Indice de Biología

1. Bioelementos 3. Glúcidos 4. Lípidos

2. El agua: una extraña molécula

5. Proteínas
s

Los 20 Aminoácidos Enlace peptídico: Gif animado

s

6. Enzimas
s

7. Ácidos Nucléicos

Estructura del ADN Transferencia de la información s Síntesis de ARN o TRANSCRIPCIÓN Síntesis de proteínas o TRADUCCIÓN Código genético Regulación de la expresión génica

s s s s

Actividades de bioquímica

Actividades de genética molecular

http://www.arrakis.es/~lluengo/biologia1.html (1 of 5)01/08/2004 9:20:22

Indice de Biología

1. El origen de la vida 2. Origen de la célula 3. Tipos de células&
s

La célula animal en Flash s La célula vegetal en Flash s Dibujo de una célula eucariota animal s Dibujo de una célula eucariota vegetal 4. Organización de la célula eucariota 1. Membrana Ampliado
s s s s

2. Citoplasma : Hialoplasma y citoesqueleto

Estructura Transporte Reconocimiento Diferenciaciones

Retículo endoplásmico s A. de Golgi s Lisosomas s Mitocondrias s Cloroplastos 3. Núcleo 4. Componentes celulares
s

5. Fisiología celular 1. Funciones de autoconservación 2. Energética celular: Fotosíntesis. 1. Fase luminosa 2. Fase oscura

http://www.arrakis.es/~lluengo/biologia1.html (2 of 5)01/08/2004 9:20:22

Indice de Biología

3. Hipótesis quimiosmótica de la fotofosforilación 4. Importancia biológica de la fotosíntesis 3. Energética celular: Respiración
s

Glucolisis
s

gif animado de glucolisis (46 KB)

s

Ciclo de Krebs
s

gif animado del ciclo de krebs

s

s

Transporte de electrones < Hipótesis quimiosmótica
(síntesis de ATP)

El ATP 4. Reproducción celular s El ciclo celular s Mitosis s Meiosis
s s

gif animado de la meiosis

Actividades de citología

http://www.arrakis.es/~lluengo/biologia1.html (3 of 5)01/08/2004 9:20:22

Indice de Biología

1. Funciones de nutrición r Aparato Digestivo r Aparato Circulatorio r Aparato Respiratorio r Aparato Excretor 2. Reproducción y desarrollo 3. Coordinación neuro-endocrina r Hormonas. Acción hormonal. Glándulas endocrinas r Anomalías endocrinas r Cuadro resumen: Acción y efecto de las hormonas 4. Genética mendeliana r Conceptos básicos r Principios de Méndel
s r r r r

Animación

r

Series alélicas Herencia del sexo Genes ligados Mutaciones 1. Cromosómicas 2. Genómicas 3. Génicas Problemas de genética 1. Herencia de un carácter 2. Herencia de dos caracteres 3. Herencia de alelos múltiples 4. Herencia ligada e influída por el sexo.

http://www.arrakis.es/~lluengo/biologia1.html (4 of 5)01/08/2004 9:20:22

Indice de Biología

1. 2. 3. 4.

Bacterias Virus Priones y "enfermedad de las vacas locas" Inmunología

Actividades de Microbiología

http://www.arrakis.es/~lluengo/biologia1.html (5 of 5)01/08/2004 9:20:22

Bioelementos

Todos los seres vivos están constituidos, cualitativa y cuantitativamente por los mismos elementos químicos. De todos los elementos que se hallan en la corteza terrestre, sólo unos 25 son componentes de los seres vivos . Esto confirma la idea de que la vida se ha desarrollado sobre unos elementos concretos que poseen unas propiedades físico-químicas idóneas acordes con los procesos químicos que se desarrollan en los seres vivos. Se denominan elementos biogénicos o bioelementos a aquellos elementos químicos que forman parte de los seres vivos. Atendiendo a su abundancia (no importancia) se pueden agrupar en tres categorías: r Bioelementos primarios o principales: C, H, O, N Son los elementos mayoritarios de la materia viva, constituyen el 95% de la masa total. Las propiedades físico-químicas que los hacen idóneos son las siguientes: 1. Forman entre ellos enlaces covalentes, compartiendo electrones 2. El carbono, nitrógeno y oxígeno, pueden compartir más de un par de electrones, formando enlaces dobles y triples, lo cual les dota de una gran versatilidad para el enlace químico 3. Son los elementos más ligeros con capacidad de formar enlace covalente, por lo que dichos enlaces son muy estables. 4. A causa de la configuración tetraédrica

Los elementos de la vida

de los enlaces del carbono, los diferentes tipos de moléculas orgánicas tienen estructuras tridimensionales diferentes . Esta conformación espacial es responsable de la actividad biológica.

5. Las combinaciones del carbono con otros elementos, como el oxígeno, el hidrógeno, el nitrógeno, etc.,

http://www.arrakis.es/~lluengo/elementos.html (1 of 4)01/08/2004 19:22:52

Bioelementos

permiten la aparición de una gran variedad de grupos funcionales que dan lugar a las diferentes familias de sustancias orgánicas . Estos presentan características físicas y químicas diferentes, y dan a las moléculas orgánicas propiedades específicas, lo que aumenta las posibilidades de cración de nuevas moléculas orgánicas por reacción entre los diferentes grupos. 6. Los enlaces entre los átomos de carbono pueden ser simples (C - C), dobles (C = C) o triples.

r

lo que permite que puedan formarse cadenas más o menos largas, lineales, ramificadas y anillos. Bioelementos secundarios S, P, Mg, Ca, Na, K, Cl Los encontramos formando parte de todos los seres vivos, y en una proporción del 4,5%.

http://www.arrakis.es/~lluengo/elementos.html (2 of 4)01/08/2004 19:22:52

Bioelementos

Azufre

Se encuentra en dos aminoácidos (cisteína y metionina) , presentes en todas las proteínas. También en algunas sustancias como el Coenzima A Forma parte de los nucleótidos, compuestos que forman los ácidos nucléicos. Forman parte de coenzimas y otras moléculas como fosfolípidos, sustancias fundamentales de las membranas celulares. También forma parte de los fosfatos, sales minerales abundantes en los seres vivos. Forma parte de la molécula de clorofila, y en forma iónica actúa como catalizador, junto con las enzimas , en muchas reacciones químicas del organismo. Forma parte de los carbonatos de calcio de estructuras esqueléticas. En forma iónica interviene en la contracción muscular, coagulación sanguínea y transmisión del impulso nervioso. Catión abundante en el medio extracelular; necesario para la conducción nerviosa y la contracción muscular Catión más abundante en el interior de las células; necesario para la conducción nerviosa y la contracción muscular Anión más frecuente; necesario para mantener el balance de agua en la sangre y fluído intersticial

Fósforo

Magnesio Calcio Sodio Potasio Cloro

q

Oligoelementos

Se denominan así al conjunto de elementos químicos que están presentes en los organismos en forma vestigial, pero que son indispensables para el desarrollo armónico del organismo. Se han aislado unos 60 oligoelementos en los seres vivos, pero solamente 14 de ellos pueden considerarse comunes para casi todos, y estos son: hierro, manganeso, cobre, zinc, flúor, iodo, boro, silicio, vanadio, cromo, cobalto, selenio, molibdeno y estaño. Las funciones que desempeñan, quedan reflejadas en el siguiente cuadro:
Fundamental para la síntesis de clorofila, catalizador en reacciones químicas y formando parte de citocromos que intervienen en la respiración celular, y en la hemoglobina que interviene en el transporte de oxígeno.

Hierro

Manganeso Interviene en la fotolisis del agua , durante el proceso de fotosíntesis en las plantas. Iodo Flúor Cobalto Silicio Cromo Zinc Litio
Necesario para la síntesis de la tiroxina, hormona que interviene en el metabolismo Forma parte del esmalte dentario y de los huesos. Forma parte de la vitamina B12, necesaria para la síntesis de hemoglobina . Proporciona resistencia al tejido conjuntivo, endurece tejidos vegetales como en las gramíneas. Interviene junto a la insulina en la regulación de glucosa en sangre. Actúa como catalizador en muchas reacciones del organismo. Actúa sobre neurotransmisores y la permeabilidad celular. En dosis adecuada puede prevenir estados de depresiones.

Molibdeno Forma parte de las enzimas vegetales que actúan en la reducción de los nitratos por parte de las plantas.

http://www.arrakis.es/~lluengo/elementos.html (3 of 4)01/08/2004 19:22:52

Untitled

El agua: La vida se apoya en su comportamiento anormal
El agua, una molécula simple y extraña, puede ser considerada como el líquido de la vida. Es la sustancia más abundante en la biosfera, dónde la encontramos en sus tres estados y es además el componente mayoritario de los seres vivos, pues entre el 65 y el 95% del peso de de la mayor parte de las formas vivas es agua. El agua fue además el soporte donde surgió la vida. Molécula con un extraño comportamiento que la convierten en una sustancia diferente a la mayoría de los líquidos, posee una manifiesta reaccinabilidad y posee unas extraordinarias propiedades físicas y químicas que van a ser responsables de su importancia biológica. Durante la evolución de la vida, los organismos se han adaptado al ambiente acuoso y han desarrollado sistemas que les permiten aprovechar las inusitadas propiedades del agua.
q

Estructura del agua Propiedades físicoquímicas
1. Acción disolvente 2. Elevada fuerza de cohesión 3. Elevada fuerza de adhesión 4. Gran calor específico 5. Elevado calor de vaporización

q

q

Funciones biológicas Ionización del agua
r

q

Disociación del agua Producto iónico del agua Concepto de pH Sistemas tampón

r

r

r

q

Ósmosis y fenómenos osmóticos Las sales minerales

q

http://www.arrakis.es/~lluengo/agua.html (1 of 9)01/08/2004 9:47:10

Untitled

Estructura del agua
La molécula de agua está formada por dos átomos de H unidos a un átomo de O por medio de dos enlaces covalentes. La disposición tetraédrica de los orbitales sp3 del oxígeno determina un ángulo entre los enlaces

H-O-H
aproximadamente de 104'5:, además el oxígeno es más electronegativo que el hidrógeno y atrae con más fuerza a los electrones de cada enlace.

Fig.1

Fig.3

Fig.2 El resultado es que la molécula de agua aunque tiene una carga total neutra (igual número de protones que de electrones ), presenta una distribución asimétrica de sus electrones, lo que la convierte en una molécula polar, alrededor del oxígeno se concentra una densidad de carga negativa , mientras que los núcleos de hidrógeno quedan desnudos, desprovistos parcialmente de sus electrones y manifiestan, por tanto, una densidad de carga positiva. Por eso en la práctica la molécula de agua se comporta como un dipolo

Fig.4 Fig.5 Así se establecen interacciones dipolo-dipolo entre las propias moléculas de agua, formándose enlaces o puentes de hidrógeno, la carga parcial negativa del oxígeno de una molécula ejerce atracción electrostática sobre las cargas parciales positivas de los átomos de hidrógeno de otras moléculas adyacentes.

http://www.arrakis.es/~lluengo/agua.html (2 of 9)01/08/2004 9:47:10

Untitled

Aunque son uniones débiles, el hecho de que alrededor de cada molécula de agua se dispongan otras cuatro molécula unidas por puentes de hidrógeno permite que se forme en el agua (líquida o sólida) una estructura de tipo reticular, responsable en gran parte de su comportamiento anómalo y de la peculiaridad de sus propiedades físicoquímicas.

Propiedades del agua
1. Acción disolvente El agua es el líquido que más sustancias disuelve, por eso decimos que es el disolvente universal. Esta propiedad, tal vez la más importante para la vida, se debe a su capacidad para formar puentes de hidrógeno con otras sustancias que pueden presentar grupos polares o con carga iónica ( alcoholes, azúcares con grupos R-OH , aminoácidos y proteínas con grupos que presentan cargas + y - , lo que da lugar a disoluciones moleculares Fig.7. También las moléculas de agua pueden disolver a sustancias salinas que se disocian formando disoluciones iónicas.(Fig.6)

Fig.6

Fig.7

En el caso de las disoluciones iónicas (fig.6) los iones de las sales son atraídos por los dipolos del agua, quedando "atrapados" y recubiertos de moléculas de agua en forma de iones hidratados o solvatados. La capacidad disolvente es la responsable de dos funciones : 1. Medio donde ocurren las reacciones del metabolismo 2. Sistemas de transporte

http://www.arrakis.es/~lluengo/agua.html (3 of 9)01/08/2004 9:47:10

Untitled

Este efecto puede verse en esta animacisn, donde vemos a las moliculas de agua separando los iones, e impidiendo que istos vuelvan a unirse.

2. Elevada fuerza de cohesión Los puentes de hidrógeno mantienen las moléculas de agua fuertemente unidas, formando una estructura compacta que la convierte en un líquido casi incomprensible. Al no poder comprimirse puede funcionar en algunos animales como un esqueleto hidrostático, como ocurre en algunos gusanos perforadores capaces de agujerear la roca mediante la presión generada por sus líquidos internos. 3. Elevada fuerza de adhesión

Esta fuerza está también en relación con los puentes de hidrógeno que se establecen entre las moléculas de agua y otras moléculas polares y es responsable, junto con la cohesión del llamado fenómeno de la capilaridad. Cuando se introduce un capilar (Fig.8) en un recipiente con agua, ésta asciende por el capilar como si trepase agarrándose por las paredes, hasta alcanzar un nivel superior al del recipiente,

Fig.8 donde la presión que ejerce la columna de agua , se equilibra con la presión capilar. A este fenómeno se debe en parte la ascensión de la savia bruta desde las raíces hasta las hojas, a través de los vasos leñosos. 3. Gran calor específico También esta propiedad está en relación con los puentes de hidrógeno que se forman entre las moléculas de agua. El agua puede absorber grandes cantidades de "calor" que utiliza para romper los p.de h. por lo que la temperatura se eleva muy lentamente. Esto permite que el citoplasma acuoso sirva de protección ante los cambios de temperatura. Así se mantiene la temperatura constante . 4. Elevado calor de vaporización Sirve el mismo razonamiento, también los p.de h. son los responsables de esta propiedad. Para evaporar el agua , primero hay que romper los puentes y posteriormente dotar a las moléculas de agua de la suficiente energía cinética para pasar de la fase líquida a la gaseosa. Para evaporar un gramo de agua se precisan 540 calorías, a una temperatura de 20: C.

http://www.arrakis.es/~lluengo/agua.html (4 of 9)01/08/2004 9:47:10

Untitled

Funciones del agua
Las funciones del agua se relacionan íntimamente con las propiedades anteriormente descritas. Se podrían resumir en los siguientes puntos 1. 2. 3. 4. 5. 6. 7. Soporte o medio donde ocurren las reacciones metabólicas Amortiguador térmico Transporte de sustancias Lubricante, amortiguadora del roce entre órganos Favorece la circulación y turgencia Da flexibilidad y elasticidad a los tejidos Puede intervenir como reactivo en reacciones del metabolismo, aportando hidrogeniones o hidroxilos al medio.

Ionización del agua
Disociación del agua

Fig.9 El agua pura tiene la capacidad de disociarse en iones, por lo que en realidad se puede considerar una mezcla de : r agua molecular (H2O ) r protones hidratados (H3O+ ) e r iones hidroxilo (OH-) En realidad esta disociación es muy débil en el agua pura, y así el producto iónico del agua a 25: es

Este producto iónico es constante. Como en el agua pura la concentración de hidrogeniones y de hidroxilos es la misma, significa que la concentración de hidrogeniones es de 1 x 10 -7. Para simplificar los cálculos Sorensen ideó expresar dichas concentraciones utilizando logaritmos, y así definió el pH como el logaritmo cambiado de signo de la concentración de hidrogeniones. Según ésto: disolución neutra pH = 7 disolución ácida pH < 7 r disolución básica pH > 7 En la figura 10 se señala el pH de algunas soluciones. En general hay que decir que la vida se desarrolla a valores de pH próximos a la neutralidad.
r r

http://www.arrakis.es/~lluengo/agua.html (5 of 9)01/08/2004 9:47:10

Untitled

En la figura 10 se señala el pH de algunas soluciones. En general hay que decir que la vida se desarrolla a valores de pH próximos a la neutralidad.

Figura 10 Los organismos vivos no soportan variaciones del pH mayores de unas décimas de unidad y por eso han desarrollado a lo largo de la evolución sistemas de tampón o buffer, que mantienen el pH constante mediante mecanismos homeostáticos. Los sistemas tampón consisten en un par ácido-base conjugada que actúan como dador y aceptor de protones respectivamente. El tampón bicarbonato es común en los líquidos intercelulares, mantiene el pH en valores próximos a 7,4, gracias al equilibrio entre el ión bicarbonato y el ácido carbónico, que a su vez se disocia en dióxido de carbono y agua:

Si aumenta la concentración de hidrogeniones en el medio por cualquier proceso químico, el equilibrio se desplaza a la derecha y se elimina al exterior el exceso de CO2 producido. Si por el contrario disminuye la concentración de hidrogeniones del medio, el equilibrio se desplaza a la izquierda, para lo cual se toma CO2 del medio exterior.

http://www.arrakis.es/~lluengo/agua.html (6 of 9)01/08/2004 9:47:10

Untitled

Ósmosis
1. Ósmosis y presión osmótica Si tenemos dos disoluciones acuosas de distinta concentración separadas por una membrana semipermeable (deja pasar el disolvente pero no el soluto ), se pruduce el fenómeno de la ósmosis que sería un tipo de difusión pasiva caracterizada por el paso del agua ( disolvente ) a través de la membrana semipermeable desde la solución más diluida ( hipotónica ) a la más concentrada (hipertónica ), este trasiego continuará hasta que las dos soluciones tengan la misma concentración ( isotónicas o isoosmóticas ).

Figura 11 Y se entiende por presión osmótica la presión que sería necesaria para detener el flujo de agua a través de la membrana semipermeable. La membrana plasmática de la célula puede considerarse como semipermeable, y por ello las células deben permanecer en equilibrio osmótico con los líquidos que las bañan.

Figura 12 Cuando las concentraciones de los fluidos extracelulares e intracelulares es igual , ambas disoluciones son isotónicas. Si los líquidos extracelulares aumentan su concentración de solutos se hacer hipertónicos respecto a la célula, y ésta pierde agua, se deshidrata y mueren (plamólisis). Y si por el contrario los medios extracelulares se diluyen, se hacen hipotónicos respecto a la célula, el agua tiende a entrar y las células se hinchan, se vuelven turgentes ( turgescencia ), llegando incluso a estallar. (Figura 12). 2. La difusión y la diálisis Los líquidos presentes en los organismos son dispersiones de diversas sustancias en el seno del agua. Según el tamaño de las partículas se formarán dispersiones moleculares o disoluciones verdaderas como ocurre con las que se forman con las sales minerales o por sustancias orgánicas de moléculas pequeñas, como los azúcares o aminoácidos.

http://www.arrakis.es/~lluengo/agua.html (7 of 9)01/08/2004 9:47:10

Untitled

Las partículas dispersas pueden provocar además del movimiento de ósmosis , estos otros dos: La diálisis. En este caso pueden atravesar la membrana además del disolvente, moléculas de bajo peso molecular y éstas pasan atravesando la membrana desde la solución más concentrada a la más diluida. (Figura 13). Es el fundamento de la hemodiálisis que intenta sustituir la filtración renal deteriorada. La difusiónsería el fenómeno por el cual las moléculas disueltas tienden a distribuirse uniformemente en el seno del agua. Puede ocurrir también a través de una membrana si es lo suficientemente permeable.

Figura 13 Así se realizan los intercambios de gases y de algunos nutrientes entre la célula y el medio en el que vive.

Sales minerales
Además del agua existe otras biomoléculas inorgánicas como las sales minerales. En función de su solubilidad en agua se distinguen dos tipos: insolubles y solubles en agua. 1. Sales insolubles en agua. Forman estructuras sólidas, que suelen tener función de sostén o protectora, como : r Esqueleto interno de vertebrados, en el que encontramos : fosfatos, cloruros, y carbonatos de calcio r Caparazones de carbonato cálcico de crustáceos y moluscos. r Endurecimiento de células vegetales, como en gramíneas (impregnación con sílice). r Otolitos del oído interno,formados por cristales de carbonato cálcico (equilibrio). 3. Sales solubles en agua. Se encuentran disociadas en sus iones (cationes y aniones ) que son los responsables de su actividad biológica. Desempeñan las siguientes funciones: r Funciones catalíticas. Algunos iones, como el Cu+, Mn2+, Mg2+, Zn+,...actúan como cofactores enzimáticos r Funciones osmóticas. Intervienen en los procesos relacionados con la distribucisn de agua entre el interior celular y el medio donde vive esa cilula. Los iones de Na, K, Cl y Ca, participan en la generacisn de gradientes electroqummicos, imprescindibles en el mantenimiento del potencial de membrana y del potencial de accisn y en la sinapsis neuronal. r Función tamponadora. Se lleva a cabo por los sistemas carbonato-bicarbonato, y tambiin por el monofosfatobifosfato.

http://www.arrakis.es/~lluengo/agua.html (8 of 9)01/08/2004 9:47:10

Glúcidos

q

Concepto de glúcidos Monosacáridos
1. triosas 2. pentosas 3. hexosas 4. Ciclación de monosacáridos

q

q

Disacáridos
1. lactosa 2. maltosa 3. sacarosa

q

Polisacáridos
1. almidón 2. glucógeno 3. celulosa

http://www.arrakis.es/~lluengo/glucidos.html (1 of 6)01/08/2004 19:42:32

Glúcidos

CONCEPTO DE GLÚCIDOS

Los glúcidos son biomoléculas formadas básicamente por carbono (C),hidrógeno (H) y oxígeno (O). Los átomos de carbono están unidos a grupos alcohólicos (-OH), llamados también radicales hidroxilo y a radicales hidrógeno (-H). En todos los glúcidos siempre hay un grupo carbonilo, es decir, un carbono unido a un oxígeno mediante un doble enlace (C=O). El grupo carbonilo puede ser un grupo aldehído(-CHO), o un grupo cetónico (-CO-). Así pues, los glúcidos pueden definirse como polihidroxialdehídos o polihidroxicetonas.

El primer glúcido es el más pequeño que existe, tiene 3 átomos de carbono solamente, es además una aldosa porque posee un grupo aldehído (-CHO ); el segundo ejemplo correspondería a una cetosa, por tener un grupo cetona (C=O )

MONOSACÁRIDOS
Los monosacáridos son glúcidos sencillos, constituídos sólo por una cadena. Se nombran añadiendo la terminación -osa al número de carbonos.

Por ejemplo, en el dibujo están representados una triosa, una tetrosa, una pentosa y una hexosa.

1. Las triosas , son abundantes en el interior de la célula, ya que son metabolitos intermediarios de la degradación de la
glucosa

2. Las pentosas, son glúcidos de 5 carbonos y entre ellos se encuentran: Ribosa y Desoxirribosa , que forman parte de los
ácidos nucléicos y la ribulosa que desempeña un importante papel en la fotosíntesis, debido a que a ella se fija el CO2 atmosférico y de esta manera se incorpora el carbono al ciclo de la materia viva.

3. Las hexosas , son glúcidos con 6 átomos de carbono. Entre ellas tienen interés en biología, la glucosa y galactosa entre las
aldohexosas y la fructosa entre las cetohexosas. En disolución acuosa, los monosacáridos se cierran formando unos anillos de 5 ó 6 lados , furanos y piranos, respectivamente.

http://www.arrakis.es/~lluengo/glucidos.html (2 of 6)01/08/2004 19:42:32

Glúcidos

Aquí está representada la fórmula lineal y cíclica de la fructosa, formando un anillo de cinco lados que corresponde al furano Al cerrarse la molécula el grupo -OH (marcado en rojo), puede ocupar dos posiciones, respecto al grupo -CH2OH del C5. Son dos nuevos isómeros, denominados anómeros alfa (en posición trans)y beta(en posición cis)

Estas fórmulas representan a la glucosa en su forma lineal y cíclica, en este caso el anillo formado tiene 6 lados y corresponde al esqueleto pirano. Es el glúcido más abundante, llamado azúcar de uva; en la sangre se encuentra en concentraciones de un gramo por litro Al polimerizarse da lugar a polisacáridos con función energética (almidón y glucógeno) o con fución estructural, como la celulosa de las plantas.

http://www.arrakis.es/~lluengo/glucidos.html (3 of 6)01/08/2004 19:42:32

Glúcidos

Ciclación de monosacáridos

En este esquema puede apreciarse como se cierra la molécula de un monosacárido, en este caso una hexosa. El grupo carbonilo del C1 queda próximo al C5 y entre ellos reaccionan sus radicales en una reacción intramolecular entre un grupo aldehido (el del C1) y un grupo alcohol (el del C5), formándose un hemiacetal.Ambos carbonos quedarán unidos mediante un átomo de oxígeno. El C1 se denomina Carbono anomérico y posee un grupo -OH llamado hemiacetálico y según la posición de este grupo, se originan dos anómeros (alfa y beta). El estudio de la ciclación fue realizado por Haworth y se conoce con el nombre de proyección de Haworth

DISACÁRIDOS
los disacáridos están formados por la unión de dos monosacáridos, que se realiza de dos formas:

1. Mediante enlace monocarbonílico, entre el C1 anomérico de un monosacárido y un C no anomérico de otro monosacárido,
como se ve en las fórmulas de la lactosa y maltosa. Estos disacáridos conservan el carácter reductor .

MALTOSA LACTOSA 2. Mediante enlace dicarbonílico, si se establece entre los dos carbonos anoméricos de los dos monosacáridos, con lo que el
disacárido pierde su poder reductor, por ejemplo como ocurre en la sacarosa

SACAROSA
http://www.arrakis.es/~lluengo/glucidos.html (4 of 6)01/08/2004 19:42:32

Glúcidos

POLISACÁRIDOS
Los polisacáridos están formados por la unión de muchos monosacáridos (puede variar entre 11 y varios miles), mediante enlace Oglucosídico,similar al visto en disacáridos, con pérdida de una molécula de agua por cada enlace. Tienen pesos moleculares muy elevados, no poseen poder reductor y pueden desempeñar funciones de reserva energética o función estructural.Los polisacáridos que tienen función de reserva energética presentan enlace a-glucosídico y son :

1. Almidón, que es el polisacárido de reserva propio de los vegetales, y está integrado por dos tipos de polímeros:
r

la amilosa, formada por unidades de maltosa,unidas mediante enlaces a(1-4). Presenta estructura helicoidal. la amilopectina , formada también por unidades de maltosas unidas mediante enlaces a(1-4), con ramificaciones en posición a(1-6).

r

POLÍMEROS QUE FORMAN EL ALMIDÓN

ALMIDON

AMILOPECTINA

2. Glucógeno es el polisacárido propio de los animales. Se encuentra abundantemente en el hígado y en los músculos. Molécula
muy similar a la amilopectina; pero con mayor abundancia de ramificaciones.

Entre los polisacáridos estructurales, destaca la celulosa , que forma la pared celular de la célula vegetal. Esta pared constituye un estuche en el que queda encerrada la célula, que persiste tras la muerte de ésta. La celulosa está constituída por unidades de b-glucosa, y la peculiaridad del enlace b(beta) hace a la celulosa inatacable por las enzimas digestivas humanas, por ello, este polisacárido no tiene interés alimentario para el hombre..

http://www.arrakis.es/~lluengo/glucidos.html (5 of 6)01/08/2004 19:42:32

Lípidos

Concepto de lípido Clasificación de los lípidos Los ácidos grasos
q

Características Clasificación Propiedades

q

q

q

Lípidos SAPONIFICABLES 1. Lípidos simples
r

Acilglicéridos Ceras

r

2. Lípidos complejos
r

Fosfolípidos Glucolípidos

r

q

Lípidos INSAPONIFICABLES 1. Terpenos 2. Esteroides 3. Prostaglandinas

q

Funciones de los lípidos

http://www.arrakis.es/~lluengo/lipidos.html (1 of 13)01/08/2004 9:28:02

Lípidos

Concepto de Lípido
Los lípidos son biomoléculas orgánicas formadas básicamente por carbono e hidrógeno y generalmente también oxígeno; pero en porcentajes mucho más bajos. Además pueden contener también fósforo, nitrógeno y azufre . Es un grupo de sustancias muy heterogéneas que sólo tienen en común estas dos características:

1. Son insolubles en agua 2. Son solubles en disolventes orgánicos, como éter, cloroformo, benceno, etc.

Clasificación de los lípidos
Los lípidos se clasifican en dos grupos, atendiendo a que posean en su composición ácidos grasos (Lípidos saponificables) o no lo posean ( Lípidos insaponificables ). 1. Lípidos saponificables A. Simples 1. Acilglicéridos 2. Céridos B. Complejos 1. Fosfolípidos 2. Glucolípidos 2. Lípidos insaponificables A. Terpenos B. Esteroides C. Prostaglandinas

http://www.arrakis.es/~lluengo/lipidos.html (2 of 13)01/08/2004 9:28:02

Lípidos

Ácidos grasos
Los ácidos grasos son moléculas formadas por una larga cadena hidrocarbonada de tipo lineal, y con un número par de átomos de carbono. Tienen en un extremo de la cadena un grupo carboxilo (-COOH).

Se conocen unos 70 ácidos grasos que se pueden clasificar en dos grupos :
q

Los ácidos grasos saturados sólo tienen enlaces simples entre los átomos de carbono. Son ejemplos de este tipo de ácidos el mirístico (14C);el palmítico (16C) y el esteárico (18C) . Los ácidos grasos insaturados tienen uno o varios enlaces dobles en su cadena y sus moléculas presentan codos, con cambios de dirección en los lugares dónde aparece un doble enlace. Son ejemplos el oléico (18C, un doble enlace) y el linoleíco (18C y dos dobles enlaces).

q

http://www.arrakis.es/~lluengo/lipidos.html (3 of 13)01/08/2004 9:28:02

Lípidos

Propiedades de los ácidos grasos
q

Solubilidad. Los ácidos grasos poseen una zona hidrófila, el grupo carboxilo (COOH) y una zona lipófila, la cadena hidrocarbonada que presenta grupos metileno (-CH2-) y grupos metilo (-CH3) terminales. Por eso las moléculas de los ácidos grasos son anfipáticas, pues por una parte, la cadena alifática es apolar y por tanto, soluble en disolventes orgánicos (lipófila), y por otra, el grupo carboxilo es polar y soluble en agua (hidrófilo). Desde el punto de vista químico, los ácidos grasos son capaces de formar enlaces éster con los grupos alcohol de otras moléculas. Cuando estos enlaces se hidrolizan con un álcali, se rompen y se obtienen las sales de los ácidos grasos correspondientes, denominados jabones, mediante un proceso denominado saponificación.

q

dedicado a Pepe Munilla.

http://www.arrakis.es/~lluengo/lipidos.html (4 of 13)01/08/2004 9:28:02

Lípidos

Lípidos simples
Son lípidos saponificables en cuya composición química sólo intervienen carbono, hidrógeno y oxígeno.

