijado el otro. Por ejemplo, si la seleccin acta contra heterocigotos Aa y homocigotos aa, slo llegarn a reproducirse los individuos AA, con lo que el alelo a estar ausente en la siguiente generacin. Lgicamente, esta forma extrema de seleccin no es frecuente en poblaciones humanas, aunque las enfermedades dominantes en las que tanto los heterocigotos como los homocigotos sufren la enfermedad podran estar sujetas a este tipo de seleccin siempre que estos individuos vean reducida su viabilidad. seleccin contra heterocigotos. Finalmente, si la seleccin acta nicamente en contra de los heterocigotos (wAA > wAa < waa) ocurrir que la poblacin se polarizar hacia los homocigotos, y esto se conoce como infradominancia. En el caso de alelos A y a con frecuencias p = q = 1/2, nicamente habr cruzamientos entre homocigotos de ambos tipos, que producirn una descendencia tpica con proporciones 25 por ciento AA, 50 por ciento Aa y 25 por ciento aa. Seleccin contra heterocigotos (Aa) Posibles cruzamientos AA AA AA AA Aa aa AA aa aa Total 4 4 4 4 (25 %) 8 (50 %) 4 4 (25 %) Genotipos esperados en la descendencia Aa aa

165

Aplicaciones en Gentica Humana

ii)

De todas formas, como los individuos Aa fallecen antes de reproducirse, las frecuencias allicas se reajustarn rpidamente hacia 50 por ciento A y 50 por ciento a. Por tanto, la subdominancia tambin produce un equilibrio polimrfico, pero al contrario que en el caso de la sobredominancia, aqu el equilibrio es inestable. Cualquier perturbacin por alguna otra fuerza evolutiva har que las frecuencias allicas cambien rpidamente hasta fijar uno de los alelos en la poblacin.

12.7 Aplicaciones en Gentica Humana


Aunque ya hemos visto algunos ejemplos en los que las nociones bsicas de la Gentica de poblaciones se aplican a poblaciones humanas, podemos hacer otras consideraciones de gran inters prctico. La ms inmediata es que la Ley de Hardy-Weinberg permite calcular las frecuencias de los alelos mutantes que causan enfermedades humanas. Esto es especialmente til en el caso de enfermedades recesivas, en las que slo los homocigotos desarrollan la enfermedad. Si se conocen las cifras de prevalencia de la enfermedad en una poblacin podemos calcular las frecuencias allicas, la tasa de portadores en la poblacin y las tasas de incidencia pre-

www.FreeLibros.me

166

vistas en generaciones futuras. Por ejemplo, si la prevalencia de una enfermedad recesiva es de 25 enfermos por cada 100 000 habitantes, entonces q2 = 0,00025 y q = 0,016. Por tanto, p = 0,984 y 2pq = 0,031. En otras palabras, en esa poblacin la tasa de portadores es del 3,1 por ciento y se mantendr estable si no se alteran significativamente las condiciones del equilibrio. Tambin es importante hacer algunas consideraciones respecto a la eficacia de las campaas de deteccin prenatal de enfermedades recesivas. La finalidad de estas campaas es evitar que nazcan individuos enfermos, es decir, homocigotos; sin embargo, esto no hace que disminuya la frecuencia allica ni el porcentaje de individuos portadores (heterocigotos). En efecto, tal y como hemos visto al hablar de seleccin frente a un homocigoto (en este caso, recesivo), el alelo deletreo nunca desaparece. Esto significa que las campaas eugensicas son totalmente ineficaces para eliminar alelos recesivos de una poblacin. Por ejemplo, se ha calculado que si la frecuencia del alelo recesivo causante del albinismo en Noruega es del 1 por ciento, un programa eugensico dirigido a eliminar el alelo albino de la poblacin noruega (esterilizando, por ejemplo, a todos los albinos) tardara 100 generaciones en reducir la frecuencia allica a la mitad de su valor actual (0,005) y llevara 9 900 generaciones reducirla al 0,0001. En este sentido, el parmetro ms importante para saber si es factible aplicar una campaa de deteccin prenatal en una enfermedad recesiva es el cociente entre heterocigotos y homocigotos: cuanto menor es la frecuencia del alelo mutante (q), mayor es el cociente 2pq/q2 y la frecuencia allica q apenas bajar debido al alto nmero de portadores en la poblacin. En cambio, estas campaas resultan ms eficaces para hacer disminuir el nmero de nuevos enfermos en el caso de enfermedades recesivas ms frecuentes, en las que q es ms alto y el cociente 2pq/q2 menor. Las enfermedades ligadas al cromosoma X constituyen un caso especial para el clculo de frecuencias allicas y genotpicas, ya que los enfermos son habitualmente varones hemicigotos que slo llevan una copia del alelo mutante. Por tanto, la prevalencia de la enfermedad en la poblacin (varones enfermos por 100 000 habitantes) es igual a q (la frecuencia del alelo mutante). El porcentaje de mujeres homocigticas (y, por tanto, enfermas) es q2, y suele ser muy bajo. Aunque en otras especies es relativamente sencillo calcular la tasa de mutaciones, la eficacia biolgica relativa y el coeficiente de seleccin, en poblaciones humanas slo podemos obtener aproximaciones. Por ejemplo, la tasa de nuevas mutaciones en enfermedades dominantes puede estimarse utilizando la frmula = n/2N, siendo n el nmero de enfermos que nacen de padres sanos (los cuales deben ser homocigotos sanos si la enfermedad tiene penetrancia completa) y N el nmero total de nacimientos. Los clculos de varan de unas enfermedades a otras, lo que refleja que las tasas de mutacin no son iguales para todos los genes. Finalmente, podemos fijarnos en cmo mutacin y seleccin natural actan en direcciones opuestas, en especial sobre los alelos deletreos. stos aumentan por efecto de la mutacin, pero la seleccin tiende a eliminarlos de la poblacin. Cuando ambas fuerzas alcanzan un equilibrio en el que todos los nuevos alelos mutados son eliminados por seleccin, la frecuencia de un alelo deletreo dominante es igual al cociente /s, siendo la tasa de mutaciones y s el coeficiente de seleccin. En el caso de un alelo recesivo, su frecuencia es igual a la raz cuadrada del cociente /s. Si conocemos la tasa de mutacin y la frecuencia allica, podemos calcular la eficacia bio-

Los genes en las poblaciones

www.FreeLibros.me

lgica o viceversa. Por ejemplo, se sabe que la acondroplasia, una enfermedad autosmica dominante, tiene una eficacia w = 0,74, ya que los individuos con acondroplasia son frtiles pero tienen en promedio un 74 por ciento de la descendencia que tienen los individuos sin acondroplasia. Por tanto, s = 1 W = 0,26. Si la tasa mutacional calculada para este gen (usando la frmula del prrafo anterior) es de 3 10-5 mutaciones por generacin, podemos deducir que la frecuencia allica es q = 0,0003/0,26 = 0,0012, que corresponde con la frecuencia de la enfermedad en la poblacin. Una ltima consideracin es la que hace referencia al papel de la seleccin natural en poblaciones humanas en la actualidad. As como a lo largo de nuestra historia la seleccin ha jugado un papel importante en los cambios de frecuencias allicas, y en gran parte del mundo todava es as (recurdese el ejemplo de la malaria en frica), en el mundo industrializado el papel de la seleccin es cada vez menor. Esto es consecuencia de las mejoras en la calidad de vida y en los cuidados sanitarios, que hacen posible que individuos enfermos (que, de otro modo, falleceran antes de la edad reproductiva) vivan ms y puedan llegar a reproducirse y pasar los alelos mutantes a la siguiente generacin. Esto es especialmente claro en el caso de tumores hereditarios de la infancia, como el retinoblastoma, que es una enfermedad de herencia autosmica dominante. Tambin sucede con enfermedades recesivas comunes, como la fibrosis qustica, que hace aos tena una alta mortalidad durante la infancia y en cambio hoy en da los enfermos suelen vivir hasta la edad adulta. Lgicamente, no debemos renunciar a los logros alcanzados en el tratamiento de las enfermedades, pero hemos de ser conscientes de que las poblaciones humanas van acumulando un lastre gentico cada vez mayor.

167

Formacin de la Teora Sinttica de la Evolucin

12.8 Formacin de la Teora Sinttica de la Evolucin


En sentido biolgico amplio, la evolucin es un concepto universalmente aceptado: a lo largo de la historia natural del planeta, unas especies han ido desapareciendo y dando paso a otras que se derivan de las anteriores. Lamarck, al comienzo del siglo XIX, fue el primer naturalista en proponer el concepto de que unas especies se han ido transformando en otras, aunque en aquel momento esto no pasaba de ser una intuicin, sin el respaldo de datos experimentales convincentes. En la Encyclopedia of Genetics, se define evolucin como el proceso mediante el cual, segn unos individuos se diferencian gradualmente de otros al irse reproduciendo, los organismos cambian en otros nuevos a lo largo del tiempo. El diccionario de la RAE, en su 22. edicin, define la evolucin (biolgica) como el proceso constante de transformacin de las especies a travs de cambios producidos en sucesivas generaciones. El Diccionario del Espaol Actual (edicin de 1999) la define como cambio gradual y progresivo de las especies a lo largo de sucesivas generaciones. Este concepto de evolucin es el que est en el imaginario popular, pero no debe ser confundido con la Teora General de la Evolucin, o evolucin tal y como se entiende en mbitos cientficos, que es la teora que intenta explicar los mecanismos que dan lugar a evolucin. La Teora de la Evolucin arranca de las observaciones de Darwin, publicadas en El origen de las especies, y del descubrimiento de las leyes de la herencia por Mendel, a finales del siglo XIX. Darwin us inicialmente la expresin des-

www.FreeLibros.me

168

cent with modification para indicar que pequeos cambios heredados de una generacin a la siguiente podan explicar la transformacin de unas especies en otras. Pero en tiempos de Darwin todava no se haban descubierto los principios de la Gentica, por lo que no se podan describir los mecanismos que producan esos cambios ni cmo se heredaban de una generacin a la siguiente. La gran intuicin de Darwin fue que el principal mecanismo por el que opera la evolucin es la seleccin natural, aunque no pudo demostrarlo experimentalmente por las razones apuntadas. El redescubrimiento de las leyes de Mendel en el ao 1900 y la elaboracin de la gentica de poblaciones en las primeras dcadas del siglo XX dieron lugar a la Teora Sinttica de la Evolucin en torno a 1940. Posteriormente, los datos aportados por la biologa molecular y la biologa del desarrollo han completado y matizado algunos aspectos de la Teora General. Por tanto, actualmente la evolucin se define en trminos cientficos como el proceso mediante el cual una poblacin de individuos adquiere cambios que son heredados a generaciones sucesivas. Por ejemplo, podemos citar la definicin de evolucin que propone Douglas J. Futuyma en su libro Evolutionary Biology (Sinauer Associates, 1986): Biological evolution (...) is change in the properties of populations of organisms that transcend the lifetime of a single individual. The ontogeny of an individual is not considered evolution; individual organisms do not evolve. The changes in populations that are considered evolutionary are those that are inheritable via the genetic material from one generation to the next. Es decir, la evolucin biolgica es el resultado de los cambios, pequeos o grandes, en los tipos y frecuencias de alelos existentes en una poblacin de individuos, ya que esos cambios son transmitidos a las generaciones siguientes. Es interesante ver con un poco ms de detalle el desarrollo histrico de las ideas que han dado lugar al concepto moderno de evolucin. En las primeras dcadas del siglo XX, como hemos visto, Hardy y Weinberg establecieron las bases de la gentica de poblaciones. Los genetistas de principios de siglo pensaban que los alelos dominantes deberan ir desplazando poco a poco a los alelos recesivos de la poblacin, hasta reemplazarlos por completo. Hardy (matemtico) y Weinberg (fsico) demostraron matemticamente que esto no tena por qu ser as, sino que en determinadas condiciones las frecuencias genotpicas deberan mantenerse estables y depender exclusivamente de las frecuencias allicas. En los aos posteriores, Ronald Fisher, J. B. S. Haldane y Sewall Wright desarrollaron estas ideas y elaboraron los conceptos que dieron lugar a la gentica de poblaciones. Fisher, creador de la estadstica moderna y del concepto de varianza, aport entre otras muchas cosas lo que se conoce como el teorema fundamental de la seleccin natural: el cambio en la eficacia biolgica (fitness) depende de la varianza gentica aditiva (en otras palabras, a mayor variacin en la poblacin, mayor capacidad adaptativa). Sewall Wright, por su parte, hizo ms hincapi en los efectos del tamao poblacional, desarrollando el concepto de deriva gentica y proponiendo la existencia de paisajes adaptativos. Todas estas ideas fueron sistematizadas y popularizadas por T. Dobzhansky, que en 1937 public Genetics and the Origin of Species. En este libro se expona una teora unificadora que explicaba de modo razonablemente satisfactorio las leyes por las que opera la evolucin, la Teora Sinttica o sntesis moderna. En torno a 1970 surgieron nuevas hiptesis para explicar aspectos evolutivos concretos, de manera que la Teora Sinttica fue matizada y ampliada para dar lugar a lo que hoy llamamos Teora General de la Evolucin.

Los genes en las poblaciones

www.FreeLibros.me

Todo lo anterior sirve para subrayar la idea que se ha expuesto al principio de este captulo: la evolucin es fundamentalmente un fenmeno que afecta a la constitucin gentica de una poblacin (el acervo gentico, es decir, el conjunto de alelos que estn presentes en una poblacin) y sus cambios en el tiempo. Por tanto, es natural que la evolucin deba ser estudiada con un enfoque eminentemente gentico y utilizando las metodologas propias del anlisis gentico. No se puede afrontar el estudio de la evolucin sin comprender todos los conceptos explicados en la seccin dedicada a la Gentica de Poblaciones. Los mtodos cuantitativos de anlisis de la variabilidad gentica y de la seleccin natural son imprescindibles en cualquier discusin cientfica en torno a la evolucin. De hecho, algunos autores resumen el proceso evolutivo en una expresin sencilla pero llena de significado: los genes mutan, los individuos son seleccionados, las poblaciones evolucionan.

169

Explicacin actual del proceso evolutivo y sus limitaciones

12.9 Explicacin actual del proceso evolutivo y sus limitaciones


El proceso evolutivo se divide habitualmente en tres fases: microevolucin, especiacin y macroevolucin. La primera se refiere a los cambios relativamente pequeos que surgen en una poblacin de individuos de una misma especie, y es la ms fcil de observar y de estudiar experimentalmente. La especiacin es el proceso por el que una especie da lugar a otra u otras mediante un proceso ramificado (cladognesis) o lineal (anagnesis). Macroevolucin se refiere a los cambios observados durante largos periodos de tiempo, que dan lugar a organismos muy diversos. La teora moderna de la evolucin explica satisfactoriamente la microevolucin y la especiacin, pero los mecanismos de macroevolucin son ms hipotticos y sujetos a discusin, ya que la evidencia experimental es ms fragmentaria y menos slida. Una idea central a todos estos procesos es el concepto de especie, que en s mismo es objeto de bastante controversia. Ernst Mayr fue el taxonomista que ms ha contribuido a dar forma al concepto moderno de especie: en organismos de reproduccin sexual, una especie es un grupo de poblaciones naturales que de hecho o en potencia se reproducen entre s y que estn aisladas reproductivamente de otros grupos similares. Este concepto de especie, que puede aplicarse con bastante generalidad a los animales pero con menos fiabilidad a las plantas, ha sido matizado ms recientemente por la gentica molecular y el concepto filogentico de especie: teniendo en cuenta caractersticas taxonmicas basadas en diferencias morfolgicas y funcionales as como diferencias genticas cuantificables por mtodos moleculares, una especie es una rama claramente definida en un rbol filogentico. La teora de la evolucin explica satisfactoriamente cmo se producen la microevolucin y la especiacin. Una idea central en estos procesos, ya presente en la definicin original de especie, es el aislamiento: para que pueda surgir una especie nueva, parte de la poblacin original ha de quedar aislada del resto de los individuos de esa poblacin. De hecho, los ejemplos mejor documentados de especiacin se han verificado en condiciones de aislamiento: por ejemplo, hay evidencias de especiacin especialmente intensa en archipilagos, en los que es frecuente encontrar situaciones de aislamiento geogrfico de poblaciones. Cuando dos poblaciones de una especie quedan separadas reproductivamente por razones geogrficas, seguirn rumbos evo-

www.FreeLibros.me

170
mariposas moscas avispas escarabajos

Los genes en las poblaciones

escarabajos avispas mariposas moscas

La Figura 12.4 explica qu es un rbol filogentico.

lutivos distintos con el paso del tiempo, tanto si los ambientes a los que estn sometidas son distintos o no. Este tipo de especiacin se llama especiacin aloptrica, y es el ms fcil de explicar y para el que se han encontrado ms ejemplos en la naturaleza. Por el contrario, dos poblaciones pueden diverger sin estar aisladas geogrficamente, fenmeno que se conoce como especiacin simptrica. Aunque sta ltima es ms difcil de explicar y est menos documentada, hay algunos ejemplos en plantas. El proceso de especiacin es explicado por la teora moderna de la evolucin utilizando los conceptos de variabilidad, seleccin natural y deriva gentica. El requisito necesario para que haya microevolucin y especiacin es la presencia de variacin gentica. Si no existe variacin, no puede haber evolucin. Como hemos visto, ya Fisher haba postulado que la variacin gentica es directamente proporcional a la velocidad con la que opera la seleccin adaptativa. Al explicar los principios de la Gentica de Poblaciones hemos visto que la mutacin es el principal mecanismo por el que aumenta la variacin gentica, mientras que la seleccin natural habitualmente disminuye la variabilidad existente en la poblacin, aunque en algunos casos la mantiene (seleccin a favor de heterocigotos y equilibrio polimrfico estable). En general, en el caso de dos poblaciones aisladas sometidas a condiciones ambientales distintas, la principal fuerza microevolutiva ser la seleccin. El coeficiente de seleccin y la eficacia biolgica (fitness) permiten predecir la magnitud de los cambios en las frecuencias allicas con las sucesivas generaciones. La teora moderna de la evolucin tambin permite predecir que dos poblaciones en condiciones de aislamiento geogrfico sufrirn evolucin aunque no estn sometidas a presiones ambientales diferentes. Sewall Wright fue el primero en predecir que si el tamao poblacional es pequeo, las frecuencias allicas pueden cambiar rpidamente por deriva gentica aleatoria, sin estar determinadas por la seleccin natural. Un mecanismo frecuente de especiacin es el aislamiento de una poblacin pequea que contiene un pequeo grupo de los alelos presentes en la poblacin original de partida (efecto fundador). En estas condiciones, la deriva gentica puede fijar r-

www.FreeLibros.me

pidamente ciertos alelos en la poblacin y producir evolucin sin seleccin. El papel de la deriva gentica en la evolucin adquiri especial protagonismo tras los trabajos de Motoo Kimura en 1968. Durante los aos precedentes, los avances en biologa molecular haban hecho posible, por primera vez, cuantificar las diferencias genticas que se observan entre especies distintas definidas por el concepto clsico de especie. Estas comparaciones confirmaron que los grupos taxonmicos se correspondan extraordinariamente bien con los grupos filogenticos derivados de la comparacin de secuencias de ADN. Kimura observ que la mayor parte de los cambios moleculares en el ADN eran neutros desde el punto de vista de la seleccin, ya que afectan a nucletidos que no alteran la secuencia de aminocidos de la protena codificada. El descubrimiento de que los genomas de mamferos estn formados en su mayor parte por ADN no-codificante, as como la presencia de numerosos polimorfismos silenciosos y selectivamente neutros ha supuesto un respaldo de la teora neutral de la evolucin, que as complement la Teora Sinttica prevalente hasta los aos 70. La teora neutral hace predicciones importantes, ya que postula que la gran mayora de las mutaciones son neutras y, por tanto, la tasa de cambio evolutivo (a nivel molecular) viene determinada exclusivamente por la tasa de mutacin, independientemente del tamao de la poblacin. Esto introdujo el concepto de reloj molecular, tan importante en los estudios actuales de evolucin molecular. Por otra parte, la teora neutral tambin predice que la probabilidad de fijacin de un alelo en la poblacin depender exclusivamente del tamao de la misma. Estas predicciones se han confirmado en bastantes casos, aunque actualmente la teora neutral se ha modificado para incluir los efectos de alelos deletreos sometidos a seleccin dbil. Dado que la teora sinttica explicaba satisfactoriamente la microevolucin y la especiacin, hasta los aos 70 era comn aceptar que la macroevolucin sera el resultado de estos mismos mecanismos operando durante grandes periodos de tiempo. Este modelo de pequeos cambios graduales a lo largo del tiempo se conoce como gradualismo, y supone que las especies estn constantemente evolucionando a una velocidad lenta. En 1972, Stephen Jay Gould y Niles Eldredge propusieron la hiptesis del equilibrio puntuado, para intentar explicar el hecho de que el registro fsil muestra que muchas especies han estado durante millones de aos bsicamente sin cambios y en poco tiempo sufrieron transformaciones drsticas. Segn estos autores y otros paleontlogos no es necesario que la evolucin acte constantemente, porque muchas especies estn bien adaptadas y no necesitan cambiar si no se alteran las condiciones ambientales. Es precisamente en periodos de cambios ambientales bruscos (glaciaciones, sequas, cambios en el clima o en los recursos alimenticios, depredadores, etc.) cuando la seleccin natural puede favorecer variedades que estaban presentes en la poblacin en baja frecuencia, dando lugar a cambios adaptativos rpidos. Por otro lado, los estudios de evolucin molecular, sobre todo en la comparacin de genomas, han mostrado que muchos genes reguladores y genes implicados en el desarrollo embrionario estn muy conservados en la naturaleza. En concreto, la biologa del desarrollo estudia los genes responsables de los patrones corporales, la polaridad, las extremidades y la organognesis. Los genes implicados en estos procesos son extraordinariamente similares entre especies evolutivamente distantes, lo que ha llevado a generar una nueva disciplina llamada biologa del desarrollo evolutiva

171

Explicacin actual del proceso evolutivo y sus limitaciones

www.FreeLibros.me

172

(evo-devo, del ingls evolutionary developmental biology). La idea que se extrae de estos anlisis es que pequeos cambios en genes clave, que regulan la expresin de un nmero elevado de genes distintos, puede producir alteraciones morfolgicas importantes en un periodo corto de tiempo.
La Figura 12.5 muestra la organizacin de los genes homeobox en humanos y en Drosophila.

Los genes en las poblaciones

En esta misma lnea, los estudios comparativos de los genomas de distintas especies muestran que la duplicacin de genes, la duplicacin de genomas y los reordenamientos cromosmicos han sido frecuentes en diversos momentos evolutivos. Susumu Ohno public en 1970 el libro Evolution by gene duplication, proponiendo la idea de que la duplicacin de genomas ha sido una de la fuerzas evolutivas que han permitido crear complejidad y aumentar la variacin gentica. Aunque en esos aos no haba mucha evidencia experimental para apoyar esta hiptesis, Ohno postul que los cambios macroevolutivos no pueden explicarse por la accin lenta de la seleccin sobre la variedad allica presente en la poblacin, sino que es necesario que haya suficiente redundancia en el genoma para que la seleccin pueda actuar por separado sobre distintas copias de los mismos genes. Esa redundancia se habra alcanzado mediante duplicaciones genmicas parciales o totales. Los estudios moleculares de familias y superfamilias de genes, y la reciente secuenciacin de genomas completos han ido confirmando algunas de las predicciones de Ohno. Hoy en da se acepta que grandes segmentos de los genomas de eucariotas estn formados por regiones duplicadas y que la mayor parte de las familias gnicas han surgido por duplicacin y divergencia separada de las distintas copias, o incluso por duplicaciones genmicas completas. La comparacin de familias de genes muestra que, en general, los genes ortlogos (copias de un gen en especies distintas) tienen mayor homologa entre s que los genes parlogos (copias duplicadas de un gen dentro de una misma especie), lo cual sugiere que la duplicacin inicial es muy antigua. En cuanto a la duplicacin de genomas, se ha sugerido que durante la evolucin de los vertebrados han tenido lugar dos duplicaciones genmicas (hiptesis 2R), ya que muchos genes importantes (genes homeobox, genes del complejo mayor de histocompatibilidad, etc.) tienen una sola copia en invertebrados pero tres o cuatro copias en vertebrados. Los anlisis ms recientes del genoma humano muestran la existencia de muchos ms genes duplicados de los que cabra esperar por azar, y cuando se compara con los genomas de Drosophila y de C. elegans parece que hubo al menos una duplicacin genmica completa entre invertebrados y vertebrados. En el caso concreto de los mamferos, los genomas analizados en los ltimos aos permiten constatar la presencia de gran cantidad de reordenaciones cromosmicas, de mayor o menor tamao. Esto se ve especialmente bien al comparar genomas de especies muy similares: por ejemplo, si se alinean los genomas de primates, se observa que la sintenia es casi total, aunque varias translocaciones e inversiones dan lugar a los 46 autosomas del chimpanc frente a los 44 de la especie humana. Al comparar especies ms separadas, como humano y ratn, los bloques de sintenia son ms pequeos y estn ms dispersos (hay 342 bloques de un tamao promedio de unas 10 Megabases cada uno). Esto sugiere que ambos genomas se han originado a partir de un genoma ancestral mediante complejos eventos de duplicacin, inversin y translocacin.

www.FreeLibros.me

Como conclusin, parece bastante claro que la historia evolutiva de la vida del planeta es tremendamente complicada. Aunque los mecanismos bsicos, sobre todo los que originan microevolucin y especiacin, son bastante bien comprendidos, los cambios macroevolutivos son ms difciles de analizar. Diferentes especies han evolucionado a distintas velocidades, en respuesta a factores ambientales muy cambiantes y a interacciones complejas con otras especies. Estos factores han propiciado, adems, la extincin de la inmensa mayora de las especies, por lo que el cuadro general macroevolutivo es fragmentario y no es fcil proponer explicaciones satisfactorias. En cualquier caso, la teora sinttica, que explicaba cambios pequeos, ha sido matizada y completada por aportaciones importantes como la teora neutral de Kimura, la teora del equilibrio puntuado y la hiptesis de Ohno. Con estas aportaciones, se ha rebajado algo la importancia de la seleccin natural gradual en los cambios macroevolutivos y en cambio se tiende a dar ms importancia a alteraciones genmicas o a cambios ambientales bruscos que pueden haber provocado fases de evolucin acelerada. Sobre los cambios adquiridos durante estos periodos, la seleccin habra proporcionado el ajuste fino adaptativo. La conciliacin de la teora moderna de la evolucin con las convicciones filosficas o religiosas de los individuos no debera ofrecer problemas, al tratarse de mbitos del conocimiento diferentes. La mayor parte de los problemas han surgido cuando uno de esos mbitos ha intentado invadir el otro. En el mbito protestante anglosajn, especialmente en los Estados Unidos, se origin un movimiento llamado creacionismo al advertir que la teora de la evolucin estaba siendo utilizada para atacar los fundamentos de las creencias religiosas de los ciudadanos. Las disputas entre creacionistas y evolucionistas son todava hoy muy acentuadas en ese pas; por desgracia, algunos intentos recientes de deslegitimar ideas propias del mbito filosfico-teolgico en nombre de la ciencia no han ayudado en absoluto a conciliar ambas visiones. Un ejemplo muy claro fue la publicacin en 1986 de El relojero ciego por Richard Dawkins. En ese libro el autor se propone refutar, recurriendo al mecanismo de la evolucin y en particular a la seleccin natural, el argumento del diseo que haba sido propuesto por el telogo protestante William Paley en 1802. Obviamente, este planteamiento traspasa los lmites de la ciencia experimental, ya que sta responde a preguntas sobre mecanismos biolgicos pero no puede responder a argumentos teolgicos ni a preguntas sobre las causas primeras y el origen ontolgico del mundo material; estas cuestiones pertenecen ms al mbito de la filosofa y escapan al propio mtodo experimental. En cualquier caso, la publicacin de ese libro dio lugar a una fuerte respuesta que cristaliz en un movimiento que hoy se conoce como Diseo Inteligente, una reformulacin moderna de la quinta va de Toms de Aquino (como lo era tambin, en el fondo, el argumento del diseo de Paley). El Diseo Inteligente intenta utilizar la ciencia actual (sobre todo a nivel molecular, proponiendo el concepto de complejidad irreductible) para demostrar la existencia de un diseo en la naturaleza, y por tanto la existencia de un ser inteligente creador de dicho diseo. Nuevamente nos encontramos ante un intento de utilizar la ciencia con fines que no son los suyos, ya que el argumento del diseo inteligente, aunque basado en observaciones de la naturaleza, es bsicamente un argumento de carcter filosfico ms que cientfico. La particular situacin de la sociedad americana ha hecho que el debate en torno al Diseo Inteligente y su posible inclusin en

173

Explicacin actual del proceso evolutivo y sus limitaciones

www.FreeLibros.me

174

las escuelas (en las asignaturas de ciencias naturales) sea especialmente agrio y haya llegado a las instancias polticas del pas. Por suerte, los crculos cientficos son cada vez ms conscientes de la magnitud del problema, y estamos asistiendo a grandes avances en todo lo que rodea a las relaciones entre conocimiento cientfico y convicciones filosficas personales.
En la Figura 12.6 se puede leer un artculo de opinin acerca de las relaciones entre ciencia y fe.

Los genes en las poblaciones

En este sentido, un editorial de la revista Nature en abril de 2005 deca: scientists would do better to offer some constructive thoughts of their own. For religious scientists, this may involve taking the time to talk to students about how they personally reconcile their beliefs with their research. Secular researchers should talk to others in order to understand how faiths have come to terms with science. All scientists whose classes are faced with such concerns should familiarize themselves with some basic arguments as to why evolution, cosmology and geology are not competing with religion. When they walk into the lecture hall, they should be prepared to talk about what science can and cannot do, and how it fits in with different religious belief s. Estas frases indican ciertamente una nueva sensibilidad hacia las creencias religiosas de los cientficos, y un intento de mantener las conclusiones de las ciencias experimentales dentro del mbito que les es propio. Un magnfico ejemplo reciente en el que se pone en prctica el consejo del prrafo citado, es la publicacin de The language of God: a scientist present s evidence for belief, escrito por Francis Collins. El autor es un genetista de gran reputacin, por haber identificado el gen responsable de la fibrosis qustica y por haber dirigido el Proyecto Genoma Humano. En este libro, Collins describe su trayectoria intelectual personal hacia la fe en un Dios personal origen del Universo, creador tambin del mecanismo evolutivo para generar diversidad. Adems, en Internet se pueden encontrar varios sitios de asociaciones de cientficos cristianos, como la American Scientific Affiliation (www.asa3.org) o Christians in Science (www.cis.org.uk), que ilustran muy bien cmo el conocimiento cientfico y las creencias religiosas de los individuos ofrecen dos visiones del mundo que no son opuestas, sino que se armonizan y complementan mutuamente.

www.FreeLibros.me

www.FreeLibros.me

D) Patologa gentica

Consta de ocho temas en los que se aborda el ncleo principal de esta asignatura: los mecanismos genticos de las enfermedades, el diagnstico de las alteraciones genticas y el clculo de los riesgos de transmisin a la descendencia.

www.FreeLibros.me

CAPTULO 13

Citogentica

Contenidos
13.1 El estudio de los cromosomas humanos 13.2 Anomalas del nmero de los cromosomas 13.3 El fenmeno de no disyuncin meitica 13.4 Anomalas estructurales de los cromosomas

13.1 El estudio de los cromosomas humanos


La citogentica constitucional se ocupa del anlisis de los cromosomas en clulas que representan la lnea germinal del individuo (habitualmente linfocitos de sangre perifrica), y se llama as para distinguirla de los estudios citogenticos sobre poblaciones celulares concretas que no representan la constitucin gentica de todo el individuo (clulas somticas, por ejemplo las clulas de un tumor). La citogentica constitucional refleja, por tanto, la estructura cromosmica que ha sido heredada y que, a su vez, se transmitir a la descendencia. La citogentica clsica se basa en la creacin y anlisis del cariotipo, que es la presentacin ordenada de los cromosomas cuando se hacen visibles en metafase. Hasta los aos 50 se crea que los humanos tenamos 48 cromosomas y que el sexo dependa del nmero de cromosomas X, como sucede en Drosophila. En 1956 se determin el nmero exacto de cromosomas de la especia humana, y en 1959 ya se haban identificado las anomalas cromosmicas caractersticas de los Sndromes de Down, Turner y Klinefelter. Esto se debi a mejoras tcnicas que permitieron cultivar leucocitos de sangre perifrica (estimulando el crecimiento en cultivo con fitohemaglutinina y mitgenos), detener el ciclo celular especficamente en metafase (utilizando sustancias como colchicina) y realizar tinciones especficas del ADN. En 1968 Caspersson introdujo las bandas Q, y en 1971 se introdujeron las bandas G, que es el mtodo ms utilizado para generar cariotipos.

www.FreeLibros.me

178

El mtodo habitual de cariotipado incluye la adicin de un mitgeno (habitualmente fitohemaglutinina) a una suspensin de linfocitos, tras lo cual se cultivan las clulas durante 48-72 horas; cuando hay suficiente nmero de clulas, se detiene el ciclo celular en mitosis utilizando colchicina, de modo que todas las clulas se habrn parado en metafase (momento en que los cromosomas se hacen visibles). El tratamiento con una solucin hipotnica rompe las clulas y separa los cromosomas, tras lo cual se procede a la fijacin de la muestra. A continuacin se aplican distintas tinciones, que producen patrones de bandas caractersticos en los distintos cromosomas. En el mtodo de bandas Q, el primero en aparecer histricamente, los cromosomas se tien con un colorante fluorescente con afinidad por regiones ricas en adeninas y timinas, lo cual produce unas bandas caractersticas en los cromosomas cuando se observan con luz ultravioleta. El mtodo de bandas G consiste en someter las preparaciones a una digestin suave con tripsina antes de teirlas con Giemsa, un colorante con afinidad por el ADN; cuando se analizan las preparaciones al microscopio de luz, se observan unas bandas oscuras (bandas G) separadas por unas bandas claras. Para teir los cromosomas segn el mtodo de bandas R se someten las preparaciones a un tratamiento de calor en solucin salina antes de la tincin con Giemsa, lo cual produce un patrn de bandas claras y oscuras que es justamente el inverso al que se obtiene con el mtodo de bandas G. Esto es as porque el tratamiento por calor hace que se desnaturalicen las regiones ricas en adeninas y timinas, por lo que las bandas R oscuras corresponden a las bandas G claras. El mtodo de bandas C se utiliza para teir la heterocromatina constitutiva (centrmeros), y consiste en la tincin con Giemsa tras la desnaturalizacin en una solucin saturada de hidrxido de bario. En conjunto, utilizando estos mtodos, y otros que son menos utilizados, se pueden ver cuatro tipos principales de estructuras:

Citogentica

Bandas de heterocromatina constitutiva (bandas C) que corresponden a las regiones que permanecen condensadas durante la interfase. Bandas de eucromatina, formando un patrn de bandas claras y oscuras alternas a lo largo de todo el cromosoma; se ven como bandas G, R o Q. Regiones organizadoras del nucleolo, correspondientes a las regiones cromosmicas donde residen los genes del ARN ribosomal; se tien con una tincin especial de plata. Quinetocoros, las estructuras centromricas que aparecen en mitosis y meiosis a las que se unen los microtbulos del huso; se tien con tinciones especiales que usan anticuerpos especficos.

Los patrones de bandas G que definen cada cromosoma humano se publican peridicamente en el International System for Cytogenetics Nomenclature (ISCN), mostrando distintas resoluciones: desde 350-550 bandas por cariotipo cuando se estudian clulas en metafase, hasta 850 bandas por cariotipo cuando se analizan clulas en prometafase. Los cromosomas (22 pares de autosomas ms los cromosomas sexuales X e Y) se ordenan en parejas de cromosomas homlogos, cada uno de los cuales tiene a su vez las dos cromtides que resultan de la replicacin del ADN en la fase S previa, aunque en ocasiones las dos cromtides estn pegadas y no se distinguen al microscopio. La forma de ordenar los cromosomas responde a un convenio (Pars,

www.FreeLibros.me

1971) y se lleva a cabo teniendo en cuenta el tamao del cromosoma y la posicin del centrmero, asignando a cada uno un brazo corto (p) y un brazo largo (q). As se pueden distinguir cromosomas metacntricos (ambos brazos de la misma longitud), submetacntricos (con el brazo p ms corto que el brazo q) o acrocntricos (cuyo brazo corto est formado por ADN satlite con ADN ribosomal en el centro). As, el cromosoma 1 es el de mayor tamao, y el cromosoma 21 el ms pequeo. Teniendo en cuenta todas estas caractersticas, el cariotipo humano se divide en varios grupos (que van del grupo A hasta el grupo G), con los cromosomas sexuales X e Y formando un grupo aparte.
La Figura 13.1 explica la nomenclatura de las regiones y bandas cromosmicas, y muestra un ejemplo de cariotipo convencional con bandas G.

179

El estudio de los cromosomas humanos

Adems de las tcnicas convencionales de bandeo, hoy contamos con una serie de tcnicas que se engloban bajo una nueva disciplina llamada Citogentica Molecular, que combina la citogentica clsica con la hibridacin especfica de sondas marcadas con fluorocromos (FISH = Fluorescence In Situ Hybridisation). La tcnica de FISH, muy utilizada hoy en da, consiste en la hibridacin de sondas especficas con cromosomas metafsicos, que previamente han desnaturalizados como en cualquier reaccin de hibridacin. Aunque inicialmente se utilizaban preparaciones de metafases, tambin se puede hacer FISH directamente en ncleos interfsicos, lo que permite detectar anomalas numricas o estructurales especficas (utilizando sondas especficas) incluso en poblaciones celulares que no pueden dividirse o que no producen buenas metafases (clulas fijadas e includas en parafina, por ejemplo). Algunas variantes de la tcnica de FISH incluyen el llamado pintado cromosmico (painting), que permite resaltar un cromosoma concreto, incluyendo los fragmentos del mismo que se hayan translocado a otras posiciones. Igualmente, la tcnica de SKY (Spectral Karyotyping) consiste en el pintado de cada cromosoma con un color distinto, gracias a combinaciones de fluorocromos y tcnicas interferomtricas en la deteccin de la fluorescencia emitida. A pesar de su complejidad y alto coste, el SKYFISH es una tcnica valiossima para detectar pequeas alteraciones cromosmicas que, de otra forma, pasaran totalmente desapercibidas. Otra variante es la tcnica de CGH (Comparative Genomic Hybridisation, Hibridacin Genmica Comparativa), que permite detectar ganancias o prdidas de material gentico en un ADN prueba cuando se compara con un ADN de referencia, y es muy utilizada en la bsqueda de regiones cromosmicas amplificadas o delecionadas en tumores.
Los vdeos de la Figura 13.2 muestran distintos ejemplos de tcnicas de citogentica molecular.

