Vous êtes sur la page 1sur 130

Sminaire International Protection et Prservation des Ecosystmes Sahariens (1ECOSYS09)

Ouargla, les 13,14 et 15 dcembre 2009


Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
PRSENTATION DU LABORATOIRE

Le Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides a t agr en
2001, et reconduit en 2004, puis en 2008 sous la responsabilit de son Directeur Pr DADAMOUSSA
Belkheir.
Le laboratoire est reprsent par cinq (05) quipes de recherche, savoir:
1. Valorisation des plantes spontanes
2. Eco dveloppement du camelin
3. Protection de lenvironnement en zones arides
4. Eco dveloppement du palmier dattier
5. Environnement et chimie des eaux

Le laboratoire nomm ECO.SYS, regroupe 6 professeurs, dont 3 associs; 5 matres de confrences
A; 3 matres de confrences B, 10 matre- assistants A, 4 matre- assistants B et 3 membres de soutien
(laborantins).

Le laboratoire sest distingu par une importante activit scientifique, savoir des publications
internationales et nationales, des encadrements de graduation et de post-graduation, llaboration de
documents scientifiques, des conventions nationales et internationales et des projets de recherche.

OBJECTIFS DU SEMINAIRE

Ce premier sminaire international sur la Protection et Prservation des Ecosystmes sahariens
(1.ECO-SYS09), se veut un carrefour dchanges et doptimisation de connaissances pour une meilleure
orientation vers de nouveaux axes de recherche. Il sagit de:
- Dresser un tat de lieu de la gestion et du fonctionnement des diffrents cosystmes oasiens;
- tudier les impacts de la dsertification, de la perte de la biodiversit, des diffrentes pollutions etc., sur
les communauts sahariennes et les cosystmes,
- Valoriser, prserver et sauvegarder les ressources naturelles des cosystmes oasiens,
- Intgrer le patrimoine naturel oasien dans la stratgie de dveloppement durable.

Ces principaux objectifs se focalisent sur la constitution dune base de donnes pour son
exploitation, notamment au bnfice des cosystmes sahariens caractriss par leur complexit et leur
fragilit.

THMES RETENUS

Prservation des agro systmes sahariens
Conduite du palmier dattier
Prservation des ressources phytogntiques du palmier dattier
Lutte biologique contre les ravageurs du palmier dattier
Gestion des agro systmes oasiens
Dveloppement de llevage camelin
Valorisation des produits et sous produits
Systmes dlevage
Prservation des parcours
Protection et prservation de lenvironnement
Prservation de la qualit des ressources hydriques et daphiques
Impacts sur la sant publique
Mise en valeur des terres
Cartographie des sols
Salinisation des sols
Amlioration de la fertilit des sols
Lutte contre lensablement
Les systmes de production agricole oasiens
Valorisation des plantes spontanes
Mcanismes adaptatifs des plantes spontanes aux contraintes environnementales
Utilisation des plantes spontanes usage thrapeutique et phytosanitaire
Sminaire International Protection et Prservation des Ecosystmes Sahariens (1ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009

Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

REMERCIEMENTS

Le comit dorganisation tient exprimer ses vifs remerciements :
- Monsieur le Pr. BOUTARFAIA Ahmed, Recteur de luniversit Kasdi Merbah-Ouargla (Algrie), pour
le soutien financier et moral quil nous a accord afin de mener bien lorganisation de cette
manifestation scientifique,
- Et aux organismes ou structures suivants :
* Commissariat au dveloppement de lagriculture dans les rgions sahariennes (CDARS)
* Restaurant au feu de braise (chez Moulud), Ouargla, Algrie
Pour leur contribution la russite de ce sminaire international.
Aussi, le comit dorganisation ne saurait oublier tous ceux qui, dune manire ou dune autre, se
sont mobiliss pour permettre la tenue de cette manifestation scientifique.

Comit dHonneur
Pr.BOUTARFAIA Ahmed : Recteur de lUniversit KASDI Merbah Ouargla
Comit dorganisation
Prsident : Pr. DADAMOUSSA Belkheir
Vice-prsident : Pr. OULD EL HADJ Mohamed Didi

ADAMOU A. (Univ. Ouargla)
BENSACI Messaoud Bachagha (Univ. Ouargla)
BERKAL I. (Univ. Ouargla)
BOUAMMAR B. (Univ. Ouargla)
BOUDJ ENAH S. (Univ. Ouargla)
BOUGHABA L. (Univ. Ouargla)
BOUZEGAG B. (Univ. Ouargla)
CHELOUFI H. (Univ. Ouargla)
DADDI BOUHOUN M. (Univ. Ouargla)
HAMDI AISSA B. (Univ. Ouargla)
IDDER M.AH. (Univ. Ouargla)
IDDER M. A. (Univ. Ouargla)
IDDER-IGHILI H. (Univ. Ouargla)
KHELIL R. (Univ. Ouargla)
KHALLEF S. (Univ. Ouargla)
KHEMGANI A. (Univ. Ouargla)
MEDJ BER T. (Univ. Ouargla)
MESSAITFA A. (Univ. Ouargla)
NEZLI I. (Univ. Ouargla)
SADINE S. (Univ. Ouargla)
SAGGAI A. (Univ. Ouargla)
SAKER M. L. (Univ. Ouargla)
SIBOUKEUR OumEl Kheir (Univ. Ouargla)
SIOUANE F. (Univ. Ouargla)
TOUIL Y. (Univ. Ouargla)
ZATOUTA Z. (Univ. Ouargla)
ZENKHRI S. (Univ. Ouargla)

Comit Scientifique
Prsident : DADAMOUSSA Belkheir
Vice-prsident : IDDER Med Azzedine

ABBAS K.(INRAA Stif, Algrie)
BENGRINA H. (Univ. Ouargla, Algrie)
BISSATI S. (Univ. Ouargla, Algrie)
BOUGUEDOURA N. (USTHB, Algrie)
BOTTON B. (Univ. Nancy I, France)
BRINIS L. (Univ. Annaba, Algrie)
CHEHMA A. (Univ. Ouargla, Algrie)
CHELOUFI H. (Univ. Ouargla, Algrie)
CTE M. (Univ. Aix en Provence France)
DJILLI K. (I.N.A. Algrie)
DOSSO M. (IRC France)
DOUMANDJI S.E. (I.N.A. , Algrie)
DOUMANDJI-MITICHE B. (I.N.A. , Algrie)
EL HAMEL Z. (Oujda , Maroc)
FAYE B. (CIRAD France)
HADJ MAHFOUD M. (Univ. Ouargla, Algrie)
HALLILAT M.T. (C.U. Ghardaa - Algrie)
HAMDI AISSA B. (Univ. Ouargla, Algrie)


IDDER Med Tahar (Univ. Ouargla, Algrie)
KRIKER A. (Univ. Ouargla, Algrie)
LAHRER F. (Univ. Rennes, France)
LAKHDARI F. (CRSTRA, Algrie)
LEBDI K. (I.N.A.T., Tunis)
MESSAITFA A. (Univ. Ouargla, Algrie)
OULD EL HADJ M.D. (Univ. Ouargla, Algrie)
OULD EL HADJ -KHELIL A. (Univ. Ouargla,
Algrie)
PINTUREAU B. (INSA-INRA, France)
SAIDI M. (Univ. Ouargla, Algrie)
SAKER M. L. (Univ. Ouargla)
SENOUSSI A. (Univ. Ouargla, Algrie)
SIBOUKEUR O. ElKheir (Univ. Ouargla,
Algrie)
TOUCHAN R. (Univ. Arizona, USA)
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr







Communications orales



Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
1
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Thme 1- Prservation des agro systmes sahariens
O1
LE PALMIER DATTIER Phoenix Dactylifera L. DU TOUAT

BAHIANI M.

Unit de Recherche en Energies Renouvelables en Milieu Saharien, Adrar, Algrie
bahiani.m@hotmail.fr

Recouvrant une superficie de 427.968km
2,
Adrar se subdivise en 04 rgions : le Gourara, le Touat et le
Tidikelt et Tanezrouft. A lexception de Tanezrouft, Adrar est une rgion vocation agricole
principalement phoenicicole avec 294 ksar. Dans les palmeraies, le palmier dattier y constitue le pivot
de tout lcosystme oasien. Un systme oasien traditionnel caractris par une agriculture
dautosubsistance base sur la phoeniciculture, les cultures sous tages et un peu dlevage. A Adrar,
la diversit varitale du palmier dattier y est importante. Les dattes dites communes, ont une faible
valeur marchande et sont destines lautoconsommation familiale ou lchange vers lAfrique sub-
saharienne travers un troc frontalier avec le Mali et le Niger. La rgion du Touat elle seule compte
environ plus de 195 cultivars. Mais si cet cosystme oasien dAdrar, reprsent par sa
phoeniciculture, est un rservoir considrable par sa diversit gntique, il est aujourdhui mconnu et
non valoris. Cest dans cette optique quun film scientifique et culturel a t ralis. Il interpelle sur
lactuelle rosion gntique du palmier dattier et appelle porter un regard sur les dattes locales
dAdrar mconnues et marginalises.
Le filmillustre :
Les cultivars de dattes dominants du Touat. Et met laccent sur certains cultivars rares
en voie de disparition ;
Le systme de caractrisation des cultivars de dattes ;
Les menaces qui psent sur le palmier dattier telles que la maladie du Bayoud, le
Boufaroua et le problme srieux du tarissement des foggaras, source deau capitale de loasis ;
Et le rle important de la femme dans la gestion des produits et sous produits du
palmier dattier.

Mots cls : palmier dattier, cosystme oasien, caractrisation, menaces et gestion.

**************************************

O2
EFFET DUN INSECTICIDE UTILISE EN PROTECTION DES VEGETAUX:
THIAMETHOXAM SUR LABEILLE SAHARIENNE Apis mellifera sahariensis

CHAHBAR N
1
, BELZUNCES L. P
2
et DOUMANDJI S
3

1
Dpartement de Biologie, Facult des sciences, Universit Mhamed Bougara Boumerdes, Algrie
2
Laboratoire Toxicologie Environnemental UMR 406, Ecologie des Invertbrs
INRA dAvignon, France
3
Dpartement de Zoologie Agricole et forestire, Institut National Agronomique dEl-Harrach, Algrie
chahabar_nora@yahoo.fr

Lutilisation des produits phytopharmaceutiques dans la lutte contre les ravageurs des cultures est une
ncessit. Mais ce moyen de lutte nest pas sans risque et peut entraner des effets non intentionnels
qui se manifestent, par une toxicit chez les organismes non cibles comme les insectes utiles. Parmi
ces derniers, les abeilles domestiques jouent un rle triple, agronomique, conomique et cologique.
La prparation commerciale Actara 25 WG qui contient le Thiamthoxamest reconnue comme tant
toxique pour les abeilles et elle est interdite dusage pendant la priode de la floraison. Cependant, ce
produit est systmique, il se trouve donc prsent en faibles concentrations dans le vgtal trait
pendant tout son cycle de dveloppement. Quels sont les effets induits chez labeille par la
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
2
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
contamination par de faibles doses de Thiamethoxam qui pourrait tre contenu dans le pollen et le
nectar au moment de la floraison, telle est la question pose ? Pour essayer dapporter une rponse
cette problmatique, nous avons dtermin dans une premire tape la sensibilit de labeille
saharienne Apis mellifera sahariensis en testant la toxicit aigue orale du thiamethoxamsur des
abeilles ouvrires au niveau du laboratoire qui constitue la base du schma dvaluation des risques
toxicologiques. Ltude repose sur la dtermination des DL 50 par voie orale. Les abeilles dge
indtermin ont t nourries avec une solution de saccharose avec des doses croissantes de
linsecticide utilis (1, 10, 20, 50, 70, 90 et 100 ng de substance active par abeille). Pendant toute la
dure de ltude les abeilles tmoins et traites sont places lobscurit (T 25C 2C et 60%
H.R.). Le rsultat a montr que la DL50 obtenue vari entre 10,86 et 11,47ng/ abeille.

Mots cls : Insecticide, Thiamethoxam, Abeille saharienne, DL50, Toxicit aigue.

**************************************
O3
APPLICATION DES INDICATEURS ETHNOBOTANIQUES DE LA DIVERSITE AU
PALMIER DATTIER

Aissa TIRICHINE
1
, Malek BELGUEDJ
1
, Abderrahmane BENKHALIFA
2

et Messaouda GUERRADI
3


1
INRA Algrie.
2
ENS. Vieux Kouba. Alger, Algrie.
3
DSA Ghardaa, Ghardaa, Algrie.
atirichine@yahoo.fr

Ltude des ressources gntiques du palmier dattier envisage gnralement une valuation de la
composition en cultivars dune palmeraie donne. Elle se base sur linventaire et lestimation des
frquences dabondance de lensemble des cultivars. Dautre part cette tude peut aussi sintresser au
mode de gestion de cette diversit agricole. Dans la rgion du Mzab, des travaux similaires ont t
conduit donnant tat de lexistence dune diversit juge intressante mais ltat drosion de cette
richesse reste encore mal connu. Lutilisation dindices ou dindicateurs constitue un moyen
dvaluation du degr drosion de la diversit gntique dune espce vgtale donne. Les
indicateurs ethnobotaniques de la diversit dans les espces cultives appliqus au palmier dattier dans
les conditions de la rgion du Mzab rvlent un risque drosion o les deux indicateurs relatifs au rle
de lespce dans la culture alimentaire locale et les usages multiples de la mme espce sont peu
vrifiables. Une analyse approfondie des diffrents indicateurs ethnobotaniques fait ressortir les forces
et les faiblesses de la gestion actuelle des ressources gntiques du palmier dattier. A travers cette
analyse, la faisabilit dutilisation de ces indicateurs ethnobotaniques dans lvaluation du degr
drosion de la diversit gntique du palmier dattier est mise en vidence.

Mots cls : palmier dattier, ressources gntiques, Phoenix dactylifera L., indicateur ethnobotanique,
Algrie.


**************************************









Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
3
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O4
RECHERCHE DES GENITEURS DE PALMIERS MALES DONNEURS DE GRAINS
DE POLLEN DE QUALITE

Larbi BOUGHEDIRI

Equipe de palynologie, Laboratoire de Biologie Vgtale et Environnement, Dpartement de Biologie,
Facult des Sciences, Universit de Annaba, BP n 12 Annaba 23000, Algrie
Boughediri2@yahoo.fr

Le palmier dattier (Phoenix dactylifera L.) constitue une espce fruitire d'une trs grande valeur
cologique, agronomique, conomique et sociologique. Il se situe au quatrime rang des productions
fruitires tropicales et subtropicales avec prs de 192 millions d'arbres qui occupent prs de 500.000
hectares rpartis essentiellement au Proche-Orient et en Afrique du Nord. En Algrie, le palmier
dattier offre, outre la production des dattes, la possibilit de dvelopper des cultures sous-jacentes
(arbres fruitiers, crales, lgumes, luzerne, henn etc.). Le palmier dattier, tant une espce
monocotyldone dioque, posent un problme particulier : les palmiers mles appels localement
Dokkars sont gnralement issus de semis et sont trs rarement clons et ils constituent le plus
souvent des gnotypes uniques et les qualits des pollens sont trs variables d'un individu l'autre. Il
est donc ncessaire de rechercher les gniteurs mles donneurs de grain de pollen de qualit, les
multiplier et enfin les conserver. Ceci ncessite la recherche de la variabilit existante entre les
Dokkars en valuant les caractres phnotypiques descriptifs et leur qualit pollinique. C'est dans
cet objectif que nous avons men cette tude sur quelques types de palmiers mles de la station
exprimentale de Biskra (Sud-est algrien).

Mots cls : Palmier dattier, Caractrisation des palmiers mles, pollens, critres de qualit.

**************************************
O5
ISOLEMENT ET CULTURE DE PROTOPLASTE DE PALMIER DATTIER (Phoenix
dactylifera L.)

D. YATTA, F ABED, B. AMARA, M.S. YAKHOU, F. S. BENHAFSI

I.N.R.A. Laboratoire de Physiologie Vgtale CRP Mehdi boualem, baraki, Algrie
eldjouzidjamila@yahoo.fr

Les suspensions cellulaires, sont lorigine des transformations gntiques et constituent le matriel le
plus utilis comme source de protoplastes. Le recours aux suspensions cellulaires, comme source de
protoplastes, a permis dinitier et dacclrer le rythme de division cellulaire chez les
monocotyldones. Le but de cette tude est ltablissement de suspensions cellulaires chez le palmier
dattier afin de disposer du matriel indispensable pour lisolement de protoplastes dans lobjectif
dobtenir des hybrides somatiques rsistants au bayoud par le biais de la fusion de protoplastes. Pour
cela des cals compacts et friables embryognes ont t utiliss pour initier les suspensions cellulaires
en milieu liquide enrichi en 5 mg.l
-1
picloram. Des suspensions cellulaires embryognes ont t
tablies sur les cals friables. Une prolifration a t obtenue avec un cfficient de multiplication de
2.9 aprs deux mois et demi de subculture. Ces suspensions ont montr des structures cellulaires de
forme allongs et arrondies de taille variable. Lisolement des protoplastes partir de ces suspensions
ont permis lobtention dun nombre lev de protoplastes de forme sphrique contenants de gros
noyaux, ce qui dnote de leur viabilit. Les meilleurs rendements sont obtenus avec les solutions E3
(Cellulase 0.5%, Pectolyase Y23 0.04%), E7 (Cellulase 0.5%, Pectolyase Y23 0.07% Hemicellulase 2
%).La culture des protoplastes issus des suspensions cellulaires a montr que les protoplastes des deux
cultivars Taqerbuchet et Deglet Nour ont volu en cals.

Mots cls: Palmier dattier, cal, suspension cellulaire, protoplastes.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
4
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
O6
INVENTAIRE ET CARACTERISATION POUR UNE MEILLEURE
PRESERVATION ET VALORISATION DES DATTES COMMUNES DE LA REGION
DU TOUAT (ADRAR)

A.DJIDDA et A.ZAKI

CRP Mehdi Boualm, BP 37, Baraki, Algrie
Tl : 021 76 20 25 Fax : 021 72 23 01.
djidda@email.com

En Algrie, les Oasis occupent une superficie totale de 85000 ha et reclent environ 10 millions de
palmiers (Ministre de lAgriculture, 2008). Le rle du palmier dattier est primordial car il consiste
entre autre un moyen essentiel de fixation des populations et de cration ou de maintien de centres de
vie. La structure varitale de la palmeraie algrienne fait apparatre que les varits communes de
faible valeur marchande sont particulirement concentres dans les zones Sud-Ouest du pays.
MESSAR (1996). Cette zone est compose despces trs diverses de palmier Degould qui
constituent 15% de la production nationale en datte (Ministre de lAgriculture, 1989 a). Dans cette
zone le palmier nest pas considr comme la principale spculation ; les diffrentes varits de dattes
sont destines essentiellement lautoconsommation et ne contribue que faiblement au revenu des
agriculteurs. Afin de leur trouver un dbouch plus rmunrateur, il est utile de les amliorer par des
transformations afin dobtenir des produits nouveaux facilement commercialisables, tels que : Alcool,
Vinaigre, Levures, Acides amins, Enzymes et Vitamines. La valorisation et la prservation de ces
dattes communes dpendent de la connaissance de la matire premire et, partir de l, la slection
des dattes de qualit et des possibilits de transformation. Dans ce contexte, des prospections ont t
raliss au niveau des 12 communes de Touat suivi d'une analyse chimique (l'eau, les sucres , pH et
cendres) sur les dattes des plus importants cultivars de la rgion, pour nous permettre de dceler les
qualits ventuelles de ces dattes et, en particulier leur richesse en sucre, et d'orienter ensuite leur
exploitation.

Mots cls : Cultivars, dattes, inventaire, analyse chimique, prservation, qualit
O7

APPORTS DES INFOCHIMIQUES (MEDIATEURS CHIMIQUES) DANS
L'EVALUATION DU POTENTIEL BIOTIQUE DE LA PYRALE DES DATTES
ECTOMYELOIS CERATONIAE DANS LES PALMERAIS ANTHROPISEES

DJ AZOULI Zahr-Eddine
1
, ALEM Lela
1
, DRIR Ahlem
1,
MOSTEFAOUI Houda
1

et DOUMANDJI-MITICHE

Bahia
2

1
Universit SAAD DAHLEB, Facult des Sciences Agro Vtrinaires, Dpartement d'Agronomie, B.P. 270,
Route de Soumaa Blida, Algrie,
Tl /Fax +213 25 43 39 38,
2
Ecole National d'Agronomie, Dpartement de Zoologie Agricole et Forestire, Hassan Badi El Harrach, Algrie
zahrdjazouli@mail.univ-blida.dz

Ltude c'est intress l'influence des mdiateurs chimiques sur la communication interspcifique,
dans le but de perturber le regroupement des nuisibles, gner leurs reproductions ou encore de
rentabiliser leurs traabilit. Les rsultats montrent que les substances extraites partir dattes ont
permis davoir une certaine corrlation entre la fcondit des femelles dEctomyelois ceratoniae, et les
stades phnologiques, les mthodes dextractions et en fin le solvant utilis. En gnral, la fcondit
total moyenne des femelles augmente avec la dose des extraits des principes actifs stimulateurs de
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
5
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
ponte. Les rsultats, refltent aussi que lacceptation ou le rejet dun sujet, seraient donc bass sur les
composs de surface plutt que sur la composition interne et la valeur nutritionnelle de la plante pour
la descendance. Limpact de la variation de la composition chimique des dattes sur le potentiel
biotique de la pyrale des dattes a t examin. Des variations des teneurs de plusieurs fractions
flavonoques durant la phase de maturations des fruits ont t observes. Ces changements refltent
lexistence dune corrlation positive entre le potentiel biotique de la pyrale et le taux des flavonodes
des dattes dans la rgion de Biskra conduite en mode biologique ; et une corrlation ngative aprs
traitement dans la rgion dEl Oued. Il semble que les traitements phytosanitaires (pesticides) peuvent
affecter le dveloppement, certains aspects de la communication chimique et le succs reproducteur
des femelles dE. ceratoniae en interfrant avec des processus physiologiques sous la dpendance des
mdiateurs chimiques (alllochimiques).

Mots cls : Dattes, Stade phnologiques, Stimulateurs de ponte, Mdiateurs chimiques, Comportement
de ponte.

**************************************
O8

POINT SUR LA SITUATION DE LAVIFAUNE DES OASIS DE PALMIERS DATTIERS AU
MAGHREB, EN VUE DUN SUIVI ECO BIOLOGIQUE

Khaled AMRANI et Georges TOUTAIN

aitamrane2000@yahoo.fr

La mise en valeur durable de lagro systme oasien, doit tre conduite de manire obtenir une haute
fertilit volutive des palmeraies et une amlioration de la capacit de rsilience de cet cosystme.
Pour ce faire, un diagnostic aussi prcis que possible doit tre ralis. Ce dernier repose sur des grilles
dvaluation de la biodiversit selon une approche multifactorielle : agro cologique, sociologique et
conomique. Cest ce quoi la prsente communication aspire, afin de proposer un outil daide la
dcision pour la mise en place dun programme de conservation, de restauration et de maintien de la
biodiversit. A lissue de ce diagnostic, il sera possible de mesurer les faiblesses de lagro systme et
les oprations damliorations apporter.Des grilles dvaluation de la biodiversit avifaunistique sont
proposes afin daffiner le diagnostic des pratiques agricoles et leurs impacts, au sein de la palmeraie.
Lavifaune est choisie car il savre quelle constitue lun des meilleurs indicateurs de ltat des
quilibres cologiques. La conception et llaboration de cet outil, sarticulent autour de la
prservation des ressources naturelles et des valeurs socio conomiques, caractristiques une
agriculture durable. Le principe de ces grilles, consiste quantifier les diverses composantes de lagro
systme oasien, en leur attribuant une note chiffre, peuplement ornithologique compris. Pour ce faire,
une mise jour de la situation de lavifaune des oasis sera dautant plus intressante dans la mesure o
elle permettra de mieux comprendre la dynamique du peuplement avifaunistique, afin de dresser un
diagnostic fiable. Ainsi, pour lchelle de durabilit agro cologique, trois composantes sont prises en
considration. Il sagit de la biodiversit, de lorganisation de lespace, et des pratiques agricoles.
Chaque composante englobe un certain nombre de bio-indicateurs ayant trait lavifaune. Concernant
lchelle de durabilit socio territoriale, trois composantes sont galement prises en compte : La
qualit des produits et des terroirs, emplois et services, thique et dveloppement humain. Quant
lchelle de durabilit conomique, quatre composantes sont considrer : la viabilit, le degr
dautonomie, la transmissibilit et lefficience. Cest au terme de ce diagnostic propos, que les
dcisions seront prises.

Mots cls : Avifaune, biodiversit, grille dvaluation, rsilience, oasis de palmiers dattiers

**************************************


Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
6
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O9
MULTIPLICATION IN VITRO DU CYPRES DU TASSILI (Cupressus
dupreziana A. Camus)

1
LEBTAHI. F.,
1
HASSINI. F/Z.,
1
AMDOUN. R.,
2
BOUGUEDOURA. N.,
1
CHETTAH. W.,
1
KEBBAB. O.,
1
MALDJI. N.

1
- INRF, Algrie,
2
- USTHB, Algrie
fatyleb@yahoo.fr

Cupressus dupreziana A-camus, cyprs endmique du Tassili N`ajjer au Sahara central, est considr
comme une espce en voie de disparition. Les conditions climatiques rigoureuses, le faible taux de
germination rendent toute rgnration trs prcaire et risque invitablement de condamner lespce
sa disparition. Pour parer cette situation inquitante, nous avons jug utile et important de recourir
une solution adquate permettant sa propagation rapide et intense afin de le sauvegarder. C`est dans
cette optique que l`utilisation de la culture in vitro devient indispensable tant donn que les
techniques traditionnelles s`avrent difficiles. L`objectif recherch par cette tude est de mettre au
point une ou plusieurs techniques de multiplication rapide et intense du cyprs du Tassili en vue d`une
cration de vergers de conservation.

Mots cls: Micropropagation, organognse, cyprs du Tassili, Cupressus dupreziana, Algrie.

**************************************

O10
LENSACHAGE DES INFLORESCENCES PAR LE LIF DU PALMIER : UNE
OPERATION CULTURALE NON PRATIQUEE EN ALGERIE

BABAHANI S
1
; DJILI B
2
.et BOUGUEDOURA N.
3

1
Laboratoire Bio Ressources -Universit KASDI Merbah Ouargla, Algrie
2
USTHB, Algrie
bbhsouad@gmail.com

Les accidents climatiques peuvent endommager partiellement ou totalement la production dattire, au
dbut ou en fin de fructification. Lensachage reste un moyen de protection contre ces accidents.
Ltude ralise dans la rgion de Ouargla sur leffet de lensachage des inflorescences pollinises par
le lif du palmier a permis de montrer que ce matriel pourrait amliorer les taux de nouaison chez la
varit Ghars, considre comme prcoce, surtout au dbut de la saison de pollinisation, caractrise
par de faibles tempratures. Chez la varit Deglet Nour, cette amlioration est note surtout en fin de
saison de pollinisation, caractrise par des tempratures relativement leves. Le lif amliore
galement la plupart des caractres biomtriques des dattes, ainsi que les rendements chez les deux
cultivars. Cette pratique encouragera les phoeniciculteurs a nettoy leur palmier du lif et permet de le
valoriser

Mots cls : Ensachage palmier dattier pollinisation Lif


**************************************





Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
7
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O11
ETUDE DE QUELQUES ASPECTS BIOECOLOGIQUE DE LA PYRALE DES
DATTES Ectomyelois ceratoniae Zeller., 1839 (Lepidoptera, Pyralidae) ET ESSAI DE
LUTTE BIOLOGIQUE PAR LE SPINOSAD DANS LES CONDITIONS
CONTROLEES

MEHAOUA .MS
1
, BEN SALAH. MK
2
, RAFRAFI.T
1
, KEBICI. H
1
, NAIDJI.T.
1
,
OUAKID.ML
3
.

1
Dpartement dagronomie, Facult des Sciences, Universit de Biskra.
2
- INPV Station de Biskra.
3
Dpartement de Biologie, Facult des Sciences, Universit Badji Mokhtar-Annaba E-mail :
linaseghir@yahoo.fr

La pyrale des dattes Ectomyelois ceratoniae Zeller reste parmi les ravageurs les plus redoutables du
palmier dattier. Ltude des aspects biocologique dEctomyelois ceratoniae sur les dattes de la varit
Mech Degla dans les conditions contrl nous a permis de connatre et dvaluer linfluence de la
qualit nutritive de la plante hte sur la performance biologique de ce ravageur, afin denvisager une
mthode de lutte efficace contre ce ravageur. Les rsultats obtenus montrent que chaque stade larvaire
est caractris par sa taille et son poids qui augmentent dun stade un autre avec une dure totale du
cycle biologique plus courte que celle obtenus sur milieu dlevage artificiel. Lessai de lutte
biologique par le spinosad contre les larves L
1
de la pyrale dans le milieu dlevage artificiel, a dvoil
un taux de mortalit trs lev par rapport au tmoin.

Mots cls : biocologique, pyrale des dattes, lutte biologique, spinosad, larve L
1

**************************************

O12
DIVERSITE FLORISTIQUE DE LA PALMERAIE DE OUARGLA
(SUD-EST ALGERIE)

Amar EDDOUD
1
, Elise BUISSON
2
, Leila ACHOUR
1
, Khadidja GUEDDIRI
1

1
Laboratoire Bio ressources Saharienne : Prservation et Valorisation Universit de Ouargla, Algrie
2
Universit dAvignon, IUT, UMR CNRS IRD IMEP, Site Agroparc, BP 1207, 84911 Avignon cedex 9, France
amar.eddoud@ina.dz

Situe au sud-est de l'Algrie, Ouargla est considre comme l'une des plus anciennes Oasis du pays.
La culture du palmier constitue dans cette rgion la principale activit agricole, et on compte plus 2
millions de pieds couvrant une superficie de 20191 ha. On distingue deux types de palmeraies :
- Lancienne palmeraie caractrise par une plantation anarchique des palmiers dattiers et
labsence dutilisation de produits chimiques (engrais chimique et produits phytosanitaires)
- Les nouvelles palmeraies qui sont caractrises par une plantation organise (espace entre
pieds constant de 10 12 m) et lutilisation de traitements phytosanitaires, de fertilisation minrale etc.
Ltude vise la quantification de la richesse et de la diversit floristique de lcosystme palmeraie de
Ouargla sur la base de transects et relevs floristiques rpartis selon un chantillonnage systmatique
dans les deux types de palmeraie. Les rsultats montrent que ces agro-cosystmes renferment 27
familles, 70 genres, 74 espces. Les cinq familles les plus reprsentes sont les Poaceae (17 espces),
Asteraceae (8 espces), Brassicaceae (7 espces), Amarantahaceae (5 espces) et les Fabaceae (4
espces). Ltude a, par ailleurs, permis de rvler la dominance des espces synanthropiques par
rapport aux espces naturelles dans ces agro-systmes et de dfinir le spectre biologique de la rgion
dtude qui se caractrise par une nette dominance des throphytes (60.7%). Lanalyse compare des
rsultats montre que le nombre despces inventories est nettement plus important aux niveaux des
nouvelles palmeraies (71 espces) par rapport aux palmeraies anciennes (38 espces). Le nombre
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
8
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
faible despces enregistr au niveau des palmeraies anciennes est probablement li au types de
cultures pratiqu (culture fauche : luzerne, menthe, etc.) ou encore la forte dominance des deux
espces Phragmites australis et Cynodon dactylon, espces forte biomasse arienne.

Mots cls : Palmeraie, richesse, diversit, Ouargla, Algrie.

**************************************
O13
LAGRICULTURE A OUARGLA VERS QUELS ESPACES ET QUELLES
SOCIETES ?

CHAOUCH Saida

Univ. Kasdi Merbah Ouargla, Algrie
saidachaouch@yahoo.fr

Lagriculture Ouargla tait, pendant plusieurs sicles, concentre dans la cuvette autours des Ksours
de Ouargla, Chott Ajaja et Ngoussa ainsi que dans des lieux de campement tels que Bamendil et El
Bour. Elle tait entre les mains des autochtones oasiens et parfois des nomades possdant des
palmiers de cueillettes. Le sicle coul a connu de grandes mutations favorises par les nouvelles
technologies notamment celle de mobilisation des eaux profondes. Ainsi, de nouveaux espaces puri-
urbains et parfois en plein dsert ont t conquis par des fronts pionniers et des entrepreneurs
investisseurs en agriculture venant des quatre coins du pays encourags par des mesures incitatives
que les dirigeant ont jug indispensable pour la russite des programmes de dveloppement agricoles.
Aprs plusieurs dcennies, le dbat reste ouvert malgr les rsultats clairs et exploitables : multiples
raisons, dont les plus importantes relvent du secteur de lagriculture, sont lorigine des rsultats qui
nous renseignent des meilleures orientations quant aux choix des espaces et surtout des acteurs
responsables de cette activit noble et extrmement dterminante pour le devenir de la rgion voir du
pays tout entier. Faut-il encourager les anciens phoeniciculteurs a entretenir et reconstituer leurs
palmeraies dans un cadre socio technique traditionnel bien tudi ignorant ainsi les nouvelles
possibilits et ressources naturelles et humaines ? ou bien faut-il admettre lavanc de la roue du
dveloppement et orienter nos efforts vers les nouveaux espaces et les nouveaux agriculteurs sans se
proccuper des espaces et des socits ayant t les piliers de la vie Ouargla pour plusieurs sicles ?
Existe-t-il peut-tre dautres solutions permettant aux uns et aux autres de cohabiter? Dans notre
article nous allons dvelopper les trois hypothses soulignant chaque fois les fondements et les
principales composantes qui sont lis aux ressources humaines et naturelles et aussi la porte de
chacune des hypothses et proposer par consquent des orientations pour le dveloppement agricole
durable dans la rgion de Ouargla.

Mots cls : Espaces, socit, dveloppement agricole, Durabilit, Ouargla

**************************************
O14
EFFET DU PROGRAMME NATIONAL DE DEVELOPPEMENT SUR LES
SYSTEMES DE PRODUCTION AGRICOLE OASIENS DE LA REGION
DE OUARGLA

ZENKHRI Salah

Universit de Ouargla, Algrie
zensalah@yahoo.fr

LEtat Algrien, qui jusqu' prsent assure la plupart des fonctions de dveloppement de lagriculture,
a mis en uvre courant ces huit dernires anne un nouveau programme de dveloppement (le
PNDA), destin lamlioration et la mise niveau des systmes de production en place et ce par la
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
9
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
mise directement la disposition de lagriculteur dun ensemble de mesures de soutien Ouargla est
lune des rgions sahariennes o lengouement envers le P.N.D.A. est importent les agriculteurs des
diffrents systmes de production en place ont en effet manifests leur adhsion a cette initiative
d'amlioration et d'extension des exploitations. , limpact du programme , son l'application et ses
rsultats constituent une alternative certaine aux programmes de dveloppement antrieures compte
tenu des immenses et incontestables possibilits qu'il offre lamlioration et lextension des systmes
de production en place et au dveloppement d'activits conomiques performantes, viable et
gnratrice de richesses et d'emplois.

Mots cls : Sahara, Agriculture, Dveloppement, P.N.D.A, Systme de production

**************************************
O15
EVOLUTION DE LA TENEUR EN POLYPHENOLS, EN FLAVONODES ET
LACTIVITE ANTI-OXYDANTE DE DATTES (PHOENIX DACTYLIFERA L. VAR.
GHARS) AU COURS DE DIFFERENTS STADES DE MATURITE.

TELLI A.
1
, MAHBOUB N.
1
,

SIBOUKEUR O.E.K.
1
et MOULTI-MATI M. F.
2

1
Laboratoire de protection des cosystmes en zones arides et semi arides, Universit KASDI MEBAH, Ouargla.
2
Laboratoire de Biochimie Analytique et Biotechnologies, Dpartement de Biochimie-Microbiologie, Facult
des Sciences Biologiques et Agronomiques, Universit Mouloud MAMMERI de Tizi-Ouzou.
alia.telli@gmail.com

Lvolution des teneurs en polyphnols et en flavonodes totaux de dattes ainsi que lactivit anti-
oxydante correspondante durant la maturation est peu tudie. Dans la prsente tude, les teneurs en
polyphnols et en flavonodes totaux de dattes (Phoenix dactylifera L. var. Ghars) sont analyses
durant cinq stades de maturit (Kimri I ou Khlal I, Kimri II ou Khlal II, Khalal ou Bser et Tmar).
Lactivit anti-oxydante est mesure par le test dABTS. Le stade Kimri I ou Khlal I prsente la
teneur en polyphnols totaux et en flavonodes totaux les plus leves de 747,21 10,49 1005,60
9,46 mg quivalent en acide gallique (EAG)/10 g de poids sec et de 581,04 20,58 306,30 27,35
mg quivalent en Rutine (ER)/10 g de poids sec respectivement. Alors que, les teneurs les plus faibles
sont trouves au stade Tmar. Elles varient de 4,78 0,36 et 3,38 0,27 mg AGE/10 g de poids sec et
de 1,81 0,20 1,17 0,13 mg ER/10 g de poids sec. Lactivit anti-oxydante de dattes, comme les
teneurs en polyphnols et en flavonodes, tend diminuer durant la maturation.

Mots cls : Dattes, stades de maturit, polyphnols, flavonodes, activit anti-oxydante.

**************************************
O16
INTERACTIONS ENTRE LA PYRALE DES DATTES ECTOMYELOIS
CERATONIAE ZELLER (LEPIDOPTERA-PYRALIDAE) ET LES
CARACTERISTIQUES BIOCHIMIQUES DE VINGT CULTIVARS DE DATTES
DANS LES PALMERAIES DE OUARGLA (SUD-EST ALGERIEN)

IDDER-IGHILI Hakima, IDDER Mohamed Azzedine, OULD EL HADJ Mohamed didi

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides, Universit KASDI Merbah, BP
511, 30000 Ouargla, Algrie
idder.ighili@yahoo.fr

Linfestation des dattes par Ectomyelois ceratoniae dans les palmeraies de la rgion de Ouargla (Sud-
Est algrien) varie selon le cultivar de dattes. Parmi les vingt cultivars tudis (Ali-Wrached, Badjmil,
Bayd-Hmam, Ben-Azizi, Bent-Khbala, Degla-Beida, Deglet-Nour, Ghars, Hamraya, Harchaya, Horra,
Litim, Mizit, Tafezouine, Takermoust, Talsasset, Tamsrit, Tati-Wtnuh, Ticherwit, Timjouhart), le
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
10
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
cultivar Takermoust est parmi les plus infests avec des taux pouvant atteindre 57% et les cultivars
Tati-wtnuh et Ghars parmi les moins infests, en revanche le cultivar Bent-Khbala na pas du tout t
infest. Seules deux cultivars, Takermoust et Ticherwit, ont montr des infestations prcoces, depuis le
stade de grossissement des fruits. Les analyses biochimiques des dattes nous ont permis de discriminer
les vingt cultivars de dattes qui sont en grande partie lgrement acides neutres, assez riches en
sucres totaux, avec deux cultivars Bent-Khbala et Ghars plus riches en sucres rducteurs et moins
riches en saccharose. Les dattes des diffrents cultivars montrent une consistance variable selon les
formules utilises pour son calcul, seules trois cultivars Tati-wtnuh, Bayd-Hmamet Tamsrit sont
considrs comme cultivars dattes molles par les deux mthodes. LA.C.P. nous a permis de dfinir
les prfrences alimentaires de la pyrale des dattes. Il parait clairement quEctomyelois ceratoniae
prfre se nourrir et pondre ses ufs sur des dattes molles demi-molles (non par rapport leur teneur
en eau mais plutt par rapport leur rapport sucres totaux/eau), lgrement acide neutre fort taux
de saccharose, afin dassurer sa descendance les meilleurs conditions de nutrition.

Mots cls : Pyrale des dattes, palmier, taux dinfestation, caractristiques biochimiques, prfrence
alimentaire.

**************************************
O17
LA FUSARIOSE DU PALMIER DATTIER (FUSARIUM OXYSPORUM
F.SP.ALBEDINIS) ET SES EFFETS REDOUTABLES DANS LA DEGRADATION DE
LA BIODIVERSITE PHOENICICOLE AU SEIN DE LA REGION DADRAR

BOUDEFFEUR.S
(1)
, KHELIFI.L
(2)
. REFFIS. M
(1)
, KHERSI.M
(1)
.
1
-N.R.A.A, Adrar, Algrie
2
-I.N.A, El-Harrach, Algrie

saidboudeffeur@yahoo.fr

La maladie du Bayoud due Fusarium oxysporum f.sp.albedinis, a caus le dprissement dau moins
3 millions de palmiers dattiers en Algrie et plus de 10 millions au Maroc, et ne cesse de ravager nos
palmeraies en dpit des recherches menes pour y faire face. Tous nos efforts de slection de varits
rsistantes et de multiplication ex-situ ne nous ont pas permis de protger efficacement nos palmiers
contre ce flau dvastateur. Il provoque le dprissement total du palmier dattier au bout de quelques
mois. Il sagit bel et bien dune catastrophe cologique dont les consquences socio-conomiques
pourraient se rpercuter ngativement sur notre pays. Le phnomne densablement et de
dsertification, la scheresse, le rchauffement climatique, les invasions acridiennes, le vieillissement
des palmiers qui dpasse les 30% chez nous, la salinit des eaux et des sols, la diminution des
ressources en eau, lextension du tissu urbain, la monoculture et lapparition des maladies et
ravageurs sont des paramtres qui ont contribu intimement la dgradation svre de la diversit des
ressources phonicicoles et exacerber la situation alarmante de nos palmeraies. Nanmoins, la maladie
du Bayoud demeure incontestablement la cause principale de la dgradation des ressources gntiques
du palmier dattier dans les oasis du sud ouest algrien en particulier Adrar o on a enregistr un
degr dattaque inquitant et qui a pu atteindre dans certains cas jusqu 100% sur quelques localits.
Certains cultivars locaux ont subi des attaques svres et qui sont en voie de distinction totale.
Plusieurs mthodes de lutte contre cette maladie ont t proposes ; mais lutilisation de varits
rsistantes demeure lalternative la plus prometteuse.Dans cette optique, nous avons men une tude
exhaustive sur la rgion dAdrar, o les ressources gntiques du palmier dattier connaissent une
rgression relle et svre des ressources gntiques phonicicoles. Cette dgradation importante est
due principalement la dissmination de la maladie du Bayoud, dont lextension est devenue
inquitante car elle a dclench des problmes socio-conomiques rels chez les agriculteurs.

Mots cls : Palmier dattier, Fusarium oxysporum albedinis, Epidmie, Ressources, Dsertification



Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
11
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O18
LEFFICACITE DES SAVOIR FAIRE TRADITIONNELS SUR LES TECHNIQUES
DE FIXATION DES DUNES MOBILES ET LA LUTTE CONTRE LENSABLEMENT

Abdelkamel SEBAA
1
, Sami BERROUSSI
1
, Mammar BOUHANNA
1
Fattoum
LAKHDARI
2
, Mohamed Tahar BENAZZOUZ
3
.

1
Charg dtude lie la recherche CRSTRA, Biskra, Algrie
2
-CRSTRA,

Biskra, Algrie
3
Facult des Sciences de la Terre, Universit de Constantine, Algrie.
sebaat@yahoo.fr

Lensablement constitue lune des manifestations les plus spectaculaires du phnomne de la
dsertification. Plusieurs oasis, agglomrations, infrastructures routires et hydro-agricoles sont
constamment menaces par lensablement travers le Bas Sahara algrien. Les interventions des
services publics pour dsensabler les axes routiers se multiplient et engendrent des dpenses trs
leves. Une tentative dinventaire et dvaluation des diffrentes techniques actuellement utilises
pour la fixation mcanique des dunes mobiles est prsente dans cette note. Lobjectif de cette
recherche consiste proposer des solutions viables qui peuvent rduire considrablement la frquence
des interventions des quipes dentretiens, et crer une stabilit du milieu dunaire et surtout rduire les
dpenses publiques. Les rsultats obtenus montrent que la mthode arodynamique avec lapplication
des savoir locaux ou technique du tas de remblais en tuf graveleux ou matriau grossier (zones des
turbulences) peut constituer une base de travail pour les projets de stabilisation des dunes mobiles.
Sur le plan technique, les rsultats obtenus sont satisfaisants, les modles de stabilisations mcanique
des dunes mis en place, demeurent encore intactes et confirment une fois de plus son efficacit, face
lagressivit de laction des vents violents. Sur le plan conomique, on note la rduction significative
des cots de ce dispositif qui offre de grandes perspectives, quant la gnralisation de son utilisation
dans les travaux de fixation des dunes.

Mots cls : fixation des dunes, ensablement, tas de remblais, savoir faire locaux

**************************************
O19
LES STRATEGIES POLITIQUES DE DEVELOPPEMENT AGRICOLE OASIEN EN
ALGERIE CES DERNIERES ANNEES FACE AUX CONDITIONS
ENVIRONNEMENTALES ET NATURELLES.

MEGUEDAD-DIABI Siham

Universit des Sciences et de la Technologie Mohamed BOUDIAF, Oran, Algrie
diabi_sihem@yahoo.fr

Lenjeu de notre rflexion sinscrit autour de deux axes fondamentaux complmentaires : Le premier
est celui de lobservation du patrimoine traditionnel du systme de production agricole oasien face
son environnement cologique .Celui ci se caractrise par une fragilit des cosystmes et des
contraintes climatiques qui ncessitent des interventions complexes ncessitant des tudes judicieuses
pour viter une dgradation continue des cosystmes avec une porte limit des interventions des
pouvoirs publics. Le deuxime axe portera sur les stratgies globales de mise en valeur agricoles
lancs ces dernires annes par les pouvoirs publics, et les consquences par rapport lquilibre des
cosystmes par rapport aux conditions environnementales naturelles. Lintrt de cette tude serait de
nous interroger sur limpact de la recherche actuelle et les potentialits de nos chercheurs (es) pour
contribuer un rendement qualitatif optimum du systme productif oasien dans lconomie
Algrienne.

Mots cls : Systme de production, stratgie politique, environnement cologique, oasien, cosystme.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
12
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

O20
LA DURABILITE DU SYSTEME OASIEN MILLENAIRE, APPLIQUE AU CAS DE
LOASIS DE OUARGLA (ALGERIE)

SALHI Abdelkader

BP 613 Ouargla 30 000, Algrie
aeksalhi@yahoo.fr

Les quatre cinquimes des 2 381 741 km que compte lAlgrie sont occups par le Sahara. Ouargla,
appele autrefois Capitale des oasis , est situe au Sud-Est de la capitale Alger une distance de
800 km. Elle est considre, depuis lantiquit, comme un carrefour important et un centre dune
activit commerciale ancienne pour les caravanes et les nomades. Le systme oasien, qui se localise
par excellence, au niveau du dsert saharien, englobe dans son territoire les pays de la frange Nord de
lAfrique du Nord. Les conditions climatiques et lingniosit de sa population ont favoriss
limplantation de ce systme unique. Un systme reposant, essentiellement, sur une association de
trois tages de cultures et o le palmier dattier est considr comme culture principale. Les pratiques
culturales traditionnelles, fondes sur un savoir faire ancestral, sont le pilier sur lequel se repose une
activit conomique et sociale trs ancienne. Lirrigation est assure par lexploitation dune ressource
collective et gre par tour deau. Diffrents systmes dirrigation font la gloire de ces rgions. Une
irrigation de submersion prdomine dans ces oasis.Lagriculture, essentiellement de type vivrier, avec
son rle identitaire, dquilibre et de stabilit rgionale, est considre comme tant la principale
activit conomique dune population en constante volution. Dune agriculture de subsistance, on
passait une agriculture de march de proximit. Ce passage est la rsultante directe de
laugmentation de la population et de sa diversit do une adaptation aux nouvelles conditions du
milieu. Ces adaptations se traduisent par lintroduction de nouvelles varits, voir de cultures
mconnues ou non pratiques grande chelle auparavant par les agriculteurs.Nanmoins, ces oasis,
avec leur complexit et leur fragilit, sont menaces par la disparition. Dinnombrables contraintes
sont lorigine de cette possible disparition, notamment lexcs deau, labsentisme et
lenvahissement du bton.Stimul par la dcouverte du ptrole et les diffrents programmes et plans de
dveloppement, Ouargla est devenu le centre vital de lindustrie ptrochimique du pays. Ce qui lui
permet dattirer une main duvre locale et trangre trs importante, favorisant par l son
dveloppement.Dans le contexte dtalement urbain et de transformation socioconomique des
espaces oasiens, lagriculture qui, sous la contrainte de lurbanisme et de la pression foncire, peut
jouer un rle de rgulateur (agriculture priurbaine) et peut aussi avoir des capacits de rsistance et
dadaptation (multifonctionnalit agricole, innovation).Le territoire perd, au fil du temps, ces
caractristiques ksouriennes et agro-rurales pour devenir de plus en plus urbanis que des annes
passrent. Dans le cadre de notre prsente tude, nous essayerons danalyser les processus dabandon
et/ou de dgradation des oasis de la rgion de Ouargla sous leffet double de lurbanisation et du
phnomne dmigration de la main duvre jeune ainsi que les remdes pouvant tre prconiss pour
la sauvegarde de ce systme millnaire.Ces oasis ont travers les sicles est-ce pour les voir chouer
enfin, vers lge des technologies et dInternet, sur le rivage dune croissance urbaine des plus
monstrueuses qua connu le Sahara algrien ? Le sauvetage de ces oasis est-il possible aujourdhui ?
Sagit-il dune simple opration de revivification des oasis , de grands travaux , de
rhabilitation de la palmeraie ou plutt dun projet de dveloppement durable, intgr,
pluridisciplinaire, associatif et sinscrivant dans la logique de la prservation et de la continuit dun
savoir faire ancestrale que nos aeux ont acquis durant des sicles dans des conditions rudes.

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
13
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Mots cls : durabilit, systeme oasien, Ouargla.

O21
LA GESTION DES AGRO SYSTEMES OASIENS: DIAGNOSTIC ET PROGRAMME
D'INTERVENTION. CAS DE L'OASIS DE HASSI BEN ABDALLAH.
BOUAMMAR B., SLIMANI S., IDDER T.

Laboratoire de protection des cosystmes en zones arides et semi arides
bouammar1959@yahoo.fr

Le prsent travail consiste connatre la vritable dimension des problmes de l'activit agricole dans
la zone de Hassi Ben Abdallah, essayer de rpondre une demande prsente par les lus locaux de
cette commune et prsenter un programme d'intervention apte prsenter des solutions et des
principes de bonne gestion des cosystmes dans la zone. Comme il vise aussi tester la mthode de
diagnostic rapide en milieu oasien. Le diagnostic de la zone a permis d'identifier 3 contraintes
majeures : la gestion de l'eau d'irrigation, l'amnagement des primtres et des exploitations et
l'insuffisance des revenus. Des tudes thmatiques ont permis de mettre en vidence les causes et les
consquences de ces contraintes (l'arbre problmes) et de proposer finalement un plan d'action et des
recommandations pour une meilleure gestion des cosystmes dans la zone.
Mots cls: diagnostic, cosystme, amnagement, gestion de l'eau, gestion des cosystmes.
**************************************

Thme 2 - Elevage camelin
O22
ETUDE DE LA COMPOSITION MINERALE DU LAIT DE CHAMELLE
COLLECTE DANS LE SUD-EST ALGERIEN

BOUDJ ENAH.S
1
, KADRI M
1
, SIBOUKEUR O.E.K
1
, MATI A
2


1
Laboratoire de protection des cosystmes en zones arides et semi arides, Universit de Ouargla, Algerie
2
Laboratoire de biochimie applique, Universit Mouloud Mammeri de Tizi Ouzou, Algrie
harunsali@yahoo.fr

Afin dtudier la composition minrale du lait de chamelle du Sahara septentrionale, des chantillons
du lait sont collects partir des troupeaux de dromadaires vivant en levage extensif dans des
parcours naturels de trois Wilayat sahariennes : Ouargla, El-oued et Ghardaa Un test la rductase a
montr que les trois laits prsentent une bonne qualit microbiologique. Les principaux paramtres
physico-chimiques ont t mesurs, tels que le pH, la densit, le taux de la matire sche, la teneur en
cendres et la conductivit lectrique. Les rsultats obtenus ont rvel une lgre diffrence entre les
trois laits Pour Les lments chimiques doss, sont dune part les lments majeurs (sodium,
potassium, calcium, magnsiumet de lautre les oligo-lments (fer, cuivre, zinc, fluor et plomb).
Daprs les rsultats, les teneurs en lments majeurs sont trs leves et sont trs proches de celles du
lait bovin, par contre les concentrations les plus leves en oligo-lments sont obtenues pour le lait
de chamelle, en comparaison avec le lait bovin et humain.