Acilglicéridos
Son lípidos simples formados por la esterificación de una,dos o tres moléculas de ácidos grasos con una molécula de glicerina. También reciben el nombre de glicéridos o grasas simples

Según el número de ácidos grasos, se distinguen tres tipos de estos lípidos:
q

los monoglicéridos, que contienen una molécula de ácido graso los diglicéridos, con dos moléculas de ácidos grasos los triglicéridos, con tres moléculas de ácidos grasos.

q

q

Los acilglicéridos frente a bases dan lugar a reacciones de saponificación en la que se producen moléculas de jabón.

http://www.arrakis.es/~lluengo/lipidos.html (5 of 13)01/08/2004 9:28:02

Lípidos

Ceras
Ceras Las ceras son ésteres de ácidos grasos de cadena larga, con alcoholes también de cadena larga. En general son sólidas y totalmente insolubles en agua. Todas las funciones que realizan están relacionadas con su impermeabilidad al agua y con su consistencia firme. Así las plumas, el pelo , la piel,las hojas, frutos, están cubiertas de una capa cérea protectora. Una de las ceras más conocidas es la que segregan las abejas para confeccionar su panal. Inicio de página

Lípidos complejos
Son lípidos saponificables en cuya estructura molecular además de carbono, hidrógeno y oxígeno, hay también nitrógeno,fósforo, azufre o un glúcido. Son las principales moléculas constitutivas de la doble capa lipídica de la membrana, por lo que también se llaman lípidos de membrana. Son tammbién moléculas anfipáticas.

http://www.arrakis.es/~lluengo/lipidos.html (6 of 13)01/08/2004 9:28:02

Lípidos

Fosfolípidos
Se caracterizan pr presentar un ácido ortofosfórico en su zona polar. Son las moléculas más abundantes de la membrana citoplasmática. Algunos ejemplos de fosfolípidos

http://www.arrakis.es/~lluengo/lipidos.html (7 of 13)01/08/2004 9:28:02

Lípidos

Glucolípidos
Son lípidos complejos que se caracterizan por poseer un glúcido. Se encuentran formando parte de las bicapas lipídicas de las membranas de todas las células, especialmente de las neuronas. Se sitúan en la cara externa de la membrana celular, en donde realizan una función de relación celular, siendo receptores de moléculas externas que darán lugar a respuestas celulares.

http://www.arrakis.es/~lluengo/lipidos.html (8 of 13)01/08/2004 9:28:02

Lípidos

Terpenos Son moléculas lineales o cíclicas que cumplen funciones muy variadas, entre los que se pueden citar:
q

Esencias vegetales como el mentol, el geraniol, limoneno, alcanfor, eucaliptol, vainillina. Vitaminas, como la vit.A, vit. E, vit.K. Pigmentos vegetales, como la carotina y la xantofila.

q

q

Esteroides
Los esteroides son lípidos que derivan del esterano. Comprenden dos grandes grupos de sustancias: 1. Esteroles: Como el colesterol y las vitaminas D. 2. Hormonas esteroideas: Como las hormonas suprarrenales y las hormonas sexuales.

COLESTEROL

El colesterol forma parte estructural de las membranas a las que confiere estabilidad. Es la molécula base que sirve para la síntesis de casi todos los esteroides

.
http://www.arrakis.es/~lluengo/lipidos.html (9 of 13)01/08/2004 9:28:02

Lípidos

HORMONAS SEXUALES

Entre las hormonas sexuales se encuentran la progesterona que prepara los órganos sexuales femeninos para la gestación y la testosterona responsable de los caracteres sexuales masculinos.

HORMONAS SUPRARRENALES

Entre las hormonas suprarrenales se encuentra la cortisona, que actúa en el metabolismo de los glúcidos, regulando la síntesis de glucógeno.

http://www.arrakis.es/~lluengo/lipidos.html (10 of 13)01/08/2004 9:28:02

Lípidos

Prostaglandinas
Las prostaglandinas son lípidos cuya molécula básica está constituída por 20 átomos de carbono que forman un anillo ciclopentano y dos cadenas alifáticas.

Las funciones son diversas. Entre ellas destaca la producción de sustancias que regulan la coagulación de la sangre y cierre de las heridas; la aparición de la fiebre como defensa de las infecciones; la reducción de la secreción de jugos gástricos. Funcionan como hormonas locales.

Funciones de los lípidos
Los lípidos desempeñan cuatro tipos de funciones: 1. Función de reserva. Son la principal reserva energética del organismo.Un gramo de grasa produce 9'4 kilocalorías en las reacciones metabólicas de oxidación, mientras que proteínas y glúcidos sólo producen 4'1 kilocaloría/gr. 2. Función estructural. Forman las bicapas lipídicas de las membranas. Recubren órganos y le dan consistencia, o protegen mecánicamente como el tejido adiposo de piés y manos.

http://www.arrakis.es/~lluengo/lipidos.html (11 of 13)01/08/2004 9:28:02

Lípidos

3. Función biocatalizadora. En este papel los lípidos favorecen o facilitan las reacciones químicas que se producen en los seres vivos. Cumplen esta función las vitaminas lipídicas, las hormonas esteroideas y las prostaglandinas. 4. Función transportadora. El tranporte de lípidos desde el intestino hasta su lugar de destino se raliza mediante su emulsión gracias a los ácidos biliares y a los proteolípidos.

Reacción de saponificación
Saponificación.Es una reacción típica de los ácidos grasos, en la cual reaccionan con álcalis y dan lugar a una sal de ácido graso, que se denomina jabón.Las moléculas de jabón presentan simultáneamente una zona lipófila o hifrófoba, que rehuye el contacto con el agua, y una zona hidrófila o polar, que se orienta hacia ella, lo que se denomina comportamiento anfipático.

Reacción de esterificación
q

Esterificación. Un ácido graso se une a un alcohol mediante un enlace covalente, formando un éster y liberándose una molécula de agua.

http://www.arrakis.es/~lluengo/lipidos.html (12 of 13)01/08/2004 9:28:02

Las proteínas

Concepto de proteína Los aminoácidos 1. Clasificación y tipos 2. Comportamiento químico El enlace peptídico Estructura de las proteínas 1. E. Primaria 2. E. Secundaria 3. E. Terciaria 4. E. Cuaternaria
q

Propiedades de las proteínas 1. Especificidad 2. Desnaturalización

q

Clasificación de las proteínas Funciones y ejemplos de proteínas

q

http://www.arrakis.es/~lluengo/pproteinas.html (1 of 10)01/08/2004 9:50:58

Las proteínas

CONCEPTO DE PROTEÍNA
Las proteínas son biomóleculas formadas básicamente por carbono, hidrógeno, oxígeno y nitrógeno. Pueden además contener azufre y en algunos tipos de proteínas, fósforo, hierro, magnesio y cobre entre otros elementos. Pueden considerarse polímeros de unas pequeñas moléculas que reciben el nombre de aminoácidos y serían por tanto los monómeros unidad. Los aminoácidos están unidos mediante enlaces peptídicos. La unión de un bajo número de aminoácidos da lugar a un péptido; si el n: de aa. que forma la molécula no es mayor de 10, se denomina oligopéptido, si es superior a 10 se llama polipéptido y si el n: es superior a 50 aa. se habla ya de proteína.

LOS AMINOÁCIDOS
Los aminoácidos se caracterizan por poseer un grupo carboxilo (-COOH) y un grupo amino (-NH2).

Las otras dos valencias del carbono se saturan con un átomo de H y con un grupo variable denominado radical R. Según éste se distinguen 20 tipos de aminoácidos.

http://www.arrakis.es/~lluengo/pproteinas.html (2 of 10)01/08/2004 9:50:58

Las proteínas

COMPORTAMIENTO QUÍMICO
En disolución acuosa, los aminoácidos muestran un comportamiento anfótero, es decir pueden ionizarse, dependiendo del pH, como un ácido liberando protones y quedando (COO'), o como base , los grupos -NH2 captan protones, quedando como (-NH3+ ), o pueden aparecer como ácido y base a la vez. En este caso los aminoácidos se ionizan doblemente, apareciendo una forma dipolar iónica llamada zwitterion

EL ENLACE PEPTÍDICO

El enlace peptídico tiene un comportamiento similar al de un enlace doble, es decir, presenta una cierta rigidez que inmoviliza en un plano los átomos que lo forman. Si pinchas aquí podrás ver en animación la formación del enlace peptídico.

ESTRUCTURA DE LAS PROTEÍNAS
La organización de una proteína viene definida por cuatro niveles estructurales denominados: estructura primaria, estructura secundaria, estructura terciaria y estructura cuaternaria. Cada una de estas estructuras informa de la disposición de la anterior en el espacio.

http://www.arrakis.es/~lluengo/pproteinas.html (3 of 10)01/08/2004 9:50:58

Las proteínas

ESTRUCTURA PRIMARIA
La estructura primaria es la secuencia de aa. de la proteína. Nos indica qué aas. componen la cadena polipeptídica y el orden en que dichos aas. se encuentran. La función de una proteína depende de su secuencia y de la forma que ésta adopte.

ESTRUCTURA SECUNDARIA
La estructura secundaria es la disposición de la secuencia de aminoácidos en el espacio.Los aas., a medida que van siendo enlazados durante la síntesis de proteínas y gracias a la capacidad de giro de sus enlaces, adquieren una disposición espacial estable, la estructura secundaria. Existen dos tipos de estructura secundaria: 1. la a(alfa)-hélice 2. la conformación beta

http://www.arrakis.es/~lluengo/pproteinas.html (4 of 10)01/08/2004 9:50:58

Las proteínas

Esta estructura se forma al enrollarse helicoidalmente sobre sí misma la estructura primaria. Se debe a la formación de enlaces de hidrógeno entre el -C=O de un aminoácido y el -NH- del cuarto aminoácido que le sigue.

En esta disposición los aas. no forman una hélice sino una cadena en forma de zigzag, denominada disposición en lámina plegada. Presentan esta estructura secundaria la queratina de la seda o fibroína.

http://www.arrakis.es/~lluengo/pproteinas.html (5 of 10)01/08/2004 9:50:58

Las proteínas

ESTRUCTURA TERCIARIA
La estructura terciaria informa sobre la disposición de la estructura secundaria de un polipéptido al plegarse sobre sí misma originando una conformación globular. En definitiva, es la estructura primaria la que determina cuál será la secundaria y por tanto la terciaria.. Esta conformación globular facilita la solubilidad en agua y así realizar funciones de transporte , enzimáticas , hormonales, etc.

Esta conformación globular se mantiene estable gracias a la existencia de enlaces entre los radicales R de los aminoácidos. Aparecen varios tipos de enlaces: 1. 2. 3. 4. el puente disulfuro entre los radicales de aminoácidos que tiene azufre. los puentes de hidrógeno los puentes eléctricos las interacciones hifrófobas.

http://www.arrakis.es/~lluengo/pproteinas.html (6 of 10)01/08/2004 9:50:58

Las proteínas

ESTRUCTURA CUATERNARIA
Esta estructura informa de la unión , mediante enlaces débiles ( no covalentes) de varias cadenas polipeptídicas con estructura terciaria, para formar un complejo proteico. Cada una de estas cadenas polipeptídicas recibe el nombre de protómero.

El número de protómeros varía desde dos como en la hexoquinasa, cuatro como en la hemoglobina, o muchos como la cápsida del virus de la poliomielitis, que consta de 60 unidades proteícas.

http://www.arrakis.es/~lluengo/pproteinas.html (7 of 10)01/08/2004 9:50:58

Las proteínas

PROPIEDADES DE PROTEINAS
1. Especificidad. La especificidad se refiere a su función; cada una lleva a cabo una determinada función y lo realiza porque posee una determinada estructura primaria y una conformación espacial propia; por lo que un cambio en la estructura de la proteína puede significar una pérdida de la función. Además, no todas las proteinas son iguales en todos los organismos, cada individuo posee proteínas específicas suyas que se ponen de manifiesto en los procesos de rechazo de órganos transplantados. La semejanza entre proteínas son un grado de parentesco entre individuos, por lo que sirve para la construcción de "árboles filogenéticos" 2. Desnaturalización. Consiste en la pérdida de la estructura terciaria, por romperse los puentes que forman dicha estructura. Todas las proteínas desnaturalizadas tienen la misma conformación, muy abierta y con una interacción máxima con el disolvente, por lo que una proteína soluble en agua cuando se desnaturaliza se hace insoluble en agua y precipita. La desnaturalización se puede producir por cambios de temperatura, ( huevo cocido o frito ), variaciones del pH. En algunos casos, si las condiciones se restablecen, una proteína desnaturalizada puede volver a su anterior plegamiento o conformación, proceso que se denomina renaturalización.

http://www.arrakis.es/~lluengo/pproteinas.html (8 of 10)01/08/2004 9:50:58

Las proteínas

CLASIFICACIÓN DE PROTEÍNAS
Se clasifican en : 1. HOLOPROTEÍNAS Formadas solamente por aminoácidos 2. HETEROPROTEÍNAS Formadas por una fracción proteínica y por un grupo no proteínico, que se denomina "grupo prostético HOLOPROTEÍNAS Prolaminas:Zeína (maíza),gliadina (trigo), hordeína (cebada) q Gluteninas:Glutenina (trigo), orizanina (arroz). q Albúminas:Seroalbúmina (sangre), ovoalbúmina (huevo), lactoalbúmina (leche) q Hormonas: Insulina, hormona del crecimiento, prolactina, tirotropina q Enzimas: Hidrolasas, Oxidasas, Ligasas, Liasas, Transferasas...etc.
q q

Globulares

Fibrosas

q q q

Colágenos: en tejidos conjuntivos, cartilaginosos Queratinas: En formaciones epidérmicas: pelos, uñas, plumas, cuernos. Elastinas: En tendones y vasos sanguineos Fibroínas: En hilos de seda, (arañas, insectos)

HETEROPROTEÍNAS
q

Glucoproteínas

q q q

Ribonucleasa Mucoproteínas Anticuerpos Hormona luteinizante

Lipoproteínas

q

De alta, baja y muy baja densidad, que transportan lípidos en la sangre. Nucleosomas de la cromatina Ribosomas Hemoglobina, hemocianina, mioglobina, que transportan oxígeno Citocromos, que transportan electrones

Nucleoproteínas

q q

Cromoproteínas

q q

http://www.arrakis.es/~lluengo/pproteinas.html (9 of 10)01/08/2004 9:50:58

Las proteínas

FUNCIONES Y EJEMPLOS DE PROTEÍNAS

q q

Estructural

q q q

Como las glucoproteínas que forman parte de las membranas. Las histonas que forman parte de los cromosomas El colágeno, del tejido conjuntivo fibroso. La elastina, del tejido conjuntivo elástico. La queratina de la epidermis.

Enzimatica

Son las más numerosas y especializadas. Actúan como biocatalizadores de las reacciones químicas y puedes verlas y estudiarlas con detalle aquí.
q

Hormonal

q q q

Insulina y glucagón Hormona del crecimiento Calcitonina Hormonas tropas Inmunoglobulina Trombina y fibrinógeno Hemoglobina Hemocianina Citocromos Ovoalbúmina, de la clara de huevo Gliadina, del grano de trigo Lactoalbúmina, de la leche

Defensiva

q q

q

Transporte

q q

q

Reserva

q q

http://www.arrakis.es/~lluengo/pproteinas.html (10 of 10)01/08/2004 9:50:58

Los aminoacidos

Existen 20 aminoácidos diferentes y todos ellos tienen una parte común en su molécula que consisten en un grupo amino (NH3) y un grupo ácido, (COOH) como puede verse en el dibujo de los aminoácidos , que aparece a continuación:

En este dibujo puede verse la fórmula de ellos, en color negro la parte común, mientras que en color azul puede verse la parte variable, que da a los aminoácidos distinto comportamiento,la clave de colores es la siguiente:
color marrón= aminoácidos hidrófobos; color verde= aminoácidos polares; color fuchsia = aminoácidos ácidos; color turquesa = aminoácidos básicos

http://www.arrakis.es/~lluengo/proteinas.html (1 of 2)01/08/2004 9:21:32

Enlace peptidico

Como puede apreciarse por la secuencia animada, la unión entre dos aminoácidos, se establece entre el grupo carboxilo (-COOH) de un aminoácido y el grupo amino (-NH2) del aminoácido inmediato, con la pérdida de una molécula de agua.

http://www.arrakis.es/~lluengo/enlace.html01/08/2004 9:51:21

ENZIMAS

q

Concepto de enzima Concepto de catalizador Características de la acción enzimática 1. Especificidad
r

q

q

de sustrato de acción

r

2. Acción enzimática 3. Cofactor 4. Coenzima 5. Vitaminas
q

Efecto del pH y de la temperatura Clasificacisn internacional de las enzimas

q

http://www.arrakis.es/~lluengo/enzimas.html (1 of 5)01/08/2004 9:49:15

ENZIMAS

CONCEPTO DE ENZIMA
Los enzimas son catalizadores muy potentes y eficaces, químicamente son proteínas Como catalizadores, los enzimas actúan en pequeña cantidad y se recuperan indefinidamente.No llevan a cabo reacciones que sean energéticamente desfavorables, no modifican el sentido de los equilibrios químicos, sino que aceleran su consecución.

CATALIZADOR Un catalizador es una sustancia que acelera una reacción química, hasta hacerla instantánea o casi instantánea. Un catalizador acelera la reacción al disminuir la energía de activación.

En una transformación dada de "A" a "P" , "A" representa las moléculas reaccionantes, que constituyen el estado inicial. "P" representa los productos o estado final. La reacción química de A a P es un proceso posible si la energía de P es menor que la de A. Pero hay una barrera de energía que los separa; si no es por ella, A no existiría, puesto que no sería estable y se habría transformado en P. Este escollo es una barrera energética, la energía de activación (Ea), que corresponde al estado de transición.

http://www.arrakis.es/~lluengo/enzimas.html (2 of 5)01/08/2004 9:49:15

ENZIMAS

CARACTERÍSTICAS DE LA ACCIÓN ENZIMÁTICA
La característica más sobresaliente de los enzimas es su elevada especificidad. Esta es doble y explica que no se formen subproductos: 1. Especificidad de sustrato. El sustrato (S) es la molécula sobre la que el enzima ejerce su acción catalítica. 2. Especificidad de acción. Cada reacción está catalizada por un enzima específico.
q

La acción enzimática se caracteriza por la formación de un complejo que representa el estado de transición.

E+ S

ES

E+ P

El sustrato se une al enzima a través de numerosas interacciones débiles como son: puentes de hidrógeno, electrostáticas, hidrófobas, etc, en un lugar específico , el centro activo. Este centro es una pequeña porción del enzima, constituído por una serie de aminoácidos que interaccionan con el sustrato. q Algunas enzimas actúan con la ayuda de estructuras no proteícas. En función de su naturaleza se denominan: 1. Cofactor. Cuando se trata de iones o moléculas inorgánicas. 2. Coenzima. Cuando es una molécula orgánica. Aquí se puede señalar, que muchas vitaminas funcionan como coenzimas; y realmente las deficiencias producidas por la falta de vitaminas responde más bien a que no se puede sintetizar un determinado enzima en el que la vitamina es el coenzima.

http://www.arrakis.es/~lluengo/enzimas.html (3 of 5)01/08/2004 9:49:15

ENZIMAS

VITAMINAS Algunas vitaminas son necesarias para la actuacisn de determinados enzimas, ya que funcionan como coenzimas que intervienen en distintas rutas metabslicas y , por ello, una deficiencia en una vitamina puede originar importantes defectos metabslicos, como puede verse en la tabla adjunta: VITAMINAS C (acido ascsrbico) B1 (tiamina) B2 (riboflavina) B5 (niacina) B6 ( piridoxina) B12 (cobalamina) Biotina FUNCIONES Coenzima de algunas peptidasas. Interviene en la smntesis de colageno Coenzima de las descarboxilasas y de las enzima que transfieren grupos aldehidos Constituyente de los coenzimas FAD y FMN Constituyente de las coenzimas NAD y NADP Interviene en las reacciones de transferencia de grupos aminos. Coenzima en la transferencia de grupos metilo. Coenzima de las enzimas que transfieren grupos carboxilo, en metabolismo de aminoacidos. Enfermedades carenciales Escorbuto Beriberi Dermatitis y lesiones en las mucosas Fatiga y trastornos del sueqo Pelagra Depresisn, anemia Anemia perniciosa Fatiga, dermatitis...

B3 (acido pantotinico) Constituyente de la CoA

EFECTO DEL pH Y TEMPERATURA
1. Efecto del pH. Al comprobar experimentalmente la influencia del pH en la velocidad de las reacciones enzimáticas se obtienen curvas que indican que los enzimas presentan un pH óptimo de actividad. El pH puede afectar de varias maneras: r El centro activo puede contener aminoácidos con grupos ionizados que pueden variar con el pH. r La ionización de aminoácidos que no están en el centro activo puede provocar modiicaciones en la conformación de la enzima. r El sustrato puede verse afectado por las variaciones del pH. Algunos enzimas presentan variaciones peculiares. La pepsina del estómago, presenta un óptimo a pH=2, y la fosfatasa alcalina del intestino un pH= 12 2. La temperatura. Influye en la actividad. El punto óptimo representa el máximo de actividad. A temperaturas bajas, los enzimas se hallan "muy rígidos" y cuando se supera un valor considerable (mayor de 50:) la actividad cae bruscamente porque, como proteína, el enzima se desnaturaliza.

http://www.arrakis.es/~lluengo/enzimas.html (4 of 5)01/08/2004 9:49:15

ENZIMAS

CLASIFICACISN DE ENZIMAS

1. Sxido-reductasas ( Reacciones de oxido-reduccisn). Si una molicula se reduce, tiene que haber otra que se oxide

2. Transferasas (Transferencia de grupos funcionales)
q q q q

grupos aldehidos gupos acilos grupos glucosilos grupos fosfatos (kinasas)

3. Hidrolasas (Reacciones de hidrslisis)

Transforman polmmeros en monsmeros. Actuan sobre: q enlace ister q enlace glucosmdico q enlace peptmdico q enlace C-N

4. Liasas (Adicisn a los dobles enlaces)
q q q

Entre C y C Entre C y O Entre C y N

5. Isomerasas (Reacciones de isomerizacisn)

6. Ligasas (Formacisn de enlaces, con aporte de ATP)
q q q q

Entre C y O Entre C y S Entre C y N Entre C y C

http://www.arrakis.es/~lluengo/enzimas.html (5 of 5)01/08/2004 9:49:15

Acidos Nucléicos

Los ácidos nucléicos son grandes moléculas formadas por la repetición de una molécula unidad que es el nucleótido.Pero a su vez, el nucleótido es una molécula compuesta por tres: 1. Una pentosa r ribosa r desoxirribosa 2. Ácido fosfórico 3. Una base nitrogenada,que puede ser una de estas cinco r adenina r guanina r citosina r timina r uracilo

http://www.arrakis.es/~lluengo/anucleicos.html (1 of 3)01/08/2004 9:25:34

Acidos Nucléicos

http://www.arrakis.es/~lluengo/anucleicos.html (2 of 3)01/08/2004 9:25:34

Acidos Nucléicos

Los ácidos nucléicos están formados por largas cadenas de nucleótidos, enlazados entre sí por el grupo fosfato.

Pueden alcanzar tamaños gigantes, siendo las moléculas más grandes que se conocen, constituídas por millones de nucleótidos. Son las moléculas que tienen la información genética de los organismos y son las responsables de su transmisión hereditaria. Existen dos tipos de ácidos nucléicos, ADN y ARN, que se diferencian por el azúcar (pentosa) que llevan: desoxirribosa y ribosa, respectivamente. Además se diferencian por las bases nitrogenadas que contienen, adenina , guanina, citosina y timina, en el ADN; y adenina, guanina, citosina y uracilo en el ARN. Una última diferencia está en la estructura de las cadenas, en el ADN será una cadena doble y en el ARN es una cadena sencilla

http://www.arrakis.es/~lluengo/anucleicos.html (3 of 3)01/08/2004 9:25:34

ADN

La molécula de ADN está constituída por dos largas cadenas de nucleótidos unidas entre sí formando una doble hélice. Las dos cadenas de nucleótidos que constituyen una molécula de ADN, se mantienen unidas entre sí porque se forman enlaces entre las bases nitrogenadas de ambas cadenas que quedan enfrentadas. La unión de las bases se realiza mediante puentes de hidrógeno, y este apareamiento está condicionado químicamente de forma que la adenina (A) sólo se puede unir con la Timina (T) y la Guanina (G) con la Citosina (C).

La estructura de un determinado ADN está definida por la "secuencia" de las bases nitrogenadas en la cadena de nucleótidos, residiendo precisamente en esta secuencia de bases la información genética del ADN. El orden en el que aparecen las cuatro bases a lo largo de una cadena en el ADN es, por tanto, crítico para la célula, ya que este orden es el que constituye las instrucciones del programa genético de los organismos. Conocer esta secuencia de bases, es decir, secuenciar un ADN equivale a descifrar su mensaje genético.

http://www.arrakis.es/~lluengo/adn.html (1 of 3)01/08/2004 9:52:52

ADN

La estructura en doble hélice del ADN, con el apareamiento de bases limitado ( A-T; GC ), implica que el orden o secuencia de bases de una de las cadenas delimita automaticamente el orden de la otra, por eso se dice que las cadenas son complementarias. Una vez conocida la secuencia de las bases de una cadena ,se deduce inmediatamente la secuencia de bases de la complementaria. El modelo de la doble hélicede Watson y Crick ha supuesto un hito en la historia de la Biología.

http://www.arrakis.es/~lluengo/adn.html (2 of 3)01/08/2004 9:52:52

Esqueleto del ADN

http://www.arrakis.es/~lluengo/adnhelice.html01/08/2004 9:53:36

ADN

Las moliculas se replican de un modo semiconservativo. La doble hilice se separa y cada una de las cadenas sirve de molde para la smntesis de una nueva cadena complementaria. El resultado final son dos moliculas idinticas a la original

http://www.arrakis.es/~lluengo/adn.html (3 of 3)01/08/2004 9:52:52

Transferencia de la información

El ADN tiene la información para hacer las proteínas de la célula. Ya que muchas de estas proteínas funcionan como enzimas en las reacciones químicas que tienen lugar en la célula, todos los procesos celulares dependen, en última instancia, de la información codificada en el ADN.

http://www.arrakis.es/~lluengo/transferencia.html (1 of 2)01/08/2004 9:54:52

Transferencia de la información

En el proceso de síntesis de proteínas, existe una molécula, el ARN, que actúa de intermediaria. Por lo tanto, en el proceso de expresión de la información contenida en los genes hay dos etapas:

ADN

ARN

PROTEÍNAS

La primera se denomina TRANSCRIPCIÓN y la segunda TRADUCCIÓN Esto se ha dado en llamar el "dogma central de la Biología Molecular"
El "dogma central" admite excepciones. Temin descubrió una enzima, la transcriptasa inversa que es capaz de sintetizar ADN copiando la información contenida en un ARN. El papel biológico de esta enzima es fundamental en los retrovirus , cuyo material genético es ARN en vez de ADN. El virus del S.I.D.A. es un retrovirus.

http://www.arrakis.es/~lluengo/transferencia.html (2 of 2)01/08/2004 9:54:52

Síntesis de ARN

El proceso de síntesis de ARN o TRANSCRIPCIÓN, consiste en hacer una copia complementaria de un trozo de ADN. El ARN se diferencia estructuralmente del ADN en el azúcar, que es la ribosa y en una base, el uracilo, que reemplaza a la timina. Además el ARN es una cadena sencilla.

http://www.arrakis.es/~lluengo/sintesisarn.html (1 of 2)01/08/2004 9:55:30

Síntesis de ARN

El ADN, por tanto, es la "copia maestra" de la información genética, que permanece en "reserva" dentro del núcleo. El ARN, en cambio, es la "copia de trabajo" de la información genética. Este ARN que lleva las instrucciones para la síntesis de proteínas se denomina ARN mensajero.

http://www.arrakis.es/~lluengo/sintesisarn.html (2 of 2)01/08/2004 9:55:30

Síntesis de proteínas

El ARN mensajero es el que lleva la información para la síntesis de proteínas, es decir, determina el orden en que se unirán los aminoácidos.

Esta información está codificada en forma de tripletes, cada tres bases constituyen un codón que determina un aminoácido. Las reglas de correspondencia entre codones y aminoácidos constituyen el código genético.

http://www.arrakis.es/~lluengo/sintesisproteinas.html (1 of 3)01/08/2004 9:52:05

Código genético

El código genético viene a ser un diccionario molecular. Constituye las reglas de correspondencia entre los codones (grupo de tres nucleótidos) y los aminoácidos El codón, constituye una palabra en el lenguaje de los ácidos nucléicos, y esta palabra es traducida por un aminoácido. Este código es universal, desde las bacterias hasta el hombre. Es decir, la interpretación de los codones por aminoácidos es igual en todas las células, todas "leen" de la misma manera los genes.

1* Base

Segunda base U
UUU Phe UUC UCC UCA Leu UUG CUU Leu CUC CCC CCA Leu CUG AUU Ile AUC ACC ACA Thr AUG Met ACG GUU Val GUC GCC GCA Val GUG GCG Ala GAG GCU Ala GAC GAA Glu GGG AAG GAU Asp GGC GGA Gly CCG ACU Thr AAC AAA Lys AGG GGU Gly Pro CAG AAU Asn AGC AGA Arg UCG CCU Pro CAC CAA Gln CGG AGU Ser Ser UAG CAU His CGC CGA Arg

C
UCU Ser

A
UAU Tyr UAC UAA Stop

G
UGU Cys UGC UGA Stop UGG Trp CGU Arg

3* Base U C A G U C A G U C A G U C A G

U
UUA

C
CUA

A
AUA Ile

G
GUA

http://www.arrakis.es/~lluengo/codigo.html (1 of 2)01/08/2004 9:52:20

Código genético

http://www.arrakis.es/~lluengo/codigo.html (2 of 2)01/08/2004 9:52:20

Síntesis de proteínas

La síntesis de proteínas o traducción tiene lugar en los ribosomas del citoplasma. Los aminoácidos son transportados por el ARN de transferencia, específico para cada uno de ellos, y son llevados hasta el ARN mensajero, dónde se aparean el codón de éste y el anticodón del ARN de transferencia, por complementariedad de bases, y de ésta forma se sitúan en la posición que les corresponde. Una vez finalizada la síntesis de una proteína, el ARN mensajero queda libre y puede ser leído de nuevo. De hecho, es muy frecuente que antes de que finalice una proteína ya está comenzando otra, con lo cual, una misma molécula de ARN mensajero, está siendo utilizada por varios ribosomas simultanéamente.

http://www.arrakis.es/~lluengo/sintesisproteinas.html (2 of 3)01/08/2004 9:52:05

Síntesis de proteínas

En esta maqueta se ha representado el ARN mensajero como una varilla con los codones (juego de tres colores). El ribosomaestá fijado al filamento, y las moléculas de ARN transferencia, con los anticodones unidos a los codones del ARNm . En la parte superior se observan tres aminoácidos unidos .

En esta sencilla animacisn puedes ver el proceso de la "smntesis de protemnas".

http://www.arrakis.es/~lluengo/sintesisproteinas.html (3 of 3)01/08/2004 9:52:05

Regulación de la expresión génica

Todas las células presentan mecanismos para regular la expresión de los genes. De esta manera, las células procariotas y eucariotas, sintetizan en cada momento solamente aquellos elementos que necesitan. A principios de los años sesenta, Jacob y Monod, del Instituto Pasteur de París, propusieron un modelo denominado operón para la regulación de la expresión génica en las bacterias.

En cada operón se diferencian dos clases de genes:
q

q

Los genes estructurales ( E1, E2, E3...), que codifican proteínas, participantes en un determinado proceso bioquímico. Un gen regulador (R), que codifica a una proteína represora (PR) que puede encontrarse en la forma activa o inactiva y es el agente que controla materialmente la expresión.