El ISCN tambin es responsable de unificar la nomenclatura para la descripcin de cariotipos normales o alterados. Las reglas bsicas ms importantes que hay que conocer son las siguientes:

Se especifica en primer lugar el nmero total de cromosomas, seguido de los cromosomas sexuales y, si las hay, las alteraciones que se encuentren. Estos

www.FreeLibros.me

180

datos van separados por comas, sin espacios antes ni despus de la coma. Por ejemplo, el cariotipo de un varn normal se expresara como 46,XY. Los individuos denominados mosaicos (es decir, aquellos que tienen dos o ms constituciones cromosmicas distintas) se describen separando cada constitucin cromosmica por una barra /. Las alteraciones que estudiaremos en este captulo se describen utilizando abreviaturas apropiadas. Por ejemplo, del significa delecin, dup duplicacin, inv inversin, ins insercin, t translocacin, i isocromosoma, r cromosoma en anillo. Despus de cada una de estas alteraciones se indican los cromosomas implicados (entre parntesis) y a continuacin las regiones implicadas (en otro parntesis distinto). Las ganancias o prdidas de cromosoma completos se indican con el signo + o antes del nmero correspondiente al cromosoma implicado.

Citogentica

13.2 Anomalas del nmero de los cromosomas


Las anomalas cromosmicas (cromosomopatas) son un tipo muy importante de patologa gentica. Los fenotipos provocados por las anomalas cromosmicas son muy variables, pero podemos describir algunas caractersticas generales que se cumplen en casi todos:

Se asocian a retraso en el desarrollo y retraso mental, frecuentemente con talla baja. Se asocian con alteraciones faciales y otras anomalas menores de cabeza y cuello. Se asocian a determinadas malformaciones congnitas (defectos cardacos, malformaciones en manos y pies, etc.), que suelen seguir un patrn especfico de cada sndrome.

Clsicamente las anomalas cromosmicas se dividen en dos grandes grupos: aquellas debidas a un nmero anormal de cromosomas (anomalas numricas) y las debidas a alteraciones en la estructura de los cromosomas (anomalas estructurales). Por lo que respecta a las anomalas numricas, en conjunto tienen una frecuencia en torno al 0,5 por ciento de nacidos vivos (1/200). A continuacin se detalla la frecuencia de las anomalas numricas ms frecuentes: Frecuencia de anomalas cromosmicas numricas (por 1 000 nacidos vivos): trisoma 21 trisoma 18 trisoma 13 XXY 45,X XYY 1,5 0,12 0,07 1,5 0,4 1,5

www.FreeLibros.me

Las anomalas numricas pueden ser de dos tipos: Euploidas: constituciones cromosmicas con un nmero total de cromosomas que es mltiplo del nmero haploide (23 en humanos). Si un cariotipo normal es diploide (46 cromosomas, 2n), es posible encontrar anomalas numricas debidas a la presencia de otros mltiplos del nmero haploide: tri-ploidas (3n, 69 cromosomas), tetra-ploidas (4n, 92 cromosomas), etc. La nomenclatura aprobada de estos transtornos consiste en especificar el nmero total de cromosomas seguido de coma (sin espacios) y el conjunto de cromosomas sexuales. Por ejemplo, una triploida en una mujer se representara como 69,XXX. La triploida es el tipo ms frecuente de poliploida (se estima que un 2 por ciento de todas las concepciones son triploides), pero la gran mayora son letales y son muy raras en nacidos vivos. Las causas ms frecuentes son la dispermia (fecundacin de un vulo por dos espermatozoides), la fusin de un vulo con un cuerpo polar (diginia), o un error meitico en la gametognesis que d lugar a un gameto diploide. La tetraploida (4n) aparece normalmente en las clulas somticas de algunos tejidos, y es el resultado de una reduplicacin endomittica, en la que hay dos duplicaciones cromosmicas con una sola divisin celular. Aneuploidas: son alteraciones numricas que no afectan a todo el complemento cromosmico, sino solamente a un par cromosmico. En ocasiones, la alteracin no afecta a todo el cromosoma, sino slo a un segmento cromosmico, en cuyo caso suelen denominarse aneusomas segmentarias. Las aneuploidas son alteraciones con distintos grados de severidad en cuanto a los fenotipos que provocan, aunque en general se puede decir que son ms graves cuando afectan a un autosoma que a un cromosoma sexual, y que son ms severas las prdidas de cromosomas (monosomas) que las ganancias de cromosomas (trisomas). La ausencia completa de un par cromosmico (nulisoma) es incompatible con la vida. A continuacin veremos algunas de las aneuploidas ms frecuentes en patologa humana:

181

Anomalas del nmero de los cromosomas

Trisoma 21 (47,XX o XY,+21), Sndrome de Down. Es la causa ms comn de retraso mental congnito. Presentan una facies caracterstica (en la que destacan las fisuras palpebrales oblicuas, hipoplasia de la nariz y macroglosia), estatura baja, defectos cardacos y retraso mental variable. Algunos casos son mosaicos 46,XX/47,XX, +21 (tienen dos poblaciones celulares, una con la trisoma y otra normal) y son clnicamente ms leves. Alrededor de un cinco por ciento de los casos de Sndrome de Down se deben a una translocacin robertsoniana entre los cromosomas acrocntricos 14 y 21. El resto de los casos la gran mayora son debidos a no-disyuncin durante la gametognesis, de los cuales el 75 por ciento son no-disyunciones en meiosis I. Por las razones que se explicarn ms adelante, existe una mayor incidencia de Sndrome de Down en mujeres de edad ms avanzada. As, aunque la incidencia global de la enfermedad es de uno por ciento por cada 650 nacidos vivos, las tasas de incidencia desglosada por tramos de edad materna muestran una clara tendencia, sobre todo a partir de los 30 aos de edad:

www.FreeLibros.me

182

Edad materna 15 20 25 30 35 40

Riesgo de S. de Down 1:1578 1:1528 1:1351 1:909 1:384 1:112

Citogentica

El riesgo de recurrencia de la enfermedad en una pareja joven (la probabilidad de tener un segundo hijo con Sndrome de Down) est en torno al uno por ciento. No hay suficiente informacin sobre el riesgo de transmisin de la enfermedad en individuos que son mosaicos.
La Figura 13.3 muestra el cariotipo de un Sndrome de Down.

Recientemente se ha visto, en un modelo murino, que el funcionamiento de una familia de factores de transcripcin llamados NFATc (Nuclear Factor of Activated T cells) es muy importante en el desarrollo de esta enfermedad. Estos factores de transcripcin regulan la expresin de genes durante el desarrollo, y viajan del ncleo al citoplasma (y viceversa) mediante una fosforilacin que es regulada por dos genes que estn en el cromosoma 21, en la regin crtica que causa el Sndrome de Down. En presencia de un nmero alto de copias de estos genes, los NFAT no funcionan adecuadamente y sus genes diana se expresan dbilmente, lo que podra causar algunas de las manifestaciones fenotpicas de la enfermedad. Trisoma 18 (47,XX o XY,+18), Sndrome de Edwards. La prevalencia de esta aneuploida es de 1/6 000 nacidos vivos. Es la anomala cromosmica que se encuentra ms frecuentemente en abortos espontneos. Muy pocos casos sobreviven el primer ao de vida. Trisoma 13 (47,XX o XY,+13), Sndrome de Patau. Tiene una prevalencia de 1/10 000 nacidos vivos. Son rasgos caractersticos de esta enfermedad las fisuras orofaciales, polidactilia y microftalmia. El 90 por ciento de los nacidos vivos fallecen en el primer ao de vida. Monosoma X (45,X), Sndrome de Turner. Los pacientes con S. de Turner slo tienen un solo cromosoma X (es la nica monosoma viable en humanos). La frecuencia de la enfermedad es 1/5 000 nias recin nacidas. Las enfermas son fenotpicamente mujeres, siendo sus caractersticas ms comunes la talla corta, malformaciones (cuello corto, pecho en coraza) e inmadurez sexual por disgenesia gonadal. No suele estar asociado a retraso mental. Se piensa que esta enfermedad se debe que el cromosoma X contiene genes que escapan a la inactivacin fisiolgica de uno de los cromosomas X, y que por tanto se necesitan las dos copias para un correcto funcionamiento celular. Al existir un solo cromosoma X en los sujetos con S. de Turner, estos genes estaran en dosis gnica mitad de la normal (una sola copia), originando las alteraciones propias de la enfermedad. Tambin existen individuos con S. de

www.FreeLibros.me

Turner que son mosaicos 46,XX/45,X o tienen anomalas estructurales del cromosoma X (como el isocromosoma del brazo largo). Los individuos con esta enfermedad suelen padecer abortos espontneos. Sndrome de Klinefelter, 47,XXY. Esta aneuploida se encuentra con una frecuencia de 1/1 000 nacidos varones. Son individuos con talla alta, hipogonadismo y ginecomastia, inteligencia ligeramente inferior a lo normal. Hasta un 15 por ciento de los enfermos muestran mosaicismo. De los raros casos de enfermos con S. de Klinefelter que tienen cariotipos 48,XXXY y 49,XXXXY se deduce que a mayor nmero de cromosomas X extra, la gravedad de la enfermedad y el retraso mental son tambin mayores.

183

El fenmeno de no disyuncin meitica

13.3 El fenmeno de no disyuncin meitica


Se estima que hasta un cinco por ciento de todas las concepciones humanas son aneuploides, aunque la gran mayora de stas terminan en abortos espontneos y no se reconocen clnicamente. La incidencia de aneuploidas vara segn el periodo gestacional, tal y como se muestra en la siguiente tabla: Frecuencia de anomalas cromosmicas en: Mortinatos (20 a 40 semanas de gestacin): Abortos espontneos detectables clnicamente (7 a 8 semanas de gestacin): Abortos espontneos NO detectables clnicamente (antes de 7 semanas): 4% 35 % 20 %

Tambin se ha visto que hasta un 20 por ciento de los oocitos humanos son portadores de aneuploidas, mientras que slo el uno-dos por ciento de los espermatozoides tienen alteraciones en el nmero de cromosomas. De estos datos se concluye que la segregacin de cromosomas durante la meiosis especialmente durante la oognesis es un proceso que no se lleva a cabo de modo totalmente eficaz en humanos. La segregacin cromosmica incorrecta origina alteraciones cromosmicas en el embrin, pero la mayora de estos embarazos se pierden porque esas alteraciones son letales en estados iniciales del desarrollo embrionario. Como se recordar, los cromosomas homlogos y las cromtides hermanas se separan en cada una de las dos divisiones que tienen lugar durante la meiosis. Las aneuploidas se producen por una separacin incorrecta (no-disyuncin) en una de las dos divisiones meiticas, aunque lo ms frecuente es la falta de disyuncin en meiosis I por la presencia de un sobrecruzamiento mal posicionado. Se ha visto en el Captulo 2 que una gonia diploide da lugar a cuatro gametos haploides ya que, tras la replicacin del ADN en el gonocito primario, la primera divisin meitica genera clulas con un solo cromosoma de cada par (aunque cada uno tiene todava dos cromtides hermanas); la segunda divisin meitica separa las cromtides hermanas a cada uno de los gametos. Teniendo este esquema en mente, es fcil comprender que los efectos de una no-disyuncin en la meiosis I sern distintos a los efectos de una no-disyuncin en la meiosis II. Si la no-disyuncin ha tenido lugar en meiosis I, se producirn dos gametos nulismicos (sin ninguna copia de ese cromosoma) y dos gametos

www.FreeLibros.me

184

dismicos (con dos copias), los cuales llevarn una copia de cada cromosoma homlogo presente en la clula progenitora (es decir, son heterodismicos). Por el contrario, si la no-disyuncin sucede en la meiosis II, tendremos dos gametos normales, un gameto nulismico y un gameto dismico con dos copias idnticas (isodismico).

Citogentica

No disyuncin en Meiosis I

No-disyuncin en Meiosis II

El vdeo de la Figura 13.4 muestra los tipos de gametos resultantes de la no-disyuncin en meiosis I o en meiosis II.

Como se ha mencionado ms arriba, est comprobado que la mayora de los errores de disyuncin tienen lugar durante la oognesis, especialmente en meiosis I. Esto se ha relacionado con el hecho de que la gametognesis femenina al contrario de lo que sucede en la espermatognesis experimenta una meiosis I especialmente larga (comienza en el periodo fetal y culmina individualmente con cada ovulacin, entre 15 y 45 aos despus). Este hecho podra aumentar la sensibilidad del oocito a sufrir no-disyunciones. Estudios recientes muestran que la aparicin de no-disyunciones tiene que ver con la posicin de los quiasmas durante la recombinacin, de modo que los quiasmas que estn demasiado cerca de los centrmeros o de los telmeros favorecen los errores en la separacin de los cromosomas homlogos. Actualmente se piensa que la maquinaria que procesa los quiasmas va perdiendo eficacia con los aos, por lo que los oocitos con quiasmas en localizaciones subptimas originan errores de disyuncin con mayor facilidad en oocitos viejos que en oocitos jvenes. Esto encaja bien con el hecho de que las aneuploidas son ms frecuentes al aumentar la edad materna. Respecto a las causas moleculares de la no-disyuncin, es razonable pensar que la des-regulacin de los procesos de recombinacin, cohesin y separacin de cromtides sea responsable, en buena medida, de la segregacin deficiente de los cromosomas a las clulas hijas. Como se recordar, durante la meiosis I cada pare-

www.FreeLibros.me

ja de quinetocoros hermanos es arrastrada hacia un extremo del huso; si ha habido un sobrecruzamiento, la cohesin debida a la presencia de los quiasmas se opondr a la fuerza de los microtbulos que tienden a separar los dos cromosomas homlogos. Por tanto, es fundamental que la cohesin entre cromosomas homlogos se mantenga a nivel de los centrmeros mientras los homlogos se separan, para que las cromtides se mantengan unidas hasta la llegada de la meiosis II. En el Captulo 2 se han esbozado los mecanismos moleculares que regulan estos procesos, por lo que la alteracin de cualquiera de las protenas implicadas puede provocar la aparicin de aneuploidas. Esto se ha visto corroborado por la deteccin de alteraciones en estos mecanismos en cncer, que en la mayora de los casos se asocia con aneuploidas muy marcadas. Se ha visto, por ejemplo, que en tumores colorrectales aneuploides hay mutaciones en el gen BUB1, que codifica una protena del complejo proteico que regula la cohesin en los quinetocoros. Adems, se ha demostrado que una securina denominada PTTG (pituitary tumour transforming gene) tiene propiedades de oncogn: muestra niveles altos de expresin en tumores pituitarios y es un factor de mal pronstico en cncer de colon, ya que los niveles de PTTG correlacionan con la invasividad del tumor. Todo esto pone de manifiesto que los genes implicados en los mecanismos que regulan la segregacin de cromtides hermanas durante la divisin celular son muy importantes para mantener una correcta segregacin cromosmica durante la mitosis, y es lgico pensar que lo mismo se puede aplicar a la meiosis.

185

Anomalas estructurales de los cromosomas

13.4 Anomalas estructurales de los cromosomas


Existen muchos posibles tipos de alteraciones en la estructura de los cromosomas. Si la alteracin da lugar a la prdida o ganancia de material gentico, se habla de alteraciones desequilibradas; en el caso contrario, se denominan equilibradas. Las alteraciones equilibradas no suelen producir patologa en el individuo que las lleva, aunque determinadas alteraciones equilibradas pueden favorecer la formacin de aneuploidas en la descendencia, como se ver ms adelante. Se piensa que las alteraciones estructurales se producen por errores durante la meiosis, bien porque los cromosomas homlogos no se alinean correctamente o bien porque se produce emparejamiento entre secuencias homlogas que pertenecen a cromosomas distintos. La recombinacin entre cromosomas que no estn correctamente alineados o entre cromosomas que no son homlogos tiene como resultado la generacin de duplicaciones, deleciones, inversiones, translocaciones, isocromosomas o cromosomas en anillo.
La Figura 13.5 muestra distintos tipos de anomalas cromosmicas estructurales.

Las inversiones son alteraciones estructurales intracromosmicas debidas a la aparicin de dos roturas dentro de un mismo cromosoma y la inversin completa del segmento que queda entre ellas. Hay bsicamente dos tipos de inversiones: pericntricas (el centrmero del cromosoma queda incluido dentro de la regin invertida) o paracntricas (la regin invertida est en uno de los brazos cromosmi-

www.FreeLibros.me

186

cos, sin incluir el centrmero). Habitualmente, las inversiones son equilibradas. Sin embargo, pueden originar problemas cuando se forman los bivalentes entre cromosomas homlogos durante la recombinacin en meosis: al formarse el bivalente, el cromosoma con la inversin puede formar un bucle para que todas las regiones queden alineadas con las correspondientes secuencias del cromosoma homlogo. Si tiene lugar un sobrecruzamiento dentro del bucle de una inversin paracntrica, se originar un cromosoma acntrico (sin centrmero) y otro dicntrico (con dos centrmeros). En anafase, cada centrmero del cromosoma dicntrico migrar hacia cada uno de los polos, formndose un puente que se romper al final de anafase. El resultado ser la generacin de gametos con diversas deleciones y/o duplicaciones, dependiendo del punto donde se rompa el puente anafsico. En cambio, si el sobrecruzamiento se produce dentro de una inversin pericntrica, los dos cromosomas resultantes llevarn un solo centrmero pero tendrn duplicada o delecionada la regin distal a los lmites de la inversin. Por tanto, aunque un individuo portador de una inversin sea fenotpicamente normal, es importante recordar que en su descendencia pueden aparecer individuos con reordenaciones des-equilibradas (deleciones o duplicaciones), aunque no es posible calcular la probabilidad de que esto suceda.
La Figura 13.6 contiene un vdeo en el que se muestran esquemticamente los tipos de gametos que se generan por una recombinacin entre cromosomas homlogos, cuando uno de ellos lleva una inversin.

Citogentica

Los isocromosomas son cromosomas en los que ambos brazos son idnticos, y se originan por la prdida total de uno de los brazos y la duplicacin del otro brazo; el resultado final es un cromosoma simtrico. Los isocromosomas de cromosomas autosmicos son habitualmente letales; el isocromosoma ms frecuente en humanos es el del cromosoma X, que aparece en algunos sujetos con Sndrome de Turner dando lugar a cariotipos 46,X,i(Xq). Las deleciones pueden ser terminales (afectan a la regin terminal o telomrica de un cromosoma) o intersticiales. Si son lo suficientemente grandes como para ser visibles citogenticamente suelen ser graves. Por ejemplo, la delecin denominada 46,XY,del(5p), en la que se pierde un fragmento terminal del brazo corto del cromosoma 5, es causa del Sndrome de cri-du-chat (maullido de gato); la delecin terminal 46,XY,del(4p) da lugar al Sndrome de Wolf-Hirschhorn. Desde que se ha utilizado la tcnica de FISH, se ha conseguido delimitar mejor las deleciones cromosmicas, e incluso se ha podido identificar algunos sndromes debidos a deleciones que no eran visibles por citogentica convencional (cariotipo de bandas G). Por esta razn, estas enfermedades se denominan Sndromes por Microdelecin, aunque tambin se les llama aneusomas segmentarias o sndromes de genes contiguos (ya que en las pequeas deleciones se pierden habitualmente varios genes). La siguiente tabla recoge algunos de los principales sndromes por microdelecin, indicando la regin delecionada y el gen (o genes) implicados en esas deleciones:

www.FreeLibros.me

Sndrome Wolf-Hirschhorn Williams-Beuren WAGR (Wilms, aniridia, genital defects, growth retardation) Prader-Willi/Angelman Rubinstein-Taybi Miller-Diecker lisencefalia Smith-Magenis Alagille DiGeorge (CATCH22)

Delecin (genes) 4p16.3 7q11.23 (elastina) 11p13 (WT1 y PAX6) 15q11-q13 16p13.3 (CBP) 17p13.3 (LIS1) 17p11.2 (KER) 20p12.1-p11.23 (Jagged1) 22q11.21-q11.23

187

Anomalas estructurales de los cromosomas

Las translocaciones consisten en el intercambio de fragmentos cromosmicos entre cromosomas no homlogos. Hablamos de translocaciones recprocas cuando ambos cromosomas son donantes y receptores de material cromosmico, de modo que parte de un cromosoma pasa a otro y, a su vez, parte de ste pasa al primero. Las translocaciones recprocas desequilibradas, en las que se ha perdido o ganado material gentico durante el proceso de formacin de la translocacin, son habitualmente causa de enfermedad. Por el contrario, las translocaciones equilibradas no son necesariamente patognicas, a no ser que los puntos de rotura en alguno de los cromosomas interrumpan algn gen concreto. En cambio, un individuo portador de una translocacin recproca equilibrada puede tener descendencia con alteraciones cromosmicas estructurales. Esto se debe a que, durante la meiosis, los cromosomas translocados se alinean con los dos cromosomas normales respectivos, dando lugar a la formacin de un tetravalente en vez de un bivalente. La segregacin de los cromosomas del cuadrivalente a cada gameto puede realizarse segn un patrn adyacente o alternante: mientras la segregacin alternante puede generar gametos normales o equilibrados, la segregacin adyacente da lugar a gametos nulismicos o dismicos, que causarn monosomas o trisomas en el embrin.
La Figura 13.7 explica la segregacin de cromosomas con una translocacin recproca equilibrada.

Otro tipo importante de translocacin son las llamadas translocaciones Robertsonianas (tambin denominadas fusin cntrica), en las que dos cromosomas acrocntricos se fusionan por sus centrmeros. Al igual que en las translocaciones equilibradas, los individuos portadores de una translocacin robertsoniana no suelen padecer ninguna patologa, ya que llevan dos copias completas de cada uno de los cromosomas implicados (la copia normal ms la copia presente en el cromosoma con la translocacin). En cambio, en la descendencia s que pueden aparecer monosomas o trisomas de los segmentos implicados. Esto se debe a que durante la meiosis el cromosoma con la fusin cntrica se aparear con los dos cromosomas homlogos correspondientes, formando un trivalente en vez de un bivalente. El resultado de esta estructura, dependiendo de cmo sea la segregacin, ser la formacin de gametos normales (segregacin alternante) o de gametos nulismicos o dismicos (segregaciones adyacentes), que a su vez provocarn monosomas o disomas en la descendencia.
En la Figura 13.8 se muestra la segregacin de cromosomas con una translocacin robertsoniana.

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 14

Mutaciones simples como causa de enfermedad

Contenidos
14.1 Caractersticas generales de las mutaciones 14.2 Mutaciones simples: tipos y nomenclatura 14.3 Potencial patognico de las mutaciones en el ADN codificante y en el ADN no-codificante intragnico e intergnico 14.4 Potencial patognico de las mutaciones en el ADN no-codificante

14.1 Caractersticas generales de las mutaciones


Ya se ha mencionado que el genoma humano est sujeto a variacin gentica y que esta capacidad de introducir modificaciones genticas heredables supone una ventaja para la especie, al permitir la adaptacin a condiciones ambientales cambiantes. Sin embargo, la existencia de una tasa mutacional basal tiene el peligro de introducir cambios genticos deletreos en un individuo o una familia concreta, provocando enfermedades heredables. Por tanto, de modo general podemos decir que la presencia de mutaciones en una poblacin est sujeta al juego entre la tasa mutacional basal (la velocidad a la que se producen) y la presin selectiva frente a cada una de las mutaciones, de forma que aquellas mutaciones que sean muy agresivas no se extendern al resto de la poblacin tan rpidamente como mutaciones con efectos fenotpicos ms leves. Por ejemplo, ya hemos visto en otro captulo que las aberraciones cromosmicas (trisomas, monosomas, etc.) son raras pero casi siempre patognicas, mientras que los polimorfismos de secuencia variantes allicas que no causan ninguna enfermedad son mucho ms frecuentes. En cierto modo, lo mismo sucede con los distintos tipos de mutaciones: aquellas que provocan alteraciones graves del producto proteico, que estn sometidas a una fuerte presin selectiva en su contra, suelen ser menos frecuentes que mutaciones con efectos ms leves.

www.FreeLibros.me

190

Antes de estudiar todos los posibles tipos de mutaciones, ser de gran utilidad recordar la estructura y procesamiento de un gen tpico, porque esto nos ayudar a comprender cmo se clasifican y sus efectos. Recordemos que en el ADN genmico se puede distinguir una regin 5 no-traducida (desde el inicio de la transcripcin hasta el ATG que seala el inicio de la traduccin), exones separados por intrones (que contienen las secuencias consenso de ayuste GT-AG), el codn de terminacin (TAA en la figura) y la regin 3 no traducida, que incluye la seal de poliadenilacin (AATAAA). La transcripcin del gen y la posterior maduracin del transcrito primario dan como resultado el ARNm maduro, que despus es traducido en la protena correspondiente. En general, los distintos tipos de mutaciones que se encuentran en un gen pueden ser tanto mutaciones simples (deleciones, inserciones o substituciones que afectan a un nucletido o a unas pocas bases) o reordenamientos grandes (deleciones parciales o reordenamientos que dan lugar a duplicaciones o deleciones del gen).
En la Figura 14.1 se muestran esquemticamente los distintos tipos de mutaciones que se pueden encontrar en un gen, y cmo afectan a su funcin.

Mutaciones simples como causa de enfermedad

A lo largo de este captulo, veremos con detalle los distintos tipos de mutaciones que provocan enfermedades humanas.

14.2 Mutaciones simples: tipos y nomenclatura


Las substituciones simples de un nucletido por otro se denominan transiciones o transversiones, segn provoquen el cambio de purina por purina o pirimidina por pirimidina (transiciones), o el cambio de una purina por pirimidina o viceversa (transversiones). En el esquema adjunto, las transiciones se representan por flechas T G grises y las transversiones por flechas negras. Como puede apreciarse, las transversiones deberan ser el doble de frecuentes que las transiciones (ocho posibles transversiones por cuatro posibles transiciones). En cambio, al analizar las mutaciones presentes en enfermedades humanas encontramos que las transiciones son ms frecuentes. Esto es debido a que en general las transiciones provocan una alteracin menos severa del producto proteico, por lo que la presin selectiva contra ellas es menor. Adems, el dinucletido CpG suele estar metilado en la citosina, y la des-aminacin espontnea de una metil-citosina da lugar a una transicin del tipo CT. Como este cambio tiene lugar con relativa frecuencia en el genoma de mamferos, esto tambin contribuye a la alta frecuencia de transiciones que se observa en estas especies.

14.3 Potencial patognico de las mutaciones en el ADN 14.3 codificante y en el ADN no-codificante intragnico 14.3 e intergnico
Cuando las substituciones simples tienen lugar en ADN codificante, sus efectos pueden ser de varios tipos:

www.FreeLibros.me

a)

b)

Substituciones silenciosas (llamadas sinnimas, sin cambio de sentido): no cambian ningn aminocido en la protena codificada, debido a que la mutacin cambia un codn por otro codn sinnimo. Como son biolgicamente neutras, no estn sujetas a seleccin y por tanto son relativamente frecuentes en ADN codificante. Habitualmente se producen por cambios en la tercera base de un triplete, ya que es habitualmente este nucletido el que vara entre codones sinnimos. Substituciones no-sinnimas (el cambio de nucletidos origina un cambio en la capacidad codificante del ARNm). Segn el cambio introducido, podemos distinguir:

191

Potencial patognico de las mutaciones en el ADN codificante y en el ADN no-codificante

Mutaciones con cambio de sentido (mis-sense, en ingls), cuando el cambio de nucletidos provoca un cambio de aminocidos. Se habla de cambio conservativo cuando ambos aminocidos (el original y el nuevo) pertenecen al mismo grupos bioqumico, o no conservativo cuando pertenecen a grupo distintos. Estos ltimos son en general ms graves, puesto que alteran la estructura de la protena en mayor grado. Tambin son importantes los cambios que afectan a Cistenas y Prolinas, que son aminocidos muy importantes en el mantenimiento de la estructura terciaria de la protena. Mutaciones sin sentido (non-sense), cuando un codn que codifica un aminocido se convierte en un codn de parada (UAA, UAG o UGA). Estas mutaciones dan lugar a protenas truncadas en la regin C-terminal, adems de disminuir la estabilidad del ARNm. En general son muy graves, por lo que son menos frecuentes que las mutaciones con cambio de sentido.

En la Figura 14.2 se muestran distintos tipos de mutaciones puntuales y su efecto sobre el producto proteico.

Mutaciones con ganancia de sentido, cuando la mutacin transforma un codn de parada en un codn codificante. Son casos infrecuentes, entre los que destaca el de una variante de la hemoglobina denominada Hemoglobina Constant Spring (variante allica HBA20001), originada por el cambio de UAA (codn de parada) a CAA. Esto tiene como resultado la adicin de 30 aminocidos a la secuencia de la hemoglobina alfa-2, que se hace ms inestable y provoca una enfermedad de la sangre llamada alfa-talasemia.

En la Figura 14.3 se esquematiza la mutacin que origina la hemoglobina Constant Spring.

c)

Deleciones e inserciones de uno o de unos pocos nucletidos pueden introducir o eliminar aminocidos sin cambiar la pauta de lectura, siempre que se trate de inserciones o deleciones de tres nucletidos (o mltiplos de tres). Cuando se insertan o delecionan nucletidos en un nmero que no es mltiplo de tres, se produce un frameshift (desplazamiento del marco de lectura)

www.FreeLibros.me

192

con un cambio muy importante en la estructura proteica. Para comprender las mutaciones con cambio del marco de lectura, es importante repasar este concepto, ya presentado en el Captulo 1.
En la Figura 14.4 se recuerda el concepto de marco de lectura (frameshift) y se muestra su desplazamiento por efecto de distintos tipos de inserciones.

Mutaciones simples como causa de enfermedad

LOS LOS LOS LOS

QUE QaU Qab Qab

VES EVE UEV cUE

SON SSO ESS VES

LOS NLO ONL SON

QUE SQU OSQ LOS

SON ESO UES QUE

... N.. ON. SON

FRAMESHIFT +1 FRAMESHIFT +2 INSERCIN 3bp

Al igual que las mutaciones sin sentido, las mutaciones con cambio del marco de lectura provocan alteraciones importantes del producto proteico y, por tanto, estn sometidas a mayor presin selectiva, por lo que suelen ser menos frecuentes en ADN codificante que las mutaciones sinnimas. Adems, los cambios del marco de lectura suelen introducir codones de parada prematuros, por lo que habitualmente se producen tambin protenas truncadas que ven muy comprometida su funcionalidad. Otro mecanismo por el que puede perderse o recuperarse el marco de lectura es la edicin del ARN, fenmeno que ya se explic en el Captulo 1. Una variedad curiosa de edicin del ARN surge en unas ratas que tienen una delecin de un solo nucletido en el gen de la vasopresina, haciendo que desarrollen hipertensin arterial. Estas ratas mejoran espontneamente al envejecer, debido a un proceso de edicin del ARNm mediante el cual se pierde el dinucletido GA en un motivo GAGAG de ese mismo gen. La delecin de estos dos nucletidos, aadida a la delecin de un nucletido que ya tenan, hace que se recupere el marco de lectura original y que se produzcan mayores niveles de vasopresina funcional. Recientemente, se ha encontrado un motivo GAGAGA en el gen de la protena precursora de amiloide- (APP) y se ha visto que tiene lugar una edicin similar, con delecin de dos bases en el ARNm y la interrupcin del marco de lectura que produce una protena truncada y es causa de algunos casos de enfermedad de Alzheimer en humanos.

14.4 Potencial patognico de las mutaciones en el ADN 14.4 no-codificante


Las mutaciones simples que tienen lugar en ADN no codificante intragnico (es decir, en intrones y regiones no traducidas) son silenciosas, excepto cuando afectan a las secuencias de consenso para ayuste (splicing) de los extremos 5 y 3 de los intrones. En este caso, podemos encontrar:

Mutaciones que destruyen una de las secuencias de consenso. Si esto tiene lugar en ausencia de secuencias de ayuste crpticas (escondidas) y en intrones pequeos, habitualmente se lee todo el intrn, que queda as incluido en el ARNm. Esto hace que se aadan aminocidos a la protena, aunque tam-

www.FreeLibros.me

bin es posible que se introduzca un cambio en el marco de lectura y se altere toda la secuencia de aminocidos a partir de ese punto. Si la mutacin que destruye la secuencia de ayuste tiene lugar en presencia de una secuencia de ayuste crptica en ese mismo intrn, el exn vecino ser ms largo; por el contrario, si la secuencia crptica est en el exn cercano a la mutacin, dicho exn ser ms corto. En ocasiones, las mutaciones que destruyen una de las secuencias consenso de ayuste hacen que se salte el exn adyacente (lo que en ingls se denomina skipping del exn), dando lugar a una protena que ha perdido un cierto nmero de aminocidos, aunque tambin es posible que produzca un cambio en el marco de lectura. El exn afectado ser el 5 o el 3 a la mutacin, segn se destruya el GT o el AG de un intrn, respectivamente.

193

Potencial patognico de las mutaciones en el ADN no-codificante

EXN 1
GT

INTRN 1
Lugar crptico de ayuste (intrnico)

EXN 2
AG

TTAGG

MUTACIN

EXN 2A
GT TTAG G AG

En la Figura 14.5 se muestran distintas mutaciones que afectan a las secuencias consenso de ayuste.

Un caso especial de este tipo de mutaciones es la transicin A G en posicin + 3 de la secuencia donante de ayuste, una alteracin que est asociada con desarrollo de enfermedades en al menos ocho genes humanos. Como se recordar, la secuencia donante de ayuste (la del extremo 5 del intrn) es complementaria a la secuencia del ARN nuclear pequeo U1 (U1snRNA), cuya presencia es necesaria para que se lleve a cabo el proceso de ayuste. Los dos primeros nucletidos del intrn son siempre GT (complementarios a CA en el U1snRNA), y el tercer nucletido de la secuencia de ayuste suele ser adenina (complementaria al uracilo correspondiente en el U1snRNA). En cambio, las posiciones + 4 a + 6 no siempre son perfectamente complementarias. De hecho, la adenina en posicin +3 dota de cierta flexibilidad a los nucletidos de las posiciones + 4 a + 6, que pueden ser dis-

www.FreeLibros.me

194

cordantes de la secuencia del U1snRNA y an as son capaces de funcionar correctamente como secuencia donante de ayuste. En cambio, si alguna de las posiciones + 4 a + 6 no son complementarias a la secuencia del U1snRNA, una mutacin en la posicin + 3 tiene como resultado la falta de funcionalidad de esta secuencia de ayuste, con lo que se salta el exon precedente.
La Figura 14.6 muestra una mutacin de la posicin +3, que provocar el skipping del exn 16 del gen COLQ.

Mutaciones simples como causa de enfermedad

Finalmente, existen mutaciones que, sin afectar directamente a secuencias consenso de ayuste, pueden activar un lugar crptico en un intrn y producir un exn ms grande y posiblemente un cambio en el marco de lectura.

La Figura 14.7 muestra la creacin de secuencias de ayuste crpticas intrnicas.

Como regla general, podemos afirmar que las mutaciones que afectan al mecanismo de ayuste son ms raras que las substituciones, aunque algunos genes tienen una estructura exnica que les otorga una tendencia especial a sufrir mutaciones de este tipo: se trata, habitualmente, de genes con muchos intrones y con exones pequeos, como sucede con los genes que codifican cadenas del colgeno (COL7A1, por ejemplo, tiene 118 exones), o bien genes con muchos sitios crpticos de ayuste (como es el caso del gen de la beta-globina). Como se explicaba en el Captulo 1, recientemente se ha descrito que ciertas secuencias exnicas o intrnicas pueden actuar como potenciadores o silenciadores del ayuste. Estas secuencias se denominan ESE (Exonic Splicing Enhancers) o ESS (Exonic Splicing Silencers) cuando estn en exones; ISE o ISS cuando estn en intrones. A estas secuencias se unen protenas llamadas protenas SR (las que se unen a los potenciadores de ayuste) o algunas hnRNP (las que se unen a los silenciadores). Por tanto, estas protenas regulan el proceso de ayuste y determinan si un exn va a estar presente en el transcrito final o, por el contrario, se va a saltar. Es importante tener en cuenta que algunas mutaciones en estos motivos, aunque sean silenciosas porque no cambian el aminocido (o porque se localizan en intrones), pueden sin embargo tener efectos sobre el mensajero, haciendo que un exn se pierda y alterando as la estructura de la protena o rompiendo el marco de lectura. De hecho, en algunos genes (ATM, NF1) se ha estimado que el 50 por ciento de las mutaciones que originan enfermedades afectan a regiones que cambian el patrn de ayuste sin cambiar la secuencia de aminocidos. Un buen ejemplo para ilustrar esta situacin es una enfermedad llamada Atrofia Muscular Espinal, debida a deleciones y/o mutaciones del gen SMN1. Cerca de este gen hay un gen parlogo casi idntico llamado SMN2, en el que un cambio C T modifica el patrn de ayuste (sin cambiar la secuencia de aminocidos) y hace que el exn 7 se pierda, dando lugar a una protena truncada no funcional. De todas formas, un pequeo porcentaje de las molculas siguen un ayuste normal (con el exn 7) y producen protena normal a partir del gen SMN2. Por tanto, aunque no haya ninguna copia funcional de SMN1 (como sucede en enfermos con atrofia muscular espinal) la enfermedad tiene distinta gravedad segn el nmero de copias de SMN2

www.FreeLibros.me

presentes. De hecho, se piensa que esta circunstancia podra utilizarse para corregir la sintomatologa de los pacientes con Atrofia Muscular Espinal.

195

Nomenclatura general de mutaciones

SMN1 6
CAGACAA

SMN1

SMN2 6
UAGACAA

8
SMN1 7

La Figura 14.8 muestra la diferencia de ayuste entre los genes SMN1 y SMN2.

Otro tipo de mutaciones del ADN no-codificante intragnico son las que afectan a la seal de poli-adenilacin, que se encuentra en la regin no traducida 3 de un gen. Estas mutaciones pueden originar protenas defectuosas y llevar a la degradacin del ARNm. Por ejemplo, una mutacin en la seal de poliadenilacin del gen que codifica la hemoglobina alfa-2 (alelo HBA20024) convierte la seal AATAAA en AATGAA, con lo que el ARNm no se poli-adenila correctamente, el ARNm se degrada y se desarrolla la enfermedad alfa-talasemia por ausencia de cadenas de hemoglobina alfa-2. Finalmente, las substituciones en el ADN no codificante intergnico, sern silenciosas excepto cuando afectan a elementos reguladores de la expresin gnica (promotores, potenciadores, etc.) o a otros elementos necesarios para el correcto procesamiento del ARNm. Por ejemplo, mutaciones que afectan a la Regin de Control del Locus de las alfa- y beta-globinas (un conjunto de potenciadores situados unas 4060 kb en direccin 5 de los genes respectivos) provocan unas enfermedades denominadas talasemias, debidas a la sntesis deficiente de globinas.

14.5 Nomenclatura general de mutaciones


Llegados a este punto, interesa estudiar la nomenclatura recomendada para describir los distintos tipos de mutaciones que hemos visto hasta ahora. Aunque las recomendaciones van cambiando con el paso de los aos, a continuacin se resumen las reglas principales: 1. Describir la mutacin utilizando la numeracin de nucletidos de la secuencia genmica (g.) o del ADNc (c.) o la numeracin de la secuencia de

www.FreeLibros.me

196

2.

aminocidos, segn los casos. Siempre la Adenina del codn de iniciacin ATG se toma como posicin +1, de forma que el nucletido anterior es la posicin 1. Describir las substituciones de nucletidos segn el esquema general: 2. Intervalo + secuencia antigua + tipo de cambio + secuencia nueva.

Mutaciones simples como causa de enfermedad

2.