Mots cls : Lait, chamelle, lments majeurs, oligo-lments, Ouargla, El-Oued, Ghardaa.

**************************************




Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
14
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr


O23
INFLUENCE DU SEXE, DE LAGE ET DE LA SAISON SUR CERTAINS
PARAMETRES BIOCHIMIQUES DU DROMADAIRE DANS LE SUD-EST
ALGERIEN

M. TITAOUINE
1
, H. MOHAMDI
1
, T. MEZIANE
2


1
Dpartement biologie, facult des sciences, universit de Biskra -Algrie
2
Dpartement vtrinaire, facult des sciences, universit de Batna-Algrie
yassinevet@yahoo.fr

Dans le but dune meilleure connaissance de la zootechnie et la biologie du dromadaire dans le Sud-
Est Algrien, les principaux paramtres biochimiques de cette espce (Camelus dromedarius) ont t
values dans 52 prlvements sanguins provenant de 11 mles et 15 femelles, et subdiviss en trois
groupes dge de 1 18 ans. Les valeurs et leurs variations physiologiques en fonction de lge, du
sexe et de la saison ont t doses pour le calcium(Ca), le phosphore (P), le magnsium(Mg), le
sodium (Na), le potassium (K), le fer (Fe), le glucose, les lipides totaux, les triglycrides (TG), le
cholestrol, lure, la cratinine, les protines totales et lalbumine. Nos rsultats ont montr des
valeurs qui concordent avec la littrature et ont permis dtablir les limites des valeurs et leurs
variations physiologiques. Des variations statistiquement significatives (test de Student) ont t
retrouves:
- En fonction du sexe pour le glucose, les lipides totaux, TG, cholestrol, lure, albumine, cratinine
et Na,
- En fonction de lge pour le glucose, les triglycrides, Ca, P, K et Mg
- Et en fonction de la saison le glucose, TG, cholestrol, les lipides totaux, lure, les protines totales
et Fe
De tels rsultats sont prendre en considration par les praticiens pour la dtection prcoce des
dsordres mtaboliques et nutritionnels chez le dromadaire.

Mots cls : dromadaire, paramtres biochimiques, sexe, ge, saison, zootechnie

**************************************
O24
ETUDE DE LAPTITUDE A LA COAGULATION DU LAIT CAMELIN AVEC
LES ENZYMES EXTRAITES DE CAILLETTES DE DROMADAIRES ADULTES
EFFETS DE DIFFERENTS MODES DE CONSERVATION SUR LACTIVITE
ENZYMATIQUE

MAHBOUB N
1
, SIBOUKEUR O
1
, BOUDJENAH S
1
, TELLI A
1
, SLIMANI N
2

MATI A
3

1
Laboratoire de protection des cosystmes en zones arides et semi arides. Universit de Ouargla, Algrie
2
Laboratoire de Bio ressources sahariennes : prservation et valorisation. Univ. K. M. de Ouargla. (Algrie)
3
Laboratoire de Biochimie Analytique et Biotechnologie ; Univ. M. M. Tizi Ouzou,. (Algrie)
bioch_nasma@yahoo.fr

Plusieurs essais ont t conduits dans le but damliorer la coagulation du lait camelin en utilisant des
enzymes coagulantes de diffrentes origines. Dans ce contexte, nous nous sommes proposs dtudier
leffet des enzymes extraites partir de caillette de dromadaire sur la coagulation du lait de chamelle
et de suivre la variation de leurs activits coagulante et protolytique en fonction de mode de
conservation (rfrigration et conglation) et de la dure de conservation de ces extraits (pendant 23
semaines). Dans un premier temps, une analyse physico-chimique du lait a t ralise et les valeurs
(6,650,13) ; (21,31,44) ; (1,0270) correspondent respectivement au pH, lacidit titrable et la
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
15
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
densit. Dun autre terme, une extraction denzyme gastrique par une technique approprie a t
effectue sur deux types de caillettes (caillette A sans muqueuse et la caillette B avec muqueuse) pour
obtenir les extraits dnomms respectivement ECD
A
et ECD
B
. Le dosage des protines totales relatif
aux deux extraits est de 807,5 et 735 g/ml. A la lumire des rsultats, les ECD
A
congels pendant 14
semaines sont caractriss par les meilleures activits : coagulante et protolytique avec
respectivement les valeurs de 0,277 UP et de 0,478.

Mots cls : lait camelin, activit coagulante, activit protolytique, caillette, conservation.

**************************************
O25
STRATEGIES DE VALORISATION DES RESSOURCES ALIMENTAIRES DE
LECOSYSTEME SAHARIEN PAR LE DROMADAIRE

CHEHMA A
1
et FAYE B
2


1
Laboratoire Bio ressources sahariennes. Prservation et valorisation , Universit de Ouargla (Algrie).
2
CIRAD-EMVT Montpellier (France)
achehma@gmail.com / madjidchehma@yahoo.fr

Lcosystme saharien est caractris par des conditions dapho-climatiques trs rudes et trs
contraignantes, ne permettant le dveloppement que dun couvert floristique particulirement adapt
(plantes lignifies, halophytes, pineuses). Dans cet environnement aux maigres ressources, le
dromadaire exprime des capacits remarquables dadaptation lui permettant de valoriser au mieux les
ressources disponibles des cosystmes sahariens. En effet il arrive survivre, se reproduire et mme
produire (viande, lait etc.) selon un mode dlevage extensif bas totalement sur lexploitation
naturelle de ces parcours sahariens. Le prsent travail fait une synthse des diffrentes caractristiques
digestives, alimentaires et comportementales de cette espce dont lensemble donne sens la notion
dadaptabilit du dromadaire aux cosystmes dsertiques. Ces facults dadaptation peuvent se
dcliner selon deux types de stratgie : (i) une stratgie physiologique (stockage, conomie des
dperditions, recyclage), (ii) une stratgie comportementale (pturage dambulatoire, espacement des
priodes dabreuvement, slection des plantes, diversit floristique de la ration). Ces stratgies,
ajoutes aux particularits anatomiques de lanimal (pied souple impliquant un faible pitinement,
long cou permettant laccs aux strates suprieures de la vgtation) en font un animal faible impact
environnemental.

Mots cls : Dromadaire, Ecosystme saharien, Adaptations, Ressources alimentaires.

**************************************
O26
ETUDE DE L'ACTIVITE ANTIMICROBIENNE DE BACTERIES LACTIQUES ISOLEES A
PARTIR DE LAIT DE VACHE, DE CHEVRE, DE BREBIS ET DE CHAMELLE VIS A VIS
D'ESCHERICHIA COLI

Amel DOUMANDJI
1
et Nabil SAIDI
2


1
Dpartement des Sciences Agronomiques, Universit Sad Dahlab, Blida, Algrie
2
Unit de Recherche et Dveloppement de lIntendance, Algrie
nabil_1210@hotmail.com . corino147@yahoo.fr

Vingt souches de bactries lactiques ont t isoles, purifies et identifies partir de lait de
diffrentes espces animales. Ces souches appartenant deux espces Streptococcus thermophilus et
Lactobacillus bulgaricus, ces dernires produisent des substances antimicrobiennes qui sont actives
dans le surnageant de culture, par consquent, la substance antimicrobienne est un mtabolite
extracellulaire. La souche Lactobacillus bulgaricus isole partir du lait de chamelle (Lb. 4) prsente
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
16
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
une forte activit bactricinogne sur Staphylococcus aureus avec une zone dinhibition gale 31
mm, alors que cette souche est moins active contre Escherichia coli 23 mm. Lactivit bactricinogne
de la souche Lb.4 se retrouve exclusivement dans le milieu de culture. On a donc formation de
substances extracellulaires. L'tude de bactriocines produites par Lb. bulgaricus et Sc. thermophilus
l'gard d'E. coli et deS. aureus entropathognes pourrait aboutir leur utilisation dans le domaine
thrapeutique contre les infections gastro-intestinales chez les l'hommes et les animaux. Les
bactriocines sont surtout actives sur les pathognes Gram+et agissent en formant des pores dans la
membrane cytoplasmique qui entranent des perturbations des fonctions cellulaires. Quel que soit le
temps de traitement thermique 100C, le surnageant garde son activit antibactrienne et la zone
dinhibition dpasse 2 mm.

Mots cl : laits, Streptococcus thermophilus, Lactobacillus bulgaricus, bactriocine et Escherichia
coli.

O27
ANALYSE PHYSIOLOGIQUE, GENETIQUE ET MOLECULAIRE DE
LACTOCOQUES ISSUS DE LAIT CRU DE CHAMELLE

Habiba DRICI

Universit dOran, Algrie
habibasiham@yahoo.fr

Le lait de chamelle est un cosystme bactrien trs peu explor dont nous avons isol 180 souches
protolytiques, capables dhydrolyser les casines du lait. Cinq isolats avec une forte activit
protolytique et capables de fermenter le citrate ont t identifis Lactococcus lactis subsp. Lactis
biovar diacetylactis. Ces lactocoques possdent au moins 3 plasmides (pPRT, pLAC, pCIT) qui
portent respectivement les gnes codant pour la protase de surface PrtP (prtP) responsable de
lhydrolyse des casines du lait, le mtabolisme du lactose (lac) et du citrate (cit). Chez 3 isolats, au
lieu de lopron citQRP habituel des biovariants diacetylactis, le cluster citI-citMCDEFGRP a t
acquis dautres bactries lactiques (Leuconostoc). Loriginalit de lisolat 9B rside aussi dans sa
capacit se dvelopper 50C et une spcificit dhydrolyse des casines diffrente de celles des
PrtPs de type PI et PIII des lactocoques laitiers actuellement connus. Cette spcificit nouvelle (type P
IV) pourrait sexpliquer par la prsence de nombreuses substitutions parmi les 1775 acides amins de
la protease mature. Cette tude a mis en vidence la diversit gntique des lactocoques issus du lait
de chamelle qui se traduit par de nouvelles proprits intressantes pour lindustrie laitire.

Mots-cls : Bactrie lactique, Lactococcus lactis subsp. lactis biovar diacetylactis, plasmide citrate,
protinase PrtP, thermotolrance.

**************************************
O28
CONTRIBUTION A LA CONNAISSANCE DE LA POPULATION CAMELINE
FEMELLE TERGUI DANS LA WILAYA DE TAMANRASSET

LONGOHAMMOUDA F.H
1
, TOUMI .K
2
, MOUATS.A
3
, BENLAMNOUAR.N
4

1
Institut National Agronomique dAlger, Dpartement de Zootechnie
2
Institut Technique de Developpement des Elevagese Baba Ali-Alger, Algrie
3
Dpartement de Physiologie, Universit de Mostaganem, Algrie
4
Direction des Services Agricoles, Tougourt, Algrie
fhlongohammouda@yahoo.fr

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
17
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Dans la perspective de la connaissance et de la prservation de la population cameline tergui dans
la wilaya de Tamanrasset et, plus exactement, dans la rgion de lAtakor, 25 leveurs ont t recenss
dont la taille des troupeaux varie de 1O plus de 5O ttes. Les leveurs sont rpartis sur trois (O3)
zones : In-Amguel, Sill et Tamanrasset. Lenqute mene a concern un total de 66 femelles. Cette
tude nous a permis didentifier deux rameaux de la population cameline tergui savoir, le MEHRI
et le MERROUKI.

Mots cls : Population cameline, Tergui, Tamanrasset, Algrie

**************************************
O29
CARACTERISATION PHYSICO-CHIMIQUE DU LACTOSERUM ET RECUPERATION
DES PROTEINES PAR ULTRAFILTRATION AVEC UNE MEMBRANE EN
POLYETHERSULPHONE

LACHEBI Samia
1
, YELLES F
1
, BELAKROUF A
2

1
Laboratoire de recherche technologie alimentaire et environnement, Universit de Boumerdes, Algrie
2
Laboratoire de recherche gnie de matriaux, Universit de Boumerdes, Algrie
Samia_lachebi@yahoo.fr


La quantit du lactosrumproduite chaque anne, partir de 20000 litres de lait mis en uvre par jour
pour la fabrication de camembert tassili, a t estime 5 840 000 litres soit 581 605. 6 kg dlments
nutritifs qui sont purement et simplement vacus dans les effluents de la laiterie de Draa Ben Khedda.
Lanalyse biochimique du sruma permis de mettre en vidence des aptitudes nutritionnelles trs
intressantes pour lalimentation humaine. En effet, le lactosrumest caractris par sa richesse en
matire sche reprsentant 67.02 % des lments nutritifs originaires du lait. Il est riche en lactose,
protines, matire grasse et lments minraux reprsentants respectivement 64.34 %, 5.63 %, 2. 55%
et 8.35 %. Et dautre part daprs les valeurs trs leves obtenues de la DCO (127 712 mg dO
2
/l) et
la DBO
5
(49333.32 mg dO
2
/l), nous pouvons affirmer que ce sous produits est un facteur de pollution
trs redoutable de lenvironnement donc Il serait ncessaire de le valoriser. Lobjectif de notre tude
vise rcuprer les protines du lactosrumpar le procd dultrafiltration et de rduire ainsi le
caractre polluant de ce sous produit par lutilisation dune membrane en PES te de 10KDa de seuil de
coupure. Linfluence de la pression transmembranaire sur le flux de permeation sera tudie et le taux
de rtention des protines ainsi que lvolution du colmatage de la membrane seront dtermins.

Mots cls : Lactosrum, techniques membranaires, protines du lactosrum, ultrafiltration,
membranes.

**************************************
O30
LES PARCOURS SAHARIENS ; ENTRE USAGE ET ENJEU ! CAS DE LA REGION
DE GHARDAIA

SENOUSSI Abdelhakim et BENSEMAOUNE Youcef

Laboratoire Bioressources Sahariennes, Universit KASDI MERBAH Ouargla, Algrie
SENOUSSI.HAKIM@yahoo.fr

Le Sahara, espace caractris par un dficit hydrique permanent, peru par certains comme
tant un territoire inculte et rpulsif et que par ailleurs le dveloppement du monde vivant a
des exigences aussi bien quantitatives que qualitatives lgard de leau. Lutilisation
rationnelle de cette ressource est une ncessit absolue et que la ralit claire que cet
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
18
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
cosystme demeure par excellence un milieu qui grouille de vie o des animaux et des
vgtaux sont adapts par des mcanismes et des adaptations dordre morphologiques,
anatomiques et physiologiques pour emmagasiner leau et diminuer la transpiration. Sur les
40 millions dhectares de parcours que recense lAlgrie, on dnombre 28 millions de type
saharien o le cortge floristique de chaque formation est spcifique (lits doueds, dayas,
hamadas, ergs, regs) compos de plantes vivaces et dautres phmres qui germent aprs les
pluies et accomplissent en quelques jours tout leur cycle volutif. La prsente tude montre
que cet espace a subit plusieurs contraintes notamment dordre anthropique, o le systme
dlevage extensif a rgress cause de lvolution du mode de vie des leveurs, savoir du
nomadisme (25%) au semi-nomadisme (60%) et enfin la sdentarisation (15%). En ce qui
concerne le mode dexploitation des espaces de parcours, 60% des leveurs les surexploitent,
corollaire dun surpturage caus par une surcharge et de l leur dgradation. Ainsi donc,
laugmentation des superficies agricoles qui ont progress au dtriment de lespace des
parcours. Ce dernier est pass de 21742 ha en 2006 26436 ha en 2007, soit une diminution
de lordre de 4694 ha. Autrement dit, les nouveaux primtres agricoles viennent en prdation
sur cet espace rvl dsormais par une soustraction bien marque de sa surface. Devant cette
situation alarmante et devant la fragilit du milieu saharien, nous admettons que lespace
pastoral saharien nous interpelle travers un amnagement et une gestion patrimonieuse dans
une perspective de durabilit. Pour se faire, un S.A.G.E. pratique est propos incarnant des
actions faisables.

Mots cls : Sahara Septentrional, Parcours, Usage, Contraintes, S.A.G.E.

**************************************
O31
CHARACTERIZATION OF THERMOTOLERANT COCCI FROM INDIGENOUS
FLORA OF FERMENTED MILK IN ALGERIAN ARID AREA AND DNA
IDENTIFICATION OF ATYPICAL Lactococcus lactis strains

Farid BENSALAH
1
, Christine DELORME
2
, Pierre RENAULT
2

1
Facult des Sciences, Dpartement de Biologie, Universit Es-Snia., Oran, Algrie
2
Gntique Microbienne, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78352 Jouy en
Josas CEDEX, France
bensalahfarid@yahoo.fr

Lactic acid bacteria are widely used in food industry and their growth performance is important for the
quality of the fermented product. By combining results from conventional isolation methods and
molecular investigation of 16S rRNA gene and lactococcal/enterococcal specific genes, we identify at
species level catalase negative grampositive thermoresistant cocci isolated fromtraditional leben, a
24-h fermented milk in arid area of west Algeria. 40 strains phenotypically related to cocci LAB were
identified as belonging to the species Lactococcus lactis ssp. lactis, Enterococcus faecalis,
Enterococcus faecium, and other Enterococcus species. No Streptococcus thermophilus strain was
isolated. Ten different phenotype groups were recognized, and the species content of these groups
were in some cases different from the expected features usually given in genus and species
descriptions. In particular, atypical lactococci, able to grow in 6.5% NaCl, at pH 9.5 and showing high
resistance to thermal stresses were isolated. Lactococci, but also enterococci isolated fromtraditional
leben produced in the desert area may be therefore of interest in milk fermentation. Further studies to
assess this source of diversity within the wild microbial population should provide starter new strains
for product innovation.

Key words: arid area, fermented milk, thermotolerant bacteria, DNA, biopreservation, product
innovation
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
19
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************

O32
INCIDENCE DE Listeria spp. ET AUTRES BACTRIES PATHOGNES DANS LE LAIT
CRU BOVIN RECOLT DANS LE SEMI-ARIDE ET LE NORD EST ALGERIENS

Abdelhafid BOUBENDIR
1
, Abdelhafid Mohamed HAMIDECHI
1
, Saad IBN SOUDA KORAICHI
2
,
Mohamed MOSTAKIM
2

1
Universit Mentouri, Constantine, Algrie
2
Laboratoire de Biotechnologie Microbienne, USMBA, Fes, Maroc
a.hafid.bio@gmail.com

Peu de travaux ont t consacrs ltude Listeria spp. en Algrie, et nulle dans la zone du Semi-
Aride. Dans notre travail nous tudions lincidence deListeria spp. et autres bactries pathognes dans
le lait cru bovin, rcolt en Algrie dans le Semi-Aride (Rgion de Biskra) et le Nord-Est (Rgion de
Mila), ce si dans le but de:
-Analyser la diversit floristique bactrienne du lait cru.
-Dceler une ventuelle influence saisonnire sur lincidence bactrienne.
-Dceler une ventuelle influence de la rgion sur lincidence bactrienne.
-Evaluer linfluence des facteurs de lenvironnement : temprature et humidit, sur la flore bactrienne
du lait rcolt.
-Analyser le risque infectieux de Listeria sp. et autres bactries pathognes dans le lait cru dans les
deux rgions.
Parmi 50 chantillons de lait cru bovin analyss jusque l, la frquence de Enterococcus spp. tait de
12%, Listeria spp. 8%, Staphylococcus spp. et Acinetobacter spp. 6%, Proteus spp., Pseudomonas
spp. et Aeromonas spp 4%.
L'isolement a t ralis par stockage froid 4C durant 3 semaines, suivi dune culture sur glose
au sang cuit additionne de Cefazoline. L'identification gnotypique a t effectue par squenage du
gne ADNr 16S amplifi par PCR, en prsence d'amorces de gnes universels fD1
(5AGAGTTTGATCCTGGCTCAG3) et Rs16 (5TACGGCTACCTTGTTACGACTT3).
Lefficacit de la PCR est teste sur gel dagarose 1%. Les rsultats du squenage obtenus ont t
confronts par analyse bioinformatique la base de donne BLASTn supporte par NCBI.

Mots cls : Listeria spp., isolement, prvalence, PCR, ADNr 16S.

**************************************
O33
EFFET DES REBUTS DE DATTES COMME COMPLEMENT DAPPOINT SUR LA
PRODUCTION LAITIERE DE BREBIS

L. BOUDECHICHE, C. AISSAOUI, R. OUZROUT

Institut dAgronomie, Centre Universitaire dEl Tarf, BP 73, 36000, EL Tarf, algerie
boudechiche_lamia@yahoo.fr

Une tude a t mene dans le but de connaitre leffet dun complment dappoint base de rebuts de
dattes sur la production laitire de brebis et les performances pondrales de leurs agneaux. Cest ainsi
que 64 brebis de race berbre ont t divises quitablement en 2 lots de 32 animaux chacun : un lot
exprimental et un autre tmoin. Lalimentation des deux lots tait essentiellement base sur les
ressources pastorales que sont les pturages dherbages dune prairie permanente pendant toute
lanne, outre cette ressource, les chaumes de crales constituaient lessentiel de lalimentation
estivale, priode concidant aux deux derniers mois de gestation des brebis durant laquelle le lot
exprimental recevait un complment dappoint son retour du pturage, constitu de rebuts de dattes
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
20
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
raison de 350g/animal/jour et dune valeur nergtique de 1,06 UFL. La production laitire des
brebis estime par des quations incluant les performances pondrales des agneaux montrent que
celle-ci a t plus importante chez le lot exprimental (1,14 vs. 0,88 l/ jour), lagnelage, aucune
diffrence significative na t observe entre les poids des agneaux (P >0,05) tandis que les GMQ
des agneaux du lot exprimental ont t plus consquents avant le sevrage (216,7 vs.167, 6 g/jour)
refltant ainsi la valeur laitire des mres. Les rebuts de dattes constitueraient ainsi un excellent
complment au pturage pour les femelles en fin de gestation.

Mots cls : brebis berbres, rebuts de dattes, pturage, GMQ, complmentation.

**************************************
O34
ETUDE DE LA VALEUR NUTRITIONNELLE DES NOYAUX DE DATTES EN VUE
DE LEUR INCORPORATION DANS LES RATIONS POUR RUMINANTS

L. BOUDECHICHE, C. AISSAOUI, R. OUZROUT

Institut dAgronomie, Centre Universitaire dEl Tarf, BP 73, 36000, EL Tarf, ALGERIE
boudechiche_lamia@yahoo.fr

La prsente tude a pour objet dvaluer la valeur nutritionnelle des noyaux de dattes partir de leur
composition chimique afin denvisager leur incorporation dans les rations pour ruminants. Cest ainsi
que des noyaux appartenant vingt varits de dattes ont t ligibles des analyses de la composition
chimique (matire sche, protines brutes, fibres au dtergent neutre et cellulose brute) selon
diffrentes mthodes internationales. Le calcul de leurs valeurs nutritionnelles sest bas sur les
mthodes INRA France (1981). Leur richesse en parois (NDF) qui reprsentent 82% 92% de la
matire sche en parois totales limiteraient, probablement, leur digestibilit, de mme, leur dficit en
protines (max 7%) suggrent leur traitement par diffrents agents (soude, ure) pour y remdier. Nos
rsultats suggrent lutilisation des ces noyaux comme concentr nergtique, ils se prteraient ainsi,
aussi bien pour la production laitire (en moyenne 0,98 UFL) que de viande (en moyenne 0,93 UFV).

Mots cls : Noyaux de dattes, ruminants, valeur nutritionnelle, rations, composition chimique.

**************************************
O35
PRODUCTION SYSTEMS AND DAIRY PRODUCTION OF SUDAN
CAMEL (Camelus dromedarius): A Review

EISA, M. O and MUSTAFA, A. B.

Dept. of Animal Production-Faculty of Agriculture, Omdurman Islamic University
P.O. Box 382 - Postal code 14415, Khartoum-Sudan
University of Juba, P.O. Box 12327, Khartoum, Sudan.
alhagmo33@gmail.com
Sudan ranks first among the Arab countries and second in Africa with respect to animal population.
The Sudan is considered as the second country in the world in camels population (more than 4
millions). The history of the dromedary camel in the Sudan is even more obscure. It is believed to
have entered the Sudan from Egypt. The oldest evidence is a bronze figure of camel with a saddle
found at Merwi and estimated to date between 25-15 B.C. Camels in the Sudan are spread in a belt
configuration; it extends between latitudes 12-16N. This belt is characterized by erratic rainfall, less
than 350 mm. and contains two main regions: the Eastern state, where camels are found in the Butana
plains and the Red Sea hills, and the Western Regions (Darfour and Kordofan). In Sudan the
production systems include: traditional nomadic system, transhumant or semi-nomadic system,
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
21
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
sedentary or semi-sedentary systemand intensive systemwhich is limited to racing and dairy camels.
Camels in most pastoral societies are milked by men (one or two herdsmen). And to prevent calves
fromsuckling at pasture during the day it is common among the nomad, to tie up one or more teat with
special strings. Milk yield of Sudan camel can reach 10 kg/day in the early lactation and good
conditions and declined to 2 kg/day in the late lactation and bad conditions (in best animal) otherwise
it range 5 10 kg / day. Most of the camel milk in the Sudan is drunk fresh, and some times sour
(fermented) (Garis) or with tea (Sbanes). Processing and manufacturing of camel milk in to milk
products like butter, ghee, cheese, ice cream, etc, not found except in some limited research.
Key wards: Sudan , camel , history, population, system , milk yield.

Thme 3- Protection et prservation de lenvironnement
O36
PRESERVATION OF THE GHOUTS IN SOUF
(ALGERIAN SAHARA)

MEZIANI Assia
1
, KALLA Hadda
2
, KALLA Mehdi
3

1
Member of L.R.N.A.T laboratory- University of Batna, University Center of El-Oued, Hydraulic Department,
El-Oued, Algeria
2
Member of L.R.N.A.T laboratory, Earth sciences department, University of Batna, Batna, Algeria
3
Director of L.R.N.A.T laboratory, Earth sciences department, University of Batna, Batna, Algeria
meziani.assia@yahoo.fr

Souf is an arid region located in the Algerian northern Sahara, its characterized by a very hilly relief
and its covered of dunes chains. Its a difficult region for agriculture in reasons of its sand winds, the
raised temperature of the water drillings (55- 60C) and its bad quality of the superficial waters. The
dominant plantation of the inhabitants is the peanut, tobacco and particularly the traditional culture of
the palmtrees in the Ghouts adjoining the number of 10 000. The important extension of the
agriculture lands required increase of waters in the region. To face the increasing needs of water, the
drillings are reaching the deep groundwater (Continental Intercalary, CI, and the Complex Terminal,
CT) have been achieved. The overexploitation of the groundwater resources caused the groundwater
rise problem and provoked inundation of important number of the Ghouts: 950 flooded Ghouts, 2100
humid Ghouts and 6547 dry Ghouts about 742525 palms of which 231540 are affected, the percentage
of affected palms is 34,76. To save this traditional agriculture system of Ghouts some solutions have
been proposed to preserve the patrimony of the region.

Key words: Preservation, Ghouts, Souf, Sahara, Algeria.

**************************************
O37
ACCUMULATION DES METAUX LOURDS CHEZ LE PEUPLIER; LOCALISATION
TISSULAIRE ET EXPRESSION DE QUELQUES TRANSPORTEURS

MIGEON Aude, BLAUDEZ Damien, GUINET Frdric, CHALOT Michel et BOTTON Bernard

Universit Henri Poincar, Nancy 1, Facult des Sciences et Techniques
IFR 110 Gnomique, Ecophysiologie et Ecologie Fonctionnelles, Unit Mixte de Recherche INRA-UHP 1136,
Interactions Arbres-Microorganismes B.P. 70239. 54506 Vandoeuvre-Les-Nancy Cedex, France
Bernard.Botton@scbiol.uhp-nancy.fr

Chez les vgtaux, des lments non essentiels comme le Cd et le Pb peuvent tre absorbs et
constituer un danger potentiel car ils entrent dans la chane alimentaire. Les lments traces comme le
Zn, Fe, Cu, Co, Mn, Mo et Ni sont ncessaires aux processus biologiques, mais leur accumulation
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
22
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
excessive peut tre toxique. Dans le cadre de cette tude il a t montr que le Peuplier (Populus spp.)
pouvait accumuler de relativement fortes concentrations de certains mtaux (Cd, Zn et Ni) par rapport
d'autres espces ligneuses. Diffrents cultivars ont t tests en culture hydroponique et il a t
montr que les hybrides de Populus trichocarpa accumulaient davantage que les autres. Ces hybrides
ont t implants sur deux sites pollus et il en rsulte que, combin la production d'une forte
biomasse qui peut tre utilise pour produire de l'nergie, le caractre accumulateur du Peuplier, fait
de cet arbre un bon candidat pour la phytoremdiation. Une tude de localisation tissulaire des mtaux
dans les feuilles et les tiges de Peupliers soumis une polycontamination mtallique a galement t
entreprise par Microscopie Electronique Balayage (MEB) et Spectromtrie de Masse Ionisation
Secondaire (SIMS). Cette dernire technique a permis de montrer que le Zn tait essentiellement
concentr au niveau du msophylle. Afin d'analyser quelques dterminants de la tolrance aux mtaux,
des mesures d'expression et de caractrisation fonctionnelle de transporteurs appartenant la famille
CDF (Cation Diffusion Facilitator) ont t ralises dans diffrents tissus et dans diffrentes
conditions physiologiques. La spcificit des gnes exprims et leur localisation ont t tudies,
respectivement par complmentation fonctionnelle et par expression htrologue la suite d'une fusion
GFP, chez la levure. Ces techniques ont permis de mettre en vidence un transporteur de Zn (PtMTP2)
et un transporteur de Mn (PtMTP9).

Mots-cls: Cation Diffusion Facilitator, Mtaux lourds, Phytoremdiation, Populus spp.,
Transporteurs

**************************************
O38
RISQUE DE CONTAMINATION DES EAUX SOUTERRAINES ET DU SOL DE LA
PLAINE DEL MA EL ABIOD PAR LES REJETS ATMOSPHERIQUES ISSUS DE
LINDUSTRIE CIMENTIERE .CAS DE LA CIMENTERIE
ERCE.TEBESSA.ALGERIE

HAMIRI. Manel
1
, GOUDJIL.Taher
1
, ROUABHIA. Abdelkader
2
, AOUIMEUR .Meriem
1

1
Dpartement de biologie, universit de Tbessa. Algrie.
2
Dpartement dhydrogologie, universit de Tbessa. Algrie.
E-mail : manalhmi@yahoo.fr

La pollution est devenue un problme crucial en Algrie surtout dans les zones industrielles comme la
plaine dEl Ma El Abiod, cette dernire situe au sud-est de la ville de Tbessa, au nord-est de
lAlgrie, vocation essentiellement agricole, a connu un dveloppement industriel important surtout
la cimenterie ERCE, avec pour consquences des rejets abondants non traits dans le milieu physique.
La prsente tude traite leffet des rejets atmosphriques de la cimenterie sur les proprits physico-
chimiques des eaux souterraines de la plaine, et sur la qualit du sol et limpacte sur lenvironnement
notamment ceux qui concernent les poussires de llctrofiltre de la cimenterie. Ltude est bas sur :
o Lanalyse chimique du sol de la plaine
o Lanalyse chimique de la poussire locale prleve lintrieur de la cimenterie
o Lanalyse chimique de la poussire rgionale dgage par la cimenterie dpose sur des bacs
placs autour de la cimenterie suivant un rayon de 4 Km
o Lanalyse granulomtrique de la poussire de llctrofiltre
o Lanalyse physico-chimique des lixiviats obtenus par les essais des lixiviations de la poussire
o Lanalyse physico-chimique des eaux souterraines.
Les rsultats ont montr que le sol de la plaine est contamin par les poussires dgages par la
cimenterie surtout provenant de llctrofiltre riche en carbonate de calcium et en silice. On a trouv
un taux trs lev des lments : chlorures, Na
+
, k
+
, Mg
2+
, SiO
2
, Ca
2+
,

sulfates dans leau ce qui
confirme la dgradation de la qualit de eaux souterraines par les poussires de la cimenterie et les
gaz issus de la combustion du gaz naturel.

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
23
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Mots cls : Sol, Eau souterraine, Rejets Atmosphriques, Poussire, Pollution, Plaine dEl Ma El
Abiod.

**************************************

O39
ETUDE EXPERIMENTALE DU COLMATAGE DANS LA FILTRATION BIOLOGIQUE
SUR LES SABLES DE DUNE (CAS DE OUARGLA)

GHERAIRI Yamina
1
,

TOUIL Youcef
1
, HAMDI AISSA Belhadj
1-2

1
Laboratoire de Biogochimie des Milieux Dsertiques, Universit de Ouargla, Algrie
2
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides Universit de Ouargla, Algrie
Gherairi_yamina@yahoo.fr

Dans la rgion de Ouargla les rserves en eaux sont reprsentes essentiellement par les nappes
profondes ; souvent inrenouvelables. Cependant, aprs utilisation de ces eaux (sans aucun traitement)
sont vacues dans un systme ferm, ce qui prsente un risque naturel sur la sant publique et met en
pril la durabilit de l'agriculture et l'environnement. D'autre part la rgion de Ouargla est trs riche en
gisement de sable dunaire; la majorit de ces sables rpondent du point de vue caractristique aux
normes des filtres biologiques des eaux uses. La filtration biologique sur sable est considre parmi
les mthodes efficaces, pour lpuration des eaux uses. Cependant le filtre soumis au cours de son
fonctionnement au phnomne du colmatage, ce qui dfavorise le procd de filtration. Pour cette
raison, notre tude a pour but danalyser ce phnomne : les causes de son apparition, ses types et leur
emplacement. On a construit plusieurs filtres de mme dimensionnement et de mmes caractristiques.
Ltude du colmatage se fait en fonction du temps tout au long de la profondeur des filtres. Il est
constater travers cette tude que le filtre sable soumis au colmatage progressivement. Ce colmatage
est class en trois fragments : mcanique, physique et organique.

Mots cls : filtration biologique, sable de dune, colmatage, Ouargla.

**************************************
O40
LA DURABILITE DES ECOSYSTEMES AGRICOLES : APPROCHES
ENVIRONNEMENTALES ET HYDRODYNAMIQUES : IMPACT ET GESTION DE
LA MISE EN VALEUR

KAHELSEN cherif

Universit KASDI MERBAH Ouargla
ka_cherif_dz@yahoo.fr

En agronomie saharienne, une grande partie des primtres sujets la mise ne valeur dpend des
ressources en eau et en sol. Dans un climat aride, les units de production agricole dpendent des
ressources en eau sous terraines o les rendements agricoles en sont en affinit. Dans la mosaque
agricole saharienne la salinit des sols fait diminuer les rcoltes et rduit la gamme de cultures
viables. Les units de production phoenicicole sont sujettes de nombreux alias rendant le sol
improductif lexemple du degr de salinit d des impacts anthropiques comme lorganisation et la
gestion des sols par les cultures mises en place, la gestion de leau par le biais des doses et le
calendrier dirrigation, la conception et le fonctionnement des rseaux de drainage et des systmes
dirrigation avec la composition en importance en sels ( Na
+
, Cl
--
,.)

Mots cls : Mise en valeur, Eco-systme, gestion, salinit, unit de production phoenicicole.

**************************************
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
24
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O41
LA VULNERABILITE DES SYSTEMES OASIENS :
CAS DE BOUSSAADA (ALGERIE)

GRECU F
1
, ABDELLAOUI A
2
, VISAN G
1
, VISAN M.
1
et DOBRE R
1


1
Universit de Bucarest ;
2
Universit de Paris12, France

La ville de Boussada est situe proximit du cordon dunaire et, comme de nombreuses oasis de la
zone prsaharienne, flanc de montagne (rempart naturel de protection) ; elle a par ailleurs connu
cette dernire priode une phase de croissance particulirement soutenue ; la population de Boussada
tait 50800 ha en 1977 et de 66688 en 1987 ; elle passe 102245 ha en 1998. Ceci a induit une
extension importante de la surface urbaine sur des espaces exposs divers alas : inondation,
ensablement, voire glissement de terrain. En particulier, la ville nouvelle est situe lexutoire du
cordon dunaire au sud des Zahrez Gharbi et Chergui et proximit de loued Maiter qui reprend les
sables oliens. Dautre part, sur la rive droite (et sur le lit majeur) de loued Maiter, a vu le jour un
quartier de constructions illicites qui sera rgularis. Ce quartier se situe galement sur la faille Nord
Atlasique qui nest pas une faille franche de niveau 1 mais un relais de failles, donc non visible. La
figure 2 illustre ces trois principaux alas. Le risque densablement est particulirement sensible pour
les extensions du ct ouest ; les effets ne se feront pas sentir forcment en terme de recouvrement
direct par des matires solides ; mais la proximit de zones importante daccumulation de sable et
lexistence de vent violent auront un effet certain sur la qualit de vie des mnages. Les flancs de
montagne ne sont pas amnags comme on le voit sur la figure 2 ; ce qui induit des risques
dboulement sur le bti et la route, non protgs comme on peut le constater. Enfin la figure permet
de voir galement les risques dcoulement deau, les rgimes pluviomtriques tant ceux du climat
semi aride : pluies irrgulires mais torrentielles. Le prsent travail a pour objectif de proposer une
carte des vulnrabilits de la ville de Boussada partir dobservations terrain et de multiples
documents cartographiques et dimages satellitales.

Mots cls : vulnrabilit des espaces ; milieux oasiens ; images satellitales ; ensablement

**************************************
O42
DIMENSIONNEMENT ET CARACTERISATION DES AEROGENERATEURS
POUR LE RENFORCEMENT DES FOUGGARAS DANS LA REGION DADRAR

A. MEHDAOUI, R. MAUEDJ, M. D. DRAOU , M. BELHADJ

Division conversion photovoltaque, Unit de Recherche en Energie Renouvelable en Milieu Saharien, Bp 478
route de rggane, Adrar
Direction des services agrigoles DSA
Mehdaoui_ahmed@yahoo.fr

Dans le cadre du projet de renforcement des foggaras par des systmes de pompage oliens, une
commission technique spcialise URER/MS Adrar (Unit de recherche en nergies renouvelables en
milieu saharien et la DSA (Direction des services agricoles de la wilaya dAdrar) sest rendu sur les
sites des puits existants pour rassembler le maximumdinformations techniques pour mener l'tude de
faisabilit du projet. Dans un premier temps avant daborder ltude proprement dite nous avons
effectu des sorties sur site. Les missions ont touchs un grand nombre de puits de renforcement de
foggaras existants qui sont repartis travers le territoire de la wilaya dAdrar des daras suivants :
ADRAR, SABIT, AOUGROUT, TIMIMOUN, CHAROUINE, ZT KOUNTA, REGGANE,
AOULEF, FENOUGHIL. Nous illustrons dans la figure suivante une olienne installe durant la
priode 1998 qui est en panne et quont projette la remplace par une olienne nouvelle technologie. A
lissue de cette mission nous avons visits plus de 80 sites (puits et foggaras), par la suite et suite au
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
25
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
cahier de charge impos par la DSA, nous avons retenu 33 sites prts et 26 autres sites
supplmentaires sous rserves des travaux. Apres une tude dtaille et en tenant compte des
caractristiques de chaque site (tat et caractristiques dynamiques des puits et de la fouggara, la
hauteur manomtrique total (HMT), distance puit-fougarra, estimation du gisement olien, les besoins
en eau, etc..), et on se rfrant sur les paramtres essentielle de larognrateur ( la puissance
nominale Kw, diamtre du rotor, hauteur du mt, vitesse de dmarrage (m/s), vitesse nominale m/s,
vitesse darrt (m/s)), nous proposons des arognrateurs par gamme de puissance correspondent
un profil de charge et caractristique de chaque site. La gamme de puissance comporte les variantes
suivantes de 1KW, 1.5 KW, 2KW, 2.5 KW, 3KW.
Mots cls : Dimensionnement, caractrisation arognrateurs, fouggaras, Adrar

**************************************
O43
LA RESSOURCE EN EAU ET LES ECOSYSTEMES OASIENS FACE AUX EFFETS
DE LA NEO-AGRICULTURE DANS LE BAS SAHARA : CAS DE LA REGION DES
ZIBAN

L. DJABRI
1
, A. FOUFOU
2
, N. BOUCHHAM
3
, W. CHAIB
3
, R. SLIMANI
3
,
L. BENAOUDA
3
,

W. MERIDJ A
3
et N. SEDRATI
3


1
Laboratoire de contrle de la qualit des aliments et de lenvironnement, Universit de Annaba, Algrie
2
Universit Paul Valrie Montpellier. France
3
CRSTRA. Biskra. Algrie.
djabri_larbi@yahoo.fr

La rgion des Ziban connue jadis par ses dattes et particulirement sa dglet Noure, aujourdhui et
grce lapport des diffrents plans de dveloppement agricoles, elle sest transforme en un
vritable vivier de lAlgrie. En effet la plasticulture sest dveloppe dune manire trs intense. Ce
dveloppement sest accompagn dun accroissement accru de la demande en eau. Par ailleurs la
construction du barrage fontaine des gazelles dune capacit de 55 Hm
3
, a entran une perte
considrable en eau pour la rgion de Biskra, dont la nappe superficielle tait alimente par les eaux
en provenance de la rgion amont (El Kantara, Ain Touta). Lautre consquence rside dans le
dveloppement de la plasticulture dans les rgions tel que El Ghrous, Tolga, qui sont irrigues
partir des eaux de forages captant les eaux du continental intercalaire (CI) et du complexe terminal
(CT), ces deux aquifres peuvent atteindre des profondeurs de lordre de 1200 mtres, qui pose le
problme de leur renouvellement trs lent et trs insignifiant. Cette situation a entrane une baisse des
rserves en eau, en effet le tarissement des sources, la baisse des dbits des forages, la baisse des
niveaux statiques sont des indices trs rvlateurs de la surexploitation. Le recours au partage est la
seule solution pour attnuer la surexploitation et la satisfaction partielle de la demande. Cette solution
est privilgie par les responsables du secteur hydrique, car elle rend le contrle facile. Les
consquences de cette exploitation sont nombreuses, la premire concerne le dstockage de la nappe
superficielle de Biskra la nappe superficielle, ce qui influe ngativement sur lenvironnement, a titre
indicatif, lirrigation se fait par les eaux uses, exposant ainsi la population aux risques de maladies
transmissions hydriques. Le manque dapport en eau barrage dut la mise en service du barrage
Fontaines des Gazelles, constitue une perte sche sur les zones dEl Outaya et Biskra, en accentuant la
salinit des eaux et des sols, les rendant souvent impraticables.

Mots cls : Ziban, Continental intercalaire, complexe terminal, irrigation, Biskra

**************************************





Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
26
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O44
CARACTERISTIQUES MICROBIOLOGIQUES ET PHYSICO-CHIMIQUES DE
LECOSYSTEME HYPERSALE CHOTT MELGHIR

AMAROUCHE-YALA Samia
1
et HACENE Hocine
2


Centre de Recherche Nuclaire dAlger, Algrie.
Laboratoire de Microbiologie/FSB/USTHB, Algrie
sam.wassi.amarouche@gmail;com

Les cosystmes hypersals sont des milieux extrmes nombreux dans le Sahara Algrien. Leur
exploration permet lexploitation des frontires de la vie tout en donnant une autre dimension la
biodiversit du monde microbien. Lcosystme Chott Melghir dans la Wilaya dEl Oued, offre des
conditions extrmes de salinit, de scheresse du climat ainsi que de pollution. Les analyses physico-
chimiques des eaux ont rvl une salinit leve dans les quatre sites non pollus, atteignant 174 g/l
de sel de NaCl, une sursaturation en oxygne et un pH trs alcalin. Dans le site pollu, les indices de
pollution indiquent des teneurs faibles en Nitrates, Phosphates et en DBO
5
ainsi quune turbidit plus
leve au niveau de deux sites : le plus salin et celui pollu. Les analyses des sels dissous montrent une
forte minralisation avec prdominance des Chlorures et du Sodium. Ltude de la pollution
bactriologique dans le site pollu a rvl labsence de Streptocoques fcaux, de Vibrio cholerae et
de Salmonella thyphi. Une prsence importante des espces de Staphylocoques, de Bacillus et de
Pseudomonas, a t notedans les boues du Chott ainsi que dans leau du site pollu. La microflore du
Chott est diversifie : micro-algues, bactries et champignons. Les espces de micro-algues ont
montr une forte prsence au niveau du site pollu (6.10
5
algues/ml) o le degr deutrophisation est
important avec une prdominance des espces de Cyanobactries. Les espces de bactries retrouves
sont celles appartenant aux Archaea et Bacteria halophiles.
La majorit des espces de champignons isoles, a t retrouve dans les boues, en particulier celles
du site pollu et moins sal.

Mots cls : Ecosystme, hypersalinit, pollution, microflore, physico-chimie

**************************************
O45
EFFETS DES VARIATIONS DE PRESSION SUR LA QUALITE DES JETS DE
PULVERISATION ET LEUR CONTRIBUTION AUX RISQUES DE POLLUTION
ENVIRONNEMENTALE

Hassina Hafida BOUKHALFA

Dpartement d'agronomie, Universit Mohammad Kheidar Biskra
hassinaboukhalfa@gmail.com

Un traitement phytosanitaire seffectue en visant un triple objectif: tre efficace, ne pas mettre en
danger loprateur et protger lenvironnement. (MOREAU et al., 1997). La quantit de pesticides
applique chaque anne est estime 2.5 millions de tonnes mais la part de cette quantit qui entre en
contact avec les organismes indsirables est trs faible. La plupart des chercheurs lvaluent moins
de 1% (ELAISSAOUI et al., 2004), ce qui veut dire que 99% des substances chimiques entre en
contact avec le milieu environnant dune manire non cible et sont potentiellement dangereux pour
les cosystmes entiers. D'aprs FAGOT et LARRAT (2002), la pression a un effet direct sur la
rpartition du produit et le volume de bouillie appliqu par son action sur la taille des gouttelettes et
sur l'angle du jet de pulvrisation. Dans le but daccrotre lefficacit de pulvrisation de pesticides et
de rduire les pertes diverses de bouillie qui en rsultent, nous avons tudi linfluence de la variation
de pression sur la forme et la composition dun jet de pulvrisation laide dun pulvrisateur
pression de liquide jet projet avec une buse turbulence. Le travail a t effectue avec 5 valeurs de
pression 0.5 bar, 1 bar, 1.5 bar, 2 bar et 2.5 bar. Les rsultats obtenus nous ont permit d'en dduire que
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
27
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
la pression de 1bar donne la meilleure couverture et rpartition du jet de pulvrisation. A partir de la
pression de 1.5 bar commence la drive, et des pressions plus leves rendent le jet irrgulier et hors
cible. L'augmentation de pression augmente les pertes en bouillie et la quantit de fines gouttelettes.

Mots cls: Pulvrisation, pression, pertes de bouillie, pollution de l'environnement, traitement
raisonn.

**************************************
O46
LA VEGETATION LIGNEUSE DANS SES LIMITES MERIDIONALES ET
L'IMPACT DES ACTIVITES ANTHROPIQUES

AISSAOUI Chadli
1
et AOUADI Asma
2

1
Institut des sciences agronomiques CU d'El-Tarf-
2
facult de biologie ; Universit Badji Mokhtar Annaba
chadaissa@yahoo.fr

Dans le milieu aride, les modifications du couvert vgtal rsultent des contraintes naturelles:
tempratures excessives, temptes de sables, scheresse ou gele persistantes, salinit. A ces
phnomnes adverses, s'ajoutent les conflits d'usage ainsi que les changements de fonds oprs dans la
politique gnrale agricole (APFA, loi du 13 aout 1983, loi 87-19 sur la libralisation du secteur
agricole). Bien avant qu'il n'y ait la convention des Nations Unies sur la lutte contre la dsertification
(CCD 1994), l'Algrie avait lanc, en 1971, un gigantesque projet destin arrter sinon inverser le
processus de dsertification du sud vers le nord par le reboisement d'une bande verte de 25 km de large
environ ; allant de la frontire est (Tunisie) jusqu' la frontire ouest avec le Maroc. De cette bande
verte appele Barrage Vert, il ne reste que le nom. A travers l'espoir du de cet ouvrage, la
communication, qui est un bilan de travaux raliss sur une priode de 30 annes dans la partie
mridionale de l'Est algrien, tentera de montrer les possibilits de faire face la vulnrabilit
cologique du milieu aride, aux risques affirms des changements climatiques annoncs et aux
pressions humaines qui sont l'origine de ces problmes.

Mots cls: Dsertification, milieu aride, climat, vgtation ligneuse.

**************************************
O47
ETUDE DU MECANISME DE REDUCTION DU MATERIAU DELECTRODE ( ET
-PBO
2
) RECUPERE A PARTIR DES BATTERIE USEES, UTILISANT UN
ELECTROLYTE TOUT SOLIDE.

R. FITAS

Laboratoire dEnergtique et dElectrochimie du solide, Dpartement du Gnie des Procds, Facult des
Sciences de lIngnieur, Universit Ferhat Abbas Stif 19000, Algrie.
rachid_fitas@yahoo.fr


Nous avons tudi leffet du dpart de leau de structure par chauffage sur la capacit lectrochimique
de -PbO
2
et -PbO
2
rcuprs partir des accumulateurs au plomb uss. Ltude a t ralise en
utilisant un lectrolyte solide : HSbO
3
.0,55H
2
O. Les rsultats montrent que le dpart de leau de
structure provoque une diminution considrable de la capacit que ce soit pour -PbO
2
ou -PbO
2
. Le
bioxyde de plomb est un oxyde non stchiomtrique contenant dans sa structure des espces
hydrognes (Crystal-gel system). La dure de vie de laccumulateur au plomb dpend de la nature et
la quantit de ces espces hydrognes. Les dioxydes de plomb peuvent tre prpars soit par voie
chimique, soit par voie lectrochimique. Il est connu que PbO
2
prpar par voie chimique est inactif,
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
28
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
par contre celui prpar par procd lectrochimique est trs actif. La cintique du processus de
formation de PbO
2
joue un rle important dans la rpartition des protons dans la structure obtenue
lectrochimiquement. Boher a localis lion H
+
dans la structure de PbO
2
sur larte commune aux
octadres voisins, crant ainsi une liaison de type O--H
. . . .
O, o les deux oxygnes considrs forment
une arte commune deux octadres [PbO
6
]. Le proton tant prfrentiellement li un des oxygnes,
mais susceptible de sauter facilement sur loxygne voisin.

Mots cls : Mcanisme, rduction, elctrode, batterie use.

**************************************
O48
IMPACT DE LA POLLUTION ORGANIQUE SUR LA QUALITE DES EAUX ET LA SANTE
HUMAINE DANS LA REGION DEL TARF

BAHROUN S, KHERICI-BOUSNOUBRA H, BOUNAB S, TITI-BENRABAH S

Laboratoire de gologie, Universit Badji Mokhtar, Annaba, Algrie.
sofia_bah@yahoo.fr.

