Vous êtes sur la page 1sur 6

Mr HAGUES BA3 biotechnologie 2013-2014

Gnie gntique : exercices dapplication


Dosage, restriction, clonage et PCR.

Introduction :
Les exercices suivants permettent davoir une comprhension thorique des mcanismes
mis en jeu dans les principales ractions de la biologie molculaire.
Exercice 1
Squence et restriction
La squence dun ADN bicatnaire (double brin), correspondant un gne, est partiellement
reporte ci-dessous.
5 ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3
1) Ecrire la squence et lorientation du second brin de ce fragment.

2) Donner le brin complmentaire dARN

3) Sur une reprsentation dtaille de lenchanement de deux nuclotides dun brin dADN
du site BamH I dont les bases seront reprsentes par les lettres correspondantes,
indiquer ( laide dune flche) quelle liaison est rompue sous laction de lenzyme BamH I.

4) Soient les enzymes de restriction BamH I, Pst I, Xho I et Mbo I dont les sites reconnus sont :
BamH I : 5' G/GATCC 3' ; Pst I : 5' CTGCA/G 3' ; Xho I : 5' C/TCGAG 3' ; Mbo I : 5' /GATC 3'.
Recopier la squence de lADN et encadrer les sites de restriction en indiquant la position des
coupures.

5) Pour chaque enzyme, crire les squences des extrmits des molcules dADN digres
et prciser le type dextrmits obtenu.

6) On mlange ce brin dADN appari avec son brin complmentaire un autre fragment
dADN double brin. La solution est porte une temprature suprieure leurs Tm
respectives, puis refroidie. Que peut-on attendre?

8) Voici la squence dune amorce (ou primer) : 5 - TTTCTGCA- 3
O cette amorce se fixera-t-elle sur la squence dADN ? Quelle squence obtiendra-t-on
aprs longation par la DNA-polymrase ?

Exercice 2
lectrophorse aprs restriction
Mr HAGUES BA3 biotechnologie 2013-2014
L'ADN dun cosmide recombinant* de 48,6 kpb a t hydrolys par l'enzyme de restriction
Sal I. Cet ADN est analys par lectrophorse sur gel dagarose (pistes 2 et 4). Un marqueur
de taille (l'ADN du phage lambda hydrolys par l'enzyme de restriction Hind III ) est dpos
dans les puits 1 et 3. Ce marqueur de taille est un mlange quimolaire de fragments dADN
de tailles connues. La quantit dADN total dpos dans les puits 1 et 2 est le double de celle
des puits 3 et 4. Aprs coloration par le bromure dthidium, limage suivante est obtenue.
* On rappelle quun cosmide est un vecteur artificiel constitu d'un plasmide auquel a t ajout le site COS du
bactriophage lambda. L'intrt des cosmides rside dans le fait qu'ils permettent le clonage de fragments d'ADN de
grande taille soit environ de 45kpb.



1) laide des valeurs du tableau I, tracer la courbe talon :
Log taille(pb) = f(distance de migration).

2) partir de cette courbe, dduire la taille des fragments issus de la digestion par l'enzyme
de restriction Sal I de l'ADN du cosmide recombinant (pistes 2 et 4).

3) La somme des tailles des fragments obtenus vous semble-t-elle en accord avec la taille
attendue de 48,6 kpb ?

Mr HAGUES BA3 biotechnologie 2013-2014
4) Le bromure dthidium s'intercale entre les bases de l'ADN de manire uniforme sur une
molcule d'ADN linaire. tudiez attentivement la photo du profil de restriction, que
remarquez-vous? Quen dduisez-vous ?