Utilizar una flecha o el signo > para las sustituciones, del para deleciones, ins para inserciones. Los rangos se indican con guin bajo (de subrayado) para evitar confusiones con el signo negativo. Las combinaciones de dos o ms alteraciones se separan con el signo + y se incluyen en corchetes. Algunos ejemplos: g.12T>A (Cambio de timina por adenina en el nucletido 12 de la secuencia genmica) [6T>C + 13_14del] (Dos cambios en el mismo alelo) [6T>C] + [13_14del] (Dos mutaciones, una en cada alelo) 1415insT (Insercin de timina entre dos nucletidos) 112_117delAGGTCAinsTG (Insercin de TG en vez de AGGTCA, tambin se podra indicar como 112_117>TG) En repeticiones en tndem, se asigna por convenio el cambio a la ltima repeticin (la que ocupa una posicin ms 3): por ejemplo, la delecin de un dinucletido TG en la secuencia ACTGTGTGCC (siendo A el nucletido 1991) se describira como 1997-1998del (o 1997-1998delTG). La variabilidad en microsatlites se designa contando la posicin de la primera repeticin. Si la secuencia del ejemplo anterior fuese polimrfica, se designara 1993(TG)3-22, para indicar que en posicin 1993 comienza un dinucletido TG que se encuentra en la poblacin repetido entre 3 y 22 veces. En intrones (cuando no se conoce la secuencia genmica), se seala la posicin dentro del intrn con referencia al exn ms cercano (utilizando nmeros positivos comenzando con la G de la secuencia de ayuste GT donante, y nmeros negativos contando desde la G de la secuencia AG aceptora). Se puede usar tanto la sigla IVS como sinnimo de intrn, como la numeracin correspondiente a la secuencia del ADNc. Ejemplos: IVS3+1G>T o c.621+1G>T (621 es el ltimo nucletido del exn 3, luego +1 es la G de la secuencia donante GT del intrn 3). IVS6-5C>A o c.17815C>A (1781 es el primer nucletido del exn 7, luego 1 es la G de la secuencia aceptora AG del intrn 6, 2 es la A, y as sucesivamente hasta llegar a 5). Para describir substituciones de aminocidos, se indica el nmero del aminocido y el cambio operado, considerando la metionina iniciadora como

2. 2. 2. 2. 2. 3.

4.

5.

2. 2.

6.

www.FreeLibros.me

2.

+1. Se sigue el esquema general aminocido cambiado + rango + aminocido nuevo. Se recomienda usar el cdigo de aminocidos de una letra, aunque tambin puede utilizarse el de tres letras, empleando la letra X para indicar un codn de parada. Ejemplos: R117H (la Arg en posicin 117 pasa a His) G542X (la Gly 542 se convierte en codn de parada) T97del (delecin de la treonina 97) o T97_C102del (delecin de los aminocidos 97 a 102) T97_W98insLK (insercin de leucina y lisina entre las posiciones 97 y 98, ocupadas por treonina y triptfano)

197

Nomenclatura general de mutaciones

2. 2.

www.FreeLibros.me

www.FreeLibros.me

CAPTULO 15

Potencial patognico de las secuencias repetidas

Contenidos
15.1 Mutaciones en secuencias que estn repetidas en tndem 15.2 Expansin de trinucletidos: neuropatas por expansiones de CAG y enfermedades por expansin de otros trinucletidos 15.3 Neuropatas por expansiones de CAG 15.4 Enfermedades por expansin de otros trinucletidos 15.5 Otras enfermedades por expansin de secuencias repetidas 15.6 Mutaciones debidas a repeticiones dispersas 15.7 Desrdenes genmicos

Adems de las mutaciones simples estudiadas en el captulo anterior, puede haber mutaciones ms complejas que afectan a secuencias repetidas, tanto repeticiones en tndem (mini- y micro-satlites) como repeticiones dispersas (elementos Alu, LINE, etc).

15.1 Mutaciones en secuencias que estn repetidas en tndem


Un tipo de mutacin que afecta con frecuencia a las repeticiones cortas en tndem de tipo microsatlite es la expansin o contraccin de la repeticin. Como ya vimos al estudiar los mecanismos de reparacin, este fenmeno se produce habitualmente por un mecanismo llamado desemparejamiento por deslizamiento de cadenas (slipped-strand mispairing en ingls). Dicho proceso puede tener lugar durante la replicacin del ADN que contiene la repeticin, si se da un deslizamiento hacia atrs o hacia delante de la cadena que est siendo sintetizada sobre la cadena molde. Este deslizamiento origina un

www.FreeLibros.me

200

bucle en una de las cadenas, cuyo resultado final es que la nueva cadena de ADN tendr una repeticin ms o una repeticin menos que la cadena original, segn el desplazamiento haya sido hacia atrs o hacia delante, respectivamente. Este mecanismo explica los polimorfismos de longitud de los microsatlites, que ya hemos estudiado al hablar de estos marcadores en el Captulo 1.
La Figura 15.1 muestra esquemticamente el mecanismo de expansin de un trinucletido por deslizamiento de una cadena durante la replicacin.

Potencial patognico de las secuencias repetidas

Lo importante ahora es darse cuenta de que si la expansin o contraccin tiene lugar en la regin codificante de un gen que contiene repeticiones en tndem cortas, el resultado ser la apari141 142 143 144 145 cin de deleciones de aminocidos (si se GCC ATT TT*G GCC TT delecionan tres nucletidos) o cambios en el marco de lectura (si se delecionan repeticiones de 329 330 331 332 333 uno, dos, cuatro o cinco nucletidos). Se presenCCA CTT GTT GAC CGA tan a continuacin dos ejemplos de lo dicho. En el cuadro superior observamos, arriba, la secuencia 329 330 331 332 nativa del gen CFTR (mutado en una enfermedad CCA CTT G** *AC CGA llamada Fibrosis Qustica del pncreas), que contiene una repeticin en tndem del nucletido Timina (hay cinco Timinas seguidas en los codones 142 y 143). La delecin de una T por el fenmeno que acabamos de describir provocar un cambio del marco de lectura, como se aprecia en la fila de debajo. En el cuadro inferior vemos un ejemplo de delecin de un trinucletido TTG en la regin codificante del Factor IX de la coagulacin: la secuencia nativa (fila superior) contiene dos repeticiones TTG en tndem, de modo que la delecin de una de ellas provoca la delecin de un aminocido sin alterar el marco de lectura (fila inferior). Lgicamente, lo mismo que se ha ilustrado aqu con deleciones puede decirse de las inserciones. Los microsatlites del tipo trinucleotdico pueden adems sufrir expansiones mayores, dando lugar a un grupo de enfermedades conocidas como enfermedades por expansin de trinucletidos. Dada su importancia en patologa humana, las estudiamos con ms detalle en el siguiente apartado.

141 142 143 144 145 GCC ATT TTT GGC CTT

15.2 Expansin de trinucletidos: neuropatas por expansiones 15.2 de CAG y enfermedades por expansin 15.2 de otros trinucletidos
Hay un grupo de enfermedades debidas a la expansin de repeticiones de trinucletidos, que tienen una serie de rasgos en comn. El descubrimiento del mecanismo por el que se desencadenan estas enfermedades ayud a comprender un fenmeno clnico que se conoca con el nombre de anticipacin: la aparicin de la enfermedad a una edad cada vez ms temprana y de forma ms severa en sucesivas generaciones de una misma familia. Como veremos, la presencia de secuencias trinucleotdicas inestables, que aumentan de tamao en cada generacin, permiti explicar este fenmeno.

www.FreeLibros.me

Las enfermedades por expansin de trinucletidos pueden agruparse en dos grandes categoras: (1) enfermedades debidas a expansiones cortas (40 a 70 repeticiones) de un trinucletido CAG localizado en la regin codificante de un gen; y (2) enfermedades debidas a expansiones mayores (desde 50 hasta miles de repeticiones) de trinucletidos situados en regiones no codificantes. Como ya hemos comentado, el mecanismo de expansin ms probable es el desemparejamiento por deslizamiento de cadenas, aunque las grandes expansiones son ms fciles de explicar mediante un mecanismo de reparacin por recombinacin homloga. De todas formas, todava no se explica bien por qu en estas secuencias se dan muchas ms expansiones que contracciones.

201

Neuropatas por expansiones de CAG

15.3 Neuropatas por expansiones de CAG


Las enfermedades del primer grupo tienen como resultado la expansin de un tracto de poliglutaminas en la protena codificada por el gen respectivo, y constituyen un grupo de enfermedades neurodegenerativas de gran importancia. La siguiente tabla resume las caractersticas ms importantes de cada una de estas enfermedades: Repeticin Huntington Smith (Haw-River) (DRPLA) Kennedy (SBMA) SCA1 SCA2 SCA3/MJD SCA6 SCA7 SCA17 SCA12 CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG Normal 11-34 7-34 9-36 6-39 15-24 13-36 4-20 4-35 25-42 7-45 Enfermedad 40-121 49-88 38-62 40-82 32-200 61-84 20-29 37-306 47-63 55-78 Localizacin ORF (HD) ORF (DRPLA) ORF (AR) ORF (SCA1) ORF (SCA2) ORF (SCA3) ORF (CACNA1A) ORF (SCA7) ORF (TBP) 5UTR? (PPP2R2B) Efecto Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia Ganancia ?

El modo de expansin, en general, es gradual. As, la inestabilidad va aumentando con el tamao de la expansin: por debajo de las 40 repeticiones, la frecuencia de expansiones es baja, pero al llegar a un rango de 40 a 100 repeticiones la inestabilidad ya es prcticamente del 100 por cien. Adems, se observan diferencias si la transmisin es materna (las repeticiones de la descendencia se distribuyen normalmente alrededor de la media materna) o paterna (produce repeticiones con una media ms alta que la paterna, con tendencia a aumentar en funcin de la edad paterna). El mecanismo patognico en estas enfermedades se ha atribuido a la expansin de un tracto de glutaminas en las protenas implicadas, lo que llevara al mal plegamiento y/o formacin de agregados proteicos que alteran la funcin neuronal. En general, se piensa que la expansin produce una ganancia de funcin, ya que muta-

www.FreeLibros.me

202

ciones y deleciones que anulan la funcin de esos mismos genes no dan lugar a la misma enfermedad que la expansin del trinucletido. Por ejemplo, la expansin de un trinucletido CAG en el gen del receptor de andrgenos da lugar a la Atrofia Muscular Espino-Bulbar (SBMA, Enfermedad de Kennedy), mientras que las mutaciones de ese mismo gen provocan el Sndrome de feminizacin testicular. Por otro lado, la longitud de las expansiones correlaciona con la gravedad de la sintomatologa, lo que hace pensar que estas enfermedades se deben a una ganancia de funcin con un efecto txico que aumenta con el nmero de glutaminas que lleva la protena, probablemente a partir de un umbral de 35-40 residuos. Tambin se ha demostrado que, para provocar degeneracin neuronal, las protenas mutantes deben entrar en el ncleo, ya que cuando se envan al citoplasma no se observa efecto patognico alguno. Esto sugiere que pueden interaccionar con factores de transcripcin ricos en glutamina y alterar la transcripcin de genes necesarios para la supervivencia neuronal. De hecho, se ha demostrado que la acetilasa de histonas CBP (co-activador transcripcional del que hemos hablado en el Captulo 2) es secuestrada en presencia de protenas con tractos de poli-glutaminas, con lo que se altera la expresin de genes necesarios para la supervivencia neuronal. Dado que las protenas con tractos de poli-glutaminas pueden unirse entre s por interacciones protena-protena, otros factores de transcripcin con poli-glutaminas tambin podran quedar secuestrados en estas enfermedades. De hecho, se ha visto recientemente que el factor de transcripcin TAFII130, un componente de TFIID, interacciona con el factor de transcripcin Sp1 a travs de regiones con tractos de glutaminas; la presencia de una protena con tractos largos de poliglutaminas podra impedir esta interaccin y cancelar la expresin de los genes regulados por estos factores. En el caso concreto de la huntingtina (la protena codificada por el gen mutado en la Enfermedad de Hutington) se ha demostrado, por ejemplo, que la presencia de huntingtina con expansin de glutaminas impide la expresin del gen que codifica el receptor D2 de la dopamina, mediante un mecanismo como el descrito.
En la Figura 15.2 se esquematiza un posible mecanismo patognico de la huntingtina que lleva expansin de un tracto de glutaminas.

Potencial patognico de las secuencias repetidas

15.4 Enfermedades por expansin de otros trinucletidos


El segundo grupo de enfermedades por expansin de trinucletidos incluye enfermedades ms heterogneas, aunque tambin se caracterizan por afectar al sistema nervioso. Sus caractersticas se resumen en la siguiente tabla, donde se muestra que la inestabilidad propia del rango de 40-100 repeticiones (llamado en estos casos premutacin) no causa la enfermedad, sino que favorece la aparicin de una expansin explosiva, llegando de golpe hasta varios miles de repeticiones (mutacin completa), que ya causa la enfermedad. Esta explosividad no se produce cuando la repeticin est interrumpida por un triplete distinto; por ejemplo, algunos alelos del gen FRAXA tienen repeticiones del trinucletido CGG que estn interrumpidas por el trinucletido AGG cada 10 repeticiones CGG, y esos alelos no sufren expansin.

www.FreeLibros.me

Repeticin Distrofia Miotnica (DM1) X Frgil (FRAXA) X Frgil (FRAXE) Ataxia Friedreich SCA8 CTG CGG GCC GAA CTG

Normal 5-37 6-52 4-35 6-32 16-37

Pre-mutacin 50-80? 59-230 (35-61)? (35-40)? ?

Mutacin 80-2000+ 230-2000+ 200-900 200-1700 107-127

Localizacin 3 UTR (DMPK) 5 UTR (FMRP) 5 UTR (FMR2) Intron (FRDA) 3 UTR (SCA8)

203

Enfermedades por expansin de otros trinucletidos

En estas enfermedades, como regla general, el efecto patognico es resultado de la prdida de funcin de la protena o de la alteracin en la funcin del ARNm, ya que las expansiones estn en regiones no codificantes. En este grupo destacan:

Sndrome del X frgil. Es la causa ms frecuente de retraso mental ligado al cromosoma X (un 40 por ciento de los casos) y la causa heredada ms frecuente de retraso mental aislado. Inicialmente, esta enfermedad se detectaba por el cariotipo, que muestra una rotura en Xq27.3 cuando las clulas se cultivan en presencia de metrotexato o en ausencia de folato. Posteriormente, la identificacin en 1991 del gen FMR1 revel la existencia de un gen de 38 kb y 17 exones, con un trinucletido CGG en una isla CpG de la regin promotora del gen. Fue el primer ejemplo de una enfermedad originada por la expansin de una repeticin de trinucletidos. Las mutaciones de la regin codificante son raras, pero tambin provocan la enfermedad cuando implican disminucin de la protena FMRP, lo que sugiere que la expansin del trinucletido provoca una prdida de funcin. La protena codificada por el gen es citoplasmtica y se expresa en cerebro (por igual en todos los tipos de neuronas, aunque no se expresa en clulas no-neuronales), as como en testculo (en clulas germinales pero no en clulas de Sertoli o de Leydig). La protena posee dominios de unin al ARN y dominios de unin a otras protenas, y se ha comprobado que se une a su propio mensajero, a un cuatro por ciento de todos los ARNm de cerebro fetal, y tambin a la subunidad 60S de los ribosomas. Podra por tanto entrar en el ncleo, capturar mensajeros y exportarlos al citoplasma como parte de la maquinaria traduccional, especficamente aquellos mensajeros que son cruciales para el desarrollo de las dendritas y para la funcin sinptica en las neuronas. Curiosamente, se ha visto que la mayor parte de los ARNm que se unen a FMRP forman estructuras secundarias llamadas cuartetos-G, debido a la presencia de Guaninas espaciadas regularmente; mediante estas estructuras, los mensajeros se unen al dominio RGG (arginina-glicina-glicina) de la FMRP. Tambin se ha visto que, en Drosophila, la protena FMRP forma parte del complejo de silenciamiento por interferencia de ARN (RISC), lo que abre la posibilidad de que dicho mecanismo tambin est implicado en la fisiopatologa del Sndrome del X frgil. Aunque el hallazgo del gen y la elucidacin de la estructura de la protena todava no han permitido desvelar completamente el mecanismo fisiopatolgico de la enfermedad, s han servido para explicar el modo inusual de transmisin de la misma, que se ver en un captulo posterior.

La Figura 15.3 muestra la estructura de los cuartetos G.

www.FreeLibros.me

204

La distrofia miotnica se puede producir por alteraciones en 2 loci. La forma ms frecuente es la DM1, debida a la expansin del trinucletido CTG en la regin no traducida-3 del gen DMPK, que codifica una proten-quinasa. Como la enfermedad se hereda de forma autosmica dominante, parece que el complejo fenotipo de esta enfermedad (que incluye miotona muscular, cataratas y arritmias cardacas) debe ser el resultado de la alteracin de algn proceso celular importante. De hecho, se ha comprobado que la expansin del trinucletido CTG en el gen DMPK inhibe la expresin de un gen vecino llamado SIX5. Se ha visto que los ratones knock-out para el gen DMPK tienen una arritmia similar a la que se ve en los pacientes con distrofia miotnica, mientras que los ratones knock-out para SIX5 sufren unas cataratas que recuerdan a las de los enfermos. La miopata se produce por la presencia de ARN con largas expansiones de repeticiones CUG (esto se ha comprobado tambin en ratones). La hiptesis ms aceptada es que la expansin da lugar a un ARN que es capaz de unirse a varias protenas de unin a ARN que regulan el fenmeno del ayuste, alterando su funcin. Como resultado, se altera el ayuste correcto de otros ARNm, y de hecho se han identificado ms de 10 genes cuyo ayuste y funcin est alterada en esta enfermedad. Estos genes incluyen un canal de cloro, el propio SIX5, el gen de la troponina T, el receptor de la insulina, genes con funciones neuronales, etc. En conjunto, se piensa que la sintomatologa de la enfermedad es el resultado conjunto de la desregulacin de todos estos genes por la presencia de un ARNm con la expansin de CTG. La ataxia de Friedreich, enfermedad autosmica recesiva que no muestra el fenmeno clnico de anticipacin, parece tambin un buen ejemplo de prdida de funcin debida a la expansin, ya que los sujetos enfermos deben ser homocigotos (tener ambos alelos con la expansin) o heterocigotos compuestos (un alelo con expansin y el otro alelo con una mutacin puntual). El trinucletido GAA que sufre la expansin est localizado en una secuencia Alu del primer intrn del gen FRDA, que codifica una protena llamada frataxina. Los alelos normales estn interrumpidos por la secuencia (GAGGAA)5-9 y no tienen ms de 32 repeticiones GAA. La expansin impide la transcripcin del gen, al formar un intrn muy largo con estructuras de triple hlice en el ADN genmico. Los niveles bajos de frataxina alteran la funcin mitocondrial, ya que esta protena es importante en la homeostasis del hierro en la mitocondria, y dan lugar a una disminucin en la produccin de energa y a la formacin de especies reactivas de oxgeno.

Potencial patognico de las secuencias repetidas

15.5 Otras enfermedades por expansin 15.5 de secuencias repetidas


Recientemente se ha descrito un tipo de epilepsia mioclnica progresiva de herencia autosmica recesiva, debida a la expansin de una secuencia de 12 nucletidos (CCCCGCCCCGCG). Este es el primer ejemplo de enfermedad por expansin de un minisatlite, que en este caso se encuentra en la regin promotora del

www.FreeLibros.me

gen CSTB (cistatina B, un inhibidor de proteasas). Los alelos normales tienen hasta tres repeticiones, mientras que sujetos con premutacin tienen 12 a 17 repeticiones y los enfermos tienen entre 30 y 75 copias (en total, un tamao de 360-900 nucletidos). Un 14 por ciento de los individuos con esta enfermedad tienen mutaciones en la regin codificante del gen, por lo que el mecanismo patognico parece ser por prdida de funcin. De hecho, la presencia de la expansin conduce a disminucin de los niveles de ARNm, probablemente debido a la desorganizacin del promotor del gen CSTB. Tambin se ha identificado un nuevo tipo de ataxia espino-cerebelosa (SCA10), de herencia autosmica dominante. La causa de esta enfermedad reside en la expansin de un pentanucletido (ATTCT) en el intrn 9 del gen SCA10. Los individuos normales tienen 10 a 22 repeticiones, mientras que los sujetos con esta enfermedad tienen alelos entre 500 y 4 500 repeticiones. Posteriormente a este hallazgo, se identific la primera enfermedad debida a la expansin de un tetranucletido: la Distrofia Miotnica tipo 2. Los individuos normales tienen menos de 26 repeticiones CCTG en el intrn 1 del gen ZNF9, mientras que las expansiones en pacientes van desde 75 a 11 000 repeticiones.

205

Mutaciones debidas a repeticiones dispersas

15.6 Mutaciones debidas a repeticiones dispersas


Las repeticiones dispersas del genoma humano, estudiadas con detalle en el Captulo 4, suelen dar lugar a reordenamientos cromosmicos por un mecanismo denominado sobrecruzamiento desigual (en ingls, UnEqual Cross-over, UEC). Habitualmente, la recombinacin homloga durante la meiosis tiene como finalidad producir nuevas combinaciones de alelos, ya que se recombinan cromosomas homlogos. El sobrecruzamiento desigual consiste en la recombinacin entre secuencias homlogas pero no-allicas (es decir, que tienen homologa en su secuencia pero estn en localizaciones genmicas diferentes). Tal es el caso, por ejemplo, de los genes parlogos (miembros de una familia gnica, con alto grado de homologa entre ellos) o de las repeticiones dispersas tipo SINE o LINE (cuyos miembros tienen una secuencia muy homloga). Un buen ejemplo que ilustra los efectos del sobrecruzamiento desigual es el mecanismo que origina varones con cariotipo XX o mujeres XY (con disgenesia gonadal y disfuncin ovrica). Hasta un 30 por ciento de los casos de estas patologas son debidos a un sobrecruzamiento desigual entre los genes PRKX y PRKY, genes homlogos que estn cerca de la Regin Pseudoautosmica de los cromosomas sexuales X e Y, respectivamente. Fruto de esta recombinacin desigual, el gen SRY gen que determina el sexo masculino, situado en el cromosoma Y acompaa al fragmento telomrico del cromosoma Y que se mueve al cromosoma X, dando como resultado un cromosoma X que contiene SRY y un cromosoma Y sin SRY. Esto origina individuos que fenotpicamente son varones a pesar de ser XX, as como mujeres con cariotipo XY.
La Figura 15.4 muestra el proceso de recombinacin desigual entre los genes PRKX y PRKY.

www.FreeLibros.me

206

Adems, los fenmenos de recombinacin desigual son causa frecuente de duplicaciones o deleciones cuando tienen lugar entre repeticiones no allicas de gran tamao con un alto grado de homologa, como son las duplicaciones segmentarias del genoma humano, que ya mencionamos en el Captulo 4. Habitualmente, esto sucede entre secuencias que pertenecen a cromosomas distintos, pero en ocasiones la recombinacin o sobrecruzamiento desigual tambin puede tener lugar entre cromtides hermanas. En este caso se produce el llamado intercambio desigual entre cromatides hermanas (en ingls, UnEqual Sister Chromatid Exchange, abreviado UESCE), que da lugar a alteraciones en ambas cromtides de un mismo cromosoma: habitualmente se produce una duplicacin en una cromtide y una delecin en la otra.
El vdeo de la Figura 15.5 ilustra el proceso de recombinacin desigual entre secuencias de cromosomas homlogos o de cromtides hermanas.

Potencial patognico de las secuencias repetidas

Otro posible efecto de la recombinacin desigual entre secuencias homlogas es la conversin gnica entre ellas. Como hemos visto en un captulo anterior, durante los procesos de recombinacin homloga se forma un heterodplex que puede dar lugar a un proceso de conversin gnica, de modo que una de las secuencias se copia a la otra. Habitualmente, la conversin gnica tiene lugar entre alelos de un mismo gen; sin embargo, la recombinacin desigual entre dos secuencias no allicas (un gen y un pseudogen no funcional, por ejemplo) puede provocar la conversin de la secuencia del gen en la secuencia del pseudogen, lo que equivaldra a anular la funcin del gen. Un ejemplo clsico de este mecanismo es la enfermedad llamada Hiperplasia Suprarrenal Congnita (dficit del enzima 21-hidroxilasa). Alrededor del 75 por ciento de los casos de esta enfermedad estn provocados por un fenmeno de conversin gnica entre el gen CYP21B (que codifica el enzima) y el pseudogen CYP21A (que no es funcional). De modo general, hasta ahora hemos considerado que los elementos repetidos que se recombinan ilegtimamente estn en la misma orientacin. Puede suceder, sin embargo, que estn invertidos (en orientaciones contrarias uno respecto del otro). En este caso, la recombinacin entre elementos repetidos dar lugar a la inversin de la regin que queda entre las repeticiones, como se ver en un ejemplo del siguiente apartado.

15.7 Desrdenes genmicos


En conjunto, los procesos de recombinacin desigual dan lugar a un grupo de enfermedades humanas que se conocen con el nombre de Desrdenes Genmicos, y que incluyen entre otros los Sndromes por microdelecin que se han mencionado estudiado en el Captulo 13. Los Desrdenes Genmicos se pueden agrupar como sigue:

A) Debidos a deleciones

Los pacientes con Ictiosis ligada al X tienen una delecin del gen de la sulfatasa esteroidea en Xp22, por reordenacin entre elementos repetidos (separados por 1,9 Mb) que flanquean este gen.

www.FreeLibros.me

La delecin que produce el Sndrome de Williams-Beuren est originada por recombinacin entre duplicaciones segmentarias que flanquean el gen de la elastina en 7q11, repeticiones que estn separadas por 1,6 Mb. La causa ms frecuente de los Sndromes de Prader-Willi y de Angelman es una delecin de 4 Mb por recombinacin desigual entre duplicaciones en 15q11-q13. La reordenacin ms frecuente en el cromosoma 22 es la delecin de unas 3 Mb en 22q11.2, que se encuentra en el 90 por ciento de pacientes con Sndrome de Di George o con Sndrome Cardio-velo-facial. Un caso especial de delecin de secuencias repetidas es la contraccin de una serie de repeticiones en tndem cerca del telmero 4q, que origina una enfermedad llamada distrofia facio-escpulo-humeral. Recientemente se ha comprendido el mecanismo molecular de dicha enfermedad. En la regin subtelomrica 4q existe un elemento llamado D4Z4 que est repetido en tndem. Los cromosomas normales tienen entre 10 y 100 repeticiones del elemento. Los cromosomas contrados, que tienen entre una y 10 repeticiones, pueden dar lugar a la enfermedad si adems ese cromosoma tiene un satlite beta a continuacin de la repeticin (lo que se conoce como variante 4qA); los cromosomas 4q sin el satlite beta no dan lugar a la enfermedad, aunque tengan slo 1-10 repeticiones D4Z4 (variante 4qB). Esta contraccin desencadena la enfermedad mediante la des-regulacin de genes cercanos a esa regin, especialmente por sobre-expresin del gen FRG1.

207

Desrdenes genmicos

Delecin de 1,5 Mb (5-10%) Delecin de 3 Mb (90%)

4 Mb

15q11 -q13

Di George (22p)

Prader -Willi /Angelman

En la Figura 15.6 se incluyen esquemas de los principales desrdenes genmicos debidos a deleciones.

B) Debidos a duplicaciones/deleciones
Los reordenamientos entre dos elementos llamados CMT1A-REP, localizados en 17p12, dan lugar a individuos con la duplicacin o con la delecin de la regin com-

www.FreeLibros.me

208

prendida entre ambas repeticiones. Esta regin incluye el gen PMP22, que codifica una protena de la mielina, y la duplicacin o delecin de esta regin origina dos enfermedades distintas (Charcot-Marie-Tooth o Neuropata Hereditaria con Parlisis por Presin, respectivamente). Las repeticiones CMT1A-REP tienen un tamao de unas 30 kb y estn a una distancia de 1,5 Mb, de forma que el sobrecruzamiento desigual entre ellas origina la delecin o duplicacin de esa regin. Estas repeticiones tienen una regin pequea (1,7 kb) que es casi totalmente idntica en todas ellas, y tambin contienen un elemento similar al transposn mariner. Parece que la presencia de ste ltimo puede favorecer la accin de una transposasa a este nivel y facilitar la recombinacin desigual entre cromtides. Algo similar sucede en el Sndrome de Smith-Magenis, debido a una delecin de unas 5 Mb en 17p11.2. Los individuos con duplicacin de esa regin tienen un fenotipo distinto.
La Figura 15.7 ilustra el proceso de recombinacin desigual que origina las enfermedades de Charcot-Marie-Tooth y la Neuropata Hereditaria con Parlisis por Presin.

Potencial patognico de las secuencias repetidas

C) Debidos a inversiones
Cuando la recombinacin desigual se produce entre repeticiones invertidas que estn en la misma cromtide, a menudo se originan inversiones cromosmicas. Este fenmeno es especialmente frecuente como causa de Hemofilia A, una coagulopata debida al dficit de Factor VIII de la coagulacin. El gen que codifica el Factor VIII tiene un elemento llamado int22h que est repetido dos veces antes del exn 1 y otra vez (en la orientacin contraria) en el intrn 22 (entre los exones 22 y 23). Un sobrecruzamiento desigual entre uno de los elementos que estn antes del exn 1 con el elemento del intrn 22 dar lugar a una inversin de toda la regin comprendida entre ambas repeticiones, rompiendo totalmente la capacidad codificante del gen. Este mecanismo es responsable de un 45 por ciento de los casos de Hemofilia A en humanos, lo que subraya la gran importancia de este tipo de fenmenos en patologa humana.
La Figura 15.8 muestra el proceso de recombinacin desigual que origina la inversin del gen del Factor VIII, causante de Hemofilia A.

Otro ejemplo de inversin es la que da lugar a la distrofia muscular de EmeryDreifuss, por recombinacin entre repeticiones invertidas en Xq28. Este caso es especialmente interesante porque se ha detectado la inversin de esta regin en un tercio de las mujeres normales.

D. Otras anomalas
La recombinacin desigual entre elementos duplicados del genoma humano origina tambin otros procesos. Por ejemplo, la duplicacin invertida del cromosoma 15 es el cromosoma marcador que se encuentra con mayor frecuencia en recin nacidos. Tambin se encuentra un cromosoma marcador dicntrico debido a una duplicacin invertida en 22q en pacientes con Sndrome de Ojo de Gato, por reordenamientos

www.FreeLibros.me

entre duplicaciones segmentarias. Estas mismas duplicaciones estn implicadas en la translocacin t(11;22)(q23;q11), que es la nica translocacin recproca equilibrada recurrente en humanos. Finalmente, se ha observado que hasta un uno por ciento de los casos de retraso mental espordico pueden ser debidos a una microdelecin en 17q21.31, por recombinacin entre duplicaciones segmentarias flanqueantes. Curiosamente, esa regin se presenta en humanos en dos configuraciones diferentes, ya que existe un polimorfismo de inversin debido tambin a la presencia de duplicaciones segmentarias en orientacin invertida; una de esas configuraciones, la llamada H2, es la que puede dar lugar a la microdelecin.
900 kb H1 (80%)

209

Desrdenes genmicos

H2 (20%) 700 kb

microdelecin 17q21.31
La Figura 15.9 muestra la estructura de 17q21.31 y la microdelecin que se origina en esta regin.

www.FreeLibros.me

www.FreeLibros.me

C APTULO 16

Efectos fenotpicos de las mutaciones

Contenidos
16.1 16.2 16.3 16.4 Prdida de funcin, fenotipos recesivos y haploinsuficiencia Fenotipos dominantes por ganancia de funcin Alteraciones de la impronta genmica Mutaciones que afectan a la morfognesis

Cuando un gen est mutado por cualquiera de los mecanismos que hemos visto en el captulo anterior, pueden suceder fundamentalmente dos cosas: (a) que esa mutacin se silenciosa, no tenga ningn efecto pernicioso ni provoque ningn fenotipo anmalo; o (b) que esa mutacin provoque la aparicin de un fenotipo aberrante que conduzca al desarrollo de una enfermedad. En este segundo caso, que es el que nos ocupa en esta Gentica Humana, es importante darse cuenta de que la alteracin de un gen puede provocar un fenotipo anormal mediante dos mecanismos, fundamentalmente: la prdida de funcin o la ganancia de funcin. La prdida de funcin de un gen equivale a su ausencia total, ya que el gen no codifica la protena respectiva. En general, esto da lugar a fenotipos que se heredan de manera recesiva, ya que es necesario que estn mutados los dos alelos para que se manifieste el fenotipo. Sin embargo, en aquellos casos en los que hay un efecto de dosis gnica, en los que se producen fenotipos dominantes por un fenmeno llamado haploinsuficiencia, la prdida de funcin genera fenotipos de herencia dominante. En el caso de las mutaciones que provocan una ganancia de funcin, los fenotipos resultantes son generalmente de herencia dominante, porque la mutacin facilita que el gen escape a los mecanismos que regulan su expresin, o bien crea una nueva funcin que tiene un efecto dominante negativo. Como regla general, podemos decir que cuando las mutaciones puntuales en un gen producen el mismo fenotipo que las deleciones de todo el gen, lo ms probable es que esas mutaciones provoquen una prdida

www.FreeLibros.me

212

de funcin; en cambio, las mutaciones que operan a travs de una ganancia de funcin suelen provocar fenotipos distintos a los que genera la delecin o disrupcin de ese gen. A continuacin veremos un poco ms a fondo cada una de estas dos situaciones.

Efectos fenotpicos de las mutaciones

16.1 Prdida de funcin, fenotipos recesivos 16.1 y haploinsuficiencia


Un gen puede perder su funcin de varias maneras:

Mutaciones en el propio gen: cualquier tipo de mutacin que interrumpa la capacidad codificante del gen har que se pierda su funcin. Como hemos visto en el captulo precedente, puede tratarse de mutaciones puntuales, deleciones o inserciones que interrumpen el marco de lectura, as como alteraciones de las secuencias de ayuste (splicing). Tambin podemos incluir aquellas mutaciones que no afectan a la secuencia del transcrito (ARNm) sino a su estabilidad, de forma que el mensajero se degrada rpidamente y no llega a traducirse en la protena correspondiente. Mutaciones que afectan a los elementos que regulan la expresin gnica. Un gen puede dejar de expresarse por mutaciones que afectan al promotor, bien por mutaciones que alteran las secuencias de unin a factores de transcripcin o bien provocando su metilacin. Otro mecanismo que disminuye la expresin gnica es el que se conoce como efectos de posicin, es decir, una reordenacin cromosmica que mueve un gen de su posicin original a otra regin del genoma que est silenciada (una regin de heterocromatina, por ejemplo). En ocasiones, esto hace que el gen deje de expresarse. Hay varios ejemplos de enfermedades humanas producidas por este mecanismo, como el caso de la Distrofia Facio-Escpulo-Humeral que hemos estudiado en el captulo anterior. Otros ejemplos son la Aniridia (por alteraciones del gen PAX6) o la Displasia Campomlica (alteraciones del gen SOX9), enfermedades en las que muchas veces se observan translocaciones que no interrumpen directamente los genes respectivos, sino que los separan de su contexto genmico habitual y los colocan en una regin de cromatina silenciada.

Aunque la prdida de funcin de un gen suele desencadenar fenotipos recesivos, a veces se obtienen fenotipos con herencia dominante. Esto sucede en aquellos casos en los que la disminucin de la dosis gnica al 50 por ciento de lo que es habitual ya es capaz de provocar el fenotipo patolgico. Como es sabido, los genes autosmicos y el cromosoma X en mujeres estn en doble dosis gnica (hay dos alelos para cada gen), lo que hace que en circunstancias normales se produzcan unos niveles determinados de producto proteico. Habitualmente, la prdida de uno de los alelos no tiene ningn efecto patolgico: aunque slo se produce la mitad de protena de lo que sera normal, la cantidad producida por el alelo normal es suficiente para realizar la funcin respectiva. Sin embargo, en algunos casos la simple disminucin de la dosis gnica a la mitad, por la inactivacin de uno de los alelos mediante cualquier mecanismo muta-

www.FreeLibros.me

cional de los que se han estudiado, provoca el desarrollo del fenotipo patolgico. Cuando esto sucede, se habla de enfermedades causadas por haploinsuficiencia o insuficiencia haploide, que lgicamente se heredan con un patrn dominante. Aunque hay bastantes enfermedades humanas causadas por haploinsuficiencia, un buen ejemplo es el Sndrome de Turner (45,X0), en el que basta la prdida de una copia de los genes implicados para que se desarrollen las caractersticas fenotpicas propias de esta enfermedad. En concreto, se ha visto que uno de los genes responsables de esta enfermedad (SHOX) se localiza en la regin pseudoautosmica del cromosoma X y habitualmente escapa a la inactivacin del cromosoma X, por lo que en condiciones normales est presente en doble dosis gnica. Cuando se pierde una copia de este gen (por la ausencia de uno de los cromosomas X), la nica copia que queda no es suficiente para llevar a cabo correctamente su funcin y esto parece ser la causa de la talla corta de las mujeres con Sndrome de Turner.

213

Fenotipos dominantes por ganancia de funcin

16.2 Fenotipos dominantes por ganancia de funcin


Los mecanismos por los que las mutaciones pueden originar una ganancia de funcin que se manifieste en un fenotipo dominante son variados, pero podemos sealar tres:

Una mutacin que altera la protena de forma que sta adquiere una nueva funcin. El mejor ejemplo es el alelo Pittsburgh de alfa-1 antitripsina, un enzima con actividad anti-elastasa. Habitualmente, los alelos mutantes de alfa-1 antitripsina producen una prdida de funcin, con la consiguiente disminucin de la actividad enzimtica y el desarrollo de una enfermedad denominada enfisema pulmonar. En cambio, el alelo Pittsburgh est debido a una mutacin que cambia la metionina en posicin 358 a una arginina (M358R). Esto hace que el enzima adquiera una actividad anti-trombina que antes no tena, dando lugar a un transtorno de la coagulacin en vez de provocar enfisema pulmonar. Las mutaciones con ganancia de funcin son muy frecuentes en cncer, siendo uno de los principales mecanismos de activacin de oncogenes. Por ejemplo, la fusin de los genes BCR y ABL, en pacientes con leucemia mieloide crnica, es el resultado de una translocacin (9;22) en la que el gen ABL una tirosina-quinasa pierde su regin reguladora y queda fusionado con la regin 5 del gen BCR, que se expresa en clulas progenitoras hematopoyticas. Esto provoca un nuevo gen de fusin que conduce a una expresin constitutiva y des-regulada de la tirosina-kinasa ABL en clulas de la serie mieloide en la mdula sea, lo que lleva el desarrollo de la leucemia. Ganancia de funcin tambin por la sobre-expresin de un gen, como resultado de duplicaciones o amplificaciones gnicas: un segmento genmico que se copia varias veces, de forma que los genes contenidos en ese segmento estarn en un nmero de copias muy superior al normal. Este tambin es un mecanismo frecuente en distintos tipos de cncer. Por ejemplo, el oncogn C-MYC est amplificado en varios tumores (sobre todo en neuroblastomas), C-ERBB2 en tumores de mama, etc. Aunque estas amplificaciones pue-

www.FreeLibros.me

214

den verse en un cariotipo convencional como regiones de tincin homognea (Homogenous Staining Regions, HSR), o tambin como Dobles Diminutos (cromosomas minsculos), la tcnica de FISH las detecta con mucha mayor sensibilidad y permite adems contar el nmero de veces que el gen se ha amplificado.
La Figura 16.1 muestra algunos ejemplos de mutaciones que producen ganancia de funcin en cncer.