Existen además dos regiones que intervienen en la regulación:
q q

El promotor (P),es una zona donde se une la ARN-polimerasa y decide el inicio de la transcripción. El operador (O), que posee una secuencia reconocida por la proteina represora activa: cuando se bloquea el operador con la proteína represora, impide el avance de la ARN-polimerasa y la transcripción se interrumpe, con lo que se origina el proceso conocido como represión génica.

Cuando la bacteria necesita sintetizar proteínas debe separar el operador del represor y utiliza para ello dos tácticas: 1. La inducción enzimática.Como en el caso del operón lactosa, que regula la síntesis de las enzimas encargadas de metabolizar la lactosa.

http://www.arrakis.es/~lluengo/regulacion.html (1 of 3)01/08/2004 9:56:12

Regulación de la expresión génica

Como puede verse en el esquema, cuando aparece la lactosa (molécula inductora), se une a la proteína represora inactivándola; entonces el complejo inductor-represor se separa del operador, permitiendo el funcionamiento del operón. 2. La represión enzimática. El ejemplo es el operón histidina, que regula la síntesis de las enzimas que intervienen en la síntesis de la histidina.

http://www.arrakis.es/~lluengo/regulacion.html (2 of 3)01/08/2004 9:56:12

Regulación de la expresión génica

http://www.arrakis.es/~lluengo/regulacion.html (3 of 3)01/08/2004 9:56:12

Untitled

Nivel de dificultad de los ejercicios

sencillos

medios

avanzados

1. 2.

Haz una clasificación cuantitativa de los bioelementos. Cita dos características que hagan del carbono un elemento idóneo para formar parte de las moléculas de los seres vivos. Haz un esquema de la molécula de H2O . ? Por qué se dice que en teoría el agua es una molécula neutra y en la práctica no ?. Explica por qué la molécula de agua se considera un dipolo. Haz un esquema que indique como se disocia la molécula de H2O. Comenta tres reacciones biológicas en las que el agua actue como reactivo.l Haz una relación de las propiedades de la molécula de agua. Haz un esquema en el que se vea como la molécula de agua disocia a una sal. Explica y pon las reacciones necesarias para ver como se solucionaría un aumento en la alcalinidad de nuestro medio interno. Explica qué ocurriría si a una persona se le inyectara en vena una solución salina hipotónica con el plasma sanguineo. Define los siguientes términos: oligoelemento, biomolécula, plasmolisis y turgencia.

3.

4. 5. 6. 7. 8. 9.

10.

11.

http://www.arrakis.es/~lluengo/actibioq.html (1 of 8)01/08/2004 9:22:42

Untitled

12.

Observa la siguiente tabla de contenido en agua en diferentes órganos del ser humano, y trata de razonar el sentido biológico de dicha distribución: cerebro sangre músculos hígado cartílagos huesos dientes 86% 79% 75% 70% 55% 22% 10%

13.

Relaciona mediante flechas los siguientes elementos minerales con el papel que realizan:

Hierro Flúor Fósforo Calcio Yodo

Se deposita en los huesos Componente de la molécula de hemoglobina Se localiza en dientes y huesos Necesario para el tiroides Componente del ADN

14.

?Por qué el agua es un dipolo?. Señala una de sus propiedades físico-químicas e indica las funciones biológicas que le permite realizar. 1. ?Qué ocurriría si se colocaran en agua marina glóbulos rojos de la sangre? 2. ? Y si se colocaran células vegetales? Indica las semejanzas y diferencias entre difusión, diálisis y ósmosis. Señala alguna función específica de los cationes de Na+ y K+. Si tenemos una disolución de sulfato de cobre al 10%,(disolución A) separada por una membrana semipermeable , de otra disolución de sulfato de cobre al 5% (disolución B).?El agua se difundirá desde la solución A hasta la B, o desde la B hasta la A?. Razónalo.

15.

16. 17. 18.

http://www.arrakis.es/~lluengo/actibioq.html (2 of 8)01/08/2004 9:22:42

Untitled

19.

El siguiente cuadro indica el pH de las disoluciones. pH 4 3 2,5 2,8 7 8,2 7,5 Disolución vino limonada vinagre coca-cola leche agua de mar gel de baño

r

?Qué disoluciones son ácidas?. Indícalas de mayor a menor grado de acidez. ?Existen algunas disoluciones neutras?, ?y básicas?. Si es asi, ?cuáles?:

r

20.

Señala de forma razonada si son verdaderas o falsas las siguientes expresiones: r El fósforo es imprescindible para la vida animal y vegetal r Cuanto más activo es un órgano más hidratado está y viceversa r El agua alcanza su máxima densidad al convertirse en hielo r Los iones minerales ayudan a mantener el pH de los líquidos biológicos. Siendo el SILICIO unas 146 veces más abundante en la corteza terrestre que el CARBONO, y siendo su posición contigua en el sistema periódico, ?qué propiedades del carbono han hecho que se seleccione en el proceso de evolución frente al silicio?. ?Quienes influyen más en la plasmolisis de una célula vegetal, los glúcidos y los cationes disueltos en el medio externo?. ?Y en la turgescencia?. Razónalo. ?Qué ocurriría si se inyectase a una persona agua destilada?.?Por qué ?: Si se elimina la pared celular de un tejido vegetal por procesos enzimáticos, las células quedarán con la membrana plasmática únicamente. ?Se darán fenómenos de turgescencia?. ?Qué ocurrirá con las células en un tejido vegetal así tratado?. ?Por qué a un filete, y en general a toda la carne, no conviene salarla hasta qué esté dorada?.

21.

22.

23. 24.

25.

http://www.arrakis.es/~lluengo/actibioq.html (3 of 8)01/08/2004 9:22:42

Untitled

26. 27.

Define los siguientes conceptos: enlace O-glucosídico, carbono anomérico. ?A qué tipo de molécula corresponde la sacarosa?. ?Tomas habitualmente en estado puro este disacárido?. ?Cuándo?. Indica las semejanzas y diferencias entre: la celulosa y el almidón la celulosa y la quitina el almidón y el glucógeno.

28.
r r r

29.

A la vista de las fórmulas estructurales de los monosacáridos, escribe la estructura de dos disacáridos cualesquiera con poder reductor y de dos disacáridos sin poder reductor. Pon las fórmulas lineales y cíclicas de la glucosa. Indica en cada una de ellas el n: de isómeros que tienen y como se llaman. Construye un disacárido, di el enlace que se forma y su posible comportamiento, si se le tratara con el Reactivo de Fheling.
r

30.

31. 32.

r

r

?Cuáles son los glúcidos de almacenamiento en los vegetales?. Escribe la estructura molecular de los mismos Describe qué experiencia llevarías a cabo para averiguar si un determinado tallo convierte glucosa en polisacárido. La gráfica muestra las cantidades relativas de glúcidos en hojas y tubérculos de una planta de patata.

Interprétala indicando los cambios bioquímicos que se producen esquematiza
http://www.arrakis.es/~lluengo/actibioq.html (4 of 8)01/08/2004 9:22:42

Untitled

las correspondientes reacciones. 33. Define los siguientes conceptos: lipófobo, anfipático, esterificación, hidrófobo. Relaciona mediante flechas los siguientes lípidos con el grupo al que pertenecen:

34.

fosfoglicérido terpeno esteroide esfingolípido triglicérido ácido graso

colesterol ácido oléico cerebrósido tripalmitina lecitina vitamina A

35. 36. 37.

?Qué es un jabón?. Explica cómo se forma. colesterol y la vitamina D? Si te dan la fórmula estructural de un ácido graso, ?en qué te basarías para conjeturar que se trata de una sustancia sólida o líquida a temperatura ambiente?. Ahora recordamos el cuento de Blancanieves...La bruja le regaló una bonita manzana roja que antes había frotado para sacarle un brillo espectacular. r ?Qué tipo de lípido tienen en su piel la manzana y otros frutos? r ?Qué función tienen? En el tubo digestivo, las enzimas proteolíticas van transformando progresivamente las proteinas en péptidos y éstos en aminoácidos, ? Qué tipo de enlaces e interacciones han de romper para conseguir estas transformaciones?. Indica si son verdaderas o falsas las siguientes afirmaciones. Razona las respuestas. r La estructura secundaria de las proteínas puede ser globular o fibrosa. r En la desnaturalización de las proteínas se rompen los enlaces peptídicos.

38.

39.

40.

http://www.arrakis.es/~lluengo/actibioq.html (5 of 8)01/08/2004 9:22:42

Untitled

41.

La tabla siguiente muestra el espectro de actividad de una enzima frente a la temperatura: Temperatura Actividad 0: 0 5: 24 10: 36 20: 150 30: 250 40: 400 50: 300 60: 25 70: 0

Haz la gráfica y comenta la relación entre temperatura y actividad enzimática 42. Basándote en la función que realizan las siguientes proteínas, o en la localización de las mismas en los distintos tejidos o materiales, ?podrías indicar si son globulares o fibrosas? r Elastina (tejido conjuntivo) r Lactasa (enzima) r Fibroína ( seda) r Hemoglobina (transporte de oxígeno) r Queratina (uñas) Define los siguientes conceptos: metabolito, energía de activación, reacción exoergónica, apoenzima, sustrato, producto. Indica qué clases de reacciones catalizan las siguientes enzimas: piruvato-quinasa fosfoglucomutasa ADN-polimerasa succinato-deshidrogenasa

43.

44.
r r r r

45.

En la figura siguiente se representa la relación entre el pH y la actividad catalítica de tres enzimas, la pepsina (P), la tripsina (T) y la fosfatasa alcalina (F).

http://www.arrakis.es/~lluengo/actibioq.html (6 of 8)01/08/2004 9:22:42

Untitled

r

r

r

r

r

Indica los valores de pH para los cuales dos enzimas tienen la misma velocidad de reacción. Determina el intervalo del pH para el cual tiene actividad catalítica las tres enzimas, pero con velocidades de reacción distintas. Para valores máximos de acidez , ?cuál es la enzima con mayor actividad catalítica? ?Qué valores y qué unidades se emplean para representar la velocidad de reacción?. Si el pH de la sangre es 7'3 , razona qué enzimas podrían presentar actividad catalítica en el plasma sanguíneo.

46.

?Qué molécula resulta más estable químicamente, la de ADN o la de ARN?. ?A qué se debe esta estabilidad?. Define qué es un nucleótido, escribiendo la fórmula de uno cualquiera que justifique tal definición ?Qué nucleótidos forman el ADN y cuáles el ARN ?. < ?Qué quiere decir que las dos cadenas que forman el ADN son complementarias?. ?Qué relación hay entre este hecho y las llamadas reglas de Chargaff? Indica las diferencias de función y localización que encuentras entre los tipos más importantes de ARN?.

47.

48. 49.

50.

http://www.arrakis.es/~lluengo/actibioq.html (7 of 8)01/08/2004 9:22:42

Untitled

51.

Enumera las diferencias que existen entre el ADN y el ARN , en cuanto a composición química, estructura molecular, tamaño y localización en una célula eucariótica.

http://www.arrakis.es/~lluengo/actibioq.html (8 of 8)01/08/2004 9:22:42

Actividades Genetica molecular

Nivel de dificultad de los ejercicios

sencillos

medios

avanzados

1. 2.

?Cuál es el concepto actual de gen?. ?Qué función realizan en general las ADN polimerasas y las ARN polimerasas? ?Qué se entiende por "dogma central de la Biología Molecular"? ?Qué significa qué el código genético es altamente específico y al mismo tiempo degenerado?. ?Puede ésto ofrecer alguna ventaja?. Señala los aspectos diferentes que encuentras entre replicación y transcripción.? Qué tienen en común? ?Qué es una mutación génica?. Discute brevemente las posibilidades de que se hereden tales mutaciones en un ser unicelular o en uno pluricelular. Cita algunos ejemplos de mutaciones génicas. ?Qué se entiende por ingeniería genética?. ?Conoces algunas de sus aplicaciones actuales?: Observa los siguientes esquemas, relativos al funcionamiento de los ácidos nucléicos, e indica cuáles son verdaderos y cuáles son falsos:

3. 4.

5.

6.

7.

8.

ADN

transcripción

ARN

http://www.arrakis.es/~lluengo/actigene.html (1 of 5)01/08/2004 9:56:39

Actividades Genetica molecular

ADN

traducción

proteína

ADN

replicación

ADN1 + ADN2

ADN

traducción

ARN

9.

Se realiza el análisis químico de un ácido nucléico y nos va suministrando progresivamente la información. Se escribe a continuación , por orden cronológico, la información que nos suministran. Conjetura después de cada etapa el tipo de ácido nucléico que se está analizando, y justifica tu respuesta: r Contiene un hidrato de carbono que es la ribosa r Contiene un 13% de uracilo, un 25% de adenina, un 28% de guanina y un 34% de citosina. r Su peso molecular es de 200.000 ?Qué quiere decir que en la replicación del ADN una cadena se copia de forma continua y la otra lo hace de forma discontinua y desfasada?. Cita algún mecanismo de reparación del ADN en el que intervenga una ADN polimerasa. En la purificación de un fragmento de ADN se ha perdido una porción de una de las dos hebras, quedando la secuencia de bases nitrogenadas como se indica a continuación. Reconstruye la porción que falta y explica en qué te basas para reconstruirla.

10.

11.

12.

ATTACC................. TAATGGGCCGAATTCGGCTAAGCT

http://www.arrakis.es/~lluengo/actigene.html (2 of 5)01/08/2004 9:56:39

Actividades Genetica molecular

13.

Si el ácido nucléico que se estuviera purificando fuera ARN , ?podrías reconstruir una porción perdida con la misma facilidad que lo has hecho en la cuestión anterior?. ?Qué datos necesitarías para intentar dicha reconstrucción?: En la purificación de unas moléculas de ARNt se obtiene un fragmento cuya secuencia de bases nitrogenadas es la siguiente:

14.

AUACGGCUAUCAGA UAUGCCGAUAGUCU
?Puede encontrarse en ese fragmento la secuencia del anticodón?. Razona tu respuesta. 15.
r r r r r r

Define brevemente los siguientes conceptos: nucleótido polinucleótido cromatina brazo aceptor del ARNt desnaturalización del ADN anticodón La siguiente secuencia de bases corresponde a un fragmento de una hebra de

16.

ADN:

TACCAACGGCAT
r r

r

r

Escribe el ARNm resultante de su transcripción. ? A cuántos codones del ARNm da lugar este fragmento?. Por tanto, ?cuántos aminoácidos codifica?. ?Qué aminoácidos son éstos?. ?Qué codones deben aparecer al principio y al final de este fragmento de ADN?. Escríbelos. ?Qué otras moléculas son necesarias para la síntesis de este tetrapéptido?. Imagina que deseas obtener el siguiente tripéptido: HIS- PHE- LYS ?Puedes fabricar el fragmento de ADN necesario para esta síntesis? ?Qué posible secuencia de bases utilizarías? No olvides que el tripéptido tiene un principio y un final. Nombra cuantas moléculas más tendrían que intervenir, y no dejes de indicar el número de cada una de ellas.

17.
r r r

http://www.arrakis.es/~lluengo/actigene.html (3 of 5)01/08/2004 9:56:39

Actividades Genetica molecular

18.

Consultando la tabla de la clave genética, señala el polipéptido que saldría de este trozo de ADN:

TACGCTGCGATAAACATTGCTCGAGAT

19. 20. 21. 22. 23.

?Qué quiere decir crecimiento

5

3. ?

?Cómo definirías el concepto de mutación?. Dibuja la estructura funcionante del operón lac. Función de los ribosomas en la síntesis de proteínas. Explicar el siguiente esquema:

?Es correcto este esquema?. Razona la respuesta. 24. Teniendo en cuenta la tabla del código genético, establece todos los pasos que conducirán a la síntesis del péptido: leucina-alanina-prolina-serina-arginina-arginina-valina indicando: r Una secuencia entre todas las posibles, del ADN bicatenario correspondiente, teniendo en cuenta que el codón de iniciación es el AUG en el ARNm. r La secuencia de codones del ARNm. r El número de ARNt que intervendrán en el proceso y sus anticodones específicos. 25. La secuencia de bases de una de las hebras de un fragmento de ADN es:

3' A A T C C G C G C T A T T A T C G T 5'
Representar: r La cadena complementaria
http://www.arrakis.es/~lluengo/actigene.html (4 of 5)01/08/2004 9:56:39

Actividades Genetica molecular
r

r

Replicar el fragmento formado siendo el punto de iniciación el extremo izquierdo. Señalar la dirección de síntesis en ambas hebras, así como el modo de síntesis (continua o discontinua). Explicar por qué la síntesis resulta: s semiconservativa s bidireccional s discontinua

http://www.arrakis.es/~lluengo/actigene.html (5 of 5)01/08/2004 9:56:39

Cadena respiratoria

Sería la etapa final del proceso de la respiración, es entonces cuando los electrones "arrancados" a las moléculas que se respiran y que se "almacenan" en el NADH Y FADH2, irán pasando por una serie de transportadores, situados en las crestas mitocondriales formando tres grandes complejos enzimáticos. La disposición de los transportadores permite que los electrones "salten" de unos a otros, liberándose una cierta cantidad de energía (son reacciones redox) que sirve para formar un enlace de alta energía entre el ADP y el P, que da lugar a una molécula de ATP. El último aceptor de electrones es el oxígeno molecular y otra consecuencia será la formación de agua.

http://www.arrakis.es/~lluengo/cadena.html (1 of 2)01/08/2004 9:28:37

Cadena respiratoria

Indice de Biología

http://www.arrakis.es/~lluengo/cadena.html (2 of 2)01/08/2004 9:28:37

El ATP

Aunque son muy diversas las biomoléculas que contienen energía almacenada en sus enlaces, es el ATP (adenosín trifosfato) la molécula que interviene en todas las transacciones de energía que se llevan a cabo en las células; por ella se la califica como "moneda universal de energía". El ATP está formado por adenina, ribosa y tres grupos fosfatos, contiene enlaces de alta energía entre los grupos fosfato; al romperse dichos enlaces se libera la energía almacenada.

En la mayoría de las reacciones celulares el ATP se hidroliza a ADP, rompiéndose un sólo enlace y quedando un grupo fosfato libre, que suele transferirse a otra molécula en lo que se conoce como fosforilación; sólo en algunos casos se rompen los dos enlaces resultando AMP + 2 grupos fosfato.

http://www.arrakis.es/~lluengo/atp.html (1 of 2)01/08/2004 9:29:11

El ATP

El sistema ATP <-> ADP es el sistema universal de intercambio de energía en las células.

http://www.arrakis.es/~lluengo/atp.html (2 of 2)01/08/2004 9:29:11

La membrana plasmática

La célula está rodeada por una membrana, denominada "membrana plasmática". La membrana delimita el territorio de la célula y controla el contenido químico de la célula. La membrana plasmática representa el límite entre el medio extracelular y el intracelular. Es de gran importancia para los organismos, ya que a su través se transmiten mensajes que permiten a las células realizar numerosas funciones. Es tan fina que no se puede observar con el microscopio óptico, siendo sólo visible con el microscopio electrónico. Presenta las siguientes características:
q

q

Es una estructura continua que rodea a la célula. Por un lado está en contacto con el citoplasma (medio interno) y, por el otro, con el medio extracelular que representa el medio externo. Contiene receptores específicos que permiten a la célula interaccionar con mensajeros químicos y emitir la respuesta adecuada.

http://www.arrakis.es/~lluengo/membrana.html (1 of 5)01/08/2004 9:32:20

La membrana plasmática

En la composición química de la membrana entran a formar parte lípidos, proteínas y glúcidos en proporciones aproximadas de 40%, 50% y 10%, respectivamente.
q

Lípidos:
En la membrana de la célula eucariota encontramos tres tipos de lípidos: fosfolípidos, glucolípidos y colesterol. Todos tienen carácter anfipático ; es decir que tienen un doble comportamiento, parte de la molécula es hidrófila y parte de la molécula es hidrófoba por lo que cuando se encuentran en un medio acuoso se orientan formando una bicapa lipídica La membrana plasmática no es una estructura estática, sus componentes tienen posibilidades de movimiento, lo que le proporciona una cierta fluidez. Los movimientos que pueden realizar los lípidos son: de rotación: es como si girara la molécula en torno a su eje. Es muy frecuente y el responsable en parte de los
r

r

r

r

otros movimientos. de difusión lateral: las moléculas se difunden de manera lateral dentro de la misma capa. Es el movimiento más frecuente. flip-flop: es el movimiento de la molécula lipídica de una monocapa a la otra gracias a unas enzimas llamadas flipasas. Es el movimiento menos frecuente, por ser energéticamente más desfavorable. de flexión: son los movimientos producidos por las colas hidrófobas de los fosfolípidos.

La fluidez es una de las características más importantes de las membranas. Depende de factores como :
r

la temperatura, la fluidez aumenta al aumentar la temperatura.

http://www.arrakis.es/~lluengo/membrana.html (2 of 5)01/08/2004 9:32:20

La membrana plasmática
r

la naturaleza de los lípidos, la presencia de lípidos insaturados y de cadena corta favorecen el aumento de fluidez; la presencia de colesterol endurece las membranas, reduciendo su fluidez y permeabilidad.

q

Proteinas
: Son los componentes de la membrana que desempeñan las funciones específicas (transporte, comunicación, etc). Al igual que en el caso de los lípidos , las proteinas pueden girar alrededor de su eje y muchas de ellas pueden desplazarse lateralmente (difusión lateral) por la membrana. Las proteinas de membrana se clasifican en: r Proteinas integrales: Están unidas a los lípidos intímamente, suelen atravesar la bicapa lípidica una o varias veces, por esta razón se les llama proteinas de transmembrana. r Proteinas periféricas: Se localizan a un lado u otro de la bicapa lipídica y están unidas debilmente a las cabezas polares de los lípidos de la membrana u a otras proteinas integrales por enlaces de hidrógeno.

q

Glúcidos
Se situan en la superficie externa de las células eucariotas por lo que contribuyen a la asimetría de la membrana. Estos glúcidos son oligosacáridos unidos a los lípidos (glucolípidos), o a las proteinas (glucoproteinas). Esta cubierta de glúcidos representan el carne de identidad de las células, constituyen la cubierta celular o glucocálix, a la que se atribuyen funciones fundamentales: r Protege la superficie de las células de posibles lesiones r Confiere viscosidad a las superficies celulares, permitiendo el deslizamiento de células en movimiento, como , por ejemplo, las sanguineas r Presenta propiedades inmunitarias, por ejemplo los glúcidos del glucocálix de los glóbulos rojos representan los antígenos propios de los grupos sanguineos del sistema sanguineo ABO. r Interviene en los fenómenos de reconocimiento celular,particularmente importantes durante el desarrollo embrionario. r En los procesos de adhesión entre óvulo y espermatozoide.

Con los datos ofrecidos por la microscopía electrónica y los análisis bioquímicos se han elaborado varios modelos de membrana.

http://www.arrakis.es/~lluengo/membrana.html (3 of 5)01/08/2004 9:32:20

La membrana plasmática

En la actualidad el modelo más aceptado es el propuesto por Singer y Nicholson (1972), denominado modelo del mosaico fluido , que presenta las siguientes características:
q

q q

Considera que la membrana es como un mosaico fluido en el que la bicapa lipídica es la red cemetantey las proteinas embebidas en ella, interaccionando unas con otras y con los lípidos. Tanto las proteinas como los lípidos pueden desplazarse lateralmente. Los lípidos y las proteinas integrales se hallan dispuestos en mosaico. Las membranas son estructuras asimétricas en cuanto a la distribución fundamentalmente de los glúcidos, que sólo se encuentran en la cara externa.

Las funciones de la membrana podrían resumirse en :

1.

TRANSPORTE El intercambio de materia entre el interior de la célula y su ambiente externo. Haz clic para ampliar este tema RECONOCIMIENTO Y COMUNICACIÓN Gracias a moléculas situadas en la parte externa de la membrana, que actúan como receptoras de sustancias.

3.

http://www.arrakis.es/~lluengo/membrana.html (4 of 5)01/08/2004 9:32:20

La membrana plasmática

http://www.arrakis.es/~lluengo/membrana.html (5 of 5)01/08/2004 9:32:20

Mecanismos de transporte

La bicapa lipídica de la membrana actúa como una barrera que separa dos medios acuosos, el medio donde vive la célula y el medio interno celular. Las células requieren nutrientes del exterior y deben eliminar sustancias de desecho procedentes del metabolismo y mantener su medio interno estable. La membrana presenta una permeabilidad selectiva, ya que permite el paso de pequeñas moléculas, siempre que sean lipófilas, pero regula el paso de moléculas no lipófilas. Los mecanismos de transporte pueden verse en el siguiente esquema:

http://www.arrakis.es/~lluengo/transporte.html (1 of 8)01/08/2004 9:37:56

Mecanismos de transporte

Transporte de moléculas de baja masa molecular: 1. El transporte pasivo. Es un proceso de difusión de sustancias a través de la membrana. Se produce siempre a favor del gradiente, es decir, de donde hay más hacia el medio donde hay menos. Este tranporte puede darse por: r Difusión simple . Es el paso de pequeñas moléculas a favor del gradiente; puede realizarse a través de la bicapa lipídica o a través de canales proteícos. 1. Difusión simple a través de la bicapa (1). Así entran moléculas lipídicas como las hormonas esteroideas, anestésicos como el éter y fármacos liposolubles. Y sustancias apolares como el oxígeno y el nitrógeno atmosférico. Algunas moléculas polares de muy pequeño tamaño, como el agua, el CO2, el etanol y la glicerina, también atraviesan la membrana por difusión simple. La difusión del agua recibe el nombre de ósmosis 2. Difusión simple a través de canales (2).Se realiza mediante las denominadas proteínas de canal. Así entran iones como el Na+, K+, Ca2+, Cl-. Las proteínas de canal son proteínas con un orificio o canal interno, cuya apertura está regulada, por ejemplo por ligando, como ocurre con neurotransmisores u hormonas, que se unen a una determinada región, el receptor de la proteína de canal, que sufre una transformación estructural que induce la apertura del canal.

http://www.arrakis.es/~lluengo/transporte.html (2 of 8)01/08/2004 9:37:56

Mecanismos de transporte

Difusión facilitada (3). Permite el transporte de pequeñas moléculas polares, como los aminoácidos, monosacáridos, etc, que al no poder, que al no poder atravesar la bicapa lipídica, requieren que proteínas trasmembranosas faciliten su paso. Estas proteínass reciben el nombre de proteínas transportadoras o permeasas que, al unirse a la molécula a transportar sufren un cambio en su estructura que arrastra a dicha molécula hacia el interior de la célula. 2. El transporte activo (4). En este proceso también actúan proteínas de membrana, pero éstas requieren energía, en forma de ATP, para transportar las moléculas al otro lado de la membrana. Se produce cuando el transporte se realiza en contra del gradiente electroquímico. Son ejemplos de transporte activo la bomba de Na/K, y la bomba de Ca. r La bomba de Na+/K+ Requiere una proteína transmembranosa que bombea Na+ hacia el exterior de la membrana y K+ hacia el interior. Esta proteína actúa contra el gradiente gracias a su actividad como ATP-asa, ya que rompe el ATP para obtener la energía necesaria para el transporte.
r

http://www.arrakis.es/~lluengo/transporte.html (3 of 8)01/08/2004 9:37:56

Mecanismos de transporte

Por este mecanismo, se bombea 3 Na+ hacia el exterior y 2 K+ hacia el interior, con la hidrólisis acoplada de ATP. El transporte activo de Na+ y K+ tiene una gran importancia fisiológica. De hecho todas las células animales gastan más del 30% del ATP que producen ( y las células nerviosas más del 70%) para bombear estos iones. Transporte de moléculas de elevada masa molecular: Para el transporte de este tipo de moléculas existen tres mecanismos principales: endocitosis, exocitosis y transcitosis. En cualquiera de ellos es fundamental el papel que desempeñan las llamadas vesículas revestidas. Estas vesículas se encuentran rodeadas de filamentos proteicos de clatrina. 1. Endocitosis: Es el proceso por el que la célula capta partículas del medio externo mediante una invaginación de la membrana en la que se engloba la partícula a ingerir. Se produce la estrangulación de la invaginación originándose una vesícula que encierra el material ingerido. Según la naturaleza de las partículas englobadas, se distinguen diversos tipos de endocitosis. 1. Pinocitosis. Implica la ingestión de líquidos y partículas en disolución por pequeñas vesículas revestidas de clatrina. 2. Fagocitosis. Se forman grandes vesículas revestidas o fagosomas que ingieren microorganismos y restos celulares. 3. Endocitosis mediada por un receptor. Es un mecanismo por el que sólo entra la sustancia para la cual existe el correspondiente receptor en la membrana.

http://www.arrakis.es/~lluengo/transporte.html (4 of 8)01/08/2004 9:37:56

Mecanismos de transporte

Haz clic si quieres ver una fagocitosis animada.

Fagocitosis Pinocitosis

http://www.arrakis.es/~lluengo/transporte.html (5 of 8)01/08/2004 9:37:56

Mecanismos de transporte

Endocitosis mediada por receptor
2. Exocitosis. Es el mecanismo por el cual las macromoléculas contenidas en vesículas citoplasmáticas son transportadas desde el interior celular hasta la membrana plasmática, para ser vertidas al medio extracelular. Esto requiere que la membrana de la vesícula y la membrana plasmática se fusionen para que pueda ser vertido el contenido de la vesícula al medio. Mediante este mecanismo, las células son capaces de eliminar sustancias sintetizadas por la célula, o bien sustancias de desecho. En toda célula existe un equilibrio entre la exocitosis y la endocitosis, para mantener la membrana plasmática y que quede asegurado el mantenimiento del volumen celular.

http://www.arrakis.es/~lluengo/transporte.html (6 of 8)01/08/2004 9:37:56

Mecanismos de transporte

3. Transcitosis.Es el conjunto de fenómenos que permiten a una sustancia atravesar todo el citoplasma celular desde un polo al otro de la célula. Implica el doble proceso endocitosis-exocitosis. Es propio de células endoteliales que constituyen los capilares sanguineos, transportándose así las sustancias desde el medio sanguineo hasta los tejidos que rodean los capilares.