La pollution reprsente un srieux problme pour lenvironnement cause des rejets dverss dans les
rivires ; les eaux uses domestiques non pures reprsentent la principale source de pollution
organique des eaux. La rgion dEl Tarf situe entre la latitude 3675'00" et la longitude 0816'66"
lextrme Nord Est Algrien sur laxe routier El Kala Annaba 60 km louest de Annaba. Elle est
limite au Nord par la mer mditerrane, au Sud et au Sud-Ouest par les wilayas de Souk-Ahras et de
Guelma, lOuest par la wilaya dAnnaba et lEst par la frontire Algro-Tunisinne avec une
superficie d'environ 2 891 Km
2
. Le suivie d'analyse dans les diffrents points dobservation a fait
l'objet d'un traitement de donnes par ltablissement d'une carte de pollution organique des eaux
naturelles de la rgion, qui nous renseigne sur linfluence des rejets et la qualit des eaux par le biais
d'un indice de pollution organique qui se calcul selon la mthode de Leclercq, Maquet, 1987 dont le
principe est de rpartir les valeurs des lments polluants en 05 classes, de dterminer partir de ses
propres mesures, le numro de classe correspondant pour chaque paramtre pour en faire la moyenne.
Linterprtation de la carte reprsentant les diffrents paramtres de pollution organique des eaux
naturelles donne des rsultats sur la contamination ou non de ces eaux. La carte montre que les
diffrentes eaux naturelles dans la rgion d'El Tarf passent d'une qualit une autre (pollution
organique forte pollution organique trs forte). De ce faite on observe la disparition de la faune
aquatique d'une part et d'autre par lutilisation du plan deau pour diverse activit devient interdite plus
particulirement dans le domaine de lirrigation pouvant influer sur la sant humaine.

Mots cls : Pollution, rejets, El Tarf, indice de pollution organique, sant humaine.


**************************************
O49
CONTRIBUTION A LETUDE DES CAPACITES EPURATRICES DUNE
MACROPHYTE POUR LES EAUX USEES DE LA VILLE DE OUARGLA

SAGGA M M
1
, MEZA N
1
, SERIDI R
2


1
Universit KASDI Merbah Ouargla, Algrie
2
Universit BAJI Mokhtar - Annaba
mounirsaggai@yahoo.fr

Ltude de lpuration par macrophytes (Phragmites communis Trinius) montre lamlioration de la
qualit des eaux uses et les rendements obtenus pour la MES, de la DCO et la DBO
5
dpassent les
90%. Le comportement du roseau dans les conditions exprimentales est similaire celui des sujets
dans le collecteur. Les teneurs des lments dans les organes varient en fonction du temps. Les
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
29
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
oligolments (Zn, Cd, Ni, Fe, Pb), sont accumuls dans les racines, par contre la teneur en Azote est
importante dans les tiges et feuilles. Les teneurs en potassiumet en calciumdans le deux parties du
vgtal sont similaire.

Mots cls : puration, Phragmites communis, Trinius, Eaux uses, Ouargla.

**************************************
O50
IMPACT DU STRESS HYDRO-HALOMORPHE ET MECANIQUE SUR LES
PALMERAIES DE LA CUVETTE DE OUARGLA (SAHARA SEPTENTRIONAL
ALGERIEN)

Mustapha DADDI BOUHOUN
1
, Louhichi BRINIS
2
, Mohamed Lakhdar SAKER
1

et Mohamed Didi OULD EL HADJ
1

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides. Universit de Ouargla, Algrie
2
Laboratoire de Biologie Vgtale et Environnement. Universit BADJI Mokhtar, Annaba, Algrie
daddibm@yahoo.fr

Les palmeraies de la cuvette de Ouargla souffrent dun problme de remonte des eaux phratiques et
de crotes gypseuses. Notre recherche consiste tudier limpact du stress hydro-halomorphe et
mcanique sur les palmeraies. Les rsultats montrent quil y a quatre types de zones hydro-daphiques
de : nappes phratiques profondes, crotes-nappes profondes, nappes superficielles et crotes-nappes
superficielles. La nappe phratique et la crote gypseuse constituent un stress hydro-mcanique qui
limite la profondeur racinaire des palmiers dattiers et produit une pourriture et une dformation du
systme racinaire des palmiers dattiers. Lenracinement des palmiers dattiers dans les zones de nappes
profondes est suprieur 1,2 mde profondeur, et dans les autres zones, il est compris entre 27 et 119
cmde profondeur. Les sols sont halomorphes cause des apports en sels par leau dirrigation et celle
de la nappe phratique. Ils ont engendr le stress salin et ont produit la chlorose des palmes. Cet
environnement de stress constitue une contrainte pour le dveloppement et la productivit des palmiers
dattiers.

Mots cls : Stress, hydro-halomorphe, mcanique, palmeraies, Ouargla.

**************************************
O51
GESTION DES RESSOURCES EN EAU A OUED RIGH : PROBLEMES POSES ET
CONSEQUENCES SUR LENVIRONNEMENT (SAHARA SEPTENTRIONAL
ALGERIEN)

Mohamed Lakhdar SAKER, Mustapha DADDI BOUHOUN,
Mohamed Didi OULD EL HADJ

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides. Universit de Ouargla, Algrie
sakermohamedlakhdar@yahoo.fr.

La gestion des ressources en eau Oued Righ se caractrise par plusieurs contraintes. Le potentiel
hydrique exploit provient des nappes du complexe terminal, du continental intercalaire et de la nappe
phratique. Ltude ralise dans le haut, le moyen et le bas Oued Righ, montre que la gestion des
eaux dirrigation et de drainage est non matrise. Les eaux mobilises narrivent pas rpondre aux
besoins de lenvironnement local, avec un surplus dans le bas et un dficit dans le haut Oued Righ. Le
problme de remonte des eaux phratiques, du linefficacit du systme de drainage, a contribu
largement la salinisation des sols et la dgradation de lenvironnement local. La gestion des eaux
dans les palmeraies traditionnelles est mal matrise par rapport aux palmeraies modernes.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
30
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Aujourd'hui, des amnagements hydro-agricoles s'imposent imprativement, pour prserver les
ressources en eau et sauvegarder lenvironnement local de lOued Righ.

Mots cls : Gestion, eau, problmes, environnement, Oued Righ.

**************************************
O52
QUELLES UTILISATIONS POSSIBLES POUR LES EAUX USEES URBAINES
TRAITEES PAR LAGUNAGE DANS LA CUVETTE DE OUARGLA ?

IDDER Tahar
1
, LAOUALI Mahamane Sani
2
, IDDER Abdelhak
1

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides Universit de Ouargla, Algrie
2- Dpartement de Chimie, Facult des Sciences Universit de Niamey
Tahar_id@yahoo.fr

Les travaux dassainissement entrepris, depuis quelques annes, dans la cuvette de Ouargla ont permis,
entre autres, la ralisation de trois stations dpuration par lagunage : une station principale, situe au
nord de la ville, et deux autres, de moindre importance, situes lune Sidi Khouiled et lautre
Ngoussa. Par souci dconomie deau destine lalimentation humaine, dont la rserve gnrale
connait des diminutions notables (ressource trs peu renouvelable), et plus gnralement, par souci
dune gestion optimale et intgre des ressources en eau dans le milieu naturel, il est ncessaire de
rflchir, ds prsent, aux diffrentes possibilits de rutilisation des eaux pures provenant de ces
stations dpuration. Les propositions qui seront mises en avant prendront principalement en
considration la qualit physico-chimique et microbiologique des eaux uses traites en fonction des
exigences du milieu rcepteur choisi, mais aussi les spcificits de lcosystme dans lequel ces eaux
uses seront utilises.

Mots cls : Traitement des eaux uses, lagunage, valorisation, Ouargla


**************************************
O53
ESSAIS DE LUTTE BIOLOGIQUE EN PALMERAIES A OUARGLA

IDDER Mohamed Azzedine
1
, DOUMANDJI Bahia
2
et PINTUREAU Bernard
3

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides. Universit de Ouargla, Algrie.
2
Institut National Agronomique dEl-Harrach. Dpartement de Zoologie Agricole et Forestire. Alger, Algrie.
3
BF2I-UMR INRA/INSA de Lyon, INSA btiment Louis Pasteur, 69621-Villeurbanne-cedex, France.
azzou.idder@yahoo.fr

La lutte biologique en palmeraies Ouargla a montr des possibilits trs intressantes dintervention
contre les principaux ravageurs du palmier dattier et de la datte. En effet contre Parlatoria
blanchardi, La lutte biologique laide de coccinelles a conduit des pourcentages de mortalit
relativement faibles, de 18,1 et 19,7, mais, il faut toutefois aussi tenir compte de leffet de la mthode
de lutte sur les populations dauxiliaires. Nous avons constat que les traitements physique et
chimique ont provoqu une trs forte mortalit des auxiliaires (78,8 89,4%). En revanche, la
mthode biologique a prserv la faune utile et donc lquilibre biologique dans le biotope. Cette
dernire mthode semble ainsi mieux adapte au milieu palmeraie, agro-systme la fois complexe et
fragile o toute perturbation brutale peut tre fatale et irrversible. Quant Oligonychus afrasiaticus,
Les taux dinfestation enregistrs dans la localit de Hassi Ben Abdallah varient en fonction du stade
phnologique. Ainsi, le nombre moyen dacariens par fruit sur un arbre atteint 1,8, 7,9, 12,5 et 12,9
successivement aux stades nouaison, grossissement des fruits, dbut de maturit et fin de maturit. Les
traitements biologiques laide de la coccinelle locale Stethorus punctillum (Weise), effectus sur des
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
31
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
arbres plus ou moins infests, ont conduit des efficacits prdatrices relativement importantes. Enfin
avec lutilisation de Trichogramma cordubensis contre Ectomyelois ceratoniae, a fait apparatre des
taux de parasitisme des ufs atteignant les 64%.

Mots cls : Ecosystme, fragilit, entomophage, auxiliaire, dprdateur.

**************************************
O54
LES SIGNES DE DEGRADATION DES SEBKHAS ET DES CHOTTS DE LA
CUVETTE DE OUARGLA

HACINI Messaoud
1
, Asma HACINI
1
, Eric H, OELKERS
2

1
Laboratoire de Biogeochimie des Milieux Desertiques, Universit de Ouargla, Algrie
2
Laboratoire de Gochimie Exprimentale, LMTG, CNRS, Toulouse, France

Les sebkhas et les chotts sont des cosystmes naturels, prsentant des intrts cologiques et
conomiques certains. Ces systmes sont utiliss par les gochimistes pour la reconstitution des
histoires gochimiques naturelles, considres comme des laboratoires ciel ouvert. Ils sont exploits
pour lextraction de beaucoup de types de sels, en loccurrence lHalite. Sur le plan cologique, les
sebkhas et les chotts sont des zones humides, constitues de zones protectrices de la biodiversit. Ces
zones sont fortement productives, avec la prsence de plusieurs chanes alimentaires, hbergeant des
oiseaux qui utilisent ces zones comme lieu de repos, de reproduction et dhivernage. En revanche, ces
zones sont trs fragiles et sensibles. Depuis laugmentation des besoins en eau avec lexplosion
dmographique, dune part, et le manque dun exutoire naturel dans ces zones, dautre part. Ces zones
sont utilises comme des exutoires des eaux excdentaires (eaux uses, industrielles,). Ces
dernires annes, les sebkhas et les chotts de la cuvette de Ouargla sont menaces par les eaux uses,
avec des signes de dgradation trs claires (odeurs, pellicules de matire organique sur la surface de
leau, surdosage de quelques lments toxiques dans leau). Le prsent travail est une modeste
contribution pour mettre en vidence quelques signes de dgradation de ces systmes, par le suivi de
quelques lments traces dans ces zones, savoir ; lithium, chrome, manganse, cobalt, nickel,
plomb, fer et cadmium.

Mots cls : Sebkhas, chotts, signe de dgradation, lments traces

**************************************
O55
POLLUTION DES FOURRAGES ET DES SOLS PAR LES ELEMENTS DU
GROUPE PLATINE ISSUS DE LA CIRCULATION ROUTIERE

A. TANKARI DAN-BADJ O
1,2,3
, C. DUCOULOMBIER
1
, G. YADJ I
3
, C. FEIDT
1
, T.
STERCKEMAN
2
, G. ECHEVARRIA
2
ET G. RYCHEN
1

1
UR AFPA, Nancy-Universit, INRA, 2 avenue de la Fort de la Haye B.P. 172, F 54505 Vandoeuvre Ls
Nancy, France
2
LSE, Nancy-Universit, INRA, 2 avenue de la Fort de la Haye B.P. 172, F 54505 Vandoeuvre Ls
Nancy, France
3
Dpartement Sciences du sol ; Facult dagronomie de Niamey, Universit Abdou Moumouni de Niamey,
BP10960 Niamey Niger.
tankari@yahoo.fr ou tankari@refer.ne

Laugmentation de dpt des lments du groupe platine (PGE : Pt, Pd et Rh) mis par les vhicules
sur le fourrage et sur le sol soulve des proccupations concernant les risques sur la qualit des
aliments, et par consquent sur la sant humaine. Ici, nous rapportons la distribution spatiale des PGE
sur le ray-grass et sur des sols l'chelle dune exploitation agricole situe proximit dune route
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
32
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
nationale avec une densit de trafic de 7200 vhicules/jour. Contrairement aux tudes classiques
procdant gnralement par des mesures sur des vgtaux prlevs directement sur les sites, nous
avons utilis une autre approche exprimentale afin de permettre une valuation sans quivoque de
limpact de la pollution automobile. Le ray-grass a d'abord t cultiv dans des pots en serre ferme
afin d'isoler les plants de tout contact avec lair extrieur. Ensuite, les pots de ray-grass ont t
transfrs sur la parcelle exprimentale. La rpartition des PGE a t value en plaant pendant un
mois les pots de ray-grass diffrentes distances de la route : 0, 10, 25 et 50 m. En outre, des
chantillons des sols sont prlevs tous les endroits o les pots de ray-grass ont t placs. Les
concentrations de PGE dans les chantillons du ray-grass et des sols ont t analyses par ICP-MS.
Nos rsultats montrent clairement l'impact de la circulation routire aussi bien sur le ray-grass que sur
le sol. Les teneurs maximales de PGE sont obtenues proximit immdiate de la route. De 0 50 m de
la route, les concentrations de Pd dcroissent significativement jusqu 39% dans le ray-grass et 50%
dans le sol. Les cartes de pollution devraient donc permettre d'valuer plus prcisment l'impact de la
circulation routire sur la qualit des aliments.

Mots cls: PGE, sol, ray-grass, cartes de pollution, trafic routier

**************************************
O56
DETERMINATION DU ROLE DES MACROPHYTES UTILISES POUR
TRAITEMENT DES EAUX USEES DOMESTIQUES SOUS CLIMAT SEMI ARIDE
VILLE DE BISKRA-

BENSMINA-MIMECHE Leila
1
, MANCER halima et DEBABECHE Mahmoud

1
Dpartement d'hydraulique, Universit de Biskra.
2
Dpartement dagronomie, Universit de Biskra
3
Dpartement d'Hydraulique, Universit de Biskra.
l.mimeche@yahoo.fr

Ce travail s'inscrit dans le cadre de la mise au point des procds de traitement des eaux uses peu
coteux et adapts aux conditions aride. Il s'agit d'valuer le rle des plantes aquatiques et leurs
l'intrt pour l'limination des polluants et des microorganismes pathognes. Le pilotes exprimental
est constitu des bacs de 60l litres de capacit remplit avec une succion dcroissante de gravier. Deux
bacs sont implants avec Arundo Donax et Papyrus Cyperus (avec trois rptitions) et un autre non
plant pris comme tmoin. Le remplissage se fait rgulirement avec des eaux uses urbaines de la
ville de Biskra (rejet du Chetma) avec une frquence dune fois chaque semaine. Lcoulement se fait
par translation verticale travers le substrat. Ltude de performance puratoire du systme montre
que ce dernier assure une limination importante de la charge organique diminue les matires en
suspension leau rcupre est claire et limpide. Les rsultats obtenus montrent une diminution
importante de lazote du phosphore par rapport au filtre tmoin. Llimination des micro-organismes
pathogne est aussi importante. On peut conclure que les macrophytes ont un grand effet pour le
traitement des eaux uses et finalement prservation de lenvironnemt.

Mots cls: epuration macrophyte, arundo donax, puration, eaux uses. Semi aride

**************************************







Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
33
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Thme 4 - Mise en valeur des terres
O57
LES CARACTERISTIQUES HYDROGEOLOGIQUES DE LA NAPPE DU
COMPLEXE TERMINAL DANS LA REGION DOUARGLA

A.ZEDDOURI
1
, S.HADJ-SAID
1
, F.DERRADJI
2

1
Universit Kasdi-Merbah, Ouargla
2
Universit Badji-Mokhtar, Annaba
azizpointcom22@yahoo.fr

Leau dans la rgion de Ouargla ne manque pas, cest sa qualit qui prsente un dfi majeur pour le
dveloppement local. La cuvette de Ouargla est situe au sud-est algrien. Elle se prsente comme un
immense bassin sdimentaire, en forme de synclinal dissymtrique. La structure gologique du sous-
sol admet lexistence dun systme daquifres. Les formations du Complexe Terminal sont trs
htrognes. Elles renferment trois horizons aquifres, spars localement par des couches semi-
permables ou impermables. Il sagit des calcaires et dolomies du Snonien et de l'Eocne Infrieur,
les sables, grs et graviers du Pontien, et les sables du Mio-Pliocne. La profondeur du Complexe
Terminal est comprise entre 100 et 600 mtres et sa puissance moyenne est de l'ordre de 300 m. La
nappe du complexe terminal est capte par 261 forages dont 125 forages oprationnels rpondent aux
critres pour des mesures correctes de dbit. Ce dernier est estim en total 82,13 millions de m
3
/an.
Ces eaux sont caractrises par une forte minralisation, la conductivit lectrique varie entre 2400 et
10600 S/cm. Elles sont destines essentiellement lirrigation. Les caractristiques
hydrodynamiques du systme montrent une variation lie aux htrognits lithologiques des
formations aquifres.

Mots cls : Eaux souterraines, zone aride, hydrogologie, complexe terminal, Ouargla.

**************************************
O58
CONTRIBUTION A LA CONNAISSANCE DES SOLS DU SAHARA DALGERIE. DE
LA BASE DE DONNEES A LA VALORISATION DES PARAMETRES
PEDOLOGIQUES

BERKAL I.
1
, DJILI K.
2

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie
2
Ecole Nationale suprieure Agronomique (ENSA, Alger ex. I.N.A,), Algrie
bismaiel@hotmail.com

Ce travail a port sur la constitution dune base de donnes relative aux sols des rgions sahariennes
dans laquelle sont compils 628 profils types. L'analyse de 2428 horizons dcrits et 1990 analyss a
rvl que ces tudes ne sont pas toujours menes selon une dmarche et des normes reconnues.
Ltude dun paramtre pdologique (CE) dans trois catgories dhorizons (H1, H2 et Hp), lchelle
du Sahara (base de donnes), a montr que les sols sahariens sont pour la plupart trs fortement sals
(C5) avec une prfrence pour lhorizon de surface dans 50 % de cas. La recherche de relations
ventuelles entre les paramtres tudis donne les rsultats suivants: Laugmentation des taux de
gypse saccompagne par une diminution de la CE. Laugmentation des taux de calcaire au-del de 30
% saccompagne par une diminution de la CE.

Mots cls : Sahara, CE, corrlations.

**************************************

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
34
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

O59
LA DEGRADATION DES SYSTEMES OASIENS TRADITIONNELS : UNE
CONSEQUENCE DE LA MONDIALISATION DE LECONOMIE ? ANALYSE
COMPAREE DE DEUX OASIS EN ARGENTINE ET DANS LE SUD MAROCAIN

M. DOSSO, O. PHILIPPON

Irc Montpellier SupAgro, France
mireille.dosso@supagro.inra.fr

Lobservation gnrale de la dgradation actuelle des systmes oasiens traditionnels conduit voquer
classiquement deux grands types de causes :
- le changement climatique global et ses effets locaux induits ;
- les drglements internes la socit de loasis.
Nous avons tudi deux oasis en voie de dgradation dans deux situations trs contrastes :
- en Argentine, loasis de San J uan
- dans le sud marocain, loasis de Laayoun, dans la province de Tata.
Notre conclusion est que dans les deux cas, la dgradation tudie nest ni principalement lie aux
changements climatiques, ni la consquence du seul drglement interne de la socit oasienne. Dans
les deux cas, cest louverture du systme oasien aux relations avec lextrieur qui initie labandon des
pratiques dirrigation et dexploitation locale ; et cest cet abandon qui est lorigine de la dgradation
physique et sociale du territoire oasien. En conclusion, cest la mise en concurrence des modes de
production oasiens avec dautres faons de produire en milieu moins contraignant qui conduit leur
ruine.

Mots clefs : Systmes de production ; salinit des sols et des eaux ; irrigation ; relations sociales ;
concurrence conomique

**************************************
O60
LARIDOCULTURE ET LE DEVELOPPEMENT DURABLE

Amor HALITIM

Dpt. Agronomie-Universit de Batna
Amor.halitim@gmail.com

On estime lheure actuelle quenviron 40% des terres merges de la plante sont arides, soit 5,2
milliards dhectares, sur lesquelles vivent plus de 2 milliards de personnes. LAfrique contient 37% de
zones arides. En Algrie, ces dernires reprsentent prs de 95% du territoire national, dont 80% dans
le domaine hyper aride. Dans ces rgions, la dgradation des ressources naturelles (sol, eau,
biodiversit) dont le stade ultime est la dsertification, est devenue inluctable. Inverser ou mme
arrter ce processus, nest pratiquement pas possible, parce que les facteurs essentiels de son
dclenchement et de son aggravation continuit dmission de gaz effet de serre par les pays
industrialiss) ne sont plus matrisables lchelle rgionale dune part et parce quil difficile de
concilier, prservation des potentialits naturelles, dveloppement durable et satisfaction dune
population en croissance et de plus en plus exigeante dautre part. Le dcaler dans le temps, le ralentir,
le prvoir, le contrler, cela est possible et ncessaire. S adapter aux rudes conditions qui rgnent,
travers notamment une aridoculture durable dans le sens agronomique, mais aussi environnemental,
conomique et social est indispensable. Soumise de nombreuses contraintes, la fois physiques
(climat, eau et sol), biologiques et socio conomiques, la pratique de laridoculture est difficile et
peut conduire une atteinte lenvironnement et la durabilit de lagriculture. Cette dernire se
trouve encore plus menace par un rchauffement accentu des rgions arides et par les futures
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
35
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
conditions de libre circulation des produits agricoles, favorisant les rgions forte productivit.
Laridoculture est certes la pratique dont lobjectif est de rpondre aux besoins alimentaires et socio-
conomiques de rgions arides ressources hydriques faibles ou fossiles et cosystmes fragiles,
mais elle constitue souvent un facteur de dgradation du milieu. En effet, quelle soit fonde sur une
agriculture en sec ou en irrigu, quelle traite de llevage nomade ou sdentaire, on observe une
atteinte aux composantes de base des cosystmes (sol, eau, plante) dans ces rgions, mettant en pril
sa durabilit avec des consquences sur les plans environnementaux (dsertification, remonte des
nappes superficielles, pollution), conomique (baisse de la productivit des agrosystmes, du niveau
de vie et du pouvoir dachat) et social (exode rural, paix sociale menace). Quelques atouts
caractrisent ces rgions et doivent tre valoriss. Tout dabord, le soleil et le vent qui peuvent tre
une source dnergie renouvelable utiliser en agriculture pour excuter diffrentes tches. Si les
rgions arides se dfinissent comme des zones faibles ressources hydriques, parfois comme cest le
cas dune partie du Sahara, le sous sol recle dimmenses rserves hydriques. Des tempratures
leves et des sols lgers propices la production de primeurs. Des spculations spcifiques de
grande valeur commerciale comme la phoeniculture ou de grande endurance comme le dromadaire ou
bien adapts comme les ovins. Des agrosystmes (les oasis) valorisant au mieux les ressources
naturelles et les facteurs de production et dont limpact nest pas seulement agricole. Une richesse
floristique dune grande valeur sur les plans agronomique, environnemental et mdical. Un attrait
touristique certain. Un savoir faire et des capacits dadaptation des populations locales, pour grer les
terres arides et supporter les rudes conditions de vie. Certes, plusieurs programmes de dveloppement
ont t mis en uvre dans ces rgions aussi bien pour amliorer la production agricole que pour
protger lenvironnement, mais force est de constater que les objectifs assigns ces programmes
nont pas toujours taient atteints. Lexplication serait quils navaient pas de fondements scientifiques
et techniques suffisants, navaient pas prise avec les ralits du terrain, navaient pas associs les
populations concernes et parce que le problme tait dune trop grande ampleur et exige une
dmarche stratgique spatio-temporelle, intersectorielle et interdisciplinaire. Une volont politique est
donc interpelle ici plus quailleurs, travers la concrtisation dun plan de dveloppement long
terme de ces rgions o lagriculture est certes le secteur focal mais doit tre accompagn dautres
secteurs, lamnagement, lhydraulique, lindustrie, la recherche, le tourisme, les transports, les
travaux publiques, lartisanat etc.., dans le cadre dune gestion intgre de lespace. Cette stratgie de
dveloppement durable doit tre labore la lumire des spcificits, des atouts, des contraintes des
rgions arides, mais aussi la lumire des expriences et des changements lchelle mondiale.

Mots cls : Rgions arides, ressources naturelles, aridoculture, dveloppement durable.

**************************************
O61
DETERMINATION DE LEVAPORATION DES SURFACES DES PLANS DEAU
POUR LES CONDITIONS CLIMATIQUES DE LALGERIE

BOUTOUTAOU D.

Laboratoire dExploitation et Valorisation des Ressources Naturelles en Zones Arides. Universit KASDI
MERBAH Ouargla.
boutoutaoudjamel@yahoo.fr

La valeur de lvaporation des surfaces des plans deau est une donne cl qui intervient dans
plusieurs processus hydrologique et hydraulique. Ltablissement par exemple dun bilan hydrique
dun chott ou dune sebkha exige la connaissance de la valeur de lvaporation. La valeur de cette
dernire est trs ncessaire aussi pour la conception des bassins de lagunage dans lpuration des eaux
uses. La construction et lexploitation dun barrage rservoir exige la connaissance de lvaporation
de leau en surface libre qui intervient dans le calcul de la rgularisation des apports pour le
dimensionnement du barrage et dans les calculs du bilan hydrique de la retenue pendant lexploitation.
Lvaluation de lvaporation en Algrie est effectue partir des stations exprimentales quipes de
bacs dvaporation ou bien aux analogies avec les plans deau qui sont toujours mesurs. Lerreur lie
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
36
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
lvaluation par analogie, peut atteindre des valeurs considrables (mauvais choix du plan deau
analogue). Quant aux stations exprimentales (bacs dvaporation), qui offrent de bons rsultats, elles
sont malheureusement limites en nombre et elles ne couvrent que quelques rgions du pays. Pour
luder ces inconvnients, on propose lapplication dune formule qui relie lvaporation aux lments
mtorologiques pour valuer les pertes par vaporation des surfaces des plans deau en Algrie.

Mots cls : Evaporation plan deau, lment mtorologique, bac dvaporation

**************************************
O62
EVOLUTION DE LA SALINITE DANS LES PERIMETRES DE MISE EN VALEUR
ET CONSEQUENCE SUR LA DIMINUTION DES RENDEMENTS DU BLE DANS
UNE REGION SAHARIENNE. CAS DE LA REGION DADRAR

ZIZA Fatima-Zohra
1
, DAOUD Youcef
2
, LABOUDI Abdelkader
3
, BRADAI Rachid
1
,

ZOUAHRA Ali
1

1
Institut National de la Recherch Agronomique d'Algrie (INRAA) Station Mehdi-Boualem Baraki (Alger)
2
Ecole Nationale Suprieur dAgronomie (ENSA) El Harrach (Alger)
3
Institut National de la Recherche Agronomique dAlgrie (INRAA) Station exprimentale dAdrar
zizafatimazohra1@gmail.com

Le dveloppement de l'agriculture saharienne en Algrie par la cration des primtres irrigus pose le
problme de sa conformit avec le systme oasien. En effet, ce dernier subsiste depuis un millnaire
dans un systme couvert, conome en eau et en nergie. En revanche, l'agriculture moderne est
introduite selon un modle emprunt sans facult d'adaptation. Les nouveaux primtres de mise en
valeur se situent dans un espace loign des oasis, expos au vent et l'rosion olienne, et utilisant
d'une manire trs onreuse les ressources en eau souterraine et minralise (Daoud et Halitim, 1994).
Aprs quelques campagnes dirrigation, les sols peu fertiles, atteignent un niveau de salinit qui
dpassent largement le seuil de tolrance de la culture (Ziza, 1992 ; Daoud et Halitim, 1994), les
parcelles sont alors abandonnes et de nouveau espaces sont occups par dplacement de la rampe des
pivots. L'objectif principal de ce travail est de faire une analyse quantitative de l'volution de la
salinit des sols irrigus par pivot depuis quelques annes, et d'valuer son intensit sur la diminution
des rendements du bl. Pour cela, trois primtres irrigus respectivement depuis 2, 3 et 4 annes sont
tudis et compars au sol tmoin non irrigu. Pour chaque parcelle, l'volution de la salinit est
tudie entre deux priodes du cycle vgtatif du bl, l'tat initial correspond au stade tallage et l'tat
final correspond au stade maturation. L'irrigation se fait par aspersion avec une eau minralise de la
nappe albienne. Les rsultats obtenus montrent que les eaux d'irrigation se caractrisent par une forte
salinit et un faible danger de sodicit. Les teneurs en sodiumet en chlorures sont excessives en mode
d'irrigation par aspersion. L'volution de la salinit des sols irrigus depuis 2,3 et 4ans l'chelle d'une
campagne agricole est hautement significative partir de la quatrime anne et dpasse le seuil de
tolrance la salinit du bl dur. La salinisation constituera donc lun des principaux facteurs
responsables de la diminution des rendements en bl. En effet, une augmentation de 1 dS/mprovoque
une chute du rendement en grains de 4 q/h.

Mots cls : Evolution, salinit, mise en valeur, rendements, bl, Adrar

**************************************







Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
37
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

O63
DYNAMIQUE DE LEAU ET DES SOLUTES DANS LES SOLS CULTIVES EN
ZONES ARIDES (CAS DE LA REGION DADRAR)

LAABOUDI A., BOUABOUB-MOSSAB K.

INRAA station de recherche Adrar, Algrie
Laaboudiaek@yahoo.fr

Dans les zones arides, Les phnomnes de lvapotranspiration intense, de la salinisation secondaire
des soles irrigus et de la pollution des nappes sous terrains provoque par les eaux de drainage et les
engrais azots en excs, dont la vulnrabilit ne pourra qutre accentus par les conditions
environnementales sont des contraintes majeurs qui entravent la durabilit du dveloppement agricole
et la prservation de la nature. Grer les potentialits dune rgion pour sauvegarder le milieu naturel,
ncessite dapporter une attention particulire aux contraintes anthropiques. Dans ce travail, et grce
lanalyse de leau en amont et en aval des palmeraies on a pu indiquer que la nappe du Continental
Intercalaire est contamine par les sels des eaux de drainage. Le suivi du mouvement de leau et des
soluts dans les milieux cultivs par lutilisation des tensiomtres et des cases lysimtriques a permis
dtablir les bilans hydriques et salins des sols irrigus. Les rsultats obtenus aboutissent la
modlisation de lvapotranspiration relle (ETR) et maximale (ETM) de la culture. Il sest avr que
dans les conditions optimales, il existe une relation troite entre le rendement en matire sche et le
rapport
0 ET
ETR
et entre lETM et la surface foliaire. Par ailleurs, on a dduit que le vgtal se comporte
comme une vritable pompe de refoulement quand lvapotranspiration est trop leve et rejette ainsi
des quantits considrables en eau dans latmosphre en induisant un mouvement ascendant de leau
dans les compartiments du sol. Les quantits de leau rejete sont dautant plus importantes que
lappareil vgtatif est bien dvelopp. Ltude du bilan des soluts nous permet de contrler la
salinit du sol et le devenir des engrais azots appliqus aux cultures.

Mots cls : Zones arides, bilans hydriques, bilans des soluts, modlisation de lETR et lETM,
devenir des engrais azots

**************************************

**************************************
O64
EVALUATION DU BILAN NUTRITIF DE LABRICOTIER (Prunus armniaca L.)
DANS LA REGION DE BISKRA

BENAZIZA A.
1
, BENTCHIKOU M.M
2

1
Dpartement d'agronomie, universit de Biskra, Algrie
2
Dpartement sciences de la nature, Universit de Constantine, Algrie
benaziza_abdelaziz@yahoo.fr

Dans le cadre de la nouvelle politique agricole visant un meilleur dveloppement de l'agriculture
algrienne afin d'aboutir la scurit alimentaire. L'arboriculture fruitire a connue une ampleur
certaine, marque par une extension des plantations fruitires dans diffrentes zones pdoclimatiques
dont certaines diffrent de celles des zones traditionnelles de la culture. L'espce abricotier (Prunus
armniaca L.) empreinte un bon comportement dans ces situations et a donner des rsultats trs
encourageants surtout en zones arides. Ces derniers sont la rsultante de multiples facteurs en
particulier la nutrition minrale. A ce propos, notre contribution s'inscrit dans le cadre d'une valuation
sur la nutrition minrale de trois varits d'abricotier dans une zone de Biskra. Ce travail est fond
essentiellement sur lanalyse physicochimique du sol et les feuilles. D'une manire gnrale, les
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
38
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
rsultats d'analyses compars aux normes tablies montrent que les nutritions azote, calcique et
magnsienne sont quilibres et l'alimentation potassique s'avre juste satisfaisante. Ce qui exige en
fait un contrle priodique pour dcliner tout risque de carence en cet lment. Pour le cas du
phosphore, il marque des faibles proportions dans les feuilles, traduites par une mauvaise alimentation
des arbres.

Mots cls : Bilan nutritif, diagnostic foliaire, comportement, Doucen, Abricotier.

**************************************
O65
EFFET DE LA FERTILISATION PHOSPHATEE SUR UNE CULTURE DE BLE
TENDRE CONDUITE EN CONDITIONS IRRIGUEES SAHARIENNES

BOUKHALFA-DERAOUI Naima
1
, HALILAT Mohammed Tahar
1
, MEKLICHE Arezki
2

1
Laboratoire de Bio ressources Sahariennes : Prservation et Valorisation.Universit de Ouargla, Algrie
2
Institut National Agronomique dAlger, Algrie
Boukhalfan2005@yahoo.fr

Une analyse de la fertilisation phosphate, portant sur le comportement et le rendement dune culture
de bl tendre conduite au champ sous irrigation en zone saharienne du sud de lAlgrie, montre que
laddition de phosphore, sous forme de superphosphate triple, influence toutes les composantes du
rendement. Lapport de phosphore accrot le tallage, le nombre de grains par pis et le poids moyen
des grains. Les rsultats les plus levs, quelle que soit la composante analyse, sont obtenus pour la
dose la plus leve utilise dans cet essai : 180 kg P
2
O
5
.ha
- 1
. A cette dose, le rendement en grains
crot, par rapport au tmoin sans phosphore de 49,3 %. Les prlvements de phosphore par les feuilles,
les grains et les pailles croissent dans lintervalle exprimental 0 - 180 kg P
2
O
5
. ha
-1
expriment. Les
quantits totales de phosphore prleves par la plante augmentent en fonction des stades de croissance.
Le coefficient apparent dutilisation (CAU %) du phosphore engrais varie de 18,5 % pour la dose la
plus faible environ 11 % pour la dose la plus leve. Ces valeurs de CAU % particulirement leves
sexpliquent par un pouvoir fixateur trs limit du sol pour les ions phosphate, malgr un pH lev.

Mots cls : Bl, Fertilisation, Phosphore, Sahara.

**************************************
O66
DYNAMIQUE DE L'OCCUPATION DES SOLS EN MILIEU ARIDE. CAS DU SUD
DU HODNA

Salah ABDESSELAM
1
, Zohra AMOR
1
, Rachid HALOUAN
2


1
Universit Ziane Achour de Djelfa, Algrie
2
Haut Commissariat au Dveloppement de la Steppe (HCDS) Djelfa, Algrie
aksalah2001@yahoo.fr

Le Sud du Hodna constitue un cadre privilgi d'tude de la vulnrabilit dun systme agro pastoral
aux changements globaux. Les changements qui se sont produits dans cette zone, notamment
lutilisation des ressources en eau et en sols en relation avec les politiques agricoles, laccroissement
dmographique ainsi que les conditions naturelles et anthropiques sont les lments cls du
fonctionnement de cet cosystme. Le but du prsent travail est danalyser lvolution de loccupation
des terres par une approche base sur l'exploitation des donnes satellitaire multi dates (1972, 2001).
Pour cela, nous avons utilis les images Landsat du capteur MSS et ETM+. Aprs la dlimitation de la
zone d'tude, on a procd la classification des images par l'tablissement des classes de signatures,
la classification des pixels en fonction de ces signatures et enfin la vrification des rsultats. Le
produit final sont les cartes thmatiques reprsentant la dynamique de l'occupation su sol. Il ressort de
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
39
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
lanalyse de ces cartes de profondes transformations intervenues depuis quelques dcennies. Ainsi, sur
une superficie tudie de 103233 ha, on a constat, globalement, quentre 1972 et 2001, soit 30 ans
dintervalle environ, loccupation des terres a subit une progression des superficies des cultures de
lordre de 8 %, une diminution des parcours denviron 11 % et une augmentation du lensablement
value 6 %. Ce rsultat rvle une situation trs alarmante de ltat de dgradation de ce milieu.
Elle interpelle ainsi, les pouvoirs publics pour prendre des mesures urgentes pour faire face au
phnomne de dgradation de cet cosystme.

Mots cls : Tldtection, SIG, Sud du Hodna, dynamique d'occupation du sol.

**************************************
O67
PROPRIETES CHIMIQUES ET BIODISPONIBILITE DE LAZOTE ET DU
POTASSIUM DANS LA RHIZOSPHERE DOLIVIERS DANS UN AGRO SYSTEME
ARIDE

S. MOUAS BOURBIA,

M. BOUDIAF NAIT KACI, M. YAHIAOUI, H. KIOUAS,
A.DERRIDJ

ET D. ISSAOUN

Laboratoire Ressources Naturelles UMMTO.
myahiaoui72@yahoo.fr

Les proprits chimiques et la biodisponibilit des lments nutritifs varient avec la distance la
racine en raison du prlvement par la plante de leau et des lments nutritifs par mass flow et
diffusion, de laltration des minraux et de la rhizodposition. Lvaluation des proprits chimiques
et de la biodisponibilit de lazote et du potassiumest ralise selon un gradient spatial dloignement
par rapport aux racines, en distinguant le sol non adhrant (SG), le sol rhizosphrique (SRh)
correspondant aux agrgats de terre de 1cm de diamtre accols aux racines fines actives de 5mm de
diamtre et le sol adhrant aux racines en couche trs fine, le rhizoplan (SRz).Le carbone organique
augmente du sol global vers le rhizoplan. La salinit et les carbonates de calcium restent proches dans
les trois fractions de sol. Les formes dazote bio disponibles, le N assimilable N-NH
4
et N-NO
3

augmentent dans les trois fractions de sol selon le schma suivant : SG <SRh <SRz. Les formes de K
bio disponible, le K soluble(Ks) dans leau, le K assimilable (K
A
, extrait lACNH
4
1N, pH 7) et K
non changeable (Kne extrait lHNO
3
1N bouillant) suivent les tendances suivantes : K
A
augmente
dans les trois fractions de sol, SG <S Rh <SRz. En revanche, on observe un appauvrissement de la
rhizosphre pour le Ks et le Kne, SG >SR h>SRz. La racine de lolivier induit des modifications des
proprits chimiques dans les sols sa proximit immdiate. La biodisponibilit des lments nutritifs
dans la rhizosphre diffre comparativement au sol global.

Mots cls : Rhizosphre, biodisponibilit, azote, potassium, aride

**************************************
O68
PRATIQUE DE LA FERTILISATION MINERALE ET DES AMENDEMENTS
ORGANIQUES DANS LES ECOSYSTEMES OASIENS (REGION DU M'ZAB)

KHENE Bachir

Centre Universitaire de Ghardaa
khenebachir@yahoo.fr

L'agriculture oasienne caractrise par ses cosystmes souvent fragiles, mais recelant des potentialits
avres travers des gnrations, peut-elle persister dans une conomie de march? Un des objectifs
atteindre cet gard est la rentabilit de lacte agricole dans ces systmes. La satisfaction des besoins
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
40
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
nutritionnels de plantes, le plus souvent cultives en association, passe par la pratique raisonne
dapports en lments nutritionnels organiques et minraux. Ceci doit aller dans le sens de concilier
limpratif de la rentabilit dune part et les considrations cologiques dautre part. Dautant plus que
ces dernires se trouvent considrablement amplifies par la fragilit et la complexit spcifique aux
systmes oasiens dans leur ensemble (irrigation, drainage, salinit, ...). Un tat des lieux a t dress
sur la ralit de la pratique par les producteurs oasiens, des amendements organiques et des apports
minraux, au niveau des diffrents systmes de production que recle la rgion naturelle du Mzab,
prsentant une variabilit vidente dans les ressources, les stratgies et les marges d'amlioration.

Mots cls: rgion naturelle Mzab, systmes de production oasiens, systme de culture, fertilisation
minrale, amendement organique.

**************************************
O69
EVOLUTION DE LA SALINITE DES EAUX DES NAPPES DU COMPLEXE
TERMINAL DE LA REGION DE MYA OUARGLA

ABDERRAHMANE-SAIL Nadhira
1
et SAIGHI Omar
2


1
Universit KASDI MERBAH Ouargla
2
FSTGAT- USTHB El Allia Bab Ezzouar
sail_nadi@yahoo.fr

La rgion de Mya - Ouargla, situe au centre du Sahara septentrional, est soumise un climat hyper
aride. Nanmoins, son sous-sol renferme deux vastes systmes aquifres importants: le Complexe
Terminal et le Continental Intercalaire. Les ressources en eau renouvelables tant insignifiantes par
comparaison aux rserves emmagasines, lexploitation de ces aquifres des dbits trs suprieurs au
dbit dalimentation, entranent des consquences graves telles que labaissement important des
niveaux pizomtriques et du dbit dartsianisme ainsi que la dgradation de la qualit chimique des
eaux. Laccroissement inconsidr des prlvements ne fait qu'aggraver cette situation. Lobjectif de
cette tude consiste en une approche des problmes poss par la salinit des eaux des nappes du
Complexe Terminal qui sont contenues dans trois niveaux aquifres superposs savoir de haut en
bas: les sdiments quaternaires constituant une nappe phratique, les sables du Mio-Pliocne et les
carbonates du Snonien. Dans cette tude, il s'agit dans une premire tape de caractriser le degr de
minralisation de chaque nappe et de dfinir son facis hydrochimique et dans une seconde tape,
d'essayer de cerner les mcanismes intervenants dans lacquisition des minralisations leves des
eaux. Pour la concrtisation de cet objectif, nous avons exploit les rsultats hydro chimiques des trois
campagnes dchantillonnages effectues entre 1989 et 2001, dans divers forages captant les
diffrentes nappes. L'interprtation de ces analyses s'est effectue selon les procds classiques de
l'hydrochimie, mais aussi par une analyse en composantes principales (ACP) et l'utilisation des
techniques isotopiques. Le travail ralis nous a permis de dterminer la rpartition spatiale de la
salinit et des facis chimiques des eaux et de suivre leur volution au cours du temps. De mme, il
nous a t possible de prciser l'origine des minralisations excessives constates et dapprcier la
qualit des eaux, selon le type d'usage envisag (alimentation humaine, irrigation ou usage industriel).
Enfin, les techniques isotopiques, utilises conjointement aux connaissances sur la gologie, nous ont
permis de mieux comprendre certaines variations brutales de salinit et de localiser les zones des
mlanges d'eaux provenant de diffrentes nappes.

Mots cls : Complexe Terminal, nappes, mio-pliocne, snonienne, phratique, Hydrogologie,
Hydrochimie, Isotopes, Qualit chimique des eaux, A.C.P.

**************************************



Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
41
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

O70
EVALUATION DE LA DURABILITE DE LA CEREALICULTURE SOUS PIVOT
PAR LETUDE DE LA SALINISATION DU SOL DANS LA REGION DOUARGLA

BEN BRAHIM Fouzi
1
, HALILAT Mohamed Tahar
1, 2


1
Laboratoire de bio-ressources sahariennes : Prservation et Valorisation - Ouargla
2
Centre universitaire de Ghardaa
fouzibenbrahim@yahoo.fr

La craliculture sous pivot dans les rgions sahariennes est confronte plusieurs contraintes qui
sopposent son dveloppement. Ce travail ralis dans la rgion de Hassi Ben Abdellah (Ouargla),
sinscrit dans le domaine des contraintes techniques et porte sur un facteur limitant de dveloppement
de la craliculture dans les rgions arides. Ce facteur est la salinit du sol qui a t suspecte
responsable des chutes des rendements et juge comme critre dvaluation de la mise en valeur
agricole dans ces rgions. Les rsultats analytiques montrent que le sol est dune texture grossire avec
un faible taux de matire organique et dazote et une faible capacit dchange cationique. Le sol est
modrment calcaire, non sal faiblement sal, alcalin et non sodique. Les eaux dirrigation
appartiennent la classe C4S2, caractrise par un degr de salinisation lev et un danger
dalcalinisation apprciable. Lanalyse couple de la variance et du taux de variation annuelle des
paramtres tudis a montr une augmentation trs hautement significative de la salinit en fonction
du nombre de campagne agricole donc de la quantit deau applique. Avec une intensit de
salinisation plus prononce dans lhorizon de sub-surface. Lvaluation de la durabilit de la
craliculture sous pivot a montr que dici 48 70 ans, le site naura plus laptitude produire des
crales cause de la salinisation. Cette variation est en fonction de lespce, de ltat actuelle de la
salinit et du taux dvolution annuelle de cette dernire. Elle est relative et conditionne par plusieurs
facteurs, essentiellement litinraire technique, les facteurs dapho-climatiques et conomiques.

Mots cls : Rgions sahariennes, craliculture, eau, sol, salinit, durabilit

**************************************
O71
REFLEXIONS POUR UNE GESTION INTEGREE DE LA FERTILITE D'UN SOL
SALE AU SEIN D'UN AGRO-ECOSYSTEME OASIEN: CAS DE LA PALMERAIE
DU KSAR DE OUARGLA

Nawel OMEIRI

nawel702001@yahoo.fr

La palmeraie du ksar de Ouargla fut considre par le pass comme un des groupes doasis les plus
prospres du pays grce aux vieilles pratiques communautaires du systme traditionnel traduisant
lingniosit et le labeur de lancien agriculteur ouargli. Aujourdhui, lensablement, le rabattement de
la nappe, la remonte de la nappe phratique sale mais aussi la perte considrable de la fertilit de ses
sols en absence dune prise en compte suffisante de la spcificit oasienne dans les domaines de la
recherche agricole, sont en partie lorigine de son dclin. Une prise en charge par la mise en uvre
dune stratgie intgre visant dune part crer les conditions densemble ncessaires la
prservation de la fertilit des sols et la bonne gestion des ressources naturelles et dautre part
amliorer les performances du systme oasien est devenue aujourdhui plus quurgente dfaut,
lavenir risque dtre encore plus sombre et nous risquons dtre les tmoins impuissants de fcheuses
situations. Ltude que nous proposons sinscrit dans cette mouvance, elle permet dexaminer les
conditions dvolution du niveau de fertilit du sol dans cet agro- cosystme oasien spcifique et
fragile, confront une baisse continue de la fertilit des sols et menac constamment par les risques
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
42
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
de salinit cause des nouvelles pratiques culturales paysannes irrationnelles, non matrises et non
adaptes aux conditions agro- cologiques du milieu. Ceci dit, notre tude vise fournir des
informations utiles sappuyant sur des bases scientifiques, techniques, conomiques et sociales pour
finalement dresser un plan daction permettant par des mesures correctives, de protger, de maintenir,
voire damliorer le potentiel de production des sols.

Mots cls : lagro-cosystme oasien, sol, contraintes, pratiques culturales paysannes, plan de gestion

**************************************
O72
LUTILISATION DES FONCTIONS PEDOTRANSFERT DANS LA
DETERMINATION DE LA RESERVE UTILE EN EAU DES SOLS : UNE
METHODE PRATIQUE DE GESTION DES RESSOURCES HYDRIQUES AU
SAHARA.

Saliha HALITIM et Amor HALITIM

Dpt. dAgronomie Universit de Batna.
salihahalitim@yahoo.fr


Leau disponible pour les plantes est le facteur essentiel dans leur rgnration, leur maintien et leur
productivit. Dans les agrosystmes sahariens et pr-sahariens elle est apporte par les irrigations.
Cette eau bio-disponible ou rserve utile en eau du sol (RU) doit tre prise en compte dans le pilotage
des irrigations travers la dtermination des doses et des frquences darrosage. Or, au Sahara
notamment, il est trs souvent observ que les apports deau se font dune manire empirique et ne
prennent pas en considration cette donne, se qui se traduit dans ces rgions par une dperdition des
rserves hydriques, une lixiviation des lments nutritifs et une atteinte lenvironnement (pollution et
remonte des nappes superficielles). La RU est modifie par certains paramtres daphiques. De
nombreuses tudes ont t ralises de part le monde pour relier ces caractristiques aux proprits de
rtention en eau des sols. Mais trs peu lont t sur les sols des rgions arides de lAlgrie. En outre,
la lourdeur et le cot des mesures des proprits hydrauliques des sols et notamment la rtention en
eau ont rendu ncessaire de dvelopper des outils destimation de ces proprits partir de relations
mathmatiques appeles fonctions pdotransfert (FPT), faisant intervenir des caractristiques
pdologiques faciles dterminer. Ces FPT pourraient constituer de ce fait une mthode pratique pour
la gestion rationnelle des potentialits hydriques lchelle de la parcelle. Dans ce travail, nous nous
proposons sur des chantillons de sols prlevs en zone aride du sud-est Algrien de mettre en
vidence les caractristiques daphiques essentielles qui influent sur la RU dune part et de tester
certaines fonctions pdotranferts permettant de dduire les proprits hydriques des sols partir de ces
paramtres dautre part.

Mots cls : Zone aride, sol, RU, fonctions pdotranfert.

**************************************











Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
43
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O73
LES EAUX D'IRRIGATION ET DE DRAINAGE FACTEURS CONCENTRATEURS
DE SALINITE DES SOLS CAS DE LA STATION EXPERIMENTALE DE SIDI
MEHDI:INRA DE TOUGGOURT

TIR C., BENSAID R., MADANI D., FELLAH S. et ZABOUBI S.

tirtir2009@yahoo.fr

Le problme fondamental de l'agriculture saharienne est li la mobilisation de l'eau et la matrise de
son utilisation .Cette dernire mise viter le gaspillage, rentabiliser au maximuml'eau envisager
l'exploitation rapide de superficies importantes. Malheureusement le dveloppement de l'irrigation s'il
constitu un espoir pour les rgions arides, se traduit par une remonte du niveau de la nappe
superficielle et par une augmentation de la salinit des sols. La station exprimentale de Sidi Mehdi
INRA de Touggourt, situe 7 kmau sud est de Touggourt est confronte une gamme de
contraintes : conditions climatiques arides, salinit des sols .existence d'une nappe phratiques proche
de la surface et surtout pratique de l'irrigation et du drainage, ce qui influe largement sur la salinit de
ces sols. Les analyses des eaux d'irrigation,de drainage ,de nappe ainsi que ceux des chantillons des
sols ont t effectues en deux priodes: sche et humide ,c'est ainsi qu'on a pu ressortir les
constatations suivantes:
malgr l'existence d'une nappe phratique trs proche de la surface du sol ( 65 cm),la salinit
des sols n'est pas lie forcement au phnomne de r remonte capillaire.
l'eau d'irrigation et par dssolution des sels notamment neutre participent dans l'augmentation
de la salinit des sols de la station.
le drainage reste fonctionnel sans attendre l'optimum donc il participe l'accentuation de la
salinit des sols surtout en priode sche.

Mots cls: Salinit, eau d'irrigation, eau de drainage, eau de nappe, sols sals.