Efectos fenotpicos de las mutaciones

Por un efecto dominante-negativo. Consiste en que ciertos tipos de genes codifican molculas que funcionan como dmeros o forman parte de complejos multimricos, de modo que basta la mutacin en uno de los alelos del gen para que las molculas proteicas mutantes desestabilicen totalmente los complejos de los que forman parte. Un ejemplo tpico es el de enfermedades que afectan a los genes que codifican alguna de las cadenas de colgeno. La molcula de pro-colgeno es un trmero formado por distintos tipos de cadenas, cuya combinacin da lugar a los diferentes tipos de colgeno que existen. De modo general, una mutacin en el gen de una de las cadenas provocar la desestabilizacin de todo el complejo trimrico, por lo que basta la mutacin en un solo alelo para que se desarrolle la enfermedad. En estos casos, puede darse la circunstancia de que una mutacin puede tener distinta gravedad en funcin del nmero de molculas mutantes y nativas que se generan.

En la Figura 16.2 se ilustra el efecto dominante negativo de las mutaciones que provocan la desestructuracin de las molculas de procolgeno tipo I.

Todo lo dicho hasta ahora supone, en cierta medida, una simplificacin con fines didcticos. De hecho, existen algunos genes en los que distintas mutaciones pueden originar tanto una prdida como una ganancia de funcin, llevando al desarrollo de fenotipos y enfermedades distintas segn se trate de una prdida o una ganancia. Ya hemos visto, por ejemplo, el caso del gen del receptor de andrgenos, en el que la expansin de un trinucletido provoca la enfermedad de Kennedy (atrofia muscular espino-bulbar) mientras que las mutaciones con prdida de funcin dan lugar al llamado Sndrome de feminizacin testicular. Otro ejemplo es el de PMP22 (localizado en 17p11.2), un gen sensible a dosis en el que la duplicacin de uno de los alelos lo que supone la existencia de tres copias funcionales del gen provoca la enfermedad de Charcot-Marie-Tooth (un tipo de neuropata perifrica). Por el contrario, la prdida de uno de los alelos por delecin o menos frecuentemente por mutacin puntual provoca otra neuropata distinta llamada Neuropata hereditaria con parlisis por presin. A continuacin veremos otras dos situaciones especiales que sirven para ilustrar muy bien la variedad de efectos fenotpicos que se obtienen por mutaciones. En primer lugar estudiaremos el fenmeno de la impronta genmica y sus alteraciones; despus veremos algunas alteraciones en el desarrollo embrionario debidas a mutaciones en genes que codifican factores de transcripcin y receptores de membrana.

www.FreeLibros.me

16.3 Alteraciones de la impronta genmica


El imprinting o impronta genmica es la marca epigentica que define una regin genmica como materna o paterna en el cigoto. La existencia de este fenmeno se descubri al crear embriones de ratn por transferencia nuclear: cambiando un proncleo masculino por un segundo proncleo femenino se obtiene un ginogenonte; reemplazando el proncleo femenino por un segundo proncleo masculino se obtiene un androgenonte. En teora, estos embriones (excepto los androgenontes YY) deberan ser viables, pero en cambio se observ que estas modificaciones son letales en el periodo embrionario, y que esa letalidad tiene dos formas diferentes: los ginogenontes muestran un embrin normal con falta de desarrollo de tejidos extraembrionarios, mientras que los androgenontes muestran ms alteraciones en el embrin que en tejidos extraembrionarios. En humanos, las concepciones uniparentales androgenticas, que se originan raramente por la prdida de los cromosomas maternos poco despus de la fertilizacin, se manifiestan en una estructura que se conoce como mola hidatidiforme completa. Por el contrario, los oocitos que se dividen por partenognesis slo contienen material materno, y dan lugar a quistes dermoides. Estos hallazgos se explican actualmente por la existencia en el genoma de genes improntados (sometidos al fenmeno de la impronta), en los que de algn modo se reconoce el origen parental de cada alelo y se produce el silenciamiento selectivo de uno de ellos: en unos casos siempre se silencia el materno, en otros genes siempre se silencia el alelo paterno. Por tanto, cuando el ncleo del cigoto slo contiene material de uno de los progenitores, pero no una mezcla de ambos, los embriones resultantes son inviables. Esto sugiere la existencia de una asimetra de los genomas materno y paterno, en cuanto a que ambos genomas tienen silenciados distintos grupos de genes. Esta asimetra es necesaria para el correcto desarrollo embrionario. Dado que ambos alelos de los genes sometidos a imprinting son idnticos y capaces de interaccionar con los mismos factores de transcripcin, el mecanismo que silencia uno de ellos de manera estable y heredable debe ser un mecanismo epigentico, que haga posible que el imprinting pueda borrarse durante la gametognesis y re-establecerse tras la fecundacin. La metilacin, como mecanismo silenciador de la expresin gnica, cumple la mayor parte de estos requisitos, y hay bastantes lneas de evidencia que apoyan el papel de la metilacin en el fenmeno de imprinting: 1) todos los genes improntados descritos hasta el momento excepto uno muestran regiones con metilacin diferencial (abreviadas DMR en ingls, regiones que estn metiladas en uno de los alelos pero no en el otro), cuyos patrones de metilacin se establecen durante la gametognesis y se mantienen gracias a la metilacin especfica de ADN hemi-metilado; 2) los embriones de ratn dnmt1-/- (que carece de ADNmetiltransferasa-1) muestran expresin bi-allica de genes improntados, es decir, en ausencia de la metilasa de mantenimiento se re-expresa el alelo que estaba silenciado; 3) se ha descrito el caso de una mujer con mutaciones en el gen DNMT3L (que codifica una metilasa) que tiene infertilidad porque los embriones fallecen al implantarse en el tero; y 4) no se ha encontrado un fenmeno similar al imprinting en especies incapaces de llevar a cabo metilacin. Igualmente, se ha comprobado que los genes sometidos a imprinting tambin se replican de manera asincrnica: por FISH se suelen ver dos seales de hibridacin

215

Alteraciones de la impronta genmica

www.FreeLibros.me

216

correspondientes a las dos cromtides que se forman durante la fase S del ciclo celular, pero en genes improntados se ve un cromosoma con dos seales y el otro cromosoma homlogo con una sola seal. Esto sugiere que el alelo especficamente silenciado se replica ms tarde. Existen varios modelos para explicar cmo la metilacin diferencial da lugar a las diferencias de expresin entre alelos paterno y materno, y cmo se regulan genes vecinos que tienen patrones de imprinting opuestos. Parece claro que en algunos casos es muy importante la protena CTCF (CTC-binding factor) una protena que se une a la las regiones de metilacin diferencial (DMR) nicamente cuando stas no estn metiladas. Por ejemplo, se ha visto que la regulacin de los genes Igf2 y H19 en ratn (que tienen patrones de imprinting opuestos) se lleva a cabo por este mecanismo, ya que CTCF acta como aislador (insulator) del promotor de Igf2 de unos potenciadores lejanos.

Efectos fenotpicos de las mutaciones

Alelo 1
Me

Alelo 2

Alelo 1
Me

Alelo 2

Alelo 1
Me

Alelo 2
La Figura 16.3 muestra varios modelos de regulacin de los genes que estn sometidos a imprinting.

La importancia de la protena CTCF se ha puesto de manifiesto gracias a un hallazgo sorprendente, al conseguir ratones partenogenticos viables cuando se deleciona de su genoma el gen H19 y la regin de metilacin diferencial a la que se une CTCF. Inicialmente, un ratn partenogentico lleva dos copias del genoma materno, por lo que tendr expresin biallica del gen H19 y silenciamiento de ambos

www.FreeLibros.me

alelos de Igf2, de ah que sean inviables. La delecin de una de las copias del H19 reestablece la expresin monoallica de este gen, pero todava hay silenciamiento total de Igf2 e inviabilidad embrionaria. En cambio, si adems se deleciona la regin de metilacin diferencial a la que se une CTCF, ahora los potenciadores pueden promover la expresin de Igf2 en este cromosoma, con lo que se reestablece la expresin monoallica de Igf2. El resultado final es la expresin monoallica de H19 de uno de los cromosomas y la expresin monoallica de Igf2 del cromosoma homlogo, que es la situacin normal. Esto ilustra la importancia que tiene la impronta genmica en el desarrollo embrionario, y sugiere que la ineficacia de los procesos de clonacin de mamferos probablemente se deba a que los ncleos somticos utilizados para la transferencia nuclear no tienen los patrones de imprinting necesarios para la viabilidad embrionaria.
El vdeo de la Figura 16.4 muestra la importancia del fenmeno del imprinting en el desarrollo embrionario.

217

Alteraciones de la impronta genmica

En cada ciclo reproductivo, los patrones de imprinting han de establecerse de nuevo, puesto que lo que en una meiosis fue material de origen paterno (transmisin de un varn a su hija, por ejemplo) en la siguiente meiosis pasar a ser marcado como materno (cuando esa hija tenga descendencia). Para poder cambiar el imprinting es necesario borrar toda la informacin previa sobre cul de los alelos debe silenciarse. Como el genoma est muy desmetilado en los gametos, el cambio en los patrones de imprinting debe de tener lugar durante la gametognesis. Con los datos actuales, la hiptesis ms aceptada para explicar el borrado y re-establecimiento de los patrones de metilacin durante la gametognesis es la existencia de protenas capaces de unirse a las DMR no-metiladas (y as protegerlas de la metilacin), junto con otros factores que se unen a las DMR metiladas y ayudan a mantener el estado silenciado. Se piensa que slo una de las lneas germinales (masculina o femenina) es capaz de producir los factores que protegen de la metilacin a las regiones nometiladas. As, estas regiones se mantendrn des-metiladas en la lnea germinal que produzca estos factores. Por el contrario, estas regiones se metilarn y silenciarn en la lnea germinal que no los produce. Por lo que respecta a la identidad de dichos factores, los candidatos ideales son las protenas que se unen especficamente a regiones metiladas (MeCP2, HDAC, etc.) o a regiones no metiladas (CTCF, factores de transcripcin que se unen a CpGs no metilados, etc.). La impronta es, por tanto, un mecanismo fisiolgico normal. Sin embargo, algunas alteraciones genticas que afectan a regiones sometidas a imprinting pueden dar lugar a enfermedades. Este es el caso de la llamada disoma uniparental, situacin en la que ambas copias de un cromosoma o de una regin cromosmica proceden del mismo progenitor. Si esa regin contiene genes improntados, el resultado puede ser la presencia de dos copias silenciadas de un gen, con lo que el efecto viene a ser similar a una delecin homocigtica de ese locus. Hoy en da conocemos una larga lista de enfermedades y tumores humanos debidos a disoma uniparental de loci sometidos a impronta. Adems, se han detectado regiones improntadas en los cromosomas 11, 15, 7 y 14, y actualmente se conocen unos 30 genes improntados en ratn y humanos.

www.FreeLibros.me

218

Los loci sometidos a impronta tienden a aparecer agrupados en determinadas regiones cromosmicas, de manera que dentro de cada uno de estos grupos o clusters unos genes muestran expresin materna y otros genes muestran expresin paterna. Esto se ilustra con el ejemplo de dos enfermedades llamadas Sndrome de Prader-Willi y Sndrome de Angelman, originados por alteraciones en el grupo de genes improntados que se encuentran en 15q11-q13. Todos los genes improntados en esta regin muestran expresin especfica del alelo paterno excepto el gen UBE3A, que muestra expresin materna en cerebro. Parece que la expresin de UBE3A depende de la expresin de un transcrito antisentido que comienza 6,5 kb en direccin 3 del codn de parada de UBE3A y que alcanza hasta la mitad 3 de UBE3A, de manera que en la mayora de los tejidos somticos este transcrito no se expresa y por tanto la expresin de UBE3A en estos tejidos es biallica. Por el contrario, el transcrito antisentido se expresa en clulas de Purkinje, neuronas del hipocampo y clulas mitrales olfatorias, silenciando el alelo paterno y originando el imprinting de UBE3A en estos tejidos.

Efectos fenotpicos de las mutaciones

PAR - 5 NECDINA ZNF127 Antisense SNRPN IPW PAR - 1 UBE3A

Paterno

Materno
En la Figura 16.5 se muestra el cluster de genes sometidos a imprinting en 15q11, cuyas alteraciones causan los sndromes de Prader-Willi y de Angelman.

Por estudios en pacientes con microdeleciones, sabemos que el centro de imprinting de esta regin es bipartito y cubre en total unas 100 kb. Dentro de esta regin, el centro de imprinting para Angelman cubre 1,15 kb, mientras que el centro de imprinting Prader-Willi es ms distal y cubre unas 4,3 kb (incluyendo el promotor y el exn 1 del gen SNRPN). Se postula que durante la gametognesis estos centros fijan los patrones de expresin de toda esta regin, de forma que en la oognesis se activa el centro de imprinting AS que, a su vez, bloquea la funcin del centro de imprinting PW. Como resultado, los gametos femeninos slo expresan el gen UBE3A. En cambio, en la espermatognesis el centro AS estara bloqueado, de manera que

www.FreeLibros.me

el centro de imprinting PW es ahora activo y promueve la expresin de todos los genes de expresin paterna, incluido el gen antisentido que bloquea la expresin de UBE3A. De este modo se crean los epigenotipos paterno y materno que se mantendrn durante el desarrollo embrionario y en clulas somticas adultas. El Sndrome de Prader-Willi, cuya incidencia estimada es de 1/25 000, se caracteriza por disminucin de la actividad fetal, obesidad, hipotona muscular, retraso mental, hipogonadismo hipogonadotrfico, manos y pies pequeos, hipopigmentacin, baja estatura y rasgos dismrficos. Se debe a la falta de expresin de los genes especficos del cromosoma paterno dentro de esta regin. Por el contrario, el Sndrome de Angelman tiene una incidencia de 1/15 000 nacimientos y est caracterizado por un fenotipo distinto al de Prader-Willi: retraso mental severo, temblor, ataxia, marcha anormal, tendencia a la risa, trastornos del sueo y convulsiones. Est provocado por la falta de expresin del gen UBE3A, que se expresa especficamente en el cromosoma materno. Las alteraciones de la impronta de todos estos genes pueden tener lugar por varios mecanismos: 1. Deleciones grandes de la regin: producirn Sndrome de Prader-Willi (SPW) si la delecin afecta al cromosoma paterno, o Sndrome de Angelman (AS) si la delecin afecta al cromosoma materno. Constituyen la principal causa de estas enfermedades (70 por ciento de todos los casos). Disoma uniparental (UPD), debida a no-disyuncin durante una de las meiosis parentales. En efecto, la no-disyuncin puede originar gametos dismicos o nulismicos, que originan cigotos trismicos o monosmicos. En estas circunstancias, la disoma uniparental puede ser resultado tanto de la recuperacin de un cigoto trismico por prdida de uno de los cromosomas, como de la duplicacin completa de un cromosoma para recuperar un cigoto monosmico. En este ltimo caso vemos una isodisoma (ambos cromosomas provienen de la duplicacin de un mismo cromosoma parental), mientras que un 70 por ciento de los casos de reduccin de cigotos trismicos dan lugar a heterodisoma (presencia de los dos cromosomas del mismo progenitor). La presencia de dos cromosomas 15 paternos da lugar a un dos por ciento de los casos de Sndrome de Angelman, mientras que el 25 por ciento de los casos de Sndrome de Prader-Willi se deben a la presencia de dos cromosomas 15 maternos. Mutaciones puntuales en los genes responsables. En el Sndrome de Angelman se detectan mutaciones en el gen UBE3A (que codifica la E6 ubiquitinligasa) hasta en un 20 por ciento de los enfermos. En el caso del Sndrome de Prader-Willi, en cambio, la bsqueda de un gen candidato no ha dado resultados, aunque el principal gen implicado es SNRPN. En el caso concreto de este gen (SNRPN), se ha visto que existe otra secuencia codificante en direccin 5 (SNURF por SNRPN Upstream Reading Frame) de manera que, de hecho, ambos forman un nico gen bicistrnico: un solo transcrito del que se traducen dos protenas. Con los datos actuales, hay que considerar el Sndrome de Prader-Willi como un sndrome de microdelecin causado por la prdida de varios genes contiguos. Mutaciones o microdeleciones que afectan a los centros de imprinting, de manera que no se podrn re-establecer los patrones durante la gametog-

219

Alteraciones de la impronta genmica

2.

3.

4.

www.FreeLibros.me

220

nesis en el caso de que haya transmisin de un sexo al opuesto (madrehijo o padre-hija). El resultado funcional en el cigoto es idntico a lo que sucede en la disoma uniparental: ambos alelos llevan el mismo patrn de imprinting. Este tipo de alteraciones son responsables de un cinco por ciento de los casos de Sndrome de Prader-Willi o de Sndrome de Angelman. El ejemplo tpico es el de la abuela paterna portadora de una mutacin en el centro de imprinting del cromosoma 15 que lleva marcado como materno. Al transmitir este cromosoma a un hijo varn, el cromosoma mutado pasar a su hijo marcado como materno, por lo que no es necesario reestablecer el imprinting y el hijo ser normal (llevar un cromosoma marcado como paterno y otro como materno). En la siguiente generacin, en cambio, este individuo varn deber pasar su cromosoma 15 marcado como paterno, por lo que la marca que lo identificaba como materno deber ser borrada durante la espermatognesis y sustituida por la marca que lo identifique como paterno. En este individuo dicho cambio ser imposible, debido a la mutacin en el centro de imprinting de su cromosoma 15 materno, por lo que su descendencia llevar dos cromosomas con epigenotipo materno y desarrollar Sndrome de Prader-Willi. Lo mismo puede suceder para el Sndrome de Angelman, cuando la mutacin del centro de imprinting afecta al cromosoma paterno. El diagnstico gentico en estas dos enfermedades va dirigido a la deteccin de deleciones, de disoma uniparental o de alteraciones en el centro de imprinting, y se realiza por los siguentes procedimientos:

Efectos fenotpicos de las mutaciones

Cariotipo convencional: es insuficiente para detectar la microdelecin tpica, pero es til en el probando y en los padres para detectar posibles translocaciones, ya que un pequeo porcentaje de las deleciones son fruto de translocaciones no equilibradas (casi siempre de novo). Tambin detectar translocaciones equilibradas de novo o heredadas, aunque estos casos son excepcionales. FISH: detecta todas las deleciones, usando sondas frente al gen SNRPN en combinacin con una sonda centromrica del cromosoma 15. La mayora de las deleciones son intersticiales, siendo la ms frecuente una pequea delecin de unas 4 Mb de tamao. Deteccin de Disoma Uniparental: se usan microsatlites del cromosoma 15 para determinar el origen parental de cada cromosoma. Lgicamente, es necesario descartar primero la presencia de delecin, y adems este procedimiento viene limitado por la necesidad de obtener muestras del probando y de ambos progenitores, as como por la posible falsa paternidad. Anlisis de metilacin: puede hacerse bien por Southern blot tras digestin del ADN genmico con enzimas de restriccin sensibles a metilacin, o por PCR especfica de metilacin (MS-PCR). Si el exn 1 de SNRPN y el centro de imprinting adyacente estn metilados en los dinucletidos CpG, esto indica un patrn materno; si no estn metilados, podemos excluir el silenciamiento de SNRPN y los dems genes de expresin paterna. Es un anlisis que no requiere muestras de los progenitores, y permite confirmar la existencia de Sndrome de Prader-Willi cuando se observa slo el patrn de metilacin materno. Tiene la ventaja de que si el anlisis es normal (es decir, si se observan

www.FreeLibros.me

dos patrones distintos de metilacin, correspondientes a los cromosomas paterno y materno), esto automticamente excluye la presencia de delecin o de disoma uniparental. Cuando esta prueba es anormal (patrn nicamente materno) y no se detecta delecin ni disoma uniparental, esto sugiere la existencia de alteraciones en el centro de imprinting. En el caso concreto del Sndrome de Angelman tambin es necesario buscar mutaciones en UBE3A: aunque esto slo supone un 20 por ciento de los pacientes, su deteccin es de gran importancia por el aumento dramtico en el riesgo de recurrencia de la enfermedad en la misma familia. Se estima que hasta un tercio de los pacientes que tienen estudios de metilacin normales tienen mutaciones en UBE3A, por lo que la estrategia diagnstica recomendada es comenzar con estudios de metilacin y despus buscar mutaciones de UBE3A en aquellos sujetos con resultados de metilacin normales.

221

Mutaciones que afectan a la morfognesis

La Figura 16.6 muestra la estrategia diagnstica en los sndromes de Prader-Willi y Angelman.

En el Sndrome de Prader-Willi el riesgo de recurrencia (un segundo individuo enfermo en la misma familia) es prcticamente cero en los casos de delecin y de disoma uniparental que no estn asociados a reordenaciones cromosmicas. De todas formas, a efectos de consejo gentico se considera un riesgo de recurrencia del uno por ciento, ya que en una muestra amplia de pacientes se detect un riesgo de recurrencia en hermanos de probandos del 1,6 por ciento (aunque esto inclua todas las posibles causas). El mayor riesgo de recurrencia se produce en los casos familiares que estn debidos a alteraciones en el centro de imprinting. En estos casos, el riesgo de recurrencia es del 50 por ciento ya que volver a suceder siempre que el padre transmita el cromosoma 15 que lleva la mutacin. En el Sndrome de Angelman, el riesgo de recurrencia tambin se considera habitualmente del uno por ciento, excepto en los casos de mutaciones del centro de imprinting y de mutaciones en UBE3A, en las que el riesgo de heredar el cromosoma materno mutado es del 50 por ciento (si el cromosoma mutado se hereda del padre no hay enfermedad porque en ese cromosoma el gen UBE3A no se expresara en cualquier caso).

16.4 Mutaciones que afectan a la morfognesis


El estudio comparativo del desarrollo embrionario en humanos, ratn y Drosophila ha permitido identificar los mecanismos genticos por los que se generan varias enfermedades congnitas de la morfognesis. En general, estas mutaciones afectan sobre todo a genes que codifican dos tipos de protenas: A) Factores de transcripcin: son protenas con actividad reguladora de la expresin gnica gracias a que poseen dos propiedades principales: capacidad de unin a determinados elementos en el ADN y capacidad de transactivacin de otros factores proteicos. Los factores de transcripcin tienen, por tanto, un dominio de unin al ADN y un dominio de transactivacin por el que se une a los otros componentes de un complejo activador o represor de la transcripcin. Hay cuatro tipos principa-

www.FreeLibros.me

222

les de dominios de unin al ADN que se encuentran en la gran mayora de factores de transcripcin: 1) HTH (helix-turn-helix o hlice-vuelta-hlice), presente sobre todo en factores de transcripcin que intervienen en la regulacin de la expresin gnica durante el desarrollo embrionario. El ejemplo mejor conocido es el homeodominio, que est presente en los genes homeobox que determinan la identidad posicional de las clulas a lo largo del eje craneo-caudal del embrin; 2) dedos de zinc, que suelen unirse a elementos de respuesta en el ADN; 3) cremalleras de leucina, con una hlice en la que hay una leucina cada siete aminocidos de manera que quedan en la misma cara de la hlice y dimerizan fcilmente; 4) HLH (helix-loop-helix o hlice-lazo-hlice) son similares a cremalleras de leucina y tambin forman homoy heterodmeros; ambos son importantes en la regulacin de procesos de diferenciacin celular y desarrollo embrionario.
En la Figura 16.7 se muestra la estructura de algunos factores de transcripcin.

Efectos fenotpicos de las mutaciones

Entre los sndromes malformativos debidos a alteraciones en factores de transcripcin encontramos varios grupos:

Las extremidades se organizan en torno a tres ejes (Antero-Posterior, DorsoVentral y Proximal-Distal), y se desarrollan a partir de un brote en el que hay una intensa actividad mittica en la llamada zona de progresin, actividad que es inducida por el repliegue apical ectodrmico. Esta actividad mittica est en equilibrio con los procesos de apoptosis de clulas del mesnquima, que da lugar a los espacios interdigitales e interseos. El principal mecanismo de formacin del eje antero-posterior es la va de sealizacin intracelular de las protenas Hedgehog, integrada por SHH, los factores de transcripcin GLI1, GLI2 y GLI3, y los receptores Patched (PTCH) y Smoothened (SMO). El gen llamado Sonic Hedgehog (SHH) se expresa en la lnea media del Sistema Nervioso Central, en la notocorda y en la Zona de Actividad Polarizante, que es la regin que determina la posterioridad de un miembro. En general, la disregulacin de este gen provoca sindactilia (fusin de dos o ms dedos) y/o polidactilia, (aparicin de uno o ms dedos extra) que tienden afectar a los dedos cercanos al pulgar (preaxiales) en casos de sobre-expresin de SHH, o bien afectan a los dedos cercanos al meique (centrales/postaxiales) en casos de represin de este gen. Sin embargo, no se han encontrado mutaciones de SHH en malformaciones de miembros, pero s en pacientes con holoprosencefalia autosmica dominante. Esta enfermedad se origina por el desarrollo defectuoso del cerebro anterior y de la cara, con unas manifestaciones muy variables que van desde un incisivo nico hasta individuos con un solo ojo (cclopes), pero es genticamente heterognea ya que mutaciones en otros genes como ZIC2, SIX3, TGIF y PATCHED tambin la causan. Por otro lado, las mutaciones del gen PTCH (localizado en 9q22.3) causan el Sndrome de Gorlin autosmico dominante (carcinoma nevoide de clulas basales), que adems cursa frecuentemente con polidactilia pre- o postaxial, o bien sindactilia del 3 y 4 dedos del pie. Finalmente, los factores de transcripcin GLI comparten el dedo de zinc de la protena codificada por

www.FreeLibros.me

el gen cubitus interruptus de Drosophila, y actan como activadores o represores de la va de transduccin de seales de SHH. Por ejemplo, el Sndrome de cefalopolisindactilia de Greig (polidactilia postaxial de manos, preaxial de pies, macrocefalia, frente prominente con hipertelorismo leve), de herencia autosmica dominante, se debe a haploinsuficiencia de GLI3 por mutaciones que destruyen el dedo de zinc de este gen, de manera que se produce expresin ectpica preaxial de SHH (GLI3 normalmente inhibe la expresin de SHH). En cambio, GLI3 tambin parece implicado en el Sndrome de Pallister-Hall (hamartomas hipotalmicos con malformaciones de extremidades), por mutaciones que respetan el dedo de zinc y por tanto mantienen constitutivamente la actividad represora sobre SHH. Un mecanismo similar parece implicado en la Polidactilia postaxial tipo A (en la que se ha identificado una mutacin de GLI3 que respeta el dedo de zinc). Por su parte, el Sndrome de Rubinstein-Taybi (retraso psicomotor y del crecimiento, dismorfismo facial, anomalas de los pulgares y, raramente, polidactilia preaxial de los pies) se debe a mutaciones en CBP: como GLI se transactiva a travs de un dominio de unin a CBP, la ausencia de este factor provoca una expresin baja de GLI, seguida por la expresin anormalmente elevada de SHH.
La Figura 16.8 ilustra el desarrollo de los miembros y la funcin de varios genes en este proceso.

223

Mutaciones que afectan a la morfognesis

Los genes que codifican protenas con el homeodominio se denominan genes homeobox (la homeobox es la caja o secuencia de ADN que codifica el homeodominio), y se agrupan en varias familias. En Drosophila, el plan corporal se regula durante la embriognesis por la expresin del grupo de genes HOM-C, organizados en un complejo Antennapedia (3, estructuras anteriores) y un complejo Bithorax (5, estructuras posteriores). Los factores de transcripcin que regulan la expresin de estos genes son el grupo trithorax (regulacin positiva) y el grupo polycomb (regulacin negativa). Los ortlogos humanos de HOM-C son la familia de genes HOX, de los que hay cuatro grupos parlogos (cada grupo se denomina por una letra de la A a la D). Dentro de un grupo, cada gen se designa con un nmero del 1 al 13 en direccin 3 a 5. As, los parlogos 1 determinan regiones anteriores y los parlogos 13 las regiones posteriores del eje corporal. El desarrollo de las extremidades tienen una fase inicial en la que es importante la expresin de genes HOX, y de hecho se ha descrito un tipo de sin-polidactilia en pacientes que tienen un aumento de 7-14 alaninas en el gen HOXD13, expansin que provoca una ganancia de funcin de dicho gen. Tambin se han encontrado mutaciones en HOXA13 en pacientes con Sndrome mano-pie-genital, caracterizado por hipoplasia del quinto dedo de manos y pies y malformaciones genitourinarias (hipospadias o tero bicorne). Los genes de la familia Pax codifican factores de transcripcin que contienen un dominio de unin al ADN de 128 aa con dos regiones de hlice-vuelta-hlice, llamado paired domain porque originalmente se encontr en el gen paired de Drosophila. Adems, los factores Pax3, Pax4, Pax6 y Pax7 tambin contienen un homeodominio. Las mutaciones en el dominio paired de PAX6

www.FreeLibros.me

224

Efectos fenotpicos de las mutaciones

1 HOX A HOX B HOX C HOX D 3

10

11

12

13 5

Bithorax Antennapedia

La Figura 16.9 muestra un esquema de los genes homeobox humanos.

causan anomalas oculares (aniridia, anomala de Peters, distrofia corneal, catarata congnita e hipoplasia de la fovea). En estos casos, la aniridia (o, a veces, anoftalmia) no parece producirse por un efecto dominante negativo, sino por haploinsuficiencia del gen PAX6, ya que los heterocigotos slo tienen aniridia pero en cambio los homocigotos padecen anoftalmia, lo cual sugiere un efecto de dosis. Las mutaciones en PAX6 tambin son responsables de la aniridia del Sndrome WAGR, por una microdelecin en 11p13 que deleciona todo el gen. Por lo que respecta al gen PAX3, algunas mutaciones en el mismo producen el Sndrome de Waardenburg tipo 1 (distopia cantorum, pigmentacin anormal y sordera sensorioneural), mientras que otras mutaciones en este mismo gen dan lugar al Sndrome de Klein-Waardenburg (lo anterior ms camptodactilia y malformaciones de las extremidades). Otro miembro de esta familia, el gen PAX8, est mutado en casos familiares de disgenesia tiroidea. Por su parte, las mutaciones que afectan al gen PAX2 causan una condicin autosmica dominante que incluye colobomas del nervio ptico, anomalas renales y reflujo vesico-ureteral. SRY es el gen que controla el desarrollo de la gnada masculina y, lgicamente, se localiza en el cromosoma Y. La protena codificada por SRY contiene una caja HMG (High Mobility Group), que es un motivo de 79 aas por el que la protena se une al ADN y lo dobla hasta 130 grados, con lo que favorece la activacin de genes cercanos. Las mutaciones en SRY son causa de la aparicin de individuos con cariotipo XY que fenotpicamente son mujeres. Otros genes relacionados con SRY son los genes de la familia SOX; por ejemplo, SOX9 est mutado en una enfermedad autosmica dominante llamada Displasia campomlica (inversin de sexo en varones, arqueamiento congnito de huesos largos, paladar hendido, ausencia de costillas y trax pe-

www.FreeLibros.me

queo). Se piensa que las malformaciones esquelticas de la displasia campomlica se deben a que SOX9 es un factor de transcripcin que transactiva secuencias reguladoras que se encuentran en el primer intrn del gen COL2A1, que da lugar al colgeno tipo II. Por tanto, la falta de SOX9 lleva consigo una produccin insuficiente de cadenas alfa-1 del colgeno tipo 2, con las consiguientes malformaciones en huesos y cartlagos. B) Receptores de las vas de transduccin de seales: constituyen otro gran grupo de protenas que suelen dar lugar a fenotipos de herencia dominante, habitualmente por un efecto dominante negativo de las molculas mutadas. A continuacin se sealan dos de los ejemplos ms ilustrativos:
El vdeo de la a 16.10 ilustra la estructura y funcionamiento de los receptores tirosina-quinasa, as como el efecto dominante negativo de las mutaciones que provocan la activacin constitutiva de la va de sealizacin.

225

Mutaciones que afectan a la morfognesis

Los genes que codifican receptores para el factor de crecimiento fibroblstico (FGF). Tras la unin del ligando extracelular al receptor, unin mediada por heparn-sulfato de la matriz extracelular, los receptores forman homo- o heterodmeros, se transfosforilan en el dominio quinasa intracelular y a continuacin fosforilan protenas intracelulares implicadas en diversas vas de transduccin de seales. Las mutaciones que afectan a los genes de estos receptores (FGFR1, FGFR2 y FGFR3) causan varios sndromes de craniosinostosis y enanismo cuyas bases moleculares estn comenzando a comprenderse. Por ejemplo, la Acondroplasia (un tipo de enanismo) es una enfermedad de herencia autosmica dominante debida a mutaciones en el gen del receptor del Factor de Crecimiento Fibroblstico-3 (FGF3). Este receptor forma un homodmero que se activa en respuesta a su ligando natural. En cambio, en los pacientes con acondroplasia se encuentran mutaciones en uno de los alelos del gen, de forma que la molcula mutada conduce a la dimerizacin del receptor incluso en ausencia de ligando. Como resultado, se obtiene una activacin constitutiva de la cascada de seales iniciada por el receptor, que en ltimo trmino provoca el cierre prematuro del cartlago de crecimiento de los huesos largos y la baja talla caracterstica de esta enfermedad. La mutacin ms frecuente en casos de acondroplasia es la mutacin G380R del gen FGFR3, que afecta al dominio transmembrana del receptor. Curiosamente, mutaciones en otras regiones de este mismo gen causan fenotipos similares pero no idnticos, como por ejemplo la displasia tanatofrica (micromelia e hipoplasia de costillas con fallo respiratorio). Estas enfermedades son de herencia dominante por el efecto dominante negativo de estas mutaciones, que hace que con una sola molcula mutada se produzca la activacin constitutiva del receptor en ausencia de ligando. Respecto a mutaciones en otros genes que codifican receptores de FGF (FGFR1 y FGFR2), tambin causan enfermedades con alteraciones de huesos y cartlagos, como el Sndrome de Crouzon (craniosinostosis, bien aislada o bien asociada con otros defectos esquelticos), el Sndrome de Pfeiffer (pulgares y primer dedo del pie anchos con

www.FreeLibros.me

226

anquilosis interfalngica), el Sndrome de Jackson-Weiss (lo anterior ms coalescencia tarso-metatarsiana) y el Sndrome de Apert (sindactilia severa). Mutaciones que afectan al gen RET. Este gen codifica un receptor tirosinaquinasa, cuyo ligando es el GDNF (Glial cell line-Derived Neurotrophic Factor). Las mutaciones de RET son muy interesantes, ya que muestran cmo un mismo gen puede sufrir mutaciones que provocan prdida o ganancia de funcin, dando lugar a fenotipos diferentes. En el caso concreto de RET, algunas mutaciones con cambio de sentido afectan a aminocidos del dominio extracelular o del dominio quinasa, y provocan la activacin del receptor de manera independiente de ligando. Estas mutaciones carcinoma medular de tiroides familiar u otros cuadros de cncer familiar denominados MEN2 (Multiple Endocrine Neoplasia), que son de herencia dominante porque un solo alelo mutado desencadena la enfermedad por un efecto dominante negativo. Por el contrario, algunas mutaciones de RET que llevan a la prdida de funcin (mutaciones sin sentido, cambios del marco de lectura, deleciones, etc.) provocan la ausencia de las molculas del receptor codificadas por el alelo mutado, con el resultado de que la intensidad de la sealizacin de esta va se ve disminuida. Esto provoca un dficit en la migracin de precursores neurales al tubo digestivo durante el desarrollo embrionario, lo que da lugar a la Enfermedad de Hirschsprung (megacolon aganglinico: ausencia congnita de los plexos submucosos y mientrico del colon distal). Esta enfermedad se hereda con un patrn dominante, aunque tambin se han identificado mutaciones en otros genes que causan la misma enfermedad con herencia recesiva, como el gen EDNRB del receptor para endotelina B (receptor de proteinas G) o tambin el gen de su ligando EDN3 (endotelina 3).

Efectos fenotpicos de las mutaciones

www.FreeLibros.me

C APTULO 17

Diagnstico de enfermedades genticas

Contenidos
17.1 Estrategias generales de diagnstico de enfermedades genticas 17.2 Mtodos de deteccin de mutaciones 17.3 Aplicacin del ligamiento gentico al diagnstico: el proceso de diagnstico indirecto de enfer17.3 medades genticas

17.1 Estrategias generales de diagnstico de enfermedades genticas


Como en cualquier otro tipo de patologas, el diagnstico de enfermedades genticas se realiza mediante la identificacin clnica de los sntomas y signos que caracterizan cada sndrome concreto, apoyado en datos de laboratorio. Con los avances del Proyecto Genoma Humano, hoy en da es posible, en muchos casos, analizar directamente la alteracin causal a nivel del ADN. De todas formas, en el entorno clnico nos encontramos varios problemas que pueden dificultar el diagnstico correcto. En primer lugar, la posible presencia de heterogeneidad gentica: varios genes pueden ser los responsables de una nica enfermedad. Esta circunstancia hace muy laborioso el estudio mutacional, ya que multiplica el nmero de exones que hay que analizar. Incluso en aquellos casos en los que se sabe con exactitud qu gen est alterado, puede suceder que las mutaciones responsables del cuadro clnico se distribuyan por todo el gen (fenmeno que algunos autores denominan heterogeneidad allica), de manera que sera necesario analizar toda la regin codificante antes de poder descartar o confirmar que el gen en cuestin est mutado. Lgicamente, si se trata de un gen de gran tamao, el anlisis se hace extremadamente laborioso. La situacin opuesta vendra dada por aquellas enfermedades genticas que estn causadas, en la gran mayora de familias, por una misma mutacin, de

www.FreeLibros.me

228

manera que podemos centrarnos en el estudio de esa mutacin concreta para confirmar o descartar el defecto molecular que provoca esa enfermedad. Por tanto, hemos de sopesar todas las circunstancias mencionadas para decidir si nos inclinamos por realizar lo que se denomina diagnstico directo (anlisis de un individuo para ver si es portador de la mutacin concreta que causa la enfermedad en esa familia), o si por el contrario aplicaremos el denominado diagnstico indirecto (anlisis de marcadores genticos en la familia para ver si el consultando ha heredado el cromosoma que lleva la mutacin). A continuacin discutiremos las ventajas e inconvenientes de cada una de estas aproximaciones diagnsticas, as como los mtodos ms habitualmente empleados.
La Figura 17.1 explica las dos estrategias diagnsticas para detectar alteraciones genticas en enfermedades humanas.