Aquí tienes dos animaciones donde puedes ver como se deforma la
http://www.arrakis.es/~lluengo/transporte.html (7 of 8)01/08/2004 9:37:56

Mecanismos de transporte

membrana en los procesos de endocitosis y exocitosis

http://www.arrakis.es/~lluengo/transporte.html (8 of 8)01/08/2004 9:37:56

http://www.arrakis.es/~lluengo/endocitosis.gif

http://www.arrakis.es/~lluengo/endocitosis.gif01/08/2004 9:38:59

Reconocimiento celular

La supervivencia de todos los organismos, exige que sus células sean capaces de responder adecuadamente a los estímulos (cambios ambientales de cualquier tipo). Esta capacidad implica la presencia de unos receptores en la membrana celular capaces de ser activados por mensajes que le venga del medio extracelular. Estos receptores de membrana ya estimulados transformarían la señal extracelular en un señal intracelular o segundo mensajero. Este segundo mensajero actúa sobre enzimas o factores intracelulares provocando una cascada de acontecimientos que conducen a una respuesta celular. Esta respuesta, según el tipo celular de que se trate, puede ser la contracción muscular, la secreción glandular, la división celular, etc. Uno de los segundos mensajeros más utilizados por las células es el AMP cíclico (AMPc). En el siguiente esquema puede ver la actuación del AMP cíclico.

haz clic aquí o en la imagen para ver la animación
q q

q

q

Unión de la molécula señal a su receptor y activación de éste. El complejo formado por el receptor y la molécula señal, activa a una proteina de membrana llamada proteina G Ésta activa a su vez, el enzima de membrana adenilato-ciclasa, que a partir de ATP sintetiza AMPc Y por último, el AMPc activa a una enzima intracelular capaz de activar a otros

http://www.arrakis.es/~lluengo/reconocimiento.html (1 of 2)01/08/2004 9:39:44

Reconocimiento celular

muchos enzimas intracelulares, que desencadenan una cascada de acontecimientos, hasta provocar la respuesta celular. Y no dejes de ver la animación de este proceso.

http://www.arrakis.es/~lluengo/reconocimiento.html (2 of 2)01/08/2004 9:39:44

http://www.arrakis.es/~lluengo/memreco.gif

http://www.arrakis.es/~lluengo/memreco.gif01/08/2004 9:42:37

Fase luminosa

Los hechos que ocurren en la fase luminosa de la fotosíntesis se pueden resumir en estos puntos: 1. Smntesis de ATP o fotofosforilación que puede ser: r acíclica o abierta r cíclica o cerrada 2. Síntesis de poder reductor NADPH 3. Fotolisis del agua
(Estos procesos puedes verlo en los esquemas propuestos y estan explicados en el texto adjunto.)

Los pigmentos presentes en los tilacoides de los cloroplastos se encuentran organizados en fotosistemas(conjuntos funcionales formados por más de 200 moléculas de pigmentos); la luz captada en ellos por pigmentos que hacen de antena, es llevada hasta la molécula de "clorofila diana" que es la molécula que se oxida al liberar un electrón, que es el que irá pasando por una serie de transportadores, en cuyo recorrido liberará la energía.

Existen dos tipos de fotosistemas, el fotosistema I (FSI), está asociado a moléculas de clorofila que absorben a longitudes de ondas largas (700 nm)y se conoce como P700. El
http://www.arrakis.es/~lluengo/faseluminosa.html (1 of 3)01/08/2004 9:49:53

Fase luminosa

fotosistema II (FSII), está asociado a moléculas de clorofila que absorben a 680 nm. por eso se denomina P680. La luz es recibida en el FSII por la clorofila P680 que se oxida al liberar un electrón que asciende a un nivel superior de energía; ese electrón es recogido por una sustancia aceptora de electrones que se reduce,la Plastoquinona (PQ) y desde ésta va pasando a lo largo de una cadena transportadora de electrones, entre los que están varios citocromos (cyt b/f) y así llega hasta la plastocianina (PC) que se los cederá a moléculas de clorofila del FSI. En el descenso por esta cadena, con oxidación y reducción en cada paso , el electrón va liberando la energía que tenía en exceso; energía que se utiliza para bombear protones de hidrógeno desde el estroma hasta el interior de los tilacoides, generando un gradiente electroquímico de protones. Estos protones vuelven al estroma a través de la ATP-asa y se originan moléculas de ATP. El fotosistema II se reduce al recibir electrones procedentes de una molécula de H2O, que también por acción de la luz, se descompone en hidrógeno y oxígeno, en el proceso llamado fotólisis del H2O. De este modo se puede mantener un flujo continuo de electrones desde el agua hacia el fotosistema II y de éste al fotosistema I. En el fotosistema I la luz produce el mismo efecto sobre la clorofila P700, de modo que algún electrón adquiere un nivel energético superior y abandona la molécula, es recogido por otro aceptor de electrones , la ferredoxina y pasa por una nueva cadena de transporte hasta llegar a una molécula de NADP+ que es reducida a NADPH,al recibir dos electrones y un protón H+ que también procede de la descomposición del H2O. Los dos fotosistemas pueden actuar conjuntamente - proceso conocido como esquema en Z, para producir la fotofosforilación (obtención de ATP) o hacerlo solamente el fotosistema I; se diferencia entonces entre fosforilación no cíclica o acíclica cuando actúan los dos, y fotofosforilación cíclica, cuando actúa el fotosistema I unicamente. En la fotofosforilación acíclica se obtiene ATP y se reduce el NADP+ a NADPH , mientras que en la fotofosforilación cíclica únicamente se obtiene ATP y no se libera oxígeno.

http://www.arrakis.es/~lluengo/faseluminosa.html (2 of 3)01/08/2004 9:49:53

Fase luminosa

Mientras la luz llega a los fotosistemas, se mantiene un flujo de electrones desde el agua al fotosistema II, de éste al fotosistema I, hasta llegar el NADP+ que los recoge; ésta pequeña corriente eléctrica es la que mantiene el ciclo de la vida.

http://www.arrakis.es/~lluengo/faseluminosa.html (3 of 3)01/08/2004 9:49:53

El comienzo de la vida

Según los cálculos más modernos, la Tierra se formó hace unos 4.500 millones de años y un millón de años después aparecería la vida. La explicación de cómo apareció es especulativa, ya que las condiciones reinantes en aquella primitiva atmósfera no son exactamente reproducibles en un laboratorio. De todas formas, se han diseñado experimentos que pueden ayudar a explicar los distintos pasos ocurridos hasta que surgió la vida.

En 1922, el bioquímico A. Oparin formuló su hipótesis sobre los procesos de evolución química que debieron producirse durante el origen de la vida. Según él, las moléculas orgánicas podrían formarse con los gases de la atmósfera, sometidos a grandes descargas eléctricas que ocurrían durante grandes tormentas. Estas moléculas se irían concentrando en los mares y lagos terrestres, formando lo que denominó como una "rica sopa". La comunidad científica de entonces ignoró sus ideas.

Sin embargo, en 1950 un estudiante de la Universidad de Chicago, Stanley Miller, probó la hipótesis de Oparín.

http://www.arrakis.es/~lluengo/oparin.html (1 of 2)01/08/2004 9:57:53

El comienzo de la vida

Stanley Miller

Miller demostró en el laboratorio, utilizando un aparato diseñado por él, similar al que ves en el dibujo, la posibilidad de que se formaran espontáneamente moléculas orgánicas. Para ello, hizo pasar vapor de agua a través de un recipiente de cristal que contenía una mezcla de gases como metano (CH4),amoníaco (NH3), hidrógeno (H2)entre otras moléculas que se suponía serían las más abundantes en la primitiva atmósfera reductora. Al mismo tiempo, las sometía a descargas eléctricas. El resultado fue la formación de una serie de moléculas orgánicas como ácido aspártico, ácido glutámico, ácido acético, ácido fórmico, urea, alanina y glicocola entre otras moléculas.

http://www.arrakis.es/~lluengo/oparin.html (2 of 2)01/08/2004 9:57:53

Evolución celular

Carl Woese (1980) denominó protobionte o progenote al antepasado común de todos los organismos y representaría la unidad viviente más primitiva, pero dotada ya de la maquinaria necesaria para realizar la transcripción y la traducción genética. De este tronco común surgirían en la evolución tres modelos de células procariotas :
q q q

arqueas urcariotas bacterias

Durante un período de más de 2000 millones de años, solamente existieron estas formas celulares, por lo que se puede pensar que se adaptaron a vivir en todos los ambientes posibles y "ensayarían" todos los posibles mecanismos para realizar su metabolismo. La evolución celular se produjo en estrecha relación con la evolución de la atmósfera y de los océanos. La teoría más aceptada es que : 1. las primeras células serían heterótrofas anaerobias, utilizarían como alimento las moléculas orgánicas presentes en el medio. Como estas moléculas terminarían por agotarse, podría haber ocurrido una primera crisis ecológica, si no hubiera sido porque en algún momento de la evolución celular...

http://www.arrakis.es/~lluengo/origencelula.html (1 of 6)01/08/2004 9:59:22

Evolución celular

2. algunas células aprendieron a fabricar las moléculas orgánicas mediante la fijación y reducción del CO2. Se iniciaba así la fotosíntesis, como un proceso de nutrición autótrofa. El empleo del agua en la fotosíntesis como donante de electrones, tuvo como origen la liberación de O2 y por tanto la transformación de la atmósfera reductora en la atmósfera oxidante que hoy conocemos. Empezón una revolución del oxígeno que causaría la muerte de muchas formas celulares para las que fue un veneno, otras se adaptarían a su presencia y ...

http://www.arrakis.es/~lluengo/origencelula.html (2 of 6)01/08/2004 9:59:22

Evolución celular

3. algunas células aprendieron a utilizarlo para sus reacciones metabólicas, lo que dio lugar a la respiración aerobia, realizando una nutrición heterótrofa aerobia.

Estas formas celulares tienen organización procariota y son de pequeño tamaño. A partir de ellas, se piensa que evolucionaron las células eucariotas.

El siguiente paso en la evolución celular fue la aparición de las eucariotas hace unos 1.500 millones de años.

http://www.arrakis.es/~lluengo/origencelula.html (3 of 6)01/08/2004 9:59:22

Evolución celular

Lynn Margulis, en su teoría endosimbiótica propone que se originaron a partir de una primitiva célula procariota, que perdió su pared celular, lo que le permitió aumentar de tamaño, esta primitiva célula conocida con el nombre de urcariota. Esta célula en un momento dado, englobaría a otras células procarióticas, estableciéndose entre ambos una relación endosimbionte.

Algunas fueron las precursoras de los peroxisomas, con capacidad para eliminar sustancias tóxicas formadas por el creciente aumento de oxígeno en la atmósfera. Otras fueron las precursoras de las mitocondrias, encargadas en un principio de proteger a la célula huésped contra su propio oxígeno.

http://www.arrakis.es/~lluengo/origencelula.html (4 of 6)01/08/2004 9:59:22

Evolución celular

Por último, algunas células procariotas fueron las precursoras de los cloroplastos . De hecho, mitocondrias y cloroplastos son similares a las bacterias en muchas características y se reproducen por división. Poseen su propio ADN y poseen ARN ribosómicos semejantes a los de las bacterias.

La incorporación intracelular de estos organismos procarióticos a la primitiva célula urcariota, le proporcionó dos características fundamentales de las que carecía: 1. La capacidad de un metabolismo oxidativo, con lo cual la célula anaerobia pudo convertirse en aerobia. 2. La posibilidad de realizar la fotosíntesis y por tanto ser un organismo autótrofo capaz de utilizar como fuente de carbono el CO2 para producir moléculas orgánicas. Así mismo, la célula primitiva le proporcionaba a las procariotas simbiontes un entorno seguro y alimento para su supervivencia. Se trataría de una endosimbiosis altamente ventajosa para los organismo implicados, ya que todos ellos habrían adquirido particularidades metabólicas que no poseían por sí mismos separadamente, ventaja que sería seleccionada en el transcurso de la evolución. En el siguiente dibujo, puede verse esquematizada esta teoría endosimbiótica:

http://www.arrakis.es/~lluengo/origencelula.html (5 of 6)01/08/2004 9:59:22

Evolución celular

http://www.arrakis.es/~lluengo/origencelula.html (6 of 6)01/08/2004 9:59:22

Untitled

http://www.arrakis.es/~lluengo/tiposcelulas.html (1 of 3)01/08/2004 10:00:20

Untitled

http://www.arrakis.es/~lluengo/tiposcelulas.html (2 of 3)01/08/2004 10:00:20

Untitled

http://www.arrakis.es/~lluengo/tiposcelulas.html (3 of 3)01/08/2004 10:00:20

celula

Esta actividad te ayudará a recordar los distintos orgánulos que tiene la célula eucariota animal. Solamente tienes que "arrastrar y soltar". Para recordar los nombres de las distintas partes, puedes ayudarte con este dibujo donde verás el aspecto final de la célula y los nombres correspondientes. También puedes bajarte la animación a tu ordenador.

http://www.arrakis.es/~lluengo/canimal.html01/08/2004 10:00:48

http://www.arrakis.es/~lluengo/organulosc.jpg

http://www.arrakis.es/~lluengo/organulosc.jpg01/08/2004 10:01:24

cvegetal

Esta actividad te ayudará a recordar los distintos orgánulos que tiene la célula eucariota vegetal. Solamente tienes que "arrastrar y soltar". Para recordar los nombres de las distintas partes, puedes ayudarte con este dibujo donde verás el aspecto final de la célula y los nombres correspondientes.

http://www.arrakis.es/~lluengo/cvegetal.html01/08/2004 10:02:03

http://www.arrakis.es/~lluengo/cvegetalc.jpg

http://www.arrakis.es/~lluengo/cvegetalc.jpg01/08/2004 10:02:26

Untitled

http://www.arrakis.es/~lluengo/canimald.html01/08/2004 10:03:01

Untitled

http://www.arrakis.es/~lluengo/cvegetald.html01/08/2004 10:03:37

Célula

Las células son estructuras altamente organizadas en su interior, constituídas por diferentes orgánulos implicados, cada uno de ellos en diferentes funciones. Sin embargo, todas las células eucariotas, que son las de todos los seres vivos con la excepción de las bacterias cuyas células son mucho más sencillas, comparten un plan general de organización: 1. Una MEMBRANA que determina su individualidad 3. Un NÚCLEO Que contiene el material genético y ejerce el control de la célula 5. Un CITOPLASMA Lleno de orgánulos, dónde se ejecutan practicamente todas las funciones.
http://www.arrakis.es/~lluengo/celula.html (1 of 2)01/08/2004 10:04:21

Célula

La figura muestra un dibujo esquemático de una célula típica con diversos orgánulos en su interior

http://www.arrakis.es/~lluengo/celula.html (2 of 2)01/08/2004 10:04:21

El núcleo

El núcleo es un orgánulo característico de las células eucariotas. El material genético de la célula se encuentra dentro del núcleo en forma de cromatina.

corte del núcleo El nucleo dirige las actividades de la célula y en él tienen lugar procesos tan importantes como la autoduplicación del ADN o replicación, antes de comenzar la división celular, y la transcripción o producción de los distintos tipos de ARN, que servirán para la síntesis de proteínas. El núcleo cambia de aspecto durante el ciclo celular y llega a desaparecer como tal. Por ello se describe el núcleo en interfase durante el cual se puede apreciar las siguientes partes en su estructura:
q

q

envoltura nuclear: formada por dos membranas concéntricas perforadas por poros nucleares. A través de éstos se produce el transporte de moléculas entre el núcleo y el citoplasma. el nucleoplasma, que es el medio interno del núcleo donde se encuentran el resto de los componentes nucleares.

http://www.arrakis.es/~lluengo/nucleo.html (1 of 4)01/08/2004 10:04:46

El núcleo
q

q

nucléolo, o nucléolos que son masas densas y esféricas, formados por dos zonas: una fibrilar y otra granular. La fibrilar es interna y contiene ADN, la granular rodea a la anterior y contiene ARN y proteínas. la cromatina, constituida por ADN y proteinas, aparece durante la interfase; pero cuando la célula entra en división la cromatina se organiza en estructuras individuales que son los cromosomas.

CROMATINA Y CROMOSOMAS

Un cromosoma es una molécula de ADN muy larga que contiene una serie de genes. Un cromosoma metafásico está formado por dos cromátidas idénticas en sentido longitudinal. En cada una de ellas hay un nucleofilamento de ADN replegado idéntico en ambas cromátidas.

Están unidas a través del centrómero. En las cromátidas se aprecia también un cinetócoro, centro organizador de microtúbulos, que se forman durante la mitosis y que ayudan a unir los cromosomas con el huso mitótico. Por lo tanto podemos decir que cromatina y cromosomas es lo mismo, y el cromosoma sería un paquete de cromatina muy compacto.

http://www.arrakis.es/~lluengo/nucleo.html (2 of 4)01/08/2004 10:04:46

El núcleo

Como puede verse en estos últimos dibujos, en una secuencia que va desde el ADN hasta el cromosoma.
q q

q q

q

El número 1 corresponde a la molécula de ADN, En el número 2 , vemos el ADN unido a proteínas globulares, formando una estructura denominada "collar de perlas", formado por la repetición de unas unidades que son los "nucleosomas", que corresponderían a cada perla del collar. En el número 3 se pasa a una estructura de orden superior formando un "solenoide". En el número 4, se consigue aumentar el empaquetamiento, formando la fibra de cromatina, nuevos "bucles". En el número 5, llegamos al grado de mayor espiralización y compactación, formando un denso paquete de cromatina, que es en realidad, un cromosoma.

El total de la información genética contenida en los cromosomas de un organismo constituye su genoma.
http://www.arrakis.es/~lluengo/nucleo.html (3 of 4)01/08/2004 10:04:46

El núcleo

http://www.arrakis.es/~lluengo/nucleo.html (4 of 4)01/08/2004 10:04:46

Mitosis

La mitosis es el proceso de división celular por el cual se conserva la información genética contenida en sus cromosomas, que pasa de esta manera a las sucesivas células a que la mitosis va a dar origen. La mitosis es igualmente un verdadero proceso de multiplicación celular que participa en el desarrollo, el crecimiento y la regeneración del organismo. El proceso tiene lugar por medio de una serie de operaciones sucesivas que se desarrollan de una manera continua, y que para facilitar su estudio han sido separadas en varias
http://www.arrakis.es/~lluengo/mitosis.html (1 of 3)01/08/2004 10:05:32

Mitosis

etapas. 1. PROFASE En ella se hacen patentes un cierto número de filamentos dobles: los cromosomas.Cada cromosoma constituído por dos cromátidas, que se mantienen unidas por un estrangulamiento que es el centrómero. Cada cromátida corresponde a una larga cadena de ADN. Al final de la profase ha desaparecido la membrana nuclear y el nucléolo. muy condensada 2. METAFASE Se inicia con la aparición del huso, dónde se insertan los cromosomas y se van desplazando hasta situarse en el ecuador del huso, formando la placa metafásica o ecuatorial. 3. ANAFASE En ella el centrómero se divide y cada cromosoma se separa en sus dos cromátidas. Los centrómeros emigran a lo largo de las fibras del huso en direcciones opuestas, arrastrando cada uno en su desplazamiento a una cromátida.
La anafase constituye la fase crucial de la mitosis, porque en ella se realiza la distribución de las dos copias de la información genética original.

4. TELOFASE Los dos grupos de cromátidas, comienzan a descondensarse, se reconstruye la membrana nuclear, alrededor de cada conjunto cromosómico, lo cual definirá los nuevos núcleos hijos. A continuación tiene lugar la división del citoplasma.

http://www.arrakis.es/~lluengo/mitosis.html (2 of 3)01/08/2004 10:05:32

Mitosis

http://www.arrakis.es/~lluengo/mitosis.html (3 of 3)01/08/2004 10:05:32

Ciclo celular

El ciclo de una célula es análogo al de un ser vivo,"nace" mediante la división de una célula progenitora, crece, y se reproduce. Todo este proceso es lo que constituye un ciclo celular completo

El ciclo celular comprende cuatro períodos denominados G1, S, G2 Y Mitosis. El período G1, llamado primera fase de crecimiento, se inicia con una célula hija que proviene de la división de la célula madre. La célula aumenta de tamaño, se sintetiza nuevo material citoplásmico, sobre todo proteínas y ARN. El período S o de síntesis, en el que tiene lugar la duplicación del ADN. Cuando acaba este período, el núcleo contiene el doble de proteínas nucleares y de ADN que al principio. El período G2, o segunda fase de crecimiento, en el cual se sigue sintetizando ARN y proteínas; el final de este período queda marcado por la aparición de cambios en la estructura celular ,que se hacen visibles con el microscopio y que nos indican el principio de la Mitosis o división celular. El período de tiempo que transcurre entre dos mitosis, y que comprende los períodos G1, S, y G2, se le denomina Interfase.

http://www.arrakis.es/~lluengo/ciclocel.html (1 of 2)01/08/2004 10:06:03

Ciclo celular

http://www.arrakis.es/~lluengo/ciclocel.html (2 of 2)01/08/2004 10:06:03

Diferenciaciones de la membrana

En algunos tipos de células, la membrana plasmática se ha especializado para cumplir distintas funciones como son: Microvellosidades. Se trata de prolongaciones membranosas digitiformes, propias de ciertas células,por ejemplo las del epitelio intestinal. Las microvellosidades aumentan la superficie de intercambio de la célula con el exterior y su membrana contiene enzimas y sistemas de transporte implicados en la digestión.

Uniones impermeables Se unen las membranas de las células entre si (1) hermetícamente para impedir el paso de sustancias a través de las capas celulares. Se encuentran por ejemplo, en las células epiteliales del intestino.

Desmosomas Unen las células entre sí (2) como si fuera una unión mecánica, que recuerda el sistema de corchetes que se usan en prendas de vestir. El desmosoma presenta un cuerpo denso que se fija al citoplasma celular mediante filamentos de queratina Uniones comunicantes o de tipo "gap" Unen las membranas adyacentes de las células de forma íntima mediante grupos de canales proteicos (3), pero permiten el paso de moléculas pequeñas y de impulsos eléctricos.

http://www.arrakis.es/~lluengo/diferenciaciones.html (1 of 2)01/08/2004 10:07:19

Diferenciaciones de la membrana

En esta animación puedes observar las microvellosidades intestinales y como las uniones impermeables impiden el paso de sustancias

1.

http://www.arrakis.es/~lluengo/diferenciaciones.html (2 of 2)01/08/2004 10:07:19

Citosol y citoesqueleto

Toda la porción citoplasmática que carece de estructura y constituye la parte líquida del citoplasma, recibe el nombre de citosol por su aspecto fluido. En él se encuentran las moléculas necesarias para el mantenimiento celular. El citoesqueleto , consiste en una serie de fibras que da forma a la célula, y conecta distintas partes celulares, como si se tratara de vías de comunicacion celulares. Es una estructura en continuo cambio. Formado por tres tipos de componentes: 1. Microtúbulos Son filamentos largos, formados por la proteína tubulina. Son los componentes más importantes del citoesqueleto y pueden formar asociaciones estables, como: r Centriolos Son dos pequeños cilindros localizados en el interior del centrosoma Figura 1, exclusivos de células animales. Con el microscopio electrónico se observa que la parte externa de los centriolos está formada por nueve tripletes de microtúbulos Figura 3 . Los centriolos se cruzan formando un ángulo de 90:. Figura 2

Figura 2

Figura 1
r

Figura 3

Cilios

y flagelos Son delgadas prolongaciones celulares móviles que presentan básicamente la misma estructura, la diferencia entre ellos es que los cilios son muchos y cortos, mientras que los flagelos son pocos y más largos. Constan de dos partes: una externa que sobresale de la superficie de la célula, está recubierta por la membrana plasmática y contiene un esqueleto interno de microtúbulos llamado axonema, y otra interna, que se denomina cuerpo basal del que salen las raíces ciliares que se cree participan en la coordinación del movimiento.

http://www.arrakis.es/~lluengo/citosol.html (1 of 3)01/08/2004 10:07:47

Citosol y citoesqueleto

Figura 4 3. Microfilamentos Se sitúan principalmente en la periferia celular, debajo de la membrana y están formados por hebras de la proteína actina, trenzadas en hélice, cuya estabilidad se debe a la presencia de ATP e iones de calcio. Asociados a los filamentos de miosina, son los responsables de la contracción muscular. 5. Filamentos intermedios Formados por diversos tipos de proteínas. Son polímeros muy estables y resistentes. Especialmente abundantes en el citoplasma de las células sometidas a fuertes tensiones mecánicas (queratina, desmina ) ya que su función consiste en repartir las tensiones, que de otro modo podrían romper la célula.

en el citoplasma de los filamentos del citoesqueleto Como se puede apreciar en los esquemas de la figura 5, los microtúbulos irradian desde una región del citoplasma denominada centro organizador de microtúbulos o centrosoma.

Distribución

Figura 5 Los microfilamentos se encuentran dispersos por todo el citoplasma; pero se concentran fundamentalmente por debajo de la membrana plasmática. Los filamentos intermedios, se extienden por todo el citoplasma y se anclan a la membrana plasmática proporcionando a las células resistencia mecánica.

http://www.arrakis.es/~lluengo/citosol.html (2 of 3)01/08/2004 10:07:47

Citosol y citoesqueleto

http://www.arrakis.es/~lluengo/citosol.html (3 of 3)01/08/2004 10:07:47

Reticulo endoplasmatico

Está formado por una red de membranas que forman cisternas, sáculos y tubos aplanados. Delimita un espacio interno llamado lúmen del retículo y se halla en continuidad estructural con la membrana externa de la envoltura nuclear.

Se pueden distinguir dos tipos de retículo: 1. El Retículo endoplasmático rugoso (R.E.R.), presenta ribosomas unidos a su membrana. En el se realiza la síntesis proteíca. Las proteinas sintetizadas por los ribosomas, pasan al lúmen del retículo y aquí maduran hasta ser exportadas a su destino definitivo. 2. El retículo endoplásmico liso (R.E.L.), carece de ribosomas y esta formado por túbulos ramificados y pequeñas vesículas esféricas. En este retículo se realiza la síntesis de lípidos. En el retículo de las células del hígado tiene lugar la detoxificación, que consiste en modificar a una droga o metabolito insoluble en agua,en soluble en agua, para asm eliminar dichas sustancias por la orina.

http://www.arrakis.es/~lluengo/reticulo.html (1 of 2)01/08/2004 10:07:57

Reticulo endoplasmatico

http://www.arrakis.es/~lluengo/reticulo.html (2 of 2)01/08/2004 10:07:57

Aparato de Golgi

Descubierto por C. Golgi en 1898, consiste en un conjunto de estructuras de membrana que forma parte del elaborado sistema de membranas interno de las células. Se encuentra más desarrollado cuanto mayor es la actividad celular. La unidad básica del orgánulo es el sáculo, que consiste en una vesícula o cisterna aplanada. Cuando una serie de sáculos se apilan, forman un dictiosoma. Además, pueden observarse toda una serie de vesículas más o menos esféricas a ambos lados y entre los sáculos. El conjunto de todos los dictiosomas y vesículas constituye el aparato de Golgi.

El dictiosoma se encuentra en íntima relación con el retículo endoplásmico, lo que permite diferenciar dos caras: la cara cis, más próxima al retículo, y la cara trans, más alejada. En la cara cis se encuentran las vesículas de transición , mientras que en la cara trans, se localizan las vesículas de secreción. El sistema de membranas comentado al principio, constituye la respuesta de las células eucariotas a la necesidad de regular sus comunicaciones con el ambiente en el trasiego de macromoléculas. Para ello, se han desarrollado dos mecanismos en los que el aparato de Golgi está involucrado.

http://www.arrakis.es/~lluengo/golgi.html (1 of 2)01/08/2004 10:08:04

Aparato de Golgi

La adquisición de sustancias se lleva a cabo por endocitosis, mecanismo que consiste en englobar sustancias con la membrana plasmática para su posterior internalización. La expulsión de sustancias se realiza por exocitosis , mecanismo que, en último término, consiste en la fusión con la membrana celular de las vesículas que contienen la sustancia a exportar. Estos mecanismos dan sentido funcional al aparato de Golgi:
q q

q q q

Maduración de las glucoproteínas provenientes del retículo. Intervenir en los procesos de secreción, almacenamiento , transporte y transferencia de glucoproteínas. Formación de membranas: plasmática, del retículo, nuclear.. Formación de la pared celular vegetal. Intervienen también en la formación de los lisosomas.

http://www.arrakis.es/~lluengo/golgi.html (2 of 2)01/08/2004 10:08:04

Lisosomas

Los lisosomas tienen una estructura muy sencilla, semejantes a vacuolas, rodeados solamente por una membrana, contienen gran cantidad de enzimas digestivas que degradan todas las moléculas inservibles para la célula. Funcionan como "estómagos" de la célula y además de digerir cualquier sustancia que ingrese del exterior,vacuolas digestivas (figura, números 4 y 5 ), ingieren restos celulares viejos para digerirlos también (número 3), llamados entonces vacuolas autofágicas Llamados "bolsas suicidas" porque si se rompiera su membrana, las enzimas encerradas en su interior , terminarían por destruir a toda la célula.

http://www.arrakis.es/~lluengo/lisosomas.html (1 of 2)01/08/2004 10:10:27

Lisosomas

Los lisosomas se forman a partir del Retículo endoplásmico rugoso (número 1)y posteriormente las enzimas son empaquetadas por el Complejo de Golgi (número 2)

http://www.arrakis.es/~lluengo/lisosomas.html (2 of 2)01/08/2004 10:10:27

Mitocondria

MITOCONDRIAS

Las mitocondrias son los orgánulos celulares encargados de suministrar la mayor parte de la energía necesaria para la actividad celular, actúan por tanto,como centrales energéticas de la célula y sintetizan ATP a expensas de los carburantes metabólicos (glucosa, ácidos grasos y aminoácidos). La ultraestructura mitocondrial está en relación con las funciones que desempeña: en la matriz se localizan los enzimas responsables de la oxidación de los ácidos grasos, los aminoácidos, el ácido pirúvico y el ciclo de krebs. En la membrana interna están los sistemas dedicados al transporte de los electrones que se desprenden en las oxidaciones anteriores y un conjunto de proteínas encargadas de acoplar la energía liberada del transporte electrónico con la síntesis de ATP,estas proteínas le dan un aspecto granuloso a la cara interna de la membrana mitocondrial.

http://www.arrakis.es/~lluengo/mitocondria.html (1 of 2)01/08/2004 10:11:35

Mitocondria

También se encuentran dispersas por la matriz una molécula de ADN circular y unos pequeños ribosomas implicados en la síntesis de un pequeño número de proteínas mitocondriales

Una característica peculiar de las mitocondrias es que son de origen maternoo, ya que sólo el óvulo aporta las mitocondrias a la célula original, y cómo la mitocondria posee ADN , podemos decir que esta información va pasando a las generaciones exclusivamente a través de las mujeres.

http://www.arrakis.es/~lluengo/mitocondria.html (2 of 2)01/08/2004 10:11:35

Ciclo de Krebs

El producto más importante de la degradación de los carburantes metabólicos es el acetilCoA, (ácido acético activado con el coenzima A), que continúa su proceso de oxidación hasta convertirse en CO2 y H2O ,mediante un conjunto de reacciones que constituyen el ciclo de Krebspunto central donde confluyen todas las rutas catabólicas de la respiración aerobia. Este ciclo se realiza en la matriz de la mitocondria En este ciclo se consigue la oxidación total de los dos átomos de carbonodel resto acetilo, que se eliminan en forma de CO2; los electronesde alta energía obtenidos en las sucesivas oxidaciones se utilizan para formar NADH Y FADH2, que luego entrarán en la cadena respiratoria En el siguiente dibujo se puede ver un esquema sumario de este ciclo.

http://www.arrakis.es/~lluengo/ciclokrebs.html (1 of 2)01/08/2004 10:12:51

Ciclo de Krebs

Y finalmente, una secuencia animada del ciclo de krebs.

http://www.arrakis.es/~lluengo/ciclokrebs.html (2 of 2)01/08/2004 10:12:51

Untitled

de los cloroplastos. Los cloroplastos son orgánulos exclusivos de las células vegetales. En ellos tiene lugar la fotosíntesis, proceso en el que se transforma la energía lumínica en energía química, almacenada en moléculas ATP y moléculas reductoras (NADPH), que se utilizarán posteriormente para sintetizar moléculas orgánicas. Tienen una organización muy similar a la de la mitocondria, aunque es de mayor tamaño y tiene un compartimento más, porque presenta un tercer tipo de membrana.