**************************************
O74
LES SYMBIOSES RHIZOBIUMS LEGUMINEUSES : BIODIVERSITE ET ROLE
DANS LA FERTILITE DES SOLS ARIDES ET SALEES
Abdelkader BEKKI
1
, Chahinez MERABET
1
, Meriem Amina REZKI
1
, Faiza
BOUKHATEM
1
, Philippe DE LAJ UDIE
2

1
Laboratoire de Biotechnologie des Rhizobiums et amlioration des plantes. Dpartement de Biotechnologie,
Universit dOran Es-Senia. BP16, Oran, Algrie.
2
Laboratoire des Symbioses Tropicales et Mditerranennes, UMR 113 INRA/AGRO-M/CIRAD/IRD, TA 10 /
J, Campus International de Baillarguet, 34398 MONTPELLIER Cedex 5, France.
abek31@hotmail.com

La dgradation de l'environnement et la baisse de la fertilit des sols agricoles et forestiers sont
particulirement sensibles dans les rgions mditerranennes, caractrises par des conditions
climatiques trs contraignantes: aridit, salinit, rosion olienne. C'est le cas de l'Algrie, dont 80%
des terres sont situes sous des climats arides ou semi-arides. Chaque anne, des milliers d'hectares
sont soustraits une utilisation agro-pastorale du fait de la dsertification conjugue la salinit. Dans
lobjectif de slectionner des lgumineuses fourragres rsistantes la salinit et la scheresse et des
espces ligneuses et arbustes intressants pour la lutte contre la dsertification et pour la stabilit des
dunes, nous avons multipli ces dernires annes les recherches sur ces lgumineuses locales et une
collection de souches bactriennes a t constitu a partir de leurs nodosits. La caractrisation
phnotypique classique complte par des techniques molculaires rcentes (PCR-RFLP, Squenage
de lADNr 16, lhybridation ADN/ADN) des isolats obtenus a rvl lexistence dune grande
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
44
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
diversit au sein des bactries associes ces lgumineuses. En effet les rsultats obtenus montrent
que ces bactries appartiennent aux genres (Ensifer, Rhizobium Agrobacterium, Phyllobacteriumet
Bradyrhizobium). Ltude de l'influence de la charge saline sur leur croissance, la nodulation et la
fixation d'azote en conditions contrles a permis de slectionner des couples symbiotiques
performantes pour leur introduction dans les sites dexprimentations arides et dgrads.

Mots cls: Salinit, Squenage, Hybridation ADN/ADN,

**************************************



O75
CARACTERISATION SALINE DUN SOL NU DANS LA CUVETTE DE OUARGLA

IDDER Abdelhak, CHELOUFI Hamid, IDDER Tahar

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie
idder_haki@yahoo.fr

Notre travail a tudi laccumulation saline sur un sol sableux nu en priode estivale. Ce sol na jamais
connu daction anthropique par sa mise en culture ou son irrigation. Les seules sources hydriques
disponibles sont celle de faible pluviomtrie caractristique de la rgion et les eaux phratiques
classes C5S3 de facis chimique chlorur sulfat sodique. A la lumire de ltude sur les profils
examins, illustr par la typologie des sels, notre sol prsente une grande homognit concernant le
compartimentage des sels. Les rsultats obtenus travers ionique indiquent clairement deux horizons
distincts daccumulation des sels. Il sagit des horizons de surface et intermdiaire. La prsence
massive des ions successivement positifs et ngatifs par ordre de dominance Na>Ca>Mg et
Cl>SO4>CO3 engendre de ce fait une occupation majoritaire des sels Na Cl et Na2 SO4 affichant
ainsi un facis chimique chlorur sulfat sodique. Une tentative damnagement de ce sol a t
entreprise pendant une dure de deux mois grce une compagne dirrigation intensive suivie de
drainage. Cette tentative sest rvle infructueuse.

Mots cls : Cuvette de Ouargla, sols nus, nappe phratique, salinit, amnagement.

**************************************

Thme 5 - Valorisation des plantes spontanes
O76
TOXICITE AIGUE ET CHRONIQUE DE LEXTRAIT AQUEUX ARISTOLOCHIA
BAETICA CHEZ LES RONGEURS

YAMANI Ama1 et ELACHOURI Mostafa

Laboratoire de Physiologie et Ethnopharmacologie Universit Mohammed Ier, Oujda, Maroc
yamani.amal@yahoo.fr

Aristolochia baetica (Aristolochiaces) connue sous le nom vernaculaire de barraztam est une
plante spontane frquemment utilise dans la mdecine traditionnelle marocaine pour le traitement
des diffrentes maladies y compris les palpitations de laorte abdominale et les maladies digestives,
mais le genre aristoloche est class parmi les plantes dangereuses pour la sant humaine puisquil
renferme les acides aristolochiques qui sont avrs cancrignes, nphrotoxiques et hpatotoxiques.
Au Maroc quatre espces seulement sont reprsentes, parmi lesquelles, Aristolochia baetica, une
espce qui pousse spontanment dans la rgion de loriental marocain. Cette espce a connu une large
utilisation, en phytothrapie, par la population marocaine, malheureusement, le cot toxique de cette
plante est compltement ignor. A fin de mettre la lumire sur les effets indsirables de cette plante,
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
45
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
nous avons entrepris un travail dans ce sens. Des extraits aqueux des racines de cette plante ont t
tests sur des animaux de laboratoire. Deux types de toxicit ont t valus :
- une toxicit aigue par voie orale en une dose unique sur des souris des deux sexes durant une
semaine.
- une toxicit chronique : des rats de laboratoire ont t gavs par extrait aqueux des racines
dAristolochia baetica, et ceci pendant une priode de 12 semaines.
Nos rsultats montrent bien la toxicit de lextrait aqueux des racines de cette espce. Des altrations
ont t rvles, aussi bien au niveau srologique quhistologique. Sur base de ces rsultats, nous
pouvons avanc que lespce Aristolochia baetica est une plante mdicinale potentiellement toxique
quelle doit tre utiliser avec beaucoup de prudence.

Mots cls : Aristolochia baetica, toxicit aigue, toxicit chronique, phytothrapie, nphrotoxique,
hpatotoxique rat et souris

**************************************

O77
INVENTAIRE ET RECHERCHE DE LUSAGE DES PLANTES SPONTANEES
MEDICINALES DE LA PHARMACOPEE TRADITIONNELLE DE LA REGION
DES ZIBAN

ZEGUERROU R, GUESSMIA H, LAHMADI S.

Station Bioressources DEl Outaya, Centre de Recherche Scientifique et Technique sur les Rgions Arides
CRSTRA, Biskra, Algrie
Zeguerroureguia@yahoo.fr

La rgion des Ziban est anciennement connue par ces pratiques en mdecine traditionnelle et ce en
raison de leurs richesses en flore surtout spontane. Des enqutes avec quelques connaisseurs anciens
toujours en activit de la phytothrapie sont effectues au niveau de la rgion des Ziban, aprs cette
tape, un travail dinventaire sur terrain t effectu dans le but de :
*Constituer un herbier de plantes mdicinales ;
* Protger et prserver quelques espces inventories au niveau de la Station Bioressources dEl-
Outaya du Centre de Recherche Scientifique et Technique sur les Rgions Arides Omar
ELBARNAOUI
*Elaborer une pharmacope traditionnelle.
Les enqutes menes auprs des connaisseurs de la phytothrapie nous ont permis didentifier un
ensemble de plantes utilises et les maladies traites par ces plantes, Les maladies traites les plus
frquentes dans la rgion sont : les maladies rhumatismales, les piqueurs des serpents et scorpions,
gyncopathie (maladies gnitales), la pathologie broncho-pulmonaire, la pathologie digestive et
dautre maladies. Les modes de prparation des traitements les plus pratiques dans la rgion de
Ziban : infusion, dcoction, poudre, cataplasme et lga. Linventaire sur terrain des diffrentes plantes
recenses nous ont permis dinventorier 80 espces mdicinales appartenant 40familles, dont 57,5%
sont des espces spontanes. Les familles les plus importantes sont : les lamiaces (27%). Astraces
(23%). Liliaces, Brassicaces (7%). Fabaces (14%). Apiaces (16%). Asclpiadaces, Rutaces,
Zygophyllaces, Euphorbiace, Cucurbitaces, Pinaces, Solanaces (4%). Chnopodiaces,
Capparidaces, Cactaces, Lythraces , Lauraces, Globulariaces, Poaces, Moraces, tiliaces,
Myrtaces, Cupressaces, Apocynace, Anacardiaces, Trbinthaces, Tamaricaces, Thymelaeces,
Urticace, Rhamnaces, Olaces, Renonculaces, Arcaces, Rosaces, Punicaces, Pdaliaces,
Verbnaces, thaces (2 %).

Mots cls : Ziban, mdecine traditionnelle, flore spontane, enqutes, pharmacope traditionnelle.

**************************************

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
46
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

O78

MISE AU POINT DUN LOGICIEL COMPILANT UNE BASE DE DONNEES DES
PLANTES MEDICINALES ALGERIENNES ET LES ETUDES DE RECHERCHES
REALISEES SUR CES PLANTES

A.E.K. HADJ SEYD
1
, T. LANEZ
2
, S. BENACHOURA
3
, A. IDHER
4

1
Centre Universitaire de Ghardaa, Route de Ouargla, Ghardaa, Algrie
2
Centre Universitaire dEl Oued, B.P 789,39000 El Oued, Algrie.
3
Universit de Ouargla, Route de Ghardaa, Algrie.
4
Laboratoirede protection des cosystmes en zones arides et semi-arides. Univ-Ouargla
seydtg@gmail.com

Le logiciel PLANTE mis en vidence dans ce travail, renferme une large gamme de plantes
reconnues dans la mdicine traditionnelle en diffrentes rgions de lAlgrie, il est en outre conu pour
contenir les tudes de recherches scientifiques qui ont t ralises sur ces plantes aux Universits et
aux centres Universitaires implants travers le territoire national. Il a pour but de faciliter la
recherche aux tudiants en stade de recherche scientifique prparant un titre de Magister, Doctorat ou
dautres recherches. Les plantes peuvent tre observ sous forme de liste ou de fiches techniques,
renfermant toutes les mentions utiles identifiant la plante, telles que : nom scientifique, nom commun,
nom arabe, famille, habitat, caractristiques, composition, parties mdicinales ainsi que la photo et un
rsum sur lutilisation mdicinale de la plante. De mme les tudes ont t groupes par : Universit
ou centre Universitaire, chercheur, intitule de la recherche, plante tudie, cadre de recherche
(Magister, Doctorat ou autre), anne et date de validation de ltude (soutenance) et en fin un rsum
comprenant le but et les objectifs de ltude ralise ainsi que les rsultats obtenues. Le langage de
programmation utilis est Delphi, qui est un outil trs puissant de programmation des bases de donnes
sous Windows, le logiciel peut tre facilement install sur PC et tre utilis. Grce son interface
graphique trs simple, lutilisateur peut ainsi rechercher, superviser, classer et imprimer une liste ou
une fiche dune plante ou tude choisie, il offre mme lavantage de modifier ou denrichir sa base de
donnes par dautres plantes ou de nouvelles tudes. Le logiciel PLANTE reprsente donc une
vrais banque de donne nationale, permettant dorienter les tudiants et chercheurs, surtout ceux dans
le domaine de la phytochimie ce documenter et de reconnatre la richesse de leur pays en matire de
plantes mdicinales et en fin choisir les thmes de recherche pour les plantes qui nont pas encore t
tudies.

Mots cls : Plante mdicinale, tude, recherche scientifique, base de donnes, Delphi.

**************************************
O79
RECHERCHE DE LACTIVITE CICATRISANTE E DES COMPOSES
PHENOLIQUES DES FEUILLES DU Balanites aegyptiaca DEL.

OUAFIS. S, BOUGUEDOURA .N.

Laboratoire de recherche sur les zones arides, (L.R.Z.A), Facult de Biologie USTHB
Saida_ouafi@yahoo.fr

Les plantes mdicinales sont doues de proprits thrapeutiques qui sont utilises comme source
principale de mdicaments, en fournissant de la matire premire ou en servant de modle pour la
synthse de molcules thrapeutiques. Le dattier du dsert ou Balanites aegyptiaca est une espce
arborescente majeur de la flore de lAHAGGAR (TAMANRASSET), cest une espce fruitire
surtout mdicinale. Notre objectif de travail a t consacr lextraction des composs phnoliques,
les extraits sont soumis des tests pharmacologiques qui ont pour but la mise en vidence dun
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
47
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
ventuel effet cicatrisant. Le principe consiste lapplication du produit tester (extrait de
polyphenols des feuilles mlang de la vaseline) sur des plaies pralablement provoques. Les
applications se feront de faon quotidienne jusqu pithlialisation complte de la plaie (environ15
jours).Notre tude a t base sur deux critres dvaluation qui sont :
-dure de cicatrisation
-volution de la surface des plaies
Elle permet de comparer les diffrentes cicatrisations et leurs volutions sur la base de la
modification de la taille de la cicatrice. Les rsultats indiquent que le traitement des rats avec le
produit test montre une dure de cicatrisation totale de 13 jours, contre 18 jours pour le groupe de rats
tmoins non trait, dure de cicatrisation maximum selon ce protocole. A noter que la cicatrisation des
plaies traites avec une pommade cicatrisante sest faite au bout de 15 jours. La ralisation du test
pharmacologique a dmontr donc que les polyphenols de la classe des flavonoides des feuilles de
Balanites aegyptiaca possdent une trs bonne activit cicatrisante.

Mots cls : Balanites aegyptiaca DEL, polyphnols, surface des plaies, cicatrisation.

**************************************
O80
CARACTERISATION PARTIELLE DES POLYSACCHARIDES HYDROSOLUBLES
DES FEUILLES D'Asphodelus tenuifolius (Liliaceae) Et L'tude De L'effet Prbiotique
Des Oligosaccharides Issus De L'hydrolyse Des Polysaccharides

BOUAL Zakaria
1
, KEMASSI Abdellah
1
, MICHAUD Philippe
2
, OULD EL HADJ Mohammed Didi
1,3
,
1
Laboratoire Protection des Ecosystmes en Zones Arides et Semi-Arides Universit de Ouargla, Algrie
2
Laboratoire des Glucides (EPMV) CNRS FRE2779, IUT/GB, UPJV, Avenue des Facults, Le Bailly, 80025
Amiens Cedex, France
3
Laboratoire de Biogochimie des Milieux Dsertiques, Universit de Ouargla, Algrie
biozakaria@yahoo.fr.

Les polysaccharides hydrosolubles des feuilles d'Asphodelus tenuifolius (Liliaceae), une plante
spontane caractre mdicinal de la rgion de Ghardaa (Sahara septentrional Est algrien), sont
obtenus par extraction l'eau distille, la temprature ambiante pendant 24 heures, aprs limination
des extraits thanoliques. Leur prcipitation est faite par lthanol 75%. Le rendement massique de
l'extrait polysaccharidique est de 0,65%. L'tude de la composition de l'extrait brut des
polysaccharides hydrosolubles aprs lyophilisation, montre des valeurs moyennes de 18,33 2,08
%d'humidit, 23,66 1,52% de cendres totales, 26,13 0,37% de protines totales et 28,961,12
d'oses totaux. Parmi les oses, 67,50 0,94% sont des oses neutres et 32,49 0,26% sont des oses
acides. Lhydrolyse des polysaccharides hydrosolubles par lacide trifluoroactique 4 M durant 5
heures 80C, laissent remarquer aprs analyse par chromatographie sur couche mince (CCM), que
les polysaccharides hydrosolubles des feuilles d'Asphodelus tenuifolius, sont des
htropolysaccharides acides renferment de l'arabinose, du glucose, du xylose, de l'acide glucuronique
et probablement du galactose et du mannose. L'analyse par chromatographie changeuse d'anions, de
haute performance, dtecteur ampromtrique puls (HPAEC-PAD), des oses constitutifs des
polysaccharides hydrosolubles des feuilles de d'A. tenuifolius montre une prdominance de mannose
39,25% et de glucose 31,55%, suivie de 10,92% de l'acide glucuronique et 8,9% d'arabinose. Le
rhamnose et le xylose sont prsents en faible pourcentage avec 5,22% et 4,14% respectivement. Les
hydrolysats partiels des extraits de polysaccharides hydrosolubles des feuilles d'A. tenuifolius,
concentration de 0,333 mg/ml, stimule de manire significative, pour 0,1 DO aprs 24 heures, la
croissance de Klebsiella pneumonea pneumonea et l'action prbiotique des oligosaccharides issus de
ces hydrolysats sur cette bactrie est apprciable.

Mots cls: Polysaccharides, plantes, mdicinal, hydrolyse, oligosaccharides, effet, bactrie.


**************************************
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
48
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O81
CONTRIBUTION A LETUDE DE LA TOXICITE DES EXTRAITS DEuphorbia
guyoniana Boiss. & Reut. (Euphorbiaceae) Et De Citrullus colocynthis Schard.
(Cucurbitaceae) SUR LES LARVES DU CINQUIEME STADE ET SUR LES
ADULTES DE Schitocerca gregaria (Forskl, 1775)
(Orthoptera- Cyrtacanthacridinae)

KEMASSI Abdellah
1
, BOUAL Zakaria
1
, OULD EL HADJ- KHELIL Aminata
1
, DADDI
BOUHOUN Moustapha
1
et OULD EL HADJ Mohamed Didi
1,2,
.

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi arides Universit, Ouargla,
2
Laboratoire de Biogochimie des Milieux Dsertiques, Universit Kasdi Merbah-Ouargla
akemassi@yahoo.fr

Ltude porte sur lactivit biologique des extraits de feuilles dEuphorbia guyoniana Boiss & Reut
(Euphorbiaceae) et de Citrullus colocynthis Schard (Cucurbitaceae) rcoltes de la rgion de
Ghardaa (Sahara septentrional Est algrien) vis--vis des larves L
5
et dadultes de Schistocerca
gregaria Forskl (1775). Les larves L
5
et adultes de S. gregaria mis en prsence de feuilles de chou
asperges de lextrait des feuilles dE. guyoniana perdent 33,09% et 26,92% de leurs poids initial
respectivement, alors que chez les larves L
5
nourries par des feuilles de choux traites lextrait
foliaire de C. colocynthis, une perte du poids de lordre de 03,95% est note, par contre, une
amlioration du poids de 16,99% est rapporte chez les adultes. Les larves L
5
nourris aux feuilles de
chou lextrait foliaire dE. guyoniana nont pas pu effectuer leur mue imaginale, de plus, une mortalit
larvaire de 100% est note au bout du 14
e
jour, et aprs le 30
e
jour 66,67% des adultes sont morts.
Chez les individus nourris aux feuilles de chou traites par lextrait foliaire de C. colocynthis, une
mortalit de lordre de 33,33% est enregistre chez les larves L
5
et de 16,66% chez les adultes.
Nanmoins, les mesures de tailles des ovarioles rvlent que chez les femelles nourries aux feuilles de
chou traites par les extraits foliaires de ces deux plantes acridifuges, la taille des ovarioles est
infrieure comparativement aux femelles des lots tmoins. Le TL
50
rapport pour les larves L
5
est de
10,51 jours pour lextrait des feuilles dE. guyoniana, et de 18,88 jours pour lextrait foliaire de C.
colocynthis, alors que pour les adultes, il est 20,02 jours et 82,87 jours pour lextrait foliaire dE.
guyoniana et de C. colocynthis respectivement.

Mots cls: Schistocerca gregaria, toxicit, plantes acridifuges, Sahara, extraits foliaires.

**************************************
O82
ETUDE DE LA VEGETATION SPONTANEES DES DEPRESSIONS SALEES DE LA
CUVETTE DE OUARGLA

DJERROUDI, O
1
, EDDOUD, A
1
, BENHAMIDA A
2
et DJEGHBALA H
2

1
Laboratoire Bio ressources Saharienne, protection et valorisation, Universit de Ouargla, Algrie.
2
Dpartement de biologie, Universit de Ouargla, Algrie.
zidaneouiza@yahoo.fr

Cette tude mene a pour objectif la caractrisation des plantes halophiles dans deux types de
dpressions sales (chott et sebkha) dans la cuvette de Ouargla. Les rultats obtenus montrent :
La prsence de quatre espces dans la station du chott et six dans la station de sebkha. Les
espces Halocnemum strobilaceum, Juncus maritimus, Phragmites communis et Tamarix gallica sont
communes aux deux stations alors que Cornulaca monacantha et Zygophyllum album se trouvent
uniquement dans la station de la sebkha.
La distribution, la densit et le recouvrement de ces espces varient dune station lautre
dune part et dune sous station lautre dautre part en fonction de la variation de la salinit et de
lhumidit.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
49
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Ltude anatomique a montr lexistence de certaines particularits adaptatives telles que : le
dveloppement du parenchyme aquifre chez Cornulaca monacantha, Halocnemum strobilaceum et
Zygophyllum album, lpaississement de la cuticule et la prsence des tissus de soutien observ chez
Juncus maritimus et Phragmites communis.
Ces rsultats montrent que les caractristiques anatomiques restent comparables ceux des
xrophytes.

Mots cls : halophytes, adaptation, anatomie, Sahara

**************************************
O83
VALORISATION DES PLANTES STPPIQUES : CAS DE LA COAGULATION DU
LAIT PAR LES PROTASES DU CHARDON (Cynara humilis L), MAUVE (Malva
sylvestris L) ET ORTIE (Ortica dioica L)

Yacine GOUDJ AL
1
, Miyada ZAAMOUM
2
Hadjira HANNANI
1
& Zineb DJ OUBAR
1

1
Dpartement de biologie, Universit Amar TELIDJI de Laghouat, Algrie
2
Institut National Agronomique - El-Harrach, Alger, Algrie
goudjal_y@yahoo.fr

Ltude porte sur la valorisation fromagre des protases extraits de trois plantes adventices de la
rgion de Laghouat (chardon, mauve et ortie) ; ainsi que la mise en vidence de leur activit
coagulante sur le lait de vache et le lait de chvre. Elle vise galement comparer les rendements
fromagers de chacun des extraits enzymatiques avec ceux de la prsure industrielle et la prsure
traditionnelle (de la caillette du veau). Les trois extraits enzymatiques obtenus des fleures de chardon,
des grains de mauve et des feuilles dortie avaient une activit coagulante sur les deux types de lait
tudis. Les rendements fromagers moyens obtenus pour un taux demprsurage de 7% et une
incubation 30C sont respectivement de 13.52%, 18.78% et 14.41%. Les rendements obtenus, dans
les mmes conditions, par la prsure industrielle et la prsure de la caillette du veau sont valus,
successivement, 15.56% et 18.25%. Tous les rendements fromagers obtenus sont notablement
influencs par l taux demprsurage, le type du lait, la temprature et la dure dincubation.

Mots cls : Protase, chardon, ortie, mauve, fromage.

**************************************
O84
EFFET INHIBITEUR IN VITRO DE LHUILE ESSENTIELLE DArtimesia herba alba SUR
DEUX SOUCHES DE Fusarium oxysporum f. sp. Radicis-lycopersici

KOLAI N, SAIAH F et BOUDIA A

Laboratoire de protection des vgtaux, Univ- Abed El Hamid IbnBadis, Mostaganem, Algrie
kolainaouel@yahoo.fr

Fusarium. oxysporum f. sp. radicis-lycopersici, est parmi les champignons telluriques les plus
agressifs, causant des fltrissements et des pourritures sur tomate. Dans le but de chercher dautres
alternatives de lutte contre ce champignon, nous tudions dans ce travail le pouvoir antifongique de
lhuile essentielle de l'armoise blanche (Artemisia herba-alba) extraite par hydrodistillation. Cette
aptitude a t recherch in vitro, sur un milieu solide glos vis--vis de deux souches ; la 1
ere
isole de
la varit Marmande et la 2
me
de la varit Agora. Les huiles diffrentes concentrations (0.1%,
0.5%, 1%, 3%, 5% et 7%) ont t ajoutes au milieu PDA une temprature de 40C puis verses
dans des botes ptri. Chacune delle est inocule laide dun explant myclien de 5 mmde diamtre
environ, provenant dune culture de champignon ge dune semaine. Pour chacune des concentrations
de lhuile ainsi que pour le tmoin, trois rptitions sont effectues. Les botes sont ensuite incubes
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
50
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
25C lobscurit pendant 07 jours. Lefficacit de chaque concentration tudie, est estime par le
calcul du pourcentage dinhibition de la croissance du champignon test, selon la relation de Leroux et
Gredet (1978). Avec un rendement de lhuiles essentielle de larmoise a montr une efficacit
remarquable sur les deux souches avec une concentration minimale inhibitrice CMI de 3%. Ces
rsultats bien que prliminaires, tmoignent dune bonne activit antifongique, permettant de limiter et
mme de stopper le dveloppement de lagent pathogne.

Mots cls : Inhibiteur, in vitro, huile essentielle, Artimesia herba alba, Fusarium oxysporum

**************************************
O85
ANALYSE MOLECULAIRE DE LA DIVERSITE GENETIQUE DE PLANTES
XERO/HALOPHYTES DU GENRE ATRIPLEX MOYENNANT RAPD-PCR

MAALEM S
1,2,3
, KHOUFI S
2
, RAHMOUNE C
3
& BENNACER M
2
.

1
Dpartement de Biologie, Universit Cheikh Larbi Tbssi- Tbessa, Algrie.
2
Laboratoire dEcotoxicologie, Universit de Constantine, Algrie.
3
Laboratoire de physiologie vgtale et biotechnologies, INRAT, Tunis, Tunisie.
soubenyou@yahoo.fr

Dans les zones arides et semi arides, le genre Atriplex reprsente une ressource fourragre importante.
Cependant, on ne dispose nos jours, que de peu dinformation sur leur structure gntique. Les essais
visant caractriser la diversit gntique de ces espces sont donc trs utiles pour leur classification,
leur conservation et leur amlioration. Dans se contexte, nous nous sommes lancs dans lvaluation
du niveau de diversit gntique caractrisant les Atriplex poussant actuellement en Algrie. Nous
avons utilis la technique RAPD sur des gnotypes de 3 diffrentes espces dAtriplex: A. halimus, A.
canescens et A. nummularia. Les rsultats obtenus ont mis en vidence lamplification de 319 bandes,
dont la totalit t polymorphe. Lanalyse de ces rsultats, moyennant le logiciel NTSYSpc 2.0 for
Windows, a permis dobtenir 4 groupes distincts o les gnotypes de 2 espces introduites ont t
classs en 2 groupes indpendants. Cependant, les gnotypes de lespce autochtone (A. halimus) ont
t aussi subdiviss en 2 autres groupes indpendants. De faon gnrale, les rsultats ont rvl un
seuil lev de divergence gntique, inter et intra espces chez les gnotypes tudis dAtriplex.

Mots cls: Atriplex, Chnopodiaces, Diversit gntique, PCR-RAPD, Steppe

**************************************
O86
TRITERPENES FROM ALGERIAN SAHARAN PLANT Euphorbia retusa WITH
ANTIBACTERIAL ACTIVITY

Hamada HABA
1
, Catherine LAVAUD
2
, Abdulmagid ALABDUL MAGID
2
, Mohammed
BENKHALED
1

1
Laboratoire de Chimie et Chimie de lEnvironnement (L.C.C.E), Universit de Batna, Algrie.
2
Laboratoire de pharmacognosie, Institut de Chimie Molculaire de Reims, CNRS UMR 6229, BP 1039, 51097
Reims Cedex 2, France
Haba.hamada@yahoo.fr

In the course of our studies on bioactive constituents frommedicinal and aromatic plants, present work
was carried out on Euphorbia retusa Forsk. (Family Euphorbiaceae). Euphorbia is the largest genus of
the family and comprises about 1000 species distributed throughout the Mediterranean region. It is
used in Algerian folk medicine against the venomous bites and trichiasis and is known as remedy
against warts. Like the other species of the genus Euphorbia, this species is characterized by the
presence of milky irritant latex which is very rich in tetracyclic triterpene compounds. We report
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
51
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
herein the isolation and structure elucidation of several triterpenes type cycloartane as 24-
methylenecycloartanol (1), 24-methylenecycloartanyl palmitate (2), 24-methylenecycloartanyl acetate
(3), 24-methylenecycloartanone (4), cycloeu-calenol (5) cycloeucalenyl acetate (6), cycloartenol (7)
and cycloart-25-ene-3,24-diol (8) from the dichloromethane extract of the roots of E. retusa.
Structures of the isolated compounds were determined of spectroscopic analysis including various two
dimensional NMR (COSY, HSQC, HMBC and NOESY) and mass spectrometry EI-MS and ESI-MS
and by comparison with literature data. The compounds 1, 5, 7 and 8 exhibited antibacterial activity.

Key words: Euphorbiaceae, Euphorbia retusa Forsk., Tetracyclic triterpenes, NMR 1D and 2D,
Antibacterial activity.

**************************************
O87
DIVERSITE DES ESPECES DE TERFEZ (TRUFFES DES SABLES) DES ZONES
ARIDES ALGERIENNES

FORTAS Z.

Laboratoire de Biologie des microorganismes et de Biotechnologie, Universit dOran, Algrie
Torfez2000@yahoo.fr

Les terfez (truffes des sables ou du dsert) sont des champignons hypogs comestibles (Ascomyctes,
Terfeziaces). Ils vivent en association symbiotique dite mycorhizienne avec des plantes herbaces de
la famille des Cistaces appartenant surtout au genre Helianthemum. Ces champignons se dveloppent
dans les zones arides et semi-arides principalement sur le pourtour du Bassin mditerranen et au
Moyen - Orient. En Algrie, ils sont abondants dans les rgions steppiques et nord sahariennes et sont
reprsents par 3 genres : Terfezia, Tirmania et Picoa et six espces. Les paramtres pdo- climatiques
et la prsence de la plante-hte jouent un rle primordial pour le dveloppement de ces champignons.
Le sol est un facteur daphique capital, ses caractristiques physico-chimiques exercent une action
prpondrante sur la croissance de ces champignons. Les terfez prosprent sous des climats chauds et
exigent des hivers et des printemps pluvieux, leur maturit nest obtenue qu la suite des pluies
orageuses de printemps, suivies dune priode de scheresse. Leur cycle de vie est encore mal connu,
il se droule entirement dans le sol et dpend dune plante-hte avec laquelle il forme une association
mycorhizienne. Les terfez sont des produits naturels, ils prsentent un intrt alimentaire et
conomique. La rcolte globale nationale des terfez nest pas bien connue, elle peut atteindre au sud-
ouest algrien environ 4 millions de quintaux pendant les annes de bonne production ceci ne
reprsente que 1/10 de production globale dans ces rgions, en raison de la superficie des zones
terfez, de la mthode de rcolte et de la dtrioration rapide des corps fructifres. Ces champignons
demeurent une marchandise clandestine et sont vendus au kilogramme des prix variables selon les
annes de production et le lieu de leur rcolte. Cet impact socio-conomique ouvre des perspectives
pour dvelopper la culture de ces ressources naturelles dans les zones arides.

Mots cls : Diversit, terfez, rpartition, paramtres pdo-climatiques, production naturelle.

**************************************










Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
52
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O88
MECANISMES ADAPTATIFS DE QUELQUES HALOPHYTES SPONTANEES
SOUS DE REGIMES HYDRIQUES DIFFERENTS DE LA REGION DE OUARGLA.

ANNOU Ghania et OULD ELHADJ KHELILE Aminata

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie.
ghaniaanno@gmail.com

Quelques aspects de la rsistance des halophytes spontanes poussent dans la rgion de Ouargla la
salinit ont t tudis. A savoir : Suaeda mollis, Phragmites communis, Liminium dlicatulu et
Salicornia fructicosa pendant deux priodes (hivernale et estivale) et sous deux rgimes hydriques
(continu et discontinu). Les essais raliss sur ces espces permettant de tirer quelques renseignements
concernant leffet du sel sur la composition minrale des diffrents organes, leur tat hydrique, leur
contenu en glucide soluble, en proline et en protine en fonction de lintensit de sel. Lanalyse
physico-chimique des sols indique que le sol de Chott Ain el Beida est plus sal que celui de
lexploitation qui montre une variabilit de la salinit suivant lirrigation. Le statut hydrominrale
permet de constat le mcanisme adaptative des plantes. Il sagit de la compartimentation (inclusion)
pour Suaeda et Salicornia et lexclusion pour Limonium, et de laccumulation pour
Phragmites.Globalement, on a constat une proportionnalit entre laugmentation de la teneur des
espces en ions toxiques et en soluts compatibles telles que les sucres solubles totaux, lamidon, la
proline et les protines. Ces lments sont compartiments lchelle de la plante entire par la
squestration des ions toxiques dans les feuilles les plus ges, les jeunes feuilles bnficient alors
dune protection accrue. Celles-ci en contrepartie accumulent de prfrence des soluts compatibles
qui contribuent leur ajustement osmotique.

Mots cls : Halophytes, glycophytes, adaptation, ions, mtabolites.

**************************************
O89
VALUATION DU POTENTIEL ANTIOXYDANT DE PLANTES MEDICINALES
ET ANALYSE PHYTOCHIMIQUE

Wahiba RACHED, Houari BENAMAR, Malika BENNACEUR, Abderrazak MAROUF

Laboratoire de Biochimie vgtale et des substances naturelles, Universit dOran, Algrie
wahiba200631@yahoo.fr

La plupart des espces vgtales utilises dans ce travail sont des plantes mdicinales utilises
largement dans la phytothrapie traditionnelle pour traiter les diverses pathologies dont le diabte, le
cancer, lathrosclrose, les maladies cardiovasculaires et les maladies neurodgnratives. Le stress
oxydatif contribue directement ces pathologies. Le matriel vgtal utilis comprend plus de 80
extraits de 56 espces rcoltes de diverses rgions dAlgrie. Ltude a port sur un screening de ces
plantes pour leur activit antioxydante value in vitro par deux tests diffrents : action
antiradicadicalaire contre le radical DPPH (2,2-diphnyl-1-picrylhydrazyl); action inhibitrice de
loxydation du -carotne et compare celle dantioxydants authentiques pris comme rfrence. Un
essai de fractionnement par partage liquide-liquide par des solvants polarit croissante a galement
t entrepris dans le cas dune plante du Tassili, Myrtus nivellei, en vue de localiser les principes actifs
responsables de lactivit antioxydante observe, trs levs dans lextrait aqueux de cette plante.
Deux espces (Pistacia. lentiscus et Tetraclinis articulata) ont t tudies pour leurs fluctuations
saisonnires de lactivit antioxydante. Celles-ci montrent une bonne corrlation avec les teneurs en
polyphnols : R
2
=0.78 et R
2
=0.96, respectivement. Par contre, il nexiste aucune corrlation entre les
teneurs en flavonodes et lactivit antioxydante chez P. lentiscus ce qui peut probablement
sexpliquer par le fait que des composes polyphnoliques bioactifs autres que les flavonodes sont
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
53
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
responsables de lactivit observe. A linverse, chez T. articulata, les flavonodes sont les agents
antioxydants de premier ordre comme en tmoigne la corrlation (R
2
= 0.97) entre ces deux
paramtres. Paralllement cette tude biologique, un criblage phytochimique de mise en vidence
des principaux phytoconstituants du mtabolisme secondaire des plantes actives a t entrepris ainsi
quune quantification des polyphnols totaux et des flavonodes.68. Les rsultats des tests biologiques
montrent que certains extraits sont trs actifs comparativement des substances authentiques et
connues comme le BHA, antioxydant de synthse largement utilis dans les industries agro-
alimentaires. Ils sont, de ce fait, une source potentielle pour lisolement dantioxydants naturels. Cest
le cas des deux espces de Pistacia (lentiscus et atlantica) et de Cynomorium coccineum. Les tests
phytochimiques montrent une grande diversit dans les profils phytochimiques des plantes tudies
avec une prdominance de polyphnols, ce qui laisse suggrer que lactivit antioxydante enregistre
est due essentiellement ces composs comme le montrent clairement les corrlations statistiques. Les
phytoconstituants identifis par CCM sont principalement des acides phnoliques, des lignanes, des
flavonodes, furano- et pyranocoumarines, des terpnodes et des sesquiterpnes lactones, des
saponines et des glycosides cardiotoniques. Lactivit antioxydante observe est souvent corrle aux
teneurs en polyphnols et en flavonodes.

Mots cls : Plantes mdicinales, antioxydants, bioautographie, DPPH, polyphnols

**************************************

O90
CRIBLAGE PHYTOCHIMIQUE ET DETERMINATION DU POUVOIR
ANTIMICROBIEN DES METABOLITES ISSUS DE PULPE, FEUILLE. DE
LArgania spinosa DE LA RGION SUD OUEST ALGRIEN (TINDOUF).

H. KADI
1
, H. AZZOUNI
2
, A. MOUSSAOUI
2

1
Universit de Bechar, Algrie
2
Universit de Tlemcen, Algrie
hamidkadi08@yahoo.fr

L'ambition de ce travail cadre la valorisation d'une substance vgtale de la rgion du sud ouest
algrien (Tindouf) du genre Argania spinosa. Larganier, Argania Spinosa (L) skeels , appartient
une famille tropicale, celle des Sapotaces, c'est un arbre forestier "multi usage ", chaque partie de
l'arbre est utilisable, et reprsente une source de revenue et de nourriture pour l'usager. C'est dans ce
contexte que notre travail s'est base sur des tests phytochimiques raliss sur la pulpe et sur les
feuilles de larganier, et une dtermination du pouvoir antimicrobien de diffrents extraits issus des
feuilles et de la pulpe dArgania spinosa Les extraits tests ont t obtenus par puisements successifs
par l'eau distill et par l'thanol. Les tests phytochimiques raliss sur la pulpe et sur les feuilles ont
rvls la prsence de cinq familles de composes chimiques savoir: Tanins, flavonoides,
saponosides, Strols insaturs et Terpnes, Steroides et Strols. Les rsultats du test antimicrobien
montrent que les extraits issus respectivement des feuilles et des pulpes sont actifs. . Les extraits issus
des feuilles montrent une activit inhibitrice trs lgrement suprieure celle des pulpes.

Mots cls:ArganiaSpinosa. graine.feuille.pulpe..tests phytochimiques.pouvoir antimicrobien

**************************************







Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
54
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
O91
CARACTERISATION DE QUELQUES PROPRIETES D'ADAPTATION AU MILIEU
SAHARIEN DES PRINCIPALES PLANTES SPONTANEES VIVACES DE LA
REGION DE OUARGLA

SLIMANI Noureddine, CHEHMA Abdelmadjid

Laboratoire de bioressource Sahariennes Prsevation et valoraisation, Universit de Ouargla, Algrie
nouri.ecologie@yahoo.fr

A partir de l'tude que nous avons ralis pour la caractrisation de quelques proprits d'adaptation au
milieu Saharien des principales plantes spontanes vivaces de la rgion de Ouargla, il ressort que les
plantes tudies prsentent une relation entre la morphologie des plantes et leurs composition
minrale qui comprennent :
La succulence chez les espces (Halocnemum strobilaceum, Zygophyllum album, Sueda
fructucosa, et Llimoniastrum guyonum), la rduction de la longeur des tiges chez les mmes espces.
Ces plantes riches en sodium(1.09%), potassium(0.37%).
La rduction de la surface foliaire en formes jonc et des tiges aphylles chez les espce (Retama
retam, et Ephedra alata), et enroulement des feuilles chez Stipagrostis pungens. et en forme aiguilles,
ces plantes ont des teneurs leves en calcium(Ca
++
) en potassium(K
+
) et en azote (N) qui sont
respectivement de (0. 36 %), (0.35%), (0.4).
Et l'excrtion des sel pour l'espce limoniastrum guyonianum, cette plantes prsente des
teneurs leve en sel surtout en potassiumet sodiumsont respectivement (.0.73%) et (0.098%).
Laugmentation de l'enracinement dans les deux directions pivotantes et horizontal en
particulier chez les espces des endroits ensable (sols sableux et lits dOued ensable) Retama retam,
Ephedra alata, Pergelaria tomentosa qui prsentent des teneurs faible en azote sont respectivement
(0.38%), (0.43%), (0.43%) et lexceptes celles du chott o les racines privilgient lorientation
horizontale.

Mots cls : Plantes spontanes, plantes vivace, Sahara, Adaptation, morphologie, minrale, Ouargla.

********** ****************************
O92
VALORISATION DES ESPECES STEPPIQUES, ELEMENTS CLES POUR LE
DEVELOPPEMENT DURABLE EN ZONES ARIDES ET SEMI-ARIDES

KAID-HARCHE Meriem

Dpartement de Biotechnologie, Universit des Sciences et de la Technologie dOran ,Algrie
armoise2001@yahoo.fr

La connaissance des espces steppiques et leur gestion rationnelle sont deux lments essentiels pour
le succs du dveloppement durable dans les zones arides et semi-arides. Les travaux que nous avons
raliss ont port en premier sur des Poaces vivaces dominantes de la steppe algrienne (de 1978
1992) puis nous avons largi notre champs dinvestigation dautres dicotyldones occupant une aire
importante dans le sud algrien (Fabaces, Sapotaces, Cactes), depuis 1992 .Le choix de ces
espces a t guid par :
leur dominance dans les rgions arides, donc leur intrt dans la lutte contre lavance du
sable ;
le rle quelles jouent dans la prservation de lenvironnement.
Les rsultats sont une synthse des travaux de lquipe, nous citerons :
les caractristiques biochimiques et structurales du compartiment parital des tissus de soutien
en vue didentifier les caractres dadaptation au milieu et de le valoriser comme matriau fibreux ;
les possibilits de rgnration des espces par semis ou par les techniques de la culture in-
vitro.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
55
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Ces rsultats mritent dtre pris en considration par les dcideurs, pour une meilleure gestion et
valorisation des espces tudies. Dautres recherches plus rcentes tentent de cibler des
polysaccharides paritaux et des poly-phnols intrts biologiques.

Mots cls : espces steppiques, sahariennes, dveloppement durable, valorisation.

**************************************
O93
IMPACT DE LA NATURE DES SOLS SAHARIENS SUR LA COMPOSITION
CHIMIQUE DE QUELQUES PLANTES DE LA REGION DE OUARGLA

HOUARI K.D., HALILAT M.T., CHEHMA A.M., SLIMANI N. et MARFOUA M.

Laboratoire de bio-ressources sahariennes : Prservation et valorisation,
Universit de Ouargla kahina_eco@yahoo.fr

A partir de ltude que nous avons mene sur limpact de la nature des sols sahariens, sur la
composition chimique de la flore saharienne Ouargla, on a pu savoir que les sols tudis sont des
sols alcalins trs pauvres en matire organique et en azote, non calcaires et peu salins, avec un rapport
C/ N trs variable. Leurs teneurs en lments minraux sont faiblement reprsents exception faite
pour le calcium avec des valeurs comprises entre 0,024 et 0,214% du PS. Mme chose pour la
composition chimique des espces tudies, nos rsultats montrent des teneurs en calciumtrs leves
par rapport aux autres lments avec des valeurs allant de 0,157 1,782 % de la MS.

Mots cls : composition chimique, sol, Ouargla.

**************************************
O94
EVALUATION DE LACTIVITE HEMOLYTIQUE DE QUELQUES PLANTES
MEDICINALES

HADDI Rihab
1
, MAROUF Abderrazak
2


1
Universit Mohamed BOUDIAF dORAN (USTO-MB)
2
Universit dOran ES-SENIA Laboratoire de Biochimie Vgtale et des Substances Naturelles
rihabhaddi@yahoo.fr

Les hmaties humaines sont des sacs limits par une membrane hmipermable renfermant une
solution riche en hmoglobine. Les saponines se combinent avec le cholestrol et les autres strols de
la membrane rythrocytaire ce qui entraine une modification de la permabilit membranaire, do la
formation de pores et donc libration de lhmoglobine dans le milieu externe. Le but de ce travail est
dvaluer lactivit hmolytique de quelques plantes mdicinales et plantes toxiques algriennes.
Paralllement cette tude biologique, un criblage phytochimique des extraits actifs ainsi quune
quantification de certains mtabolites secondaires importants (polyphnols totaux et flavonodes) ont
t entrepris. Le matriel vgtal tudi dans ce travail est constitu par diffrentes parties de la
plante : feuilles, fleurs, fruits, graines, tiges feuilles, thalle, corces et racines. La plupart de ces
plantes ont t rcoltes durant lanne 2007 / 2008, de diffrentes rgions de lAlgrie. Nous avons
test lactivit hmolytique des extraits aqueux lyophiliss des plantes. Aprs lavage des hmaties et
incubation pendant 30 minutes avec des concentrations croissantes en extraits, la quantification de
lactivit hmolytique a t suivie par dosage spectrophotomtrique de lhmoglobine libre. Les
rsultats sont exprims en pourcentage dactivit hmolytique (variation de la quantit dhmoglobine
libre) en fonction de la concentration en extraits en se rfrant un tmoin positif (la saponine
Quillaya saponaria). Lactivit hmolytique teste sur diffrents extraits exprime par leur IC
50

(concentration de lextrait ncessaire pour provoquer 50% dhmolyse) a montr une activit
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
56
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
biologique trs importante respectivement chez les feuilles de Pistacia lentiscus et les graines de
Solanum sodomaeum.

Mots cls : Sang, plantes mdicinales, extraits aqueux, hmolyse, phytochimie.

**************************************
O95
STRATEGIES DADAPTATION A LARIDITE DES CHENOPODIACEAE

SMAL-SAADOUN Noria

Laboratoire Ressources Naturelles.Universit Mouloud Mammeri Tizi Ouzou
Saadoun_n2002@yahoo.fr

Treize espces de Chenopodiaceae sont concernes par ce travail. Elles sont toutes rcoltes dans la
rgion de Bni Abbs, wilaya de Bchar, dans le Sahara Septentrional algrien. Notre tude a consist
en une approche de larchitecture tissulaire des feuilles ou rameaux, ainsi que des types stomatiques de
ces espces. Chez les reprsentants de la famille tudie, nous notons une volution vers une plus
grande adaptation anatomique, cest--dire un passage dun parenchyme assimilateur du type
photosynthtique C3 vers le type photosynthtique C4, une installation de lhypoderme et enfin une
pluristratification de lpiderme qui implique un enfoncement des stomates dans de profondes
chambres sus-stomatiques. Cette adaptation anatomique saccompagne dune diminution de la
frquence et enfin dune disparition des types stomatiques volus, mais aussi dune apparition et
dune augmentation de frquence du type paracytique msoprigne (T
3
), caractristique des espces
vivant dans des milieux o leau manque.

Mots cls : Chenopodiaceae Adaptation laridit Sahara septentrional algrien Types
stomatiques Anatomie foliaire.

**************************************
O96
ETUDE VARIETALE DE LA VIGUEUR ET DE LA VIABILITE SUR TROIS
VARIETES DE BLE DUR (Triticum durum Desf) STOCKEES PENDANT
DIFFERENTES PERIODE A UNE ZONE SEMI ARIDE.

GHLIS NEE CHIAHI N.
1
, BRINIS L.
2
, BENAMARA O.
3
et TAHAR A.
2

1
Dpartement de Biologie, Centre Universitaire de Souk Ahras, Algrie.
2
Laboratoire de biologie vgtale et environnement, Universit de Annaba, Algrie
3
Dpartement de Biologie, Centre Universitaire de Tbessa, Algrie.
nghlisdz@yahoo.fr

Les semences de trois varits de bl dur (Triticum durumDESF): CAPETTI, INRAT 69 et un lot de
WAHA-VITRON stockes au niveau du CCLS de Tbessa pendant diffrentes priodes allant de 7
20 mois, ont fait l'objet (pourcentage et vitesse de germination, croissance des plantules (longueur des
racines et des coloptiles), l'absorption d'eau et la teneur en chlorophylle). Le but est l'tude des
potentialits de chaque gnotype aux diverses conditions de stockage. Ces dernires ne sont pas
toujours bonnes (T et humidit leves) peuvent affecter ainsi la sant de la graine par l'apparition du
vieillissement dans les stocks. Les rsultats obtenus montrent que :
La varit INRAT 69 stocke pendant une anne possde les meilleurs performances
(viabilit et vigueur), ainsi elle pourrait tre juger comme ayant une bonne qualit.
La diminution de tous les paramtres tudies chez la varit stocke pendant plus de 20
mois de mme que la perte de viabilit et de vigueur qui associ la diminution du pourcentage et de
la vitesse de germination.
La dtrioration irrversible des semences s'installe aprs le 2eme jour de vieillissement.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
57
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Le contrle des conditions de stockage est le seul facteur permettant aux semences de
rester longtemps en bon tat.

Mots cls : Stockage, viabilit; vigueur; bl dur, semences, vieillissement acclre, semi aride.

**************************************
O97
CHOLINESTRASE ET TOXICIT PAR LES CARBAMATES CHEZ
SCHISTOCERCA GREGARIA (FORSKL, 1775)
GHENABZIA I., OULD EL HADJ M. D., HAMDI AISSA L.

Laboratoire de protection des cosystmes en zones arides et semi arides universit Kasdi Merbah de Ouargla
BP 163 Ouargla 30000 Algrie
Imene.gh@gmail.com

Les principes mthodologiques sur lesquels se fondent lusage de biomarqueurs, reposent sur la mise
en vidence de dsquilibres biochimiques ou physiologiques susceptibles de rvler prcocement
lexposition dune population dune espce donne de faibles concentrations dinsecticide ;
cependant le choix de ces indicateurs biologiques, est bas sur leur sensibilit aux insecticides ,
lactivit de lactylcholinestrase et le rythme cardiaque, tudis chez des individus femelles et mles
de Schistocerca gregaria exposs au Kuik 200 SL, un insecticide de la famille des carbamates, sont
effectus diffrentes dures dexpositions et concentrations de linsecticide de 2g ,4g et 8g de
Kuik 200 SL/l. Une inhibition de lactivit cholinestrasique est note pour les diffrentes doses de
Kuik 200 SL, avec un maximum dinhibition la dose de 8g de Kuik 200 SL/l, lactivit
cholinestrasique nest que de 3,813,68 nmol/min/ml pour les individus mles de S. gregaria, et de
5,65,98 nmol/min/ml pour les individus femelles. Cette exposition au Kuik 200 SL modifie de faon
sensible le rythme cardiaque quelle que soit la dose dexposition et la dure dexposition. Il est
perceptible que plus la dose augmente, le rythme cardiaque diminue. Laction des diffrentes doses de
Kuik 200 SL sur le temps de mortalit des mles et des femelles de S. gregaria laisse apparatre que le
temps de mortalit le plus court est observ chez les criquets traits la dose de 8g de Kuik 200 SL /l.
Les individus mles de ce locuste meurent plus vite comparativement aux individus femelles. Il est
remarqu au vu des rsultats quune basse temprature soit 18C, a plus deffet aprs traitement sur
lactivit de lactylcholinestrase et le rythme cardiaque quune temprature leve savoir 36C.
Mots cls : Actylcholinestrase, toxicit, carbamate, Schistocerca gregaria, temprature.

**************************************

O98
ETUDE PHYTOGEOGRAPHIQUE DE LA FLORE MEDICINALE DANS LA
REGION D'OUARGLA

HADJ AIDJI-BENSEGHIER F., CHERADID D. et DERRIDJ A.

Laboratoire de bio-ressources saharienne, Valorisation, Dpartement des Sciences Agronomique, Facult des
sciences et sciences de l'ingnieur, Universit de Ouargla, Algrie.
-Facult des sciences biologiques et Agronomiques, Universit de Mouloud Mammeri, Tizi-Ouzou, Algrie.
Hadjaidji_f@yahoo.fr

La rgion d'Ouargla, situe l'Est du Sahara septentrional, appartenant la rgion mditerranenne,
est caractrise par un bioclimat saharien hiver doux. La prsente tude a pour objectif d'effectuer
une tude biogographique des plantes spontanes, caractre mdicinal. Durant le printemps de
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
58
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
l'anne 2008, l'tude floristique a permis de recenser 34 espces vgtales dont 16 sont mdicinales,
slectionnes suite une enqute ethnoboanique. Ces espces se rapportent 15 ordres et 18 familles
dont les plus importantes sont les Chnopodiaces, les Poaces et les Zygophyllaces. Sur le plan
biologique, les phmres et les Champhytes dominent respectivement avec 52,94% et 33%.
Egalement, nous enregistrons l'importance de l'aire endmique avec 67,64%. Enfin, llment Saharo-
sindien est le plus abondant avec 54,16%. Ce travail, nous a permis de contribuer la caractrisation
phytogographique du patrimoine en PAM spontanes offrant ainsi une base qui peut tre capitalise
pour des alternatives de valorisation.

Mots-cls: Flore, mdicinale, biologie, phytogographie, Ouargla.