Diagnstico de enfermedades genticas

17.2 Mtodos de deteccin de mutaciones


Como hemos dicho, el diagnstico directo consiste en el estudio de un gen cuya implicacin en el desarrollo de una enfermedad ya ha sido demostrada para detectar la presencia de posibles mutaciones en el mismo. En aquellos casos en que las mutaciones patognicas pueden estar localizadas a lo largo de toda la secuencia codificante del gen (heterogeneidad allica fuerte), se deben utilizar mtodos de barrido, que examinan cada exn por separado para detectar simplemente si existe una mutacin o no. Estos mtodos no identifican el tipo de mutacin, pero nos permiten descartar rpidamente todos aquellos exones normales, para centrarnos en el estudio de los exones mutados. En cambio, cuando queremos detectar una mutacin concreta, porque ya sabemos que es esta mutacin la que origina la enfermedad en esa familia, utilizaremos mtodos dirigidos a identificar nicamente esa mutacin (mtodos de confirmacin). Estos ltimos son quizs los mtodos ms utilizados en el contexto de un laboratorio diagnstico, especialmente en aquellas enfermedades que tienen una heterogeneidad allica limitada, es decir, enfermedades en las que un pequeo nmero de mutaciones causan la inmensa mayora de los casos. Los ejemplos ms notorios son la mutacin C282Y (que causa la mayora de los casos de Hemocromatosis Hereditaria en europeos); la mutacin F508del, responsable de hasta el 80 por ciento de los casos de Fibrosis Qustica en individuos nor-europeos; la inversin de los exones 1-22 del gen del Factor VIII de la coagulacin (responsable de un 50 por ciento de los casos de hemofilia A); la mutacin G380R del gen FGFR3 (que causa la mayora de los casos de Acondroplasia), las mutaciones N370S y L444P (que detectan la mayora de los casos de Enfermedad de Gaucher), o las enfermedades por expansin de trinucletidos (Enfermedad de Huntington, Sndrome del X Frgil, etc.). A continuacin analizaremos algunos de los mtodos ms utilizados en el diagnstico directo, tanto mtodos de barrido como de confirmacin. 1. Mtodos de barrido para la deteccin rpida de mutaciones (sin identificar el tipo concreto de mutacin). Excepto en el primero (SSCP) estos mtodos se basan en la deteccin de heteroduplexes, que se forman por la reasociacin lenta de las cadenas tras la desnaturalizacin del fragmento de ADN.

www.FreeLibros.me

Cuando el fragmento contiene una mutacin y se mezcla con un ADN normal, la desnaturalizacin-reasociacin da lugar a molculas heteroduplex portadoras de un desemparejamiento (mismatch) precisamente en el nucletido donde est la mutacin.

229

Mtodos de deteccin de mutaciones

SSCP (Single Strand Conformation Polymorphism, Polimorfismo de la Conformacin de Cadenas Sencillas). Un cambio en la secuencia provoca cambios conformacionales cuando el ADN se desnaturaliza (se separan las dos cadenas) y se deja que cada cadena se repliegue por separado. Estos cambios conformacionales se detectan porque alteran la migracin electrofortica en geles de poliacrilamida no-desnaturalizantes. En el ejemplo tpico, se amplifica un exn mediante PCR, se desnaturaliza el producto de PCR por calor, se cargan los productos desnaturalizados en un gel de acrilamida, se realiza la electroforesis y se tie el gel mediante una tincin especfica para el ADN (tincin de plata, por ejemplo). Si no hay mutaciones, se detectarn nicamente las bandas correspondientes al homodplex (resultado de la reasociacin parcial de las dos cadenas complementarias durante la electroforesis) y las bandas correspondientes a cada una de las cadenas sencillas que se han replegado adoptando una conformacin determinada. En cambio, la presencia de una mutacin dar lugar a nuevas bandas debidas al patrn de plegamiento de las cadenas sencillas mutantes, que ser diferente al de las cadenas nativas. Como hemos comentado, este anlisis no nos dice de qu tipo de mutacin se trata: para eso es necesario secuenciar este producto de PCR y compararlo con la secuencia normal. La ventaja es que nos permite descartar la presencia de mutaciones rpidamente, lo que ahorra tiempo y recursos.

La Figura 17.2 explica grficamente la tcnica de SSCP.

DGGE (Denaturing Gradient Gel Electrophoresis, Electroforesis en Gel con Gradiente Desnaturalizante) y sus variantes, entre las que destaca TGGE (Temperature Gradient Gel Electrophoresis). Esta tcnica se basa en someter una muestra de ADN a una electroforesis en geles de acrilamida con un gradiente desnaturalizante qumico o trmico, de manera que la muestra se encuentra con condiciones cada vez ms desnaturalizantes a medida que avanza por el gel. Las muestras de ADN son productos de PCR (exones, habitualmente) en cuyo extremo hay una regin corta muy rica en citosinas y guaninas (regin llamada clamp o pinza GC), de forma que la temperatura de desnaturalizacin de esta pequea regin es mayor que la del resto del fragmento. Por tanto, cuando el fragmento va avanzando por el gel, llegar un momento en que se desnaturaliza todo excepto la regin del clamp-GC. El resultado es que el fragmento se frena y deja de avanzar por el gel. Cuando la muestra de ADN es un heterodplex que contiene un desemparejamiento, su punto de desnaturalizacin ser distinto al del fragmento nativo, y por tanto se

www.FreeLibros.me

230

parar en un punto distinto del gel. Esto se reflejar en la aparicin de una banda con distinta migracin electrofortica.

Diagnstico de enfermedades genticas

Electroforesis

Electroforesis

Gradiente

La Figura 17.3 ilustra el fundamento de las tcnicas que detectan la presencia de heterodlex, con ejemplos de DGGE y TGGE.

DHPLC (Denaturing HPLC) es una tcnica en la que los heterodplex y homodplex son separados en un aparato de HPLC (High Performance Liquid Chromatography) utilizando un gradiente desnaturalizante de acetonitrilo y variando la temperatura de la columna. La muestra se injecta en una columna de cromatografa y el ADN se une a la matriz. El acetonitrilo deshace estas interacciones y el ADN eluido se detecta a la salida de la columna midiendo la absorbancia a 260 nm, originando un pico a un tiempo de elucin caracterstico. En temperaturas bajas, no desnaturalizantes, la concentracin de acetonitrilo necesaria para eluir un fragmento depende del tamao y la secuencia del mismo, por lo que cada fragmento da lugar a un pico de elucin caracterstico. Al aumentar la temperatura de la columna, la elucin tiene lugar a concentraciones menores de acetonitrilo, a medida que el fragmento comienza a desnaturalizarse. Como los heterodplex se desnaturalizan a temperaturas distintas a los homodplex, generan picos a tiempos de elucin diferentes. De este modo es posible detectar mutaciones puntuales. La gran ventaja del DHPLC es su rapidez, ya que los tiempos de elucin tpicos estn en torno a los cinco minutos y una muestra se puede analizar en 10 minutos. Por tanto, conserva la gran sensibilidad de los mtodos de deteccin de heterodplex que utilizan un gradiente desnaturalizante (temperatura, en este caso), pero tiene una procesividad mucho mayor y es fcilmente automatizable.

La Figura 17.4 presenta ejemplos del anlisis mediante DHPLC.

www.FreeLibros.me

Gradiente

Rotura de Desemparejamientos (Mismatch Cleavage). Es un mtodo basado en el hecho de que determinados tratamientos qumicos o enzimticos son capaces de romper un fragmento de ADN especficamente en el punto donde existe un desemparejamiento. Como hemos dicho, los heteroduplexes son portadores de un desemparejamiento (mismatch) precisamente en el nucletido donde est la mutacin. Por tanto, el tratamiento con determinadas sustancias romper el fragmento slo en el caso de que existan desemparejamientos, de forma que una electroforesis en gel ser suficiente para comprobar la presencia de una mutacin. PTT (Protein Truncation Test, Prueba de truncamiento de protenas). Es un mtodo especialmente dirigido a la deteccin de mutaciones que crean un codn de parada prematuro y provocan el truncamiento de la protena. Para llevar a cabo esta prueba, se prepara ADNc mediante RTPCR (PCR tras transcripcin reversa del ARN del paciente) utilizando un cebador que contiene la secuencia del promotor del fago T7 y la secuencia consenso de inicio de la traduccin (secuencia de Kozak). Esta construccin permite realizar la transcripcin y traduccin in vitro, a partir del producto de la RT-PCR. El anlisis en un gel de acrilamida de los fragmentos proteicos que resultan de la transcripcin/traduccin revelar la presencia de una banda correspondiente al tamao esperado para la secuencia nativa, o bien otras bandas de menor tamao correspondientes a todas las posibles mutaciones que provoquen un truncamiento del producto proteico (mutaciones sin sentido, los cambios del marco de lectura y las mutaciones que afectan a las secuencias de ayuste).

231

Mtodos de deteccin de mutaciones

La Figura 17.5 ilustra el fundamento de la tcnica de PTT.

Secuenciacin. Hoy en da, con la aparicin de equipos fluorescentes automatizados y con bajo coste por reaccin, la secuenciacin directa de productos de PCR (exones, o incluso la secuenciacin directa de un ADNc obtenido por RT-PCR) es un mtodo cada vez ms popular de deteccin de mutaciones. Tiene la ventaja de que identifica el tipo de mutacin, y de hecho es un paso obligado para identificar las mutaciones detectadas por los mtodos de barrido que acabamos de explicar. Sin embargo, slo es realmente fiable cuando el ADN mutado est en una proporcin superior al 15-20 por ciento del total de ADN presente en la muestra. Aunque esto se cumple en las enfermedades hereditarias, no es el caso de la deteccin de mutaciones en muestras procedentes de tumores, en las que con frecuencia la cantidad de clulas tumorales es baja y no todas son portadoras de una mutacin concreta.

Cada uno de los mtodos de barrido que hemos visto tiene sus ventajas e inconvenientes, sobre todo en lo referente a la sensibilidad (porcentaje de mutaciones que son capaces de detectar), coste, complejidad tcnica, capacidad de especificar la posicin de la mutacin, etc. Aunque las caractersticas de cada mtodo se presentan resumidas en la siguiente tabla, la eleccin de un mtodo u otro depender de las pe-

www.FreeLibros.me

232

Diagnstico de enfermedades genticas


2.

La Figura 17.6 muestra una mutacin detectada mediante secuenciacin con terminadores marcados.

culiaridades de cada laboratorio, del gen que se quiera estudiar, los medios disponibles y la experiencia previa con cada uno de los mtodos. Mtodo Secuenciacin SSCP DGGE y DHPLC Rotura de Desemparejamientos PTT Ventajas Detecta todas y especifica la posicin. Sencillo. Buena sensibilidad. Muy alta sensibilidad. Muy alta sensibilidad. Puede especificar posicin. Alta sensibilidad. Especifica la posicin. Inconvenientes Excesiva informacin, coste alto, laboriosa. Secuencias <400bp. No especifica posicin. Cierta complejidad. No especifica posicin. Gran dificultad tcnica. Toxicidad OsO4. No todos los tipos de mutaciones. Complejidad tcnica, coste.

Mtodos de comprobacin para detectar de la existencia de una mutacin especfica:

PCR-Digestin. El fundamento de esta tcnica reside en el hecho de que la mutacin crea o destruye una diana de restriccin, de modo que la simple digestin del producto de PCR con el enzima de restriccin permite determinar, en un gel de agarosa, el patrn de digestin indicativo de la presencia o ausencia de la mutacin. Es un mtodo que, por su sencillez y rapidez, es uno de los ms utilizados en laboratorios clnicos. La prin-

www.FreeLibros.me

cipal limitacin, lgicamente, es que no todas las mutaciones alteran una diana de restriccin.
La Figura 17.7 explica el proceso de deteccin de una mutacin especfica mediante la digestin de un producto de PCR con enzimas de restriccin.

233

Mtodos de deteccin de mutaciones

ASO (Allele Specific Oligonucleotide, Oligonucletido Especfico de Alelo). Una tcnica bastante utilizada en los primeros aos del diagnstico molecular, aunque hoy en da ha cado en cierto desuso. Se basa en el diseo de sondas especficas para el alelo mutado y para el alelo nativo, utilizando oligonucletidos. El tamao de las sondas hace que su Tm (temperatura de desnaturalizacin) sea lo suficientemente distinta para que en determinadas condiciones de hibridacin la sonda especfica del alelo normal hibride solamente con ADN normal, y la sonda especfica del alelo mutado hibride especficamente con ADN genmico que contiene la mutacin. El ADN de los pacientes (puede ser tanto ADN genmico como un exn amplificado mediante PCR) se deposita en membranas de nylon haciendo un dot-blot, y esas membranas se hibridan con cada una de las sondas (oligonucletidos marcados con radioactividad o con fluorescencia). El anlisis de la hibridacin de cada sonda permite identificar si la muestra contiene un solo alelo mutado (heterocigoto), dos alelos mutados (homocigoto para la mutacin), o ninguno (homocigoto sano). ARMS (Amplification Refractory Mutation System, Sistema de Mutacin Resistente a la Amplificacin) est basada en el mismo principio que ASO, es decir, la utilizacin de oligonucletidos especficos para la secuencia normal y para la secuencia mutada. La diferencia estriba en que, en el caso del ARMS, estos oligonucletidos son cebadores de PCR. Se disean, por tanto, dos reacciones de PCR que comparten un mismo cebador comn pero se diferencian en los cebadores especficos para cada alelo: un cebador amplificar slo el alelo normal, el otro cebador amplificar slo el alelo mutado. Dada la rapidez y sencillez de la PCR, esta tcnica est desplazando cada vez ms a la tcnica de ASO. OLA (Oligonucleotide Ligation Assay, Ensayo de Ligacin de Oligonucletidos). Se trata de un mtodo algo ms laborioso, pero que una vez optimizado permite analizar gran nmero de muestras con rapidez y fiabilidad. Se basa en la ligacin de dos oligonucletidos, uno de los cuales est marcado con biotina y el otro con una molcula radioactiva o fluorescente. El punto crucial es el diseo de los oligonucletidos a ambos lados de la base mutada. Por ejemplo, un diseo habitual es que ambos oligos hibriden sobre la secuencia normal, de modo que la mutacin impida la hibridacin de uno de ellos. Como consecuencia, la reaccin de ligacin slo ser efectiva en presencia de una secuencia normal. Cuando se separan las sondas y se unen por los residuos de biotina a un soporte que contiene estreptavidinas, slo las molculas completas (fruto de la ligacin de los dos oligos) emitirn la seal correspondiente al marcador (ra-

www.FreeLibros.me

234

dioactividad o fluorescencia). Por el contrario, el ADN de un sujeto homocigoto para la mutacin no dar ninguna seal. En principio, este mtodo tambin permite detectar los individuos heterocigotos para la mutacin, ya que la intensidad de la seal emitida ser la mitad de la de un individuo homocigoto normal. El mtodo de OLA permite la automatizacin y la cuantificacin de la seal cuando se utilizan marcadores fluorescentes, lo que le convierte en un buen mtodo para el anlisis de gran cantidad de muestras. MLPA (Multiplex Ligation-dependent Probe Amplification) es una modificacin del OLA que permite determinar el nmero de copias de hasta 45 genes en un solo ensayo, pudiendo discriminar secuencias que difieren en un solo nucletido. MLPA utiliza, para cada gen, dos sondas: una de ellas es complementaria a la secuencia que se quiere estudiar (21-30 nucletidos), a la que se aade la secuencia de un cebador universal en el extremo 5; la otra sonda de la pareja tiene otra secuencia complementaria a la diana, un ADN de relleno que puede ser de distintos tamaos y la secuencia de otro cebador universal en el extremo 3. Ambas sondas hibridan a ambos lados de la secuencia diana, y son ligadas por una ligasa termoestable. Con un solo cebador se pueden amplificar las sondas que se han ligado correctamente. Utilizando secuencias de relleno de distintos tamaos para cada gen, podemos amplificar en una misma reaccin muchos fragmentos distintos, lo que ahorra mucho tiempo y reactivos. Adems, como las condiciones de reaccin son las mismas, la cantidad final de producto es proporcional a la cantidad inicial de ADN, por lo que los resultados de MLPA pueden ser cuantificados. Por tanto, MLPA permite detectar deleciones y amplificaciones, adems de detectar mutaciones.

Diagnstico de enfermedades genticas

La Figura 17.8 resume los principios generales de varios mtodos para la deteccin de mutaciones especficas, basados en la utilizacin de oligonucletidos especficos.

Un comentario final a todas estas tcnicas de anlisis directo es que pueden aplicarse a ADN procedente de distintos tipos de muestra, ya que trabajan con secuencias amplificadas mediante PCR. Por tanto, es posible detectar la presencia de mutaciones no slo en ADN de sangre perifrica, sino tambin en raspados bucales, vellosidades coriales, cabello, biopsias, material incluido en bloques de parafina o incluso de tarjetas impregnadas con manchas de sangre (tarjetas de Guthrie, por ejemplo).

17.3 Aplicacin del ligamiento gentico al diagnstico: el proceso 17.3 de diagnstico indirecto de enfermedades genticas
Como ya se ha mencionado al principio de este captulo, hay ocasiones en las que no es posible, o resulta muy poco prctico, llevar a cabo diagnstico directo. Esto sucede en aquellos casos en los que no se conoce la secuencia del gen causante de una enfermedad, o cuando ste es excesivamente grande y complejo (compuesto por mu-

www.FreeLibros.me

chos exones, por ejemplo). En estos casos todava podemos predecir si un individuo ha heredado la enfermedad, estudiando marcadores especficos que nos permitan identificar cul cromosoma de los progenitores es el que lleva la mutacin. Una vez identificado, simplemente hemos de ver qu cromosomas han heredado los hijos, para predecir la probabilidad de que tambin hayan heredado la mutacin. Como no estudiamos directamente el gen, sino marcadores genticos que nos ayudan a identificar los cromosomas, se denomina a este proceso Diagnstico Indirecto. Para comprender el diagnstico indirecto es necesario repasar los conceptos generales de ligamiento gentico y su aplicacin a familias humanas que han sido expuestos en el Captulo 11. A veces nos enfrentamos con una enfermedad gentica cuyo gen causal no ha sido todava identificado, lo que obviamente impide realizar diagnstico directo. En otras ocasiones, aun conociendo el gen que debe estar mutado, resulta impracticable realizar estudios de diagnstico directo en la rutina de un laboratorio clnico, por la gran heterogeneidad allica que muestra esa enfermedad (un gran nmero de posibles mutaciones pueden ser las responsables del cuadro clnico), o en genes con una estructura exnica muy compleja. Un ejemplo bastante claro es la Distrofia Muscular de Duchenne (DMD), debida a mutaciones en el gen de la distrofina. Este gen es muy grande (ARNm de 14 kb) y tiene 79 exones distribuidos a lo largo de 2,3 megabases de ADN genmico, por lo que el estudio mutacional de cada exn sera excesivamente laborioso. En este tipo de situaciones, una alternativa muy utilizada es la de establecer si el probando ha heredado el cromosoma o los cromosomas parentales que llevan el gen mutado, o si por el contrario ha heredado los cromosomas parentales normales. Para hacer esto se sigue un proceso denominado gene tracking, algo as como seguir la pista a los alelos enfermos en una familia concreta. Esto se hace utilizando marcadores polimrficos situados muy cerca o incluso dentro del gen en cuestin, escogiendo aquellos marcadores que sean informativos en cada familia concreta. Los marcadores son del mismo tipo que los utilizados en el anlisis de ligamiento (RFLP, microsatlites). Utilizando esta estrategia podemos saber si un individuo ha heredado una mutacin de su progenitor enfermo simplemente determinando si ha heredado el cromosoma mutado de ese progenitor. Lgicamente, esta estrategia es vlida siempre que no haya habido ninguna recombinacin entre el locus de la enfermedad y el locus del marcador, de ah que utilicemos marcadores tan cercanos al gen que la frecuencia de recombinacin sea prcticamente 0. De hecho, la metodologa empleada es la misma que en los estudios de ligamiento, pero vara la manera de utilizar la informacin obtenida: mientras en los estudios de ligamiento queremos determinar la distancia entre dos loci, en el anlisis indirecto ya sabemos cul es esa distancia (y conocemos por tanto la frecuencia de recombinacin) y simplemente utilizamos esa informacin para determinar qu cromosoma ha sido transmitido por cada progenitor a un individuo concreto de la descendencia. El proceso general que se sigue en el diagnstico indirecto es el siguiente: a) Distinguir los dos cromosomas en cada uno de los progenitores: para esto es imprescindible encontrar un marcador para el que ambos progenitores sean heterocigotos (a poder ser no idnticos), de manera que esta familia sea totalmente informativa.

235

Aplicacin del ligamiento gentico al diagnstico: el proceso

www.FreeLibros.me

236

b)

c)

Resolver la fase de ligamiento en el individuo transmisor: esto supone ser capaces de determinar cul de los alelos del marcador segrega con el alelo de la enfermedad (y viaja, por tanto, en el mismo cromosoma). Para esto hay que estudiar a los progenitores del individuo transmisor o a su descendencia y deducir la fase de ligamiento entre el marcador y el gen. Nuevamente, una recombinacin entre ambos loci (enfermedad y marcador) llevara a resultados errneos, de ah la importancia de usar marcadores cercanos al gen (o intragnicos) de modo que la frecuencia de recombinacin entre ambos sea despreciable. Determinar el alelo del marcador que ha sido transmitido al probando. Esto nos dir (con una fiabilidad mayor o menor dependiendo de la fraccin de recombinacin entre el marcador y el gen) si se ha transmitido el cromosoma con el alelo mutado o el alelo normal. Aqu se hace evidente la enorme utilidad del diagnstico indirecto: permite establecer si un individuo ha heredado la mutacin sin necesidad de detectar directamente la presencia de la misma. Como hemos comentado, su gran limitacin viene dada porque en ocasiones los marcadores estn a cierta distancia del locus de la enfermedad y las predicciones no son fiables al 100 por cien. Por ejemplo, si la distancia entre el marcador y el locus de la enfermedad fuese de 5 cM (lo que supone una frecuencia de recombinacin del cinco por ciento), la fiabilidad del anlisis slo sera del 95 por ciento, ya que en un cinco por ciento de los casos podra haberse dado un sobrecruzamiento entre ambos loci que hubiese trasladado el alelo mutado al cromosoma homlogo. En la prctica, solventamos esta limitacin mediante el uso de varios marcadores, preferiblemente situados a ambos extremos del locus de la enfermedad. De esta forma, la nica posibilidad de error sera un doble sobrecruzamiento entre el locus de la enfermedad con cada uno de los marcadores, pero la probabilidad de que esto suceda es prcticamente despreciable. Lgicamente, a mayor nmero de marcadores, mayor fiabilidad de los resultados, sobre todo si adems se incluyen marcadores situados dentro del propio gen de la enfermedad.

Diagnstico de enfermedades genticas

La Figura 17.9 explica el proceso general del diagnstico indirecto utilizando marcadores polimrficos en ligamiento con el gen responsable de una enfermedad gentica.

www.FreeLibros.me

CAPTULO 18

Gentica clnica

Contenidos
18.1 Gentica clnica y consejo gentico 18.2 Enfermedades de herencia autosmica 18.3 Enfermedades de herencia ligada al cromosoma X 18.4 Teorema de Bayes y su aplicacin al clculo de riesgos genticos 18.5 Enfermedades por alteracin del ADN mitocondrial 18.6 Diagnstico prenatal

18.1 Gentica clnica y consejo gentico


La gentica clnica se ocupa del diagnstico y atencin de las personas y familias en las que aparece una enfermedad gentica. Incluye varios aspectos, algunos de ellos algo diferentes de la prctica mdica habitual:

Diagnstico correcto de la enfermedad, de lo contrario el clculo de riesgos genticos no tiene sentido. Para ello, adems de los mtodos clsicos de diagnstico, es importante realizar bien el diagnstico molecular (estudiado en el captulo anterior) y reconstruir la historia familiar detallada. La aplicacin de los principios de la gentica mendeliana permite calcular el riesgo de recurrencia de la enfermedad en la misma familia, establecer el pronstico, iniciar medidas de diagnstico precoz y de prevencin en individuos de riesgo (antes de la aparicin de los sntomas). Por todo esto, la gentica clnica es un pilar bsico de la Medicina predictiva del futuro. Un elemento fundamental es el consejo gentico, que, segn la definicin de la Sociedad Americana de Gentica Humana (1975) es un proceso de comunicacin que trata de los problemas humanos asociados con la ocurrencia, o riesgo de ocurrencia, de un transtorno gentico en una familia. Este proceso requiere que una o ms personas adiestradas de forma apropiada ayuden al individuo o fami-

www.FreeLibros.me

238

lia a: 1) comprender los hechos mdicos, incluyendo el diagnstico, la evolucin probable del transtorno y el tratamiento disponible; 2) apreciar el modo en que la herencia contribuye al transtorno y el riesgo de recurrencia en parientes concretos; 3) comprender las alternativas para enfrentarse al riesgo de recurrencia; 4) escoger un curso de accin que les parezca apropiado a la vista de su riesgo, sus objetivos familiares y sus normas ticas y religiosas, y actuar de acuerdo con la decisin tomada, y 5) procurar la mejor adaptacin posible a la enfermedad en un miembro afectado de la familia y/o al riesgo de esta enfermedad. En contraste con el mtodo mdico tradicional, en el que el facultativo prescribe al paciente lo que debe hacer, entre profesionales de la Gentica Clnica existe un amplio consenso a favor de que el consejo gentico sea un proceso no-directivo, es decir, que sea el propio paciente o la familia los que decidan qu accin tomar en funcin de la informacin proporcionada por el facultativo. En este sentido, es importante comprender que la carga de una enfermedad gentica para el paciente y para la familia puede ser valorada de modo muy distinto de unos casos a otros, dependiendo de varias circunstancias. Es importante explicar bien las posibilidades de modificar la carga gentica o el riesgo gentico, y poner a las familias afectadas en contacto con servicios sociales de apoyo, organizaciones de afectados por la enfermedad, etc. Las dos herramientas bsicas de la gentica clnica, que el estudiante debe dominar, son la realizacin de la historia familiar y la estimacin de riesgos genticos. La historia familiar es la parte de la historia clnica en la que se reconstruye el rbol familiar y se intenta identificar otros miembros del mismo que puedan estar afectados por la enfermedad. Esto permitir deducir el tipo de herencia y el riesgo de recurrencia. Se utilizan las reglas generales de construccin de rboles familiares, y adems es importante:

Gentica clnica

Preguntar acerca de nacidos muertos o abortos espontneos. Indagar la existencia de posible consanguinidad. Tener en cuenta posibles casos de falsa paternidad. Recoger tambin informacin bsica de las ramas del rbol que parezcan no estar afectadas. Siempre es mejor registrar la fecha de nacimiento que la edad. Tener en cuenta que el diagnstico puede no ser acertado, sobre todo en el caso de individuos ya fallecidos. Por tanto, es importante examinar directamente, siempre que sea posible, a los individuos afectados; examinar a los presumiblemente sanos, para excluir que en realidad tengan una forma poco severa de la enfermedad; tratar de obtener toda la informacin posible de otros parientes ms lejanos.

Por lo que respecta a la estimacin del riesgo gentico, se expresa siempre como una probabilidad, es decir en modo fraccional o en porcentaje (un riesgo de 1/2 es igual a un riesgo del 50 por ciento). El riesgo gentico no es ms que la probabilidad de padecer la enfermedad que tiene un individuo concreto de la familia, probabilidad estimada a partir de los datos del rbol familiar que nos permiten deducir el tipo de herencia y aplicar las leyes mendelianas.

www.FreeLibros.me

Los patrones hereditarios tpicos se pueden reconocer al analizar el rbol genealgico de la familia en la que hay individuos enfermos, ya que cada tipo de herencia produce rboles familiares con unas caractersticas propias. Para la construccin de rboles familiares, llamados tambin genealogas o pedigrs (por influencia del trmino ingls pedigree), se utilizan unos smbolos aceptados por convenio, y se construyen siguiendo unas reglas que hay que conocer.
La Figura 18.1 muestra los principales smbolos utilizados en la creacin de rboles genealgicos (genealogas o pedigrs).

239

Enfermedades de herencia autosmica

18.2 Enfermedades de herencia autosmica


Las enfermedades autosmicas dominantes suelen tener una frecuencia gnica muy baja (la prevalencia de estas enfermedades es habitualmente inferior a 1/1 000 individuos), y por tanto los individuos homocigotos son extremadamente infrecuentes; de hecho, la homocigosidad para estas enfermedades es muchas veces letal y provoca abortos espontneos. El rbol tpico de una enfermedad autosmica dominante muestra individuos enfermos en todas las generaciones, afectando ambos sexos por igual. Cuando se ve una transmisin de padre enfermo a hijo varn, podemos descartar la presencia de una enfermedad ligada al cromosoma X. Para calcular el riesgo de padecer la enfermedad en la descendencia, se utilizan los cuadrados de Punnet. Mediante el uso de estos diagramas es fcil concluir que la mitad de la descendencia sern heterocigotos enfermos y la otra mitad homocigotos sanos. Dos individuos sanos, si efectivamente son homocigotos (veremos alguna excepcin ms adelante), no pueden tener descendencia con la enfermedad. Ya se ha mencionado antes que es muy poco frecuente encontrar enfermos homocigotos (dos alelos mutados), pues esto exigira la unin de dos heterocigotos enfermos. Sin embargo, hay algunas enfermedades autosmicas dominantes en la que esto sucede con mayor frecuencia de lo habitual, debido a que tienen una frecuencia gnica ms alta de lo habitual (no son letales, sino de comienzo tardo, por lo que permiten llegar a la edad frtil, tener descendencia y propagar la mutacin). Un buen ejemplo de lo dicho es la Hipercolesterolemia familiar, una enfermedad autosmica dominante debida a mutaciones en el receptor de las LDL (lipoprotenas de baja densidad) que cursa con niveles altos de colesterol total y colesterol LDL, xantomas tendinosos, xantelasmas y aterosclerosis precoz. La enfermedad afecta a uno de cada 500 individuos de la poblacin y es causa del cinco por ciento de los infartos de miocardio que se producen antes de los 60 aos de edad. Como es una enfermedad que no altera la fertilidad, la frecuencia allica es alta (en torno a uno de cada 1 000 alelos presentes en la poblacin estn mutados) y no es raro encontrar individuos homocigotos (en torno a uno por milln). Los homocigotos estn afectados con ms gravedad que los heterocigotos, mostrando niveles ms altos de colesterol y mayor riesgo de enfermedad coronaria. El anlisis molecular de los individuos enfermos y de los miembros de su familia permite predecir la gravedad de la enfermedad, establecer el riesgo en la descendencia y comenzar el tratamiento preventivo con dieta o frmacos hipolipemiantes. Tambin se pueden encontrar individuos homocigotos en

www.FreeLibros.me

240

enfermedades autosmicas dominantes en las que existe una cierta predisposicin a las uniones entre individuos enfermos. Esto ltimo sucede, por ejemplo, en una enfermedad llamada acondroplasia. Los individuos que sufren esta enfermedad, dada su baja estatura, tienden a formar matrimonios entre ellos, lo que eleva la probabilidad de que aparezcan sujetos homocigotos. Las enfermedades autosmicas recesivas requieren, por definicin, que los individuos afectados sean homocigotos (dos alelos mutados) y, por tanto, sus progenitores son habitualmente portadores sanos heterocigotos. El rbol tpico de un patrn autosmico recesivo muestra generaciones con algn miembro afectado, separadas por generaciones en las que no hay ningn individuo enfermo, patrn muy poco probable en transtornos dominantes. Se encuentran individuos enfermos de ambos sexos, y es muy frecuente la presencia de uniones con-sanguneas (entre individuos que comparten un ancestro comn, como primos, primos segundos, etc.). Un buen ejemplo de enfermedad autosmica recesiva es la Fibrosis Qustica del Pncreas, enfermedad debida a mutaciones en el gen CFTR (Cystic Fibrosis Transmembrane Regulator), localizado en 7q31. La enfermedad afecta a uno de cada 2 500 nacidos vivos de raza caucsica, lo que significa una frecuencia allica del 0,02 (dos por ciento de los alelos presentes en la poblacin estn mutados) y una frecuencia de portadores del 0,04 (uno de cada 25 individuos de la poblacin general son heterocigotos). La enfermedad surge por el mal funcionamiento de un canal de cloro, lo que provoca una mucoviscidosis (secreciones mucosas muy viscosas) que poco a poco conduce a la destruccin del tejido pulmonar y pancretico, adems de provocar obstruccin intestinal en algunos neonatos. Se conocen alrededor de 400 mutaciones diferentes en el gen CFTR, pero en poblaciones europeas un 70 por ciento de los casos se deben a la delecin F508del, que deleciona tres bases sin cambiar el marco de lectura: SECUENCIA NORMAL F508del GAA AAT ATC ATC TTT GGT GTT GluA Asn IleTC IleC Phe GlyT Val GAA AAT ATC AT- --T GGT GTT GluA Asn IleTCIle- --T GlyT Val

Gentica clnica

Adems de F508del, hay otras mutaciones que causan Fibrosis Qustica y que se encuentran con frecuencia allica mayor a uno por ciento, de modo que el anlisis de ocho mutaciones (incluyendo F508del) puede detectar hasta un 85-90 por ciento de los casos en poblaciones de origen europeo. Hay una serie de fenmenos muchos de los cuales ya se han mencionado que complican la evaluacin de los rboles de enfermedades autosmicas dominantes y recesivas, y hacen que el clculo de los riesgos en la descendencia sea menos fiable. A continuacin se sealan los problemas ms frecuentes:

Heterogeneidad gentica de locus. Ya se ha mencionado que muchas enfermedades hereditarias pueden estar causadas por mutaciones en genes distintos, y se han visto algunos ejemplos. Esto se manifiesta, habitualmente, en la aparicin de distintos patrones de herencia en familias diferentes. As, por ejemplo, hemos visto un tipo de enfermedad de Charcot-Marie-Tooth que si-

www.FreeLibros.me

241
I II
1 2 3 4 5 6 7 8

Enfermedades de herencia autosmica

III
1 2 3 4 5 6 7 8

I II
1 2 3

III IV

?
1 2 3 4

La Figura 18.2 muestra los rboles genealgicos tpicos de las enfermedades con herencia autonmica dominante y autonmica recesiva.

gue un patrn autosmico dominante (por duplicaciones del gen PMP22), pero tambin existen familias en las que esta enfermedad sigue un patrn ligado al sexo (por mutaciones en otro gen situado en el cromosoma X). Otro ejemplo notable es el Sndrome de Ehlers-Danlos, que puede estar causado por mutaciones en al menos ocho loci diferentes, dando lugar a familias con patrn autosmico dominante, autosmico recesivo o ligado al sexo recesivo, dependiendo del gen implicado en cada caso. Lgicamente, la identificacin del tipo de herencia en una familia concreta nos ayudar a predecir el gen afectado (y buscar mutaciones en el mismo, si es posible) y a estimar el riesgo de padecer la enfermedad en la descendencia. Penetrancia incompleta. Hasta ahora hemos dado por supuesto que siempre que un gen est mutado se desarrollar la enfermedad correspondiente. Por desgracia para el profesional de la Gentica (pero por suerte para los pacientes), esto no se cumple en el 100 por cien de los casos. De hecho, no es infrecuente encontrar rboles en los que un individuo ha transmitido una enfermedad dominante sin haber estado l mismo afectado por dicha enfermedad. En la Figura 18.3 puede observarse una familia afectada por una enfermedad autosmica dominante en la que el individuo II-2 (sealado por la flecha) ha heredado y transmitido la mutacin, pero no ha llegado a desarrollar la en-

www.FreeLibros.me

242

fermedad. Descartando la posibilidad de que se trate de una nueva mutacin que ha surgido en ese individuo, ya que esa misma enfermedad estaba ya presente en los progenitores, hemos de concluir que este individuo es portador de la mutacin pero no expresa la enfermedad. Este fenmeno se denomina penetrancia incompleta, y es caracterstico de algunas enfermedades dominantes, como por ejemplo el Retinoblastoma hereditario. Expresividad variable. Muchas enfermedades hereditarias tienen manifestaciones clnicas complejas, con signos y sntomas que se pueden presentar en distintas combinaciones y con distinto grado de severidad. Se dice entonces que estas enfermedades tienen expresividad clnica variable. En algunos casos, como por ejemplo la Neurofibromatosis tipo 1, distintos miembros de una misma familia (todos con la misma mutacin), pueden tener manifestaciones clnicas de la enfermedad muy dispares. No tenemos hoy en da una explicacin clara para el fenmeno de la distinta expresividad de una misma mutacin, pero es probable que est originado por factores ambientales que influyen en el desarrollo de la enfermedad o por diferencias inter-individuales en otros genes que modifican la expresin del fenotipo.

Gentica clnica

En la Figura 18.3 se ilustran los conceptos de penetrancia incompleta y expresividad variable.

Por lo que respecta al clculo de riesgos, podemos resumir:

Las enfermedades de herencia autosmica dominante tienen, en general, frecuencias allicas muy bajas (<0,001) y por eso los individuos homocigotos (ambos alelos mutados) son muy raros. Lo normal es encontrar cruces entre un heterocigoto y un homocigoto sano, por lo que el riesgo en la descendencia es de 50 por ciento heterocigotos enfermos y 50 por ciento homocigotos sanos. Por eso, para cada hijo el riesgo de recurrencia es del 50 por ciento, aunque siempre hay que tener en cuenta los factores que pueden modificar estos riesgos (penetrancia incompleta, expresividad variable, tasa de nuevas mutaciones). En enfermedades de herencia autosmica recesiva, ambos progenitores tienen que ser al menos portadores, por lo que en la descendencia habr 25 por ciento de enfermos (homocigotos con mutacin), 25 por ciento de sanos (homocigotos sin mutacin) y 50 por ciento de portadores sanos (heterocigotos). Por tanto, el riesgo de recurrencia es inicialmente 1/4 (25 por ciento). Es importante recordar que la presencia de consanguinidad es un hecho muy frecuente en estas enfermedades. Ms raramente hay matrimonios entre un portador sano y un enfermo homocigoto, en cuyo caso se produce un patrn de herencia cuasi-dominante con 50 por ciento de enfermos y 50 por ciento de portadores sanos en la descendencia. Una causa frecuente de consulta en el caso de enfermedades de herencia autosmica recesiva es el matrimonio entre un portador y un individuo de otra familia distinta en la que no existe la enfermedad. Lgicamente, el riesgo final para la descendencia depender fundamentalmente de la probabilidad que tenga este individuo de ser portador, lo cual, a su vez, depende de la tasa de portadores en la poblacin ge-

www.FreeLibros.me

neral. Como se recordar, la ley de Hardy-Weinberg permite estimar esta tasa en funcin de la prevalencia de la enfermedad en esa poblacin.
En la Figura 18.4 se muestran los cuadrados de Punnet que ayudan a calcular el riesgo de recurrencia en enfermedades de herencia autonmica dominante y recesiva.