Estructura

figura 1 Un cloroplasto tiene por tanto tres membranas y presenta tres compartimentos.
q q

q

La membrana externa es muy permeable, gracias a la presencia de porinas. La membrana interna es menos permeable,no presenta pliegues (la de la mitocondria sí los presenta). Entre ambas membranas queda un primer compartimento que es el espacio intermembrana. La membrana interna delimita un espacio que es el estroma, dónde se encuentran ribosomas, copias de ADN, distintos tipos de ARN, gránulos de almidón y gotas de lípidos. La membrana tilacoidal, es el tercer tipo de membrana, aparece formando unos sacos aplanados denominados tilacoides, y forman unas agrupaciones llamadas grana. Los tilacoides están interconectados y delimitan una tercera cavidad que es el espacio tilacoidal

http://www.arrakis.es/~lluengo/cloroplastos.html (1 of 3)01/08/2004 10:13:22

Untitled

membrana tilacoidal Es la responsable de la captación de la energía solar, gracias a la presencia de clorofilas y de otros pigmentos asociados con proteínas en unas estructuras funcionales que son los fotosistemas.

La

Figura 2 En esta membrana (figura 2), se encuentra también una cadena de transporte electrónico y una ATP-sintasa que funciona como la ATP-sintasa mitocondrial. En la figura 3 se ve la distribución de estas estructuras en la membrana tilacoidal. El fotosistema II (PSII) se localiza principalmente en la grana, mientras que el fotosistema I (PSI) lo hace en contacto con el estroma al igual que el complejo ATP-sintasa. El citocromo b6-f, tiene como función el transporte de los electrones desde el fotosistema II al I, por lo que se encuentra en ambas localizaciones.

Figura 3

Fotosistemas
http://www.arrakis.es/~lluengo/cloroplastos.html (2 of 3)01/08/2004 10:13:22

Untitled

Los fotosistemas son las unidades de la membrana tilacoidal. Cada fotosistema está formado por dos partes:

un complejo antena, formado por varios centenares de moléculas de clorofila y carotenos. q un centro reactivo, o centro de reacción fotoquímico, tiene unas moléculas de clorofila a que actúan como una verdadera trampa energética, puesto que los electrones que liberan son catapultados hacia la cadena de transporte electrónico de la membrana tilacoidal
q

Figura 4 El complejo antena funciona así: Cuando una de sus moléculas se excita al captar un fotón (unidad de energía lumínica ) transfiere esa energía de excitación a otra molécula cercana (figura 4) por un proceso de resonancia y, en una reacción en cadena, esa energía llega hasta el centro reactivo.

http://www.arrakis.es/~lluengo/cloroplastos.html (3 of 3)01/08/2004 10:13:22

Fotosmntesis

La fotosíntesis es uno de los procesos metabólicos de los que se valen las células para obtener energía. Es un proceso complejo, mediante el cual los seres vivos poseedores de clorofila y otros pigmentos, captan energía luminosa procedente del sol y la transforman en energía química (ATP) y en compuestos reductores (NADPH), y con ellos transforman el agua y el CO2 en compuestos orgánicos reducidos (glucosa y otros), liberando oxígeno:

CO2 + H2O+ LUZ

GLUCOSA + O2

La energía captada en la fotosíntesis y el poder reductor adquirido en el proceso, hacen posible la reducción y la asimilación de los bioelementos necesarios, como nitrógeno y azufre, además de carbono, para formar materia viva. La radiación luminosa llega a la tierra en forma de"pequeños paquetes", conocidos como cuantos o fotones. Los seres fotosintéticos captan la luz mediante diversos pigmentos fotosensibles, entre los que destacan por su abundancia las clorofilas y carotenos. Al absorber los pigmentos la luz, electrones de sus moléculas adquieren niveles energéticos superiores, cuando vuelven a su nivel inicial liberan la energía que sirve para activar una reacción química: una molécula de pigmento se oxida al perder un electrón que es recogido por otra sustancia, que se reduce. Así la clorofila puede transformar la energía luminosa en energía química.. En la fotosíntesis se diferencian dos etapas, con dos tipos de reacciones: 1. Fase luminosa: en en tilacoide en ella se producen transferencias de electrones. 2. Fase oscura: en el estroma. En ella se realiza la fijación de carbono

http://www.arrakis.es/~lluengo/fotosintesis.html (1 of 2)01/08/2004 10:13:40

Fotosmntesis

http://www.arrakis.es/~lluengo/fotosintesis.html (2 of 2)01/08/2004 10:13:40

Fase oscura de la fotosíntesis

En esta fase, se va a utilizar la energía química obtenida en la fase luminosa, en reducir CO2, Nitratos y Sulfatos y asimilar los bioelementos C, H, y S, con el fin de sintetizar glúcidos, aminoácidos y otras sustancias. Las plantas obtiene el CO2 del aire a través de los estomas de sus hojas. El proceso de reducción del carbono es cíclico y se conoce como Ciclo de Calvin., en honor de su descubridor M. Calvin.

La fijación del CO2 se produce en tres fases: 1. Carboxilativa: El CO2 se fija a una molécula de 5C, la ribulosa 1,5 difosfato, formándose un compuesto inestable de 6C, que se divide en dos moléculas de ácido 3 fosfoglicérico conocido también con las siglas de PGA 2. Reductiva:El ácido 3 fosfoglicérico se reduce a gliceraldehido 3 fosfato, también conocido como PGAL ,utilizándose ATP Y NADPH. 3. Regenerativa/Sintética: Las moléculas de gliceraldehido 3 fosfato formadas siguen diversas rutas; de cada seis moléculas, cinco se utilizan para regenerar la ribulosa 1,5 difosfato y hacer que el ciclo de calvin pueda seguir, y una será empleada para poder sintetizar moléculas de glucosa (vía de las hexosas), ácidos grasos, amoinoácidos... etc; y en general todas las moléculas que necesita la célula.

http://www.arrakis.es/~lluengo/faseoscura.html (1 of 3)01/08/2004 10:14:04

Fase oscura de la fotosíntesis

En el ciclo para fijar el CO2, intervienen una serie de enzimas, y la más conocida es la enzima Rubisco (ribulosa 1,5 difosfato carboxilasa/oxidasa), que puede actuar como carboxilasa o como oxidasa, según la concentración de CO2.

Si la concentración de CO2 es baja, funciona como oxidasa, y en lugar de ayudar a la fijación de CO2 mediante el ciclo de Calvin, se produce la oxidación de glúcidos hasta CO2 y H2O, y al proceso se le conoce como fotorrespiración. La fotorrespiración no debe confundirse con la respiración mitocondrial, la energía se pierde y no se produce ni ATP ni NADPH; y como se ve en el esquema se disminuye el rendimiento de la fotosíntesis, porque sólo se produce una molécula
http://www.arrakis.es/~lluengo/faseoscura.html (2 of 3)01/08/2004 10:14:04

Fase oscura de la fotosíntesis

de PGA que pasará al ciclo de Calvin; en cambio cuando funciona como carboxilasa, se obtienen dos moléculas de PGA.

http://www.arrakis.es/~lluengo/faseoscura.html (3 of 3)01/08/2004 10:14:04

Componentes celulares

COMPONENTE
Membrana celular

ESTRUCTURA
Mosaico fluído: bicapa lipídica con proteínas y glucocálix externo.Colesterol en células animales

FUNCIÓN
Límite de la célula y permeabilidad selectiva

Pared celular

Responsable de la forma de las células; le da Pared primaria y pared secundaria soporte mecánico, protección y mantiene el balance de fibras de celulosa osmótico

Hialoplasma

Solución acuosa con alta concentración de proteínas, esencialmente enzimas.

Participación en procesos metabólicos

Citoesqueleto

Red tridimensional formada por filamentos protemcos.

Organizacisn y control del espacio interior. Involucrado en la forma, movimiento y divisisn celular.

Centríolos

Microtzbulos y pequeqas fibras

Centro organizador de microtzbulos. Formacisn del huso acromatico. Formacisn de cilios y flagelos.

Ribosomas

Dos subunidades formadas por ARN y protemnas

Smntesis de protemnas

R.E. Rugoso

Cisternas membranales intercomunicadas con ribosomas adheridos.

Smntesis, procesamiento y almacenamiento de protemnas.

R.E. Liso

Cisternas de membrana intercomunicadas

Smntesis, almacenamiento y transporte de lmpidos. Tratamiento y eliminacisn de sustancias tsxicas.

Aparato de Golgi

Sistema de cisternas de membrana aplanadas, en relacisn con vesmculas

Maduracisn, almacenamiento y transferencia de glucoprotemnas. Formacisn de membranas, y pared celular.

Lisosomas

Vesmculas esfiricas de membrana Digestisn celular que contienen enzimas digestivos.

http://www.arrakis.es/~lluengo/componentes.html (1 of 3)01/08/2004 10:14:27

Componentes celulares

Peroxisomas

Vesmculas esfiricas de membrana Proteccisn contra productos tsxicos del que contienen enzimas oxidativas metabolismo del O2.

Vacuolas

Vesmculad redondeadas

Almacenar sustancias: agua, sustancias nutritivas, sustancias de desecho.

Mitocondrias

Organulos con doble membrana. Presentan gran cantidad de enzimas, ADN y ribosomas

Centrales energiticas de la cilula: llevan a cabo la respiracisn celular, consistente en la oxidacisn de nutrientes para obtener ATP.

Cloroplastos

Organulos con doble membrana, mas una tercera en su interior (tilacoidal). Contiene enzimas, ADN y ribosomas.

Responsables de la fotosmntesis.

Membrana nuclear Doble membrana con poros.

Separar y proteger el ADN del resto de la cilula.

Nucleoplasma

Composicisn similar al hialoplasma.

Contiene enzimas involucrados en la replicacisn del ADN, en la transcripcisn del ARN y su empaquetamiento para el traslado al citoplasma.

Cromatina

ADN mas protemnas densamente empaquetadas.

Portador de la informacisn genitica

Nucléolo

Regisn esferoidal con alta concentracisn de ARN y protemnas.

Constituye el organizador nucleolar: lugar de smntesis de las subunidades ribossmicas.

En este cuadro se representan esquemáticamente los componentes de una célula eucarita, con el siguiente código de colores:

q

Barreras externas de la célula

q

Componentes citoplásmicos sin membrana

http://www.arrakis.es/~lluengo/componentes.html (2 of 3)01/08/2004 10:14:27

Componentes celulares
q

Orgánulos citoplásmicos de membrana no energéticos

q

Orgánulos citoplásmicos de membrans energéticos

q

Núcleo

http://www.arrakis.es/~lluengo/componentes.html (3 of 3)01/08/2004 10:14:27

Hipótesis quimiosmótica de la fotofosforilación

HIPÓTESIS QUIMIOSMÓTICA DE LA FOTOFOSFORILACIÓN
La síntesis de ATP en el cloroplasto se explica mediante la hipótesis quimiosmótica de Mitchell, de forma muy semejante como ocurre en la mitocondria. El transporte de electrones en la cadena transportadora de la membrana tilacoidal produce el bombeo de protones desde el estroma hacia el espacio tilacoidal a nivel del complejo citocromo b6 - f , lo que genera un gradiente electroquímico. El flujo de protones a favor del gradiente desde el espacio tilacoidal hasta el estroma, a través del canal de protones de la ATP - sintasa, activa la síntesis de ATP a partir de ADP y fosfato.

http://www.arrakis.es/~lluengo/fotoquimio.html (1 of 2)01/08/2004 10:14:40

Hipótesis quimiosmótica de la fotofosforilación

Los electrones se emplean para reducir el NADP+ a NADPH. El ATP y el NADPH producidos de esta forma pueden utilizarse en la fase oscura para las reacciones de síntesis, en las que se reducen moléculas sencillas, como el CO2, para formar glúcidos.

http://www.arrakis.es/~lluengo/fotoquimio.html (2 of 2)01/08/2004 10:14:40

Importancia biológica de la fotosíntesis

La fotosíntesis es seguramente el proceso bioquímico más importante de la Biosfera por varios motivos: 1. La síntesis de materia orgánica a partir de la inorgánica se realiza fundamentalmente mediante la fotosíntesis; luego irá pasando de unos seres vivos a otros mediante las cadenas tróficas, para ser transformada en materia propia por los diferentes seres vivos. 2. Produce la transformación de la energía luminosa en energía química, necesaria y utilizada por los seres vivos 3. En la fotosíntesis se libera oxígeno, que será utilizado en la respiración aerobia como oxidante. 4. La fotosíntesis fue causante del cambio producido en la atmósfera primitiva, que era anaerobia y reductora. 5. De la fotosíntesis depende también la energía almacenada en combustibles fósiles como carbón,petróleo y gas natural. 6. El equilibrio necesario entre seres autótrofos y heterótrofos no sería posible sin la fotosíntesis. Se puede concluir que la diversidad de la vida existente en la Tierra depende principalmente de la fotosíntesis.

http://www.arrakis.es/~lluengo/importancia.html01/08/2004 10:15:16

Glucolisis

La glucolisis tiene lugar en el citoplasma celular. Consiste en una serie de diez reacciones, cada una catalizada por una enzima determinada, que permite transformar una molécula de glucosa en dos moléculas de un compuesto de tres carbonos, el ácido pirúvico.

En la primera parte se necesita energía, que es suministrada por dos moléculas de ATP, que servirán para fosforilar la glucosa y la fructosa. Al final de esta fase se obtienen, en la práctica dos moléculas de PGAL, ya que la molécula de DHAP (dihidroxiacetona-

http://www.arrakis.es/~lluengo/glucolisis.html (1 of 2)01/08/2004 10:16:53

Glucolisis

fosfato), se transforma en PGAL. En la segunda fase, que afecta a las dos moléculas de PGAL, se forman cuatro moléculas de ATP y dos moléculas de NADH. Se produce una ganancia neta de dos moléculas de ATP. Al final del proceso la molécula de glucosa queda transformada en dos moléculas de ácido pirúvico, es en estas moléculas donde se encuentra en estos momentos la mayor parte de la energía contenida en la glucosa. La glucolisis se produce en la mayoría de las células vivas, tanto en procariotas como en las eucariotas. En este gif animado, puedes ver los cambios sufridos por la molécula de glucosa hasta transformarse en dos moléculas de ácido pirúvico.

http://www.arrakis.es/~lluengo/glucolisis.html (2 of 2)01/08/2004 10:16:53

http://www.arrakis.es/~lluengo/glicoan.gif

http://www.arrakis.es/~lluengo/glicoan.gif01/08/2004 10:17:04

http://www.arrakis.es/~lluengo/krebs.gif

http://www.arrakis.es/~lluengo/krebs.gif01/08/2004 10:17:20

Hipótesis quimiosmótica

Según la hipótesis quimiosmótica sostenida por el investigador P. Mitchell, que es la que goza de mayor prestigio,y puede además explicar la síntesis de ATP tanto en la mitocondria como en el cloroplasto. La energía liberada por el transporte de electrones se utiliza para bombear protones desde la matriz al espacio intermembrana (en mitocondrias); o desde el estroma al interior del tilacoide (en cloroplastos). El bombeo de protones se realiza a través de transportadores localizados en complejos enzimáticas existentes en la membrana (de las crestas mitocondriales o membrana tilacoidal, según el caso). De esta manera se genera un gradiente electroquímico de protones que ejerce lo que se conoce como fuerza protonmotriz, ya que cuando los protones atraviesan de nuevo la membrana interna (mitacondrial o tilacoidal) a favor del gradiente, lo hacen a través del sistema ATP-sintetasa, que se encuentra en dichas membranas, donde la energía protonmotriz se transforma en energía de enlace en moléculas de ATP . El proceso se podría comparar con este símil: El flujo de protones cumple el papel de transductor de energía, del mismo modo que el vapor que suministra una caldera puede utilizarse para generar energía eléctrica: el calor aplicado a la caldera (flujo de electrones) calienta el agua y forma vapor de agua (gradiente electroquímico de H+), cuya presión (fuerza protonmotriz) se puede acoplar a las turbinas de un generador eléctrico (ATP sintetasa) para producir electricidad (ATP).

http://www.arrakis.es/~lluengo/hipotesis.html01/08/2004 10:17:40

Meiosis

La meiosis es la división celular por la cual se obtiene células hijas con la mitad de los juegos cromosómicos que tenía la célula madre pero que cuentan con información completa para todos los rasgos estructurales y funcionales del organismo al que pertenecen.

PROCESO DE MEIOSIS:

1. Duplicación de los cromosomas Antes de que se produzca la primera división los cromosomas se duplican.

3. Primera división meiótica Los cromosomas homólogos se separan formándose dos células. Observa sin embargo, que los cromosomas están duplicados, cada uno de ellos está formado por dos cromátidas unidas por el centrómero.

http://www.arrakis.es/~lluengo/meiosis.html (1 of 3)01/08/2004 10:18:54

Meiosis

5. Segunda división meiótica Estamos ante un fenómeno que ya conoces:la mitosis. Durante esta segunda división los cromosomas se separan en sus dos cromátidas, dando lugar en este caso a cuatro células haploides.

La meiosis se produce siempre que hay un proceso de reproducción sexual. En la célula existen dos juegos de material genético, es decir "n" parejas de cromosomas homólogos, uno de origen paterno y otro de origen materno. En la Profase I, cada cromosoma se aparea con su homólogo formando lo que se denomina una tétrada, es decir cuatro cromátidas y dos centrómeros. Este apareamiento es un rasgo exclusivo de la meiosis, y tiene una trascendencia fundamental, ya que las cromátidas no hermanas, es decir paterna y materna, pueden entrecruzarse y romperse en los puntos de fusión dando lugar a un intercambio y recombinación de segmentos cromatídicos y por lo tanto de los genes en ellos localizados. La meiosis ocurre mediante dos mitosis consecutivas. La primera división es reduccional y el resultado es la formación de dos células hijas cada una con "n" cromosomas. La segunda división es una división mitótica normal y el resultado final de la segunda división meiótica es la formación de cuatro células hijas cada una de las cuales tiene
http://www.arrakis.es/~lluengo/meiosis.html (2 of 3)01/08/2004 10:18:54

Meiosis

un núcleo con "n" cromátidas

CONSECUENCIAS DE LA MEIOSIS
1. Es el proceso mediante el cual se obtienen células especializadas para intervenir en la reproducción sexual. 2. Reduce a la mitad el número de cromosomas, y así al unirse las dos células sexuales, vuelve a restablecerse el número cromosómico de la especie. 3. Se produce una recombinación de la información genética. 4. La meiosis origina una gran variación de gametos, debido al entrecruzamiento de segmentos de los cromosomas homólogos.
Esto puedes observarlo en la siguiente animación:

http://www.arrakis.es/~lluengo/meiosis.html (3 of 3)01/08/2004 10:18:54

Meiosis animada

MEIOSIS ANIMADA

http://www.arrakis.es/~lluengo/meiosisani.html01/08/2004 10:21:32

Actividades de citología

Nivel de dificultad de los ejercicios

sencillos

medios

avanzados

1. 2.

Señala las semejanzas y diferencias entre las células procariotas y eucariotas. Enumera las semejanzas y diferencias entre las células animales y las vegetales. Realiza un esquema de ambas indicando sus componentes. Analiza el desarrollo de la teoría celular y haz una valoración de su importancia como teoría básica de la biología. Ordena de mayor a menor tamaño los diferentes tipos celulares que conozcas. Define que se entiende por "unidad de membrana" o "membrana unitaria" y enumera los componentes que resultarían de su análisis químico. ?Qué tipo de proteínas se diferencian en la membrana de acuerdo con el modelo de "mosaico fluido".?. ?Qué papel tienen en la actividad de la membrana?. Enumera las funciones de la membrana plasmática. ?Qué tipos de sustancias pueden atravesar las membranas por difusión simple?. ?Se trata de un transporte activo o pasivo?. Justifica tu respuesta. Enumera las principales finalidades que tiene la formación de vesículas en la membrana plasmática, en relación con la incorporación y eliminación de sustancias. ?Qué se entiende por endocitosis?. ?Qué modalidades se distinguen y en qué se diferencian?.

3.

4. 5.

6.

7. 8.

9.

10.

http://www.arrakis.es/~lluengo/acticelu.html (1 of 7)01/08/2004 10:22:34

Actividades de citología

11.

Justifica con algún ejemplo concreto por qué decimos que la membrana transfiere información y determina la identidad celular?. ?Cómo definirías el citoesqueleto?. ?Qué componentes se distinguen?. ?A qué se debe la fluidez de la membrana plasmática?. ? Qué papel desempeña en ella el colesterol?. ? Por qué se dice que la bomba de Na/K, es un mecanismo de transporte activo?. ?Cómo contribuye este sistema de transporte a mantener la polaridad de las membranas celulares?. Si en una célula se inhibe la síntesis de ATP, ?podría llevarse a cabo procesos de transporte pasivo?, ?y activo? ? por qué?. ?Poseen biomembranas y paredes celulares todas las células?. Razónalo. Razona si son verdaderas o falsas las siguientes afirmaciones: La estructura básica de las membranas biológicas está determinada por la bicapa lipídica, pero sus funciones específicas, las llevan en su mayor parte las proteínas. El mantenimiento de la bicapa lipídica, require enzimas específicos y la hidrólisis de ATP. La movilidad de las proteínas de la membrana puede ser limitada por interacciones con estructuras fuera de la célula o dentro de la misma. Los glicolípidos y glicoproteínas nunca se encuetran en el lado citoplasmático de las membranas. Las proteínas de la membrana forman una monocapa que se extiende a ambos lados de la bicapa lipídica. La membrana plasmática es muy impermeable a todas las moléculas cargadas.

12. 13. 14.

15.

16. 17.
r

r

r

r

r

r

18.

En 1977 se aisló una proteína de membrana transportadora de glucosa y 8 años más tarde se dilucidó su secuencia de aminoácidos. Dicha proteína está formada por una cadena de 492 aminoácidos, organizada en 25 segmentos. Trece de ellos muy hidrofílicos con afinidad por el agua; estos segmentos se alternan con otros doce hidrofóbicos. r ?De qué tipo de proteína de membrana se trata? r Representa la estructura de dicha proteína en una bicapa lipídica. r ?Cómo puede conseguir tal estructura transportar la glucosa hacia el interior celular?. Relaciona los términos: cilios, flagelos y centríolos. ?En qué función biológica

19.

http://www.arrakis.es/~lluengo/acticelu.html (2 of 7)01/08/2004 10:22:34

Actividades de citología

están implicados?. 20. Los individuos que debido a un problema genético tienen defectuosa la dineína, son estériles. ?Cuál es la base molecular para este problema?. Indica los procesos bioquímicos o fisiológicos con los que están relacionados los siguientes orgánulos. r ribosomas r lisosomas r retículo endoplasmatico lisi r aparato de Golgi ?Qué orgánulos citoplasmáticos están implicados en la síntesis y transporte de componentes celulares?. El esquema mudo siguiente representa la actividad fisiológica de los lisosomas:

21.

22.

23.

r r

Identifica las estructuras señaladas con los números Explica brevemente lo que ocurre en cada una de las estructuras señaladas en el esquema. Explica el recorrido de una glicoproteína de la membrana plasmática desde que comienza su síntesis hasta que llega a la membrana. Señala el camino que siguen todas las proteínas destinadas a ser secretadas por la célula. ?En qué se diferencia el recorrido de ambos tipos de proteínas desde que

24.
r

r

r

http://www.arrakis.es/~lluengo/acticelu.html (3 of 7)01/08/2004 10:22:34

Actividades de citología

r

comienza su síntesis hasta que llegan a su destino final?. Una vez incorporada a la membrana, ?puede la glicoproteína cambiar de orientación, quedando la parte glucídica hacia dentro de la célula?. Razónalo. Señala las semejanzas y diferencias entre mitocondrias y cloroplastos. De las siguientes alternativas, escoge la correcta:

25. 26.

El proceso de la fotosíntesis consume..................y produce........... Consume
Alternativa 1 Alternativa 2 Alternativa 3 Alternativa 4 Alternativa 5 Clorofila H2O CO2 H2O Glucosa

Produce
H2O CO2 Clorofila O2 O2

27.
r

r

r

La respiración celular: Es un proceso catabólico del que se obtiene energía directamente utilizable por la célula para su desarrollo y productos más simples. Es un proceso que sólo ocurre en las células animales, pues los vegetales tienen otros mecanismos para conseguir lo mismo. Consiste en una combustión incompleta de la materia orgánica dando lugar a compuestos orgánicos más sencillos.

?Cuál de las tres opciones es la verdadera y por qué.?. 28. ?Qué características estructurales del cloroplasto son esenciales para la fotosíntesis?. Razona si son verdaderas o falsas las siguientes afirmaciones: La orientación de las ATP-sintetasas en la membrana mitocondrial interna es tal que el ATP se genera en el espacio intermembrana, lo que permite su difusión al citosol a través de los poros de la membrana externa. La conversión del CO2 a hidratos de carbono requiere la energía de la luz directamente, mientras que la formación de 02 requiere la energía de la luz sólo directamente. Indica si los siguientes datos son compatibles o incompatibles con la teoría de

29.
r

r

30.

http://www.arrakis.es/~lluengo/acticelu.html (4 of 7)01/08/2004 10:22:34

Actividades de citología

que las mitocondrias proceden de primitivas bacterias que viven en simbiosis en el interior de las células eucarióticas: r Una célula eucariótica típica contiene del orden de 2.000 mitocondrias, cuyo tamaño es semejante al de las bacterias. r Las mitocondrias poseen varias copias de una molécula de ADN circular, sin histonas. r Los ribosomas mitocondriales son 70S y no 80s como los del citosol. r Las mitocondrias poseen dos membranas: una externa lisa y otra interna plegada que contiene las enzimas de la cadena respiratoria. 31. Describe mediante un esquema la estructura de la cromatina. Haz otro esquema de un cromosoma metafásico señalando sus constituyentes. ?Cuáles son las principales diferencias entre la cromatina interfásica y el cromosoma metafásico?. En un organismo pluricelular, casi todas sus células se dividen en uno u otro momento. r ?Por que han de dividirse la mayoría de las células de un organismo pluricelular?. r ?Cuáles son las etapas de la mitosis?. r De las distintas etapas de la mitosis, ?Cuál tiene mayor duración?. r Haz un esquema de la anafase de una célula que tenga 2n=4 cromosomas. Enumera las semejanzas y diferencias entre el proceso de división celular por mitosis y por meiosis. La figura siguiente representa el esquema de una célula que va a dividirse por meiosis.

32.

33.

34.

http://www.arrakis.es/~lluengo/acticelu.html (5 of 7)01/08/2004 10:22:34

Actividades de citología

r

r

r

?Cuál es el número diploide de cromosomas de la célula representada?.? Cuántos pares de cromosomas homólogos y cuántas cromátidas contiene?. Representa mediante esquema: el resultado de la formación de un quiasma entre cada pareja de homólogos, la anafase I, la telofase I y la telofase II. Sólo hay que realizar uno de los posibles resultados hasta obtener las cuatro células finales. ?Qué hechos de la meiosis dan como resultado gametos con diferentes cromosomas?.

35.

La siguiente gráfica representa la variación del contenido de ADN durante el ciclo vital de una célula:

r r r r

?Qué ocurre en el intervalo de tiempo de 2 a 3 ?. ?Cómo se denomina la fase que transcurre entre 3 y 4?. La gráfica corresponde a un ciclo mitótico o a uno meiótico? Si la cantidad de ADN no se ha modificado al final del ciclo, ?qué utilidad tiene este proceso?.

36.

Razonar si es cierta o falsa a siguiente frase: "En el cuerpo humano todas las células obtienen el ATP a partir de la respiración mitocondrial": Indicar los productos finales de las siguientes rutas metabólicas: ciclo de Calvin, glucolisis, fase fotoquimica, cadenas transportadoras de electrones, fermentación láctica. Completa las siguientes cuestiones: Tipo de fotofosforilación cuando sólo actúa el Fotosistema I.......... Sustancia que se reduce en la fotosíntesis al recibir electrones y protones..........

37.

38.
r r

http://www.arrakis.es/~lluengo/acticelu.html (6 of 7)01/08/2004 10:22:34

Actividades de citología
r r r

r

? Que sustancia inicia el ciclo de Calvin ?.......... ? Qué sustancia inicia el ciclo de Krebs ?.......... Sustancia que aporta protones y electrones en la fotosíntesis de las plantas......... Nombre que se da a la descomposición de las moléculas de agua por la luz........ ?Qué diferencia hay entre fotorrespiración y respiración en plantas? Completa las siguientes frases: Una célula tiene nutrición autótrofa cuando........ Una célula tiene nutrición heterótrofa cuando........ Una célula es fotosintética cuando........ Una célula es quimiosintética cuando........ Una célula realiza la fermentación cuando........ Una célula realiza la respiración cuando.......

39. 40.
r r r r r r

http://www.arrakis.es/~lluengo/acticelu.html (7 of 7)01/08/2004 10:22:34

La Nutrición animal

Los animales, como todos los seres vivos, deben tomar del medio exterior las sustancias necesarias para mantener sus estructuras y realizar sus funciones. Estas sustancias reciben el nombre de nutrientes y el conjunto de procesos que llevan a cabo para obtenerlas y utilizarlas se llama nutrición. Los animales son seres heterótrofos, lo que quiere decir que necesitan alimentarse de materia orgánica ya elaborada (alimento), producida por los seres autótrofos. Al tener que tomar sustancias orgánicas ya elaboradas, los animales deben "hacerlas suyas", es decir incorporarlas a su organismo para poder utilizarlas. Surge así la necesidad de un aparato digestivo que transforme esta materia vegetal o animal, en pequeñas moléculas asimilables por las células del organismo. Si el organismo es complejo, para llevar el alimento a las células de su cuerpo precisa de un sistema de transporte : el aparato circulatorio. La utilización de los nutrientes por las células para obtener energía, implica la necesidad de O2. Por tanto, el O2 procedente del exterior debe incorporarse al organismo problema que se resuelve a través del aparato respiratorio. . Las células del organismo, realizan entonces con los nutrientes y el O2 los procesos

metabólicos para obtener la materia y la energía necesarias. En estos procesos, además del CO2, se producen otras sustancias de desecho, que deben ser eliminadas, lo cual implica la necesidad de un aparato excretor Para realizar la nutrición, el organismo necesita por tanto cuatro aparatos: 1. Aparato digestivo: se encarga de tomar el alimento del exterior, digerirlo y absorberlo. 2. Aparato circulatorio: transporta, por el interior, todos los productos digeridos y absorbidos, así como los desechos originados en los procesos de nutrición. 3. Aparato respiratorio: toma el oxígeno del aire y expulsa el CO2 sobrante. 4. Aparato excretor: concentra y expulsa al exterior las sustancias tóxicas producidas en las funciones de nutrición.
http://www.arrakis.es/~lluengo/nutricion.html (1 of 3)01/08/2004 10:23:25

La Nutrición animal

Se pueden considerar las siguientes etapas: 1. Ingestión de los alimentos Consiste en la incorporación de los alimentos mediante los órganos situados en la boca o en sus proximidades. Los alimentos pueden ser: r Alimentos líquidos. Muchos animales toman sólo líquidos, como jugo de plantas, sangre o materia animal disuelta. Tienen estos animales, estructuras chupadoras de diversas clases. r Alimentos de partículas sólidas microscópicas. En este caso la ingestión se realiza por medio de filtros localizados en la boca y en los cuales quedan retenidas las partículas. r Alimentos sólidos en grandes fragmentos. La ingestión se realiza cortando y masticando. Las estructuras que realizan este proceso son las mandíbulas y los dientes. 2. Digestión Consiste en la transformación de las macromoléculas componentes de los alimentos en moléculas sencillas, que pueden ser absorbidas y utilizadas por las células del propio organismo. Dependiendo de la complejidad de los animales, la digestión puede ser: r Digestión intracelular: Propia de organismos unicelulares (protozoos) y de algunos pluricelulares sencillos, como las esponjas. Al carecer de medio interno, la digestión se efectúa dentro de las células y los lisosomas vierten sus enzimas digestivos a las vacuolas digestivas. Después de realizar la digestión, los productos de desecho se expulsan al exterior por una vacuola fecal. r Digestión mixta. Algunos metazoos inferiores, como los celentéreos tienen una digestión en parte intracelular y en parte extracelular. Estos animales poseen, tapizando la cavidad gástrica, unas células secretoras de enzimas. Los alimentos llegan a dicha cavidad y empiezan a ser digeridos (digestión extracelular). Las partículas parcialmente digeridas son fagocitadas por otras células de la pared de la cavidad gástrica, terminando allí la digestión (digestión intracelular). Los residuos se expulsan a la cavidad gástrica y posteriormente al exterior. r Digestión extracelular: Característica de animales superiores, que tienen un tubo digestivo dividido en varias partes, en cada una de las cuales se segregan distintos enzimas digestivos específicos. La digestión , por tanto , se va realizando de una forma gradual.