**************************************
O99
CHEMICAL COMPOSITION AND PROTEIN DEGRADABILITY OF
WATERMELON SEEDS IN WESTERN SUDAN

A.B. MUSTAFA and A. A. ALAMIN

University of Juba, p.o.box 12327, Khartoum, Sudan
Animal feed industry, Nadec company, Riyad, Saudi Arabia
ayman_balla@yahoo.com

A study was conducted to estimate the chemical composition and crude protein degradability of whole
seed, cake and pulp of watermelon seeds were grown in Kordofan state, western Sudan. Samples were
collected fromKordofan crops market. Tow fistulated steers were fed with green alfalfa during trail
period. Approximate analysis was used to determine chemical composition. Whenever protein
degradability was determined used in situ polyester bag technique. The individual sample was
incubated in rumen for 2,4,8,16,24,36 and 48 hrs. Significant different (p0.05) were observed in dry
matter, crude protein, ether extract, crude fibre and ash of whole seed, cake and pulp. This study
revealed that watermelon seed cake had lower dry matter degradability than whole seed and pulp
respectively. Whereas, watermelon seed cake was higher (p0.05) crude protein degradability
following by pulp and whole seed in the first trail times but there was linear increase in protein
disappearance of pulp with increase in period of incubation in rumen up to 48 hrs than cake and whole
seed.

Key wards: watermelon, protein, chemical composition, Kordofan, degradability

**************************************


Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009

Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr






Communications affiches



Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
59
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Thme 1 - Prservation des agro-systmes sahariens
A1
FATTY ACID COMPOSITION AND PHYSICO-CHEMICAL PROPERTIES OF
DATE SEEDS OILS OF THREE FRUITS (Phoenix dctylifera L) PRODUCED IN
OUARGLA REGION

Mustapha BOUKOUADA
1
, Zineb GHIABA
1
, Mokhtar SAIDI
1
, Mohamed YOUSFI
2
,
Mohamed lakhdar BELFAR
1


1
Laboratoire de Valorisation et Promotion des Ressources Sahariennes, Universit de Ouargla, Algeria
2
Laboratoire des Sciences Fondamentales, Universit Amar Telidji de Laghouat, Algeria.
moustapha0101@yahoo.com

Algeria considered as one of the major date producing countries. The production reaches up 468,000
tons annually, most of it consumed locally. The seeds or date stones which represent a relatively high
yield are considered in most cases as waste and hence the present work was planned with the aim of
making use to them and to study the possible economic and medicinal potentialities of this crop in
Algeria. Three different date palm seeds (Phoenix dactylifera L.) cultivars, Deglet-Nour, Ghars and
Tamdjouhert , originating from south eastern of Algeria (Ouargla region ), were analyzed, The oil
contents of these seeds range 5.05 6.08%. all the seed oil studied were liquid at room
temperature and the characteristics and constituents of the seed oils were determined, including
physico-chemical properties, specific gravity, refractive index, saponification value, acid value and
Iodine value. The analysis by gas chromatography of fatty acid methyl esters, shows that oils contains
mainly fatty acids oleic, linoleic, palmitic and stearic,less fatty acid in the tale us fatty acid capric,
lauric and myristic have also been detected. The amount of sterols has been determined by a simple
spectrophotometric method.

Keywords: Date Seed, Phoenix dactylifera L, fatty acid composition, physico-chemical properties,
Sterols.

**************************************
A2
ETUDE COMPARATIVE ENTRE QUINZE VARIETES DE DATTES ET LEURS
TAUX DINFESTATION PAR Ectomyelois ceratoniae ZELLER DANS LA REGION
DE OUARGLA

HADDOU I., IDDER H. et IDDER M. A.

Laboratoire de protection des cosystmes en zones arides et semi arides. Universit de Ouargla, Algrie.
haddou.ilies@yahoo.fr

La pyrale des dattes Ectomyelois ceratoniae Zeller est lun principal ennemi du palmier dattier.
Lobjectif de notre tude est de donner des estimations des taux dinfestation de quelques varits de
palmier dattier au cours de trois stades phnologiques et faire une comparaison entre ces rsultats.
Notre tude a t raliss dans trois (03) palmeraies de la rgion de Ouargla : Kser BELABESSE,
TIBZIZINE et 13 kms de Ouargla ver Hassi-Messaoud. Des analyses biochimique (pH, teneur en sels
solubles, teneur en saccharose et en sucres rducteurs) suivi par une analyse des donnes (ACP) ont
t effectus sur quinze (15) varits pour une mise en vidence des facteurs explicatifs des variations
des taux dinfestation. Les rsultats obtenus montrent que :
Certaines varits sont infestes au stade grossissement des fruits.
Le taux dinfestation augmente avec lvolution de la maturation des dattes pour la plupart des
varits.
Lexistence dune varit qui na pas t infest au cours des trois stades phnologiques.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
60
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
La pyrale de datte prfre des varits taux de saccharose lve et pH lgrement acide.

Concernant la bio cologie dEctomyelois ceratoniae, nous avons constat quil existe une relation
entre :
la longueur des papillons et la taille des dattes.
La teint des papillons et la couleur des dattes.
A travers notre tude, des recommandations doivent tre prises en considration :
le choix des varits cultives.
lentretient de la palmerais, la bonne conduite du palmier dattier et lorganisation de la
plantation.

Mots cls : pyrale de datte, palmier dattier, varit, taux dinfestation, analyse biochimique, Ouargla.

*************************************
A3
ETUDE DES CARACTERISTIQUES PHYSICO-CHIMIQUES ET BIOCHIMIQUES
DE TROIS VARIETES DE DATTES DE LA REGION DE OUARGLA SELON LES
CLASSES MOLLE, DEMI-MOLLE, ET SECHE

SAYAH Zineb et OULD EL HADJ Mohamed Didi

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi arides, Universit Kasdi Merbah-Ouargla
BP 163 Ouargla 30000 Algrie
zineb.sayah@yahoo.fr

L'tude des caractristiques physico-chimiques et biochimiques de trois varits de dattes (Ghars,
Dglet-Nour et Dgla-Beida), reparties dans les trois classes de dattes (molles, demi-molles et sches)
de la rgion de Ouargla montre que la varit sche prsente un pH plus acide, soit 5,48 0,05 par
rapport ceux des varits molles et demi-molles, qui sont respectivement de 6,42 0,11 et 6,02
0,13. Elles renferment des teneurs leves en lments minraux. De mme, les sucres sont dominants
dans les trois varits. Ils sont de 73,42% pour la varit molle, 42,01% pour la varit demi-molle et
55,17% pour la varit sche. La teneur en protines et en lipides est faible pour les trois varits. La
varit demi-molle prsente des teneurs leves en cellulose et en pectines, soit 4,71 0,23% de
cellulose et 2,51 0,08% de pectine. La teneur en composs phnoliques totaux est leve pour la
varit molle, avec 263,04 6,09 mg quivalent dacide gallique/100g, suivie par Dgla-Beida, avec
217,55 4,24 mg quivalent dacide gallique/100g, puis Dglet-Nour, avec 195,91 6,98 mg
quivalent dacide gallique /100g. L'analyse en composantes principales (ACP), montre que chaque
classe de dattes, se caractrise par sa spcificit physico-chimique et biochimique. La varit molle est
riche sucres rducteurs et en glucose. Elle se caractrise par une teneur leve en composs
phnoliques totaux. La varit demi-molle se caractrise par un taux lev en cellulose et en pectine.
Par contre, la varit sche prsente une acidit importante et un taux lev en saccharose et en
protines.

Mots cls : Dattes, varit, caractristiques, teneur, Ouargla.

**************************************







Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
61
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A4
ETUDE PHYSIOLOGIQUE DE Mauginiella scaettae ISOLEE A PARTIR DE SPATHE
DU PALMIER DATTIER DE CUVETTE DE OUARGLA- ALGERIE

BENSACI Messaoud Bachagha
1
, RAHMANIA Fatima
2

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides. Universit de Ouargla, Algrie.
2
Dpartement de Biologie, Universit Houari-Boumediene, BabZouar, Algrie.
mbachagha@Gmail.com

Apres lisolement et lidentification de champignons Mauginiella scaettae lagent causal de la
pourriture de linflorescence du palmier dattier. Ltude de linfluence de quelques lments sur la
physiologie du champignon, limpact du milieu de culture sur le dveloppement du champignon
montre que le milieu MEA (Malt Extract Agar) est le meilleur pour la croissance du champignon, et
que la temprature idale varie entre 25 et 30 C, avec un pH variant entre 04 et 08, notant que ce
champignon crot sur milieu MEA avec une concentration NaCl de 05 a 50 g\l.

Mots cls : Cuvette de Ouargla, pourriture, inflorescence, physiologie.

**************************************
A5
ETUDE DES PROPRIETES NUTRITIVES ET DIETETIQUES DE SIROPS DE
DATTES EXTRAITS PAR DIFFUSION, EN COMPARAISON AVEC LES SIROPS A
HAUTE TENEUR EN FRUCTOSE (ISOGLUCOSE), ISSUS DE L'INDUSTRIE DE
L'AMIDON

Yamina MIMOUNI et Oumelkheir SIBOUKEUR

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi Arides , Universit de Ouargla, Algrie.
Yamina.mimouni_@yahoo.fr

En Algrie, il nexiste pas dusines de transformation de dattes, permettant de valoriser limportante
diversit gntique (900 cultivars environ) du verger phoenicicole. La prsente tude , s'intresse la
mise au point d'une technique d'laboration de sirops partir de quatre varits de dattes, de
consistance diffrente , rpandues dans les rgions, de Ouargla, de Touggourt et de Biskra (Deglet
Nour, Ghars, Degla Beida et Mech Degla) rcoltes au stade tmar. Lobjectif assign au prsent travail
vise essentiellement, une comparaison des proprits nutritives et de l'aspect dittique de ces
produits obtenus par diffusion 50
0
C, 80
0
C et 90
0
C pendant 24 heures suivie dune condensation
60C, avec celui des sirops haute teneur en fructose (HFCS ou isomroses), issus de lamidonnerie et
destins aux obses et aux diabtiques. Les rsultats montrent que les dattes de la varit Ghars sont
plus aptes produire du sirop ayant les proprits nutritives et dittiques recherches.

Mots cls : Dattes, technologie, fructose, sirops, isomroses

**************************************








Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
62
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A6
LETUDE DE LA RELATION ENTRE LA COMPOSITION PHYSIQUE,
CHIMIQUE, BIOCHIMIQUE ET QUALITATIVE DE VINAIGRE TRADITIONNEL
DE DATTES ISSUES DE CULTIVARS DE LA REGION DOUARGLA
BOUAZIZ Sabrina et OULD EL HADJ Mohamed Didi

Laboratoire de protection des cosystmes en zones arides et semi-arides, Universit de Ouargla, Algrie.
bz.sabrine@yahoo.fr

Les populations sahariennes depuis fort longtemps, ont eu fabriquer localement leur propre vinaigre,
cette production est une tradition ancestrale solidement enracin dans les populations de cette rgion.
A fin dtudie la relation entre la composition physique, chimique et biochimique entre trois types de
vinaigre issu de cultivars Aagina, Dgla Beida et HChef Dglet Nour. La densit, le taux de solide
solubles, pH, M.S., conductivit lctrique, les cendre, lacidit totale, lacidit non volatile et volatile
en plus dalcool brut, les sucres totuax, la tenur en lipides, en proteines, en polyphnols et en
viatamines C sont effectuer et afin dtudiers les relation entre ces paramtrs, il est effectuer lanalyse
statistique en composante principales qui a permet de revl des corrlation positif entre la maitre
sches et lacidit non volatiles, en plus lanalyse en composante principale (ACP) a permet de class
ces vinaigre en trois classe et les caractriss, do elle permet de ressortir que chauque types de
vinaigre a des caractristiques spcifique.
Mots cls : Vinaigres traditionnel, dattes, Ouargla, relation, physique, chimiques, biochimiques,
qualitatifs

**************************************
A7
CHOLINESTERASE ET TOXICITE PAR LES ORGANOPHOSPHORES CHEZ
SCHISTOCERCA GREGARIA FORSKL 1775

HAMID OUDJ ANA A., OULD EL HADJ D. et HAMDI AISSA L.

Dpartement des sciences Biologiques, Universit de Ouargla, Algrie
nadjah.oudjana2007@yahoo.fr

Lutilisation des indicateurs biologiques dans l'valuation de l'impact dun compos toxique est une
technique trs courante de surveillance, du fait que le suivi de la perturbation de cibles biologiques
peut pallier la difficult de dosage de ses insecticides, et les insecticides peuvent tre non efficaces
dans certaines conditions (temprature, dose,..), le prsent travail vis tudi limpact dun insecticide
organophosphor sur le plan comportemental, physiologique et neurochimique chez le criquet plerin
Schistocera gregaria Forskl 1775 qui prsente lespce la plus redoute en raison de la capacit des
essaims se dplacer sur de trs grandes distances et envahir les cultures. Linhibition de
lactylcholinestrase semble plus importante la dose 8g Malatox EC 50/l, soit 6,248,00
nanomole/ml/min pour les individus mles et 5,564,91 nanomole/ml/min pour les femelles.
Cependant le traitement des individus femelles et mles une dose fixe de 2g Malatox EC 50/l et
diffrentes tempratures soient 18C et 36C entrainer une inhibition denzyme plus importante la
temprature 18C considre comme tant basse, avec 21,695,66 nanomole/mn/ml pour les femelles
et 30,323,94 nanomole/mn/ml pour les mles.

Mots cls: Toxicit, Cholinestrases, Organophosphors, Schistocerca gregaria Forskl 1775,
Mortalit.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
63
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
**************************************
A8
CARACTERISATION PHYTOECOLOGIQUE DE QUELQUES PALMERAIES DE
LA REGION DE OUARGLA

MEDJBER .T ; KADIK L., BENYAYA A., BEZAM A. et GUESSOUM S.

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides
Universit Kasdi Merbah Ouargla
torkia_eco@yahoo.fr

Notre travail consiste ltude de la caractrisation des plantes spontanes sous leffet des facteurs
daphiques dans les palmeraies dgrades dans la rgion de Ouargla ; pour cela nous avons choisi
quatre zones possdant des caractres diffrents (gomorphologie, diversit floristique).
Lchantillonnage ralis est systmatique, avec une mthode linaire oriente de lextrieur vers
lintrieur de la palmeraie. Cette tude permis de dterminer 28 espces vgtales appartenant 15
familles botaniques, les plus importantes sont : Poaceae, Astraceae, Chnopodiaceae. Lanalyse des
rsultats montre que les espces les plus abondantes le long de la ligne dans les quatre zones sont :
Juncus rigidus (433 individus), Phragmites communis ( 388 individus ), et Cynodon dactylon (310
individus ). Le recouvrement linaire totale est plus lev lextrieur et concernant la structure
verticale, les strates les plus importantes (VI ,V,IV ). La distribution des espces le long de la ligne est
irrgulire. La diversit floristique est peu importante hors palmeraies. La variation quantitative et
qualitative de la vgtation est lie aux caractristiques du sol (texture, calcaire total, pH, salinit) pour
chaque zone. Le sol pour la majorit des stations est de texture sableuse, pH basique, peu calcaire
salinit variable. Le nombre des espces spontanes dans les palmeraies dgrades reflte le degr de
dgradation de celle-ci et linfluence du milieu naturel sur la flore de lagro-cosystme.

Mots cls : Milieu naturel, palmeraie dgrade, spontane, adventice, chantillonnage linaire, sol,
Ouargla.
**************************************
A9
ETUDE DE CARACTERES BIOCHIMIQUES DE QUELQUES ISOLATS DE
Fusarium oxysporim f.sp albdinis

GHARBI samia

Universit Mohamed Boudiaf, Oran, Algrie
samiakarkachi@hotmail.com

Le palmier dattier, Phoenix dactyliferaL.,monocotyldone prenne, de louest algrien subi des pertes
considrables estimes 3 millions darbres (Derbi.1982) due une maladie vasculaire appele
localement Bayoud cause par un champignon tellurique Fusarium oxysporum f.sp
albedinis(F.o.a) et elle est menac de disparition au nord de lAfrique et constitue une menace
permanente pour tous les paysqui en sont indemnes.diffrents moyens sont utilisspour lutter contre
cette maladie fongique, comme lutte;biologique chimique et gntique ,cette dernire reste lun des
moyens dintervention le plus efficace pour lutter contre la fusariose.Ce sont les cultivars de haute
qualit dattire qui sont les plus sensibles la maladie. Les programmes damlioration biochimique
de la plante visent, gnralement, lobtention de palmiers dattiers rsistants au Bayoud et de bonne
qualit fruitire. Llectrophorse dextraits enzymatiques du myclium du champignon pathogne
sur gel de polyacrylamide, suivi de la rvlation de diffrentes isoenzymes, permet dvaluer la
diversit des populations. Ltude des polymorphismes isoenzymatiques permet de mettre en vidence
des diffrences entre les isolats tudis et les classs en groupes.

Mots cls: Fusarium oxysporum f.sp albedinis(F.o.a).
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
64
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
A10
DIVERSITE ET ROLE DES MANTODEA DANS LE FONCTIONNEMENT DE
LECOSYSTEME DE PALMERAIE.

KORICHI Raouf
1
et DOUMANDJI Salaheddine
2


1
Univesit de ouargla, Algrie
2
INA, alger, Algrie
korichkov@hotmail.fr

Utiliss dans le cadre de la lutte biologique, les auxiliaires des cultures, prdateurs ou parasites
dorganismes, ont prouvs leur efficacit. Cest en abordant le rle des Mantodea (espces hautement
prdatrices) dans les quilibres naturels en milieu rmien, que la prsente tude essaye de dmontrer
en focalisant leffort sur le rgime alimentaire de quelques espces de mantes recenses, ainsi que
leurs proies, dans diffrents biotopes de la rgion dOuargla (Sahara septentrional). Cet inventaire a
abouti la capture de 9 espces de mantes appartenant 3 familles distinctes. La plupart vivent dans
lcosystme de palmeraie o les insectes sont les plus abondants. Par ailleurs, lactivit trophique des
Mantodea est ralise grce lanalyse des contenus de leurs excrments. La comparaison des rgimes
alimentaires de 8 espces de mantes confirme leur forte insectivorie. Les disponibilits alimentaires
dans 8 stations rvlent que la richesse totale prsente des fluctuations allant de 15 77 espces
dArthropoda. Selon les biotopes, les Insecta sont les plus frquents que ce soit en milieux naturels ou
en zones cultives. Le pourcentage des Insecta varie de 82,6 % (sebkha) 77,3 % (erg) 93,5 % dans la
palmeraie entretenue. Les valeurs de lindice de Shannon-Weaver atteignent 5,57 bits. Mantis
religiosa a consomm que des insectes dont des Orthoptera (35,7 %) et des Diptera (35,7 %). Lindice
de slection (Ii) montre que Mantis religiosa cherche consommer des Diptera (+0,36) et des
Orthoptera (+0,31). Dans le rgime alimentaire dIris oratoria, les Insecta avec 96,7 % sont plus
ingrs que les Arachnida (3,3 %). Il y a ressemblance entre les rgimes trophiques des espces
tudies. Pour ce qui concerne les proies, les Diptera, les Orthoptera, les Hymenoptera et les
Heteroptera sont les plus ingrs par les espces de mantes notant ainsi leur caractre gnraliste.

Mots-clefs : Mantodea, cosystmes sahariens, biodiversit, rgime trophique, palmeraie.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
65
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
**************************************
A11
Etude des ravageurs du palmier dattier et leurs ennemis naturels dans loasis de Biskra

Tarai Nacer
1
, Duvallet Jerard
2
, Doumandji Salaheddine
3


1 Dpartement dAgronomie , Universit Mohamed Khider , Biskra, Algrie.
2 Laboratoire Protection des Ecosystmes Mditerranens, Montpellier, France.
3 Dpartement de Zoologie, Institut National Agronomique, Elharrach, Alger



Resum :

Le palmier dattier Phoenix dactilyfera dans loasis de Biskra est soumis aux attaques de
plusieurs ravageurs insectes , les plus important dans la rgion sont la cochenille blanche
Parlatoria blanchardi Targ , et Ectomyelois ceratoniae Zeller. On estime quenviron 30% des
dattes de la varit Deglet Nour une varit qui reprsente 70 % de la production de cette
culture dans loasis de Biskra sont rgulirement attaques. , la perte de rcolte pour
cette production tait situe entre 2 et 05 O00 tonnes.

Dans ce but , nous avons jug utile de raliser cette tude dans lOasis de Biskra , Algrie sud
Afin de dlimiter lutilisation intense des produits chimiques et de favoriser la lutte
biologique qui reste un moyen alternatif et efficace contre les ravageurs du palmier dattier.


Mots cls : Palmier dattier - Oasis- Biskra insectes- ravageurs - lutte biologique


Abstract :

The date palm Phoenix dactilyfera in the oasis of Biskra is subjected to the attacks of several
insects, most important in the area are the white l Parlatoria blanchardi Targ, and Ectomyelois
ceratoniae Zeller. It is estimated that approximately 30% of dates of the variety `Deglet Nour'
a variety which accounts for 70% of the production of this culture in the oasis of Biskra are
regularly attacked. , the loss of harvest for this production was located between 2 and 05 O00
tons. To this end, we considered to be useful to make this study in the Oasis of Biskra,
southern Algeria In order to delimit the intense use of the chemicals and to support the
biological fight which remains an alternative and effective means against the ravageurs of the
date palm.


Key words: Date palm- Biskra Oasis devastating- insects - biological fight



**************************************









Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
66
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A12
APPORT DES DONNEES SATELLITALES A LETUDE DE VULNERABILITE DU
MILIEU DESERTIQUE AU PHENOMENE DE SALINISATION
(CAS DE LA VALLEE DOUED RIGH)

NEZZAR A
1
MAARGEB R
2


1
CRSTRA Biskra, Algrie
2
Doctorant : Labo de recherche (CIRTA), Universit Paul Czanne, Aix-en-Provence-France
nezzarabdelhamid@yahoo.fr

Au_sujet_des tudes et recherches sur la dsertification dans les milieux dsertiques en Algrie ne
sont pas nombreux et concernent principalement la dgradation de la vgtation, la dgradation des
sols et des eaux, mais lautre forme de dsertification, qui est la salinisation, tant considrer
secondaire, est bien suivie et value dans les principaux primtres irrigus travers le Sahara
Algrien. Alors Il ne faut pas non plus ngliger les tudes de la salinisation dans son contexte
rgional. Dans ce cot nous avons choisi la valle dOued Righ, qui fais partie trs important du Bas
Sahara Algrien ltude de vulnrabilit du milieu dsertique au phnomne de salinisation, o ce
phnomne, est classe en deuxime position parmi les contraintes, qui ont menacent les derniers
points de verdures dans ce milieu dsertique endorque et fragile, aprs le risque majeur de
lensablement. Parmi les outilles les plus efficaces ltude de la vulnrabilit de laspect de surface,
vis--vis la salinisation, par suite la dsertification et lensablement lchelle spatio-temporelle, dans
ce milieu dsertique et trs vaste

est la cartographie thmatique par les images satellitales

, qui
contribue relativement lidentification les aires de ce phnomne dans cette valle dsertique, qui est
plus en plus menace par la salinisation et dautre phnomnes lie ce dernier. Cette recherche, est
bas sur 04 extrait des scnes satellitales, de mme type de capteur TM, de deux types de rsolution
(28 et 58m), de quatre missions de photographie spatial (1973 de type MSS 2007 de type ETM+),
avec des mesures des valeurs radiomtriques de dfrents objets dtects durant les investigations de
terrain, qui ont t fais durant deux ans (2007 et 2008). Le principal rsultat montre, une volution
normment important (13%) l de ce phnomne lchelle spatial dans cette valle, notamment
laval.

Mots cls : Oued Righ, vulnrabilite, salinisation, dsertification, donnes satellitales.

**************************************
A13
CONTRIBUTION A LA CARACTERISATION FLORISTIQUE ET LETUDE DE
LEFFET DECOSYSTEME (MILIEU NATUREL) SUR LAGROSYSTEME
(PALMERAIE) DE LA REGION DOUARGLA

MOUANE. A., MEDJBER T.

Universit Kasdi Merabah- Ouargla, Algrie
nawelfsom@yahoo.fr

Ce travail est une contribution la connaissance de la flore oasienne et l'tude de la relation entre la
palmeraie et le milieu naturel, pour cela nous avons ralis un inventaire dans 3 zones situes dans la
rgion dOuargla (Chott, HBA, ksar). Les rsultats obtenues montre que :
Dans les palmeraies nous avons inventori :
- 43 espces dans la zone de HBA dont 30 spontanes et 13 adventices.
- 19 espces dans la zone de Chott dont 10 spontanes et 09 adventices.
- 14 espces dans la zone de Ksar dont 13 spontanes et 01 adventice.
Et dans les milieux naturels:
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
67
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
- 21 espces spontanes dans la zone de HBA.
- 09 espces dont 07 spontanes et 02 adventices dans la zone de Chott
- 07 espces spontanes dans la zone de ksar.
Les lments Mditerranens dominent dans toutes les palmeraies mais, dans les milieux naturels les
lments biogographiques varient selon la formation gomorphologique : les Reg et Erg sont
domines par les lments Saharo- sindien, la zone de Chott caractrise par la dominance des
lments Mditerranenne et dans la zone de Ksar est domine par les lments Cosmopolites. Le
type biologique qui domine dans toutes les palmeraies est les Throphytes et la dominance des
Champhytes dans les milieux naturels. L'ensemble des palmeraies est riche en espces spontanes
suivant leur localisation par apport au milieu naturel ainsi que le type gomorphologique de celui- ci,
ceci exprime l'tat de dgradation de celle-ci due la variation des facteurs cologiques et socio-
conomiques. Le dlaissement des palmeraies favorise le dveloppent des espces spontanes qui
refltent l'volution rgressive de cet agro- cosystme. Ce travail montre la ncessit de l'tude et la
connaissance des relations qui existe entre les palmeraies et les milieux naturels, et la contribution
dans la prservation des oasis comme un moyen de lutte contre la dsertification.

Mots cls : Rgion, palmeraie, milieu naturel, plante spontane, plante adventice.

**************************************
A14
TUDE DE QUELQUES ASPECTS TOXICOLOGIQUES ET
BIOTECHNOLOGIQUES DUN HYPHOMYCETE MONILIALE Beauveria bassiana

GUELLAL D*. HALOUANE F. et BOURGUIG S.

Universit UMBB, Boumerdes, Algrie
drifa_guellal@yahoo.fr

Lutilisation dun biopesticide base dun microorganisme grande chelle impose une prudence
particulire notamment linnocuit vis--vis de la faune auxiliaire utile et les mammifres entre autre
ltre humain. Cest dans ce cadre qui sinscrit notre travail sur Beauveria bassiana afin de vrifier
son innocuit vis--vis des mammifres. Pour cela on a ralis une tude toxicologique de
lhyphomycte Beauveria bassiana sur des souris cobayes, lorgane cible est le foie. Ltude
toxicologique a t complte par un test de linflammation sur des rats Wistars. Dans un 2me temps
on a ralis une fermentation discontinue de Beauveria bassiana sur le lactosrumet PDA dans des
fermenteurs conceptionns manuellement. Les rsultats de ltude toxicologique ont montr que
lhyphomycte Beauveria bassiana administr une dose suprieure la DL50 pour les acridiens na
pas affect lhistologie du foie des souris et il na engendr aucun effet inflammatoire chez les rats
Wistars. Les rayons ultraviolets qui chargent la lumire solaire constituent un facteur limitant la
bonne croissance de Beauveria bassiana, pour y remdier il faut penser trouver une formulation
adquate qui minimise laction de ces UV sur Beauveria bassiana en vue dune utilisation grande
chelle. Les rsultats de la fermentation discontinue de lhyphomycte Beauveria bassiana sur LD
(Lactosrum Dprotin) et PDA (Peptone Dextrose Dagar) montrent que lentomopathogne
Beauveria bassiana prsente des caractristiques biotechnologiques trs intressantes qui le rend
largement exploitable tel que la production des agent anti-microbiens.

Mots cls : Hyphomycte Beauveria bassiana, tude toxicologique, test de linflammation, tude
biotechnologiques, Fermentation.

**************************************




Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
68
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A15
GESTION DES PERIMETRES AGRICOLES ET LEURS CONSEQUENCES SUR
LECOSYSTEME SAHARIEN : CAS DE LA CHEBKA DU MZAB

BENSAHA H.
1
, CHELLOUFI H.
2
et BOUAMMAR B.
2


1
La Gnrale des Concessions Agricoles DR GCA, Ghardaa, Algrie
2
Laboratoire de protection des Ecosystmes en Zones Arides et Semi-Arides, Universit de Ouargla, Algrie
hocinemail@yahoo.fr

La mise en valeur agricole a permis une augmentation des superficies agricoles au niveau du Mzab
linstar des autres rgions sahariennes. La cration de primtres de mise en valeur au niveau de la
Chebka du Mzab a engendr une dynamique certaine par un ensemble de mesures ayant eu des
impacts diffrents sur les composants de cet cosystme saharien. Lanalyse de la gestion de cet agro
cosystme particulier a montr des insuffisances diffrents niveaux mme de compromettre sa
durabilit. Les mesures prendre sont discutes non seulement pour prserver lcosystme mais aussi
donner une signification aux forts investissements consentis par les pouvoirs publics.

Mots cls : Primtres agricoles, Mise en valeur, Gestion, Dveloppement agricole, Importance,
Chebka du M'ZAB, Algerie.

**************************************
A16
COMPARISON OF ANTIOXIDANT ACTIVITY AND PHENOLICS CONTENT OF
THREE VARIETIES OF ALGERIAN COMMON DATES

GHIABA Zineb
1
, BOUKOUADA Mustapha
1
, SADI Mokhtar
1
, YOUSFI Mohamed
2
,
GHIABA Nadjet
1
, KENDOUR Zaouia
1

1
Laboratoire V.P.R.S, Universit de Ouargla, Algrie.
2
Laboratoire de Chimie Organique, Universit de Laghouat, Algrie.
ghiaba_zineb@yahoo.fr

The date palm is a typical plant of the arid and semi arid areas. Unfortunately in fact they are not all
the varieties that profits from an economic interest except for Deglet-Nour. Thus, it represents a
danger to the genetic inheritance and the biodiversity. in this study. was to investigate the antioxidant
of methanol water extracts fromthree date palm fruit (DPF) common varieties, Degla Baidha (DB),
Tamjhourt (Tam), and Tafezauine(Taf) , fromthe Ouargla region (Algeria),The antioxidant capacities
of these varieties were evaluated by using different methods, namely ABTS
.+
(2,2'-azino-bis-(3-
ethylbenzthiazoline-6-sulphonic acid)) scavenging activity expressed as Trolox equivalent antioxidant
capacity (TEAC), DPPH (2,2-diphenyl-1-picrylhydrazyl ) radical scavenging activity, Reducing power
expressed as Ascorbic acid equivalents antioxidant capacity (AEAC). Total phenol content (TPC) was
determined by using FolinCiocalteau Reagent. Total flavonoid content (TFC) was determined by
using aluminumchloride method. ABTS radical cation scavenging activity (Trolox equivalent), the
TEAC values decreased in the order of DB>Tam>Tef. Effective scavenging concentration (IC50) on
DPPH radical decreased in the order of Tam>DB>Tef. Effectiveness in reducing powers was in a
descending order of Tam >DB>Tef. The TPC was found from 41.8 to 84.73 mg/100g gallic acid
equivalents, the order of TPC of DPF is: DB>Tef>Tam, while TFC to vary from to vary from 7.52 to
14.1 mg/100g rutin equivalents and in a descending order of DB>Tam>Tef. These results suggest that
all date varieties serve as a good source of natural antioxidants and could potentially be considered as
a functional food or functional food ingredient.

Keywords: Date palmfruit; Antioxidant capacity; ABTS;DPPH; Reducing power; Total, phenolic
content and total flavonoid
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
69
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
A17
LANTIQUE OASIS; ENTRE DCLIN ET RHABILITATION
(CAS DU PAYS DE OUARGLA)

FACI Mohamed, SENOUSSI Abdelhakim et BABAHANI Souad

Laboratoire des bioressources sahariennes, Universit Ouargla, Algrie

La prsente tude, relative la situation de lantique oasis du pays de Ouargla, quest un patrimoine de
la population locale, sest assigne comme objectifs : dtablir un tat des lieux, connatre la place de
cet oekoumne dans la nouvelle dynamique agricole et de situer les diffrentes contraintes. Le travail
de terrain a port sur cinq zones caractristiques, comptes parmi les plus anciennes de la rgion : le
ksar de Ouargla, Ngoua, Chott, Adjadja et Sidi Khouiled. Les enqutes de terrain rvlent une
situation alarmante, lagrosystme oasien fait face bon nombre de problmes : dordre anthropique
(tel que lavancement de bton), cologique (comme la remont de la nappe phratique) et technico-
conomique (le manque dentretien, labsence des marchs de gros de dattes, etc.). La zone une, le
ksar de Ouargla, est la plus touche par ces problmes, contrairement aux autres zones de ltude, son
tat de dgradation avance nest autre quun vritable spectre de tendance disparition. Dans la
perspective de la prservation de lantique oasis, nous avons recommand des propositions pratiques
touchant : lamnagement et lentretien de l'exploitation et de son environnement, la redynamisation
du cadre associatif et de la vulgarisation agricole, lappui de la recherche scientifique et de milieu
conomique et finalement lencouragement de lagro-tourisme.

Mots cls: Lantique oasis, pays de Ouargla, patrimoine, contraintes, prservation.

**************************************
A18

LES SYSTEMES DE PRODUCTION AGRICOLES DANS L'OASIS DE SEBSEB (W.
GHARDAA)

HOUICHITI Rachid et BISSATI Samia

Laboratoire des Bioressources Sahariennes, U.K.M. Ouargla, Algrie
rhouichiti@gmail.com . samiabouafia@yahoo.fr

Le prsent article consiste caractriser diffrents systmes de production mis en uvre par les
agriculteurs de l'oasis de Sebseb, bas sur la dmarche systmique, partir des rsultats d'enqutes
effectues dans la dite oasis, grce un chantillonnage raisonn couvrant 25 exploitants. L'enqute a
rvl l'existence de 05 systmes de production agricole oasiens, dont un est bas sur la production
animale. On trouve le systme "Dattier-fruitier", qui domine la partie ancienne de l'oasis. Le systme
"Maracher" est adopt par les agriculteurs qui n'ont aucune ressource. Un systme de "Polyculture", et
un autre bas sur la culture d'arachide sont galement reprsentatifs de la rgion. En dernier lieu on
cite le systme "levage ovin-caprin" pratiqu par des ex-nomades.Le choix du systme de production
dpend de plusieurs facteurs, notamment la capacit financire de l'exploitant, son ge, la situation de
sa parcelle et les possibilits du march. Cependant, ces systmes possdent un caractre commun,
savoir la recherche de la scurit financire, par limitation des charges variables. Il s'agit de la
multiplication de sa propre semence, la fertilisation base sur le fumier de la ferme et l'exploitation
maximale de la main d'oeuvre familiale.

Mots cls : Agriculture familiale, Elevage, Oasis, Sebseb, Systme de production.

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
70
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A19
DIVERSITE VARIETALE DE LA PALMERAIE PRESAHARIENNE
DE MDOUKAL (SUD-OUEST DE LA WILAYA DE BATNA)

LEBCHAKI H
1
., BELHADI A
2
., ROMANI M
2
.

1
Universit Mohamed Kheider Biskra
2
Centre de Recherche Scientifique et Technique sur les Rgions Arides
aissabelhadi@yahoo.fr

Pour prserver et valoriser notre patrimoine phoenicicole contre les diffrentes pressions quil subi
(biotiques, abiotiques et socio-conomiques), cela nous impose sa connaissance et son valuation.
Pour ce faire des inventaires priodiques doivent tre raliss, localit par localit et terroir par terroir
pour tre le plus exhaustif possible. Cest dans ce cadre que sinscrit notre prsente tude, mene au
niveau de la palmeraie prsaharienne de Mdoukal (Sud-Ouest de la wilaya de Batna). Aprs ltape
de ltablissement de la liste des cultivars se trouvant au niveau de la palmeraie, avec la collaboration
dagriculteurs ayant une exprience dans le domaine de la phoeniciculture, sensuit ltape du terrain,
pour identification des cultivars recenss et ventuellement complter la liste dj tablie. Linventaire
effectu au niveau de la palmeraie de Mdoukal nous a permet didentifier 109 cultivars femelles. Sur
les 109 cultivars inventoris 57, soit 52,29 % sont endmiques Mdoukal. Les 52 autres restants, soit
47, 71 %, sont communs dautres rgions phoenicicoles dAlgrie (Ziban, Aurs-Nemencha, Souf,
Mzab, etc.). Ce nombre important de cultivars que renferme la palmeraie de Mdoukal est d son
caractre traditionnel et familial. En effet, les exploitations sont de superficies trs rduites contenant,
en moyenne, entre 20 et 30 palmiers. Cette diversit, nous renseigne aussi sur leffort de slection
entrepris par les agriculteurs de cette localit. En effet, cette palmeraie prsaharienne renferme plus de
cultivars endmiques que de cultivars communs, aux autres rgions phoenicicoles dAlgrie. Aussi, la
palmeraie de Mdoukal est une palmeraie vieille, ce qui la menace dans sont existence. En effet, cest
85,32% des cultivars qui sont gs de plus de 50 ans.

Mots cls : Palmier dattier, diversit varitale, palmeraie prsaharienne, Mdoukal (w. Batna).

**************************************
A20
LA PERTE DE LA DIVERSITE GENETIQUE DE LOLIVIER DE LAPERRINE
MULTIPLIE PAR GRAINES

Djamel BAALI-CHERIF ; Guillaume BESNARD ; Nadia BOUGUEDOURA ; Louisa
BOUHIRED

1
LRZA/USTHB BP 44 16000 Alger-gare, Algrie
2
Imperial College London, Silwood Park Campus, Buckhurst Road Ascot, Berkshire YSL57PY, U. Kingdom.
bacherdj@yahoo.fr

Lolivier de Laperrine (Olea europaea subsp. laperrinei) est une oleacee endmique des rgions
montagneuses du Sahara central : Hoggar et Tassili (Algrie), Ar (Niger) et Djebel Mara (Soudan).
Aucune rgnration naturelle rcente de ce taxon na t observe dans les massifs algriens et
certaines de ses populations sont menaces dextinction. Pour pallier ce problme, la multiplication
du taxon par graines a t propose. Afin de dterminer limpact de cette pratique, des graines
provenant de dix arbres (issues de quatre localits dans le Hoggar) taient caractrises avec des
microsatellites nuclaires (SSR). Une importante perte de la richesse alllique tait rvle par rapport
la population initiale, indiquant que notre chantillon de graines ntait pas reprsentatif de la
diversit gntique locale. Les flux de pollen effectifs taient ensuite mesurs par des analyses de
paternit. Des croisements prfrentiels entre gnotypes taient rvls. Une tendance pour une plus
forte multi-paternit sur les graines collectes darbres provenant de peuplements relativement larges
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
71
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
tait observe. Enfin, les plantules issues darbres de petits peuplements montraient de faibles
performances de croissance. Nos rsultats sont discuts pour dvelopper une stratgie adapte de
multiplication de ce taxon par graines.

Mots cls : Flux de pollen, Germination, Hoggar, Microsatellites, Olivier de Laperrine, Paternit.

**************************************

Thme 2 - Elevage camelin
A21
ETUDE DE LAFFINITE DE LA PEPSINE BOVINE POUR LES CASEINES
CAMELINES

BOUDJENAH.S
1
, SIBOUKEUR O.E.K
1
, MATI A
2


1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi arides, Universit de Ouargla, Algrie.
2
Laboratoire de biochimie applique, Institut des Sciences de la Nature Universit de Tizi Ouzou, Algrie
harunsali@yahoo.fr

Le lait camelin produit dans les rgions arides reste non exploit, vu son aptitude limite la
coagulation. Dans le but de remdier au retard la coagulation du ce lait, nous nous sommes propos
dutiliser de la pepsine bovine comme enzyme coagulante. Son activit coagulante(UP) a t calcule
ainsi que Son protolytique en comparaison avec le lait bovin. Les rsultats obtenus ont montr que
lactivit coagulante de la pepsine bovine est de 0.1105 UP. Par ailleurs lactivit protolytique ne
change pas avec le substrat casiniques puisque les densits optiques (DO) enregistres avec les
casines bovines et les casines camelines sont trs comparables (DO=58 et 59 respectivement). La
mesure des temps de floculations du lait de chamelle et du lait de vache par La pepsine bovine a
rvl lexistence dune meilleure affinit de la pepsine bovine pour les casines camelines.
L'amlioration du temps de floculation du lait de chamelle par la pepsine bovine est optimale lorsque
le pH du lait est compris entre 6 et 6.3, la temprature gale 42C avec une concentration de CaCl
2

gale 0.01M.

Mots cls: Lait, coagulation, floculation, pepsine, affinit, protolyse.

**************************************
A22
DETERMINATION DES PRIORITES DE CONSERVATION DE RACES OVINES
ALGERIENNES PAR LETUDE DE LEUR DIVERSITE GENETIQUE

KHAIB DIT NAIB O
1
., BRAHAMI L
1
., BOUSABA N
1
., HAMOUDA L
1
., GAOUAR S
2
.
TABET-AOUL N
3
et SAIDI-MEHTAR N
1
.

1
Laboratoire de Gntique Molculaire et Cellulaire. Universit dOran, Algrie
2
Dpartement de Biotechnologie, Universit dOran, Algrie
3
Dpartement de Gntique Molculaire Applique, Universit dOran, Algrie
naibouahiba@yahoo.fr

Le danger dextinction qui menace le cheptel ovin algrien, et les consquences qui sen suivent,
impose la mise en place de programmes de conservation pour une meilleure exploitation des
ressources gntiques ovines. En matire de politique de conservation, la problmatique centrale est de
dfinir des priorits de conservation face au cot lev de cette derrire. Les marqueurs molculaires
notamment les microsatellites prsentent un outil simple et efficace pour lorientation du choix des
races prserver. Dans le cadre de ltude de la biodiversit des ressources gntiques animales en
gnral et des ovins en particulier, nous avons contribu ltude de la diversit gntique de six races
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
72
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
ovines algriennes (Hamra, Ouled-Djellal, Tadmit, Rembi, Sidaoun et Dmen) en vue de dterminer
loriginalit gntique de chaque race en utilisant des marqueurs microsatellites tudis par la
technique PCR-lectrophorse sur gel de polyacrylamide suivie dune coloration au nitrate dargent.
Lapplication de lalgorithme propos par Weitzman nous a permis de mesurer les contributions
relatives de lensemble des races tudies la diversit totale en utilisant le programme informatique
du logiciel WEITZMAN (Derban et al, 2002). La race Dmen a prsent la plus grande valeur de
contribution relative la diversit totale des six races tudies, ce rsultat implique le rle important
de cette race dans le maintien de la diversit globale des races ovines algrienne. Mais en plus de la
variabilit gntique, les dcisions de conservation devraient prendre en considration dautres critres
tels que : la valeur dexistence (leffectif de la race, le risque dextinction), La valeur culturelle de la
race et la valeur socio-conomique...La finalit de notre travail est la contribution ltablissement des
choix de stratgies de conservation en vue de maintenir un niveau maximumde biodiversit.

Mots cls : biodiversit - races ovines microsatellite conservation.

**************************************
A23
IMPACT ECOLOGIQUE DES MODES DELEVAGE SUR LECOSYSTEME ET
LENVIRONNEMENT STEPPIQUES DE LA COMMUNE DE MAAMORA, WILAYA
DE SAIDA

BOUCHIKH Yamina, TERRAS Mohamed

Dpartement de Biologie. Centre Universitaire Moulay Taher, Saida, Algrie.
aminacorinna@yahoo.fr

Le prsent travail a t ralis dans la commune de Maamora, localise au niveau de la wilaya de
Saida, il a pour objectif dvaluer limpact cologique des modes dlevage sur lcosystme de la
commune caractris par sa vocation typiquement pastoral o la steppe occupe prs de 70% de la
superficie. Les nouveaux systmes dlevages apparus ces dernires annes dans cette rgion, sont
considrs comme une adaptation logique lenvironnement politico-socio-conomique, cest dire
rsultant des diffrentes restructurations du foncier, des diffrents systmes de production, et dune
nouvelle occupation de lespace. Une tentative dapproche qualitative, et quantitative, effectu au
niveau de diffrents parcours certains protgs tel que des mises en dfens, et dautre non protgs, de
laction de ces nouveaux comportements sur lespace, nous a permis de faire ressortir les causes de ces
bouleversements, et leurs consquences sur lenvironnement ainsi que le secteur de llevage en
steppe.

Mots cls : Impact, mode dlevage, dgradation, mise en dfens, Saida.

**************************************
A24
SYSTEMES DELEVAGE DES PETITS RUMINANTS DANS LE SUD DE LA
TUNISIE

Amor GADDOUR, Sghaier NAJ ARI, Ali FERCHICHI

Institut des Rgions Arides, Mdenine, Tunisie
gaddour.omar@yahoo.fr

Les rgions arides de la Tunisie sont exploites par les petits ruminants dans des conditions difficiles.
La socit a conduit lapparition de nouveaux systmes dlevage. La typologie de ces systmes doit
aider laborer des plans damlioration conformes leurs caractristiques fonctionnelles et
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
73
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
structurelles. La prsente tude se focalise sur les systmes caprins en vue de regrouper les levages en
entits "homognes" et identifier les possibilits et les modalits damlioration de chaque systme.

Mots cls : systmes dlevage, petits ruminants, Tunisie

**************************************
A25
ETUDE DE LA DYNAMIQUE DES PARCOURS STEPPIQUES DANS LES HAUTES
PLAINES DU SUD ALGEROIS (REGION DAN-OUSSERA, WILAYA DE
DJELFA)

TAIBAOUI brahim
1
et KADIK Leila
2


1
Universit Ziane achour Djelfa, Algrie.
2
FSB, USTHB, Alger, Algrie
Taibaoui.b2006@yahoo.fr

La steppe des hautes plaines du sud algrois est soumise des perturbations de nature climatique et
anthropozoque trs anciennes mais durant ces dernires dcennies, cette dgradation relativement
rapide. Il faut remarquer qu partir des annes 1980, les changements enregistrs dans les hautes
plaines de lAlgrois et de lOranais sont importants. Le constat majeur actuellement est celui dune
diminution de la superficie de ces parcours qui est la consquence de leur dgradation parfois
extrme. Cette situation due au phnomne de la dsertification dans cette rgion a engendr une
dgradation de la biodiversit, notamment de la faune et de la flore, menaant ainsi de disparition
des ressources naturelles difficilement renouvelables. Lobjectif de ce travail est dapprcier la
dgradation du couvert vgtal travers une tude diachronique, dans la rgion des hautes plaines
steppiques wilayas de Djelfa (rgion An-Oussera). Ltude de la dynamique de la vgtation base
sur les changements physionomiques montre une volution rgressive du tapis vgtal faite par la
substitution de la steppe vivace climacique graminenne base dalfa (Stipa tenacissima) avec une
steppe climacique chamaephytique base darmoise blanche (Artemisia herba alba, Noaea
mucronata) avec le dveloppement des formations vgtales de dgradation essentiellement post
culturales. Le traitement des tables appartenant chaque carte tablie par le biais dun SIG et la
comparaison quantitative des donnes (surface de chaque facis) permet de noter essentiellement une
diminution remarquable des facis domins par Stipa tenacissima qui passent de 48% 7%.

Mots cls : Hautes plaines, steppe, diachronisme, cartographie, dynamique.

**************************************
A26
ETUDE DE LA SPIRULINE COMME ALIMENT FONCTIONNEL, NOURRISSANT
LA FLORE INTESTINALE: INFLUENCE IN VITRO DE LA SPIRULINE SUR LA
CROISSANCE DE Bifidobacterium pseudocatenulatum

Amel DOUMANDJI
1
et Nabil SAIDI
2


1
Facult des sciences agro-vtrinaires, Universit Sad Dahlab, Blida, Algrie.
2
Unit de Recherche et Dveloppement de lIntendance, Alger, Algrie.
corino147@yahoo.fr

La spiruline est une micro algue bleue, une cyanobactrie. Elle pousse l'tat naturel dans les eaux
saumtres et chaudes des rgions dsertiques. La spiruline agit comme aliment fonctionnel, nourrissant
la flore intestinale, surtout le lactobacille et le bifidus. Le maintien d'une population saine de ces
bactries dans l'intestin rduit les problmes provoqus par des lments pathognes comme E. coli et
Candida albicans. Ltude effectue dans le cadre de ce projet porte sur loptimisation des aptitudes
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
74
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
technologiques soit la croissance bactrienne, et le pouvoir acidifiant des souches d'intrts. Nous
avons utilis la souche Spirulina platensis de provenance de deux pays, lAlgrie et le Bangui au profit
des bifidobactries contenu dans le lait afin daugmenter leurs effectifs car la spiruline jouent un rle
important dans la rgulation de la flore intestinale, immunologique et la dgradation du lactose,
plusieurs facteur dune importance majeur pour le nouveau ne. Et pour cela le lait infantile deuxime
ge (Bldina) contenant une souche de bifidobactries (Bifidobacterium pseudocatenulatum) a t
enrichi avec la spiruline. Cette dernire a montr une bonne influence sur les bifidobactries car le lait
enrichi avec cette algue montre une croissance suprieure de leffectif des colonies bifides/ml que
celui qui nen contient pas. Loptimisation de la cintique de croissance de Bifidobacterium
pseudocatenulatum en culture pure est obtenue lorsque cette souche est cultive dans le lait infantile
2
me
ge enrichi avec de la spiruline raison de 0,5% avec un taux daccroissement pour
Bifidobacterium pseudocatenulatum de (65%) lorsque le lait est additionn de spiruline provenant de
la rgion de Tamanrasset et un taux daccroissement pour Bifidobacterium pseudocatenulatum de
(82%) lorsque le lait est additionn de spiruline provenant de Bangui. Bifidobacterium
pseudocatenulatum cultive dans le lait infantile seul a un pouvoir acidifiant trs intressant (pH =
0,99) aprs 8h de fermentation. Cette activit acidifiante est meilleure aprs 8h de fermentation
lorsque le lait est enrichi en spiruline algrienne ou banguine soit respectivement (pH =0,92 et pH =
1,04). Loptimisation du temps de gnration (G) est obtenue dans le cas o la flore bifide est cultive
dans le lait enrichi avec de la spiruline algrienne ou banguine soit respectivement 0,5 h et 0,49h.

Mots cls: Spirulina platensis, Bifidobacterium pseudocatenulatum, lait infantile, pH, croissance.

**************************************
A27
LES PARCOURS SAHARIENS DANS LA NOUVELLE DYNAMIQUE SPATIALE :
CONTRIBUTION A LA MISE EN PLACE DUN SCHEMA DAMENAGEMENT ET
DE GESTION DE LESPACE (S.A.G.E.) - CAS DE LA REGION DE GHARDAA-

BEN SEMAOUNE Youcef et SENNOUSSI Abdelhakim

bensemyoucef@yahoo.com

A partir de l'tude que nous avons ralise, les rsultats de l'enqute montrent que le mode de vie
nomade volue de point de vue dplacement, travail et situation. Les leveurs nomades reprsentent
25%, les sdentaires 15 % et les semi nomades 60 %. Ces derniers reprsentent la majorit ; c'est la
consquence de plusieurs causes lies diverses contraintes particulirement dordre anthropique
(amnagement et gestion de l'espace). En ce qui concerne le mode d'exploitation des espaces des
parcours, 60 % des leveurs les sur exploitent ; corollaire dun surpturage cause par une surcharge et
de l leurs dgradation. Laugmentation de la surface agricole qui est passe de 21742 ha en 2006
26436 ha en 2007. Cette extension sest faite au dtriment de lespace pastoral qui a diminu de 4694
ha. Cette soustraction de lespace pastoral entre 2006-2007 correspond la moiti de la surface
soustraite pendant quatre annes (2000-2004).

Mots-clefs : Sahara, Parcours, Eleveur, S.A.G.E.