243

Enfermedades de herencia ligada al cromosoma X

18.3 Enfermedades de herencia ligada al cromosoma X


Al igual que las enfermedades autosmicas, las enfermedades ligadas al sexo pueden ser recesivas o dominantes. Lo ms habitual es encontrar enfermedades de herencia ligada al sexo recesivas, en las que las mujeres portadoras son sanas. El rbol tpico muestra nicamente varones enfermos, habitualmente sin transmisin de la enfermedad de un padre a sus hijos varones. Se pueden dar tres situaciones, cuyos cuadrados de Punnet se presentan en la Figura 18.5. En primer lugar, la unin entre una mujer portadora (Aa) y un varn sano (A) dar lugar a un 50 por ciento de hijas homocigotas sanas y un 50 por ciento de heterocigotas portadoras, mientras que el 50 por ciento de los hijos varones sern sanos y el otro 50 por ciento sern enfermos. En el caso de uniones entre una mujer portadora sana (Aa) y un varn enfermo (a), los hijos varones tendrn los mismos riesgos que en el caso anterior (la mitad sanos y la mitad enfermos), pero las hijas sern homocigotas (enfermas, por tanto) en el 50 por ciento de los casos y portadoras sanas en el otro 50 por ciento. Por ltimo, las uniones entre un varn enfermo (a) y una mujer homocigota sana (AA) dan lugar a una descendencia en la que todos los hijos son sanos y todas las hijas son portadoras sanas. Como puede apreciarse, es importante distinguir las mujeres sanas que son homocigotas de aquellas que son heterocigotas portadoras. Ya hemos comentado que la inactivacin del cromosoma X se realiza al azar en clulas somticas, de forma que toda mujer es, en el fondo, un mosaico con poblaciones celulares en las que se ha inactivado un cromosoma X y poblaciones celulares en las que se ha inactivado el otro. Sin embargo, en algunas circunstancias la inactivacin puede ser preferencial, inactivndose el mismo cromosoma X en todas las clulas. Esto sucede, por ejemplo, en casos de anomalas estructurales (deleciones o duplicaciones) que afectan a uno de los cromosomas X, en cuyo caso suele inactivarse el cromosoma anormal. En cambio, en individuos con translocaciones equilibradas entre el cromosoma X y un autosoma se inactiva preferencialmente el cromosoma normal, ya que de lo contrario se producira a una monosoma parcial del autosoma implicado en la translocacin. Tambin se ha visto inactivacin sesgada en algunas familias con deleciones que afectan a XIST o a TSIX, as como en familias con mutaciones que afectan al promotor de XIST. En algunos casos raros de enfermedades ligadas al sexo recesivas, la inactivacin preferencial del cromosoma X normal en mujeres portadoras (que deberan ser fenotpicamente sanas) puede dar a lugar a la aparicin de la enfermedad, aunque habitualmente con unas manifestaciones ms leves. La Distrofia Muscular de Duchenne (DMD) es quizs uno de los mejores ejemplos de enfermedad ligada al sexo recesiva. Est causada por mutaciones en el gen de la distrofina, localizado en Xp21, y afecta a uno de cada 3 300 varones en todos los grupos

www.FreeLibros.me

244

tnicos. La ausencia de distrofina provoca la desestructuracin del Complejo Asociado a la Distrofina (DAC) del sarcolema y conduce a la aparicin de una degeneracin muscular progresiva que suele terminar con la vida del paciente alrededor de la tercera dcada de la vida. Como se recordar, el gen DMD es uno de los de mayor tamao conocido, lo que condiciona una alta tasa de nuevas mutaciones (en torno a 104 nuevas mutaciones por generacin). Alrededor del 60 por ciento de las mutaciones son deleciones (con tamaos que van desde varias kilobases hasta una megabase), con un punto caliente (hot spot) de aparicin de deleciones en el exn 7. El resto de las mutaciones son deleciones pequeas y mutaciones puntuales que alteran el marco de lectura. La distrofia muscular de Becker es un fenotipo ms leve causado por mutaciones en el mismo gen, pero en este caso las mutaciones NO rompen el marco de lectura (deleciones pequeas y mutaciones puntuales con cambio de sentido). El rbol tpico de las enfermedades con herencia ligada al sexo dominante muestra una estructura similar al de las enfermedades autosmicas dominantes, con la peculiaridad de que nunca hay transmisin padre-hijo, pero en cambio todas las hijas de los varones enfermos son heterocigotas enfermas. Por el contrario, desarrollar la enfermedad el 50 por ciento de los hijos y el 50 por ciento de las hijas de una mujer portadora y un varn normal. En general, los rboles suelen mostrar la presencia del doble de mujeres enfermas que de varones enfermos, excepto en aquellos casos en que la enfermedad es letal en varones. De todas formas, las mujeres suelen desarrollar formas ms leves de la enfermedad, debido a que el 50 por ciento de sus clulas habrn inactivado el cromosoma X portador de la mutacin y expresarn el alelo normal del gen implicado. Algunos ejemplos de estas enfermedades son el Sndrome de Rett, el Raquitismo Hipofosfatasmico, o la Incontinencia Pigmentaria tipo 1 (enfermedad en la que slo se ven mujeres afectadas, probablemente por letalidad embrionaria en varones).

Gentica clnica

I II
1 2

III
1 2 3 4 5

IV
1 2

En la Figura 18.5 se muestran los pedigrs tpicos de enfermedades ligadas al sexo recesivas y dominantes.

Un patrn hereditario anmalo, dentro de las enfermedades ligadas al cromosoma X, es el que presentan las familias con Sndrome del X Frgil. El estudio del rbol de una familia con esta enfermedad pone de manifiesto un patrn de herencia

www.FreeLibros.me

dominante con penetrancia reducida en mujeres, adems de otros hechos que constituyen lo que se conoce como paradoja de Sherman: 1) el riesgo de transmisin de la enfermedad aumenta en sucesivas generaciones, y 2) se encuentran varones normales que transmiten la enfermedad a todas sus hijas, que sern por tanto portadoras sanas. Como hemos comentado en otro captulo, hoy en da sabemos que esta enfermedad est causada por la expansin de un trinucletido en el gen FMR1, con alelos que varan en el nmero de veces que est repetido el trinucletido. La presencia de premutacin (rango de 50 a 230 repeticiones) no provoca manifestaciones fenotpicas en los portadores (tanto varones como mujeres). La expansin de estos alelos premutados slo se produce por va materna, y la probabilidad de que esto suceda depende de la longitud del alelo premutado.
La Figura 18.6 ilustra la paradoja de Sherman, mostrando en un rbol los riresgos de expansin a mutacin completa dependiendo del tamao de la premutacin y del sexo.

245

Enfermedades de herencia ligada al cromosoma X

En general podemos afirmar que la expansin de pre-mutacin a mutacin completa tiene lugar en menos del 20 por ciento de los alelos <70 repeticiones y en ms del 70 por ciento de los alelos >90 repeticiones. Como se recordar, la expansin a mutacin completa va acompaada de hipermetilacin del promotor del gen FMR1, lo que provoca la ausencia de la protena. Aunque la mutacin provoca una prdida de funcin del gen, el fenotipo es dominante (basta un alelo con la mutacin completa para desarrollar la enfermedad). De hecho, la presencia de un cromosoma con mutacin completa e hipermetilacin se asocia con retraso mental en todos los varones y en el 50-70 por ciento de las mujeres (por la inactivacin del X, muchas clulas habrn inactivado el cromosoma X mutado). Las mujeres que llevan un alelo con pre-mutacin no suelen desarrollar la enfermedad, pero tienen riesgo de sufrir expansin en su descendencia. Por el contrario, los varones con pre-mutacin denominados Varones Transmisores Normales (NTM, Normal Transmitting Male) transmiten el alelo premutado, sin sufrir expansin, a todas sus hijas (que sern portadoras sanas), y como es lgico no lo transmiten a ninguno de sus hijos. Recientemente se ha encontrado que estos varones desarrollan una enfermedad neurolgica llamada FXTAS (sndrome de temblor/ataxia asociado con el X-frgil) en las ltimas dcadas de la vida. Estos individuos muestran inclusiones cerebrales con aumento del mRNA y de la protena FMRP, adems de otras protenas como laminina A/C. Esta enfermedad es un bello ejemplo de cmo la identificacin del mecanismo molecular gentico ha permitido explicar una serie de fenmenos clnicos y hereditarios de difcil comprensin. El clculo de riesgos en las enfermedades de herencia recesiva ligada al cromosoma X, por tanto, debe hacerse teniendo en cuenta que las mujeres portadoras (heterocigotas) son sanas pero los varones hemicigotos (con una mutacin en su nico cromosoma X) son enfermos. En el caso de mujeres portadoras, la mitad de sus hijos varones sern enfermos y la otra mitad sanos; de sus hijas, la mitad sern portadoras y la otra mitad homocigotas sanas. Es caracterstico que nunca hay transmisin de padre enfermo a hijos varones, lo cual es muy importante para el consejo gentico. En cambio, el 50 por ciento de las hijas de un varn enfermo sern portadoras (sanas), pero ninguna ser enferma. La excepcin a esta regla general es el matrimonio de un varn enfermo con una mujer portadora, lo cual sucede a veces en

www.FreeLibros.me

246

casos de consanguinidad. En estos casos puede haber mujeres enfermas (heredan dos mutaciones) e incluso transmisin de padre enfermo a hijo varn (aunque, en realidad, el hijo hereda la enfermedad de su madre). Por lo que respecta a la herencia ligada al X dominante, el matrimonio entre una mujer enferma (heterocigota) y un varn normal produce una descendencia con riesgo de recurrencia en el 50 por ciento de los hijos y en el 50 por ciento de las hijas. En cambio, el matrimonio entre un varn afectado y una mujer normal da lugar a un riesgo del 100 por cien de recurrencia en las hijas (todas heredan el cromosoma X paterno, que transmite la mutacin), pero todos los hijos varones sern sanos.

Gentica clnica

18.4 Teorema de Bayes y su aplicacin al clculo de riesgos 18.4 genticos


En algunas situaciones, los riesgos de recurrencia calculados segn los principios mendelianos pueden ser matizados y precisados por informacin adicional acerca de esa familia. Por este motivo, el consejo gentico hace uso de la estadstica bayesiana, derivada de la aplicacin del teorema de Bayes. En su formulacin general, el teorema de Bayes dice que: P(A) P(B|A) P(A|B) = P(A) P(B|A) Esto significa que la probabilidad de un suceso A cuando se verifica una condicin B (eso se representa como A sobre B) es igual a la probabilidad inicial del primer suceso, multiplicado por la probabilidad de que la condicin B se verifique en presencia del suceso A, dividido por la probabilidad total de la condicin B (que es el sumatorio de todos los posibles numeradores). Es decir, la probabilidad inicial o terica de un suceso cualquiera puede ser modificada si se cumple alguna condicin que afecta a ese suceso, dependiendo de la probabilidad de esa condicin y de la probabilidad de que cuando tal condicin se cumple se vea afectado el suceso inicial. Este tipo de anlisis estadstico tiene aplicacin en muchos campos, pero en el caso concreto del consejo gentico es especialmente til en el clculo de riesgos de recurrencia de enfermedades recesivas ligadas al cromosoma X, en las que podemos incluir informacin de tipo condicional. Tambin es posible incorporar los datos del diagnstico molecular para matizar los riesgos de recurrencia calculados segn los principios mendelianos, como veremos en algunos ejemplos. Quizs el ejemplo ms sencillo de cmo utilizar la informacin derivada de rboles genealgicos para modificar los riesgos iniciales sea el clculo del riesgo de ser portador de una enfermedad autosmica recesiva. Como sabemos por los principios mendelianos, cualquier hermano o hermana de un afectado con una enfermedad autsomica recesiva, cuyos progenitores son portadores sanos, tiene una probabilidad inicial del 50 por ciento de ser portador sano, 25 por ciento de ser homocigoto sano y 25 por ciento de ser homocigoto enfermo. En cambio, puede darse el caso de que nos encontremos una familia en la que uno de los hermanos es sano, y claramente no ha desarrollado la enfermedad. En ese individuo, lgicamente, podemos despreciar el

www.FreeLibros.me

25 % de probabilidad de ser enfermo, porque de hecho est sano. En efecto, slo hay dos posibilidades de ser hermano sano de un afectado por una enfermedad autosmica recesiva: o ser portador (probabilidad inicial del 50 por ciento) o ser homocigoto sano (probabilidad inicial del 25 por ciento). De este 75 por ciento total, un 50 por ciento corresponde a la probabilidad de ser portador, luego el riesgo que tiene un hermano sano de ser portador de la enfermedad no es 50 por ciento, como inicialmente cabra suponer, sino realmente 2/3. Esto, que se comprende modo intuitivo, supone realmente una aplicacin del teorema de Bayes. En efecto, la probabilidad (P) inicial de ser portador sano es 1/2 y de ser homocigoto sano es 1/4, como acabamos de ver. Establecemos la condicin (si el individuo es SANO) y calculamos la probabilidad condicional para cada estado posible: en este caso, la probabilidad condicional es 1 (100 por cien) siempre, ya que tanto un portador sano como un homocigoto sano son sanos. Si hacemos una tabla en la que indicamos las probabilidades bajo cada una de las dos posibles situaciones, obtenemos algo como lo que se muestra a continuacin. Un individuo portador tiene una probabilidad inicial (a priori) del 50 % de ser sano, y si cumple la condicin de estar sano su probabilidad condicional (estar sano) es del 100 por cien (P = 1); lo mismo puede calcularse para un homocigoto sano (probabilidades inicial y condicional de 1/4 y 1, respectivamente). A continuacin se calcula la probabilidad combinada o conjunta de que ambos sucesos tengan lugar a la vez, es decir, se multiplican la probabilidad inicial y la condicional. La probabilidad conjunta corresponde al trmino P(A) P(B|A) de la ecuacin anterior. Como vemos en la tabla, las probabilidades conjuntas son 1/2 y 1/4, respectivamente, para el caso de ser portador sano o de ser homocigoto sano:

247

Teorema de Bayes y su aplicacin al clculo de riesgos genticos

Portador Inicial Condicional (si es sano) Conjunta Final 1/2 1 1/2 2/4 3/4 = 2/3

Homocigoto (sano) 1/4 1 1/4 1/3

La suma de todas las posibles probabilidades conjuntas (el sumatorio que est en el denominador de la ecuacin) es, en nuestro caso, 3/4 (1/2 + 1/4). Por tanto, la probabilidad final se calcula hallando el cociente entre la probabilidad conjunta de cada situacin y la suma de todas ellas. En nuestro ejemplo, la probabilidad final de que el hermano de un enfermo con una enfermedad autosmica recesiva sea portador de la misma, si es sano, es de (1/2) (3/4) = 2/3, y la probabilidad final de que sea homocigoto sano es 1/3. Como se puede ver, los riesgos no siempre son algo fijo, sino que en ocasiones pueden modificarse, a veces de manera sustancial, con la incorporacin de nueva informacin. El teorema de Bayes tambin se utiliza con frecuencia para calcular el riesgo derivado de pruebas diagnsticas bioqumicas o moleculares, y puede combinarse con la informacin obtenida del rbol genealgico. Por ejemplo, si se sabe que una enfermedad tiene una prevalencia de 1/100 000 individuos, la probabilidad inicial de padecerla es P(A) = 10-5. Si una prueba diagnstica es positiva en el 80 por ciento de los in-

www.FreeLibros.me

248

dividuos enfermos y en un cinco por ciento de sanos (falsos positivos), podemos calcular la probabilidad de que un individuo en el que la prueba es positiva realmente padezca la enfermedad. Para esto, calculamos la probabilidad de tener alterada la prueba si uno est enfermo: P(B|A) = 0,8. Igualmente, la probabilidad de tener alterada la prueba si uno est sano es 0,05 (obsrvese el uso del condicional para calcular las probabilidades condicionales). La probabilidad final de que un sujeto tenga la enfermedad y adems una prueba diagnstica positiva es, por tanto, el producto de la probabilidad inicial de enfermar multiplicado por la probabilidad condicional de tener alterada la prueba si est realmente enfermo, dividido por la probabilidad de que el marcador est alterado en general (la suma de ambas probabilidades conjuntas):

Gentica clnica

Enfermo Inicial Condicional Conjunta Final 10-5 0,8 0,8 10-5

Sano 0,99999 0,05 0,0499995

(0,8 10-5) 0,0500075 = 1,6 10-4

Obsrvese que hemos multiplicado por ms de 10 el riesgo inicial, en aquellos casos en los que la prueba diagnstica est alterada. En cualquier caso, la situacin en la que ms se utiliza el teorema de Bayes en consejo gentico es para el clculo del riesgo de ser mujer portadora en las enfermedades con herencia ligada al X recesiva, ya que en estos casos el riesgo puede modificarse sustancialmente. En estas familias es importante identificar correctamente la mujeres portadoras obligatorias (aquellas que han tenido al menos un hijo enfermo o una hija portadora) y asignar la informacin condicional correctamente, sobre todo en el caso de estudios moleculares de anlisis indirecto.
La Figura 18.7 ilustra la aplicacin del teorema de Bayes al clculo de riesgos en enfermedades de herencia ligada al X recesiva, utilizando algunos ejemplos prcticos.

18.5 Enfermedades por alteracin del ADN mitocondrial


El ADNmt presenta una serie de caractersticas genticas que lo diferencian claramente del ADN nuclear:

Alta tasa de mutacin: la tasa de mutacin espontnea del ADNmt es unas 10 veces superior a la del ADN nuclear. Por tanto, hay una gran variacin de secuencias entre especies e incluso entre individuos de una misma especie. En el hombre se ha calculado que dos individuos escogidos al azar tienen como promedio 50-70 nucletidos diferentes en su genoma mitocondrial. Adems de estas diferencias, en un individuo determinado se est produciendo continuamente, a lo largo de la vida, una heterogeneidad en el ADNmt como consecuencia de las mutaciones que se estn dando en las clulas somticas. Se

www.FreeLibros.me

ha propuesto que una acumulacin de este dao mitocondrial pudiera ser la causa de la disminucin en la capacidad respiratoria de los tejidos que tiene lugar durante el envejecimiento. Poliplasmia y Segregacin mittica: en cada clula hay cientos o miles de molculas de ADNmt. En principio, todas las clulas de un individuo normal tienen molculas idnticas de ADNmt, situacin que se denomina homoplasmia. Si en una clula aparecen dos poblaciones de ADNmt, una normal y otra mutada, se dice que estamos en una situacin de heteroplasmia. Durante la divisin celular, las mitocondrias y, por tanto, las molculas de ADNmt se distribuyen al azar entre las clulas hijas. Efecto umbral: el fenotipo de una clula en heteroplasmia depender del porcentaje de ADN daado que exista en la clula; es decir, del grado de heteroplasmia de una mutacin. Cuando el nmero de molculas de ADNmt mutadas es pequeo, el ADNmt normal es capaz de mantener la funcin mitocondrial. Sin embargo, cuando el nmero de copias de ADNmt mutado sobrepasa un umbral determinado, la produccin de ATP puede llegar a estar por debajo de los mnimos necesarios para el funcionamiento de los tejidos, llevando al desarrollo de patologa mitocondrial. Es importante tener en cuenta que los distintos tejidos pueden variar en el grado de homoplasmia o heteroplasmia para un ADNmt mutado, lo que origina una gran variabilidad en la expresividad clnica de las enfermedades mitocondriales. Por otra parte, los tejidos tienen distintas necesidades energticas, y el nmero de orgnulos y de molculas de ADNmt es tambin diferente en cada tejido. Por tanto, los rganos preferentemente afectados en las enfermedades mitocondriales son aquellos que dependen en mayor grado de la produccin de energa para su correcto funcionamiento. Herencia materna: el ADNmt se hereda exclusivamente por va materna. La pequea cantidad de genoma mitocondrial contenido en el espermatozoide raramente entra en el vulo fecundado, y cuando lo hace es eliminado activamente. El tipo de herencia matrilineal es bastante fcil de reconocer al examinar un rbol genealgico, y tiene importantes consecuencias en el consejo gentico (ver ms adelante).

249

Enfermedades por alteracin del ADN mitocondrial

Por lo que respecta a las enfermedades humanas debidas a mutaciones del ADNmt, podemos dividirlas en dos grandes grupos: enfermedades asociadas a mutaciones puntuales y enfermedades debidas a alteraciones estructurales del ADNmt. Las enfermedades asociadas a mutaciones puntuales son frecuentes, debido a la alta tasa de mutacin del ADNmt. Actualmente se han descrito ms de 50 mutaciones puntuales, que se localizan en los tres tipos de genes codificados en el ADNmt (ARNr, ARNt y polipptidos del OXPHOS). Segn su efecto patognico, distinguimos las mutaciones que originan el cambio de un aminocido por otro, afectando a alguno de los 13 genes codificantes de protenas, y las mutaciones que afectan a los genes de los ARNr o ARNt, que tienen efectos globales en la sntesis de las protenas mitocondriales. Las enfermedades asociadas a alteraciones estructurales del ADNmt pueden ser tanto deleciones ms o menos grandes como, menos frecuentemente, inserciones y/o duplicaciones. Hasta el momento se han descrito varios cientos de reordenaciones del ADNmt, que al contrario que las mutaciones puntuales suelen

www.FreeLibros.me

250

ser espordicas. Como regla prctica, podemos decir que en aquellos casos que muestran herencia matrilineal ha de sospecharse la presencia de mutaciones puntuales del ADNmt; en casos espordicos, en cambio, son ms frecuentes las deleciones y/o duplicaciones. Si, por el contrario, se confirma un patrn de herencia autosmico dominante, el estudio debe ir dirigido hacia la bsqueda de deleciones mltiples; si fuese autosmico recesivo, deben buscarse depleciones del ADNmt.
La Figura 18.8 muestra las mutaciones puntuales ms frecuentes del ADN mitocondrial.

Gentica clnica

La deteccin de mutaciones puntuales se realiza habitualmente por digestin de fragmentos de PCR con enzimas de restriccin sensibles al cambio de nucletido introducido por la mutacin. En cualquier caso, resulta ms fiable la deteccin mediante Southern del ADNmt digerido con enzimas de restriccin especficas para cada una de las mutaciones concretas, pero esto no siempre es posible y, por otra parte, es ms laborioso. Las deleciones se encuentran siempre en heteroplasmia, aunque pueden llegar a constituir un porcentaje muy alto de la poblacin de ADNmt. Su determinacin se hace fundamentalmente en biopsias musculares, pero si la afectacin es muy grave se pueden llegar a detectar tambin en sangre perifrica. Las deleciones se detectan con relativa facilidad por la tcnica de Southern, que muestra poblaciones de ADNmt de menor tamao que el normal (16.569 pb). Se emplea habitualmente ADNmt digerido con BamHI o con EcoRV, utilizando como sonda un gran fragmento de ADNmt obtenido mediante PCR de largo alcance. El diagnstico de deplecin del ADNmt se realiza tambin por hibridacin Southern, comparando los niveles de ADNmt con los de ADN nuclear. La confirmacin molecular de una alteracin del ADNmt ayuda a establecer el diagnstico de enfermedad mitocondrial y el patrn de herencia matrilineal. Esto tiene una importancia capital desde el punto de vista del consejo gentico y el clculo del riesgo de recurrencia de la enfermedad, ya que la herencia matrilineal est caracterizada por la transmisin exclusivamente por va materna. Esto hace que tenga algunas caractersticas especiales: se afectan ambos sexos, pero los varones enfermos o no nunca transmiten la enfermedad, y sus descendientes (hijos o hijas) no son portadores; por otro lado, las mujeres afectadas transmiten la enfermedad a toda su descendencia, de forma que todas sus hijas tienen riesgo de transmitir y/o padecer la enfermedad, y todos sus hijos tienen riesgo de padecerla. Las enfermedades mitocondriales pueden deberse a defectos en genes nucleares o a alteraciones del propio genoma mitocondrial. La diferencia entre ambos tipos de procesos es importante porque los tipos de herencia son diferentes y las implicaciones para el clculo de riesgos pueden ser grandes. Dada la importancia del metabolismo oxidativo, las enfermedades mitocondriales presentan gran variedad de sntomas y signos, y suponen un problema diagnstico importante. En general encontramos afectacin neuromuscular: neuropata ptica, convulsiones, accidentes cerebrovasculares, mioclonas, neuropata perifrica, ataxia, demencia, miopatas. De todas formas, los pacientes con enfermedad del ADN mitocondrial pueden agruparse en tres categoras:

www.FreeLibros.me

251

Enfermedades por alteracin del ADN mitocondrial

La Figura 18.9 muestra un rbol genealgico tpico de herencia matrilineal.

Raramente se presenta como un sndrome fcilmente identificable: MELAS (encefalopata mitocondrial con acidosis lctica y episodios de accidentes cerebrovasculares) muestra estatura baja, sordera bilateral, diabetes, convulsiones, accidentes cerebrovasculares y encefalopata en la 3. o 4. dcadas de la vida. LHON (Leber hereditary optic neuropathy) muestran fallo visual bilateral en la 2-3 dcadas. Otras presentaciones clsicas son la oftalmoplegia externa con o sin ptosis, que aparece junto con una miopata proximal en CPEO (chronic progressvie external ophtalmoplegia) o con ataxia, sordera bilateral y defectos de conduccin cardaca en el Sndrome de Kearns-Sayre. Otros sndromes son NARP (neurogenic weakness, ataxia, retinitis pigmentosa) y MERRF (epilepsia mioclnica y ragged-red-fibers o fibras musculares rojas deshilachadas). Un segundo grupo de pacientes tienen una constelacin de datos clnicos que sugieren enfermedad mitocondrial, pero no encajan en ninguno de los sndromes citados. Por ejemplo, son tpicos los casos de estatura baja con sordera neurosensorial bilateral, oftalmoplegia con ptosis, diabetes y migraas. Es necesario un estudio neurolgico exhaustivo, y la asociacin de cualquiera de estos datos con miopata o signos de afectacin neurolgica central hace el diagnstico de enfermedad mitocondrial muy probable. Sin embargo, lo ms habitual es que estos pacientes sean estudiados para descartar gran cantidad de enfermedades neurolgicas hereditarias autosmicas (alguna forma de ataxia espinocerebelosa, estados iniciales de la enfermedad de Huntington, sndrome de Usher, Charcot-Marie-Tooth) antes de que se llegue a pensar en enfermedad mitocondrial. Un diagnstico comn en estos pacientes es el de miastenia congnita. El ltimo gran grupo de enfermos es el ms difcil de definir, y est constituido por pacientes con sntomas aislados que despus de un estudio exhaustivo terminan achacndose a patologa mitocondrial. Por ejemplo, un cierto porcentaje de accidentes cerebrovasculares juveniles son resultado de patologa mitocondrial, pero adems la presentacin a menudo es extra-neurolgica: cardiomiopata hipertrfica, enfermedad tubular renal, hipoparatiroidis-

www.FreeLibros.me

252

mo, insuficiencia suprarrenal, diabetes, disfagia. La sordera familiar neurosensorial progresiva es frecuentemente debida a patologa mitocondrial, como demostr el grupo de Xavier Estivill en 70 familias espaolas con la mutacin del nucletido 1555. Entre las pruebas diagnsticas que resultan tiles para llegar al diagnstico de patologa mitocondrial, contamos con las siguientes:

Gentica clnica

Investigaciones generales: habitualmente, estos pacientes han sido sometidos a gran catidad de tests. Es necesario ver la funcin cardaca, test de tolerancia a glucosa, nivel de lactato en sangre (es ms especfico en el lquido cefalo-raqudeo), electroencefalograma para detectar encefalopata subaguda, TAC cerebral (es comn la calcificacin bilateral de ganglios basales). Investigaciones especficas: deteccin de alteraciones en el ADN mitocondrial, tanto reordenamientos (deleciones, duplicaciones) como mutaciones puntuales. Lo ms habitual es que las mutaciones estn en heteroplasmia, y esto determina la expresividad fenotpica (habitualmente es necesario >85 por ciento de ADNmt mutado para que se manifieste la enfermedad). Las mutaciones letales slo pueden estar en heteroplasmia, pero en general el porcentaje de heteroplasmia vara en distintos rganos en un mismo individuo e incluso tambin con la edad, de ah la enorme variabilidad clnica. En algunas entidades es relativamente sencilla la deteccin molecular: por ejemplo, hay tres mutaciones que en conjunto explican el 95 por ciento de los pacientes con LHON. En cambio, las deleciones responsables de los sndromes de CPEO o Kearns-Sayre no son detectables en sangre, por lo que los resultados negativos han de ser interpretados con cautela. En estos casos, la biopsia de msculo esquletico es la piedra angular para el diagnstico de patologa mitocondrial: por un lado, la deteccin histoqumica de fibras deficientes en COX y en otros complejos de la cadena respiratoria confirma la afectacin mitocondrial; adems, los estudios moleculares en ADN muscular confirman la presencia de deleciones o de mutaciones puntuales.

18.6 Diagnstico prenatal


El avance de las tcnicas diagnsticas genticas permite hoy en da, para determinados procesos, realizar diagnstico precoz dentro del tero. Esta modalidad diagnstica, llamada diagnstico prenatal, es con frecuencia causa de la peticin de consejo gentico, y tiene unos matices especiales por las implicaciones emocionales fuertes que conlleva para la familia. El desarrollo de los mtodos de diagnstico prenatal ha ido parejo a la prctica del consejo gentico, y por tanto se ha realizado de modo responsable y adecuado. En cambio, el uso generalizado de nuevos mtodos, especialmente la ecografa, fuera del contexto del consejo gentico (o incluso como sustituto del mismo) sin realizar adecuadamente el clculo de riesgos, la deteccin de portadores ni otras medidas de apoyo, supone un descenso en la calidad de la asistencia que reciben las familias con enfermedades genticas. El uso de pruebas de barrido (screening) en el primer trimestre del embarazo significa que la mayor parte de las consultas de diagnstico prenatal se realizan en situaciones en las que no exis-

www.FreeLibros.me

ta riesgo previo de una enfermedad gentica, lo cual genera situaciones especialmente delicadas que es importante gestionar bien. Dado que los procesos de diagnstico prenatal suponen una cierta tensin emocional para la familia, especialmente para la madre, y pueden provocar una morbilidad fetal significativa, se recomienda que slo se realice diagnstico prenatal cuando se cumplen una serie de condiciones y en aquellos casos en que est indicado. En concreto, slo se debe plantear el diagnstico prenatal en el caso de enfermedades graves para las que exista un mtodo diagnstico especfico y fiable, y que sean susceptibles de tratamiento o prevencin. Las indicaciones principales, por tanto, son las cromosomopatas, los defectos del tubo neural, y la edad materna avanzada. Tambin se debe valorar la aceptacin o no, por parte de la familia, del aborto eugnico como opcin, ya que algunos autores desaconsejan iniciar los estudios de diagnstico prenatal cuando dicha opcin no se acepta (por motivos ticos, religiosos o de ndole personal). En efecto, en estas circunstancias no est claro que el diagnstico conlleve ningn beneficio, y por el contrario pueden generarse conflictos serios que son difciles de resolver y a los que el facultativo no podr dar respuesta. En estas circunstancias, el diagnstico prenatal slo sera de utilidad si se pueden tomar medidas preventivas o teraputicas en el periodo fetal, lo cual slo es posible en un nmero reducido de enfermedades. Por tanto, antes de la puesta en marcha del proceso de diagnstico prenatal es importante conocer las disposiciones de la pareja respecto a las posibles opciones teraputicas, adems de considerar otros factores como la severidad de la posible enfermedad, la posibilidad de tratamiento o medidas preventivas, y la fiabilidad de las tcnicas de diagnstico prenatal. Este ltimo punto es tambin de gran importancia, y debe ser explicado con claridad y ejemplos prcticos, porque el concepto de riesgo no siempre es correctamente entendido. Igualmente es importante que no se realice diagnstico prenatal sin una estimacin previa del riesgo que tiene un feto concreto de padecer la enfermedad: el diagnstico prenatal no est exento de complicaciones y supone en s mismo un riesgo para el feto, por lo que no est justificado realizarlo cuando el riesgo previo de padecer esa enfermedad es muy bajo. Esto supone, lgicamente, que el diagnstico prenatal debe formar parte del proceso global de consejo gentico y ser realizado, siempre que sea posible, por especialistas en gentica clnica. Los dos mtodos ms utilizados para la obtencin de material fetal son la amniocentesis y la toma de una biopsia de vellosidades corinicas. La amniocentesis consiste en la toma de una muestra de lquido amnitico, que contiene clulas fetales en suspensin. Dichas clulas se pueden cultivar in vitro para despus realizar estudios cromosmicos, bioqumicos o moleculares, lo cual requiere entre una y tres semanas. El procedimiento es, guiado por ultrasonidos y, en manos experimentadas, fiable. Sus principales inconvenientes son el lmite de edad fetal, ya que no puede realizarse antes de las 15 semanas de gestacin, y los riesgos de prdida fetal que conlleva (en torno al 0,5-1 por ciento). La biopsia de vellosidades corinicas puede realizarse durante el primer trimestre del embarazo, en torno a la dcima semana, y es especialmente til para realizar estudios moleculares y en la presencia de un riesgo alto de cromosomopata. En cambio, es menos utilizada que la amniocentesis cuando el riesgo de alteraciones citogenticas es bajo. El procedimiento se realiza me-

253

Diagnstico prenatal

www.FreeLibros.me

254

diante puncin a travs de la pared abdominal (transabdominal) o a travs del cuello del tero (transcervical), bajo gua ecogrfica. En ese momento, el tejido corinico todava no forma una placenta propiamente dicha, por lo que la biopsia se examina bajo microscopio y se aslan las vellosidades (que nicamente contienen tejido fetal). El material obtenido puede utilizarse directamente (sin necesidad de cultivo) para estudios moleculares o enzimticos. En general, este procedimiento se reserva para embarazos de alto riesgo, ya que la probabilidad de prdida fetal es mayor que en la amniocentesis (en torno al 2-3 por ciento). Dado el riesgo relativamente alto de dao fetal que tienen la amniocentesis y, sobre todo, la obtencin de vellosidades corinicas, desde hace aos se estn buscando mtodos no invasivos que permitan realizar estudios moleculares o bioqumicos en material fetal. Entre stos, estan siendo muy utilizados los mtodos ecogrficos, el anlisis bioqumico de sangre materna, el anlisis de clulas fetales presentes en la sangre materna, o incluso la obtencin de sangre fetal (aunque este procedimiento es ms invasivo y por tanto ms peligroso que los otros mencionados). Tambin en los ltimos aos, con la proliferacin de las tcnicas de fertilizacin in vitro, es posible realizar diagnstico gentico preimplantatorio, obteniendo un blastmero a partir de un embrin de pocas clulas y realizando estudios moleculares a partir del ADN de esa nica clula. Por desgracia, dicho procedimiento habitualmente no se realiza en el contexto del consejo gentico, y todava no existen datos claros acerca del posible dao fetal que pueda producir. Tampoco hay estudios abundantes sobre las tasas de error que se obtienen en el diagnstico de las distintas enfermedades genticas, y en cualquier caso su aplicacin est limitada por la baja tasa de xito de la fertilizacin in vitro.

Gentica clnica

www.FreeLibros.me

www.FreeLibros.me

E) Nuevas herramientas de la gentica moderna

Esta seccin aborda los dos ltimos temas del programa, que introducen al alumno en las cuestiones de ms actualidad y le abren perspectivas de futuro.

www.FreeLibros.me

CAPTULO 19

Terapia gnica

Contenidos
19.1 Componentes de un sistema de terapia gnica y vas de administracin 19.2 Naturaleza del cido nucleico teraputico 19.3 Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica 19.4 Aplicaciones clnicas de la terapia gnica en el momento actual

19.1 Componentes de un sistema de terapia gnica y vas 19.1 de administracin


El desarrollo de la gentica molecular durante los ltimos aos, y especialmente toda la informacin derivada del Proyecto Genoma Humano, han propiciado que podamos afrontar la modificacin directa de las alteraciones genticas o la utilizacin de cidos nucleicos como agentes teraputicos. La terapia gnica es una nueva modalidad teraputica surgida a finales de los aos 80, y que puede definirse como la transferencia de cidos nucleicos (ADN o ARN) con fines teraputicos. Toda estrategia de terapia gnica se basa, por tanto, en la transferencia de cidos nucleicos (transferencia gnica) al interior de un grupo de clulas. Estas clulas pueden ser las clulas enfermas cuyo dao se pretende reparar, o bien un grupo de clulas normales que se modifican genticamente para que sean las efectoras de una accin teraputica, por ejemplo sintetizando una protena concreta. Por lo tanto, todo sistema de terapia gnica es anlogo a un sistema de transporte, en el que hay un agente que es transportado y un vehculo de transporte. En nuestro caso, el agente transportado es un cido nucleico y el vehculo encargado de llevarlo al interior de las clulas diana se denomina vector. Segn el modo de hacer llegar el vector (conteniendo el agente teraputico) a las clulas diana, es ya clsica la distincin entre terapia gnica ex vivo y terapia gnica in vivo. En el primer caso, la administracin del vector se realiza fuera del cuerpo: se obtiene una biopsia del rgano de inters, se expanden las clulas mediante culti-

www.FreeLibros.me

258

In vivo
VECTOR

Terapia gnica
a)

Ex vivo

La Figura 19.1 ilustra los componentes de un sistema de terapia gnica y las vas de administracin.

vo celular y se ponen en contacto con el vector mientras estn siendo cultivadas. Esto hace posible seleccionar las clulas que hayan sido modificadas genticamente y reintroducirlas en el paciente. En la administracin in vivo, el vector teraputico se administra directamente al individuo enfermo por cualquiera de las vas habituales (intramuscular, oral, intravenosa, intraportal, subcutnea), escogiendo aquella que nos permita alcanzar la mxima eficacia teraputica.

19.2 Naturaleza del cido nucleico teraputico


Segn el efecto biolgico que pretendemos obtener, el agente teraputico ser de distinta naturaleza. En general, podemos clasificar los cidos nucleicos teraputicos en tres grupos, dependiendo de si buscamos la correccin directa de una mutacin, la suplementacin gnica, o la inhibicin de la expresin. En los ltimos aos se ha conseguido corregir especficamente defectos a nivel del ADN mediante la utilizacin de quimeraplastos, molculas quimricas (hbridas) formadas por ADN y ARN que son capaces de reconocer especficamente una mutacin y corregirla. Este tipo de tecnologa funciona con cierta eficacia cuando se aplica a clulas en cultivo (in vitro), y es de esperar que en los prximos aos se pueda utilizar tambin in vivo. Los quimeraplastos son oligonucletidos formados por una molcula lineal de ADN que contiene un tracto de cinco desoxi-ribonucletidos complementarios a la secuencia genmica que se quiere corregir. Es importante que esta regin co-

www.FreeLibros.me

b)

c)

rrectora est flanqueada por fragmentos de 10 ribonucletidos (ARN). El oligonucletido se empareja especficamente con la regin mutada y los sistemas de reparacin celulares llevan a cabo la reparacin de la mutacin tomando como molde la base correspondiente del oligonucletido teraputico. Tericamente, es posible disear oligonucletidos ARN/ADN para corregir directamente las mutaciones puntuales que causan las enfermedades hereditarias ms frecuentes. En el caso de mutaciones que simplemente producen prdida de funcin, puede ser suficiente la suplementacin gnica, es decir, suplementar las clulas con copias normales del gen sin preocuparnos de corregir las mutaciones presentes en el ADN genmico. Lo ms habitual en estos casos es que el agente teraputico sea una unidad de expresin en la que la transcripcin del gen en cuestin viene regulada por promotores virales potentes, por promotores regulables o por promotores especficos de un tipo celular concreto. Cuando el defecto gentico que tratamos de corregir origina una ganancia de funcin, como suele suceder en mutaciones con efectos oncognicos, lo lgico es intentar inhibir la expresin del gen que est causando el fenotipo aberrante. Los agentes teraputicos ms utilizados en estas circunstancias son las molculas antisentido o los ribozimas. Los oligonucletidos antisentido pueden inhibir directamente la expresin de un gen al unirse a la doble hlice de ADN mediante enlaces tipo Hoogsteen, formando una triple hlice que impide la transcripcin mediada por la ARN polimerasa II. Estos oligonucletidos suelen estar modificados qumicamente para aumentar su estabilidad y eficacia, siendo las principales modificaciones los grupos fsforo-tioato en el esqueleto desoxi-ribosa-fosfato de los oligonucletidos, o bien los cidos nucleicos en los que el enlace fosfo-dister viene substituido por un enlace peptdico (denominados Acidos Nucleicos Peptdicos, PNA). Los ARNm antisentido son capaces de emparejarse con los ARN sentido y formar molculas bicatenarias de ARN que no pueden ser traducidas y son digeridas por la RNAsa H celular. Los ribozimas, pequeas molculas de ARN con actividad cataltica, pueden ser diseados para reconocer un ARNm especfico y degradarlo merced a su actividad endonucleoltica especfica. En general, la utilizacin de molculas antisentido y ribozimas est limitada por la baja eficacia que muestran todava en modelos in vivo. Hoy en da, las mejores perspectivas de inhibicin eficaz y especfica de la expresin gnica se basan en la interferencia de ARN, un mecanismo de silenciamiento gnico post-transcripcional descrito en plantas y C. elegans que consiste en la degradacin de ARN mensajeros endgenos por la presencia de molculas pequeas de ARN de doble cadena homlogas al mensajero que se destruye. Este proceso depende de una RNAasa tipo III llamada DICER, responsable de la formacin de los ARN pequeos, y de un complejo llamado RISC (RNA Induced Silencing Complex) que contiene unas protenas del complejo ARGONAUTA y los ARN pequeos que dirigen el complejo a la diana. Se ha visto que este mecanismo tambin juega un papel importante en la regulacin gnica en humanos, ya que el anlisis del genoma ha revelado la presencia de genes que codifican ARN pequeos (aproximadamente 75 nucletidos) que forman horquillas y que son procesados por

259

Naturaleza del cido nucleico teraputico

www.FreeLibros.me

260

DICER y protenas del complejo Argonauta para generar ARN intereferentes pequeos, de unos 21-22 nucletidos. Estos genes endgenos se denominan miRNA (microRNA), para diferenciarlos de los siRNA que provienen de molculas bicatenarias de ARN de procedencia externa. Actualmente se piensa que ambos tipos de molculas (miRNA y siRNA) tienen la misma va efectora, que acta impidiendo la traduccin (si la homologa de la molcula interferente con el ARN mensajero no es total), o bien eliminando los mensajeros si la homologa es total. Sorprendentemente, tambin se ha visto que las repeticiones centromricas y los transposones, cuando se transcriben, dan lugar a ARN interferentes pequeos que utilizan este mecanismo para modificar la cromatina, induciendo metilacin en las histonas o en el ADN y provocando la formacin de heterocromatina o el silenciamiento transcripcional. En los ltimos aos se ha demostrado que se pueden utilizar siRNAs o microRNAs para inhibir la expresin de genes endgenos, generando molculas interferentes especficas para un gen concreto. Por ejemplo, se ha conseguido silenciar genes endgenos en clulas humanas mediante siRNAs dirigidos especficamente frente a promotores concretos. Dicho silenciamiento se lleva a cabo por metilacin de los dinucletidos CpG de esos promotores y por metilacin de la lisina 9 de la histona H3 de esa regin. El avance ms espectacular usando esta tecnologa tuvo lugar en 2004, cuando un grupo consigui reducir hasta un 40 % los niveles de colesterol en ratn, usando unos siRNA sintticos conjugados con colesterol que fueron injectados directamente en la vena de la cola. Los siRNA fueron captados eficazmente por receptores del hgado, yeyuno y otros rganos y provocaron la degradacin de los ARNm endgenos de apolipoprotena B, con el consiguiente descenso en los niveles de LDL y colesterol total.
En la Figura 19.2 se muestran algunos ejemplos de molculas utilizadas en distintas estrategias de terapia gnica.