Procesos de la nutrición animal.

http://www.arrakis.es/~lluengo/nutricion.html (2 of 3)01/08/2004 10:23:25

La Nutrición animal

Es el aparato digestivo que veremos con más detalle. 3. Transporte de los alimentos digeridos a las células Una vez transformados los alimentos en sustancias asimilables, la sangre y el aparato circulatorio tienen la misión de transportar estas sustancias a todas las células. En este proceso, el aparato respiratorio es el encargado de llevar el oxígeno a las células. 4. Metabolismo celular Las moléculas nutritivas digeridas y transportadas por la sangre, son transformadas en el interior de la célula en energía (catabolismo) o bien utilizadas para la síntesis de moléculas más complejas ( anabolismo). 5. Excreción Por último, los residuos metabólicos son expulsados al exterior por medio del aparato excretor. La idea de este tema, es hacer un recorrido evolutivo, por todos estos aparatos implicados en la Nutrición, a través de los diversos grupos biológicos, haciendo un estudio más detallado de la organización de cada uno de ellos en el hombre. Puedes acceder a los distintos aparatos, en los botones siguientes:

http://www.arrakis.es/~lluengo/nutricion.html (3 of 3)01/08/2004 10:23:25

Aparato Digestivo

El aparato digestivo puede presentar múltiples variantes morfológicas; pero el proceso digestivo es el mismo en todos los animales: transformar los glúcidos, lípidos y proteinas en unidades mas sencillas, por medio de enzimas digestivos. Vamos a hacer un pequeño recorrido viendo distintos modelos de aparatos digestivos en varios grupos de animales.

Tipos de aparatos digestivos en los invertebrados:
q q q

Anélidos Moluscos Artrópodos

Aparato digestivo de los vertebrados.
Los vertebrados presentan un aparato digestivo desarrollado, en el que podemos distinguir.
q q q q q q q q

Dibujo del Aparato Digestivo La cavidad bucal La faringe El esófago El estómago El intestino Glándulas anejas Dibujo del proceso de la digestión

En Anélidos encontramos un tubo digestivo con dos apeturas. En él se distinguen : r la boca r la faringe musculosa r el buche para almacenar el alimento r la molleja, con pequeños granos de arena para la trituración y r el intestino que recorre el cuerpo y acaba en el ano. Por tanto la digestión es practicamente extracelular a lo largo del tubo.

http://www.arrakis.es/~lluengo/digestivo.html (1 of 9)01/08/2004 10:26:05

Aparato Digestivo

Tipos de A. digestivos

El aparato digestivo en Moluscos, excepto en Lamelibranquios o Bivalvos (almejas, ostras...), se compone de. r boca, provista de un órgano en forma de lima, la rádula para roer el alimento r esófago r estómago r intestino que termina en el ano Poseen una glándula llamada hepatopáncreas que colabora en el proceso digestivo. Los lamelibranquios tienen un tipo de nutrición primitivo, consistente en un sistema filtrador que retiene las partículas alimenticias.

Tipos de A. digestivos

Los Artrópodos constituyen un grupo muy diversificado, adaptado a muchos ambientes y formas distintas de adquirir alimentos. Poseen distintas estructuras para la captura e ingestión de dichos alimentos. En general, presentan: r cavidad bucal rodeada de apéndices para la captura e ingestión de alimento. r a continuación la faringe, r el esófago, con buche y molleja r el intestino medio que segrega las enzimas digestivas y r el intestino posterior con el ano.
http://www.arrakis.es/~lluengo/digestivo.html (2 of 9)01/08/2004 10:26:05

Aparato Digestivo

El tubo digestivo va acompañado de diversas glándulas que segregan, en cada tipo de artrópodo, los enzimas digestivas necesarios.

Tipos de A. digestivos

http://www.arrakis.es/~lluengo/digestivo.html (3 of 9)01/08/2004 10:26:05

Aparato Digestivo

Tipos de A. digestivos

La boca aparece rodeada por unos pliegues de la piel, llamados labios. Dentro de la boca se encuentran los dientes cuya función es cortar,trocear y triturar los alimentos (digestión mecánica) En la boca encontramos también la lengua, que tiene una gran cantidad de papilas gustativas, cuya función es la de mezclar los alimentos y facilitar su tránsito hacia el esófago. En la cavidad bucal desembocan las glándulas salivales, que segregan saliva,cuyas funciones son: r actuar de lubricante r destruir parte de las bacterias ingeridas con los alimentos r comenzar la digestión química de los glúcidos mediante una enzima, la amilasa o ptialina, que rompe el almidón en maltosa.

http://www.arrakis.es/~lluengo/digestivo.html (4 of 9)01/08/2004 10:26:05

Aparato Digestivo

Una vez finalizado los procesos que tienen lugar en la cavidad bucal, se produce la deglución del alimento ingerido.
Tipos de A. digestivos

La faringe es un tubo muscular que comunica el aparato digestivo con el respiratorio. Para que las vías respiratorias permanezcan cerradas durante la deglución, se forma en la faringe un repliegue, llamado epiglotis , que obstruye la glotis. De esta forma se impide que el alimento se introduzca en el sistema respiratorio.
Tipos de A. digestivos

Es un conducto recto y musculoso. Sus contracciones musculares producen el movimiento peristáltico que hace avanzar el bolo alimenticio hacia el estómago.
Tipos de A. digestivos

Constituye una dilatación del tubo digestivo, donde se almacenan los alimentos durante un tiempo para que pasen al intestino en un estado de digestión avanzado. Se compone de : r una región cardíaca, que limita con el esófago mediante un esfínter llamado cardias r una región media, llamada cuerpo r y una región pilórica que comunica con el intestino a través del esfínter pilórico. El estómago es musculoso, por lo que gracias a sus contracciones, se completa la acción mecánica. Además en él se realiza parte de la digestión química, gracias a la acción del jugo gástrico, segregado por las glándulas de las paredes.

http://www.arrakis.es/~lluengo/digestivo.html (5 of 9)01/08/2004 10:26:05

Aparato Digestivo

En el estómago se produce la absorción de agua, alcohol y de algunas sales minerales.

En general, después de permanecer en el estómago el tiempo necesario, los alimentos forman una papilla, llamada quimo, que pasará poco a poco al intestino.
Tipos de A. digestivos

El intestino se divide en dos tramos: 1. Intestino delgado: Formado por tres porciones: s duodeno s yeyuno s íleon Se realizan dos funciones distintas: s la digestión química total de los alimentos y s la absorción de éstos. En este tramo desembocan: s el hígado, que segrega la bilis s el páncreas que segrega el jugo pancreático. Además en las paredes de la mucosa intestinal existen otras glándulas como las s Glándulas de Brünner que segregan mucus y s las glándulas de Lieberkühn, que segregan jugo intestinal. El resultado de la acción de estos jugos es conseguir que:
s s s

los glúcidos se transformen en monosacáridos las grasas se rompan en ácidos grasos y glicerina, y las proteinas se rompan en aminoácidos.
COMPOSICIÓN DE LOS JUGOS QUE VIERTEN AL INTESTINO

Bilis

Jugo intestinal

Jugo pancreático

http://www.arrakis.es/~lluengo/digestivo.html (6 of 9)01/08/2004 10:26:05

Aparato Digestivo

s s s s s s s s

agua sales inorgánicas sales biliares pigmentos biliares ácidos biliares grasas colesterol fosfatasa alcalina

s s s s

s s s

agua iones inorgánicos mucina lactasa, maltasa, sacarasa lipasa intestinal peptidasas enteroquinasa

s s s s s s s

agua iones inorgánicos peptidasas inactivas carboxipeptidasas amilasa pancreática lipasa pancreática nucleasas pancreáticas

Al finalizar la digestión, el quimo se ha transformado en un líquido lechoso, llamado quilo formado por:
s s s s s s

agua monosacáridos aminoácidos glicerina bases nitrogenadas productos no digeridos.

La digestión ha terminado y sus productos deben traspasar la pared intestinal (absorción) para ingresar en el torrente circulatorio y ser transportados a todas las células del cuerpo. La absorción se realiza molécula a molécula a través de la pared intestinal. 2. Intestino grueso Se halla separado del intestino delgado por la válvula ileocecal. Su mucosa presenta unos repliegues transversales, que le dan un aspecto característico. Las glándulas que tapizan la mucosa segregan mucus. A lo largo del intestino se absorbe una gran cantidad de agua, por lo que a medida que se acercan al tramo final , transportados por los movimientos peristálticos, van espesándose. Estos productos se expulsarán al exterior en el proceso denominado egestión o defecación. Entre los productos residuales se encuentran las paredes celulósicas de los vegetales, a cuyas expensas viven una serie de bacterias sapròfitas simbiontes (flora intestinal), que producen fermentaciones con desprendimiento de gases. También producen algunas sustancias útiles para el organimo, como la vitamina K.
Tipos de A. digestivos

http://www.arrakis.es/~lluengo/digestivo.html (7 of 9)01/08/2004 10:26:05

Aparato Digestivo

Además de las glándulas salivales, hay otras dos glándulas que contribuyen a la digestión: 1. El páncreas 2. El hígado

El páncreas es una glándula mixta, porque segrega hormonas (componente endocrino), y jugo pancreático (componente exocrino). El jugo pancreático llega al intestino a través del conducto de Wirsung, que desemboca junto con el colédoco, en la ampolla de Vater. q La misión del hígado es fundamentalmente metabólica, pero contribuye a la digestión mediante la bilis. Ésta se almacena en la vesícula biliar. Desempeña un papel importante en la digestión de las grasas, ya que contribuye a dividir las sustancias grasas en partículas más pequeñas,con lo que se facilita el ataque de las enzimas lipasas al aumentar la superficie de las gotas de grasa.
q

Tipos de A. digestivos

http://www.arrakis.es/~lluengo/digestivo.html (8 of 9)01/08/2004 10:26:05

Aparato Digestivo

http://www.arrakis.es/~lluengo/digestivo.html (9 of 9)01/08/2004 10:26:05

Untitled

http://www.arrakis.es/~lluengo/digefisio.html01/08/2004 10:28:28

Mecanismos de transporte

Los animales necesitan unos medios de transporte internos, conocidos como sistemas circulatorios, que sirven para conducir los nutrientes a todas las células, y además eliminar los productos de desecho, llevándolos a los sistemas excretores.

Los animales más sencillos carecen de un sistema de transporte especializado, y el líquido circulante es el líquido intersticial que es el líquido que ocupa los espacios que existen entre las células. De este líquido toman los nutrientes y a él expulsan sus productos de excreción. Este tipo de transporte puede ser:
q

q

Por difusión: como en Celentéreos (FIGURA 1), que toman los nutrientes del agua por difusión y de la misma forma, expulsan al agua los desechos. Por eso se puede considerar la cavidad gastrovascular como un órgano circulatorio y el agua que entra y sale por el único orificio (que hace de boca y ano) puede considerarse como un esbozo de fluido circulante. Por el aparato digestivo: como en Platelmintos(FIGURA 2). El aparato digestivo posee gran cantidad de ramificaciones intestinales que son las que realizan la función de transporte. Los nutrientes atraviesan estas ramificaciones y pasan al líquido intersticial que ya se encuentra en contacto con todas las células.

(FIGURA 2) (FIGURA 1)
http://www.arrakis.es/~lluengo/circulatorio.html (1 of 8)01/08/2004 10:32:07

Mecanismos de transporte

En los animales más complejos, existe un sistema de transporte especializado: los aparatos circulatorios. Un aparato circulatorio está formado por un sistema de tubos, abierto o cerrado, que sirve para transportar un fluido circulante. Este líquido necesita una fuerza impulsora, un órgano especial llamado corazón con propiedades contráctiles. La contracción del corazón se propaga a todo el sistema mediante una onda que, además marca el sentido en el que se mueve el fluido. Con la aparición de los aparatos circulatorios surgen los líquidos circulantes, entre los que destacan: Hidrolinfa. Líquido de composición parecida al agua del mar, que transporta nutrientes y productos de excreción. En Equinodermos. Hemolinfa. Líquido incoloro, que lleva además un pigmento con función respiratoria (hemocianina). LLeva células como son fagocitos (para digerir elementos extraños) y hemocitos (para transportar los pigmentos respiratorios). Sangre. Circula por vasos cerrados y contiene como pigmento respiratorio la hemoglobina. La sangre está formada por:
r r

el plasma, líquido que contiene agua, sales, proteinas, etc y por células que flotan en el plasma : s eritrocitos, que transportan la hemoglobina s leucocitos, con función defensiva s plaquetas, que intervienen en el proceso de coagulación sanguinea..

Linfa. Líquido amarillento, que circula por los vasos linfáticos. Formada por
r r

plasma y linfocitos

Un sistema circulatorio está constituido por un órgano propulsor, el corazón y un sistema de

http://www.arrakis.es/~lluengo/circulatorio.html (2 of 8)01/08/2004 10:32:07

Mecanismos de transporte

vasos. El corazón puede ser :
q q

tabicado como en moluscos y vertebrados tubular como en artrópodos

Dependiendo de que el sistema de vasos sea abierto o cerrado, exixten dos grandes tipos de sistemas circulatorios: abierto y cerrado.

En este tipo de aparato, el líquido bombeado por el corazón circula por vasos abiertos en un extremo que desembocan en los espacios del cuerpo, bañando así las células.Este sistema es propio de:
q

q

Moluscos: El corazón es tabicado, formado por dos cámaras (aurícula y ventrículo). La hemolinfa pasa del ventrículo a los vasos que vierten a los espacios tisulares, de donde es recogida por otros vasos que van a las branquias donde la sangre se oxigena y de ahí vuelve al corazón por la aurícula. FIGURA 4 Artrópodos: El corazón es tubular y ocupa una posición dorsal en el animal. La hemolinfa es bombeada por el corazón a las arterias y vertida a los espacios tisulares. Después retorna al corazón a través de pequeños orificios, los ostiolos, que tienen válvulas para impedir el retroceso de la sangre. El mecanismo de entrada es como el de una bomba de succión. FIGURA 3

FIGURA 3 FIGURA 4

En este tipo de aparato circulatorio el fluido circula por el interior de un circuito cerrado. Típico de :

http://www.arrakis.es/~lluengo/circulatorio.html (3 of 8)01/08/2004 10:32:07

Mecanismos de transporte
q

q

Anélidos: Consta de dos vasos sanguineos principales, un vaso dorsal y un vaso ventral. Estos vasos recorren el cuerpo y están unidos por vasos laterales , de los cuales, los más anteriores son contráctiles y tienen válvulas por lo que se pueden considerar corazones primitivos. El vaso dorsal impulsa el líquido circulatorio hacia delante y el ventral hacia atrás. FIGURA 5 Vertebrados: Básicamente todos los vertebrados tienen el mismo sistema circulatorio. Consta de un corazón muscular y tabicado situado en posición ventral , que actua como una bomba que impulsa la sangre por los vasos. Estos vasos forman un circuito cerrado que tiene tres tipo de vasos : arterias, capilares y venas. Por los vasos circula la sangre , que es el líquido circulante. FIGURA 6 La sangre sale impulsada por el corazón a través de arterias de paredes elásticas. Estas se van ramificando en otras de menor diámetro, llamadas arteriolas y éstas en vasos muy delgados y de paredes finas, los capilares. Los capilares se reunen formando las vénulas que a su vez se agrupan en unos conductos mayores, las venas (FIGURA 7) , que llevan de nuevo la sangre al corazón.

FIGURA 5

FIGURA 6

FIGURA 7

http://www.arrakis.es/~lluengo/circulatorio.html (4 of 8)01/08/2004 10:32:07

Mecanismos de transporte

El aparato circulatorio de los vertebrados consta de dos sistemas: 1. el sanguíneo y 2. el linfático. En el proceso evolutivo de los vertebrados el corazón va sufriendo una especialización desde peces hasta aves y mamíferos. Esta especialización se relaciona con el cambio de la respiración branquial a respiración pulmonar. Se diferencian dos tipos de circulación: 1. Circulación simple. La sangre pasa solamente una vez por el corazón en cada vuelta del cuerpo. Es propia de los peces. Poseen un corazón de forma curvada con un seno venoso que recibe la sangre del cuerpo, una aurícula y un ventrículo muy musculoso. La sangre sale del corazón por el ventrículo y las arterias eferentes lleva la sangre a las branquias donde se oxigena. Después es conducida al cuerpo y vuelve al corazón, donde es recogida por el seno venoso y pasa a la aurícula y de ésta al ventrículo. (FIGURA 8) 2. Circulación doble. Propia de vertebrados pulmonados. El corazón funciona como un sistema de doble bomba y existen dos circuitos circulatorios. (FIGURA 9) r El menor o pulmonar, en el que la sangre va del corazón, por las arterias pulmonares, a los pulmones, donde se oxigena, y de éstos vuelve al corazón por las venas pulmonares. r El mayor o general o sistémico, en el que la sangre oxigenada sale del corazón por la aorta , se distribuye por todo el cuerpo y regresa al corazón por las venas.

http://www.arrakis.es/~lluengo/circulatorio.html (5 of 8)01/08/2004 10:32:07

Mecanismos de transporte

FIGURA 8 FIGURA 9 Se dice que la circulación es:
q

q

Doble e incompleta, cuando la sangre oxigenada y la no oxigenada se mezclan en el corazón debido a que éste no está perfectamente tabicado. Es propia de anfibios y reptiles. (FIGURA 10) El corazón posee dos aurículas y un ventrículo, donde se mezclan la sangre oxigenada y la sangre no oxigenada. Doble y completa. Es propia de cocodrilos, aves y mamíferos . El corazón se divide en cuatro cavidades: dos aurículas y dos ventrículos , por lo que hay separación total de sangre oxigenada y no oxigenada. (FIGURA 11).

http://www.arrakis.es/~lluengo/circulatorio.html (6 of 8)01/08/2004 10:32:07

Mecanismos de transporte

FIGURA 10

FIGURA 11

La sangre rica en oxígeno, procedente de los pulmones, llega por las venas pulmonares a la aurícula izquierda, pasa al ventrículo izquierdo a través de la válvula mitral o bicúspide, y sale por la aorta a todo el resto del cuerpo (circulación mayor). Por las venas vuelve al corazón sangre pobre en oxígeno que a través de las venas cavas , penetra en la aurícula derecha, pasa al ventrículo derecho por la válvula tricúspide y sale por la arteria pulmonar hacia los pulmones (circulación menor). (FIGURA 12)

FIGURA 12 A continuación tienes un enlace para ver detalles del Aparato Circulatorio y Sistema Linfático en el hombre

http://www.arrakis.es/~lluengo/circulatorio.html (7 of 8)01/08/2004 10:32:07

Mecanismos de transporte

http://www.arrakis.es/~lluengo/circulatorio.html (8 of 8)01/08/2004 10:32:07

Untitled

Cuando hablamos de excreción, siempre pensamos en la eliminación de productos de desecho. Esta sin embargo, es sólo una de sus funciones. La excreción es además, un sistema regulador del medio interno, es decir, determina la cantidad de agua y de sales que hay en el organismo en cada momento, y expulsa el exceso de ellas de modo que se mantenga constante la composición química y el volumen del medio interno (homeostasis). Así es como los organismos vivos aseguran su supervivencia frente a las variaciones ambientales. Se puede decir, que la excreción llevada a cabo por los aparatos excretores implica varios procesos:
q q q

La excreción de los productos de desecho del metabolismo celular. La osmorregulación o regulación de la presión osmótica. La ionoregulación o regulación de los iones del medio interno.

ÓRGANOS IMPLICADOS EN LA EXCRECIÓN EN LOS VERTEBRADOS Productos de desecho Urea Ácido úrico Pigmentos biliares Origen del producto Órgano productor Órgano de excreción Riñones Hígado A. digestivo Riñones Piel Pulmones Medio excretor Orina Orina Heces Orina Sudor Vapor de agua Aire espirado

Por la degradación Hígado de aminoácidos Por la degradación Hígado de purinas Por la degradación Hígado de hemoglobina Conjunto de Respiración celular células del organismo Conjunto de Respiración celular células del organismo

Agua

CO

2

Pulmones

En todos los animales pluricelulares, la excreción debe llevarse a cabo por medio de aparatos excretores especializados que tomen las sustancias de desecho del medio interno y los transporten al exterior del animal. En todos ellos se han de realizar tres tipos de procesos:
http://www.arrakis.es/~lluengo/excretor.html (1 of 6)01/08/2004 10:35:16

Untitled

1. la filtración: Que es el paso de los líquidos del cuerpo, por difusión, al interior de los tubos excretores. Es una orina inicial, que lleva además de sustancias de desecho, otras muchas moléculas necesarias para el organismo, que volverán al medio interno de los organismos gracias al proceso de : 2. la reabsorción: que se realiza a lo largo de los tubos excretores, cuyas celulas extraerán de esta orina inicial grandes cantidades de agua y sustancias útiles para el organismo, devolviéndolas a los liquidos corporales. 3. la secreción, opera en sentido contrario y transfiere materiales de los líquidos corporales a los tubos excretores, fundamentalmente iones, como el K . El líquido obtenido es la orina final, que será expulsada al exterior. Se pueden considerar los siguientes tipos de aparatos excretores: Aparato excretor en invertebrados: Protonefridios Metanefridios Tubos de Malpigio Aparato excretor en vertebrados: Aparato urinario Anatomía y fisiología de la nefrona
+

1. 2. 3. 4. 5.

Son típicos de los Platelmintos y de otros animales sin celoma, son órganos excretores que constan de una serie de túbulos muy ramificados cuyos extremos internos terminan en una célula , célula flamígera provista de varios flagelos que se dirigen hacia la luz del túbulo. Las sustancias de desecho atraviesan las células flamígeras, penetran en los túbulos y son empujadas por el batido rítmico de los flagelos saliendo al exterior por los poros excretores. DIBUJO N: 1

DIBUJO N: 1
http://www.arrakis.es/~lluengo/excretor.html (2 of 6)01/08/2004 10:35:16

Untitled

Tipos de aparatos excretores

Aparecen en Anélidos y moluscos. Son estructuras abiertas por los dos extremos. Uno se abre a la cavidad celómica tiene forma de embudo ciliado y se llama nefrostoma, el otro extremo se abre al exterior por un poro, el nefridioporo. El líquido que está en el celoma y que contiene los productos de desecho es recogido por los cilios del nefrostoma por un proceso de filtración, pasa a los túbulos, donde se reabsorben las sustancias que son útiles, los desechos salen al exterior por el nefridioporo. DIBUJO N: 2

Tipos de aparatos excretores

DIBUJO N: 2

Aparecen en los insectos. Son tubos delgados, cerrados por el extremo que se encuentra en la cavidad corporal y abiertos por el otro extremo al tubo digestivo, entre el intestino medio y el intestino posterior. De esta forma, se vierten al exterior los productos de desecho, junto con los alimentos sin digerir.DIBUJO N: 3 En la pared de los tubos se produce una secreción de K por transporte activo desde la hemolinfa, por lo que pasan también moléculas de pequeño tamaño y agua. Cuando estas
http://www.arrakis.es/~lluengo/excretor.html (3 of 6)01/08/2004 10:35:16

+

Untitled

sustancias llegan al intestino posterior, se produce la reabsorción de agua y sustancias aprovechables, y el resto se elimina.

Tipos de aparatos excretores

DIBUJO N: 3

El aparato urinario está constituido por dos riñones, donde se elabora la orina, y unos conductos que la llevan al exterior. Los riñones son típicos de vertebrados. Cada riñón está formado por un conjunto de unidades llamadas nefronas. La nefrona se puede considerar como la unidad funcional del riñón. Una nefrona consta de un corpúsculo renal, que filtra a presión el plasma sanguineo, y de un túbulo contorneado, de longitud variable, donde se produce la reabsorción y la secreción. En el caso de los animales vertebrados superiores, el aparato excretor está compuesto por: DIBUJO n: 4 dos riñones, que por medio de unos tubos llamados s uréteres, comunican con la s vejiga , donde se almacena la orina y se expulsa al exterior mediante un conducto que es la s uretra El riñón de los mamíferos está constituido por mas de un millón de nefronas, y en él se distinguen las siguientes capas: DIBUJO n: 5 s La cápsula renal: capa externa formada por una membrana de tejido conjuntivo fibroso.
s

http://www.arrakis.es/~lluengo/excretor.html (4 of 6)01/08/2004 10:35:16

Untitled
s

s

s

La zona cortical: tiene un aspecto granuloso debido a los corpúsculos de Malpigio. Forma una cubierta continua bajo la cápsula renal con prolongaciones hacia el interior: las columnas renales. La zona medular: tiene aspecto estriado debido a su división en sectores por las columnas renales. Estos sectores se llaman pirámides renales. La pelvis renal: zona tubular que recoge la orina.

DIBUJO n: 4
Tipos de aparatos excretores

DIBUJO n: 5

Una nefrona está formada por el glomérulo renal, constituido por capilares sanguineos, que está rodeado por la cápsula de Bowmann, con función filtradora. La presión de la sangre impulsa el agua y las sustancias disueltas, a excepción de las proteinas plasmáticas, a través de las paredes semipermeables del capilar y hacia la cápsula de Bowmann, mediante un proceso de ultracentrifugación. De esta manera se extraen del sistema circulatorio, no sólo productos tóxicos del metabolismo, sino también compuesto
http://www.arrakis.es/~lluengo/excretor.html (5 of 6)01/08/2004 10:35:16

Untitled

útiles, como glucosa aminoácidos. El túbulo renal, consta de varias partes:
r r r r

tubo contorneado proximal asa de Henle tubo contorneado distal tubo colector
del total del filtrado glomerular se elimina solamente alrededor del 1%, con una concentración cuatro veces mayor que la del principio.
Tipos de aparatos excretores

DIBUJO n: 6

http://www.arrakis.es/~lluengo/excretor.html (6 of 6)01/08/2004 10:35:16

Ionorregulación y osmorregulación

Consiste en la regulación en el contenido de iones del medio interno. Este proceso es muy importante, porque cualquier desequilibrio puede alterar las funciones biológicas de forma irreversible. Así, la secreción de H+ regula el pH de la sangre, de forma que si éste es demasiado ácido, aumenta la secreción de H+. De no suceder ésto, algunas moléculas (básicamente proteinas ) se alterarían irreversiblemente. También la secreción de K+ es fundamental, ya que un aumento de éste en la sangre produce grandes arritmias cardíacas, y una disminución excesiva provocaria parálisis al interferir en la transmisión del impulso nervioso. La regulación de la concentración de K+ se produce por medio de una hormona, la aldosterona, segregada por las cápsulas suprarrenales. Si en la sangre hay un exceso de K +, se estimulan las cápsulas suprarrenales y se produce aldosterona. Esta acelera la secreción de K+.

La regulación de la concentración de sales en el medio interno se consigue en los vertebrados de diferentes formas, según el medio en el que vivan. Los peces de agua dulce viven en un medio hipotónico, por lo que el agua tiende a entrar en su cuerpo de forma continua por ósmosis y a través de las branquias. Por ello, tienen que eliminar el exceso de agua, para lo cual los riñones reabsorben las sales pero muy poca agua, con lo que la orina está muy diluida y es abundante. Por el contrario, los peces de agua salada están expuestos a una pérdida continua de agua por ósmosis, ya que el medio en el que viven es hipertónico.
q

q

Los peces óseos (teleósteos) resuelven este problema ingiriendo gran cantidad de agua salada por la boca y reabsorbiéndola casi toda en sus riñones, con lo que la cantidad de orina excretada es muy pequeña y concentrada. Además expulsan el exceso de sales por medio de unas células especializadas de sus branquias. Los peces cartilaginosos(elasmobranquios), poseen una adaptación completamente distinta, ya que han transformado su medio interno en ligeramente hipertónico (prácticamente isotónico) respecto al agua del mar, para lo cual acumulan una alta

http://www.arrakis.es/~lluengo/excionosmo.html (1 of 2)01/08/2004 10:35:28

Ionorregulación y osmorregulación

concentración de urea que sería tóxica para otros animales. No ingieren agua, esta penetra por ósmosis y segregan una orina hipotónica y abundante, mientras que la sal se excreta por una glándula situada en la región posterior del intestino. Los vertebrados terrestres, cuyo problema es la desecación, han de conservar el agua, pero a la vez deben eliminar los productos de desecho nitrogenado.
q q

q

Los reptiles, que excretan ácido úrico, casi no necesitan agua para su excreción. Las aves también excretan ácido úrico, por lo que tienen gran reabsorción tubular que reduce al máximo el agua excretada. Los mamíferos, se han adaptado para producir una orina hipertónica, gracias al desarrollo de nefronas con túbulos muy largos y complejos (asas de Henle) que facilitan su reabsorción.
En zonas desérticas con cantidades de agua muy escasas existe mamíferos que tienen muy desarrollada el asa de Henle,lo que permite la eliminación de orinas muy concentradas, hasta veinte veces más de lo normal

http://www.arrakis.es/~lluengo/excionosmo.html (2 of 2)01/08/2004 10:35:28

Untitled

El funcionamiento de los animales requiere la existencia de un sistema nervioso encargado de captar los estímulos, conducirlos e integrarlos en la unidad en la unidad fisiólogica del animal. Para lograr esta unidad de función se necesita también la cooperación del sistema endocrino. Tanto el sistema hormonal como el nervioso utilizan como primer mensajero un compuesto químico; en el primer caso es una hormona y en el segundo un neurotransmisor sináptico. Frente a esta característica que les asemeja presentan las siguientes diferencias: Actividad Velocidad de respuesta Duración de respuesta Especificidad de la respuesta Capacidad de respuesta Procesos que controla S. nervioso Rápida Transitoria Muy específica La posee Rápidos Lenta Duradera Variable, según las células Carece (depende del sistema nervioso) Lentos y generalizados S. hormonal

HORMONAS

Una hormona es una sustancia química que se sintetiza en una glándula de secreción interna y ejerce algún tipo de efecto fisiológico sobre otras células hasta las que llega por vía sanguínea. Actúan como mensajeros químicos y sólo ejercerán su acción sobre aquellas células que posean en sus membranas los receptores específicos. Figura 1.

