Vous êtes sur la page 1sur 27

DNA FINGERPRINT

-Sidik jari (1930)----- Sidik DNA (1989)


-- Sidik jari dapat diubah dengan di operasi
-Sidik DNA: - Ada pada semua jaringan
-- Tidak dapat diubah
Struktur DNA:
1. Struktur molekul: C (cytosin)
G (guanin)
A (adenin)
T (thymin)
2. Bangunan dasar nukleotida:
- gula/sugar
- desoksiribosa
- kelompok phosphat
- 4 nitrogen dasar berpasangan:

A-T; C-G; G-C; T-A;
Determinasi
@ Segmen DNA dideterminasi dari pasangan gula phosphat
@ DNA membedakan :
- Karakter
- Organisme
- Individu
Nucleotida (asam amino)
Chromosome
Chromosome




Kromosom
Lengan pendek
(p)






Lengan panjang
(q)
Analisis DNA
1. Isolasi DNA: darah, rambut, kulit, sperma dsb



2. Memotong mengukur dan mensortir (restriksi):
dengan enzim restriksi asal bakteri:
mis Eco RIpada sequen GAATTC




3.- Elektroforesis gel
- Transfer DNA ke nylon




4. Probing: -dengan radioaktif- DNA.FP
- Pewarna probDNA.FP


5. DNA. FP dengan pewarna prob lagi
Sidik DNA
Setelah proses elektroporesis, kemudian
Diwarnai:
Dengan methylen blue untuk pewarnaan gel
Konvensional

Pewarnaan khusus untuk
peningkatan penampilan
Dan memudahkan pembacaan,
dapat diwarnai :
Dengan: - Carolina blue, atau
- Quikviem DNA

Kedua jenis pewarnaan ini
dapat mengurangi
Back ground dan meningkatkan sensitiviti
POLYMERASE CHAIN REACTION (PCR)
Reaksi penggandaan DNA:

Diperlukan: - DNA original
- dua molekul primer nukleotida utuh
- larutan buffer
- Taq DNA polimerases (enzim):



Fungsi/kegunaanya: - Melipatgandakan DNA dengan cara
mengkopi(copy)
- Diagnosis untuk mengkonformasi DNA
Proses PCR
Denaturasi annealing primer Replikasi DNA
Denaturasi (suhu 94-96
o
C)
Dobel helix strand dipisah
Annealing Primer (suhu 50-65
o
C)
annealing/primer melekat pada masing-masing strand
Replikasi DNA (suhu 72
o
C)
masing-masing strand digandakan
Aplikasi DNA FP
1. Mendiagnosis Kelainan keturunan (genetik)
- pada janin yang belum dilahirkan
- Bayi yang baru dilahirkan

2. Penelitian mengenai kelainan genetik
Normalbandingkan --Kelainan

3. Bukti biologik: untuk laboratorium forensik

Penyakit Genetik
Gen
makhluk
hidup
Ling-
kungan
Klasifikasi penyakit genetik
Penyakit
Genetik
Autosomal
dominan
Autosomal
resesif
X-Y-link
X-link
Dominant:
*Aicardi
*Klinefelter
*Hipo-
phospatemi
a
*Achondro-
plasia
*Huntington
-disease
*Marfan
disease
*Cystic
fibrosis
*Sickle cel
anemia
*Spinal-
muscular
atrophy
X-link
Resesif:
*Hemophilia
*Buta warna
*Muscular
destrofi
Y-link:
*Infertility
pria

Mitokondri
a
*Leber
hereditary
optic
neurophaty
Multi-
factorial
*Autisme
*Hipertensi
*Cancer
*Mental
dis.
dsb
Achondroplasia
ENZIM UNTUK RESTRIKSI

Enzim Organisme sequen yang
dikenal
-------------------------------------------------------------------------------------------------------------------------
EcoRI Escherichia coli GAATTC
BamHI Bacillus amyloliquefaciens GGATCC
Bgl/II bacillus globigii AGATCT
PvuII proteus vulgaris CGATCG
PvuIII Proteus vulgaris CAGCTG
HindIII haemophilus influenzaeRd AAGCTT
HinfI Haemophilus influenzaeRf GANTC
Sau3A Staphylococcus aureus GATC
AluI Arthrobacter luteus AGCT
TaqI Thermus aquatus TCGA
HaeIII haemophilus aegyptius GGCC
NotI Nocardia otitidis-caviarum GCGGCCGC

Mutasi DNA
Kelainan keturunan


Kasus perselingkuhan (hal. 51)
Kasus perkosaan (hal 52)
Kasus perkosaan (hal. 53)
MINI-SATELIT
Variable Number Tandem Repeat (VNTR)
-Pada kromosom manusia ada sequens pendek yang diulang

-Ulangan : dari 1-30 ulangan

-Dapat dipotong pada variasi jumlah tandem repeat: dengan cara
- hibridisasi dan probe spesifik
TAAGGGCCATAAGGGCCATAAGGGCCA

VNTR
VNTR
Ayah


Ibu
Ayah ---------------Anak------------------ Ibu
VNTR
Single locus:
-memperlihatkan locus-tunggal probe VNTR sangat mudah
diinterpretasikan untuk setiap individu dengan band yang tidak
lebih dari dua

-Digunakan di Amerika untuk penyidikan forensik dan jejak
keturunan
Multi locus:
-Memperlihatkan locus-multi probe VNTR, banyak informasi
yang dapat dibaca secara simultan dengan band antara 10-30
Tetapi agak susah interpretasinya

-Digunakan di Eropa untuk penyidikan forensik dan jejak
keturunan