Terapia gnica
1.

19.3 Tipos de vectores y su utilizacin en distintas estrategias 19.3 de transferencia gnica


Los cidos nucleicos teraputicos han de ser vehiculizados al interior de las clulas diana por medio de vectores adecuados. Se distinguen dos tipos fundamentales de vectores: los basados en virus (vectores virales) y los vectores sintticos (vectores no virales) que intentan emular la capacidad natural que tienen los virus de introducir cidos nucleicos en las clulas. Los vectores virales fueron los primeros en ser utilizados, dada su alta eficacia como vehculos de cidos nucleicos. Los virus estn compuestos por un ADN o un ARN rodeado de una cpside proteica y, en algunos casos, una envuelta lipoproteica. El ciclo biolgico de los virus pasa por la introduccin del genoma viral en determinados tipos celulares, habitualmente por la presencia de receptores en la membrana de las clulas. Para poder utilizar un virus

www.FreeLibros.me

como vector en terapia gnica, es preciso insertar el cido nucleico teraputico en el genoma viral, y conseguir al mismo tiempo que el virus no se replique y, por tanto, no sea patognico. Por esto, los virus utilizados en terapia gnica se denominan virus recombinantes y defectivos (carecen de alguna funcin necesaria para su propio ciclo replicativo). A continuacin se repasan los principales vectores virales utilizados actualmente en terapia gnica. a) Vectores retrovirales. La familia Retroviridae est compuesta por las subfamilias Spumaviridae, Lentiviridae y Oncoviridae. Los vectores retrovirales utilizados en terapia gnica estn derivados de los oncovirus murinos del tipo C, especialmente los que son anfitrpicos (que pueden infectar tanto clulas murinas como humanas). Recientemente se han desarrollado vectores derivados de lentivirus, especialmente del HIV-1. Los retrovirus son virus ARN que tienen una envuelta fosfolipdica, con glicoprotenas que determinan el tropismo del virus al ser reconocidas por receptores celulares especficos. Dentro de esta envuelta hay una cpside proteica de estructura icosadrica que contiene dos copias del genoma viral, la transcriptasa inversa (RT), y la integrasa. El genoma de un retrovirus es una molcula de ARN de polaridad positiva en la que se distinguen tres tipos de genes: genes gag (que codifican las protenas de la cpside), genes pol (que codifican las enzimas necesarias para el ciclo viral, como la proteasa y la integrasa) y genes env (que codifican las glicoprotenas de la envuelta). El genoma est flanqueado por dos repeticiones terminales largas (LTR, Long Terminal Repeat), y contiene tambin una seal de empaquetamiento PSI mediante la cual las molculas de ARN se unen a las protenas de la cpside y son empaquetadas eficazmente. El LTR izquierdo contiene una regin (U3) para el comienzo de la transcripcin, y un primer binding site (pbs) para el comienzo de la retrotranscripcin. El LTR derecho contiene una secuencia de poli-purinas (ppt) para la replicacin de la segunda cadena.

261

Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica

a)

LTR

PSI

gag

pol

env

LTR ppt

U3 pbs
La Figura 19.3 muestra la estructura del genoma de un retrovirus.

a)

El ciclo replicativo de los retrovirus comienza cuando el virus es reconocido por receptores celulares, lo que lleva a la fusin de la envuelta viral con la membrana celular y a la internalizacin del nucleoide. A continuacin tiene lugar la retrotranscripcin del ARNm para formar un ADNc bicatenario (este proceso tiene lugar dentro de la nucleocpside,

www.FreeLibros.me

262

a)

a)

antes de su llegada al ncleo de la clula), y despus se desensambla la cpside al llegar a la membrana nuclear. El genoma viral se integra en el genoma de la clula husped (integracin mediada por la propia integrasa del virus), y entonces comienza la transcripcin a partir del promotor U3 que est en el LTR izquierdo. Se producen distintos tipos de ARNm, fundamentalmente un transcrito que contiene gag y pol y otros transcritos que codificarn las protenas de la envuelta. Los ARNm son exportados al citoplasma y traducidos, dando lugar a poliprotenas gag-pol y a las protenas de la envuelta. Estas ltimas viajan a la membrana celular, mientras que las poliprotenas gag-pol forman nuevas nucleocpsides al unirse a la seal de empaquetamiento de los ARNm positivos. Tras el empaquetamiento, que tiene lugar en el citoplasma, las cpsides salen de la clula por gemacin, quedando rodeadas de nuevo por una envuelta compuesta por la membrana celular y las glicoprotenas codificadas por el virus que haban llegado anteriormente a la membrana. Las nuevas partculas retrovirales se activan cuando la proteasa rompe la poliprotena gag-pol dentro de la propia partcula viral y da lugar a molculas independientes de proteasa, integrasa y retrotranscriptasa. Es importante sealar que el nucleoide de un oncovirus es incapaz de atravesar la membrana nuclear, por lo que es necesario que la clula sufra al menos una mitosis para que el genoma viral entre en contacto con el genoma de la clula husped. En cambio, los retrovirus de la familia de los lentivirus s que pueden atravesar la membrana nuclear, por lo que pueden infectar clulas que no estn en divisin. Esta es una propiedad muy importante a la hora de valorar las posibles aplicaciones de estos tipos de vectores. Para generar un retrovirus recombinante defectivo, es necesario sustituir los genes de las protenas virales por el gen teraputico que se quiere utilizar. Lgicamente, para producir estos virus defectivos debemos usar una lnea clular (clula empaquetadora) que aporte los genes virales en trans. Estas clulas empaquetadoras tienen los genes virales insertados en el genoma celular, de modo que expresan establemente las protenas virales. Sin embargo, las copias de los genes virales que estn integradas en el genoma celular carecen de la seal de empaquetamiento, por lo que sus transcritos no pueden empaquetarse en las nuevas partculas virales. De este modo, una clula empaquetadora en condiciones normales no produce viriones completos, sino slo partculas vacas. En cambio, cuando transfectamos estas clulas con un plsmido recombinante que contenga el ADN teraputico flanqueado por los LTR y por la seal de empaquetamiento (adems de otros elementos necesarios en cis como el primer binding site, y el tracto polipurnico necesario para la sntesis de la segunda cadena) se generarn partculas retrovirales recombinantes y defectivas, que pueden ser purificadas y concentradas a partir de los sobrenadantes del cultivo celular. En este proceso es muy importante evitar la aparicin de retrovirus con capacidad replicativa, que podran generarse por recombinacin homloga entre las secuencias virales que

Terapia gnica

www.FreeLibros.me

estn presentes en nuestro plsmido con las secuencias virales presentes en el genoma de la clula empaquetadora. Por este motivo, se utilizan clulas empaquetadoras que tienen los genes virales separados entre s, de modo que seran necesarias varias recombinaciones independientes para generar un virus replicativo, algo altamente improbable.
El vdeo de la Figura 19.4 explica el ciclo replicativo de los retrovirus y el proceso de generacin de retrovirus defectivos recombinantes.

263

Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica

a)

a)

b)

Los retrovirus recombinantes defectivos han sido muy utilizados en terapia gnica. Por las limitaciones propias del tamao del genoma viral, el ADN teraputico no puede ser mayor a 7-8 kb. Son vectores con buena infectividad, un tropismo amplio, pero son bastante lbiles (lo que dificulta su purificacin) y slo transducen eficazmente clulas que estn en divisin. Adems, son inactivados en el torrente sanguneo por el sistema del complemento, por lo que su principal uso ha estado reservado a estrategias de terapia gnica ex vivo. Su capacidad integrativa les permite alcanzar, en teora, una duracin muy larga de la expresin incluso en clulas que estn dividindose activamente. Sin embargo, los promotores virales suelen silenciarse por metilacin, por lo que la expresin no es tan prolongada como cabra esperar. Se est investigando la posibilidad de modificar el tropismo de estos vectores, mediante la creacin de protenas de la envuelta quimricas que incluyan algn scFv (anticuerpo monocatenario) u otros ligandos de receptores celulares conocidos. Como se ha mencionado, recientemente se han desarrollado vectores retrovirales basados en lentivirus, aprovechando la circunstancia de que el HIV-1 es uno de los virus mejor estudiados. El genoma de este virus contiene algunos genes (tat y rev, por ejemplo) que no estn presentes en los oncoretrovirus y que son esenciales para la expresin de los genes virales. Algunas de las protenas virales tienen seales de localizacin nuclear y facilitan la entrada del virus por los poros nucleares, de ah la capacidad que tienen estos virus de infectar clulas que no estn en divisin. Aunque los problemas de seguridad de los lentivirus estn prcticamente superados, todava hay que mejorar los sistemas de produccin para poder utilizarlos en pacientes con total seguridad. Su principal aplicacin est en la transferencia de genes a clulas del sistema nervioso in vivo, y a progenitores hematopoyticos ex vivo, siendo esta ltima una propiedad especialmente interesante por su inmenso potencial teraputico, y porque estas clulas son prcticamente intransfectables por otros medios. Vectores adenovirales. Se conocen gran cantidad de serotipos de adenovirus humanos, pero los ms utilizados en terapia gnica han sido los serotipos 2 y 5. Los adenovirus son virus ADN sin envuelta, responsables de las principales enfermedades de vas respiratorias altas (el catarro comn), con muy buen tropismo por clulas humanas. La nucleocpside de un adenovirus consta de una cpside icosadrica que est compuesta por 720 protenas hexona y 60 protenas pentona. De las pentonas parte

www.FreeLibros.me

264

a)

la protena de la fibra (una protena trimrica) que termina en una protena botn (knob) mediante la cual el adenovirus se une a receptores celulares especficos. El genoma adenoviral es un ADN de doble cadena de aproximadamente 35 kb de tamao, flanqueado por repeticiones terminales invertidas (ITR) de 100-140 nucletidos y una seal de empaquetamiento (psi) cerca del ITR izquierdo. Contiene gran cantidad de genes, que se agrupan en regiones tempranas (early) y tardas (late), segn el momento en que se transcriben despus de la infeccin. As, las regiones tardas se transcriben tras la replicacin del genoma viral, y contienen los genes que codifican las protenas estructurales del virus. En cambio, las regiones tempranas se transcriben antes de la sntesis del ADN viral, y cumplen varias funciones:

Terapia gnica


b)

Las protenas codificadas en E1 incluyen, por ejemplo, E1A (protena necesaria para transactivar la transcripcin de los dems genes virales) y E1B 55kd (que se une a E4). Adems, estas protenas interfieren con las funciones de la clula husped: E1A es una oncoprotena, E1B 19kd inhibe la apoptosis mediada por p53 y E1B 55kd promueve la degradacin de p53. La regin E2 codifica protenas necesarias para la replicacin viral: ADN polimerasa, protena terminal, etc. La regin E3 codifica algunas protenas que ayudan al adenovirus a escapar al sistema immune, como la protena gp19kd que inhibe la presentacin de fragmentos antignicos con molculas de clase II del Complejo Mayor de Histocompatibilidad. La regin E4 codifica diversas protenas que silencian genes endgenos, regulando el transporte de ARN mensajeros fuera del ncleo.

b)

El ciclo replicativo de un adenovirus es ms sencillo que el de los retrovirus. El adenovirus se une a un receptor de membrana especfico denominado CAR (CoxackieAdenovirusReceptor) mediante el botn de la fibra, y a continuacin la pentona se une por un motivo RGD (arginina-glicina-asprtico) a integrinas cercanas para despus ser internalizado por endocitosis. La propia cpside adenoviral es capaz de desestabilizar el endosoma, que se rompe y libera las partculas virales al citoplasma. Las nucleocpsides llegan a la membrana nuclear y son capaces de introducir el genoma viral a travs de los poros nucleares. Para generar adenovirus recombinantes defectivos (es decir, que lleven el ADN teraputico pero no puedan replicarse) se sigue una estrategia similar a la que veamos para los retrovirus: substituir algn gen viral por el gen teraputico. Lo ms habitual es delecionar el genoma viral en la regin E1, para lo que necesitaremos una clula empaquetadora que exprese de manera estable los genes contenidos en esa regin. La lnea celular ms utilizada como clula empaquetadora para construir adenovirus recombinantes se denomina clula 293. Para conseguir el adenovirus recombinante, se cotransfectan clulas 293 con dos plsmidos distintos:

www.FreeLibros.me

un plsmido en el que el gen teraputico est flanqueado por parte del gen E1, la seal de empaquetamiento y los ITR virales, y otro plsmido que contiene todo el genoma viral excepto la seal de empaquetamiento y la regin de E1 que est presente en trans en el genoma de las clulas 293. Una vez dentro de la clula, los mecanismos de recombinacin son capaces de generar un genoma viral recombinante que llevar el gen teraputico dentro del genoma viral (al que le falta E1). Como el gen teraputico va unido a la seal de empaquetamiento PSI, nicamente estos transcritos se empaquetarn correctamente en las nuevas cpsides virales, mientras que los genomas virales producidos endgenamente carecen de la seal PSI y por tanto no producen viriones infectivos. Los adenovirus delecionados en E1 permiten insertar genes teraputicos con un tamao mximo de 5 kb, por lo que posteriormente se han generado vectores que llevan adems deleciones en E3 y E4, para conseguir llegar a una capacidad de 7-8 kb. La ltima generacin de vectores adenovirales consiste en los llamados adenovirus gutless (vacos), en los que todo el genoma viral ha sido delecionado y por tanto tienen una capacidad terica en torno a las 30 kb de ADN exgeno. Para producirlos hay que aportar en trans todas las funciones adenovirales necesarias, mediante plsmidos helper o por estrategias que utilizan el sistema Cre/loxP.
La Figura 19.5 muestra la estructura del genoma de un adenovirus y de una partcula adenoviral, as como el proceso general de produccin de adenovirus recombinantes defectivos.

265

Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica

b)

c)

Los adenovirus comenzaron a usarse en terapia gnica ms tarde que los retrovirus, pero rpidamente ganaron en popularidad y hoy en da son los vectores ms utilizados para aplicaciones in vivo. Infectan gran variedad de clulas, son relativamente estables y fciles de purificar y concentrar, y son eficaces tanto sobre clulas quiescentes como sobre clulas en divisin. Como el genoma del vector no se integra en el genoma de la clula husped, la duracin de la expresin en clulas en divisin es limitada. Su principal inconveniente es la toxicidad que producen a dosis altas, y la fuerte respuesta inmune celular y humoral que sigue a su administracin, con la consiguiente disminucin de eficacia teraputica. Los nuevos vectores adenovirales vacos superan algunos de estos inconvenientes. Vectores Virales Adenoasociados. Se trata de Parvovirus que infectan al hombre pero no son patgenos. Pertenecen al grupo de los Dependovirus, virus ADN sin envuelta que necesitan de funciones helper para completar su ciclo replicativo completo. Estas funciones helper las aporta un adenovirus o un herpesvirus que sobreinfecta las mismas clulas que previamente haban sido infectadas por un dependovirus. El genoma de un virus adenoasociado es un ADN monocatenario con un tamao de 4,8 kb y una estructura muy simple, con dos regiones codificantes: cap, que codifica las tres protenas de la cpside, y rep, que codifica cuatro protenas necesarias para la replicacin viral. El genoma est flanqueado por

www.FreeLibros.me

266

b)

b)

b)

d)

dos repeticiones terminales invertidas (ITR), que forman unas estructuras en horquilla y que son los nicos elementos necesarios en cis para poder llevar a cabo el ciclo vital del virus. La infeccin por un virus adenoasociado comienza por la unin del virus a receptores celulares y su entrada en la clula. El genoma viral es capaz de entrar en el ncleo incluso en clulas que no se dividen, y una vez all se convierte a doble hebra y se integra en un locus especfico localizado en el brazo largo del cromosoma 19 humano (banda 19q13). Todas estas funciones estn mediadas por protenas de la clula husped, pero adems se ha comprobado que las protenas virales Rep78/68 son necesarias para la integracin especfica del genoma viral en una secuencia llamada AAVS1 que est en 19q13. En ausencia de funciones helper, el genoma viral integrado permanecer como un provirus, en forma latente. Ante una sobreinfeccin por adenovirus o herpesvirus, el adenoasociado comienza su fase ltica con la transcripcin de los genes virales, la replicacin del genoma viral y el empaquetamiento en las cpsides para dar lugar a nuevos viriones. Para obtener virus adenoasociados recombinantes como vectores en terapia gnica, se construye un plsmido recombinante que contiene el gen teraputico flanqueado por los ITR virales. En el mtodo clsico de produccin de estos vectores, se cotransfectan clulas 293 con el plsmido recombinante y con otro plsmido que aporta en trans las funciones cap y rep, y despus se infectan esas mismas clulas con un adenovirus. El problema de este procedimiento es que los preparados virales tienen una fuerte contaminacin por adenovirus, por lo que es necesario inactivar este adenovirus contaminante mediante tratamiento con calor. Los mtodos actuales de produccin evitan este problema al aportar las funciones helper del adenovirus en un tercer plsmido que se cotransfecta con los otros dos, de forma que la generacin de adenovirus maduros es prcticamente imposible. Los vectores adenoasociados estn ganando popularidad rpidamente por sus extraordinarias caractersticas: buena infectividad, integracin en el genoma de la clula husped, muy baja toxicidad y ausencia de respuesta inmune celular frente a las protenas virales. Por desgracia, la especificidad de la integracin en un locus concreto se pierde en los virus adenoasociados recombinantes, ya que no se produce Rep68/78 (que es absolutamente necesaria para que tenga lugar esta integracin especfica). En consecuencia, la integracin se realiza al azar, como en el caso de los retrovirus. Los virus adenoasociados pueden transducir clulas mitticas o clulas en divisin, y estn especialmente indicados en aplicaciones in vivo en las que se requiere una expresin prolongada del gen teraputico. Otros vectores virales que actualmente estn ganado en popularidad son los Herpesvirus, basados en el virus del herpes simplex (HSV), que tienen un marcado tropismo neuronal y por eso se emplean fundamentalmente para la transferencia de genes al sistema nervioso. Los HSV son virus envueltos con un genoma lineal de 152 kb de ADN bicatenario, en el que se

Terapia gnica

www.FreeLibros.me

b)

han identificado ms de 80 genes. El genoma est dividido en dos regiones nicas (Larga y Corta) que estn flanqueadas por repeticiones terminales (TR) y repeticiones internas (IR). El virus se une a glicosamino-glucanos celulares y a receptores celulares especficos (por ejemplo, el receptor HveC, que pertenece a la superfamilia de las inmunoglobulinas y se expresa a alto nivel en el sistema nervioso). Tras la entrada en la clula, el virus avanza por transporte retrgrado y llega al ncleo, penetrando por los poros nucleares. Despus de entrar en el ncleo se expresan los genes inmediatos tempranos, que activan la expresin de los genes tempranos (necesarios para la sntesis de ADN viral) y de los genes tardos (protenas estructurales). Una caracterstica importante es que uno de los genes inmediatos tempranos (ICP4) es absolutamente necesario para la replicacin viral, por lo que basta eliminarlo del genoma para obtener virus defectivos. En los vectores actualmente en uso se han delecionado todos los genes inmediatos tempranos, por lo que son totalmente apatognicos. Otra caracterstica importante de estos virus es que cuando no se replican entran en un periodo de latencia en el que se transcriben nicamente unos transcritos asociados a latencia (LATs), aunque no se expresen los genes inmediatos tempranos. Por tanto, incluyendo la unidad transcripcional en la regin de latencia se pueden obtener virus defectivos que expresan de forma persistente un gen teraputico. Adems, se trata de vectores de gran capacidad porque permiten acomodar hasta 50 kb de ADN exgeno.
ITR rep cap ITR

267

Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica

rep78 p5 rep68 rep52 p19 rep40

p40

VP1 VP2 VP3

En la Figura 19.6 se muestra la estructura del genoma de virus adenoasociados (AAV) y herpes (HSV), as como el ciclo replicativo del AAV.

www.FreeLibros.me

268

2.

Los Vectores no-virales representan un intento de imitar las funciones de los virus como vehculos de transferencia gnica mediante sistemas sintticos, de forma que en principio son vectores mucho ms seguros desde el punto de vista de su peligrosidad biolgica y su patogenicidad. En este sentido, los vectores no-virales no se diferencian conceptualmente de los frmacos a los que estamos habituados. La principal limitacin de este tipo de vectores es que, en la actualidad, su eficacia in vivo es mucho menor que la de los vectores virales. Esto se debe a la inestabilidad propia de sistemas sintticos complejos y a las diferentes barreras que han de superar:

Terapia gnica
a)

Los complejos entre el cido nucleico y los dems componentes de estos sistemas han de ser estables tras su administracin, y no desintegrarse antes de alcanzar las clulas. Por otra parte, la biodistribucin de estos preparados hace que la concentracin efectiva en las clulas diana sea baja, por lo que es importante que lleven en su superficie algn tipo de ligando para receptores especficos de las clulas a las que lo queremos enviar. Habitualmente, estos complejos entran en las clulas por endocitosis, de manera que quedan expuestos al ataque de las enzimas lisosomales. Para evitar esto, se intenta incluir en estos vectores algn tipo de molcula que altere el pH del endosoma y consiga romperlo antes de su fusin con los lisosomas y liberar as el complejo intacto al citoplasma. Estas molculas suelen ser pptidos o protenas virales que cumplen esta misma funcin en algunos tipos de virus. Una vez en el citoplasma, estos complejos han de ser lo suficientemente estables como para llegar hasta el ncleo, pues si el cido nucleico se libera muy pronto ser degradado por nucleasas citoplasmticas. Pero si son demasiado estables, el cido nucleico no conseguir liberarse y por tanto no podr entrar en el ncleo de la clula. Este compromiso entre proteccin y liberacin es quizs uno de los retos ms importantes que tienen que superar los vectores no virales para aumentar su eficacia actual. En cierta medida, la inclusin en estos complejos de alguna molcula capaz de dirigirlos al ncleo celular servira para acelerar su trnsito citoplasmtico. Por tanto, otro componente habitual en los vectores no virales son las molculas con seales de localizacin nuclear que adems permitan la entrada del cido nucleico a travs del complejo del poro nuclear, pues de lo contrario slo sern efectivos en clulas que estn en mitosis.

Como se ve, la tarea de construir un vector no-viral ideal equivale a intentar reconstruir en el laboratorio lo que los virus consiguen de manera natural, lo cual no es en absoluto sencillo. En cualquier caso, son uno de los campos de investigacin ms activa, sobre todo por parte de empresas farmacuticas y de biotecnologa, y es previsible que los prximos aos vean avances significativos en este terreno. Actualmente, los vectores no-virales ms utilizados son los siguientes: Inyeccin Directa. Lgicamente, lo ms sencillo es injectar directamente el cido nucleico (ADN desnudo) en el rgano de inters. Aunque poco eficaz,

www.FreeLibros.me

b)

este procedimiento funciona razonablemente en ciertas aplicaciones y en algunos rganos. Por ejemplo, el msculo esqueltico es uno de los rganos que ms eficazmente incorporan un plsmido inyectado, alcanzando niveles de expresin suficientes para conseguir inmunizacin frente a protenas virales, tumorales, etc. En ocasiones se utiliza la inyeccin de ADN formulado con diversos polmeros (sobre todo poli-vinil-pirrolidona) que lo protegen de la accin de las nucleasas y prolongan su vida media tras la administracin. Tambin se utiliza el ADN encapsulado en microesferas de polmeros biodegradables (por ejemplo, copolmeros de cido lctico y gliclico), que pueden inyectarse en un rgano y proporcionar liberacin sostenida del cido nucleico teraputico durante un periodo de tiempo ms o menos prolongado, dependiendo del tipo de polmero utilizado. Otra variedad es la transferencia gnica balstica (pistola gnica o gene gun), en la que el cido nucleico teraputico se adsorbe sobre la superficie de una bolas microscpicas de oro u otro metal inerte, que son disparadas a presin sobre el rgano diana. Es una va de administracin utilizada en la piel (para inmunizacin gnica) o a veces sobre otros rganos, pero las bolas no tienen un gran poder de penetracin (raramente superior a unos pocos milmetros). Complejos formados por el cido nucleico teraputico y otros componentes. Son los sistemas ms complicados de elaborar y optimizar, pero los ms eficaces dentro de los vectores no-virales. El principio que subyace a todos los sistemas de este tipo es la complejacin del ADN (molcula grande con alto nmero de cargas negativas) con polmeros de naturaleza catinica (con cargas positivas), de manera que la neutralizacin de cargas da lugar a complejos ms o menos estables, de pequeo tamao, en los que el ADN est protegido de la accin de nucleasas. Suele distinguirse entre lipoplexos (cuando el ADN se compleja con lpidos catinicos) y poliplexos (ADN complejado por policationes, habitualmente poli-lisina o poli-etiln-imina). Sobre la estructura bsica de un lipoplexo o un poliplexo pueden aadirse otro tipo de molculas que acten como estabilizadores, ligandos para receptores especficos, molculas desestabilizadoras del endosoma, seales de localizacin nuclear. Por ejemplo, se ha utilizado poli-etiln-glicol para aumentar la estabilidad de lipoplexos en el torrente sanguneo y evitar la inactivacin por el suero. Asimismo, ha sido muy utilizada la unin de poli-lisina a transferrina o a orosomucoide, para conseguir unin especfica a receptores hepticos. Otra estrategia utilizada con bastante xito ha sido la formacin de lipoplexos que adems incluyen partculas del virus hemaglutinante del Japn (virus Sendai) inactivados, lo que proporciona una entrada en las clulas muy eficaz (por la fusogenicidad del virus Sendai) y buen escape endosomal.

269

Tipos de vectores y su utilizacin en distintas estrategias de transferencia gnica

En la Figura 19.7 se muestran algunos ejemplos de vectores no virales.

La siguiente tabla resume las principales caractersticas de los vectores que se han mencionado:

www.FreeLibros.me

270
Tamao mximo terico Ttulos alcanzados durante la preparacin (partculas/ml) Administracin preferente Integracin en el genoma Duracin expresin in vivo Inmunogenicidad Inmunidad previa Problemas de seguridad

Retrovirus 7-8 kb 108/ml Ex vivo S Corta Poca Improbable Mutagnesis

Adenovirus 7-8 kb (30 kb) 1012/ml Ex/in vivo No Corta Mucha S Inflamacin Toxicidad

AAV 5 kb 1011/ml Ex/in vivo S/No Larga Poca S Mutagnesis

No virales No lmite No lmite Ex/in vivo Mnima Corta Nada No Ninguno

Terapia gnica

Como resumen de todo lo dicho acerca de vectores, podemos concluir diciendo que el vector ideal de terapia gnica debera ser fcil de preparar, tener gran capacidad para aceptar genes teraputicos de gran tamao, funcionar tanto en clulas en divisin como en clulas quiescentes, ser totalmente inocuo e invisible para el sistema inmune, fcilmente dirigible a distintos tipos de clulas diana, ser capaz de persistir en las clulas durante periodos prolongados y poseer elementos reguladores de la transcripcin del gen teraputico que sean fcilmente regulables para poder variar los niveles del producto teraputico segn sea necesario. Hay numerosos ejemplos de cmo se han conseguido mejorar los distintos tipos de vectores para dotarlos con alguna de estas propiedades. Por ejemplo, los retrovirus se han podido pseudotipar con las protenas de la envuelta del virus de la estomatitis vesicular para modificar su tropismo. Igualmente, se ha modificado la protena botn de la fibra de los adenovirus mediante anticuerpos bi-especficos o por modificacin gentica. Los vectores no virales se han glicosilado para ser selectivamente reconocidos por receptores especficos presentes en distintos tipos celulares. Tambin se han construido sistemas de transcripcin regulables muy efectivos, que se pueden incorporar en los distintos tipos de vectores.

19.4 Aplicaciones clnicas de la terapia gnica 19.4 en el momento actual


Desde el caso de la nia Ashanti Da Silva, primer paciente de la historia tratado mediante terapia gnica en 1989 por sufrir Inmunodeficiencia Combinada Severa (dficit del enzima adenosn-desaminasa), el nmero de ensayos clnicos llevados a cabo en todo el mundo ha aumentado rpidamente, de manera que en la actualidad hay varios miles de enfermos incluidos en protocolos clnicos de terapia gnica. Como las estrategias utilizadas son variadsimas, a continuacin se resumen las ms utilizadas hasta el momento:

www.FreeLibros.me

Terapia gnica del cncer: la estrategia ms utilizada es, sin duda, la utilizacin de los llamados genes suicidas. Se trata de transferir a las clulas tumorales un gen que codifique una protena capaz de activar un pro-frmaco inactivo a su forma activa. Es muy popular la utilizacin del gen de la timidn-kinasa del virus del Herpes Simplex (HSV-tk), que codifica una timidn-kinasa capaz de fosforilar el ganciclovir a ganciclovir-trifosfato. El ganciclovir tri-fosfato es la forma activa capaz de interferir con la replicacin del ADN y provocar la muerte de las clulas que estn dividindose activamente. Por tanto, si somos capaces de transferir el gen de la HSV-tk a las clulas de un tumor, que tienen una alta tasa replicativa, la administracin sistmica de ganciclovir conseguir matar selectivamente las clulas tumorales. Una ventaja aadida es el llamado efecto espectador (bystander), mediante el cual la timidn-kinasa producida en unas clulas puede pasar a las clulas vecinas, de forma que aunque no todas las clulas tumorales hayan incorporado el gen teraputico, el efecto citotxico es bastante homogneo en todo el tumor. Esta estrategia se ha empleado en tumores cerebrales, usando vectores retrovirales para transducir slo clulas tumorales (en divisin) pero no neuronas (que no se dividen). Tambin se ha empleado con xito en tumores hepticos, usando en este caso vectores adenovirales. Otra estrategia utilizada en terapia gnica del cncer se basa en la suplementacin de las clulas malignas con genes supresores tumorales (p53, por ejemplo). Se ha utilizado tambin la transferencia al tumor de genes que inhiben la angiognesis (endostatina, angiostatina, etc.) para eliminar el tumor por falta de aporte vascular. Por ltimo, una de las estrategias que han tenido ms xito y que ofrecen mejores perspectivas de futuro es la inmunopotenciacin, es decir, favorecer la puesta en marcha de una respuesta inmune frente a las clulas tumorales. En este sentido, se han transferido los genes de gran variedad de citoquinas o molculas inmunopotenciadoras (IL-2, IL-12, GM-CSF, IFN-, TNF, etc.) tanto a clulas tumorales como a clulas presentadoras de antgeno (clulas dendrticas), o bien se han transferido a las clulas tumorales los genes de molculas co-estimuladoreas del complejo mayor de histocompatibildad (por ejemplo, B7.1) para favorecer la presentacin de los antgenos tumorales.
El vdeo de la Figura 19.8 muestra algunos ejemplos de utilizacin de terapia gnica frente al cncer.

271

Aplicaciones clnicas de la terapia gnica en el momento actual

Terapia gnica de enfermedades hereditarias: la mayora de las enfermedades metablicas debidas a mutaciones inactivantes en genes que codifican protenas con actividad biolgica (un enzima, un factor de coagulacin, una hormona, etc.) pueden abordarse mediante una estrategia de suplementacin gnica que restaure los niveles de la protena deficiente. Por ejemplo, se ha utilizado la transferencia gnica al msculo para conseguir la produccin local de distrofina en casos de distrofia muscular de Duchenne. De manera similar, se han transferido genes al msculo o al hgado para que estos rganos secreten al torrente circulatorio un factor que est ausente. En este sentido, ha tenido especial resonancia el xito alcanzado con la transferencia mediada por virus adenoasociados del gen del factor IX de la coagulacin al msculo esqueltico, para producir niveles plasmticos de este factor que puedan corregir los defectos en la coagulacin que sufren animales hemoflicos.

www.FreeLibros.me

272

Inmunizacin frente a enfermedades infecciosas mediante transferencia gnica, con el fin de que las clulas sinteticen pptidos inmunognicos y estimulen al sistema inmune hasta eliminar el agente patgeno. Se estn ensayando inmunizaciones gnicas frente a virus (virus B y virus C de la hepatitis, virus de la gripe) u otros agentes, como el parsito de la malaria. Es bastante eficaz la injeccin directa de un plsmido en msculo o la transferencia intradrmica mediante pistola gnica. En general, la eficacia de estos tratamientos reside en la capacidad de producir localmente una protena que sea liberada y capturada por macrfagos y otras clulas presentadoras de antgenos, que procesan esas protenas a pequeos pptidos y los presentan con molculas de clase II del sistema mayor de histocompatibilidad (MHC) para estimular las clulas CD4+ (linfocitos T helper). Adems, si las clulas transfectadas expresan molculas de clase I del MHC tambin podrn presentar los pptidos recin sintetizados y estimular clulas CD8+ (linfocitos T citotxicos). Una de las asignaturas pendientes de la terapia gnica es la demostracin de su utilidad clnica en humanos. En enero de 2006, el nmero de ensayos clnicos que incluan transferencia de genes ascenda a 1 145 en todo el mundo. El 80 por ciento de estos estudios son ensayos clnicos en fase I (estudio de toxicidad) o fase I/II, el resto son ensayos en fase II (estudio de eficacia teraputica) o en fase III. Estos datos se resumen a continuacin: Ensayos clnicos en enero de 2006: 1 145 en total Distribuidos por el tipo de enfermedad: Cncer: 67 % Monognicas: 9% Marcaje: 4% Infecciosas: 7% Vasculares: 9% Distribuidos por el tipo de vector utilizado: Retrovirus: 24 % Lipofeccin: 8% Adenovirus: 25% DNA desnudo: 17% HSV: 3% Virus adenoasociados: 3% Distribuidos por el tipo de gen teraputico: Citoquinas: 26 % Antgenos: 15 % Genes suicidas: 7 % Protenas deficientes: 6 % Genes supresores tumorales: 12 % Genes antisentido y ribozimas: 1 % Receptores: 4 %

Terapia gnica

www.FreeLibros.me

CAPTULO 20

Bioinformtica del genoma humano

Contenidos
20.1 La Bioinformtica 20.2 Bases de datos en Gentica Humana: bases de datos de secuencias 20.3 Bases de datos en Gentica Humana: bases de datos relacionadas con enfermedades 20.4 Bsquedas en bases de datos con BLAST 20.5 Navegadores del genoma humano

20.1 La Bioinformtica
Tradicionalmente, la investigacin en Biologa Molecular se ha realizado en el laboratorio experimental, pero la inmensa cantidad de datos generados en los ltimos aos ha propiciado el desarrollo de herramientas computacionales para extraer, organizar y analizar toda la informacin contenida en esos datos y as poder generar nuevo conocimiento. Por eso, hoy en da es difcil entender la investigacin en biologa sin la utilizacin de herramientas informticas ms o menos sofisticadas. La Bioinformtica es la disciplina cientfica que combina biologa, computacin y tecnologas de la informacin. El objetivo de esta disciplina es facilitar nuevas percepciones biolgicas y crear una perspectiva global que permita identificar los principios unificadores de la biologa. Inicialmente, la Bioinformtica se ocupaba sobre todo de la creacin de bases de datos de informacin biolgica, especialmente secuencias de nucletidos y de protenas, y del desarrollo de herramientas para la utilizacin y anlisis de los datos contenidos en esas bases de datos. Sin embargo, cada vez es ms claro que ser necesario unificar toda esta informacin si queremos alcanzar un cuadro completo de la biologa de la clula, de forma que los investigadores puedan comprender cmo se alteran estos procesos en las distintas enfermedades. Por eso, la Bioinformtica ha ido evo-

www.FreeLibros.me

274

lucionando para ocuparse cada vez con mayor profundidad del anlisis e interpetacin de los distintos tipos de datos que se generan hoy en da (secuencias de genomas, proteomas, orfeomas, dominios y estructuras de protenas, etc.). Estas formas de anlisis e interpretacin de datos suelen denominarse Biologa Computacional. Las principales reas de la Bioinformtica y de la Biologa Computacional son, por tanto, 1) el desarrollo de herramientas que permitan el acceso, uso y actualizacin de distintos tipos de informacin biolgica; 2) el desarrollo de nuevos algoritmos y soluciones estadsticas para analizar grandes conjuntos de datos y resolver problemas biolgicos complejos, tales como predecir la estructura de un gen en una secuencia genmica, predecir la estructura de protenas, identificar familias de protenas a partir de sus secuencias, etc. En este captulo nos centraremos nicamente en algunas herramientas necesarias para explorar el genoma humano desde el punto de vista biomdico, pero es importante tener en cuenta que existen muchas otras reas de la Bioinformtica que no se tocarn aqu.
La Figura 20.1 enlaza con algunos recursos educativos en Bioinformtica.