**************************************







Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
75
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A28
ETUDE DE LA COAGULATION DU LAIT DE CHAMELLE PAR LES ENZYMES
GASTRIQUES DE DROMADAIRE: EFFET DES PROTEASES DES
PSYCHROTROPHES SUR LACTIVITE PROTEOLYTIQUE

BOUDJENAH.S
1
, MADANI Z
1
, MOHAMMEDI F.
1
MATI A
2

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi Arides, Universit de Ouargla, Algrie
2
Laboratoire de biochimie applique, Universit de Tizi Ouzou, Algrie
harunsali@yahoo.fr

La transformation du lait de chamelle en fromage prsente aprs affinage un dveloppement de got
atypique qui est du la richesse du formage en peptides. Dans le but de rechercher l'origine de ce got;
nous nous sommes proposs d'tudier un des facteurs responsables de cette forte protolyse en
l'occurrence les protases de la flore psychrotrophe existante dans le lait. L'volution de la flore
psychrotrophe du lait de chamelle a t suivie en travaillant dans diffrentes conditions: lait cru
rfrigr 4 et 7 pendant 24 et 96 h et le lait pasteuris conserv dans les memes conditions. Les
rsultats ont montre que la forte activit protolytique est observ dans le lait rfrigr 7 durant 96h.
Par contre dans le cas du lait pasteuris, elle est plus importante 7 seulement pendant 24 h.

Mots cls: Lait, Chamelle, caillette, activit protolytique, activit coagulante, bactries
psychrotrophes, fromage.

**************************************
A29
ETUDE DES RELATIONS PHYLOGENETIQUES DES RACES OVINES
ALGERIENNES

1
BOUSHABA N.,
1
HAMMOUDA L.,
1
BRAHAMI N.,
1
KHAIB DIT NAIB O.,
2
GAOUAR
S.,
3
TABET-AOUL N. ET
1
SAIDI-MEHTAR N.

1
Dpartement de Gntique Molculaire Applique, Universit dOran, Algrie.
2
Dpartement de Biologie, Universit de Tlemcen, Algrie
3
Dpartement de Biotechnologie, Universit dOran Universit dOran, Algrie.
nedjet22@yahoo.fr

Ltude des relations phylogntiques nous a permis davoir une ide sur la diversit gntique inter-
populationnelles de six races ovines algriennes : Ouled Djellal (30), Hamra (30), Tadmit (30),
Sidaoun (28), Rembi (27) et Dmen (13) par lutilisation de 4 marqueurs microsatellites : OarFCB128,
OarCP34, INRA63 et BM1824. La mthode utilise est lamplification in vitro (PCR) des ADN ovins
suivie de llectrophorse sur gel de polyacrylamide non dnaturant et dune coloration au nitrate
dargent. Les distances gntiques entre paires de races ont t calcules selon lapproche classique
base sur les frquences allliques dans chaque race en retenant la distance standard de Nei et celle de
Reynolds. Chacune de ces deux distances prsente des proprits spcifiques et reste approprie pour
un modle particulier dvolution. Ces distances gntiques ont t employes pour regrouper les
diffrentes races suivant les deux mthodes de Neighbor-J oining et UPGMA. Ainsi, les
dendrogrammes ont t construits. Les rsultas obtenus ont montr trois groupes distincts : le premier
inclut la race Hamra et Ouled-Djellal. Ceci est en accord avec le continuumgographique des aires de
rpartition des deux races. Le deuxime groupe inclut les trois races Sidaoun, Tadmit et Rembi
malgr quelles proviennent de diffrents secteurs gographiques. Enfin, la race Dmen constitue un
outgroup , probablement d son isolation. Par ailleurs, lAnalyse Factorielle des Correspondances
(AFC) a montr globalement les mmes rsultats obtenus par les dendrogrammes. Enfin, nos rsultats
restent prliminaires cause du faible nombre de microsatellites utiliss dans cette analyse et devraient
tre approfondis par ltude dau moins vingt marqueurs. Les perspectives de ce travail seraient
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
76
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
dlargir cette tude toutes les races de notre cheptel ovin telles que les deux races Berbre et
Barbarine ainsi qu dautres races maghrbines et europennes.

Mot-cls : Microsatellites - race ovine - phylognie - distance gntique dendrogramme


Thme 3 - Protection et prservation de lenvironnement

A30
UTILISATION DE DEUX SOUCHES BACTERIENNES SAHARIENNES
PSEUDOMONAS ET RHODOCOCCUS DANS LA BIOREMEDIATION DES SOLS
POLLUES PAR LES HYDROCARBURES.

CHABOUNI sarra
1
, AROUSSI aroussi
2
,

OULD HADJ-KHELIL aminata
1


1
Laboratoire de Protection des Ecosystmes en Zone Aride et Semi-Aride
2
Laboratoire danalyses dpartement de chimie : SH-FOR DML
sarra.revs@yahoo.fr

La bioremediation des sols contamins par les hydrocarbures lchelle du laboratoire par un procd
biologique Landfarming a fait lobjet de notre travail. Lutilisation de deux souches bactriennes
locales (sahariennes) Pseudomonas et Rhodococcus prleves dans le bourbier OMOz 562 Hassi
Messaoud a permis de mettre en vidence une forte dgradation dhydrocarbures explique par une
diminution de leur concentration dans lchantillon du sol contamin. Les rsultats obtenus montrent
que les deux souches bactriennes Pseudomonas et Rhodococcus sont performantes vu leur
rendements dlimination dhydrocarbures variant de 82.09% dans le bac biostimul 84.29% dans le
bac bioaugment.

Mots cls: Sol, Hydrocarbures, Souches bactriennes, Pollution, Bioremediation.

UTILISATION DES PLANTES ENRACINEES POUR LE TRAITEMENT DES A31
EAUX USEES : CAS DU ROSEAU

ALOUI nabiha

Universit KASDI Merbah- Ouargla
alouinabiha@yahoo.fr

La prsente tude consiste tester les potentialits dun halophyte : le roseau purer une eau urbaine
sous un climat aride. Le pilote exprimental est constitu de bacs dont deux plants de jeunes tiges de
roseau et deux non plants. La prsence du roseau dans le systme plant assure donc une nette
amlioration de labattement de la charge organique et des nutriments par rapport au sol nu Pour le sol
plant ou les pertes de volume sont considrables, labattement moyen obtenu pour le lit plant est de
68 48 52 et 39 respectivement pour le NTK, NH4, PT et PO4 pour le sol non plant les
rabattements sont faibles 51,3,12et -8

Mots cls : Plantes enracines, Traitement, Eaux uses, Roseau.

**************************************




Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
77
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A32
ETUDE DE LA QUALITE PHYSICO-CHIMIQUE ET BACTERIOLOGIQUE DES
REJET DOMESTIQUES BRUTS DE LA DIRECTION REGIONALE DE HAOUD
BERKAOUI.

KHALLEF .S
1
, BNEKARA Mostefa .L
2
, ATTAB.S
1

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides. Universit de Ouargla, Algrie
2
Division exploitation, Direction rgionale Haoud Berkaoui, Ouargla, Algrie.
sakina_khallef@yahoo.fr

La Direction Rgionale de Haoud Berkaoui reprsente lune des principales zones de production
dhydrocarbures du Sahara algrien ; elle se situe une trentaine de kilomtres au sud ouest de la
wilaya de Ouargla. Le dveloppement important de lactivit industrielle a conduit un accroissement
dmographique, qui gnre une production importante deaux uses. Suite larrt de la station
dpuration deaux uses domestiques par boues actives installe pour parer aux problmes de
lenvironnement en outre la protection de la nappe phratique et rduction du risque de prolifration
des maladies transmission hydriques, les eaux rsiduaires urbaines sont actuellement rejetes sans
aucun traitement pralable dans un bourbier naturel, avec toutes les consquences sur un milieu
rcepteur aride. Ltude de la qualit physico-chimique et bactriologique des rejets domestiques bruts
de la Direction Rgionale de Haoud Berkaoui, mene au niveau de cinq sites diffrents, a rvle une
charge importante de ces eaux en matires azotes et phosphores, une conductivit lectrique leve
avec un pH moyennement alcalin mis part un site. Les rsultats de la DBO
5
et la DCO affichent des
valeurs suprieures aux normes algriennes appliques aux rejets. Les analyses bactriologiques nous
renseignent sur une charge moyenne en coliformes totaux et fcaux avec absence de clostridiums
sulfito-rducteurs dans la majorit des chantillons. Il est impratif de traiter ces eaux avant rejet, afin
dviter la contamination de la nappe phratique, prserver les ressources hydriques et lutter contre la
transmission des maladies.

Mots cls : rejets domestiques, nappe phratique, contamination, pollution, qualit

**************************************
A33
DETECTION DE LA POLLUTION ATMOSPHERIQUE PAR LES
HYDROCARBURES A L'AIDE D'UN BIOCCUMULATEUR (Phoenix dactylifera)
DANS LA REGION DE OUARGLA (SIDI KHOUILED)

DOKKAR Keltoum et KHELIL Rahma

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides. Universit KASDI MERBAH-
Ouargla, (Algrie)
keltoumdokkar@yahoo.fr

La commune de Sidi Khouiled (w. Ouargla), avec sa situation gographique et stratgique connat
aujourdhui dnormes risques qui menacent le citoyen et son environnement, exprims en une
croissance dmographique, ainsi quune urbanisation un rythme acclr et incontrl concentrer en
grandes missions automobiles. Notre travail consiste une tude de certains aspects de la pollution
atmosphrique principalement dus aux rejets de la circulation routire dans la rgion dOuargla. Cest
dans ce contexte la et dans le cadre de notre tude que nous avons jug utile dvaluer les niveaux de
concentration des hydrocarbures totaux, aussi bien dans le temps que dans lespace, en se basons sur la
bioaccumulation de ces polluants par un excellent bio accumulateur de la qualit de lair, ce dernier est
le palmier dattier (Phoenix dactylefera), grce a son caractre daccumulation qui reprsente aussi une
bonne adaptation avec le milieu saharien. Nous avons relev une corrlation significative entre les
H.C.T (hydrocarbures totaux) et la dure dexposition la pollution pour la majorit des chantillons
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
78
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
du palmier dattier, ainsi que pour la teneur en chl a+b (chlorophylle a+b). Mais concernant le rapport
MF/MS. Cette relation est significative pour juste la moiti des chantillons du bioaccumulateur
utilis. Nous constatons galement une corrlation significative entre les concentrations en
hydrocarbures dans les tissus vgtaux et la teneur de ces derniers en chl a+b ainsi que le rapport
MF/MS dans certains chantillons des deux stations tudie. Laccumulation des hydrocarbures quant
elles, semble tre un processus relativement lent dans la majorit des palmiers, qui est lie surtout
lintensit des gaz mis et la dure dexposition des palmiers dattiers la pollution ainsi que les
paramtres climatiques.

Mots cl : Pollution atmosphrique, hydrocarbures, bioaccumulateur, palmier dattier, Ouargla.

**************************************
A34
PRESERVATION DE LA QUALITE DES EAUX SOUTERRAINES ET DE SURFACE
DUN SITE PROPOS LINSTALLATION DUNE DCHARGE CONTRLE

BOUCHIKHI TANI Zoheir et HASSAINE Karima

Dpartement de biologie et environnement, Universit de Tlemcen, Algrie
bou_zoheir@yahoo.fr

La gestion des rsidus urbains est devenue une des proccupations majeures de ces dernires
dcennies par consquent plusieurs mthodes ont t utilises pour y rpondre. La dcharge contrle
est lun de ces procdures les plus adquates. Il est noter que mme la dcharge contrle prsente
des risques de contamination pour les eaux de surface et de nappe souterraine susceptible dtre
utilises pour lalimentation en eau potable. La protection des eaux doit tre une priorit absolue lors
de limplantation de la dcharge, et donc le choix du site rcepteur dun tel projet est ncessaire ainsi
que les amnagements raliser (barrire tanche) sans oublier les contrles priodiques effectuer.
Dans le cadre de la prsente tude, nous avons procde linventaire et lvaluation des rpercussions
environnementales, en adoptant une des plus rcentes des procdures de protection de lenvironnement
conue par le ministre de lenvironnement du Qubec et applique lchelle mondiale. Une tude
gologique et hydrogologique commande le choix de lemplacement de la dcharge contrle, cette
tude a pour objet de sassurer que les eaux d ruissellement et les eaux dinfiltration percolant a travers
la dcharge, ne pourraient rejoindre une nappe utilise pour lalimentation quaprs un parcours
suffisant dans un sol de nature a effectuer une filtration convenable, comme il faut prendre en
considration les dangers de pollution que peut constituer les lixiviats aux eaux de surface par
ruissellement. Le rsultat de notre travail permet de proposer le site de Koudia (situ la limite
administrative au Nord-ouest de la commune de Tlemcen, une distance denviron 6 Kmd la ville de
Tlemcen ) comme un site prsentant des conditions favorables la cration dune dcharge contrle,
mais avec les corrections ncessaire pour la protection et prservation des eaux souterraines et de
surface par la ralisation dune barrire de scurit tanche, peut se faire selon trois options sols
naturels en place, ltanchement artificiel, le drainage .

Mots cls : Dcharge contrle, contamination des eaux, rpercussions environnementales, Koudia,

**************************************








Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
79
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A35
LELIMINATION DU CUIVRE PAR LEXTRACTION A DEUX PHASES
AQUEUSES A LAIDE DALCOOLS POLYETHOXYLES

Z.TALBI; B. HADDOU; Z. BOUBERKA; Z. DERRICHE

Laboratoire de Physico-chimie des matriaux : catalyse et environnement, Universit dOran, Algrie.
talbizahera@yahoo.fr

La pollution de leau par les mtaux lourds (cuivre, plomb, mercure, arsenic et le cadmium) due des
missions provenant des activits humaines est diverse. Essentiellement, elle a pour origine les
fonderies de la mtallurgie et les incinrateurs d'ordures, ainsi que les industries de traitement de
surfaces, de raffinage des mtaux, de la chimie, des textiles, des peintures, etc. Avec les pluies et le
lessivage, il se retrouvent dans les ocans. La facilite avec laquelle les polluants sont emports par
l'eau de lessivage dpend fortement de conditions spcifiques (surface spcifique, forme, taille des
grains...). Llimination de ces pollutions passe par plusieurs types de procd, dont les traitements
physico-chimiques, la concentration-vaporation et lultrafiltration. Mais la diversit des polluants
complexifie les mthodes de traitement. Dans notre travail, nous proposons une nouvelle technique de
dpollution des eaux, savoir lextraction par point de trouble. Cette mthode fait appel aux
tensioactifs non ioniques polythoxyls dont leurs solutions aqueuses deviennent troubles quand elles
sont chauffes une temprature appele prcisment point de trouble . A l'quilibre les solutions
se sparent en deux phases une phase contenant la plupart du tensioactif, appele coacervat, et une
autre phase aqueuse dans laquelle la concentration du tensioactif est proche de sa concentration
micellaire critique (cmc). En prsence de tensioactifs non ioniques, les composs hydrophobes
peuvent tre solubiliss dans les micelles puis se concentrs dans le volume du coacervat aprs
sparation de phase provoque au dessus de la temprature de trouble du tensioactif non ionique, on
ralise ainsi une extraction deux phases aqueuses. Le principal but de ce travaille concerne
lextraction par coacervat de polluants mtalliques partir de solutions synthtiques, visant la
dpollution des rejets industriels chargs en mtaux lourds en particulier le cuivre, dangereux pour
lenvironnement. Pour cela, nous utilisons des micelles formes de tensioactifs non ioniques en
prsence dagent complexant de type organophosphors convenablement choisis pour leur capacit de
former des complexes hydrophobes stables avec les ions du cuivre tel que le Di (2-etylhexyl)
phosphate (D2HPA), le tensioactif utilis dans ce travail est le lOxo-C
10
E
3
aisment et rapidement
biodgradables. Nous avons tudi leffet du pH, de la concentration du complexant, de la temprature
et leffet de la salinit sur lefficacit dextraction.

Mot cls : point de trouble, tensioactif non ionique, D2HPA, extraction, coacervat

**************************************
A36
EVALUATION DE LA POLLUTION PAR LES NITRATES ET LES PHOSPHATES
DE LA NAPPE PHREATIQUE DANS LA VALLE DOUED SOUF

S.E.LAOUINI
1
, S.LADJ AL
2
, A.KHELEF
1
, M.R.OUAHRANI
2

1
Centre Universitaire d'El-Oued, Algrie
2
Universit de Ouargla, Algrie
Salah_laouini@yahoo.fr

La pollution constitue un risque permanent de limitation des ressources en eaux souterraines.
Lurbanisation croissante et le dveloppement conomique contribuent la dgradation quantitative et
qualitative des eaux souterraines. La protection et la prservation de ces ressources sont une ncessit
de premier ordre particulirement dans les zones arides o leau souterraine constitue la principale
source hydrique. La valle de souf tend sur une superficie de 3.000 Km. La population est value
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
80
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
420.000 habitants, on value la production deau dans le Souf 90 millions de m
3
partir de 107
forages exploitant la nappe du Pontien, par pompage, et de 5 forages artsiens dans lalbien.
Lapprovisionnement en eau potable utilise environ 65% de ce volume se traduisant par une dotation
moyenne de plus de 400 l/j/hab. La valle de Souf souffre actuellement des consquences ngatives de
la remonte et pollution des eaux de la nappe phratique. La pollution par les nitrates et les
phosphates de la nappe phratique de la zone dOued souf t rvle depuis 15 ans. Les nitrates et
les phosphates menacent l'quilibre des milieux aquatiques. Par exemple, seulement 10 % des cours
d'eau dans le globe ont un taux de phosphate infrieur 0,1 mg/l, limite de l'apparition des effets sur
l'environnement. Ces substances favorisent le dveloppement des vgtaux, qui touffent petit petit
le milieu. Les nitrates sont galement considrs comme responsables de certaines maladies, dont la
maladie bleue du nourrisson. Mme si ces effets sur la sant sont aujourd'hui remis en cause, les
nitrates et les phosphates restent des perturbateurs de l'environnement et les efforts de dpollution ne
doivent pas se relcher. Ce travail a t ralis sur l'eau de la commune d'El-oued en collaboration
avec le laboratoire de l'Algrienne des eaux (ADE). L'exprimentation visait dfinir les quantits de
nitrates et phosphates existent dans les zones tudies et en fin valu (estimer) la qualit des eaux de
la nappe phratique.

Mots cls: Nitrate, phosphate, nappe phratique, pollution, Oued souf.

**************************************
A37
EVOLUTION SPATIO-TEMPORELLE DE LA PHYSICO-CHIMIE,
MICROBIOLOGIE ET ECOTOXICOLOGIE DES LIXIVIATS
DE LA DECHARGE PUBLIQUE DEL-KERMA (ORAN, ALGERIE)

BENNAMA T.
1
, YOUNSI A.
2
, DERRICHE Z.
1
, DEBAB A.
1

1
Laboratoire de Physico-chimie des Matriaux
Universit dOran, Algrietbennama@yahoo.fr
2
Laboratoire des Gosciences et Techniques de lEnvironnement
Universit Chouab Doukkali, El Jadida, Maroc

Ce travail sinscrit dans le cadre de la rhabilitation des dcharges publiques. En effet,
la dcharge publique dEl-Kerma (Oran, Algrie) constitue linstallation centrale de stockage et
dlimination des dchets solides (mnagers, industriels, hospitaliers et autres) de la ville dOran. Les
quantits normes de dchets putrescibles rejets dans cette dcharge, gnrent des eaux de lixiviats
trs polluants, riches en matires organiques (DCO moyenne=14.000 mg dO
2
/l), en sels
(CE moyenne=130 mS/cm) et en microorganismes. La caractrisation physico-chimique de ces
lixiviats bruts gnrs par cette dcharge a montr quil sagit de jus de dcharge vieux et stabiliss,
vhiculant une importante charge polluante (DBO
5
/DCO=0,05). Lanalyse de la composition en
mtaux lourds a mis en vidence limportante charge mtallique de ces effluents, dont le fer est le
mtal le plus abondant (8 mg/l). Les rsultats de la caractrisation bactriologique ont indiqu une trs
mauvaise qualit microbiologique de ces lixiviats. En effet, des taux suprieurs 18.000 germes par
100ml de lixiviat ont t enregistrs pour les coliformes totaux et les streptocoques fcaux, considrs
comme traceurs de premier rang de la pollution microbienne dans les jus de dcharges. Les essais du
test dcotoxicit aigue Toxtracer raliss sur ces lixiviats ont rvl des taux dinhibition assez
levs, excdant les 50% pour des dilutions suprieures ou gales 0,5. Ce qui rend ces effluents
extrmement toxiques et prsentent ainsi un danger permanent pour la sant de la population riveraine
et lenvironnement avoisinant, et ncessitent, par consquent, un traitement spcifique avant leur rejet
dans le milieu rcepteur.

Mots-cls : dcharge publique, lixiviats, caractrisation, contamination, El-Kerma
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
81
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A38

LE POUVOIR DELIMINATION DES HYDROCARBURES DES ACTINOMYCETES
ISSUS DES SOLS CONTAMINES DE HASSI MASSAOUD

MERGOUD L
1
et BENOUARETH D.E
2

1
Dpartement de Biologie, Universit de Ouargla, Algrie.
2
Dpartement de Biologie, Universit de Guelma, Algrie.
con_ann_war@yahoo.fr

La prsence des hydrocarbures dans le sol pose un problme de toxicit ds lors ils migrent et se
retrouvent dans la chane alimentaire ou entrant en contact avec lhomme. Les voies dlimination
chimique et physiques de ces composs ont leurs limites du fait de leur cot ou de leur impact
secondaire sur lenvironnement. La voie biologique est actuellement en plein essor et suscite de trs
nombreux travaux de part le monde entier. Notre travail vise isoler les actinomyctes des sols
contamins et tester leur pouvoir de dgradation de Gasoil (un type dhydrocarbure) sachant que ces
bactries sont connues par leur comptence dcomposer une large gamme de matires organiques.
Dix souches sont isoles partir dun milieu slectif ensemenc par des chantillons de sol contamins
par les hydrocarbures de la rgion de Hassi Massaoud ; sur cet ensemble, quatre souches sont purifies
et soumises au test de biodgradation de gasoil. La rsistance et le dveloppement des souches sur cet
hydrocarburant comme seule source de carbone permet de prouver leur pouvoir liminer les
hydrocarbures.

Mots cls : Hydrocarbures, sol, Actinomyctes, Biodgradation, Hassi Massaoud

**************************************
A39
DETECTION DE LA POLLUTION ATMOSPHERIQUE PAR LES
HYDROCARBURES A LAIDE DUN BIOINDICATEUR LICHENIQUE (Xanthoria
parientina) ET QUELQUES VEGETAUX SUPERIEURS COMME
BIOACCUMULATEUR (Casuarina equisetifolia et Phoenix dactylifera) DANS LA
REGION DE HASSI MESSAOUD.

BEBBA Dalal, BEN DEROUICHE Nadjet et KHELIL Rahma

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie
rkhelil2002@yahoo.fr

Les produites ptroliers (huile minrale et gaz) reprsentent une source dnergie pour toutes les
activits, mais constituent une source de pollution importante vu quils engendrent des masses
normes de rsidus de combustion. Notre travail est port sur la dtection de la pollution
atmosphrique par les hydrocarbures laide dun bio indicateur lichnique (Xanthoria parientina) et
quelques vgtaux suprieurs comme bio accumulateurs (Casuarina equistifolia, Phoenix
dactylifra).Lutilisation des bio indicateurs et bio accumulateurs peut fournir des indications trs
intressantes quant la qualit et les caractristiques du milieu naturel. Le choix de la ville de Hassi
Messaoud (Wilaya de Ouargla, sud-est dAlgrie) comme lieu dtude est bas sur le fait que cette
ville est particulirement marque par une urbanisation rapide concentre en plein champ ptrolier et
un ple attractif et constitue une vritable mtropole conomique, grce aux activits dexploration, de
production et de transport des hydrocarbures. Les rsultats obtenu montrent une corrlation
significative entre laccumulation des hydrocarbures et la dure dexposition chez les vgtaux
suprieurs. Par contre, lespce lichenique utilise montre une corrlation non significative pour la
majorit des sites. Nous avons galement not des variations dans certains paramtres biochimiques
pour lespce lichenique et les vgtaux suprieurs tudis savoir le rapport MF/MS et la teneur en
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
82
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
chlorophylle a+b. Les diffrences enregistres dans laccumulation des hydrocarbures entre les
diffrents sites sont lies surtout : lintensit des gaz torchs et la dure dexposition des vgtaux a
la pollution ainsi que les paramtres climatiques.

Mots cl : Pollution atmosphrique, hydrocarbures, lichens, vgtaux suprieurs, bioindicateur,
bioaccumulateur, Hassi Messaoud.

**************************************
A40
EVOLUTION DU CHIMISME DES EAUX SOUTERRAINES DE LA NAPPE
PHREATIQUE DANS LA VALLEE DOUED SOUF

MEGUELLATI Soumia
1


Centre universitaire dEL-Oued, Algrie.
meguellati_soumia@yahoo.fr

Laltration de lenvironnement naturel, notamment le milieu aquifre est devenu progressivement une
proccupation mondiale. En Algrie, la principale source de satisfaction de la demande en eau est
leau souterraine, du fait de son exploitation relativement facile. La croissance dmographique et la
modernisation de lagriculture entranent un grand problme de dtrioration de la qualit de cette
source souterraine, dj en quantit limite. Le mcanisme de pollution des eaux souterraines est un
processus volutif dans lespace et dans le temps, difficilement matrisable. L'analyse de la chimie des
eaux constitue un complment indispensable l'tude hydrogologique des nappes et la gestion des
ressources en eau. Elle permet d'apporter de nombreuses informations sur le milieu aquifre, la nature
de l'encaissant, les zones d'alimentation et de circulation, la potabilit des eaux, etc. En effets, cette
tude constitue une approche mthodologique base sur le traitement qualitatif des rsultats issus des
analyses chimiques des eaux de la nappe phratique; Son objectif est la dtermination des
caractristiques de la qualit chimique des eaux, et la mise en vidence des facteurs rgissant cette
variabilit.

Mots cls : Eau souterraine, Nappe phratique, Valle dOued Souf, Chimie des eaux, Variabilit.

**************************************
A41
ENREGISTREMENT DES CHANGEMENTS PALEO-ENVIRONNEMENTAUX
DANS LES SEDIMENTS DE PALEOLACS. CAS DE LA REGION DE OUARGLA

YOUCEF Fouzia
1
et HAMDI-ASSA Baelhadj
1, 2, 3


1
Laboratoire de biogochimie des milieux dsertiques, Universit de Ouargla, Algrie
2
C.R.S.T.R.A. Biskra, Algrie
3
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides, Universit de Ouargla, Algrie
youcef_yf@yahoo.fr

L'tude des climats passs montre que l'environnement de l'Homme a subi des variations d'une
amplitude considrable. Cependant, ces tudes ne doivent pas tre considres comme des
spculations de savants la recherche de paradis disparus, elles dbouchent en effet sur des
applications concrtes; la prvision des risques hydrologiques, la comprhension des problmes
paloclimatiques plus anciens, la comprhension des fluctuations des palolacsDe ce fait, toute
prdiction des effets de changements climatiques futurs sur les cosystmes doivent tre bass sur une
comprhension des vnements passs. Les Sebkhas tudies (Sebkha de Ouargla et Mellala) sont
situs dans la rgion de Ouargla (Sahara septentrional), caractrise par un climat hyperaride. Les sols
de ces cuvettes contient une gamme trs large des indicateurs palocologiques. L'tude ralise
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
83
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
(morphologique, micromorphologique et analytique) nous a permet de mettre en vidence des
processus pdologiques qui sont des tmoins de variations paloenvironnementales. Les donnes
acquises pour la Sebkha de Ouargla, nous ont permet de mettre en vidence des changements
paloenvironnementaux se manifestant par l'existence d'un palolac qui t probablement synchrone
avec celui de Mellala, l'encrotement calcaire qui traduit des conditions plus humides que l'actuelle, la
couche organique, les microfossiles, les revtements argileux et la prsence du gypse en surface. Pour
la Sebkha Mellala, les formations gypseuses existantes ont t formes dans un milieu lagunaire sous
un climat suppos moins aride pour permettre la mobilisation de ces quantits de gypse. Et l'existence
de conditions plus humides par la prsence de fossiles indiquant des eaux douces a peu sales, et les
couches organiques qui indiquent un passage par un stade marcageux.

Mots cls : Sahara septentrional, Ouargla, paloenvironnement, palolac, micromorphologie.

**************************************
A42
LES PRINCIPALES ESPECES DES SCORPIONS DANS LA REGION DOUARGLA
(SAHARA SEPTENTRIONAL DU NORD-EST ALGERIEN)

Salah Eddine SADINE et Mohamed AzzedineIDDER

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides, Universit de Ouargla, Algrie
sse.scorpion@yahoo.fr

tant situe ltage bioclimatique hyperaride, la rgion dOuargla constitue le refuge propice dune
faune dsertique tant diversifie quabondante mais qui demeure, malheureusement, ce jour peu
tudie. Les scorpions sont les groupes danimaux les moins connus de tous ; bien quils refltent une
image fidle de ltat dquilibre des cosystmes qui les abritent. partir dun chantillonnage
qualitatif balayant la quasi-totalit du territoire dOuargla, nous nous sommes intresss dterminer
la rpartition spatiale du peuplement scorpionique ainsi que sa composition spcifique. Cette approche
nous a permis dtablir un inventaire systmatique runissant six espces appartenant cinq genres
diffrents : Androctonus amoreuxi, Androctunus australis, Buthacus arenicola, Buthus tunetanus,
Orthochirus innesi et Scorpio morus. Nous avons galement fait ressortir trois groupes ayant des
rpartitions gographiques homognes. Par ailleurs, Androctunus australis, Androctonus amoreuxi et
Scorpio morus sont les espces les plus abondantes et qui prsentent une vaste distribution travers
toute rgion parcourue. Alors que Buthus tunetanus fus signale comme trs rare. En outre, dautres
espces prsentent une distribution vaste mais localise des biotopes spcifiques o nous avons
rencontr Orthochirus innesi exclusivement en palmeraies et Buthacus arenicola sur des terrains de
sable jaune. Nonobstant que linventaire que nous avons dress constitue une tude pionnire sur les
scorpions mais il reste loin dtre le plus exhaustif dune part, vu la probabilit dexistence dautres
espces et dautre part ; tant donn que des espces ont des murs nocturnes et/ou discrtes, ayant
chapp par consquent lidentification.

Mots-clefs : Faune dsertique, Inventaire taxonomique, Ouargla, Rpartition gographique, Scorpion.

**************************************









Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
84
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A43
EFFICACITE ANTIBACTERIENNE ET ANTIFONGIQUE DES HUILES
ESSENTIELLES OBTENUES PAR EXTRACTION DE LA MENTHE VERTE
Mentha spicata L.- ISSUE DE LA REGION DE OUARGLA SUR QUELQUES
GERMES PATHOGENES : Escherichia coli, Pseudomonas aeruginosa, Staphylococcus
aureus, Bacillus subtilis et Candida albicans.

IDDER M.A, IDDER-IGHILI H., CHAKOU M. et BASSOU K.

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides, Universit de Ouargla, Algrie.
Azzou.idder@yahoo.fr

Depuis longtemps, lhomme connat et utilise les plantes pour se nourrir et pour traiter
diverses maladies.Les extraits des plantes taient dj connus et utiliss par les gyptiens et
les grecs pour leur proprits aromatisantes et mdicinales. Aujourdhui encore, la science
confirme les diffrentes vertus des plantes aromatiques et de leurs huiles essentielles dont
les domaines dapplication sont trs varis et qui sont trs utilises dans lindustrie
alimentaire comme additifs, et dans les cosmtiques, les parfumeries, les industries de savon
et de dtergents en volume impressionnant. Afin de dterminer limportance des huiles
essentielles de la menthe verte Mentha spicata L. de la rgion de Ouargla, ainsi que leurs
effets sur certaines souches microbiennes pathognes pour lhomme, nous avons ralis une
tude d'efficacits antibactriennes et antifongiques de cette huile obtenue par extraction sur
quelques germes pathognes. Les rsultats obtenus nous ont permis de dgager se qui suit :
Lhydrodistillation de 100 g de matire vgtale donne un rendement de 0,78%.
Les huiles essentielles de la menthe verte inhibent la croissance des
microorganismes tudis avec des degrs diffrents :
o Bacillus subtilis : 25 mm, Staphylococcus aureus : 19 mm, Escherichia coli : 24
mm,
o Pseudomonas aeruginosa : 15 mmet Candida albicans : 26 mm.
La concentration minimale inhibitrice de lhuile essentielle de la menthe verte varie comme
suit :
Bacillus subtilis, Escherichia coli, Staphylococcus aureus : 0,25%.
Candida albicans : 0,125%.
Pseudomonas aeruginosa : 2%.

Mots cls : Menthe verte, huiles essentielles, microorganismes, activit antimicrobienne, Ouargla.

**************************************
A44
L'ECHTYOFAUNE, LE PLANCTON ET LE BENTHOS DE QUELQUE
ECOSYSTEMES AQUATIQUES SAHARIENS

GOUASMIA G.
1
, KARA M.H.
2
, FREHI H.
2


1
Dpartement de Biologie, universit de Ouargla, Algrie.
2
Laboratoire des bioressources marine, universit de Annaba, Algrie.
ghouzala23@yahoo.fr

Ltude est ralise dans quatre lacs ; trois dans la rgion de Ouargla : lac Hassi ben abdallah, lac
Tmacine et lac Lala fatma, et un lOued c'est le lac Ayata. Ces zones dtude appartiennent ltage
bioclimatique saharien hiver tempr. Lchantillonnage est effectu entre 2008 et 2009. La ligne et
l'puisette ont permis la pche de trois espces de poissons. Le tilapia zilli et Gambusia affinis
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
85
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
prsente dans les quatre sites tudier, Mais L'Hemichromis bimaculatus prsente que dans lac
T'macie lac Mgarien et lac Ayata. Le filet plancton de vide de maille de 60 m a permis, la rcolte
de zooplancton qui constitu, par ordre dimportance, de coppodes, de rotifres, dostracodes et de
cladocres. Le phytoplancton rcolt l'aide d'un filet plancton de vide de maille de 20 m .les
Diatomophyce, chlorophyces et les Cyanophyces sont les trois groupes phytoplanctonique
identifi. Un carottier et un tamis d'un millimtre de diamtre nous a permis le prlvement et la
sparation du benthos ; ce dernier est reprsent essentiellement par des gastropodes et des larves
dinsectes.

Mots cls: Lac, poissons, zooplancton, phytoplancton, benthos

**************************************

A55
LE PROBLEME DE GESTION DES EAUX USEES DANS LA CUVETTE DE
OUARGLA : QUELQUES DONNEES RECENTES

IDDER Tahar
1
, LAOUALI Mahamane Sani
2
, IDDER Abdelhak
1

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie.
2
Dpartement de Chimie, Facult des Sciences, Universit de Niamey, Niger
tahar_id@yahoo.fr

Loasis de Ouargla connait depuis plusieurs dcennies, linstar de nombreuses autres oasis
algriennes, un problme de remonte des eaux de la nappe superficielle. A lheure actuelle, les eaux
de drainage provenant des palmeraies et les eaux urbaines non traites sont mlanges et vacues vers
un site proche de lagglomration (la sebkha Oum Raneb). Ce site engendre des prjudices
environnementaux trs importants et favorise l'insalubrit et la dgradation des conditions sanitaires. Il
est aujourdhui devenu, suite laugmentation trs importante des rejets, une vritable menace pour
loasis toute entire. Les pouvoirs publics ont heureusement rcemment entrepris des travaux
damnagement dampleur pour faire face cette menace. Sil est encore trop tt pour mesurer de
manire concrte limpact de ces amnagements sur lamlioration des conditions sanitaires dans
loasis, on se propose, nanmoins, den effectuer une description gnrale qui permettra de cerner le
rle potentiel que les diffrents amnagements mis en place sont appels jouer pour assurer une
meilleure prise en charge de la problmatique de gestion des excdents hydriques dans loasis.

Mots cls : Insalubrit, assainissement, traitement des eaux uses, Ouargla

**************************************
A46
AMENAGEMENTS HYDRO-AGRICOLES A OUED RIGH : SITUATION
ACTUELLE, PROBLEMES POSES ET CONSEQUENCES SUR
LENVIRONNEMENT (SAHARA SEPTENTRIONAL ALGERIEN)

Mohamed Lakhdar SAKER, Mustapha DADDI BOUHOUN,
Mohamed Didi OULD EL HADJ
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides,
Universit de Ouargla, Algrie.
sakermohamedlakhdar@yahoo.fr.

La zone de lOued Righ reste confronte des problmes damnagements hydro-agricoles, qui se
sont traduits par une exploitation immodre et une gestion anarchique de ses ressources naturelles,
qui ne lui ont pas permis daccder un dveloppement correct. Ltude montre que les problmes
damnagements sont multiples, savoir une rpartition inquitable des forages sur les plans
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
86
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
quantitatif et qualitatif, des rseaux de drainage et dassainissement dfaillants, accentus par une
mauvaise vacuation des eaux. Les eaux uses sont mal traites, la station dpuration narrive pas
fonctionner correctement et ne peut pas supporter la charge quotidienne des eaux uses. Ces dernires
rejoignent les eaux de drainage, ce qui favorise la pollution de lenvironnement local. Cette situation
est le corollaire des actions damnagements ralises qui restent le plus souvent inadaptes et peu
efficaces. Tout cela a eu des retombes nfastes sur la dgradation de lenvironnement oasien de
lOued Righ et sur les populations locales. Pour assurer le maintien de cet agro-systme, le prserver
et garantir sa durabilit, de nouvelles mesures damnagement simposent, devant tre compatibles
aux conditions du milieu local de lOued Righ et rpondant ses proccupations majeures.

Mots cls : Amnagements, hydro-agricole, problmes, environnement, Oued Righ.

**************************************
A47
ANALYSE PHYSIOCHIMIQUE DE LEAU DU ROBINET (EN UNIVERSIT
KASDI MERBAH OUARGLA)

Khadra MOKADEM, A. A. BEBBA, Dhrifa ALMI, Abdel Mounaim BENHANIA, Rekia
CHERBI, Mohamed MOKADEM

Laboratoire de Valorisation et Promotion des Ressources Saharienne (VPRS), Universit de Ouargla, Algrie.
Mo2kadem@mail.com

On dit que leau est potable lorsque est caractrise par : (paramtres physico-chimiques,
microbiologiques et dautre ). On observe que leau de Ouargla trs sal, cest pour ca on
choies ltude danalyse physicochimique de leau dans cette rgion pour avoir selle est satisfit les
normes de potabilit. Notre chantillon est prlev appartir le robinet du laboratoire de gnie des
procds duniversit kasdi Merbah Ouargla. Ltude est base sur la concentration des ions, les
rsultats obtenu indique que les concentrations des ions majors (HCO
3
-
, SO
4
-
, Ca
2+
) sont
confirment celles des normes de lOMS et CEE. Tandis que le fluore est dpasse les normes, donc on a
classe cette eau dans la moyenne. Comme projet propose, Il doit tre trait leau du robinet pour
limit la concentration du fluor

Mots cls : Eeau potable, physicochimique, ions, indsirable

**************************************
A48
IMPACT DE LHYDRO-HALOMORPHIE A OUARGLA SUR LA SALINISATION
DES SOLS (SAHARA SEPTENTRIONAL ALGERIEN)

Mustapha DADDI BOUHOUN
1
, Louhichi BRINIS
2
, Mohamed Lakhdar SAKER
1
,
Mohamed Didi OULD EL HADJ
1

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides. Universit de Ouargla, Algrie.
2
Laboratoire de Biologie Vgtale et Environnement. Universit de Annaba, Algrie.

daddibm@yahoo.fr

La cuvette de Ouargla souffre dun problme de remonte des eaux phratiques. Notre recherche
consiste tudier limpact de hydro-halomorphies sur la salinisation des sols. Les rsultats montrent
quil y a des zones de nappes phratiques superficielles, entre 29 et 119 cm de profondeur, et de
nappes profondes, suprieures 1,2 m de profondeur. Le sol contient une crote gypseuse
superficielle, comprise entre 33 et 117 cm de profondeur. Laugmentation de la salinit des eaux
dirrigation, la salinit et le niveau de la nappe phratique, favorisent laugmentation de la salinit des
sols, qui est comprise entre 1,1 et 9,8 dS.m
-1
. La salinisation des sols ascendante et descendante
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
87
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
semble diffrente entre les zones de crotes et sans crotes gypseuses. Le problme de dgradation
hydro-halomorphe est crucial Ouargla et ncessite un bon amnagement hydro-agricole.

Mots cls : Sol, hydro-halomorphie, salinisation, Ouargla.

**************************************
A49
ETUDE D'UN SYSTEME D'EPURATION BIOLOGIQUE DES EAUX USEES EN
ZONE ARIDE

SAGGA Mohamed Mounir
1
, HEMAIDI Abderrezak
2
, DJERIBI Ryad
2
et DEBBA Med Sad
3


1
Universit de Ouargla, Algrie.
2
Universit de Annaba, Algrie.

3
Office National dassainissement (STEP Touggourt), Algrie.
mounirsaggai@yahoo.fr

La prsente tude consiste en partie contrler lefficacit dun systme dpuration des eaux use
dorigine domestique par lutilisation des macrophytes dans un climat aride. Le systme exprimental
est compos de deux bassins, la dure de traitement est de 07 jours. Leffluent travers le bassin
racteur par gravit avec un courant de 4 L/min. Le temps de la rtention dans le dcanteur est de 60
heures. La frquence dirrigation est hebdomadaire. Les paramtres tudis sont: (MES, DBO5, DCO,
CE, pH), lments nutritifs (Azote total Kjeldhal: NTK et phosphore total: TP) et les paramtres
microbiologiques. Les rsultats rvlent un rendement encouragent, la baisse dans la charge
organique, les lments nutritifs et la charge parasite (MES : 95,75 %, DBO5 : 91,15%, DCO :
91,92%, PT : 24,90%, pH 7,5). La qualit de leffluent du systme du bassin racteur est utilise dans
irrigation des quelques arbres fruitiers.

Mots cls : Phyto-puration, macrophytes, eaux uses domestiques, charge organique, lments
nutritifs, climat aride.
**************************************
A50
ETAT DE LENVIRONNEMENT DANS LA REGION DE TOUGGOURT (SUD-EST
ALGERIEN) : LES PRINCIPALES POLLUTIONS ET LEURS IMPACTS

IDDER-IGHILI Hakima et IDDER Mohamed Azzedine

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi- Arides, Universit de Ouargla, Algrie.
idder.ighili@yahoo.fr

Sans doute, le problme de la pollution de lenvironnement est considr comme tant primordial pour
lhomme surtout avec le dveloppement technologique qui ne cesse de progresser. Notre travail
denqute dans la rgion de Touggourt (wilaya de Ouargla) auprs des diffrentes structures
administratives ainsi que sur terrain nous a permis de recenser les contraintes environnementales
suivantes :
Lutilisation irrationnelle de leau souterraine de mauvaise qualit chimique et de temprature
leve cause lentartrage des canalisations provoquant des fuites deau et par consquent des coupures
deau potable.
La dmographie croissante, lurbanisation au dtriment du palmier dattier (couvert vgtal) et
notamment, lindustrialisation provoquent une pollution de lair.
La dsertification, lensablement, la salinisation et les incendies dgradent un sol dj fragilis
par sa texture.
Enfin la mauvaise gestion des dchets solides cause la prolifration des maladies et des
scorpions.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
88
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Les monuments historiques ainsi que les sites archologiques (patrimoine culturel)
nchappent pas cette dgradation.
A partir de ce constat, il est indispensable, voire urgent de remdier la situation par la prise en charge
de ces contraintes afin de prserver cet environnement par un travail de sensibilisation et dducation
de la population, cette prise en charge doit tre mene dans une politique de dveloppement durable

Mots cls : Dsertification, cosystme palmeraie, pollution, protection.

**************************************
A51
DEVERSITE FLORITIQUE DANS LA REGION DE OUARGLA (SAHARA
SEPTENTRIONAL EST ALGERIEN)

BAAMEUR M
1
, OULD EL HADJ M D
1,2
,

1
Laboratoire de Biogochimie en milieux dsertiques, Universit de Ouargla, Algrie
2
Laboratoire Bioressources sahariennes, Protection et Valorisation, Universit de Ouargla, Algrie
baameurmalika@yahoo.fr

La prservation des cosystmes saharienne passe par lamlioration des connaissances et la
conservation de la diversit biologique reprsente dont la flore, particulirement les plantes
spontanes qui ont dvelopps sur des milliers dannes des qualits et des adaptations qui
sharmonisent parfaitement avec les conditions dj extrmes de ces milieux, Ltude de la vgtation
effectue travers la rgion de Ouargla dans 6 stations, fait ressortir une richesse floristique de 56 taxa
appartenant 52 genres regroups dans 28 familles botaniques, et 3 classes. 20 familles ne sont
reprsentes que par un seul genre soit 35,71% de leffectif total. Parmi les familles les mieux
reprsentes se rencontrent les Brassicaceae et les Amaranthaceae avec 7 espces chacune soit 12,5%
de leffectif total des espces, suivis par les Poaceae et les Asteraceae avec 6 espces soit 10,71%. Des
56 espces chantillonnes 32 plantes sont des phmres et 24 des vivaces. Lapplication des indices
cologiques donne la plus grande richesse totale dans les lits doued soit 39 espces, vient ensuite le
Reg avec 19 espces, puis la Sebkha avec 7 espces devant le erg avec 6 espces et la Hamada avec
5 espces. Toutefois la richesse moyenne est de 4,83 espces dans les lits dOueds et 0,83 espce dans
les Hamada. Labondance-dominance de la flore varie pour une mme espce dune station lautre.
Des diffrentes formes biologiques notes, les Champhytes dominent dans les milieux secs et
moyennement humides comme le Reg de Hassi Ben Abdellah et lOued NSa, mais dans les milieux
humides comme lOued MZab, ce sont les Throphytes qui dominent.

Mots clefs : Flore spontane, Ouargla, sol, Sahara, biotope.

Thme 4 - Mise en valeur des terres
A52
ACTION DES BOUES RESIDUAIRES DE LA STATION DEPURATION DES EAUX
USEES DE TOUGGOURT SUR UN SOL SABLEUX CULTIVE

IDDER Abdelhak, IDDER Tahar et MAHMA Sid-Ali

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie.
idder_haki@yahoo.fr

A travers un essai portant sur lapplication des boues rsiduaires de la station dpuration des eaux
uses de Touggourt sur un sol sableux, on constate des effets notables sur ce sol dune part, et sur la
culture mise en place dautre part. Nanmoins, la richesse minrale des boues en lments nutritifs et
satisfaisante pour les plantes lexception du potassium dont lapport supplmentaire reste
recommand en cas de leur utilisation comme engrais aux cultures. Quant aux mtaux lourds, leur
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
89
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
concentration se prsente sous forme de traces ne constituant ainsi aucun danger pour lutilisation
agricole. Il est noter que ces boues ont exerc des effets meilleurs aprs leur application surtout sur
la richesse du sol en matire organique, par consquent en humus, lment auquel sattache la fertilit
et la vie dun sol. Les lments minraux affichent des taux constants dans le sol travers les saisons.
La seule augmentation note est relative llment azote.

Mots cls : Boues rsiduaires, valorisation des boues, traitement des eaux uses, Touggourt.

**************************************
A53
ETUDE DE L'INFLUENCE DES FERTILISANTS ORGANIQUES SUR
LAMELIORATION ET LA CONSERVATION DE FONCTIONNEMENT
MICROBIOLOGIQUE DES SOLS DANS LES REGIONS ARIDES.

Mabrouka OUSTANI
1
, Md . Tahar HALILAT
2
; Slimane HANACHI
3


1
Universit de Ouargla, Algrie.
2
Centre Universitaire de Ghardaa, Algrie
3
S.Hanachi : Chef de dpartement Eau et Sol, C.D.A.R.S., Ouargla, Algrie.
belsam.oustani@yahoo.fr

Cette tude a t conduite sur des sols caractres contrasts et reprsentatifs de la rgion saharienne.
Elle consiste tudier l'influence de l'apport des substrats organiques (fumier de volailles et fumier de
bovins) sur lamlioration du fonctionnement microbiologique des sols sableux non sals et sableux
sals notamment les processus de la minralisation de lazote et du carbone. Ainsi l'issue de 56 jours
d'incubation sous des conditions d'humidit et de temprature contrles (28C et 80 % de CR), les
deux types de fumiers ont montr une activit minralisatrice qui varie en fonction du type de sol et du
substrat organique lui-mme. L'analyse des rsultats globaux obtenus a permis de mettre en vidence
un effet favorable et significatif des matires organiques (fumier de volailles et de bovins) sur l'activit
microbiologique des deux sols. Cet effet est plus marqu dans le cas du sol sableux non sal. En ce
qui concerne l'importance de la minralisation du carbone et de l'azote, le meilleur effet a t observ
par les traitements du sol avec fumier de volailles (C/N faible), et ce en raison de sa richesse relative
en azote et en lments facilement dcomposables. Quand au fumier de bovins, sa teneur plus ou
moins riche en lignine et en cellulose (C/N relativement lev) lui offre un potentiel de minralisation
relativement moins important. Les tests respirometriques in vitro ont montr que les quantits de CO
2

dgages cumulatives sont respectivement pour le sol sableux non sal et sableux sal:1173.4 et 917.2
mg/100 g de sol, sous l'effet du fumier de volailles, et 541.44 et 497 mg/100 g de sol, sous l'effet du
fumier de bovins, contre 96.12 et 74 .08 mg /100 g de sol pour les sols non enrichis (tmoins). Le taux
de rduction de l'activit respiratoire en conditions salines est de 21 % par rapport aux conditions non
salines. Concernant la minralisation de l'azote, nous avons not aprs 56 jours d'incubation, une
production de l'azote minral (NH
4
+
+NO
3
-
) de 12.66 et 7.85 mg/100g de sol respectivement pour le
sableux non sal et sableux sal sous l'effet de fumier de volailles et de 4.34 et 3.08 mg/ 100 g de sol
sous l'effet du fumier de bovins. Ces valeurs sont nettement suprieures celles enregistres pour les
sols tmoins (1.72 et 1.4 mg / 100 g de sol). Ceci rvle l'effet favorable d'un apport organique au sol
sableux et surtout au sol sableux sal o le processus de la nitrification est rduit. Le taux de rduction
de la nitrification sous l'effet de la salinit est de 36.78 %. Concernant l'influence des substrats
organiques sur la densit microbienne, nous avons observ un effet stimulant des groupes fonctionnels
tudis (Cellulolytiques, Nitriques, Ammonifiants) ainsi que celui de la microflore totale et fongique.
L'ensemble des rsultats obtenus montrent l'intrt de l'utilisation des deux types de fumiers pour
l'amlioration du fonctionnement microbiologique des sols sahariens,qui connaissent d'normes
problmes de mise en valeur et o les processus physiques de l'volution de la matire organique,
l'emportent sur les processus biologiques.