Exercice 3
tablissement de la carte de restriction dun plasmide
On propose dtablir la carte de restriction dun plasmide circulaire double brin avec les
enzymes PstI et EcoRV.
On prcise que les sites de restriction pour PstI et EcoRV sont respectivement :
PstI : CTGCAG
EcoRV : GATATC
1- Schmatiser les ractions catalyses par les enzymes PstI et EcoRV. Comment nomme-t-
on les extrmits obtenues ?
2- Quelle est la probabilit thorique de trouver un site de coupure de lADN par PstI et
EcoRV en supposant que la composition et la rpartition des bases soient alatoires ? Quelle
serait la taille des fragments ainsi gnrs ?
3- La digestion du plasmide par PstI et EcoRV donne les rsultats suivants :

tablir la carte de restriction de ce plasmide

Exercice 4
Clonage et analyse de l'ADN recombinant
On souhaite tudier la fonctionnalit dun gne M dune bactrie. Pour cela, on essaie de le
cloner au site Eco RI du vecteur plasmidique pBR330 (voir schma) un fragment Eco RI-Eco RI
d'ADN gnomique de la bactrie dintrt :


a- Proposez un protocole de clonage et indiquez comment vous slectionnez les clones
recombinants.

b- Un des plasmides recombinants contenant le gne M (appel pBM1) est digr par les
enzymes de restriction Bam HI et Eco RI. Aprs migration et sparation des fragments d'ADN
Mr HAGUES BA3 biotechnologie 2013-2014
sur gel d'agarose puis coloration au bromure d'thidium, on obtient les profils de restriction
suivants:

Donnez la carte de restriction du plasmide recombinant pBM1. Dterminez la taille de
linsert.

Exercice 5
Modification du plasmide pBR322 par laction successive denzymes
Le plasmide pBR322 possde un site unique de restriction pour EcoRI. (EcoRI : GAATTC)

Le plasmide est schmatis ci-dessous :

On ralise successivement sur la plasmide les manipulations suivantes :
- Traitement par EcoRI
- Incubation avec la polymrase I en prsence de dATP et de dTTP
- Incubation avec la ligase T4 en prsence dATP
1- Schmatisez les ractions enzymatiques effectues et conclure
2- Quel serait le produit obtenu aprs la mme succession de ractions si le site de
restriction tait orient comme suit :

Exercice 5
Choix des amorces pour PCR
On se propose damplifier par PCR un fragment nuclotidique du rsidu 118 288 inclus de
la squence suivante. La taille des amorces est de 21 bases.


Mr HAGUES BA3 biotechnologie 2013-2014
1- Quelle sera la taille du fragment amplifi sans tenir compte des amorces ? Et en tenant
compte de ces amorces ?
2- Indiquez la squence des amorces de 21 bases ncessaires pour amplifier le segment
dsign.
3- Rappelez les critres de choix des amorces.
4- Calculez la temprature de fusion Tm de chaque amorce en utilisant la relation :
Tm = 2.(A+T) + 4.(G+C) en C
5- Calculez la temprature de fusion de chaque amorce en utilisant la relation
thermodynamique du plus proche voisin. Conclure
Site recommand pour dterminer la Tm : http://www.promega.com/biomath/calc11.htm
Exercice 5
Squenage
Vous disposez dun brin dADN squencer (matrice), dune amorce, dADN polymrase
tronque*, des quatre 2-dsoxyribonuclotides (dXTP) et dun jeu des diffrents 2,3-
didsoxyribo-nuclotides (ddXTP). Lamorce est radiomarque par du phosphore radioactif
32P.
LADN matriciel squencer ACGTAATCGC---- comporte, son extrmit 3, une squence
supplmentaire (reprsente ici par un segment de droite en pointill) sur laquelle lamorce
va shybrider, crant ainsi le site dinitiation de lADN polymrase.
*lenzyme est constitue de plusieurs domaines dont lun est responsable de la destruction "
programme " de lamorce ; aprs limination de ce domaine, la fraction restante, dsigne "
fragment de Klenow ", conserve lactivit ADN polymrase.

1 Rsumez brivement le principe de la mthode en indiquant le rle du
didsoxyribonuclotide.

2 Complter le tableau en indiquant la composition des diffrents milieux ractionnels et,
pour chaque milieu, le type et la taille des fragments nosynthtiss.

Mr HAGUES BA3 biotechnologie 2013-2014


3 Sur le gel ci-dessous, reprsenter la taille des fragments nosynthtiss dans chaque
milieu ractionnel (utiliser lchelle de taille reprsente gauche du schma)
4 Reporter, droite, la squence du brin synthtis puis la squence recherche, en
indiquant le sens de lecture des squences tablies.