Figura 1

MECANISMOS BIOQUÍMICOS DE ACCIÓN HORMONAL
Las hormonas son transportadas por la sangre hasta las "células diana" y en estas ejercerán su acción de diferente forma según el tipo de hormona.
q

Las hormonas esteroideas, gracias a su naturaleza lipídica, atraviesan facilmente las membranas de las células diana o células blanco, y se unen a las moléculas receptoras de tipo proteico, que se encuentran en el citoplasma. De

http://www.arrakis.es/~lluengo/endocrino.html (1 of 8)01/08/2004 10:39:48

Untitled

esta manera llegan al núcleo, donde parece que son capaces de hacer cesar la inhibición a que están sometidos algunos genes y permitir que sean transcritos. Las moléculas de ARNm originadas se encargan de dirigir en el citoplasma la síntesis de unidades proteicas, que son las que producirán los efectos fisiológicos hormonales. Figura 2

q

Figura 2 Las hormonas proteicas, sin embargo, son moléculas de gran tamaño que no pueden entrar en el interior de las células blanco, por lo que se unen a "moléculas receptoras" que hay en la superficie de sus membranas plasmáticas, provocando la formación de un segundo mensajero, el AMPc,que sería el que induciría los cambios pertinentes en la célula al activar a una serie de enzimas que producirán el efecto metabólico deseado. Figura 3

Figura 3

CONTROL HORMONAL

http://www.arrakis.es/~lluengo/endocrino.html (2 of 8)01/08/2004 10:39:48

Untitled

La producción de hormonas está regulada en muchos casos por un sistema de retroalimentación o feed-back negativo, que hace que el exceso de una hormona vaya seguido de una disminución en su producción. Se puede considerar el hipotálamo, como el centro nervioso "director" y controlador de todas las secreciones endocrinas, el hipotálamo segrega neurohormonas que son conducidas a la hipófisis. Estas neurohormonas estimulan a la hipófisis para la secreción de hormonas trópicas (tireotropa, corticotropa, gonadotropa). Estas hormonas son transportadas a la sangre para estimular a las glándulas correspondientes(tiroides, corteza suprarrenal, y gónadas) y serán éstas las que segreguen diversos tipos de hormonas , (tiroxina, corticosteroides y hormonas sexuales, respectivamente ), que además de actuar en el cuerpo, retroalimentan la hipófisis y el hipotálamo para inhibir su actividad y equilibran las secreciones respectivas de estos dos órganos y de la glándula destinataria. Figura 4

Figura 4

SISTEMA ENDOCRINO HUMANO
Las principales glándulas secretoras de hormonas, son: Hipófisis Tiroides q Paratiroides q Páncreas q Cápsulas suprarrenales q Gónadas (ovarios y testículos) Su localización puede observarse en el dibujo siguiente: Figura 5.
q q

http://www.arrakis.es/~lluengo/endocrino.html (3 of 8)01/08/2004 10:39:48

Untitled

Figura 5 HIPÓFISIS Tiene el tamaño y la forma de un guisante y cuelga del hipotálamo mediante el eje hipotálamo-hipófisis. Figura 6. En la hipófisis se distinguen tres lóbulos, que pueden considerarse incluso como glándulas independientes: Figura 7.

Figura 6.

Figura 7.

http://www.arrakis.es/~lluengo/endocrino.html (4 of 8)01/08/2004 10:39:48

Untitled

1. El lóbulo anterior o adenohipófisis. Produce dos tipos de hormonas: s hormonas trópicas, es decir estimulantes, ya que estimulan a las glándulas correspondientes. s TSH o tireotropa: regula la secreción de tiroxina por el tiroides s ACTH o adrenocorticotropa:controla la secreción de las hormonas de las cápsulas suprarrenales. s FSH o folículo estimulante: provoca la secreción de estrógenos por los ovarios y la maduración de espermatozoides en los testículos. s LH o luteotropina: estimula la secreción de progesterona por el cuerpo lúteo y de la testosterona por los testículos. s hormonas no trópicas, que actúan directamente sobre sus células blanco. s STH o somatotropina, conocida como "hormona del crecimiento", ya que es responsable del control del crecimiento de huesos y cartílagos. s PRL o prolactina: estimula la secreción de leche por las glándulas mamarias tras el parto. 2. El lóbulo medio segrega una hormona, la MSH o estimulante de los melonóforos, estimula la síntesis de melanina y su dispersión por la célula. 3. El lóbulo posterior o neurohipófisis , libera dos hormonas, la oxitocina y la vasopresina o ADH, que realmente son sintetizadas por el hipotálamo y se almacenan aquí. s Oxitocina: Actúa sobre los músculos del útero, estimulando las contracciones durante el parto. Facilita la salida de la leche como respuesta a la succión. s Vasopresina: Es una hormona antidiurética, favoreciendo la reabsorción de agua a través de las nefronas.
Esquema glándulas

Tiroides
Esta glándula, situada en la parte anterior del cuello y a ambos lados de la tráquea,(Figura 8) segrega tiroxina y calcitonina. r Tiroxina:Su función es actuar sobre el metabolismo y la regulación del crecimiento y desarrollo en general. r Calcitonina: Interviene junto a la hormona paratiroidea, en la regulación del metabolismo del calcio en la sangre, estimulando su depósito en los huesos.

Figura 8
Esquema glándulas

http://www.arrakis.es/~lluengo/endocrino.html (5 of 8)01/08/2004 10:39:48

Untitled

Paratiroides
Está formada por cuatro grupos celulares incluídos en la parte posterior del tiroides. Segregan parathormona, que está implicada en la regulación de los niveles de calcio en la sangre con efectos contrarios a la calcitonina del tiroides, ya que la parathormona estimula la absorción del calcio en el intestino por lo que produce un aumento de calcio en sangre, mientras que la calcitonina tiende a disminuir la presencia de calcio en sangre.
Esquema glándulas

Páncreas
Constituye una glándula de secreción mixta, situada detrás del estómago, por delante de las primeras vértebras lumbares. En su secreción externa vierte jugo pancreático, con función digestiva. Su secreción interna se realiza gracias a la acción de unos acúmulos de células que constituyen los llamandos islotes de Langerhans, en estos islotes se aprecian dos tipos de células: las células alfa, segregan glucagón y las beta producen insulina. Ambas son proteinas e intervienen en la regulación del contenido de glucosa en sangre (glucemia). r La insulina estimula la absorción de la glucosa por las células, fundamentalmente por las del hígado y el tejido muscular, para que se transformen en glucógeno hepático y muscular. Se produce así una disminución de glucosa en sangre (hormona hipoglucemiante). r El glucagón antagónico de la insulina, estimula la descomposición en el hígado del glucógeno para dar origen a moléculas de glucosa. Es por tanto, una hormona hiperglucemiante, ya que produce un aumento de la concentración de la glucosa en sangre.
Esquema glándulas

Cápsulas suprarrenales
Son dos pequeñas glándulas situadas sobre los riñones. Se distinguen en ellas dos zonas: la corteza en el exterior y la médula que ocupa la zona central. 1. Corteza : Formada por tres capas, cada una segrega diversas sustancias hormonales. s La capa más externa segrega los mineralocorticoides, que regulan el metabolismo de los iones. Entre ellos destaca la aldosterona, cuyas funciones más notables son facilitar la retención de agua y sodio, la eliminación de potasio y la elevación de la tensión arterial. s La capa intermedia elabora los glucocorticoides. El más importante es la cortisona,cuyas funciones fisiológicas principales consisten en la formación de glúcidos y grasas a partir de los aminoácidos de las proteinas, por lo que aumenta el catabolismo de proteinas. Disminuyen los linfocitos y eosinófilos. Aumenta la capacidad de resistencia al estrés. s La capa más interna, segrega andrógenocorticoides, que están íntimamente relacionados con los caracteres sexuales. Se segregan tanto hormonas femeninas como masculinas, que producen su efecto fundamentalmente antes de la pubertad para, luego, disminuir su secreción.

http://www.arrakis.es/~lluengo/endocrino.html (6 of 8)01/08/2004 10:39:48

Untitled

2. Médula : Elabora las hormonas, adrenalina y noradrenalina. Influyen sobre el metabolismo de los glúcidos, favoreciendo la glucógenolisis, con lo que el organismo puede disponer en ese momento de una mayor cantidad de glucosa; elevan la presión arterial, aceleran los latidos del corazón y aumentan la frecuencia respiratoria. Se denominan también "hormonas de la emoción" porque se producen abundantemente en situaciones de estrés, terror, ansiedad, etc, de modo que permiten salir airosos de estos estados. Sus funciones se pueden ver comparadamente en el siguiente cuadro: Adrenalina Incremento de la fuerza y frecuencia de la contracción cardíaca Dilatación de los vasos coronarios Vasodilatación general Incremento del gasto cardíaco Incremento de la glucogenolisis Noradrenalina Incremento de la fuerza y frecuencia de la contracción cardíaca Dilatación de los vasos coronarios Vasoconstricción general Descenso del gasto cardíaco Incremento de la glucogenolisis (en menor proporción)

Esquema glándulas

Gónadas
Las gónadas (testículos y ovarios )son glándulas mixtas que en su secreción externa producen gametos y en su secreción interna producen hormonas que ejercen su acción en los órganos que intervienen en la función reproductora. Cada gónada produce las hormonas propias de su sexo, pero también una pequeña cantidad de las del sexo contrario. El control se ejerce desde la hipófisis. r En los testículos se producen las hormonas masculinas, llamadas genéricamente andrógenos. La más importante de estas es la testosterona, que estimula la producción de espermatozoides y la diferenciación sexual masculina. r En los ovarios se segregam estrógenos y progesterona. s Los estrógenos son los responsables del ciclo menstrual e intervienen en la regulación de los caracteres sexuales femeninos. s La Progesterona, u "hormona del embarazo", prepara el útero para recibir el óvulo fecundado.
http://www.arrakis.es/~lluengo/endocrino.html (7 of 8)01/08/2004 10:39:48

Untitled

Provova el crecimiento de las mamas durante los últimos meses del embarazo. Si el óvulo no es fecundado
Esquema glándulas

Endocrino

Índice Biología

http://www.arrakis.es/~lluengo/endocrino.html (8 of 8)01/08/2004 10:39:48

Sistema linfático

Este sistema propio de vertebrados, está constituido por: 1. Vasos linfáticos. Se forman como capilares linfáticos con un extremo cerrado. Son muy permeables y como se encuentran en casi todos los espacios tisulares entra facílmente el fluido intersticial. Estos capilares se van uniendo para formar vasos linfáticos mayores . Estos vasos poseen válvulas para evitar el retroceso de la linfa. Los vasos linfáticos desembocan en el sistema circulatorio sanguíneo. 2. Ganglios linfáticos.Son agregados de células que se encuentran a lo largo de los vasos linfáticos. Su función consiste en producir linfocitos, implicados en los mecanismos de defensa del organismo. 3. Linfa. Es el líquido circulante y posee además de la función defensiva, que corre a cargo de los linfocitos circulantes; se encarga también de recuperar parte del fluido intersticial, fundamentalmente proteinas de elevado peso molecular que no pueden ser absorbidas por los capilares sanguineos. Una vez recuperadas son transportadas hasta el la sangre. También desempeñan un importante papel en el transporte de las grasas absorbidas en las vellosidades intestinales, que de esta manera pasan a la circulación sanguinea a través del sistema linfático.

http://www.arrakis.es/~lluengo/linfatico.html (1 of 2)01/08/2004 10:40:22

Sistema linfático

http://www.arrakis.es/~lluengo/linfatico.html (2 of 2)01/08/2004 10:40:22

Untitled

En los siguientes esquema puede verse el aparato circulatorio en el hombre, con los vasos más importantes y su nombre. También puedes ver el corazón y sus distintas partes con sus nombres correspondientes. Según el nivel que te pidan utiliza lo que necesites.

http://www.arrakis.es/~lluengo/circuhombre.html (1 of 2)01/08/2004 10:41:20

Untitled

http://www.arrakis.es/~lluengo/circuhombre.html (2 of 2)01/08/2004 10:41:20

Untitled

El término respiración se aplica a dos procesos biológicos separados:
q

q

Al proceso químico de liberación de energía tras el metabolismo de los compuestos orgánicos, proceso que se denomina respiración interna o respiración celular . A la respiración externa referida al proceso de intercambio de gases entre el organismo y su medio externo.

Los animales, necesitan oxígeno para obtener energía en los procesos celulares. Tienen que realizar un intercambio gaseoso entre el organismo y su medio, de éste toman el O2 y al medio desprenden CO2, formado durante el proceso de la respiración celular. El intercambio gaseoso se produce siempre por difusión . Esta se realizará de forma diferente en función del tamaño, el hábitat y la complejidad del animal. En animales sencillos como protozoos, esponjas y celentéreos, el O2 disuelto en el agua pasa por difusión a las células y de la misma forma el CO2 se difunde al agua. En animales que viven en ambientes húmedos o acuáticos como ciertos anélidos, algunos artrópodos y anfibios(que además tienen pulmones) respiran a través de la piel: es la respiración cutánea. En este tipo de respiración se necesita que la piel sea fina y permeable a los gases, además de estar continuamente húmeda. A medida que aumenta la complejidad del animal aparecen estructuras especializadas para hacer más eficiente el proceso de la difusión.

1. Respiración branquial: Las branquias son características de animales acuáticos,como algunos anélidos, moluscos, crustáceos, equinodermos y peces. Las branquias son proyecciones de la superficie externa del cuerpo o de la capa interna del intestino hacia el exterior del animal, y por tanto, proceden evolutivamente por evaginación. Hay dos tipos de branquias: externas e internas. Las primeras evolutivamente son más primitivas. r Las branquias externas tienen la ventaja de que su simple movimiento moviliza el agua, pero pueden ser fácilmente dañadas por los agentes externos.FIGURA 1 r Las branquias internas, están situadas en una cavidad protectora por lo que es necesario un sistema de ventilación de la superficie de intercambio. FIGURA 2 La forma de conseguirlo en los distintos grupos zoológicos es muy variado: cilios, sifones, apéndices variados, movimientos contracorriente, etc.

FIGURA 1
r

FIGURA 2

En los peces, cuyas branquias son siempre internas, se da una asociación entre éstas y una serie de hendiduras , las hendiduras branquiales. En los peces más evolucionados, que son los peces óseos, las branquias están formadas por unas laminillas muy

http://www.arrakis.es/~lluengo/respiratorio.html (1 of 6)01/08/2004 10:44:59

Untitled

vascularizadas que se insertan en el arco branquial y están tapadas por el opérculo. El agua penetra por la boca FIGURA 3 y saldrá por el opérculo, en este trayecto, las branquias toman el O2 disuelto en el agua.

2. Respiración traqueal.

FIGURA 3

Propia de insectos y otros artrópodos terrestres. Este aparato está formado por una serie de tubos, las tráqueas, producidas por invaginaciones del tegumento, en las que el aire entra a través de unos pequeños orificios de la superficie del cuerpo, llamados estigmas. Las tráqueas se van ramificando y disminuyendo de diámetro, hasta que contactan directamente con las células, donde se realiza el intercambio gaseoso por difusión. No necesitan por tanto, un aparato circulatorio para el transporte de gases.

FIGURA 4

3. Respiración pulmonarLos pulmones son invaginaciones de las superficies respiratorias rodeadas de capilares sanguineos. Son bolsas de finas paredes, que sirven para realizar el intercambio gaseoso, para lo que se conectan con el exterior mediante una serie de conductos. Según se asciende en la escala animal, los pulmones van incrementando su superficie interna, desde los anfibios, (FIGURA 5), cuyos pulmones son sacos sin ninguna tabicación, por lo que complementan esta respiración con la cutánea, hasta llegar a las aves FIGURA 6 y los mamíferos, cuyos pulmones son los más desarrollados debido a los sacos aéreos de las aves y a los alvéolos en mamíferos. Estos mecanismos permiten a estos dos grupos de vertebrados un considerable aumento de la superficie respiratoria.

http://www.arrakis.es/~lluengo/respiratorio.html (2 of 6)01/08/2004 10:44:59

Untitled

FIGURA 5

FIGURA 6

El mecanismo de intercambio gaseoso del organismo con el exterior presenta dos etapas: 1. La ventilación pulmonar. Consiste en : r La inspiración, o entrada de aire a los pulmones. Este mecanismo es diferente en distintos grupos de vertebrados: s en anfibios es una deglución, como si se tragaran el aire. s En aves por la compresión de los sacos aéreos por los músculos de las alas. s En mamíferos, (FIGURA 7) el aire entra activamente en los pulmones al dilatarse la caja torácica r La expiración, o salida de aire, se realiza pasivamente.

FIGURA 7

2. El intercambio de gases en los pulmones. Se realiza debido a la diferente concentración de gases que hay entre el exterior y el interior de los alvéolos; por ello, el O2 pasa al interior de los alvéolos y el CO2 pasa al espacio muerto (conductos respiratorios). A continuación se produce el intercambio de gases entre el aire alveolar y la sangre. Cuando la sangre llega a los pulmones tiene un alto contenido en CO2 y muy escaso en O2. El O2 pasa por difusión a través de las paredes alveolares y capilares a la sangre. Allí es transportada por la hemoglobina , localizada en los glóbulos rojos, que la llevará hasta las células del cuerpo donde por el mismo proceso de difusión pasará al interior para su posterior uso. (FIGURA 8). El mecanismo de intercambio de CO2 es semejante, pero en sentido contrario, pasando el CO2 a los alveólos. (FIGURA 9). El CO2, se transporta disuelto en el plasma sanguineo y también en parte lo transporta los glóbulos rojos.

http://www.arrakis.es/~lluengo/respiratorio.html (3 of 6)01/08/2004 10:44:59

Untitled

FIGURA 8

FIGURA 9

A continuación vamos a ver con algo de más detalle el Aparato respiratorio en el hombre: En él vamos a distinguir:

q q q q q

q

Cavidad nasal Cavidad oral Faringe Laringe Árbol bronquial r Tráquea r Bronquios r Bronquiolos Pulmones
FIGURA 10

FIGURA 10 La boca y la faringe intervienen también forman parte del aparato digestivo, y ya se han descrito en dicho aparato. La laringe es, el órgano de la fonación, aunque constituye también un paso obligado para los gases respiratorios. 1. La cavidad nasal está situada encima de la boca, y se comunica con el exterior por los orificios nasales, que puede considerarse como la entrada natural al aparato respiraatorio. Está recubierta por una mucosa, recubrimiento que se extiende hasta los bronquios. Desemboca por dos orificios en la faringe y ésta se abre, a su vez, en la laringe. 2. La laringe, constituida por nueve piezas cartilaginosas, con numerosos músculos que se encargan de moverla. Los cartílagos más representativos son: r Tiroides, denominado vulgarmente nuez o bocado de Adán. r Epiglotis, que tapa el orificio laringeo, contribuyendo a evitar que durante la deglución penetren alimentos por éste. r Aritenoides, que mueven las cuerdas vocales.

http://www.arrakis.es/~lluengo/respiratorio.html (4 of 6)01/08/2004 10:44:59

Untitled

En el interior de la laringe, están las cuerdas vocales, formadas por bandas de naturaleza fibrosa. En ellas se produce la vibración sonora que origina la voz.

incompletos de cartílago en forma de C. La rigidez cartilaginosa impide que el tubo se colapse. La tráquea se bifurca en dos ramas, que son r los bronquios principales, con una estructura semejante a la de la tráquea pero con los anillos cartilaginosos completos. Penetran en los pulmones, en donde se dividen en ramas más delgadas llamadas bronquios secundarios, los cuales continuan subdividiéndose originando los r bronquiolos. Los bronquiolos, se van ramificando progresivamente dando tubos cada vez más pequeños hasta formar los conductos alveolares, los cuales acaban en los sacos alveolares cuyas paredes están formadas por unas vesiculitas denominadas alveólos pulmonares. 4. Los pulmones, son órganos de forma cónica, situados dentro de la cavidad torácica. El pulmón derecho está dividido en tres lóbulos y el izquierdo presenta dos. Los pulmones están constituidos por los alveólos, sacos alveolares, conductos alveolares, bronquiolos, y una gran red de vasos sanguineos.

3. El árbol bronquial está constituido por el conjunto de la tráquea, los bronquios y los bronquiolos. r La tráquea es un tubo de unos 12 cm. de longitud y 2 cm. de diámetro, contituida fundamentalmente por anillos

Las arterias pulmonares penetran en los pulmones y se ramifican profusamente en infinidad de arteriolas. Alrededor de cada alveólo hay una red de capilares que interviene en el intercambio gaseoso. Estos capilares, se reunen en pequeñas vénulas que conducen la sangre oxigenada al corazón. Los pulmones están rodeados por unas membranas, las pleuras entre las que queda una cavidad pleural ocupada por el líquido pleural. 5.

http://www.arrakis.es/~lluengo/respiratorio.html (5 of 6)01/08/2004 10:44:59

Untitled

Respiración celular Es el catabolismo de las moléculas orgánicas. En el proceso aerobio se consume O2 y se liberan CO2 y energía, que se almacena en forma de ATP.
Top

Difusión La difusión es un fenómeno físico, por el que una sustancia disuelta es capaz de atravesar una membrana que separa dos disoluciones. La difusión de las moléculas disueltas, en este caso el O2 o el CO2, se produce de la disolución que tenga mayor concentración (hipertónica) hacia la de menor (hipotónica) y cesa cuando se alcanza el equilibrio (isotónica).
Top

http://www.arrakis.es/~lluengo/respiratorio.html (6 of 6)01/08/2004 10:44:59

La Reproducción

La reproducción es el proceso mediante el cual se generan nuevos seres vivos a partir de los organismos ya existentes, así aseguramos el mantenimiento de la vida. Los nuevos individuos se originan a partir de las células sexuales. Estas células pueden ser masculinas o femeninas y se forman en el aparato reproductor masculino y femenino, respectivamente. Al juntarse dos células procedentes de distinto sexo, mediante la fecundación, se origina un nuevo ser. La fecundación es interna y tiene lugar mediante órganos copuladores. Los embriones se desarrollan en el interior del vientre de la madre, en un órgano denominado útero. El ser humano presenta una diferenciación de sexos que puede verse incluso antes del nacimiento y viene determinada por la presencia de órganos sexuales masculinos o femeninos. Éstos son los caracteres

sexuales primarios.

Al tranformarse en adulto, aparecen más diferencias entre los dos sexos, aparecen diferencias corporales entre las que se pueden citar:
q

q

q

En la mujer las formas se redondean, los senos se desarrollan, la cintura se hace más extrecha y la cadera más ancha. En el hombre hay mayor desarrollo de la masa muscular, la espalda más ancha, la laringe se desarrolla y aparece la nuez, la voz se hace más grave y aparece pelo sobre la cara y el tronco. En ambos sexos se produce un aumento de estatura y aparece vello en el pubis y las axilas.

Estas diferencias constituyen los caracteres sexuales secundarios CONTENIDOS: 1. 2. 3. 4. El aparato reproductor masculino El aparato reproductor femenino Fecundación El ciclo menstrual

Está formado por un conjunto de órganos y estructuras que intervienen en la formación, conducción y expulsión de los espermatozoides. r Órganos y estructuras externas: s El pene s El escroto
http://www.arrakis.es/~lluengo/reproduccion.html (1 of 5)01/08/2004 10:50:44

La Reproducción
r

Órganos y estructuras internas: s Los testículos s Epidídimo y conductos deferentes s Las vesículas seminales y la próstata

detalle del testículo

r

r r

r

r

reproductor femenino. Internamente formado por dos cuerpos cavernosos, en su parte superior, que producen la erección, y un cuerpo esponjoso, en su parte inferior, que protege la última porción de la uretra. El último tramo del pene es el glande, recubierta por una porcion de piel llamada prepucio El escroto. Contiene y protege a los testículos Los testículos. Son dos y en su interior se encuentran los tubos seminíferos donde se forman los gamentos masculinos o espermatozoides, que se producen continuamente a partir de la pubertad. Epidídimo y conductos deferentes. Su función es almacenar los espermatozoides y conducirlos al exterior. Las vesículas seminales y la próstata. Son glándulas y segregan diversas sustancias que vierten sobre los espermatozoides, formando el esperma o semen.
El aparato reproductor del hombre asegura la producción de los espermatozoides, su conducción y su introducción en el aparato reproductor de la mujer.

El pene. Es el órgano copulador cuya función es depositar el semen en el interior del aparato

Contenidos

El aparato reproductor femenino produce las hormonas sexuales femeninas, responsables de los caracteres sexuales secundarios. Producen óvulos, que son las células sexuales femeninas. En caso de haber fecundación, se encargará de proporcionar al embrión un ambiente apropiado para su desarrollo.

http://www.arrakis.es/~lluengo/reproduccion.html (2 of 5)01/08/2004 10:50:44

La Reproducción

vista lateral

vista frontal

detalle

Los órganos que lo componen son los siguientes:
q

q

q

q q

Los ovarios. Se encuentran alojados en la parte inferior del abdomen. En ellos a partir de la pubertad, maduran los óvulos. Las trompas de Falopio. Capturan los óvulos al ser expulsados de los ovarios y los conducen hasta el útero a través del oviducto . El útero. Es un órgano único, hueco. Ha desarrollado una capa mucosa para acoger al óvulo si ha sido fecundado. Si no se produce fecundación, será eliminada a través de la vagina, mediante una hemorragia llamada menstruación. La vagina.Comunica el útero con el exterior y recibe al pene durante la cópula. La vulva. Es en su conjunto la parte externa del aparato reproductor femenino. En ella se encuentran: r los orificios de salida de la uretra y de la vagina. r el clítoris. Pequeño órgano que colabora en la sexualidad de la mujer. r los labios mayores y menores. Son pliegues de la piel que protegen la entrada al interior del aparato femenino.
El aparato reproductor de la mujer produce óvulos maduros y favorece su encuentro con los gametos masculinos. Además, alberga y alimenta al nuevo ser durante sus primeros meses de vida

Contenidos

La fecundación es la unión del óvulo y el espermatozoide para dar origen al zigoto, también llamada célula-huevo y que es en definitiva la primera célula del nuevo ser. Se produce en el interior del cuerpo de la madre, después de que se haya producido la unión sexual o cópula.

http://www.arrakis.es/~lluengo/reproduccion.html (3 of 5)01/08/2004 10:50:44

La Reproducción

El camino del óvulo. El óvulo maduro es inmóvil. Después de su salida del ovario se desplaza por la trompa de Falopio, gracias a los movimientos de ésta. Aproximadamente tardará una semana en llegar al útero. El óvulo debe ser alcanzado por algún espermatozoide entre las 24 y las 48 horas de su salida del ovario, ya que después pierde vitalidad y muere El camino de los espermatozoides. Los espermatozoides alcanzan su madurez al unirse con las líquidos segregados por las glándulas sexuales masculinas. La unión de las células y los líquidos constituyen el semen o esperma. Para permitir la introducción de los espermatozoides en la vagina de la mujer, el pene se pone en erección. En el interior de la vagina se produce la eyaculación de 2 o 3 mililitros de esperma, que contienen entre 150 y 300 millones de espermatozoides. La vida de éstos es de 48 a 72 horas. La fecundación. Los espermatozoides deben recorrer la vagina y el útero hasta llegar a las trompas. La fecundación se produce en el primer tercio del oviducto. Allí numerosos espermatozoides rodean al óvulo, pero sólo uno de ellos penetrará en él, dejando fuera su flagelo. Una vez en su interior se fusionan los núcleos de los dos gametos. Se ha producido la fecundación.

La fecundación es el resultado de la unión de un óvulo y un espermatozoide y tiene lugar en el interior del cuerpo de la mujer.
Contenidos

ESTOY EN REMODELACIÓN, ESPERO ESTAR TERMINADA DENTRO DE UNOS DÍAS
http://www.arrakis.es/~lluengo/reproduccion.html (4 of 5)01/08/2004 10:50:44

La Reproducción

(hoy es 26/octubre/2001)

Ciclo menstrual
Contenidos

Fecundación, gestación y desarrollo

Índice de Biología

http://www.arrakis.es/~lluengo/reproduccion.html (5 of 5)01/08/2004 10:50:44

Desarrollo

Clic para ver la animación.(388KB)

Clic para ver la animación.(627KB)

Clic para ver la animación

EN CONSTRUCCIÓN

http://www.arrakis.es/~lluengo/desarrollo.html01/08/2004 10:51:25

Untitled

Sistema Endocrino
q q q

Hormonas. Acción hormonal. Glándulas endocrinas Anomalías endocrinas Cuadro resumen: Acción y efecto de las hormonas

http://www.arrakis.es/~lluengo/endogen.html01/08/2004 10:51:28

Untitled

En condiciones patológicas, la secreción de las glándulas endocrinss puede estar aumentada o disminuida, hablándose entonces , respectivamente, de hiperfunción o hipofunción de la glándula endocrina correspondiente. Las principales disfunciones en el hombre son: Diabetes insípida. Es producida a causa de una escasa secreción de vasopresina por alguna lesión en el hipotálamo o en la neurohipófisis. Los efectos son: r eliminación de ingentes cantidades de orina diluida (poliuria), que puede alcanzar hasta 30 o 40 litros diarios. r intensa sed, que induce a beber un volumen considerable de líquido (polidipsia) para compensar las pérdidas. Enanismo y gigantismo hipofisario. Son causados, respectivamente, por la hipo e hipersecreción de la hormona del crecimiento en el periodo de desarrollo de la persona. Los enanos y gigantes hipofisarios son individuos normales y bien proporcionados, capaces de madurar sexualmente y procrear. Cuando la fase de crecimiento ya ha finalizado, la excesiva producción de hormona origina la acromegalia, que produce un crecimiento en partes distales del cuerpo: pies, manos, mandíbulas. Mixedema. La causa de esta anomalía es la hipofunción del tiroides. Los síntomas que la caracterizan son : r bajo metabolismo r temperatura corporal inferior a la normal r piel fría r escasa sudoración r tendencia a la obesidad El hipotiroidismo producido en la infancia origina el cretinismo, caracterizado por baja estatura, escaso desarrollo mental, no maduración de los órganos sexuales y obesidad abdominal.

q

q

q

http://www.arrakis.es/~lluengo/endo2.html (1 of 3)01/08/2004 10:52:04

Untitled

q

Bocio exoftálmico. Esta anomalía es producida por una hiperfunción del tiroides y un exceso de tiroxina y triyodotironina, produciéndose un gran aumento del tamaño del tiroides y una protusión de las órbitas oculares hacia afuera (exoftalmos). Los síntomas son: r aumento del metabolismo basal r Piel caliente y abundante sudoración r taquicardia r aumento de la excitabilidad nerviosa r tendencia a la pérdida de peso. Síndrome de Conn. Es causado por un exceso de mineralocorticoides producidos por tumores de la corteza adrenal. Los síntomas principales son: r alcalosis hipopotasémica en la sangre r hipertensión r poliuria y r tetania Síndrome de Cushing. Se produce como consecuencia de una hipersecreción de glucocorticoides. Los síntomas son: r aumento del catabolismo proteico (escaso desarrollo muscular) r acumulación de grasa en el abdomen, cara y espalda r hipertensión r osteoporosis (desmineralización y ablandamiento de los huesos) Enfermedad de Addison. Aparece ante una hipofunción de toda la corteza adrenal. Los síntomas son: r gran pigmentación de ciertas áreas corporales r hipotensión r debilidad muscular. Diabetes mellitus. Es debida a la ausencia o disminución de la insulina pancreática por alguna lesión que afecte a las células de los islotes de Langerhans. Los tres síntomas básicos de la diabetes son: 1. Poliuria(eliminación de grandes cantidades de orina)

q

q

q

q

http://www.arrakis.es/~lluengo/endo2.html (2 of 3)01/08/2004 10:52:04

Untitled

2. Polidipsia (ingestión de un volumen elevado de líquido) y 3. Polifagia (aumento del apetito). Síntomas adicionales son: r hiperglucemia r glucosuria r aumento del catabolismo proteíco y lipídico (cuerpos cetónicos en el aliento de los diabéticos) r pérdida de peso y r acidosis sanguínea Endocrino Índice Biología

http://www.arrakis.es/~lluengo/endo2.html (3 of 3)01/08/2004 10:52:04

Untitled

SISTEMA ENDOCRINO: EFECTO DE LAS HORMONAS GLÁNDULA HORMONA TEJIDOS/ ÓRGANO DIANA Tiroides FUNCIÓN Estimula al tiroides para que secrete hormona tiroidea. Estimula a la corteza de las glándulas suprarranales para que secreten hormonas esteroideas. Favorece metabolismo para estímulo del crecimiento Estimula crecimiento de las glándulas mamarias y de la secreción de leche Estimula maduración del folículo ovárico. Estimula formación de espermatozoides. Estimula secreción testosterona. Estimula cuerpo lúteo para ovulación

Tireotropa (TSH)

Adrenocortitropa (ACTH)

Corteza suprarrenal

Somatotropa (STH) General LÓBULO ANTERIOR Prolactina (PRL) Glándulas mamarias

HIPÓFISIS FSH Gónadas folículo estimulante

LH

Gónadas

http://www.arrakis.es/~lluengo/endo3.html (1 of 3)01/08/2004 10:52:19

Untitled

LÓBULO MEDIO

MSH

C. pigmentarias

Favorece síntesis de melanina y dispersión del pigmento Estimula contracciones uterinas en el parto y de la producción de leche. Favorece la reabsorción de agua por el riñón Estimula el metabolismo celular, del crecimiento y sistema nervioso. Inhibe la secreción de TSH. Regulación del calcio en sangre y estimula su depósito en huesos.