Mots cls: Salinit, Matire organique, Sable, Microorganismes, Minralisation, Azote, Carbone.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
90
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
A54
LA CARACTERISATION DES ETATS DE SURFACE DES SOLS ALLUVIAUX
DANS LE SAHARA SEPTENTRIONAL

HELIMI Samia

Universit de Ouargla, Algrie.
helimisamia@yahoo.fr

Les rgions sahariennes sont souvent peu accessibles, aussi leur cartographie est-elle difficile en plus.
Les nombreuse tudes pdologiques localises ne permettent pas aux organismes charges du
dveloppement des ces rgions dapprendre de faon rationnelle et globale les grandes espaces dont ils
ont le charg. Pour cette raison daprs, la prsence dorganisations particulires la surface des sols
est une caractristique des rgions arides qui a attir lattention des diffrents spcialistes de ces
milieux. La surface de sol est constitue linterface au niveau de la quelle sexerce la rception des flux
thermiques et hydriques et par voie de consquence des flux biologiques. Cest aussi le lieu qui rgit la
sparation des eaux, entre infiltration et ruissellement, do son importance en matire drosion.
Donc lexploitation de ces donnes au dveloppement de nouvelles mthodes plus rapide et moins
onreuses permet de diminu les charges financiers et dacclre le rythme des recherches
pdologiques dans ces rgions qui peuvent rpondre lurgence des prises de dcision ncessaires.
Les sols alluviaux des rgions arides sont des sols de lits doued et des zones dpandage, et les
apports trs limits, dans le temps, par la raret des pluies dintensit suffisant, dans lespace et en
quantit, les coulement nintressant souvent que quelques tronons de bassin ou de fondes Dayas.
On essaye dtudier laide que peut apporter la tldtection la cartographie pdologique des sols
alluviaux dans ces rgions a partir aux tats de surface du sol en tant quoutil qui permettant
dinterpoler et de spatialiser les donnes discontinues recueillies sur le terrain par les pdologues. La
mthode dtude des tats de surface du sol par tldtection consiste en un traitement de limage
satellital par lanalyse visuelle suivi du traitement numriques qui permet de faire un classement des
tats de surface du sol sur limage en se fondant sur (i) linterprtation des rflectances apparentes des
groupes. (ii) la superficie correspondante a chaque groupe. (iii) Dfinition de chaque groupe en se
basant sur les donnes pdologiques du terrain. La validation des rsultats de classification numrique
des images sur terrain consiste en lobservation et la caractrisation de la surface des sols sur le terrain
et tude morphologique des solums et classification des sols.

Mots cls : Sols alluviaux, tats des sols, tldtection, zones arides.

**************************************
A55
FONCTIONNEMENT MICROBIOLOGIQUE DES SOLS OASIENS : CAS DUN SOL
SABLEUX SALE ET DUN SOL ARGILEUX NON SALE

M. KARABI, B. HAMDI AISSA
1
et A. DELLAL
2


1
Laboratoire de Biogochimie des Milieux Dsertiques, Universit deOuargla, Algrie.
2
Universit Ibn-Khaldoun, Tiaret, Algrie.
mokhtarmsk@hotmail.com

La dgradation des sols est un problme majeur dans les rgions arides soumises des processus de
dgradation trs pousses, conduisant souvent une dsertification qui se caractrise, sur le plan
pdologique par une baisse notable de la fertilit des sols sur multiples plans : physique, chimique et
biologique (structure dgrade, texture grossire, teneur faible en matire organique, concentration
leve en sels). En effet, la qualit biologique des sols en milieu saharien est influence grandement
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
91
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
par des facteurs pdoclimatiques et agronomiques, ainsi que de leur interaction. Si de nombreux
travaux sur les caractristiques physico-chimiques des sols des rgions arides existent, trs peu
dtudes ont t menes sur laspect biologique des sols sahariens, sur la base danalyse des
populations microbiennes et de leurs activits, plus particulirement dans le contexte oasien. Compte
tenu de ces considrations et afin dtudier le fonctionnement microbiologique et biochimique des
sols sahariens, on sest intress ltude de deux exemples de sols largement rpondus dans le Sahara
et qui appartiennent deux contextes pdoclimatiques diffrents, il sagit dun sol sal sableux de la
palmeraie de luniversit de Ouargla, et dun sol non sal argileux de la palmeraie de Guerara. Ltude
de la microflore des deux sols fait apparaitre une prdominance des bactries et des algues dans le sol
alluvionnaire par rapport au sol sal, ce dernier prsente une microflore fongique lgrement plus
importante numriquement par rapport lautre sol. Quant aux groupes fonctionnels, les nitrificateurs
se trouvent inhibs dans le cas du sol sal. Nos rsultats montrent que la salinit apparat lun des
facteurs essentiels agissants sur la densit des microorganismes dans le sol. Cependant, la salinit ne
doit pas tre considre part puisque plusieurs facteurs interviennent en mme temps, savoir la
texture, lalcalinitLe nombre des microorganismes dans un sol sal, dpend aussi des espces qui le
composent et de leur facult dadaptation aux sels.

Mots cls: Microorganismes, sol sal, sol alluvionnaire, matire organique, oasis.

**************************************
A56
CARACTERISATION DES SOLS ET DE LA NAPPE ALLUVIALE DE L'OASIS DE
GUERRARA

M. KHEMGANI
1, 2
, B. HAMDI AISSA
1, 2
, S. HADJ SAD
1


1
Laboratoire de Biogochimie des Milieux Dsertiques, Universit de Ouargla, Algrie.
2
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-arides, Universit de Ouargla, Algrie.
malek.khemgani@yahoo.com

Loasis de Guerrara est plante dans les alluvions de lOued Zegrir dont les crues occasionnelles
permettent lapport et la formation de sols alluviaux. Ces sols enrichis en permanence en lments
minraux sont accompagns dune nappe dinfroflux ou (alluviale) ce qui a permis linstallation et
lexistence dun agrosystme oasien particulier. Les objectifs viss travers ce prsent travail sont ; la
caractrisation des sols ainsi que la caractrisation hydrochimique et pizomtrique de la nappe
alluviale de loasis de Guerrara. Pour ce, cinq profils ont t raliss lintrieur de la palmeraie, et 72
pizomtres (puits) ont t tudis et chantillonns en deux compagnes (42 et 30). Les rsultats des
analyses physico-chimiques des sols nous ont permis de classer nos sols comme tant des fluvisols de
type takyrique, avec une texture fine ; sablo-limoneuse limono-sableuse, prsence dargile en
quantits suffisantes, non salins et pH alcalin, riches en calcaire total, faibles teneurs en matire
organique, des CEC moyennes et prsentant un facis chimique calci-magnsien et
chloruri.bicarbonat. En gnral, leau de la nappe alluviale est non saline pH lgrement alcalin et
avec un facis chimique calci-bicarbonat. Les leves pizomtriques nous ont permis de tracer la
carte pizomtrique de la nappe en deux compagnes (Dcembre 2008 et Mars 2009). Par la suite nous
avons pu dterminer le sens dcoulement de cette nappe, qui suit dune manire gnrale le sens de
circulation de lOued Zegrir lintrieur de la palmeraie.

Mots cls: Sols alluviaux, nappe alluviale, pizomtrie, agrosystme oasien.

**************************************




Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
92
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A57
ESTIMATION DE LA RETENTION EN EAU DES SOLS DALGERIE PAR LES
FONCTIONS DE PEDOTRANSFERT

DILMI A. et DRIDI B.

Institut National des Sols de lIrrigation et du Drainage, Alger, Algrie.
Ecole Nationale Suprieure Agronomique, Alger, Algrie.
amal.dilmi@yahoo.fr

Lobjectif principal de ce travail consiste rechercher un modle prdictif de rtention en eau des sols
diffrents potentiels par la mise en corrlation des caractristiques des sols et de leurs proprits
hydriques. Les principaux rsultats ont rvl que les sols selon quils soient remanis ou non
remanis, prsentent des teneurs en eau diffrentes particulirement aux hauts potentiels. Le
remaniement des sols modifie les rsultats de faon importante et mne ainsi une surestimation des
teneurs en eau des sols diffrents potentiels. Lanalyse par rgressions multiples pour ltablissement
des fonctions de pdotransfert (FPT) neuf valeurs de potentiel, montre que la qualit de la prdiction
de la rtention en eau diffrents potentiels est amliore avec lintroduction successive des
caractristiques du sol dans les quations de rgressions. La stratification texturale amliore la qualit
des prdictions. Les caractristiques du sol ont des effets variables sur la teneur en eau selon le niveau
du potentiel de leau. Largile et la matire organique constituent les facteurs les plus importants de la
rtention en eau alors que la densit apparente amliore la qualit de la prdiction. Cependant,
lintroduction de la CEC dans les quations de rgressions namliore pas lestimation de la rtention
en eau des sols. De ce travail, il ressort que la prdiction des principales caractristiques hydriques des
sols dAlgrie peut tre ralise grce des relations statistiques partir de leur composition
granulomtrique (argile, limon et sable), du taux de matire organique et de la densit apparente,
vitant ainsi le recours aux mesures lourdes et coteuses.

Mots cl : Sol, eau, fonctions de pdotransfert, texture, rtention en eau, potentiel.

**************************************
A58
EAUX DIRRIGATION ET SALINITE DES SOLS EN ZONES ARIDE
(PERIMETRE DEL OUTAYA BISKRA)

MEKAOUSSI Hayet

Dpartement dagronomie, Universit de Batna, Algrie.
mekayet@yahoo.fr

Lagriculture ainsi quune grande partie de la vie sur notre plante dpendent du sol, une ressource
naturelle non renouvelable. De nombreux rgions climat aride ncessitent chaque anne dimportants
volumes deau dirrigation afin dobtenir des rcoltes rentables. Certains sols de ces rgions sont affects
par la salinit, entranant des problmes pour la production agricole et pour la qualit des eaux de surface
et des eaux souterraines. La teneur en sels est lune des rares caractristiques des sols qui puisse changer
en augmentation ou diminution, en lespace de quelques annes. Laugmentation de la salinit
pdologique fait diminuer les rcoltes et rduit la gamme de cultures viables. Une modalit de la
dtrioration par salinit est la sodicit, et celle-ci peut dgrader la structure pdologique du sol, le rendant
ainsi improductif. Nombreux sont les changements de la salinit pdologique dus des facteurs
anthropiques, comme la gestion des sols, les cultures mises en place, les doses et le calendrier dirrigation,
la conception et la maintenance des rseaux de drainage, la composition des eaux dirrigation et leur mode
dapplication. Lirrigation avec des eaux salines et la mise en valeur des terres est malgr tout possible
en adoptant des techniques adquates pour de telles situations : une bonne gestion de leau dirrigation,
le lessivage et le drainage des sels dans la zone racinaire des plantes, des techniques culturales
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
93
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
adaptes, le choix despces ou de varits tolrantes au sel devraient permettre une production
satisfaisante pour lagriculteur.

Mots cls : Salinit, eau, irrigation, zone aride, sol.

**************************************
A59
IMPACT DE LA PLANTATION DATRIPLEX CANESCENS SUR LA FIXATION
BIOLOGIQUE DU CORDON DUNAIRE DANS LA WILAYA DE DJELFA.

MAAMAR KOUADRI Kaddour
1
, TAZAIRT Kamel
2
et

MEKCHOUCHE Bachir
3

1
INRF/ BARAKI, Alger, Algrie.
2
Laboratoire dcologie, USTHB, Alger, Algrie.
3
Conservation des forts de Ain-Defla, Algrie.
maamar_kader@yahoo.fr

La monographie de la steppe algrienne a t tous le temps menace par lrosion olienne vu la
prsence des accumulations sableuses, la susceptibilit de la nature de substrat, la vulnrabilit de la
vgtation steppique, les conditions climatiques dfavorables et les facteurs anthropozoques.
LAtriplex canescens est parmi les espces exotiques introduites dans la steppe algrienne. Elle a t
choisie pour sa rapidit de croissance, par sa rsistance aux alas climatiques et sa valeur fourragre
trs leve. Nous avons adopt une mthode permettant dtudier lvaluation qualitative et
quantitative de la vgtation base de plantation Atriplex canescens dans le cordon dunaire (w.Djelfa).
Des rsultats ont montr que le taux de russite des plantations est sous dpendance totale de
lpaisseur de la couche meuble, les meilleurs taux de russite sont atteints de 91% sur milieu ensabl,
75% sur milieu sal et 62% sur milieu encrot ensabl. Quand la prsence de la fixation mcanique
du sable avec la nappe phratique proche de la surface sont galement une grande influence sur la
russite des plantations qui saccompagnent par un processus de succession dautres espces
autochtones diversifies. Ainsi la dure de mise en dfens, celle-ci contribue fortement
laugmentation de la richesse floristique. Le recouvrement global des annuelles et celui des prennes
se varie de 30 % sur Barkane 80 % sur nappe de sable. Par ailleurs, on a enregistre que la richesse
floristique peut se varie de 31espces sur voile sableux, 20 espces sur nappe ensabl et autour de 6
espces sur les bordures du chott. Enfin, grce ce projet de plantation, nous avons des rsultats
spectaculaires dans la stabilit structurale du sable avec un recouvrement atteint 80 %. De ce fait, la
plantation dAtriplex canescens a cre une couverture vgtale permanente et contribu au processus
de remonte biologique d lombrage produit par ses touffes et la matire organique fournie au sol,
sa ramification de son systme racinaire accrot considrablement la permabilit des sols et
laugmentation du drainage dans les horizons superficiels, permettant ainsi la reconstitution dun tapis
herbac capable de stopper le dplacement du sable malgr la violence de la vitesse du vent olien
dans cette rgion donc on peut class lAtriplex canescens parmi les espces pionnires par excellence.

Mots cls : Steppe, cordon dunaire, rosion olienne, Atriplex canescens, fixation, recouvrement.

**************************************









Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
94
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A60
SIG ET CARTOGRAPHIE DES SOLS DANS LES MILIEUX ARIDES

DEKHINAT Said

Laboratoire LAPAPEZA , Universit de Batna, Algrie.
dekdz@yahoo.fr

Les systmes dinformation gographique (SIG) sont entrain de simposer comme outils de gestion et
de diagnostique par excellence dans le monde . En effet, grce la puissance de calcul des
algorithmes, les logiciels spcialiss dans le traitement des bases de donnes peuvent traiter une
multitude de variables dans des temps trs rduits pour analyser, cartographier, prdire des
vnements comme la climatologie, la salinit dans le sol, les crues, les rendements agricoles, etc. Des
tudes sur des sols dans les milieux arides, avec ces systmes, nous ont permis dtablir une
cartographie numrique de plusieurs phnomnes tels que la salinit, le gypse, le calcaire, la CEC,
etc., Ces cartes qui sont obtenues avec lextension Spatial Analyst de ArcGIS 9.3 peuvent, si elles sont
bien fusionnes, devenir un outil daide la dcision pour les agriculteurs. Leur avantage rsidera
alors dans une meilleure gestion des sols surtout au niveau du cot et de la prservation de
lenvironnement.

Mots cls : Cartographie, SIG, aide la dcision, agriculture.

**************************************
A61
EFFET DE LA CONTRAINTE SALINE SUR LA GERMINATION ET LA
CROISSANCE DE LA FEVEROLE Vicia faba L. minor

CHAKER-HADDADJ
1
A., OUNANE S.M.
2
, MECHERI Z. et MESBAH C.

1
Dpartement de biologie, facult des sciences, Universit MHamed Bougara, Boumerds, Algrie.
2
Dpartement de phytotechnie, Institut National Agronomique, Alger, Algrie.
assiachaker@yahoo.fr

Lobjectif de cette tude est de comparer leffet de diffrentes concentrations de NaCl (0, 25, 50 et
75mM) sur la germination, la croissance et la nodulation chez la fverole (Vicia faba L.minor.cv. Sidi
Aich). La germination est suivie par les taux quotidiens et les taux cumuls des graines germes
pendant une priode de 8 jours. Dans le milieu tmoin (0 mM NaCl), le pourcentage de germination
atteint son maximumau bout du quatrime jour. Durant la mme priode et en prsence de 25 mM, les
taux de germination commencent diminuer pour atteindre (63%) avec le traitement de 75 mM NaCl.
Leffet de la salinit se fait sentir soit au dbut de limbibition des graines soit au 10me jour de
dveloppement, et affecte les diffrents paramtres de croissance, ds que la concentration excde
25mM NaCl. Cependant ces effets sexpriment davantage chez les plantes soumises prcocement
cette contrainte. Leffet dpressif du sel concerne plus les organes ariens que les racines, se traduisant
par une augmentation du rapport partie racinaire/partie arienne de la matire sche. Il entraine aussi
une rduction de la nodulation 25 et 50 mM NaCl, et une inhibition totale 75 mM NaCl. Les
teneurs en proline accumules dans les feuilles des plantes stresses sont trs variables. La plus
grande concentration est enregistre en prsence de 25mM de NaCl et chute brutalement partir de
50mM de NaCl.

Mots cls : Vicia faba L.minor ; Stress salin; Germination; Matire sche; Proline.

**************************************


Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
95
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A62
INFLUENCE DUNE CONTRAINTE HYDRIQUE SUR LE DEVELOPPEMENT
DE 2 CULTIVARS DE HARICOT DOLIQUE (Vigna unguiculata (L) Walp.)

AID-HOUCHI A., MEDJBEUR D., AMRI A. et LEKMACHE M.

Laboratoire de Physiologie Vgtale, Universit de Tizi Ouzou, Algrie
houchiaini@yahoo.fr

Linfluence de la contrainte hydrique a t suivie sur 2 cultivars de haricot dolique
(Vigna unguiculata (L.) Walp.) qui sont le haricot hile noir et tadelaght noire dAoulef dorigine
bioclimatique diffrente et ce, durant les principaux stades du cycle vgtatif. Les rsultats obtenus
indiquent que le dficit en eau impos aux plantes engendre un raccourcissement du cycle
phnologique. Il en ressort galement une rduction du nombre dorganes fructifres forms
particulirement les boutons floraux et les gousses dont la taille est infrieure 1 cm(40 % et 38 %
pour les premiers et 39 % et 35 % pour les secondes et ce, respectivement pour le haricot hile noir et
tadelaght). Le rendement et ses composantes sont galement affects ainsi que la matire sche et la
teneur en azote total. La phase la plus sensible la restriction hydrique est celle de la floraison-
fructification compte tenu des tempratures leves cette priode qui augmentent leffet de la
scheresse sur les processus de floraison et de fcondation. Le rendement est plus rduit chez le
haricot cultiv au nord de lAlgrie par rapport celui des zones sahariennes. Les donnes montrent
que les organes ariens, plus sensibles au dficit hydrique, contiennent moins dazote total par rapport
aux racines. Celles-ci accumulent plus de glucides solubles que les tiges et les feuilles ce qui
impliquerait limportance du rle quelles jouent dans lajustement osmotique. Les observations
releves travers cette exprimentation montrent que le cultivar tadelaght est plus tolrant ce
phnomne de scheresse que le haricot hile noir ce qui pourrait sexpliquer par la diffrence de
provenance et/ou certains mcanismes dvitement inhrent au cultivar tadelaght lui procurant une
aptitude limiter lintensit transpiratoire afin de maintenir dans la plante un bilan hydrique favorable
au droulement des processus physiologiques et mtaboliques en conditions de scheresse.

Mots clefs : Vigna unguiculata (L.) Walp., phnologie, rendement, contrainte hydrique, mtabolisme
azot, mtabolisme carbon

**************************************
A63
VALORISATION DE LA CARTE PEDOLOGIQUE DUNE ZONE SEMI-ARIDE :
LA PLAINE DE TLEGHMA (W.MILA)

F. MEDJRAB
1
et R. BENSAID
2

1
Dpartement dagronomie, Universit de Batna, Algrie.
2
Dpartement dagronomie, Universit de Skikda, Algrie.
farouk711@yahoo.fr

Lobjectif de cette tude est danalyser, critiquer, valuer et prciser le degr de la fiabilit dune carte
pdologique ralise dans le cadre de ltude de lamnagement hydro agricole de la plaine de
Tleghma. Cette carte est un produit dune dmarche cartographique adopte sur le terrain base sur
une prospection systmatique qui a permis de dcrire 36 profils pdologiques et dchantillonner 23
profils (plus de 60% des chantillons sont analyss). Les sols de la zone dtude sont rpartis dans
quatre (04) classes de sols : ce sont les sols minraux bruts, les sols peu volus, les sols
calcimagnsiques et les vertisols. Dans un premier temps les donnes de la carte pdologique de la
plaine de Tleghma font lobjet dune tude de vrification travers une tude analytique et critique en
utilisant les statistiques classiques. Daprs ltude, il ressort que pour lensemble des chantillons il
nexiste pas des corrlations hautement significatives sauf pour la matire organique et le calcaire
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
96
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
total. Contrairement ce qui tait dj dmontr par nombreux auteurs, la corrlation entre les deux
paramtres (argile, CEC) est faiblement significative. Ltude thmatique en utilisant un SIG a porte
sur deux volets : une tude dun facteur extrinsque du sol qui est la gologie et une tude des facteurs
intrinsques les plus utiliss en classification des sols (CPCS 1967). Ces facteurs sont la texture, la
couleur, lintensit de leffervescence lHCl et de la profondeur. Dune manire gnrale nous avons
constat que les modifications portes la carte pdologique lors de ltude de la carte des UCM sont
localiss primordialement dans les groupes des sols peu volus, dont il ressort que la nature des
units cartographiques des matriaux constitue un lment dterminant dans la classification. Le
croisement des cartes thmatiques, a donn une ide globale sur le degr defficience de la texture, de
la couleur, de lintensit de leffervescence lHCl et de la profondeur de chaque horizon dans la
classification du sol. En effet, il ressort que la texture du deuxime horizon est le facteur le plus
efficient.

Mots cls : Carte pdologique, Plaine de Tleghma, Sol peu volu, Gologie, SIG.

**************************************
A64
MISE EN VALEUR DES SOLS A OLIVIER DANS LA REGION DE TLEMCEN-
ALGERIE: UNE COUVERTURE VEGETALE POUR AMELIORER LA FERTILITE
DES SOLS

Mostafia BOUGHALEM
1
, Mohamed MAZOUR
1
et Baghdad MAACHOU
2

1
Universit Abou Bekr Belkaid, Tlemcen, Algrie.
2
Chercheur en lgislation et rglementation rurale, Tlemcen, Algrie.
boughalem_2000@yahoo.fr

Lexploitation irrationnelle des sols de la rgion de Tlemcen par lhomme, fragiliss par les
contraintes climatiques, favorise localement la dgradation souvent irrversible des oliveraies. Sous le
climat semi-aride de l'ouest algrien, o la pluviomtrie est caractrise par son irrgularit et sa
mauvaise rpartition, lentretien du sol grce aux modes de gestion des terres favorisant la
conservation de l'eau, est primordiale pour la bonne croissance et la fructification de lolivier. Par
ailleurs, le systme de culture est le facteur important o lhomme peut intervenir pour modifier la
sensibilit des sols lagressivit des pluies. Contrairement aux oliveraies traditionnelles, o le sol est
nu entre les arbres, une mthode particulirement efficace consiste faire pousser des plantes basses
entre les oliviers pour retenir le sol et le protger de lrosion. Dans ce cadre, lanalyse des rsultats
de mesures du ruissellement et de lrosion en nappe, obtenus en parcelles exprimentales de type
Wischmeier durant la priode 1991-2005 nous a permis dvaluer limpact de certains systmes de
cultures intercalaires dans les oliveraies de Tlemcen, sur les pertes en eau et en terre. Les rsultats
montrent que les quantits de sdiments rods varient selon le mode de gestion du couvert vgtal.
Elles plafonnent sur sol nu (5,90 t/ha/an) ; assez leves sur parcelles traditionnelles (0,10 3,95
t/ha/an) et rduites sur parcelles amliores (0,10 2,50 t/ha/an). Les teneures en carbone organique
du sol (C) sont faibles. Elles varient de 0,63 3,33% : 0 10 cmde profondeur et de 0,6 1% : 030
cmde profondeur. Les stocks en carbone organique durant les annes de mesures dans les 10 premiers
cmdu sol ont diminu de 10 25% pour les sols nus, de 8% sur les systmes traditionnels. Par contre
sur les systmes amliors les stocks ont augment de 5 28%.
Il parait clairement que cesont les sols nus inter-arbre qui contribuent la dgradation majeure de la
fertilit des sols.

Mots cls: Olivier, rosion, systmes de cultures, Carbone organique, Fertilit.

**************************************


Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
97
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A65
BIODISPONIBILITE DU PHOSPHORE DANS LA RHIZOSPHERE DE LOLIVIER
SOUS CLIMAT ARIDE : CAS DE TROIS OLIVERAIES A AIN-OUASSARA

M. BOUDIAF-NAIT KACI, S. MOUAS-BOURBIA et A. DERRIDJ

Dpartement des Sciences Agronomiques UMM, Tizi-Ouzou, Algrie.
malikanboud@yahoo.fr

Lobjectif de cette tude est de suivre au champ linfluence des racines de lolivier sur certaines
proprits physiques, chimiques et la biodisponibilit du phosphore sous climat aride. Pour cela nous
avons chantillonn au sein de trois oliveraies dge diffrent dans la rgion d'Ain-Ouassara. Les trois
fractions de sols prleves correspondent au sol global, indemne de toute activit racinaire ; le sol
rhizosphrique, agrgats de diamtre infrieur 2 cm accols aux racines fines actives de diamtre
infrieur 5 mm et le rhizoplan qui est la fraction de terre fine accole la racine. Le pH des trois
fractions de sol est proche, ce qui sexplique par le fort pouvoir tampon exerc par les carbonates de
calcium. Le carbone organique, la C.E.C. augmentent significativement dans la rhizosphre. En
revanche les teneurs en calcaire et la salinit diminuent lgrement proximit de la racine.
Lvaluation des formes de phosphore, le phosphore soluble leau, le phosphore assimilable Olsen et
le phosphore total associe la mthode dchantillonnage permet de mettre en vidence le gradient
essentiel dloignement par rapport aux racines. La rhizosphre est pauvre en phosphore soluble et
phosphore assimilable Olsen en raison du prlvement de ces formes biodisponibles par les racines.
Par contre le phosphore total prsente un accroissement au niveau de la rhizosphre.

Mots cls : Rhizosphre, phosphore, olivier, semi - aride.

**************************************
A66
HOLISTIC APPROACH FOR SUSTAINABLE DEVELOPMENT IN SEMI ARID
REGIONS, CASE STUDY, ALKIMMA WATERSHED YEMEN

GAHANEM O.
1
KADDOR J.
2
JAZEM A.
3

1
National school for Agricultural Since, Algeria.
2
Pedology deportment, National school for Agricultural Scince, Algeria.
3
Engineering and dames, Dhamar university, Yemen.
Ogazem@yahoo.com

The agricultural Terraces in Yemen were thousands years ago the base of economic and social
inhabitance in mountain highlands which express about 60% of the area of Yemen. Recently the
people began to leave this regions because of the degradation of the terraces in this research we
studded the reasons of terraces degradation I and we will focus on water erosion. In Addition to study
other reasons of terraces degradation either natural or by human activities That will through the study
of AlKImma watershed Hajjah Governorate as representative of northern highlands. The general
objective of this research is to assist the land recourse status in agricultural terraces in the studied
watershed and assign the ways of its sustainable development. Its locates in Alkimma watershed
Kuhlan Affar in western north of the capital Sana'a the area of this watershed. 1200 Hectares. The
watershed distinguished intensive agricultural activity. The agricultural terraces spread in the all area
of the watershed. The study area located between 1600 and 2700 above se surface. I have chosen this
location because in include the problemthat we studied in the research. We have done approach for
field work in to parts. The First is study of erodibility of soil by take irregular simples in all kinds of
agricultural terraces; witch was divided into three categories: Good terraces slightly degraded and
heavily degraded. In each simple we examined the soil in field and we take simple fromthe surface
and sub surface class to analyze the physical and chemical properties in the laboratory. in addition to
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
98
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
describe the status of Erosion and to register the length, width and depth of terrace. And describe
the status of vegetation around the simple. The second part is we called out social and economic
questionnaire for the farmers to know the agricultural activities and another reasons for terraces
Degradation. In this Research we have used air photos (Scale 1:30000) and topographic Maps
(1:100.000 and 1:50.000) In addition to GPS and digital camera and the special tools to take soil
simples. The initial results witch we had obtained fromthe analyses of the questionnaire Clearfield
that there are some other reasons of terraces degradation such as the low fertility, the law income and
low production, roads and migration. Also we have made some maps for analyze, soil degradation and
physiographic maps and we analyze the simples to know the soil readability. According to those
results we will make scientific recommendations to make strategy for sustainable development we can
generalize on the similar regions in the country.

Key ward: Terrces, erosion, dsegradation, watershed, sustainablty.

**************************************
A67
IDENTIFICATION DES PRINCIPAUX GROUPEMENTS DE SOLS GYPSEUX
POUVANT TRE OBSERVES EN ALGERIE
APPROCHE MULTIDIMENSIONNELLE

OUAMER-ALI K.
1
, HAMDI-AISSA B.
2
, DJILI K.
3

1
Institut national des sols de lirrigation et du drainage INSID/DMV/MADR, Alger, Algrie.
2
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi-Arides, Universit de Ouargla, Algrie.
3
Dpt. de Science du Sol, Ecole National Suprieure dAgronomie, Alger, Algrie.
oa_karim@yahoo.fr

Lobjectif principal de ce travail est dtudier les sols gypseux dAlgrie. Il sagit de mettre en
vidence, sur les plans morphologique, analytique et fonctionnel, les principaux groupements de sols
gypseux pouvant tre observs en Algrie et de tenter de dterminer des profils de rfrence.
Lapproche mthodologique choisie a port sur llaboration dune banque de donnes informatise, la
dlimitation et la prsentation des milieux caractristiques des tudes et des profils, et enfin la
ralisation dune analyse multidimensionnelle (ACP) dont le traitement appliqu repose sur une
association des paramtres descriptifs et analytiques. Lanalyse multidimensionnelle (ACP) nous a
permis de mettre en vidence 6 groupements de sols gypse bien distincts. Laffinement des rsultats
de lACP et lexploitation du rle de chaque axe nous a aid tablir une cl de prdiction et
didentification des profils rfrences des sols gypse.

Mots cls : Gypse, sols gypseux, Algrie, Banque de donnes, analyse multidimensionnelle.

**************************************
A68
LA GESTION PAYSANNE DES RESSOURCES EN EAU DANS LES PALMERAIES
TRADITIONNELLES PRIURBAINES DE BISKRA MATRISER LEAU POUR
MIEUX GRER LENSEMBLE DE LESPACE AGRICOLE OASIEN

FOUFOU Ammar

La prennit de lagriculture traditionnelle Biskra et dans les autres rgions oasiennes ne peut pas se
concrtiser sans ressources hydriques abondantes et matrises. Celles-ci exigent des modalits de
gestion rigoureuses et adaptes aux conditions du milieu physique, lespace parcellaire et aux
besoins des cultures. Partant du fait que labsence dune gestion raisonne et rationnelle de leau
mettrait en pril tout un systme de production qui a prouv le mrite dexister depuis des sicles,
depuis trois dcennies, le rseau dirrigation dans les vieilles palmeraies priurbaines de Biskra a subi
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
99
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
des transformations rapides, qui se sont concrtises par lintroduction des pompes lectriques de haut
dbit, la cration des forages profonds et la construction de nouveau barrage. En consquence, les
motopompes et les sources balancier ont disparu jamais, mais de nouvelles formes de mise en
valeur capitalistes sont apparues, alors que leau est toujours insuffisante la parcelle. Cette
mobilisation massive de leau souterraine et superficielle a provoqu des menaces sur les rserves
hydrauliques fossiles et lquilibre cologique du systme oasien. Vu la richesse hydraulique de la
rgion des Ziban, le problme se situe dans le rseau dirrigation lui-mme (conduites, rpartiteurs.)
et les mthodes de gestion adoptes la parcelle, qui ont du mal sadapter au rapport
disponibilits/besoins pour minimiser les pertes en amont afin davoir une eau suffisante en aval. Par
ailleurs, les sources en eau collectives ont montr des capacits dadaptation tonnantes depuis des
sicles avec lespace, la culture, le climat et la ralit sociale. Cela est constat travers les mthodes
de partage de leau, les tches dentretien et de distribution, insatures par les paysans et qui font
lunanimit. Des mthodes de partage bases sur lquit, la rigueur, la solidarit et lentraide travers
lorganisation du tour deau en fonction de son origine (source), la taille de la palmeraie, les
associations culturales. Les moyens financiers nont jamais un critre daccs leau, bien que la
vente de leau agricole soit tolre par les premiers paysans fondateurs, mais selon des rgles rgies
par des valeurs sociales locales, toute en respectant les producteurs les plus dmunis par linstauration
du Nefk . Ainsi, nous constatons que plus lespace est traditionnel, il est davantage polyculture. Des
stratgies paysannes bases sur la diversification des cultures sous formes dassociation culturales
tonnantes, alors que celui de mise de la mise en valeur est moins diversifi en raison de sa tendance
marchande, ce qui en partie justifie sa fragilit dans le temps et dans lespace, bien que leau qui lui a
t mobilise soit abondante. Si lespace oasien traditionnel sest maintenu dans le temps et sest
adapt dans lespace des contraintes physiques, hydrauliques et conomiques, cest grce un
savoir-faire paysan irrprochable, qui serai certainement utile pour la nouvelle forme de mise en
valeur, car cest dans la gestion des ressources en eau que la bataille du dveloppement de
lagriculture dans les oasis sera gagne ou perdue.

Mots cls : Biskra, espace agricole oasien, ressources en eau, stratgies paysannes.

**************************************
A69
APPROCHE HYDROGEOCHIMIQUE A LETUDE DES AQUIFERES DE LA
CUVETTE DE OUARGLA (SUD-EST ALGERIEN)
NEZLI Imed Eddine

Laboratoire de protection des Ecosystmes en Zones arides et Semi-Arides, Universit de Ouargla, Algrie
imedinezli@yahoo.fr

Les ressources en eau souterraines dans la cuvette de Ouargla, sont reprsentes, comme partout et
ailleurs dans les rgions du Sahara septentrional algro-tunisien, par deux grands systmes aquifres
superposs : le Continental Intercalaire (CI) et le Complexe Terminal (CT). Les eaux issues de ces
nappes aquifres posent de srieux problmes de qualit chimique. Elles sont fortement minralises,
trs dures et prsentent des teneurs en fluor dpassant les teneurs recommandes par lOMS. Le
prsent travail a pour objectif de dcrire lvolution hydrogochimique des eaux des diffrents niveaux
aquifres, par la recherche dune relation entre la composition chimique des eaux et la nature
lithologique des formations aquifres. De ce fait, notre tude sest appuye sur la dmarche suivante :
Echantillonnage et analyse physicochimique des eaux des nappes;
Traitement statistique et modlisation graphique des paramtres physicochimiques des eaux,
afin daboutir une approche globale des processus dacquisition de la composition chimique des
eaux;
Simulation lvaporation naturelle et isotherme des paramtres sus indiques, pour prciser
davantage les mcanismes dacquisition de la composition chimique des eaux.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
100
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Dune faon gnrale, les rsultats obtenus montrent que les eaux du systme aquifre de notre zone
dtude appartiennent la mme famille gochimique.

Mots cls : Ouargla, Sahara, hydrogochimie, Complexe Terminal, Continental Intercalaire.

Thme 5 - Valorisation des plantes spontanes
A70
EFFET DE LA SALINITE DE LEAU SUR LA GERMINATION ET LA
CROISSANCE DE Casuarina equisetifolia

SLIMANI S.
1
et MEHDJANE R.
2

1
Laboratoire de Protection des Ecosystmes en Zones Arides et Semi Arides, Universit de Ouargla, Algrie.
2
Circonscription des Fort de la Daira de Ouargla, Algrie.
slimanisaid@yahoo.fr

La production de plants au niveau des ppinires en vue dventuelles oprations de boisement,
reboisement et ralisation de brise-vents est dune importance capitale dans les rgions semi-arides et
arides. Malheureusement, dans ces rgions, plusieurs contraintes environnementales se posent pour
assurer un bon contrle depuis le semis jusqu la transplantation. La prsente tude a port sur leffet
de la salinit de leau darrosage sur la germination et la croissance de Casuarina equisetifolia. Elle a
t mene au niveau de la ppinire de An Beda (Ouargla, Algrie), sur une priode permettant
dobtenir des plants en stades suffisamment avancs pour permettre la ralisation de mesures
biomtriques telles que la hauteur et le diamtre de la tige. Les semis, raliss dans deux placettes de
50 sachets en plastique chacune, de mme substrat, ont t arross avec deux eaux dorigines et
salinits diffrentes : une eau de forage 4,38 g/l de rsidus secs et une eau albienne 1,9 g/l de
rsidus secs. Les rsultats enregistrs ont montr un taux de germination de 42% au niveau de la
placette arrose leau de lalbien, alors que ce taux na t que de lordre de 10% au niveau de la
placette alimente lautre eau de forage. Aussi, au cours de la croissance, les valeurs biomtriques
ralises ont t plus importantes chez les plants arross leau de lalbien.

Mots cls : Casuarina equisetifolia; salinit; germination; croissance; Ouargla.

**************************************
A71
IDENTIFICATION DE LA MYCOFLORE ET RECHERCHE DES SOUCHES
PRODUCTRICES D'AFLATOXINES B1 DANS LES BLES TENDRES ET LEURS
DERIVES DE MEUNERIE (FARINES ET SONS) DU SUD OUEST ALGERIEN.

A. AMROUCHE et A. MOUSSAOUI

Universit de Bchar, Algrie.
abdelillahamrouche@yahoo.fr

Plus que jamais La scurit alimentaire est au cur de toutes les proccupations de L'industrie
agroalimentaire et des professions de sant. La contamination des produits d'alimentations humaines et
animales par les mycotoxines constitue actuellement un problme majeur de scurit sanitaire des
aliments et mrite donc toute notre vigilance. Les rsultats de notre travail rvlent la forte
contamination de nos chantillons avec un taux plus lev pour les chantillons locaux; la dominance
des Pnicilliums, Aspergillus et Rhizopus sur nos chantillons a t la preuve des mauvaises conditions
de stockage de ces derniers. L'aflatoxinogenese des souches du groupe Aspergillus flavus parasitucus
a rvle que ces dernires sont productrices d'aflatoxines AFB et AFG. Vu l'htrognit de la
rpartition de ces mycotoxines sur les diffrents chantillons la recherche de ces toxines s'est rvle
ngative la chromatographie sur couche mince. Laflatoxinognse a trouv un terrain plus favorable
au niveau du bl tendre partir de la temprature ambiante du laboratoire avec des quantits allant de
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
101
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
57 145 ng (en se rfrant laflatoxine standard) et cela sur une dure dun mois. cette production
d'aflatoxines a engendre une acidification voire une diminution du taux de proteins dans nos
echantillons de bl tendre.

Mots cls: Bl tendre, drivs de bl, moisissures, stockage, aflatoxines

**************************************
A72
ETUDE DE LACTIVIT ANTIBACTRIENNE DES FEUILLES DE LAWSONIA
INERMIS

Rekia CHERBI, Mehamed YOUSFI, Mokhtar SADI, Faial TEMACINI, Mokhtar
AISSOUS, Hocine DENDOUGUI, Mohamed Lakhdar. BELFAR, Zawia GHANDOR,
Khadra MOKADEM et Mohamed Lazhar KADRI

Laboratoire de Valorisation et Promotion des Ressources Saharienne (VPRS), Universit de Ouargla, Algrie.
rekia30@gmail.com

Tous les tres vivants ont un mtabolisme primaire qui fournit les molcules de base (acides
nucliques, lipides, protines, acides amins et glucides). Les plantes produisent, en plus, un grand
nombre de composs qui ne sont pas issus directement lors de la photosynthse, mais rsultent de
ractions chimiques ultrieures. Ces composs sont appels mtabolites secondaires .De nos jours, un
grand nombre de Ces composs sont utiliss en mdecine moderne et une majorit de ceux-ci le sont
selon leur usage traditionnel. Des 25 composs pharmaceutiques les plus vendus travers le monde,
12 proviennent de produits naturels, mais jusqu'ici, environ seulement 10 % des 250 000 espces de
plantes inventories ont fait l'objet de recherches de molcules bioactives. Ils comportent les composs
phnoliques et les composs azots forms essentiellement des alcalodes et des glycosides. Ces
mtabolites jouent souvent un rle de dfense de la plante qui les fabrique .En plus de leurs activits
antioxydantes et antimicrobiennes, les polyphnols possdent plusieurs autres effets bnfiques pour la
sant humaine. Face aux limites thrapeutiques des mdicaments chimiques, le dveloppement de la
recherche sur les plantes mdicinales a t orient vers l'obtention de phytomdicaments. Ce
dveloppement constitue une tape indispensable pour l'essor de tout un secteur li aux besoins non
seulement de la thrapie, mais aussi de l'industrie agroalimentaire, de la cosmtique et de la
parfumerie. Le but de ce projet de recherche est donc, dans un premier temps, Etudier la phytochimie
de lawsonia inermis et d'valuer l'activits antibactriennes d'extraits des feuilles du lawsonia inermis.

Mots cls : Lawsonia inermis, Activit antimicrobienne, d'extraits des feuilles, phytochimie,
composs phnoliques.

**************************************
A73
ASSOCIATION BNL-LEGUMINEUSES SPONTANNEES DANS LE SAHARA
ALGERIEN: RESSOURCES GENTIQUES MICROBIENNES PROMETTEUSES

CHAICH Khaled

Universit de Ouargla, Algrie.
khaledchach@yahoo.fr

Au Sahara, malgr les conditions dapho-climatiques trs hostiles (aridit du climat, salinit, sols
squelettiques) au dveloppement de la vie animale et vgtale, il existe une vgtation
clairseme constitue de plantes spontanes adaptes ces conditions marginales et prsentant des
intrts multiples (cologique, fourrager, mdicinal.). A travers une prospection dans le Sahara
septentrional Est de lAlgrie, six (06) diffrents espaces gomorphologiques ont t rcences (ergs,
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
102
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
regs, hamadas, lits doueds, chotts et sebkhas) et paraissent lorigine dune variabilit des milieux
naturels sahariens. Chacun de ces milieux est caractris par des paramtres cologiques propres dans
lesquels volue une flore adapte. En gnral, les sols rencontrs sont squelettiques et trs peu fertiles,
ils sont constitus essentiellement dune fraction minrale de sable et dune fraction organique trs
faible (<1%). Eu gard, aux conditions difficiles de ces milieux, notamment, la pauvret de leurs sols
en lments nutritifs, les fabaces requirent une importance particulire en relation avec leur capacit
de fixer lazote atmosphrique et damliorer la fertilit des sols. Une liste exhaustive dresse partir
des prospections ralises fait tat de (09) espces de fabaces dont (02) vivaces et (07) annuelles
biannuelles appartenant sept (07) diffrents genres. En tant que symbionte, la variabilit des
paramtres cologiques en relation avec les diffrents milieux naturels sahariens font des espces de
fabaces recenses, des rservoirs potentiels de microorganismes (spcificit des souches bactriennes
symbiotiques) adapts ces milieux. Par consquent, la recherche approfondie concernant ces souches
prometteuses serait trs bnfique en vue dune valorisation future tant sur le plan agronomique et
conomique (bio fertilisation), qucologique (sauvegarde des cosystmes sahariens contre la
dsertification, amlioration de la fertilit des sols ).

Mots cls : Sahara, conditions marginales, flore adapte, fabaces spontanes, milieux naturels,
espaces gomorphologiques, fertilit, symbiose, souches bactriennes, variabilit, ressources
gntiques, valorisation

**************************************
A74
ETUDE FLORISTIQUE SPATIOTEMPORELLE DU CHOTT DE AIN BEIDA
(OUARGLA)

HADDANA S
1
. et CHEHMA A
2
.

1
Dpartement de Biologie, Universit de Ouargla, Algrie.
2
Laboratoire Bio-ressources sahariennes. Prservation et valorisation, Universit de Ouargla, Algrie.
haddanaecologie@yahoo.com

Le Sahara septentrionale est un milieu dsertique trs rude. Mais malgr ces conditions dapho-
climatique trs contraignantes, ils existent des formations gomorphologiques relativement favorables
la survie et la prolifration dune flore spontane caractristique. Parmi elles, les zones humides qui
constituent une anomalie hydrologique positive la fois dans lespace et dans le temps,
comparativement leur environnement plus sec. A cet effet, la rgion de Ouargla recle dimportants
biotopes humides tels que le chott de Ain El Beda qui est class comme une zone humide
dimportance internationale selon la conservation de RAMSAR (1971). Ce milieu fait partie des
ressources les plus prcieuses sur le plan de la diversit biologique (faune et flore). Pour cela, on a
jug plus quutile deffectuer une tude floristique spatio-temporelle au niveau de ce chott, o nous
avons choisi une station exprimentale subdivise en 4 sous stations dans lesquelles a t effectue
une tude qualitative et quantitative de la flore suivant plusieurs relevs temporels. A partir de cela, on
a pu recenser 5 espces halophytes vivaces appartenant 5 familles, dont la plus reprsente est celles
des Amaranthaceae et, gnralement, ltat de la flore est rarfi dans les quatre sous stations tudies.
Dun autre ct, les variations climatiques saisonnires se traduisent par des variations enregistres
pour les paramtres quantitatifs de densit et de recouvrement de ces espces. De ce fait, on a
enregistr des densits et des recouvrements ingaux suivant les trois saisons, dans le sens o les
grandes valeurs sont marques en automne et les plus faibles en hiver.

Mots cls : Zones humides, Chott de Ain El Beda, flore spontane, spatiotemporelle, Densit,
recouvrement.

**************************************

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
103
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A75
FLORE ASSOCIEE AUX CULTURES CEREALIERES DANS LES REGIONS
SAHARIENNES : CAS DE LA REGION DE OUARGLA (Hassi Ben Abdellah)

Ibtissem SAYAD
1
, Amar EDDOUD
1
et Abdelkrim HACENE
2


1
Laboratoire Bio-ressources Saharienne : Prservation et Valorisation, Universit de Ouargla, Algrie.
2
Ecole Nationale Superieure dAgronomie Hassan Badi El Harrach, Alger, Algrie.
amar.eddoud@ina.dz

Le problme de nuisibilit des mauvaises herbes, se pose avec acuit dans les cultures cralires, leur
apparition nest jamais spontane, cest le rsultat de plusieurs conditions. Linsuffisance des
techniques culturales adquates, est lorigine de lenvahissement par ces adventices. Notre tude
porte sur la diversit floristique de cette flore dans les primtres craliers de la rgion de Ouargla
(Hassi Ben Abdellah). Les relevs raliss durant la priode dchantillonnage, allant du mois de
dcembre (2007) jusquau mois davril (2008), ont permis dinventorier 52 espces adventices
reparties sur 14 familles botaniques et 43 genres. Lanalyse des rsultats obtenus, a fais ressortir :
La dominance des Asteraceae (19,23 % de lensemble des espces adventices recenses), des
Poaceae (17,30 % de lensemble des espces adventices recenses) et des Brassicaceae (13,46 % de
lensemble des espces adventices recenses) sur le plan qualitatif et celle des Poaceae sur le plan
quantitatif (49 % de leffectif total) ;
La prdominance de la classe des dicotyldones, sur le plan qualitatif (82,69 % de lensemble
des espces adventices recenses) et celle des monocotyldones, sur le plan quantitatif (63,64 % de
leffectif total) ;
La prdominance du groupe biologique des throphytes, sur les deux plans qualitatif et
quantitatif (90,38 % de lensemble des espces adventices recenses et (90,38 % de leffectif total) ;
Et en fin, la prdominance des espces introduites par rapport celles spontanes en matire
de nombre despces fournies et deffectif recens, dans la majorit et non pas la totalit des stations.

Mot cls : Primtre cralier, flore adventice, diversit

**************************************
A76
CINETIQUE DES PLANTES SPONTANEES APRES L'ABANDON D'UN PIVOT
(CAS DE LA FERME D'E.R.I.A.D.) HASSI BEN ABDALLAH, OUARGLA

Hafida TRABELSI
1
, Aicha TOUATI
1
et Ahmed CHAABENA
2


1
Dpartement des sciences agronomiques, Universit de Ouargla, Algrie.
2
Laboratoire de bioressources sahariennes prservation et valorisation, Universit de Ouargla, Algrie.
tr.hafida@yahoo.fr

Ce travail porte sur la connaissance de la cintique de la vgtation spontane aprs la mise en place
d'un pivot suivie d'un arrt; nous avons retenu 3 stations (3 pivots diffrents ges d'abandon) et hors
pivot (jamais cultiv) au niveau de primtre E.R.I.A.D. dans la rgion de Hassi Ben Abdallah
Ouargla. Le premier constat est que c'est au niveau de la zone naturelle que la flore apparat riche du
point qualitatif suivie par la station 3 puis les 2 autres stations. Nous avons aussi relev que Bromus
rubens a un pouvoir colonisateur dans les 3 stations. On note aussi l'existence d'espces qui sont
caractristiques des stations.

Mots cls: Zone aride, Flore, Pivot abandonn, Agriculture, Action anthropique.

**************************************

Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
104
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A77
ACTIVITE ANTIBACTERIENNES DE MASCARI COMOSUM ET Tamarix gallica

KENDOUR Zaouia, OUAHRANI Mohamed Ridha, GHIBA Zineb, GHERRAF Noureddine
et HACINI Zineb

Laboratoire V.P.R.S Universit de Ouargla, Algrie.
zaken1977@yahoo.fr

Dans ce travaille nous avons tudies Lactivit antibactrienne des extraits aqueux et alcooliques de
Muscari Comosum et Tamarix Gallica a t compare avec celle de la pnicilline sur quelque souches
des bactries Escherichia coli ; Klebsiella pneumoniae ; Pseudomonas aeruginosa par la mthode de
diffusion. Les extraits alcooliques bruts de Muscari Comosum se est rvl Plus actifs sur
Escherichia coli et Klebsiella pneumoniae mais extrait aqueux de Tamarix Gallica se est rvl plus
actif sur Pseudomonas aeruginosa que leur extrait alcoolique. Les zones dinhibition 300 mg/ml ont
t de 14 24 mmet de 20 24 mmrespectivement pour les extraits aqueux et alcooliques sur les
souches. Lactivit antibactrienne des extraits alcooliques bruts sur Klebsiella pneumoniae 300
mg/ml a t quivalente celle de la pnicilline la concentration de 800 mg/ml.

Mots cls : Activit antibactrienne, extraits, Muscari comosum, Tamarix gallica, Escherichia coli.

**************************************
A78
EVALUATION DES ACTIVITES HYPOGLYCEMIANTE ET ANTI
HYPERGLYCEMIANTE DEXTRAIT DE PLANTE MEDICINALE DE LEST
ALGERIEN CHEZ LE RAT AVEC UN DIABETE INDUIT.

LEKOUAGHET Asma, DJEDIOUI Abdallah, BOUASLA Asma et HENCHIRI Chrifa

Laboratoire de biochimie applique. Dpartement de biochimie. Universit de Annaba, Algrie.
lekouaghet_23@yahoo.fr

Beaucoup de plantes mdicinales ont t utilises pour le traitement du diabte sucre en Algrie.
Dans notre tude, les effets de lextrait aqueux des feuilles de lArbutus unedo (famille : Ericaceae) en
suivant lvolution de la glycmie et du poids corporel des rats Wistar rendus diabtiques par
linjection intra pritonal de 150 mg/kg dalloxane pendant les trois semaines de traitement ont t
valus. Durant cette priode, une diminution significative de la glycmie a t remarque ainsi
quune amlioration du poids corporel des rats diabtiques. Paralllement, ltude phytochimique
effectue sur les feuilles de lAbutus unedo a rvl la prsence de flavonodes, de tanins, de strols et
terpnes.

Mots cls : Arbutus unedo, effet anti- hyperglycmiant, Algrie, Ericaceae, alloxane.

**************************************









Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
105
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A79
REPONSE ADAPTATIVE DES PLANTS DE Parkinsonia aculeata L. UNE
CONTRAINTE OSMOTIQUE

BENADJ AOUD Ali
1
et AD Fatiha
2

1
Dpartement des Troncs Communs Sciences de la Nature, Universit de Bjaa, Algrie.
2
Laboratoire de Biologie des Populations et des Organismes, Universit des STHB, Alger, Algrie.
fatiha_dz@yahoo.fr

Parkinsonia aculeata L. ou gent pineux est une lgumineuse de la sous-famille des
Caesalpinodeae, fortement rpandu dans presque tous les pays tropicaux et subtropicaux et dans les
rgions semi-arides et arides. En Algrie, sa rcente introduction russie en premier lieu dans les parcs
et jardins, surtout dans une rgion de stress typique comme Tamanrasset, suscite lattention. Une
premire valuation de la raction de lespce une contrainte osmotique impose par le PEG
6000

montre une rponse de lespce en relation avec lintensit du stress et son temps dapplication. La
premire rponse concerne la capacit de rtention de leau au niveau foliaire, apprcie grce des
mesures de la teneur relative en eau. Cette capacit de rtention est observable lorsque le temps
dapplication du stress impos est de 24 heures pour une concentration en PEG
6000
nallant pas au-del
de 20 % ; pour un temps dapplication de 48 heures, mais pour une concentration en PEG
6000
ne
dpassant pas 15 % ; ou encore pour un temps dapplication de 72 heures, mais pour une concentration
en PEG
6000
nexcdant pas 10 %. La seconde rponse concerne laccumulation de la proline
observable lorsque la concentration en PEG
6000
ne dpasse pas 15 % pour un temps dapplication du
stress de 24 heures ; ne dpasse pas 10 % pour un temps dapplication de 48 heures ; ou encore ne
dpasse pas 5 % pour un temps dapplication de 72 heures.