Bioinformtica del genoma humano

20.2 Bases de datos en Gentica Humana: bases de datos 20.2 de secuencias


Las bases de datos biolgicas son archivos de datos almacenados de modo eficaz y uniforme. Los datos provienen de las distintas reas de la Biologa Molecular. Las bases de dados primarias contienen secuencias de ADN y de protenas, estructuras de protenas o perfiles de expresin de genes y protenas. Cada registro de estas bases de datos contiene una secuencia y su correpondiente anotacin (comentarios que incluyen informacin acerca de esa secuencia, habitualmente hechos de modo manual por algn investigador). Las bases de datos secundarias archivan los datos que son fruto del anlisis de las bases de datos primarias; por ejemplo, son bases de datos secundarias las que contienen familias de protenas, motivos o dominios proteicos, familias de genes, etc. Un aspecto crucial en las Bases de Datos es la necesidad de un interfaz que permita interrogar cada base de datos (o, mejor incluso, todas a la vez) de un modo intuitivo y sencillo, de manera que el investigador pueda obtener una imagen global y completa del proceso biolgico que se propone estudiar. Las dos herramientas principales de bsqueda que estn disponibles hoy en da son SRS (Sequence Retrieval System) para las bases de datos mantenidas en Europa por el Instituto Europeo de Bioinformtica (EBI, European Bioinformatics Institute en Hinxton, Reino Unido) y Entrez para las bases de datos mantenidas por el Centro Nacional para la Informacin en Biotecnologa de los Estados Unidos (NCBI, National Center for Biotechnology Information en Bethesda, Estados Unidos). En general, estos interfaces permiten extraer informacin mediante bsquedas por texto, ya que nos ofrecen una pgina de bsqueda donde introducimos la expresin que queremos buscar y obtenemos todos los registros que contienen esa expresin en alguno de sus campos. Este tipo de bsqueda es rpido y potente, ya que nos permite obtener gran cantidad de informacin (secuencias, descripciones, etc.) sobre una entidad concreta.

www.FreeLibros.me

Las tres principales bases de datos primarias de secuencias de nucletidos son EMBL-Bank (en el EBI), DDBJ (en el CIB de Mishima, Japn) y GenBank (en el NCBI). Desde hace unos aos, estas bases de datos firmaron un convenio de colaboracin por el que constituyeron el INSDC (International Nucleotide Sequence Database Collaboration), de modo que se sincronizan entre ellas cada 24 horas y contienen exactamente la misma informacin. Adems, son accesibles gratuitamente por Internet, y contienen todas las secuencias de nucletidos que son de dominio pblico. En febrero de 2006 estas bases de datos contenan unos 54 millones de registros, con unos 60 000 millones de nucletidos en total, y su crecimiento en los ltimos aos ha sido exponencial. Estn divididas en varias secciones que reflejan grupos taxonmicos, adems de otros grupos no taxonmicos como por ejemplo las secuencias protegidas por patente. En estas bases de datos prima la cantidad sobre la calidad, en el sentido de que contienen todo lo que los investigadores depositan en ellas, y por tanto son bastante heterogneas en cuanto al tipo de secuencias, su calidad, su anotacin, etc. Por este motivo son tambin redundantes, ya que la misma secuencia puede encontrarse repetida en distintos registros procedentes de distintos autores. Cada entrada en estas bases de datos es un registro que debe tener un identificador nico, formado por letras y/o nmeros, conocido como nmero de acceso (accession number), que es estable (nunca cambiar en sucesivas versiones de ese registro). Por tanto, otro cdigo indicar las sucesivas versiones de cada nmero de acceso, por lo que es importante conocer ambos. En febrero de 1999, el consorcio GenBank/Embl/DDBJ acord un formato de versin consistente en el nmero de acceso seguido de un punto y un nmero. Adems, GenBank incluye el indicador GI.
La Figura 20.2 incluye algunos tutoriales para ilustrar el uso de Entrez y de SRS.

275

Bases de datos en Gentica Humana: bases de datos de secuencias

Entrez Gene es otra base de datos del NCBI, que podramos calificar de secundaria ya que contiene infromacin derivada de GenBank. Se trata de una base de datos centrada en genes, ms que en secuencias, y por eso rene todas las secuencias (adems de informacin de otro tipo) sobre un gen concreto, en todos los genomas en los que existen secuencias correspondientes a dicho gen. De hecho, Entrez Gene es un interfaz nico con gran cantidad de informacin descriptiva sobre loci genticos (nomenclatura, nombres alternativos, nmeros de acceso de las secuencias, informacin sobre la posicin y enlaces a otros recursos). Entrez Gene se basa en un tipo especial de secuencias llamadas RefSeq, generadas por el propio NCBI a partir de secuencias contenidas en GenBank. RefSeq pretende ser una coleccin integrada, completa y no redundante de secuencias de ADN genmico, ARN y protenas, para los principales organismos. El NCBI genera secuencias RefSeq para ms de 1 100 virus y 150 bacterias adems de organismos superiores (humano, ratn, rata, zebrafish, etc.). Las principales caractersticas de la coleccin RefSeq son la no-redundancia, la conexin entre secuencias nucleotdicas y sus correspondientes secuencias proteicas, un formato constante, nmeros de acceso especficos y mantenimiento (curation en ingls) a cargo del personal del NCBI y colaboradores externos. Los nmeros de acceso de RefSeq tienen el formato: XX_123456 (dos letras, guin bajo y seis nmeros). Las dos letras iniciales indican el tipo de secuencia. Por ejemplo, en el caso de secuencias que han sido revisadas manualmente podemos encontrar nmeros de acceso de estos tipos:

www.FreeLibros.me

276

NC_123456 NG_123456 NM_123456 NR_123456 NP_123456

Molculas genmicas completas (genomas, cromosomas, plsmidos) Regin genmica incompleta ARN mensajero ARN no codificante (ribosomal, pseudogenes, etc.) Protena (en futuras versiones se aadirn dos nmeros ms)

Bioinformtica del genoma humano

En el caso de secuencias que todava no han sido revisadas por el personal del NCBI, los nmeros de acceso pueden ser: NT_123456 NW_123456 XM_123456 XR_123456 XP_123456 Secuencias de clones usados para ensamblar genomas (BACs) Ensamblajes parciales de genomas (shotgun) ARN mensajero deducido de las anotaciones del ADN genmico ARN no codificante deducido de las anotaciones Protenas deducidas de las anotaciones del ADN genmico

La Figura 20.3 ilustra el uso de Entrez Gene para obtener informacin y secuencias de referencia de genes completos.

20.3 Bases de datos en Gentica Humana: bases de datos 20.3 relacionadas con enfermedades
Adems de las bases de datos de secuencias, existen tambin muchos recursos de inters en Biomedicina, entre los que destacan las bases de datos relacionadas con enfermedades. A continuacin se describen las tres que pueden ser de ms utilidad al estudiante o profesional de una disciplina biomdica, para encontrar informacin sobre enfermedades genticas y las mutaciones que las causan, descripcin clnica, grupos de apoyo, etc. Online Mendelian Inheritance in Man (OMIM) es un catlogo de genes y enfermedades genticas humanas, centrado especialmente en enfermedades hereditarias. OMIM se basa en el texto escrito por Victor A. McKusick llamado Mendelian Inheritance in Man, cuya ltima edicin es de 1998. Cada entrada en OMIM est caracterizada por un nmero de acceso que consiste en un nmero de seis dgitos; el primer dgito es indicativo del modo de herencia de ese rasgo o gen. As, los nmeros OMIM que comienzan por 1, 2 6 indican loci o fenotipos de herencia autosmica, los que empiezan por 3 indican loci o fenotipos de herencia ligada al cromosoma X, los que empiezan por 4 indican herencia ligada al cromosoma Y y los que empiezan por 5 indican herencia mitocondrial. Adems, las variantes allicas se designan por el nmero OMIM seguido por un punto y un nmero de cuatro dgitos. Cada nmero de acceso suele ir precedido por un smbolo, que nos indica algo ms acerca de ese locus o fenotipo. As, un asterisco (*) indica que se trata de un gen cuya secuencia es conocida; almohadilla (#) indica que es la descripcin de un fenotipo, y no representa necesariamente un nico locus; el smbolo ms (+) indica que se trata de la descripcin de un fenotipo y de un gen de secuencia conocida; el tanto por cien (%) indica que se trata de un fenotipo o locus con herencia mendeliana comprobada, del que se desconoce la base molecular. Cuando no hay ningn smbolo, quiere decir que esa entrada no tiene una base mendeliana confirmada, o bien que su diferenciacin de otra entrada en la base de datos no est clara. En ocasiones en-

www.FreeLibros.me

contraremos un acento circunflejo (^) para indicar que una entrada ha sido eliminada de la base de datos. GeneClinics y GeneTests son una base de datos estadounidense de enfermedades genticas, dirigida a enfermos y personal sanitario, cuyo fin es proporcionar informacin sobre anlisis genticos y su uso en el diagnstico, tratamiento y consejo gentico. Contiene un listado de laboratorios de Estados Unidos y del resto del mundo donde se realizan pruebas genticas diagnsticas y de investigacin. Adems, tiene un listado de centros donde se realiza consejo gentico, una serie de revisiones hechas por expertos sobre algunas de las enfermedades genticas ms frecuentes, y materiales educativos como un glosario ilustrado de trminos genticos, presentaciones, etc. El equivalente europeo es EDDNAL (European Directory of DNA Laboratories), que contiene informacin sobre laboratorios de Europa que llevan a cabo pruebas moleculares diagnsticas para enfermedades genticas; sin embargo, no contiene una descripcin de las enfermedades ni ofrece apoyo a enfermos y sus familias. Finalmente, otro tipo de bases de datos de gran importancia en Gentica Humana son las que renen mutaciones que causan enfermedades. Aunque existen muchas bases de datos para genes o enfermedades concretas, Human Gene Mutation Database (HGMD) intenta recopilar todas las mutaciones publicadas que causan enfermedades hereditarias humanas (no incluye, por tanto, mutaciones somticas ni mutaciones del genoma mitocondrial). Desde 1999, HGMD tambin incluye polimorfismos asociados con enfermedades humanas, extrados de la literatura cientfica. Estos polimorfismos slo se incluyen si su relacin con la enfermedad est demostrada de un modo convincente.
En la Figura 20.4 se pueden encontrar enlaces a OMIM, Geneclinics, EDDNAL y HGMD.

277

Bsquedas en bases de datos con BLAST

20.4 Bsquedas en bases de datos con BLAST


En las bases de datos que contienen secuencias, adems de hacer bsquedas por texto tambin es posible interrogar directamente la base de datos con una secuencia concreta, con el fin de extraer todas las secuencias parecidas o idnticas que estn en la base de datos. De esta forma, es posible conocer la identidad de una secuencia annima, bien porque ya est depositada en la base de datos (indicando a qu corresponde) o bien por su alto grado de similitud con otras secuencias conocidas. Para hacer este tipo de bsquedas, es necesario comparar directamente nuestra secuencia pregunta (query) con cada una de las secuencias de la base de datos, y extraer nicamente las que superen un cierto grado de parecido. Lgicamente, si buscamos en todo GenBank, por ejemplo, hemos de comparar nuestra secuencia con varios millones de secuencias, lo que podra llevar un tiempo excesivo. Por suerte, disponemos de herramientas bioinformticas que realizan alineamientos de secuencias de modo rpido y eficaz, por lo que una bsqueda tpica en GenBank se completa en cuestin de segundos. Aunque no podemos entrar aqu en una descripcin detallada de cmo funcionan los algoritmos para alineamientos de secuencias, es importante describir con cierto detalle el ms utilizado hoy en da para bsquedas en bases de datos, que se llama BLAST (siglas en ingls de Basic Local Alignment Search Tool). BLAST compara secuencias de modo apareado (pairwise), es decir, de dos en dos, y cada compara-

www.FreeLibros.me

278

cin da como resultado una puntuacin (score) que es mayor cuanto mayor es el parecido entre las secuencias que se comparan. El algoritmo permite una implementacin en programas informticos de ejecucin rpida y al mismo tiempo con alta sensibilidad, que se realiza en varios pasos. En primer lugar, el programa rompe nuestra secuencia pregunta (query) en pequeos fragmentos llamados palabras (words) y busca todas las palabras de la base de datos que se parezcan a cada una de las palabras de nuestra secuencia. Una vez que encuentra alineamientos entre palabras que superan una puntuacin inicial determinada que viene definida por el parmetro T, el programa extiende esos alineamientos iniciales en ambas direcciones hasta generar un alineamiento. La rapidez y sensibilidad de la bsqueda viene determinada por el parmetro T, mientras que W (el tamao de palabra) puede ser modificado dependiendo del tipo de secuencias que estemos manejando. Al final, los posibles alineamientos se ordenan en funcin de la puntuacin (score) final. Es importante comprender que la puntuacin de un alineamiento se obtiene utilizando matrices de substitucin, que permiten asignar una puntuacin a cada posicin del alineamiento. Inicialmente, las matrices se desarrollaron para los alineamientos entre secuencias de protenas, en las que se puede calcular la probabilidad de que un aminocido concreto (en una de las secuencias) est substituido por otro aminocido (en la otra secuencia). Las primeras matrices utilizadas fueron las matrices PAM, creadas por Margaret Dayhoff, y estn basadas en alineamientos mltiples para determinar la frecuencia con la que se producen sustituciones de unos aminocidos por otros. Examinando alineamientos globales de secuencias muy relacionadas y la frecuencia de las distintas sustituciones, Dayhoff construy las matrices PAM (Point Accepted Mutation), matrices de probabilidad para cada sustitucin dada una distancia evolutiva concreta. De hecho, 1 PAM representa la matriz de sustituciones para una distancia evolutiva tal que han cambiado el uno por ciento de los aminocidos. La matriz PAM ms utilizada es la PAM250, que corresponde a una distancia evolutiva tal que ha cambiado el 80 por ciento de los aminocidos (aunque la mutabilidad vara para cada aminocido dentro de una misma matriz). Por tanto, PAM250 es til para alinear secuencias cuando no sabemos si son homlogas. Si la similitud entre las secuencias que queremos alinear es alta, deberemos utilizar otras matrices (habitualmente PAM30). Steven y Jorja Henikoff construyeron despus otro tipo de matrices, llamadas matrices BLOSUM (Blocks Substitution Matrix), usando alineamientos locales mltiples de secuencias ms divergentes que en el caso de las matrices PAM. Agrupando las secuencias segn distintos umbrales de identidad de aminocidos obtuvieron distintas matrices: por ejemplo BLOSUM80 se deriv de los alineamientos que contenan un 80 por ciento de identidad. Por tanto, se utilizan matrices BLOSUM con valores bajos para secuencias ms divergentes (BLOSUM30) y matrices con valores altos (BLOSUM90) para secuencias muy similares. La ms utilizada es BLOSUM62. En cualquier caso, las matrices se utilizan para puntuar alineamientos de protenas, mientras que en alineamientos de secuencias de nucletidos se utilizan matrices de sustitucin unitarias en las que los nicos parmetros importantes son la puntuacin que se le asigna a un emparejamiento y la penalizacin que se asignan a los desemparejamientos y a los huecos.
La Figura 20.5 muestra las dos matrices de sustitucin ms utilizadas para calcular la puntuacin de alineamientos de secuencias.

Bioinformtica del genoma humano

www.FreeLibros.me

Para comparar la calidad de cada alineamiento, BLAST calcula la probabilidad de encontrar un alineamiento con esa misma puntuacin en esa base de datos simplemente por azar, y a esa probabilidad le llama valor E (expectation), que es el parmetro que mejor describe la significacin de los alineamientos hallados por el programa. En cualquier caso, todo alineamiento debe ser revisado para comprobar que efectivamente tiene relevancia biolgica, ya que pequeas regiones de baja complejidad, elementos repetidos, etc., suelen dar puntuaciones altas y significativas y confundir el alineamiento verdadero entre dos secuencias. Por esto, es importante utilizar los filtros que incluye el programa, para eliminar regiones de poco inters biolgico que puedan interferir en la interpretacin de los resultados. BLAST se ofrece como varios programas distintos, dependiendo del tipo de secuencias que se comparan; blastn para dos secuencias de nucletidos, blastp para dos secuencias de protenas, blastx para comparar una secuencia de nucletidos (traducida) con una base de datos de protenas, tblastn para comparar una secuencia de protenas con una base de datos de nucletidos (traducida), y tbalstx para comparar una secuencia de nucletidos (traducida) con una base de datos de nucletidos (traducida).
La Figura 20.6 incluye enlaces a algunos tutoriales para aprender los fundamentos de la utilizacin de BLAST.

279

Navegadores del genoma humano

20.5 Navegadores del genoma humano


Con la publicacin del primer borrador de la secuencia completa del genoma humano en 2003, se desarrollaron varias herramientas informticas para poder visualizar de modo grfico la secuencia y todas las anotaciones hechas por distintos investigadores (por anotacin se entiende cualquier elemento que se sita sobre la secuencia, en una posicin concreta: genes, ARNm, SNP, los clones utilizados para la secuenciacin, repeticiones, etc.). Las tres herramientas que acabaron por imponerse, por ser las de mayor envergadura y facilidad de uso, fueron ENSEMBL, creada por el EBI y el Instituto Sanger de Hinxton (Reino Unido), el Genome Browser de la Universidad de California en Santa Cruz (Estados Unidos) y el Map Viewer del NCBI (Estados Unidos). Inicialmente, cada uno de estos sitios desarrollaba su propio ensamblaje del genoma humano a partir de los fragmentos depositados en GenBank, y despus aadan todas las anotaciones sobre dicho ensamblaje. Regularmente, cada tres o seis meses, se hacan nuevos ensamblajes incorporando las nuevas secuencias depositadas en GenBank, pero a partir de un momento dado el ensamblaje pas a ser realizado nicamente por el NCBI. En el momento de escribir este texto, el ensamblaje utilizado es el llamado Build 36 del NCBI, correspondiente a la secuencia ya terminada, y realizado en noviembre de 2005. Genome Browser y ENSEMBL utilizan este mismo ensamblaje para realizar sus propias anotaciones y hacerlas de dominio pblico en sus respectivos sitios web. ENSEMBL y Genome Browser son, por tanto, similares en su concepcin y en su estructura, pero muy distintos en su apariencia y en algunas de las anotaciones que ofrecen. En ambos casos, todas las anotaciones estn almacenadas como entradas de una base de datos relacional, que es interrogada utilizando formularios en pginas web y que dispone la informacin en modo grfico con elementos interactivos. Algunos aspectos importantes, como la prediccin de genes y su estructura (exones,

www.FreeLibros.me

280

transcritos alternativos, etc.) son elaborados siguiendo procesos distintos: por ejemplo, Genome Browser muestra Known Genes (genes conocidos), basados en el alineamiento de todas las protenas contenidas en Uniprot y de todos los ARNm de RefSeq sobre la secuencia genmica; ENSEMBL, por el contrario, genera sus propios genes utilizando un proceso similar pero totalmente automtico. Otras anotaciones son idnticas, ya que ambos sistemas usan el mismo procedimiento. Por ejemplo, para anotar los elementos repetidos tanto ENSEMBL como Genome Browser utilizan un programa llamado Repeatmasker, que detecta todas las repeticiones conocidas que estn contenidas en una base de datos especfica llamada Repbase. Cada uno de los sitios tiene tambin una herramienta de bsqueda rpida que realiza el alineamiento de una secuencia pregunta sobre la secuencia del genoma. Ambos navegadores permiten ver a la vez el genoma de otras especies, y contienen infinidad de anotaciones y enlaces con otras bases de datos y con los registros originales de GenBank. Todo estudiante o profesional que necesite explorar el genoma humano y los elementos que contiene debera aprender a manejar con soltura estas herramientas.
En la Figura 20.7 se incluyen tutoriales para utilizar navegadores del genoma humano.

Bioinformtica del genoma humano

www.FreeLibros.me

281

ndice analtico

ndice analtico
aislador, 73, 216 albinismo, 124 alelismo mltiple, 121 alelo, 81, 97, 119, 120 letal, 123 silvestre, 119 idntico por descendencia, 148, 157 alfa-1 antitripsina, 213 alfa-talasemia, 195 algoritmos, 274 Alu, 63 amniocentesis, 253 amplificaciones gnicas, 213 anafase, 24 anagnesis, 169 andamio, 18 androgenonte, 215 aneuploidas, 181 aneusomas segmentarias, 181, 186 Angelman aniridia, 212, 223 anotacin, 274, 279 antennapedia, 223 anticipacin, 200, 204 anticodn, 14 antiparalelas, 4 apolipoprotena ApoB48, 10 apolipoprotena B, 260

chips de ADN, 47 45,X, 180 8-oxoguanina, 84 aborto eugnico, 253 acntrico, 186 acetilacin, 72, 76 acondroplasia, 225, 228, 240 acrocntricos, 187 activadores adaptacin, 161 adenovirus, 263 gutless, 265 ADN, 1 codificante, 58, 190 desnudo, 268 extragnico, 58 glicosilasas, 84 forma B, 5 mitocondrial, 89, 248 repetitivo, 59, 62 ribosomal, 62, 179 satlite, 63, 179 ADNc, 34, 44, 47 ADNmt, 67 ADN-PK, 88 agentes alquilantes, 84 agut, 123, 126

www.FreeLibros.me

282

apoptosis, 66 rbol familiar, 238 rbol filogentico, 169 ARGONAUTA, 259 ARMS, 233 ARN, 1 mensajero, 5 ribosomal, 178 transferentes, 14 ARNm antisentido, 259 ARNnp, 12 Artemis, 88 ASO, 233 asociacin allica, 147, 149 ataxia de Friedreich, 204 espino-cerebelosa, 205 Atrofia Muscular Espinal, 194 Espino-Bulbar, 202 ayuste, 192, 204 (splicing), 10 alternativo, 12 BAC, 35, 54 bandas C, 69, 178 G, 177 Q, 177 R, 69, 178 bases de datos, 274 Bateson, 131 BER, 84, 89 bioinformtica, 58, 273 biopsia de vellosidades corinicas, 253 bithorax, 223 bivalente, 26, 27, 186, 187 BLAST, 277 BLOSUM, 278 brazo corto, 179 largo, 179 BRCA1, 87 BRCA2, 87 bromodominio, 73

bucle-D, 67 burbuja de replicacin, 20, 82 cadena gua, 20 retrasada, 20 caja CAAT, 6 GC, 6 TATA, 6 clculo de riesgos, 242, 245, 246, 250 caperuza, 9 carcinoma medular de tiroides familiar, 226 cariotipo, 177, 220 CBP, 73, 78, 202, 223 cebador, 20, 41, 42, 43, 45 cefalopolisindactilia, 223 clula empaquetadora, 262 centimorgans, 142 centro de imprinting, 218, 219 centrmeros, 23, 60, 63, 178 CFTR, 200, 240 CGH, 179 Charcot-Marie-Tooth, 208, 214 chi-cuadrado, 118, 149 ciclo celular, 18 cigoteno, 25 citogentica, 177 molecular, 40 citoquinesis, 18, 24, 27 cladognesis, 169 clamp-GC, 229 clonacin molecular, 33, 35 clonaje posicional, 141 C-MYC, 213 CNP, 62 cociente entre heterocigotos y homocigotos, 166 cdigo de Histonas, 73 gentico, 13, 68 co-dominancia, 120 codn de inicio, 13 terminacin, 8, 190

ndice analtico

www.FreeLibros.me

codones, 13 coeficiente de endogamia, 157 seleccin, 162 cohesinas, 23, 24, 28 colgeno, 214 colchicina, 178 Collins, 174 complejo basal de iniciacin, 8 condensinas, 19 consanguinidad, 242, 246 consejo gentico, 221, 237, 246, 252, 277 contigs, 55 conversin gnica, 30, 206 corpsculo de Barr, 111 csmidos, 35 CPEO, 251 creacionismo, 173 cremalleras de leucina, 222 cresta genital, 110 cromtide, 22, 23, 25, 26, 27, 178 hermanas, 206 cromatina, 17, 21, 23, 25, 69, 71, 79, 80, 103 cromodominio, 74 cromosoma, 23, 177, 180 submetacntrico, 179 X, 107, 111, 114 Y, 108, 115 cruce trihbrido, 101 cruzamiento preferencial, 156 prueba, 98 CTCF, 216 cuadrados de Punnett, 97, 239 cuartetos-G, 203 Darwin, 94, 129, 167 dedos de zinc, 222 delecin, 180, 186, 191, 206, 207, 219, 220, 250 deplecin del ADNmt, 250 depresin endogmica, 157 deriva gentica, 168 aleatoria, 158, 170

desemparejamiento, 82, 231 por deslizamiento de cadenas, 199 desequilibrio de ligamiento, 147, 150 desnaturalizacin, 43 DGGE, 229 DHPLC, 230 diagnstico, 227, 237, 252 directo, 228 gentico preimplantatorio, 254 indirecto, 235 prenatal, 252 diaquinesis, 27 dicntrico, 186 Dicer, 61, 259 dictioteno, 27 diferencial de seleccin, 136 diginia, 181 dihibridismo, 124 dihbridos, 99 dmeros de pirimidinas, 84 dinucletido CpG, 74, 190 diploteno, 26 diseo inteligente, 173 disgenesia gonadal, 182, 205 disoma uniparental, 217, 219, 220 dispermia, 181 Displasia campomlica, 212, 224 tanatofrica, 225 distrofia facio-escpulo-humeral, 207, 212 miotnica, 203, 204, 205 muscular de Becker, 244 muscular de Duchenne, 235, 243 muscular de Emery-Dreifuss, 208 disyuncin, 27 DNMT1, 75 Dobzhansky, 168 dominancia incompleta, 120, 131 dot-blot, 233 drosopterina, 125 DSB, 29, 86 duplicacin, 180, 206, 207 duplicaciones genmicas, 172 segmentarias, 60, 62, 206

283

ndice analtico

www.FreeLibros.me

284

EBI, 274 edicin del ARN, 10, 192 efecto de cuello de botella, 159 dominante-negativo, 211, 214, 225 fundador, 149, 159 umbral, 249 efectos de dosis, 120 posicin, 212 eficacia biolgica, 161 Ehlers-Danlos, 241 electroforesis, 40, 46, 229 electroporacin, 36 elementos ultraconservados, 61 elongacin, 8, 15 EMBL, 275 Endogamia, 157 enfermedad de Alzheimer, 192 Gaucher, 228 Hirschsprung, 226 enfermedades complejas, 133 multifactoriales, 133 por expansin de trinucletidos, 200 enfisema pulmonar, 213 ENSEMBL, 279 enzimas de restriccin, 35, 37 epigenticas, 71 epilepsia mioclnica progresiva, 204 epistasia, 125, 126 equilibrio de Hardy-Weinberg, 154, 158 polimrfico, 165 polimrfico estable, 164 puntuado, 171 error de muestreo, 158 especiacin, 169 aloptrica, 170 simptrica, 170 EST, 57 estenosis pilrica, 134 estructuras de Holliday, 30 eucromatina, 69, 178

euploidas, 181 evo-devo, 172 evolucin, 153, 167 exones, 10 expresin gnica, 5, 71 expresividad variable, 242 extensin, 43 extremos cohesivos, 38 romos, 38 F1, 96 F2, 96 factor C de la replicacin, 21 de crecimiento fibroblstico, 225 IX de la coagulacin, 200 factores de transcripcin, 6, 221 unitarios, 97, 103 fase de ligamiento, 144, 146, 236 fase S, 19 fenotipo Bombay, 125 Fibrosis del pncreas, 200, 240 FISH, 179, 220 fitohemaglutinina, 178 flujo gentico, 160 fluorocromo, 46 FMR1, 203 FMRP, 203 fosforilacin, 72 fraccin de recombinacin, 141 fragmentos de Okazaki, 21 frameshift, 191 frataxina, 204 frecuencia de recombinacin, 235 frecuencias allicas, 154, 159 genotpicas, 154 fusin cntrica, 187 no homloga de extremos, 86, 88 FXTAS, 245

ndice analtico

www.FreeLibros.me

gametocitos primarios, 25 gametognesis, 25, 26, 181, 184, 215, 217, 218 gametos, 27, 28 recombinantes, 140 ganancia de funcin, 201, 211 sentido, 191 gatas calico, 112 gemelos, 137 gmulas, 94, 129 gen hiposttico, 125 GenBank, 275 gene tracking, 235 genes, 97 constitutivos, 70, 75 homeobox, 172, 222, 223 HOX, 223 suicidas, 270 gentica clnica, 237 de poblaciones, 153, 168 genoma mitocondrial, 66 Genome Browser, 279 genoteca, 34 genotipos, 97 germoplasma, 102 Giemsa, 178 ginogenonte, 215 gnada primitiva, 110 grados de libertad, 119 gradualismo, 171 haploide, 22 haploinsuficiencia, 211, 213, 223, 224 haplotipo, 147, 151 HapMap, 61 Haseman y Elston, 149 HAT, 73 HDAC1, 73 HDAC2, 73 hebra antisentido, 6 codificante, 6 molde, 6 sentido, 6

Hedgehog, 222 helicasas, 20 hlice -lazo-hlice, 222 -vuelta-hlice, 222 hemicigosis, 108 hemicigotos, 166 Hemocromatosis Hereditaria, 149, 228 Hemofilia A, 208, 228 heredabilidad, 135, 136, 137 herencia autosmica, 239 cuasi-dominante, 242 ligada al X, 248 matrilineal, 249, 250 multifactorial, 133 polignica, 132, 133 herpesvirus, 266 HERV, 65 heterocromatina, 69, 111, 178, 260 heterodisoma, 219 heterodplex, 30, 229 heterogeneidad allica, 227 gentica, 227, 240 heteroplasmia, 249 hibridacin, 39, 43, 47, 179 Hipercolesterolemia familiar, 239 Hiperplasia Suprarrenal Congnita, 206 hiptesis 2R, 172 hiptesis de Lyon, 112 histonas, 18, 72, 73 historia familiar, 238 hnRNP, 194 holoprosencefalia, 222 homeodominio, 222, 223 homodplex, 229 homoplasmia, 249 horquillas de replicacin, 20 Huntington, 159, 201, 228 huso mittico, 23, 27 Ictiosis, 206 idnticos por descendencia, 148 imprinting, 215 impronta genmica, 77, 215

285

ndice analtico

www.FreeLibros.me

286

inactivacin del cromosoma X, 77, 243 ndice de heterocigosidad, 142 Inestabilidad de Microsatlites, 83 informatividad, 142 infradominancia, 165 Inmunodeficiencia Combinada Severa, 88, 270 inmunopotenciacin, 271 insercin, 180, 191 inserto, 34 interaccin gnica, 124 interfase, 18, 18 interferencia de ARN, 259 International System for Cytogenetics Nomenclature, 178 intrones, 10 inversin, 180, 185, 206, 208 islas CpG, 74 isocoro, 59 isocromosoma, 180, 183, 186 isodisoma, 219 isosquizmeros, 37 ITR, 264, 266 Johannsen, 130 Kimura, 171 Kozak, 14 KU70, 88 KU80, 88 labio leporino, 134 lastre gentico, 161 LCV, 62 lentivirus, 262, 263 leptoteno, 25 leucemia mieloide crnica, 213 ley de Ohno, 114 LHON, 251 ligamiento, 104, 109 gentico, 51, 139, 234 no paramtrico, 147 ligasa, 35 ligasas, 21 likelihood ratio, 145 LINE, 63, 113, 205

lnea germinal, 177 lipoplexos, 269 locus, 81, 105 LOD score, 144 LTR, 65, 261 Lyonizacin, 112 macroevolucin, 169 macroH2A, 113 mapa gentico, 140 mapas de ligamiento, 141 fsicos, 53 genticos, 51 marcadores, 52, 148, 235 genticos, 140 marco de lectura, 191 matrices de substitucin, 278 Mxima Verosimilitud, 144 MDB, 76 mediador, 9 medicina predictiva, 237 meiosis, 25, 28, 29, 140, 183, 187, 217 MELAS, 251 Mendel, 93, 94, 102 MERRF, 251 metacntricos, 179 metafase, 23, 178, 179 metilacin, 72, 74, 75, 77, 212, 215, 220, 260 metil-transferasas de ADN, 75 mtodo ramificado, 98 MGMT, 84 MHC, 271 microARN, 61, 260 microarrays, 47, 53 microdelecin, 219 microevolucin, 169 microsatlite, 53, 63, 143, 200 migracin, 160 minisatlites, 53, 63 mis-sense, 191 mitosis, 18, 22, 23, 24 MLPA, 234 MMR, 82 mola hidatidiforme, 215

ndice analtico

www.FreeLibros.me

monohbridos, 95 monosoma, 181, 182, 187 Morgan, 104, 108, 139 mortinatos, 183 mosaicos, 180, 181, 182 movimiento eugensico, 130 mucoviscidosis, 240 mutacin, 82, 83, 160, 166, 189, 199, 211 puntual, 250 sinnima, 191 NARP, 251 NCBI, 274 NER, 85 Neurofibromatosis tipo 1, 242 no-disyuncin, 183 non-sense, 191 nuclena, 1 nuclesido, 1 nucleosoma, 18, 72 nucletido, 1 nulisoma, 181 nmero de acceso, 275 octmero, 18, 72 Ohno, 172 OLA, 233 oligonucletidos antisentido, 259 OMIM, 276 oncovirus, 262 orgenes de replicacin, 20 PAC, 35, 54 PAM, 278 pangnesis, 93, 129 paquiteno, 26 paracntricas, 185 paradoja de Sherman, 245 parlogos, 205 PCNA, 21 PCR, 41, 229, 232, 233, 250 penetrancia incompleta, 241 prdida de funcin, 203, 211 pericntricas, 185 PIC, 142

pintado cromosmico, 179 pirimidinas, 1 pistola gnica, 268 placa metafsica, 24 plsmidos, 34 polidactilia, 222 polimerasa de ADN, 20, 41, 42, 45 ARN, 6 polimorfismo, 81, 141 de inversin, 209 poliplasmia, 249 poliplexos, 269 polycomb, 223 potenciadores, 6, 9, 11, 80, 194 exnicos del ayuste, 12 Prader-Willi preiniciacin, 6 pre-miARN, 61 premutacin, 202, 245 prevalencia, 165 primasa, 20 pri-miARN, 61 probabilidad, 247 condicional, 247 conjunta, 247 final, 247 inicial, 247 profase, 23 promotor, 6 protenas SR, 12, 194 truncadas, 192 Proyecto Genoma, 51, 56, 57 Internacional Hapmap, 151 pseudogen, 60, 206 PTT, 231 punto de ramificacin, 11 puntuacin lod, 145 purinas, 1 quiasmas, 27, 30, 184 quimeraplastos, 258 quinetocoro, 23, 23, 27, 178, 185 quistes dermoides, 215

287

ndice analtico

www.FreeLibros.me

288

RAD50, 29, 84, 87 RAD51, 86 RAD52, 29, 87 radiacin UV, 84 reaccin en cadena de la polimerasa, 41 receptor de andrgenos, 214 recombinacin, 26, 28, 30, 140, 160, 184 homloga, 29, 86 RefSeq, 275 regin 3 no traducida, 190 5 no-traducida, 190 regiones no-traducidas, 14 pseudoautosmicas, 114 relacin fenotpica, 97 genotpica, 97 reparacin, 82 acoplada a la transcripcin, 85 Repeatmasker, 280 replicacin, 19, 30, 75, 76, 80, 82 repliegue apical ectodrmico, 222 retinoblastoma, 167, 242 retrotranscripcin, 44, 261 retrovirus, 261 RFLP, 52, 143, 235 ribonucleoprotenas nucleares pequeas, 12 ribosoma, 14 ribozimas, 259 RIDGES, 80 riesgo de recurrencia, 135, 221, 237, 246 relativo, 136 RISC, 61, 203, 259 rotura bicatenaria, 29, 86 RPA, 20, 29, 85, 87 RT-PCR, 44, 231 SAR, 19, 70 secuencia de ayuste crptica, 193 secuenciacin, 44, 55 securina, 24, 185 segregacin, 28, 97, 139 adyacente, 187

alternante, 187 seleccin, 161, 166 estabilizante, 164 sensibilidad, 231 seal de empaquetamiento, 261 poliadenilacin, 10, 190, 195 separasas, 28 separinas, 24 serie allica, 121 sexo heterogamtico, 108 shugoshinas, 28 silenciadores, 6, 11, 194 sinapsis, 25 sindactilia, 222 Sndrome de Angelman, 207, 218, 219, 221 de Apert, 226 de Cockayne, 85 de cri-du-chat, 186 de Crouzon, 225 de Di George, 187, 207 de Down, 181 de Edwards, 182 de Gorlin, 222 de Kearns-Sayre, 251 de Klein-Waardenburg, 224 de Klinefelter, 183 de Microdelecin, 186 de Ojo de Gato, 208 de Patau, 182 de Pfeiffer, 225 de Prader-Willi, 207, 218, 219 de Rett, 244 de Roturas de Nimega, 87 de Rubinstein-Taybi, 187, 223 de Smith-Magenis, 208 de Turner, 111, 182, 213 de Williams-Beuren, 187, 207 de Wolf-Hirschhorn, 186 del X frgil, 203, 228, 244 sndromes malformativos, 222 SINE, 63, 205 sintnicos, 139 sitio A, 15 sitio P, 15

ndice analtico

www.FreeLibros.me

sitios apurnicos, 84 hipersensibles a DNAsa I, 71 skipping, 193 SKY, 179 SNP, 53, 61, 143, 150 sobrecruzamiento, 30, 139, 185, 186 desigual, 205 sobredominancia, 164 solenoide, 18 sonda, 39, 47, 233 sordera neurosensorial, 251 Southern, 40, 250 SOX9, 110 SRY, 110, 205, 224 SSCP, 229 STR, 53 STS, 54 Sturtevant, 140 substituciones, 190 suplementacin gnica, 259 sustancia H, 121, 125 tag-SNPs, 151 tamao poblacional, 159 tasa de portadores, 166 mutacional, 161, 248 mutacional basal, 189 tasas de concordancia, 137 TDT, 149 telofase, 24 telomerasa, 22 telmeros, 22, 63 temperatura de fusin, 39 teorema de Bayes, 246 fundamental de la seleccin natural, 168 teora cromosmica de la herencia, 104 General de la Evolucin, 167 neutral de la evolucin, 171 terapia gnica, 257 terminadores, 45 termocicladores, 44

ttrada, 26 tetra-ploidas, 181 tri-ploidas, 181 trisoma, 21, 181, 187 tetravalente, 187 TGGE, 229 topoisomerasas, 21 tracto rico en pirimidinas, 11 traduccin, 5, 13, 14 transcripcin, 5, 6, 80 transcriptosoma, 8 transferencia gnica, 257 southern, 40 transformacin, 36 transiciones, 190 translocacin, 180, 187 robertsoniana, 181, 187 transposones, 65 transversiones, 190 trinucletidos, 200 triploida, 181 trisoma, 21, 180, 181 trithorax, 223 trivalente, 187 TSIX, 113 UBE3A, 218, 219, 221 UNIGENE, 57 VNTR, 53 variacin, 56, 81 continua, 130 discontinua, 129 gentica, 61 varianza fenotpica, 135, 136 genotpica, 136 vector, 257 de clonacin, 34 no-viral, 267 viral, 260 virus adenoasociado, 265 hemaglutinante del Japn, 269

289

ndice analtico

www.FreeLibros.me

290

Walter Sutton, 104 William Bateson, 102 Williams-Beuren xantomatina, 125 xeroderma pigmentosum, 85 XIC, 112 XIST, 112

XRCC4, 88 XXY, 180 YAC, 35, 54 ZFY, 110 Zona de Actividad Polarizante, 222

ndice analtico

www.FreeLibros.me