Mots Cls : Parkinsonia aculeata L., stress osmotique, PEG
6000
, teneur relative en eau, proline.

**************************************
A80
LE COMPORTEMENT DE DEUX PROVENANCES DAtriplex halimus L.
SOUMISES AU STRESS SALIN

SOUALMI N.
1
, BELKHODJ A M.
2
et ADDA A.
3


1
Universit Ibn Khaldoun Tiaret, Algrie.
2
Laboratoire dEcophysiologie Vgtale, Universit dEs senia Oran, Algrie.
3
Laboratoire dAmlioration des plantes, Universit Ibn Khaldoun Tiaret, Algrie.
snadia04@yahoo.fr

Lexcs en sels dans un milieu est un lment dterminant pour la croissance et la reproduction des
plantes. Il induit un stress ionique du la toxicit des ions et un stress hydrique du la diminution du
potentiel hydrique du sol. Souvent la rponse dune plante soumise un stress salin se traduit par des
mcanismes dadaptation de tolrance et de rsistance. Leffet du stress salin est appliqu sur deux
provenances dAtriplex halimus L., lune dOran dans la rgion Des snia et lautre de Tiaret dans la
rgion de Ain Dheb pendant cinq semaines o nous avons dtermin la teneur relative en eau (TRE ou
RWC) par la mthode de Barrs et Weaterley 1962 et la transpiration (RWL) par la mthode de Klarke
et al., 1989 au niveau foliaire. La rsistance stomatique est galement quantifie laide dun
poromtre. Les solutions salines sont composes dune part de 300 meq et 600 meq de NaCl +CaCl
2

et dautre part deau de mer. Les rsultats obtenus montrent qu la fin de lexprimentation les plantes
des deux provenances ont diminu leur teneur relative en eau et leur transpiration sous les deux types
de stress salin. La rsistance stomatique a subit des perturbations importantes en fonction de lintensit
du stress et de la provenance tudie. Nous pouvons conclure que ces paramtres physiologiques sont
indicateurs importants de la tolrance de cette espce la salinit.

Mots cls : Atriplex halimus L., salinit, teneur relative en eau, transpiration, rsistance stomatique.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
106
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
A81
EVALUATION OF ALKALOID CONTENT OF Traganum nutadum AND ITS
EFFECT AS ANTIBACTERIAL AND ANTIOXIDANT.

LABED brahim
1
, HAMEURLAIN Samir
1
, CHIHI Soumia
1
, GHERRAF Noureddine
2
and
ZELLAGUI Amar
2


1
Ouargla University, Algeria.
2
Organic synthesis and Phytochemistry Lab, Mentouri University Constantine, Algeria.
ngherraf@yahoo.com

Traganum nudatum is a medicinal plant widely used in folk medicine. In the present study, we have
carried out the assessment of alkaloid content of the plant and undertaken the biological effects of the
crude alkaloid content of the plant as far as the antibacterial and antioxidant activities are concerned.
The results revealed that the plant involves an important biological effect towards a set of defined
bacteria as well as the free radicals compared to some known compounds. The different plant parts
extracts behave more or less active. It was found that the extract of the roots in both studies has
efficiency better than the extract of the leaves and this in turn is more effective than the extract of the
stems.

Key words: Medicinal plants, Traganum nudatum, extraction, phytochemical screening, alkaloids,
antibacterial activity, antioxidant activity.
**************************************

A82
ACTIVITE BACTERIOLOGIQUE DES EXTRAITS PHENOLIQUES DE LA
PLANTE Teucrium polium geyrii PAR LA TECHNIQUE DAROMATOGRAMME

HAMMOUDI Roukia
1
, RAMDANE Farah
1
, KHODIR Abed Allah
2
et HADJ MAHAMMED
Mahfoud
1

1
Laboratoire de Biogochimie des milieux dsertiques associ au CRAPC, Universit de Ouargla, Algrie.
2
Laboratoire rgional de contrle de qualit (CAQE) Ouargla, Algrie.
rokia1811@yahoo.fr

Dans le but de la valorisation dune des plantes de la famille Lamiaces issue de la rgion de
Tamanrasset (sud dAlgrie), en loccurrence Teucrium polium geyrii, nous avons effectu un travail
permettant pour contribuer la mise en vidence de lactivit biologique de certains mtabolites
secondaires. Teucrium polium geyrii a t reconnue depuis longtemps en mdecine populaire dans le
traitement de divers physiopathologiques, telles que les inflammations, maladies gastriques et les
rhumatismes. Il serait donc trs intressant de lexploiter pour la recherche de ses principes actifs,
responsables de ces proprits pharmacologiques. Le screening phytochimique avait mis en vidence
divers mtabolites secondaires: Tanins, Saponosides, terpnes et sesquiterpnes, alcalodes,
anthraquinones, strols, flavonodes et polyphnols. La plante a t soumise deux types dextraction
des composs phnoliques, la macration, et Soxhlet. L'analyse semi-quantitative des phnols totaux et
des flavonodes des extraits phnoliques ralise par colorimtrie, a montr que notre plante est trs
riche en composs phnoliques. Lextrait lactate dthyle obtenu par macration renferme la plus
grande quantit de phnols totaux, 89.05 mg/g en quivalent dacide gallique, au mme titre que le
taux des flavonodes avec et 0.45 mg/g en quivalent de vitexine. Lactivit antibactrienne ralise
sur des souches bactriennes pathognes et daltration, Staphylococcus aureus, Pseudomonas
aeruginosa, Streptococcus cremoris, Clostridium perfringens, Klebsilla pneumoniae, Escherichia
coli, Proteus mirabilis, par la mthode dAromatogramme a montre que les extraits tests sont dous
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
107
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
dactivit antibactrienne intressante avec un maximumdinhibition 3.4 +/- 0.3 cm de diamtre pour
lextrait butanolique sur Proteus mirabilis.

Mots cls: Plante mdicinale, Teucrium polium geyrii, activit antibactrienne, Aromatogramme,
extraits phnoliques.

**************************************
A83
LA COMPOSITION CHIMIQUE DES HUILES ESSENTIELLES DE Nauplius
graveolens DALGERIE

RAMDANE F.,

HAMOUDI R., HADJ MAHAMMED M.

Laboratoire de Biogochimie des milieux dsertiques. Universit de Ouargla. Algrie.
farahramdane@yahoo.fr

Les huiles essentielles des parties ariennes de la plante Nauplius graveolens qui ont t rcoltes au
Sahara central dAlgrie (Tamanrasset), ont t extraites par la mthode dentranement la vapeur,
ensuite ces huiles ont t analyses par gaz chromatographie seul (GC- FID) puis couple au
spectromtre de masse (GC-MS). Les constituants majoritaires sont : cadinene 33,75%, 2, 6, 6-
trimthylactate de bicyclo 3.1.1 hept-2- en- 4-ol, 13.91% suivi de liguloxide 9.47%, mertenyl
actate 6,50%, eudesmol 1,29% et eudesmol 1,00%.

Mots cls: plantes mdicinales Nauplius graveolens, Astraces, les huiles essentielles, GC-MS.

**************************************
A84
REPONSES MORPHO-PHYSIOLOGIQUES ET BIOCHIMIQUES DE LA
SYMBIOSE Rhizobia-Arachide AU STRESS HYDRIQUE.

LAZALI M
1
,

OUNANE S.M
1
, CHAKER-HADDADJ A
2
,

ALKAMA N
3
, NOUAR S
1
.


1
Dpartement de Phytotechnie, Ecole Nationale Suprieure Agronomique (ENSA), El-Harrach. Algrie.
2
Dpartement de biologie, Universit MHamed Bougara, Boumerds, Algrie.

3
Dpartement dagronomie, Universit Mouloud Mammeri, Tizi Ouzou, Algrie.
m.lazali@yahoo.fr

En dpit du niveau de rsistance assez important dvelopp par larachide (Arachis hypogaea L.), son
production dans les cosystmes secs est affecte par des priodes de dficit hydrique survenant au
cours du cycle de croissance. Le but de ce travail tait de mettre en vidence, les rponses au dficit
hydrique faible, modr puis svre de cinq populations darachides dorigine locale et trangre
inocules par trois souches rhizobiennes, en vue d'identifier des critres pour la slection des
interactions symbiotiques mieux adaptes la scheresse. Les mcanismes tudis ont port
principalement sur les aspects morpho-physiologiques (hauteur de la tige, surface foliaire,
accumulation de la proline et sucres solubles, teneur de la chlorophylle), aspects biochimiques
(fixation et lassimilation de lazote), aspects hydriques de la plante (la teneur relative en eau, potentiel
hydrique foliaire, rsistance stomatique et la temprature du couvert vgtal) et agronomiques
(rendement et ses composants). Les rsultats obtenus ont mont que les effets du stress hydrique se
manifestent par une diminution de la teneur relative en eau et du potentiel hydrique foliaire et une
augmentation de la rsistance stomatique et de la temprature du couvert vgtal. Tous ces effets de la
contrainte hydrique se rpercutent ngativement sur la croissance vgtative ainsi que sur
lassimilation et la fixation de lazote et enfin sur le rendement et ses composantes. Les interactions
symbiotiques tudies se comportent diffremment en fonction de la svrit de stress. Cependant, Les
couples symbiotiques SA
3
-BER, SA
3
-OUM, SA
3
-TON, SA
3
-TIM, SA
1
-BER, SA
1
-TON et SA
1
-OUM
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
108
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
se sont avr les plus tolrantes aux diffrents degrs de dficit hydrique. Par contre, les interactions
symbiotiques SA
2
-TIM et SA
2
-NIG ont montr une sensibilit importante face au manque deau. Le
comportement des autres couples symbiotiques a vari en fonction de la svrit de la contrainte
hydrique. De plus, la variabilit gntique du matriel vgtal vis--vis du stress hydrique ne semble
pas lie lorigine gographique des populations darachides, mais plutt leur phnologie et leur
morphologie. Cette tude pourrait servir la dfinition de critres pertinents de rsistance la
scheresse utilisables en slection varitale.

Mots cls : Symbiose, stress hydrique, fixation dazote, arachide, rhizobia, tolrance, slection.

**************************************
A85
CONTRIBUTION A L'ETUDE DE L'ACTIVITE ANTIMICROBIENNE DE
L'EXTRAIT FOLIAIRE BRUT DE Salvatoria persica LINDI RECOLTE DANS LA
REGION DE TAMANRASSET

BOUGHABA Latifa, AISSAOUI Khadidja, MAAMRI Malika, OULD EL HADJ Med Didi

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi arides
Universit de Ouargla, Algrie
syranova@yahoo.fr

La prsente tude est une contribution la valorisation dune plante spontane caractre mdicinal. Il
sagit de Salvadora persica. Lextrait foliaire actonique par macration et les huiles essentielles
obtenues par hidrodistillation ont servi ltude lactivit antimicrobienne. Le rendement dextraction
des huiles essentielles nexcdent pas pour toutes les parties de la plante 0,05%. La prsence des
alcalodes dans les diffrentes parties de la plante dont les racines, les tiges et les feuilles, elle est note
dans les diffrentes parties de cette plante la prsence dalcalodes. Les rsultats laissent apparatre
l'effet significatif de l'extrait de tige actone avec un maximumd'inhibition sur les souches P.
aeruginosa avec une zone dinhibition de 13,5 mm et S. aureus avec une zone dinhibition de
13,33. Par contre, elle est trs faible pour E. Coli et C. albicans ayant des zones dinhibition de prs de
5,6 mm. Les huiles de cette espce vgtale possdent une large action sur les souches bactiennes
testes avec des zones inhibitrices comprises entre 8,33 et 10 mm. Toutefois, l'extrait des feuilles
lactone est active sur le Candida albicaus et Pseudomonas aeruginosa, trs faible pour Escherichia
coli et semble nulle sur les Staphylococcus aureus. L'extrait des racines actone et des feuilles
lthanol, prsentent de faibles activits. Ces extraits sont actifs sur E. coli avec une zone dinhibition
de 11,66 mmpour lextrait foliaire, et sur C. albicans avec une zone dinhibition 10,33 mmpour
lextrait racinaire.

Mots cls : Salvadora persica, extrait, feuille, racine, huiles essentielles, micro-organisme, activit
antimicrobienne.

**************************************
A86
ETUDE ETHNOBOTANIQUE ET INVENTAIRE DES PLANTES MEDICINALES DE
LA REGION DE CHERIA - WILAYA DE TEBESSA

BOUTABIA L, TELAILIA S, CHEFROUR A et BOUCHEKIOUA O

Institut dAgronomie, Centre Universitaire dEl Tarf, Algrie
b_lamiadz94@yahoo.fr

Ltude mene au niveau de la rgion de Chria de la wilaya de Tbessa sur linventaire des plantes
mdicinales au niveau de deux stations d'tude: station 1 Bhiret Laneb et Station 2 Fidh El Mahri a fait
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
109
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
ressortir une diversit de la flore notamment en nombre de famille. La richesse totale est de 45 espces
appartenant 25 familles. Les familles dominantes sont reprsentes par les Asteraceae et les
Labiatae. Sur les 45 espces inventories travers les deux stations d'tude, 31 espces ont t
identifies comme mdicinales. L'tude ethnobotanique effectue dans la rgion de Chria au niveau
de 26 familles rparties en 13 populations a montr que sur les 31 espces mdicinales recenses
seules 13 espces sont utilises par la population riveraine.

Mots cls : Ethnobotanique, Plantes mdicinales, steppe armoise blanche, Chria, Tbessa.

**************************************

A87
UNE COMPOSITION SPECIFIQUE DES HUILES ESSENTIELLES DE LA PLANTE
MARRUBIUM DESERTI DE LA REGION DE GHARDAA

CHEBROUK Farid
1
, HAMMOUDI Rokia
1
, HADJ Med Mahfoud
1
, FERFAD Taha Bachir
2

1
Laboratoire de biogochimie des milieux dsertiques, Universit de Ouargla, Algrie
2
Centre de recherche et dAnalyses physico-chimiques, Universit de lUSTHB, Alger, Algrie
chebroukfarid@yahoo.fr

Les huiles essentielles du Marrubium deserti, obtenues par entranement la vapeur deau, ont t
analyses par GC-MS impact lectronique. Lanalyse a abouti lidentification de 27 composs
constituant (60, 79%) de lhuile essentielle et appartenant essentiellement la classe des
sesquiterpnes. Les composs majoritaires sont : le -cadinne (17,63%), germacrne D (7,01%),
trimthylpentadeca-2-one (4,61%) et 9-methyl-undecne (4,17%).De plus, une composition
spcifique, en hydrocarbures un nombre impair datomes de carbone et diverses structures
particulires ont t rapportes pour la premire fois chez les espces Marrubium. Les huiles analyses
se sont aussi avres pauvres en monoterpnes et composs apparents. Ces spcificits, sont
probablement, mettre en rapport avec des facteurs abiotiques tels que le climat spcifique de la
rgion de provenance de lchantillon et les facteurs gographiques comme laltitude et la nature du
sol.

Mots cls : Marrubium deserti, sesquiterpnes, GC-MS, huiles essentielles, entranement la vapeur
deau.

**************************************
A88
INHIBITION EFFECT OF SOME PLANT EXTRACTS ON THE CORROSION OF
MILD STEEL IN H
2
SO
4
MEDIUM

CHIHI Soumia
1
, HAMEURELAIN Samir
1
,

LABED Brahim
1
, ZELLAGUI

Amar
2
,
GHERRAF

Noureddine
1
, and SEGNI Ladjel
1


1
Universit of Ouargla, Algeria
2
Laboratory of Natural Product and Organic Synthesis, University Mentouri; Constantine, Algeria.
ngherraf@yahoo.com

The inhibitive effect of extracts of Euphorbia guyoniana on the corrosion of X52 mild steel in
aqueous15% sulfuric acid was investigated. Weight-loss determinations and electrochemical
measurements were performed. Polarization curves indicated that the plant extracts behave as mixed-
type inhibitors. The corrosion rates of steel and the inhibition efficiencies of the extracts were
calculated. The results reveal that the extract solutions of the plants could serve as effective inhibitors
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
110
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
for the corrosion of steel in sulphuric acid media. Inhibition rate was found to increase with increasing
concentration of the plants extract up to an optimumconcentration.

Key words: plant extract, euphorbia, corrosion inhibition, acidic media

**************************************
A89
ESSENTIAL OIL COMPOSITION OF TWO ENDEMIC PLANTS: Rhanterium
adpressum and Pituranthos scoparius

HAMEURELAIN Samir
1
; ZELLAGUI

Amar
2
, GHERRAF Noureddine
1
, RHOUATI Salah
1
,
SEGNI Ladjel
1
, LABED brahim
1
and CHIHI Soumia
1
.

1
Universit of Ouargla, Algeria
2
Laboratory of Natural Product and Organic Synthesis, University Mentouri; Constantine, Algeria.
nouargla@yahoo.fr

Aromatherapy makes use of essential oils extracted fromaromatic plants. These oils can enhance
health, and beauty, and can also influence the mind and emotions. Essential oils may be used against
acetyl- and butyrylcholinesterase
1
; as antibacterial
2
; as Antifungal
3
; as Antimicrobial
4,5,6
. They have
been reported to have Antioxidative properties
7
, fungitoxic activity
8
, cytotoxic and apoptotic
effects
9
etc. Rhanterium adpressum and Pituranthos scoparius, two endemic plants (Algeria), were
investigated for their oil content using the ordinary GC-MS Analysis. More than 50 compounds were
identified in each plant. The main components in Rhanterium adpressum were .tau.cadinol (8.37%),
2-isopropyl-5-methyl-9-methylene-(7.86), -Cadinol (6.55), -(-)Spathulenol (4.72). Pituranthos
scoparius, famous for its therapeutic effects and pleasant odor, was reinvestigated. Analysis revealed
that its oil content is time dependent. In fact, essential oil concentrations, yields, percentage of the
principle components of the aerial parts were determined using two samples collected on February and
April respectively. The results showed important fluctuations both quantitatively and qualitatively.

Key words: essential oils, Rhanterium adpressum, Pituranthos scoparius, GC-MS Analysis

**************************************
A90
TOXICITE DE TROIS EXTRAITS DE POUDRES VEGETALES ORIGINAIRES DES
REGIONS SEMI-ARIDES ET ARIDES SUR LE COMPORTEMENT DUN INSECTE
DE DENREE STOCKEE (Callosobruchus Maculatus F.)

DEMNATI F et ALLACHE F.

Dpartement dagronomie, Universit Mohamed Khider, Biskra, Algrie
fat_demnati@yahoo.fr

Le but de cette tude vise essentiellement dterminer lefficacit de trois extraits de poudres de
plante issu de la zone semi-aride et aride, il sagit de : Juneperus oxycedrus, J. communis et Artemisia
herba alba, sur le comportement biologique la bruche du pois chiche Callosobruchus maculatus F.
(Coleoptera, Bruchidae). Nous avons enregistr une mortalit chez les adultes, value 50% traits
avec A. herba alba. 40% est not chez les adultes traits avec Juneperus oxycedrus et J. communis.
Une diminution importante de la fcondit des femelles traites par J. oxycedrus est constate par
rapport celles traites avec A. herba alba et J. communis. Cependant, un mme taux de fertilit est
enregistr pour les trois plantes.

Mots cls : Efficacit, Extrait vgtale, Juneperus oxycedrus, J. communis, Artemisia herba alba
Comportement biologique.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
111
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************

A91
LES TERFEZ DE LA REGION DE OUED M'YA - OUARGLA

BISSATI Samia et BRADAI Lys

Laboratoire de Bio-Ressources Sahariennes, Valorisation et Prservation, Universit de Ouargla, Algrie.
baradai_lyes@yahoo.fr

Notre travail consiste identifier les diffrentes espces de Terfez rcolts dans la rgion de Oued
M'ya (Ouargla), en prcisant les donnes cologiques et climatiques relatives leur rcolte. Les Terfez
rcolts sont rpartis en trois espces, appartenant deux genre diffrents : Tirmania nivea, Terfezia
arenaria, Terfezia claveryi. Les Terfez reprsentent un champignon symbiote, mycorhizien, hypog et
symbiote avec des plantes de la famille des Cistacea et plus particulirement les Hlianthmes :
Helianthemumlippii.Le dveloppement du Terfez ncessite des conditions climatiques et daphiques
particulires : des niveaux de prcipitations favorables au dbut de l'automne et au printemps, des sols
sableux bien structurs, ars permettant une meilleure circulation des lments minraux, ainsi que la
prsence des Hlianthmes en forte densit et en pleine vigueur. La majorit du cycle biologique du
Terfez seffectue sous forme de filaments, formant un mycliumqui lui permet en automne, de former
avec lextrmit racinaire dun Hlianthme une mycorhize. Linitiation fructifre dbute par la
formation du primordium proximit des racines, chaque peloton volue en truffe. A la fin du cycle,
et en t les ascocarpes se dcomposent et peuvent germer lautomne. Le dveloppement des Terfez
est fortement li aux variations des critres morphologiques de la symbiose ectomycorhizienne, tel que
le poids, la profondeur, le nombre de Terfez, et la densit des plantes symbiotiques.

Mots cls : Bio-cologie, Terfez, symbiose, Helianthemum, Oued M'ya.

**************************************
A92
POTENTIALITES DE LAPICULTURE EN MILIEU OASIEN (CAS DE LA WILAYA
DE GHARDAA)

KACI Safia, et ADAMOU Abed El Kader

Universit de Ouargla, Algrie
Kaci_safia09@yahoo.fr

Ltude mene auprs de 18 apiculteurs, sur les potentialits de lapiculture en milieu oasien (wilaya
de Ghardaa) nous a permis de constater que le milieu offre des possibilits pour llevage apicole par
son climat et sa flore (arboriculture fruitire). Dune part, nous avons remarqu que la majorit des
apiculteurs sont des amateurs issus de diffrentes catgories socioprofessionnelles. Dautres part,
lintroduction de lapiculture est dicte par le dsir de diversifier les spculations ; ainsi que le prix de
ventes trs stimulant du miel. Lapiculture est confronte plusieurs contraintes diffrentes,
principalement techniques et pathologiques, chose qui sest rpercute sur la production du miel qui
nenregistre que 07 10 Kg/ruche/an. Les diffrentes analyses sur le miel, nous ont permis de conclure
que le miel oasien, est un miel qui rpond en grande partie aux normes.

Mots cls : milieu oasien, apiculture, potentialits, conduite, qualit du miel

**************************************


Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
112
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
A93
LES ESPECES MELLIFERES DU SAHARA SEPTENTRIONAL ALGERIEN.

LAALLAM H
1
, BOUGHEDIRI L
2
et BISSATI S
1


1
Laboratoire Bio ressources Sahariennes, Universit de Ouargla, Algrie
2
Dpartement de Biologie, Universit de Annaba, Algrie
nrhalimi@yahoo.fr

Nous assistons depuis lanne 2004 un dveloppement remarquable de lapiculture dans notre pays;
grce au plan national du dveloppement agricole qui a soutenue des milliers de jeunes diplms en
agriculture dans plusieurs wilayas du pays, dans le but daccrotre la production nationale en miel.
Le programme dextension de cette spculation a touch galement certaines rgions sahariennes : il
sagit des wilayas de Biskra, Ghardaa, Laghouat, Naama et Bechar. En effet, ces rgions climat
aride sont caractrises par une insuffisance des prcipitations avec une irrgularit du rgime des
pluies qui exercent une influence directe sur le couvert vgtal. Il en ressort que la russite de
lapiculture dans ces rgions est incontestablement lie la disponibilit et labondance en espces
vgtales, source alimentaire des abeilles. Lobjectif principal travers ce travail, est la mise en
vidence des espces apicoles dans ces rgions sahariennes et leur valorisation en vue du
dveloppement de lapiculture saharienne. Des enqutes effectues, auprs des apiculteurs de chaque
wilaya prcite au cours de lanne 2007-2008, ont permis de mettre en vidence lexistence dune
flore diversifie, compose de plantes cultives (cultures marachres et fourragres ; arbres fruitiers et
forestires ; palmier dattier ) mais surtout despces spontanes vivaces et phmres connues pour
leur vertu en mdecine traditionnelle, ce qui se rpercutera sans doute sur la qualit thrapeutique du
miel saharien.

Mots cl : plantes mellifres, spectre pollinique, miel, apiculture, rgion saharienne

**************************************
A94
CONTRIBUTION A LA CARACTERISATION FLORISTIQUE DE DEUX OUEDS
DE LAHAGGAR (IDELES ET TASSAKIMT)

MEDJBER-TEGUIG .T, SAHKI R et ABIRI O.K

Laboratoire de Protection des Ecosystmes en Zones Arides et Semi Arides, Universit de Ouargla, Algrie
torkia_eco@yahoo.fr

Le Hoggar est une rgion environnement saharien spcial. Il porte une diversit floristique
importante ; cette richesse nous invite raliser une tude sur les plantes spontanes de deux Oueds de
cette rgion : - Oued Idels moyenne altitude - Oued Tassakimt haute altitude. Les rsultats
montrent quil y a 101 espces : 79 dans la station I et 58 dans la station II. Les espces les plus
frquentes et abondantes sont Moricandia arvensis dans la station I et Lotus jolyi dans la station II. Les
espces grand degr de recouvrement sont : Typha elephantina, Acacia raddiana Oued Idels er
Myrtus nivellei Oued Tassakimt. Dans les deux stations, les Champhytes et les Throphytes sont les
plus remarquables, les Phanrophytes sont faiblement reprsents avec lexistence des Cryptophytes.
Llment Saharo-sindien est le plus dominant puis le Mditerranen et lendmique dans les deux
Oueds. Lanalyse factorielle de correspondance montre leffet de laltitude, la gomorphologie et la
texture du sol sur la flore, dont elle dgage 05 groupes floristiques dans la station I et 04 dans la
station II. La diversit floristique dans lAhaggar est influence surtout par les facteurs : laltitude, la
gomorphologie et la texture du sol.

Mots cls : Hoggar, environnement spcial, diversit floristique, Altitude, Gomorphologie.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
113
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr


**************************************
A95

Mauginiella scaettae Trichoderma harzianum


1

2

1

2

mbachagha@Gmail.com


Trichoderma harzianum Mauginiella scaettae
MEA ) Malt Extract Agar (
90 30 ) 50 (
Trichoderma harzianum
harzianum Trichoderma 48 Mauginiella scaettae
. 100 X
.

: Mauginiella scaettae Trichoderma harzianum

**************************************
A96
EFFET DE TROIS REGIMES DE DILUTION D'EAU DE MER SUR DES
MARQEURS MOLECULAIRES (PROLINE ET SUCRES SOLUBLES) DE PLANTES
JUVENILES D'ATRIPLEX HALIMUS L. ET ATRIPLEX CANESCENS (PURCH)
NUTT
HADJ ADJ Soumia, BISSATI Samia, DJERROUDI Ouiza

Laboratoire de Bioressources Sahariennes, Universit de Ouargla, Algrie
hadjajsoumaia@gmail.com
LAtriplex, plante bien adapte laridit et la salinit, est considre parmi les espces vgtales
qui valorisent le mieux leau des terrains sals. Elle possde un systme racinaire trs dvelopp fixant
les couches suprieures du sol et peut tre utilise comme moyen de lutte contre la dsertification.
Dans ce travail, nous avons valus l'effet de trois rgimes de dilution d'eau de mer (0%, 50% et
100%) sur des paramtres molculaires: proline et sucres solubles et au niveau de divers organes de
deux espces dAtriplex: Atriplex halimus L. et Atriplex canescens (Purch) Nutt. Les rsultats
montrent que l'accumulation de proline et des sucres solubles varie selon l'organe de la plante, l'espce
et la concentration du traitement en sels. Les feuilles apicales dAtriplex halimus L. accumulent plus
de proline lorsque les plantes reoivent la solution saline 50% et 100% d'eau de mer et les feuilles
basales dAtriplex canescens sous salinit infrieure 50%. Par contre, ce compos azot migre
davantage vers les tiges des plantes stresses 100% deau de mer. Laccumulation des sucres
solubles est importante au niveau des feuilles dAtriplex canescens avec les trois traitements et
dAtriplex halimus L. sous salinit hautes concentrations 100%. A 50% deau de mer ces composs
glucidiques saccumulent davantage dans les tiges. La variabilit inter spcifique, rvle que les deux
espces utilisent les mmes mcanismes de tolrance la contrainte saline. La seule diffrence rside
au niveau des taux de synthse des marqueurs molculaires et de leurs lieux d'accumulation.

Mots cls : Atriplex, Eau de mer, Tolrance, Proline, Sucres solubles.
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
114
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr

**************************************
A97
LES FABACEAE DANS LA FLORE DU SAHARA SEPTENTRIONAL : CAS DES
REGIONS DE OUARGLA ET OUED RIGH

CHAABENA Ahmed
1
, LAOUAR M
2
, EDDOUD A
1
, CHEHMA A
1
, BABAHANI S
1
,
BRADAI L
1
, BENAMOR O
1
, SOUTA H. 3, RAHMANI A. 3, BENHANIA A
3
,
BOUZIANI I
3
, MAAMRI K
4
, TOUATI A
3
, TRABELSI H
3
, ACHOUR L
4
et
ABDELGUERFI A
5
.

1
Laboratoire de Bio-Ressources Sahariennes, Universit de Ouargla, Algrie
2
Laboratoire de Physiologie Vgtale, INRAA et L-RGB, El harrach, Algrie
3
Dptement de Biologie, Universit de Ouargla, Algrie
4
Dptement des Sciences Agronomiques, Universit de Ouargla, Algrie
5
L-RGB et L-CGAF, INA, El-harrach, Algrie
achaabena@hotmail.com

Le fourrage semble tre la premire culture sous jacente pratique au niveau de la cuvette de Ouargla
car 75.77% des exploitants cultivent au moins une espce fourragre durant la campagne agricole. Et
dans l'Oued Righ les fourrages occupent 20% de la surface cultive. De plus, quand il y a pratique de
culture fourragre, c'est la luzerne (Medicago sativa) qui est retenue (82 % des cas). Aussi, parmi les
"mauvaises herbes" qu'on retrouve le plus, au niveau des crales sous centres pivot, c'est le Mlilot
(Melilotus indica) et qui n'est pas limin s'il s'agit d'une culture fourragre comme l'avoine ou l'orge,
mais est fauch et donn avec les autres espces au btail. Et au niveau des parcours, parmi les 112
espces recenses (appartenant 38 familles botaniques), neuf (09) espces sont des Fabaceae et qui
sont rparties sur les diffrents reliefs gomorphologiques du Sahara algrien.

Mots clefs : Fabaceae, Fourrage, Rgion saharienne, Ouargla, Oued Righ


A98
EFFET DE QUELQUES BACTERIES ANTAGONISTES SUR LA FUSARIOSE
VASCULAIRE DU PALMIER DATTIER

BESSEDIK Fadila
Laboratoire de physiologie vgtale et d'amlioration des plantes
fadilabessedik@gmail.com

Le palmier dattier est menac par le bayoud, fusariose vasculaire. Le comportement du pathogne est
troitement li au comportement du reste de la microflore tellurique.
Ce prsent travail a pour objectif, la connaissance des microorganismes que renferme les sol des
palmeraies, et lisolement de microorganismes ayant un effet inhibiteur in vitro vis vis dune souche
agressive (Fusarium oxysporum f sp albedinis) en vue de mettre en place un moyen de lutte
biologique.
La caractrisation de quelques bactries est ralise. Il s'agit essentiellement de Bacillus

Mots cls: bayoud, palmier dattier, microorganismes, sol, lutte biologique.

Sminaire International sur: La protection et prservation des cosystmes sahariens 1ECOSYS09
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Index
Auteurs E-mail (s) Institutions
A.B.Mustafa ayman_balla@yahoo.com U. Khartoum, Sudan
ABDESSELAM S aksalah2001@yahoo.fr U. Djelfa
AID-HOUCHI A houchiaini@yahoo.fr U. Tizi Ouzou
AISSAOUI C. chadaissa@yahoo.fr CU d'El-Tarf
ALOUI. N alouinabila@yahoo.fr U. Ouargla
AMAROUCHE -YALA S sam.wassi.amarouche@gmail;com C.R.N.F, Alger
AMRANI. K aitamrane2000@yahoo.fr U. Maghrib
AMROUCHE. A abdelillahamrouche@yahoo.fr U. Bechar
ANNOU. G ghaniaanno@gmail.com U. Ouargla
BAALI-CHERIF D. bacherdj@yahoo.fr LRZA/USTHB
BAAMEUR M. baameurmalika@yahoo.fr U. Ouargla
BABAHANI. S bbhsouad@gmail.com U.Ouargla
BAHIANI. M. bahiani.m@hotmail.fr U.Adarar
BAHROUN. S sofia_bah@yahoo.fr U. Annaba
BEKKI. A abek31@hotmail.com U. Oran
BELHADI A aissabelhadi@yahoo.fr CRSTRA Biskra
BEN BRAHIM F fouzibenbrahim@yahoo.fr U. Ouargla
BEN SEMAOUNE, Y bensemyoucef@yahoo.com U. Ghardaia
BENADJ AOUD A ali.benadjaoud@laposte.net U. Bjaia
BENAZIZA A benaziza_abdelaziz@yahoo.fr U. Biskra
BENNAMA T tbennama@yahoo.fr U. Oran
BENSACI M B mbachagha@gmail.com U.Ouargla
BENSAHA H hocinemail@yahoo.fr U.Ghardaa
BENSALAH FARID bensalahfarid@yahoo.fr U. Oran
BENSMINA MIMECHE L l.mimeche@yahoo.fr U. Biskra
BERKAL I bismaiel@hotmail.com U. Ouargla
BESSEDIK F. fadilabessedik@gmail.com U. Oran
BOTTON B bernard.Botton@scbiol.uhp-nancy.fr U. Nancy
BOUAL Z biozakaria @yahoo.fr U. Ouargla
BOUAMMAR B bouammar1959@yahoo.fr U.Ouargla
BOUAZIZ S bz.sabrine@yahoo.fr U.Ouargla
BOUBENDIR A a.hafid.bio@gmail.com U. Biskra
BOUCHIKH Y. aminacorinna@yahoo.fr U. Saida.
BOUCHIKHI TANI Z. bou_zoheir@yahoo.fr U. Tlemcen
BOUDECHICHE L boudechiche_lamia@yahoo.fr U. Tarf
BOUDEFFEUR S saidboudeffeur@yahoo.fr INRA d'Alger
BOUDIAF-NAIT KACI M malikanboud@yahoo.fr U. Tizi Ouzou
BOUDJ ENAH S harunsali@yahoo.fr U. Ouargla
BOUGHABA L syranova@yahoo.fr U. Ouargla
BOUGHALEM M boughalem_2000@yahoo.fr U. Tlemcen
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
BOUGHEDIRI L boughediri2@yahoo.fr U.Annaba
BOUKHALFA H. H. hassinaboukhalfa@gmail.com U. Biskra
BOUKHALFA-DERAOUI N boukhalfan2005@yahoofr U. Ouargla
BOUKOUADA M moustapha0101@yahoo.com U.Ouargla
BOUSHABA N. nedjet22@yahoo.fr U. Oran
BOUTABIA L b_lamiadz94@yahoo.fr C.U. Tarf
BOUTOUTAOU D boutoutaoudjamel@yahoo.fr U. Ouargla
BRADAI ILYES bradai_i@yahoo.fr U. Ouargla
CHAABENA A
achaabena@hotmail.com
U. Ouargla
CHABOUNI S sarra.revs@yahoo.fr U. Ouargla
CHAHBAR N. chahabar_nora@yahoo.fr U. Boumerdes
CHAICH K khaledchach@yahoo.fr U. Ouargla
CHAKER-HADDADJ A assiachaker@yahoo;fr U. Boumerds
CHAOUCHE. S saidachaouch@yahoo.fr U.Ouargla
CHEBROUK F chebroukfarid@yahoo.fr U. Ouargla
CHEHMA A achehma@gmail.com U. Ouargla
CHERBI R rekia30@gmail.com U. Ouargla
CHIHI S ngherraf@yahoo.fr U. Ouargla
DADDI BOUHOUN M daddibm@yahoo.fr U. Ouargla
DECHICHE N diab_nassima@yahoo.fr I.A.M di Bari -IAM Bari ITALY
DEKHINAT S dekdz@yahoo.fr U. Batna
DEMNATI F fat_demnati@yahoo.fr U. Biskra
DILMI A amal.dilmi@yahoo.fr INA Alger
DJ ABRI L djabri_larbi@yahoo.fr U. Annaba
DJ AZOULI Z zahror2002@yahoo.fr U.Blida
DJ ERROUDI O zidaneouiza@yahoo.fr U. Ouargla
DJ IDDA A djidda@email.com U.baraki
DOKKAR K keltoumdokkar@yahoo.fr U. Ouargla
DOSSO M mireille.dosso@supagro.inra.fr Montpellier
DOUMANDJ I, A corino147@yahoo.fr U. Blida
DRICI H habibasiham@yahoo.fr U. Oran
EDDOUD A amar.eddoud@ina.dz U.Ouargla
EISA Mohamed Osman alhagmo33@gmail.com U. Sudan
FACI M fm_alg@yahoo.fr U.Ouargla
FITAS R rachid_fitas@yahoo.fr U. Stif
FORTAS Z Torfez2000@yahoo.fr U. Oran
FOUFOU Ammar foufouammar@yahoo.fr U. Mentpellier
GADDOUR A gaddour.omar@yahoo.fr I. R. A. Mdenine Tunisie
GHARBI S samiakarkachi@hotmail.com U. Mohamed boudiaf Oran
GHENABZIA I imene.gh@gmail.com U. Ouargla
GHERAIRI Y gherairi_yamina@yahoo.fr U. Ouargla
GHIABA Z ghiaba_zineb@yahoo.fr U. Ouargla
Sminaire International sur: La protection et prservation des cosystmes sahariens 1ECOSYS09
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
GHLIS NEE CHIAHI.N nghlisdz@yahoo.fr U. Souk Ahras
GOUASMIA G ghouzala23@yahoo.fr U. Ouargla
GOUDJ AL Y goudjal_y@yahoo.fr U. Laghouat
GRECU F abdellaouid@yahoo.fr U. Bucarest Paris
GUELLAL D drifa_guellal@yahoo.fr U.Boumerdes
HABA H Haba.hamada@yahoo.fr U. Batna
HACINI MESSAOUD Hacimess@yahoo.fr U. Ouargla
HADDANA S haddanaecologie@yahoo.fr U. Ouargla
HADDI R rihabhaddi@yahoo.fr U. Oran
HADDOU I haddou.ilies@yahoo.fr U. Ouargla
HADJ SEYD AEK seydtg@gmail.com C. U. Ghardaia
HADJ ADJ S hadjajsoumaia@gmail.com U. Ouargla
HADJ AIDJ I F Hadjaidji_f@yahoo.fr U. Ouargla
HALITIM A. amor.halitim@gmail.com U. Batna
HALITIM S. salihahalitim@yahoo.fr U. Batna
HAMEURELAIN S nouargla@yahoo.fr U. Ouargla
HAMID OUDJ ANA A nadjah.oudjana2007@yahoo.fr U. Ouargla
HAMIRI M manalhmi@yahoo.fr U. Tbessa
HAMMOUDI R rokia1811@yahoo.fr U. Ouargla
HAMOUDA L. caralind001@yahoo.fr U. Oran
HELIMI S helimisamia@yahoo.fr U. Ouargla
HOUARI K.D kahina_eco@yahoo.fr U. Ouargla
HOUICHITI R samiabouafia@yahoo,fr U. Ouargla
IDDER A idder_haki@yahoo.fr U. Ouargla
IDDER M. A azzou.idder@yahoo.fr U. Ouargla
IDDER T tahar_id@yahoo.fr U. Ouargla
IDDER-IGHILI H idder.ighili@yahoo.fr U. Ouargla
KACI S kaci_safia@yahoo.fr U. Ouargla
KADI H hamidkadi08@yahoo.fr U. Bechar
KAHELSEN C ka.cherif.dz@yahoo.fr U. Ouargla
KAID-HARCHE M Armoise2001@yahoo.fr U. Oran
KARABI M mokhtarmsk@hotmail.com U. Ouargla
KEMASSI A akemassi@yahoo.fr U. Ouargla
KENDOUR Z zaken1977@yahoo.fr U. Ouargla
KHAIB DIT NAIB O naibouahiba@yahoo.fr U. Oran
KHALLEF S sakina_khallef@yahoo.fr U. Ouargla
KHAMGANI M malek.khemgani@yahoo.com U. Ouargla
KHELIL R rkhelil2002@yahoo.fr U. Ouargla
KHENE B khenebachir@yahoo.fr U. Ghardaia
KOLAI N Kolainaouel@yahoo.fr U. Mostaganem
KORICHI R korichkov@hotmail.fr U. Ouargla
LAABOUDI A laaboudiaek@yahoo.fr INRAA Adrar
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
LAALLAM H nrhalimi@yahoo.fr U. Ouargla
LABED B ngherraf@yahoo.com U. Ouargla
LACHEBI S samia_lachebi@yahoo.fr U. Boumedes
LAOUALI M.S sanicrobi@yahoo.fr U. Niamey
LAOUINI S. D salah_laouini@yahoo.fr U. El Oued
LAZALI M m.lazali@yahoo.fr E.N.S.A Elharrach Alger
LEBTAHI F, fatyleb@yahoo.fr U. Bab Ezzouar
LEKOUAGHET A lekouaghet_23@yahoo.fr U. ANNABA
LONGO-HAMMOUDA H fhlongohammouda@yahoo.fr U. Alger
MAALEM S soubenyou@yahoo.fr U. Tbessa
MAAMAR K maamar_kader@yahoo.fr INRF
MAHBOUB N bioch_nasma@yahoo.fr U. Ouargla
MEDJ BAR T torkia_eco@yahoo,fr U. Ouargla
MEDJ RAB F farouk711@yahoo.fr U. Batna
MEGUEDAD-DIABI S sihamdiabi6@gmail.com U.ORAN
MEGUELLATI S maguellati_soumia@yahoo.fr U. El Oued
MEHAOUA M.S linaseghir@yahoo.fr U. Biskra
MEHDAUOI A mehdaoui_ahmed@yahoo.fr U. Adrar
MEKAOUSSI H mekayet@yahoo.fr U. Batna
MERGOUD L con_ann_war@yahoo.fr U. Ouargla
MEZIANI A meziani.assia@yahoo.fr C.U. El-Oued
MIMOUNII Y yamina.mimouni_@yahoo.fr U. Ouargla
MOKADEM K mo2kadem@mail.com U. Ouargla
MOUANE A nawelfsom@yahoo.fr U. Biskra
MOUAS BOURBIA S myahiaoui72@yahoo.fr U.M.M.T.O
NADHIRA SAIL A sail_nadi@yahoo.fr U. Ouargla
NEZZAR A nezzarabdelhamid@yahoo.fr> CRSTRA Biskra
OMEIRI N nawel702001@yahoo.fr U. Ouargla
OUAFI S saida_ouafi@yahoo.fr U. Bab Ezzouar
OUAMER-ALI K oa_karim@yahoo.fr INSID/ DMV Alger
OULAD BELKHIR A ouladbelkhir_amar@yahoo.fr U. Ouargla
OULD ELHADJ K. A. aminatakhelil@yahoo.fr U. Ouargla
OULD ELHADJ M. D. mohameddidi@yahoo.fr U. Ouargla
OUSTANI M belsam.oustani@yahoo.fr U. Ouargla
RACHED W wahiba200631@yahoo.fr U. Oran
RAMDANE F farahramdane@yahoo.fr U. Ouargla
SADINE S. D sse.scorpion@yahoo.fr U. Ouargla
SAGGAI M.M mounirsaggai@yahoo.fr U. Ouargla
SAKER M.L sakermohamedlakhdar@yahoo.fr U. Ouargla
SALHI. A aek_salhi@yahoo.fr U. Ouargla
SAOULI K akessai05@yahoo.fr U. Biskra
SAYAD I amar.eddoud@ina.dz U. Ouargla
Sminaire International sur: La protection et prservation des cosystmes sahariens 1ECOSYS09
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
SAYAH. z zineb.sayah@yahoo.fr U. Ouargla
SEBAA A sebaat @ yahoo.fr CRSTRA Touggourt
SENOUSSI A senoussi.hakim@yahoo.fr U. Ouargla
SIBOUKEUR O. oum_siboukeur@yahoo.fr U. Ouargla
SLIMANI. N nouri.ecologie@yahoo.fr U. Ouargla
SLIMANI. S slimanisaid@yahoo.fr U. Ouargla
SMAIL-SAADOUN N saadoun_n2002@yahoo.fr U. Tizi-Ouzou
SOUALMI N snadia04@yahoo.fr U. Tiaret
TAIBAOUI B. Taibaoui.b2006@yahoo.fr U. Djelfa
TALBI Z. talbizahera@yahoo.fr U. Oran
TANKARI DAN-BADJ O A tankari@yahoo.fr U. Abdou Moumouni de Niamey Niger
TARAI N tari_nc@yahoo.fr U. Biskra
TELLI A alia.telli@gmail.com U.Ouargla
TIR C tirtir2009@yahoo.fr U. M'sila
TIRICHINE A atirichine@yahoo.fr I.N.R.A.A dAlger
TITAOUINE. M yassinevet@yahoo.fr U. Biskra
TRABELSI H tr.hafida@yahoo.fr U. Ouargla
YAMANI A yamani.amal@yahoo.fr U. M
ed
premier Oujda Maroc
YATTA D eldjouzidjamila@yahoo.fr U. Baraki
YOUCEF F youcef_yf@yahoo.fr U. Ouargla
ZEDDOURI A azizpointcom22@yahoo,fr U. Ouargla
ZEGAYE F bvfarah@yahoo.fr U. M
ed
premier Oujda Maroc
ZEGUERROU R Zeguerroureguia@yahoo.fr CRSTRA Biskra
ZENKHRI S zensalah@yahoo.fr U.Ouargla
ZIZA. F. Z zizafahimazohra@gmail.com INRAA Barakai Alger











Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
Index des auteurs
A.B.Mustafa. 58
ABDESSELAM S. 38
AID-HOUCHI A... 95
AISSAOUI C. 27
ALOUI. N.. 76
AMAROUCHE -YALA S 26
AMRANI. K.. 05
AMROUCHE. A... 100
ANNOU. G 52
BAALI-CHERIF D... 70
BAAMEUR M.. 88
BABAHANI. S. 06
BAHIANI. M. .. 01
BAHROUN. S.. 28
BEKKI. A. 43
BELHADI A. 70
BEN BRAHIM F.. 41
BEN SEMAOUNE, Y.. 74
BENADJ AOUD A 105
BENAZIZA A.. 37
BENNAMA T... 80
BENSACI M B 61, 113
BENSAHA H 68
BENSALAH FARID. 18
BENSMINA MIMECHE L.. 32
BERKAL I 33
BESSEDIK F. 114
BOUAL Z.. 47
BOUAMMAR B.. 13
BOUAZIZ S.............. 62
BOUBENDIR A 19
BOUCHIKH Y.. 72
BOUCHIKHI TANI . 78
BOUDECHICHE L.. 19, 20
BOUDEFFEUR S. 10
BOUDIAF-NAIT K.. 97
BOUDJ ENAH S 13 , 71, 75
BOUGHABA L. 108
BOUGHALEM M. 96
BOUGHEDIRI L... 03
BOUKHALFA H. H. 26
BOUKHALFA-DERAOUI N... 38
BOUKOUADA M 59
BOUSHABA N. 75
BOUTABIA L... 108
BOUTOUTAOU D.. 35
BRADAI ILYES... 111
CHAABENA A.
114
CHABOUNI S.. 76
CHAHBAR N.. 01
CHAICH K.. 101
CHAKER-HADDADJ A. 94
CHAOUCHE. S 08
CHEBROUK F. 109
CHEHMA A.................. 15
CHERBI R. 101
CHIHI S. 109
DADDI BOUHOUN M 29,86
DEKHINAT S.. 94
DEMNATI F. 110
DILMI A... 92
DJ ABRI L 25
DJ AZOULI Z 04
DJ ERROUDI O 48
DJ IDDA A 04
DOKKAR K. 77
DOSSO M. 34
DOUMANDJ I, A.. 15, 73
DRICI H 16
EDDOUD A.. 07
EISA M. O.... 20
FACI M. 69
FITAS R 27
FORTAS Z... 51
FOUFOU A... 98
GADDOUR A... 72
GAHNEM O. 97
GHARBI S 63
GHENABZIA I. 57
GHERAIRI Y 23
Sminaire International sur: La protection et prservation des cosystmes sahariens 1ECOSYS09
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
GHIABA Z 68
GHLIS NEE CHIAHI.N .. 56
GOUDJ AL Y. 49
GRECU F.. 24
GUELLAL D. 67
GOUASMIA G. 84
HABA H 50
HACINI M.... 31
HADDANA S... 102
HADDI R.. 55
HADDOU I... 59
HADJ SEYD A E K...................... 46
HADJ ADJ S. 113
HADJ AIDJ I F... 57
HALITIM A... 34
HALITIM S... 42
HAMEURELAIN S.. 110
Hamid Oudjana A 62
HAMIRI M.. 22
HAMMOUDI R 106
HELIMI S 90
HOUARI K.D 54
HOUICHITI R. 69
IDDER A... 44,88
IDDER M. A. 30,84
IDDER T... 30,85
IDDER-IGHILI H. 09,87
KACI S.. 111
KADI H. 53
KAHELSEN C.. 23
KAID-HARCHE M... 54
KARABI M 90
KEMASSI A. 48
KENDOUR Z 104
KHAIB DIT NAIB O 71
KHALLEF S. 76
KHAMGANI M 91
KHELIL R. 81
KHENE B.. 39
KOLAI N . 49
KORICHI R.. 64
LAABOUDI A. 37
LAALLAM H.. 112
LABED B. 106
LACHEBI S. 17
LAOUINI S. E... 79
LAZALI M 107
LEBTAHI F,. 06
LEKOUAGHET A 104
LONGO-HAMMOUDA H.. 16
MAALEM S.. 50
MAAMAR K. 93
MAHBOUB N... 14
MEDJ BAR T. 63,112
MEDJ RAB F. 95
MEGUEDAD-DIABI S 11
MEGUELLATI S.. 82
MEHAOUA M.S... 07
MEHDAUOI A. 24
MEKAOUSSI H 92
MERGOUD L... 81
MEZIANI A. 21
MIGEON A.. 21
MIMOUNII Y.. 61
MOKADEM K 86
MOUANE A. 66
MOUAS BOURBIA S. 39
NADHIRA SAIL A.. 40
NEZLI I. E 99
NEZZAR A... 66
OMEIRI N. 41
OUAFI S... 46
OUAMER-ALI K. 98
OUSTANI M 89
RACHED W.. 52
RAMDANE F.. 107
SADINE S. E. 83
SAGGAI M.M .. 28,87
SAKER M.L.. 29,85
SALHI. A.. 12
SAYAD I. 103
SAYAH. Z 60
SEBAA A.. 11
SENOUSSI A 17
Sminaire International Protection et Prservation des EcosystmesSahariens (1.ECOSYS09)
Ouargla, les 13,14 et 15 dcembre 2009
Tel/Fax : 029 71 65 71 e-mail : ecosys.2009@yahoo.fr / ouargla.oasis@yahoo.fr
SLIMANI. N 54
SLIMANI. S. 100
SMAIL-SAADOUN N.. 56
SOUALMI N. 105
TAIBAOUI B.... 73
TALBI Z 79
TANKARI DAN-BADJ O A. 31
TARAI N... 65
TELLI A 09
TIR C. 43
TIRICHINE A.. 02
TITAOUINE. M 14
TRABELSI H 103
YAMANI A... 44
YATTA D. 03
YOUCEF F 82
ZEDDOURI A... 33
ZEGUERROU R... 45
ZENKHRI S. 08
ZIZA. F. Z. 36