Oxitocina LÓBULO POSTERIOR ADH Antidiurética

Útero, Gl. mamarias

Riñones

Tiroxina TIROIDES

General

Calcitonina

Huesos

PARATIROIDES

Parathormona

Regulación del calcio en sangre por Huesos, riñones liberación del ión calcio a partir de los huesos. Regulación del metabolismo general. Control de inflamaciones y tensión sanguinea

Cortisona CORTEZA CÁPSULA SUPRARRENAL

General

Aldosterona

Mantenimiento del equilibrio del sodio Túbulos renales y fósforo, excreción de potasio y retención de agua.

http://www.arrakis.es/~lluengo/endo3.html (2 of 3)01/08/2004 10:52:19

Untitled

MÉDULA

Adrenalina

Músculos, corazón, vasos sanguineos, hígado General

Respuesta al estrés y estados de emergencia del organismo. Reducción de la concentración de glucosa en sangre. Incremento de la concentración de glucosa en sangre. Aparición y mantenimiento de los caracteres sexuales masculinos. Determinación de los caracteres sexuales femeninos. Estimula desarrollo del endometrio. Inhibición de la secreción de LH. Preparación para el embarazo. Relajación del cuello del útero. Favorece el parto.

Insulina PÁNCREAS Glucagón

Hígado,tejido adiposo. General Estructuras reproductoras General. Útero

TESTÍCULOS

Testosterona otros andrógenos

FOLÍCULOS

Estradiol Otros estrógenos

OVARIOS CUERPO LÚTEO Progesterona

Útero. Glándulas mamarias

ÚTERO Y PLACENTA

Relaxina

Útero

Endocrino

Índice Biología

http://www.arrakis.es/~lluengo/endo3.html (3 of 3)01/08/2004 10:52:19

Herencia mendeliana

q

Conceptos básicos Leyes de Mendel
q

q

Primera ley Segunda ley Retrocruzamiento Tercera ley

q

q

q

Conceptos básicos
Un pequeño diccionario con los términos mas usuales utilizados en Genética mendeliana.
q

q

q

q

q

q

q q

Gen. Unidad hereditaria que controla cada carácter en los seres vivos. A nivel molecular corresponde a una sección de ADN, que contiene información para la síntesis de una cadena proteínica. Alelo. Cada una de las alternativas que puede tener un gen de un carácter. Por ejemplo el gen que regula el color de la semilla del guisante , presenta dos alelos, uno que determina color verde y otro que determina color amarillo. Por regla general se conocen varias formas alélicas de cada gen ; el alelo más extendido de una población se denomina "alelo normal o salvaje", mientras que los otros más escasos, se conocen como "alelos mutados". Carácter cualitativo. Es aquel que presenta dos alternativas claras, fáciles de observar: blanco-rojo; lisorugoso; alas largas-alas cortas; etc. Estos caracteres están regulados por un único gen que presenta dos formas alélicas ( excepto en el caso de las series de alelos múltiples). Por ejemplo, el carácter color de la piel del guisante está regulado por un gen cuyas formas alélicas se pueden representar por dos letras, una mayúscula (A) y otra minúscula (a). Carácter cuantitativo. El que tiene diferentes graduaciones entre dos valores extremos. Por ejemplo la variación de estaturas, el color de la piel; la complexión física. Estos caracteres dependen de la acción acumulativa de muchos genes, cada uno de los cuales produce un efecto pequeño. En la expresión de estos caracteres influyen mucho los factores ambientales. Genotipo.Es el conjunto de genes que contiene un organismo heredado de sus progenitores. En organismos diploides, la mitad de los genes se heredan del padre y la otra mitad de la madre. Fenotipo. Es la manifestación externa del genotipo, es decir, la suma de los caracteres observables en un individuo. El fenotipo es el resultado de la interacción entre el genotipo y el ambiente. El ambiente de un gen lo constituyen los otros genes, el citoplasma celular y el medio externo donde se desarrolla el individuo. Locus. Es el lugar que ocupa cada gen a lo largo de un cromosoma (el plural es loci). Homocigoto. Individuo que para un gen dado tiene en cada cromosoma homólogo el mismo tipo de alelo, por ejemplo, AA o aa .

http://www.arrakis.es/~lluengo/genemende.html (1 of 7)01/08/2004 10:52:58

Herencia mendeliana

q

Heterocigoto. Individuo que para un gen dado tiene en cada cromosoma homólogo un alelo distinto, por ejemplo, Aa.

Principio de página

Leyes de Mendel
Conviene aclarar que Mendel, por ser pionero, carecía de los conocimientos actuales sobre la presencia de pares de alelos en los seres vivos y sobre el mecanismo de transmisión de los cromosomas, por lo que esta exposición está basada en la interpretación posterior de los trabajos de Mendel.

Primera ley de Mendel
1. Enunciado de la ley.- A esta ley se le llama también Ley de la uniformidad de los híbridos de la primera generación (F1). , y dice que cuando se cruzan dos variedades individuos de raza pura ambos (homocigotos ) para un determinado carácter, todos los híbridos de la primera generación son iguales. El experimento de Mendel.- Mendel llegó a esta conclusión trabajando con una variedad pura de plantas de guisantes que producían las semillas amarillas y con una variedad que producía las semillas verdes. Al hacer un cruzamiento entre estas plantas, obtenía siempre plantas con semillas amarillas. Figura 1

Interpretación del experimento.- El polen de la planta progenitora aporta a la descendencia un alelo para el color de la semilla, y el óvulo de la otra planta progenitora aporta el otro alelo para el color de la semilla ; de los dos alelos, solamente se manifiesta aquél que es dominante (A), mientras que el recesivo (a) permanece oculto. Otros casos para la primera ley.- La primera ley de Mendel se cumple también para el caso en que un determinado gen de lugar a una herencia intermedia y no dominante, como es el caso del color de las flores del "dondiego de noche" (Mirabilis jalapa). Al cruzar las plantas de la variedad de flor blanca con plantas de la variedad de flor roja, se obtienen plantas de flores rosas. La interpretación es la misma que en el caso anterior, solamente varía la manera de expresarse los distintos alelos. Figura 2

http://www.arrakis.es/~lluengo/genemende.html (2 of 7)01/08/2004 10:52:58

Herencia mendeliana

2.

Segunda ley de Mendel
Enunciado de la ley.- A la segunda ley de Mendel también se le llama de la separación o disyunción de los alelos. El experimento de Mendel. Mendel tomó plantas procedentes de las semillas de la primera generación (F1) del experimento anterior (figura 1) y las polinizó entre sí. Del cruce obtuvo semillas amarillas y verdes en la proporción que se indica en la figura 3. Así pues, aunque el alelo que determina la coloración verde de las semillas parecía haber desaparecido en la primera generación filial, vuelve a manifestarse en esta segunada generación. Figura 3

Interpretación del experimento.Los dos alelos distintos para el color de la semilla presentes en los individuos de la primera generación filial, no se han mezclado ni han desaparecido , simplemente ocurría que se manifestaba sólo uno de los dos. Cuando el individuo de fenotipo amarillo y genotipo Aa, forme los gametos, se separan los alelos, de tal forma que en cada gameto sólo habrá uno de los alelos y así puede explicarse los resultados obtenidos. Otros casos para la segunda ley. En el caso de los genes que presentan herencia intermedia, también se cumple el enunciado de la segunda ley. Si tomamos dos plantas de flores rosas de la primera generación filial (F1) del cruce que se observa en la figura 2 y las cruzamos entre sí, se obtienen plantas con flores
http://www.arrakis.es/~lluengo/genemende.html (3 of 7)01/08/2004 10:52:58

Herencia mendeliana

blancas, rosas y rojas, en la proporción que se indica en el esquema de la figura 4.También en este caso se manifiestan los alelos para el color rojo y blanco, que permanecieron ocultos en la primera generación filial. Figura 4

3.

Retrocruzamiento
Retrocruzamiento de prueba
. En el caso de los genes que manifiestan herencia dominante, no existe ninguna diferencia aparente entre los individuos heterocigóticos (Aa) y los homocigóticos (AA), pues ambos individuos presentarían un fenotipo amarillo. La prueba del retrocruzamiento, o simplemente cruzamiento prueba, sirve para diferenciar el individuo homo del heterocigótico. Consiste en cruzar el fenotipo dominante con la variedad homocigota recesiva (aa). Si es homocigótico, toda la descendencia será igual, en este caso se cumple la primera Ley de Mendel. (figura 5). Si es heterocigótico, en la descendencia volverá a aparecer el carácter recesivo en una proporción del 50%. (figura 6).

http://www.arrakis.es/~lluengo/genemende.html (4 of 7)01/08/2004 10:52:58

Herencia mendeliana

figura 5

figura 6

Tercera ley de Mendel
Enunciado de la ley.Se conoce esta ley como la de la herencia independiente de caracteres, y hace referencia al caso de que se contemplen dos caracteres distintos. Cada uno de ellos se transmite siguiendo las leyes anteriores con independencia de la presencia del otro carácter. El experimento de Mendel. Mendel cruzó plantas de guisantes de semilla amarilla y lisa con plantas de semilla verde y rugosa ( Homocigóticas ambas para los dos caracteres). (Figura 7)Las semillas obtenidas en este cruzamiento eran todas amarillas y lisas, cumpliéndose así la primera ley para cada uno de los caracteres considerados , y revelándonos también que los alelos dominantes para esos caracteres son los que determinan el color amarillo y la forma lisa. Las plantas obtenidas y que constituyen la F1 son dihíbridas (AaBb). Estas plantas de la F1 se cruzan entre sí, teniendo en cuenta los gametos que formarán cada una de las plantas y que pueden

http://www.arrakis.es/~lluengo/genemende.html (5 of 7)01/08/2004 10:52:58

Herencia mendeliana

verse en la figura 8. En el cuadro de la figura 9 se ven las semillas que aparecen y en las proporciones que se indica. Se puede apreciar que los alelos de los distintos genes se transmiten con independencia unos de otros, ya que en la segunda generación filial F2 aparecen guisantes amarillos y rugosos y otros que son verdes y lisos, combinaciones que no se habían dado ni en la generación parental (P), ni en la filial primera (F1). Asímismo, los resultados obtenidos para cada uno de los caracteres considerados por separado, responden a la segunda ley. Figura 9

Interpretación del experimento. Los resultados de los experimentos de la tercera ley refuerzan el concepto de que los genes son independientes entre sí, que no se mezclan ni desaparecen generación trás generación. Para esta interpretación fue providencial la elección de los caracteres, pues estos resultados no se cumplen siempre, sino solamente en el caso de que los dos caracteres a estudiar estén regulados por genes que se encuentran en distintos cromosomas. No se cumple cuando los dos genes considerados se encuentran en un mismo cromosoma, es el caso de los genes ligados.
Principio de página

http://www.arrakis.es/~lluengo/genemende.html (6 of 7)01/08/2004 10:52:58

Herencia mendeliana

http://www.arrakis.es/~lluengo/genemende.html (7 of 7)01/08/2004 10:52:58

Untitled

ANIMACISN DE LA 3* LEY DE MENDEL
En esta animacisn puede verse como se unen los gametos formados por los dos individuos, simbolizados con los colores rojo y azul los de uno y otro progenitor. Se ve como van apareciendo en la cuadrmcula los distintos genotipos de la descendencia y finalmente queda reflejado a la izquierda los 16 genotipos posibles y en la derecha la proporcisn de los cuatro fenotipos que se originan.

http://www.arrakis.es/~lluengo/geneanimacion.html01/08/2004 10:54:41

Series alélicas

SERIES ALÉLICAS

q

ALELOS MÚLTIPLES. PROBLEMAS DE SERIES ALÉLICAS.

q

Alelos múltiples
Hasta ahora, en todos los casos vistos, un gen tenía dos formas diferentes de expresarse; pero puede ocurrir que un mismo gen tenga múltiples formas de presentarse, en cuyo caso decimos que tenemos una serie de alelos múltiples. En estos casos, ha de establecerse la jerarquía de dominancia de unos alelos sobre otros. Los alelos múltiples más conocidos dentro de la especie humana son los de los grupos sanguíneos AB0. Existen tres formas alélicas, representadas por los alelos "A", "B", "0". Los alelos A y B son codominantes entre sí y su característica principal es que cada uno de ellos codifica la síntesis de una proteína específica que se localiza en la superficie de los glóbulos rojos; son el antígeno A y el antígeno B. La forma alélica 0 es recesiva con respecto a los alelos A y B y a su vez no produce ningún antígeno. La jerarquía de dominancia en este caso es :

A = B > 0
Genotipo AA, A0 BB, B0 B AB 00 AB 0

Fenotipo A
Principio de página

Problemas de series alélicas
1. Si un hombre de grupo sanguíneo AB se casa con una mujer de grupo A, cuyo padre era de grupo 0. ? Qué grupos sanguíneos se puede esperar entre sus hijos y con qué frecuencia ?.

http://www.arrakis.es/~lluengo/seriesalelicas.html (1 of 4)01/08/2004 10:55:05

Series alélicas

2.

Un hombre de grupo sanguíneo A y una mujer de grupo sanguíneo B tienen cuatro hijos, de los cuales, uno pertenece al grupo AB, otro al 0, otro al B, y otro al A. Señalar razonanadamente el genotipo de los padres.

3.

La herencia del color de la piel en las reses, está determinado por una serie de alelos múltiples, con la siguiente jerarquía de dominancia:

S > sh > sc > s
El alelo "S" determina una banda de color blanco alrededor del cuerpo que se denomina cinturón holandés. El alelo "sh" produce manchas tipo Hereford, , el color sólido es el resultado del alelo "sc" y las manchas tipo Holstein, están producidas, están producidas por el alelo "s". Machos con cinturón holandés, homocigóticos son cruzados con hembras tipo Holstein. Las hembras de la F1 son cruzadas con machos tipo Hereford de genotipo "sh sc". Predecir las frecuencias genotípicas y fenotípicas de la descendencia.

4.

Una serie de alelos múltiples gobierna la intensidad de la pigmentación en el ratón. D= color completo, d= color diluído y dl= es letal en homocigosis. El orden de dominancia es :

D > d > dl
Un ratón de color completo portador del gen letal es apareado con un individuo de color diluído también portador del gen letal. La F1 es cruzada con el padre diluído: r ?Qué proporción fenotípica puede esperarse de la descendencia viable ? r ? Qué porcentaje de la descendencia con color completo es portadora del gen letal ?. r ? Qué porcentaje de la descendencia con color diluído lleva el gen letal ?

5.

El color de la concha de un molusco está controlado por una serie alélica que determina los siguientes fenotipos: marrón, rosa, amarillo intenso y amarillo pálido. Se hicieron cruzamientos entre varias razas puras, obteniendo la siguiente descendencia:

http://www.arrakis.es/~lluengo/seriesalelicas.html (2 of 4)01/08/2004 10:55:05

Series alélicas

PARENTALES rosa x a. intenso rosa x a. pálido a. intenso x a. pálido marrón x rosa marrón x a. pálido
r r

F1 ROSA ROSA A. INTENSO ROSA MARRÓN

Interpretar los resultados Se puso a aparear un individuo de color amarillo intenso con otros dos, uno de fenotipo amarillo intenso y otro rosa El individuo amarillo intenso deja 16 descendientes que son. 4 amarillo intenso, 8 rosa, 4 amarillo pálido Suponiendo que sólo uno de los otros dos individuos actuó como padre, s ? cuál será su fenotipo ? s ? Qué genotipos presentan el padre, la madre y los descendientes?. .

6.

El sistema de grupos sanguíneos AB0, está determinado por tres alelos A, B, 0. 1. Indicar las proporciones fenotípicas que se espera en la descendencia de los cruzamientos siguientes: s AA x AB s AA x B0 s AA x A0 s A0 x A0 s A0 x AB 2. En una clínica se mezclan por error 4 recién nacidos. Los grupos sanguíneos de estos niños son : 0, A, B, AB. Los grupos sanguíneos de las cuatro parejas de padres son : s AB x 0 s A x 0 s A x AB s 0 x0 Indicar qué niño corresponde a cada pareja.

7.

En la familia de la ilustración se indican los grupos sanguíneos de cada individuo ( los hombres se representan con un cuadrado y las mujeres con un círculo ). Uno de

http://www.arrakis.es/~lluengo/seriesalelicas.html (3 of 4)01/08/2004 10:55:05

Series alélicas

los miembros de la genealogía tiene un grupo sanguíneo no explicable en base al tipo de herencia del carácter. Indicar de qué persona se trata. Indicar cuál de estas dos explicaciones es la más probable: r La persona en cuestión es hijo/hija extramatrimonial de la persona que figura como su madre en la genealogía. r Hubo una confusión (cambio de niño/a) en la clínica en que nació esta persona. La persona señalada con una flecha se casa con un hombre que tiene un grupo sanguíneoo AB. Determine qué grupos sanguíneos pueden tener sus hijos, así como la probabilidad de cada uno de ellos.

http://www.arrakis.es/~lluengo/seriesalelicas.html (4 of 4)01/08/2004 10:55:05

Herencia y sexo

La diferenciación sexual es la expresión fenotípica de un conjunto de factores genéticos que determinan que el individuo sea capaz de producir uno u otro tipo de células sexuales. Los individuos machos o de sexo masculino, son los productores de espermatozoides, los individuos hembras o de sexo femenino, son los productores de óvulos y los individuos hermafroditas son capaces de producir los dos tipos de gametos.
q

q

q

Determinación del sexo r Determinación fenotípica r Determinación génica r Determinación cromosómica r Determinación cariotípica Herencia ligada al sexo r Daltonismo r Hemofilia Herencia influida por el sexo

Determinación del sexo
q

Determinación fenotípica. En muchas especies, la dotacón genética no determina totalmente el tipo de sexo, y son las condiciones ambientales las que realizan dicha determinación. Muchas plantas superiores que producen flores hermafroditas pueden masculinizar o feminizar sus flores cuando se las trata con alguna fitohormona. En algunos gusanos marinos de la clase Poliquetos , los individuos jsvenes son todo machos y los adultos todos hembras. Ademas cuando varias hembras crecen juntas en un ambiente cerrado, las mas jóvenes acaban transformándose en machos, por influencia de una ectohormona elaborada por los óvulos maduros. En especies de ranas y sapos, los machos son hermafroditas en su fase juvenil y las hembras adultas pueden pasar a hermafroditas e incluso a machos. En Rana temporaria , las larvas geniticamente hembras que se desarrollan a 28:C dan lugar a machos y las larvas genéticamente machos, y las larvas genéticamente machos que se desarrollan a menos de 10:C, dan lugar a hembras. Determinacisn ginica. En algunas especies la determinación sexual es producida por un gen con varios alelos. Es el caso del pepinillo del diablo, en el que se dan tres

q

http://www.arrakis.es/~lluengo/herenciasexo.html (1 of 5)01/08/2004 10:55:59

Herencia y sexo

alelos para la sexualidad: r aD es el alelo dominante y determina masculinidad r a+ es el alelo intermedio y determina plantas monoicas (plantas con flores masculinas y flores femeninas ) r ad es el alelo recesivo y determina la feminidad
q

Determinación cromosómica. El caso mas común de determinación sexual es aquel en el que los genes que determinan la sexualidad se reunen en unos cromosomas determinados que se llaman cromosomas sexuales. En todas las células de un individuo, excepto en los gametos, existen dos series de cromosomas, que forman parejas de homólogos, es decir su dotación cromosómica, que representamos por 2n.

Al agrupar estas parejas de homólogos existe un par de cromosomas que es diferente según estemos estudiando una hembra o un macho.
http://www.arrakis.es/~lluengo/herenciasexo.html (2 of 5)01/08/2004 10:55:59

Herencia y sexo

Estos dos cromosomas que pueden ser identificados por su forma y tamaqo, como pertenecientes a uno de los dos sexos, se denominan cromosomas sexuales, mientras que los restantes pares de cromosomas homólogos, que son iguales en tamaño y forma para ambos sexos de una misma especie , se denominan autosomas. La representación gráfica de todos los cromosomas de un individuo en cuanto al número, tamaño y forma constituye el CARIOTIPO. Los cromosomas sexuales se han denominado X e Y . En los mamíferos, las células de los individuos machos contienen un pan XY y las células de las hembras por un par XX. En la especie humana, cuya dotación cromosómica es de 46 cromosomas, cada cilula somatica contiene 22 pares de autosomas mas un par XX si se trata de una mujer y 22 pares de autosomas y un par XY si se trata de un varsn.

La determinación sexual queda marcada en el momento de la fecundación y viene fijada por el tipo de gametos que se unen. Las mujeres sólo produciran un tipo de svulo con 22 autosomas y un cromosoma sexual X, mientras que los varones formaran dos tipos de espermatozoides, el 50% portadores de un cromosoma X y el 50% portadores de un cromosoma Y. Al ser la fecundacisn producto del azar, un svulo puede unirse a cualquiera de los tipos de espermatozoides que se han producido, por lo que en la mitad de los casos se formaran hembras y en otro 50% se formaran machos.
q

Determinacisn cariotmpica. En Himenópteros sociales ( abejas, avispas...) el sexo viene determinado por la dotación cromosómica: los individuos diploides son hembras y los haploides son machos.

Principio de pagina

http://www.arrakis.es/~lluengo/herenciasexo.html (3 of 5)01/08/2004 10:55:59

Herencia y sexo

Herencia ligada al sexo
En la especie humana los cromosomas X e Y presentan diferencias morfológicas ( el Y es mas pequeño que el X )y tienen distinto contenido génico. Están compuestos por un segmento homólogo donde se localizan genes que regulan los mismos caracteres y otro segmento diferencial, en este último se encuentran tanto los genes exclusivos del X , caracteres ginándricos, como los del cromosoma Y, caracteres holándricos. Los caracteres cuyos genes se localizan en el segmento diferencial del cromosoma X, como daltonismo, hemofilia, ictiosis están ligados al sexo.
q

Daltonismo. Consiste en la incapacidad de distinguir determinados colores, especialmente el rojo y el verde. Es un caracter regulado por un gen recesivo localizado en el segmento diferencial del cromosoma X. Los genotipos y fenotipos posibles son: MUJER XDXD: visión normal XDXd: normal/ portadora XdXd:daltónica HOMBRE XD Y : visión normal Xd Y : daltónico

q

Hemofilia Se caracteriza por la incapacidad de coagular la sangre, debido a la mutación de uno de los factores proteicos. Igual que en el daltonismo, se trata de un caracter recesivo, y afecta fundamentalmente a los varones ya que las posibles mujeres hemofílicas Xh Xh no llegan a nacer, pues esta combinación homocigótica recesiva es letal en el estado embrionario. Los genotipos y fenotipos posibles son:

http://www.arrakis.es/~lluengo/herenciasexo.html (4 of 5)01/08/2004 10:55:59

Herencia y sexo

MUJER XHXH: normales XHXh: normal/portadora XhXh:hemofílica (no nace)

HOMBRE XH Y : normal Xh Y : hemofílico

Principio de pagina

Herencia influida por el sexo
Algunos genes situados en los autosomas, o en las zonas homslogas de los cromosomas sexuales, se expresan de manera distinta segzn se presenten en los machos o en las hembras . Generalmente este distinto comportamiento se debe a la acción de las hormonas sexuales masculinas. Como ejemplo de estos caracteres, podemos citar en los hombres la calvicie, un mechón de pelo blanco , y la longitud del dedo índice. Si llamamos "A" al gen de pelo normal y "a" al gen de la calvicie. El gen "a" es dominante en hombres y recesivo en mujeres. Según ésto tendremos los siguientes genotipos y fenotipos para el pelo. Genotipo AA Aa aa Hombres Normal Calvo Calvo Mujeres Normal Normal Calva

http://www.arrakis.es/~lluengo/herenciasexo.html (5 of 5)01/08/2004 10:55:59

Untitled

GENES LIGADOS

A medida que se avanzó en la investigación sobre la herencia, se fue descubriendo que existían pares de genes que no se heredaban en las proporciones que había encontrado Mendel. Y por lo tanto no se cumple siempre la tercera ley . Esta ley se cumple cuando los caracteres elegidos están regulados por genes situados en distintos cromosomas. Como se aprecia en el esquema los dos caracteres elegidos por Mendel color de la semilla "A" y forma de la semilla "B" se encuentran en distintos cromosomas y por lo tanto el individuo dihíbrido AaBb formará cuatro clase de gametos (AB, Ab, aB, ab ). En cambio si los genes que estamos estudiando se encuentran localizados en el mismo cromosoma , un individuo que tuviera el mismo genotipodihíbrido AaBb sólo formará dos clases de gametos, en el caso concreto del esquema se formarán los gametos con las combinaciones : AB, ab.

http://www.arrakis.es/~lluengo/genesligados.html (1 of 4)01/08/2004 10:56:26

Untitled

En el caso concreto de las semillas de guisantes, como se ve en el esquema siguiente, en el que se ha utilizado la técnica del retrocruzamiento o cruce de prueba tendríamos estos resultados:

http://www.arrakis.es/~lluengo/genesligados.html (2 of 4)01/08/2004 10:56:26

Untitled

q

q

Si los genes fueran independientes, el individuo dihíbrido AaBb formará cuatro posibles gametos que darán origen a cuatro fenotipos posibles : amarillo-liso, amarillo - rugoso, verde - liso, verde - rugoso Si los genes están ligados, el individuo dihíbrido formará solamente dos tipos de gametos y se obtendrán solamente dos fenotipos : amarillo-liso y verde- rugoso .

Hoy en día sabemos que los cromosomas son portadores de un número elevado de genes, por lo tanto, cuando un cromosoma es heredado por un hijo también son heredados todos sus genes, y en este caso su comportamiento no sigue la Tercera Ley de Mendel, es decir, no se segregan independientemente. A los genes que están localizados en el mismo cromosoma se les llama genes ligados. Los genes ligados pueden encontrarse en fase de acoplamiento , alelos dominantes en el mismo cromosoma; o en fase de repulsión, alelo dominante de un carácter junto al recesivo
http://www.arrakis.es/~lluengo/genesligados.html (3 of 4)01/08/2004 10:56:26

Untitled

para el otro carácter.

http://www.arrakis.es/~lluengo/genesligados.html (4 of 4)01/08/2004 10:56:26

Untitled

MUTACIONES
Una mutación es un cambio heredable en el material genético de una célula. En la naturaleza las mutaciones se originan al azar y, aunque las causas siguen siendo inciertas, se conocen bastantes agentes externos, mutágenos, que pueden producir mutaciones como: las radiaciones ambientales y sustancias químicas. Una mutación en una célula somática, puede provocar alteraciones en el organismo en el que se presente; pero desaparece en el momento en que muere el individuo en que se originó. Sin embargo, las mutaciones en las células sexuales, óvulos y espermatozoides, pueden transmitirse como rasgos hereditarios diferenciadores a los descendientes del organismo en los que tuvo lugar la mutación. Se distinguen varios tipos de mutaciones en función de los cambios que sufre el material genético. 1. Mutaciones cromosómicas . Este tipo de mutaciones provoca cambios en la estructura de los cromosomas. r Deleción. Implica la pérdida de un trozo de cromosoma; los efectos que se producen en el fenotipo están en función de los genes que se pierden. r Duplicación. En este caso existe un trozo de cromosoma repetido.

2. Mutaciones genómicas. Este tipo de mutaciones afectan a la dotación cromosómica de un individuo, es decir, los individuos que las presentan tienen en sus células un número distinto de cromosomas al que es propio de su especie. No son mutaciones propiamente dichas, porque no hay cambio de material genético, sino una aberración, la cual suele ser el resultado de una separación anormal de los cromosomas durante la meiosis, con lo que podemos encontrarnos individuos triploides (3n), tetraploides (4n), etc. Estos poliploides así formados son genéticamente muy interesantes en las plantas cultivadas, y hoy en día la mayoría de variedades gigantes de fresones, tomates, trigo, ... que existen en el mercado, tienen este origen. En el hombre, existen varios síndromes provocados por la no separación de una pareja de cromosoma homólogos durante la meiosis, con lo cual permanecen unidos y se desplazan juntos a un mismo gameto provocando lo que se denomina trisomía, es decir un individuo con un cromosoma triplicado. En los siguientes esquemas, tenemos las trisomías más frecuentes tanto en los autosomas, como en los cromosomas sexuales. ALTERACIONES EN LOS AUTOSOMAS

http://www.arrakis.es/~lluengo/mutacion.html (1 of 3)01/08/2004 10:56:44

Untitled

SÍNDROME Síndrome de Down Síndrome de Edwars Síndrome de Patau

TIPO DE MUTACIÓN Trisomía 21 Trisomía 18 Trisomía 13 ó 15

Características y síntomas de la mutación
Retraso mental, ojos oblicuos, piel rugosa, crecimiento retardado Anomalías en la forma de la cabeza, boca pequeña, mentón huido, lesiones cardiacas. Labio leporino, lesiones cardiacas, polidactilia.

ALTERACIONES EN LOS CROMOSOMAS SEXUALES

Síndrome de Klinefelter 44 autosomas + XXY Escaso desarrollo de las gónadas, aspecto eunocoide. Síndrome del duplo Y Síndrome de Turner Síndrome de Triple X 44 autosomas + XYY 44 autosomas + X
Elevada estatura, personalidad infantil, bajo coeficiente intelectual, tendencia a la agresividad y al comportamiento antisocial. Aspecto hombruno, atrofia de ovarios, enanismo.

44 autosomas + XXX Infantilismo y escaso desarrollo de las mamas y los genitales externos.

3. Mutaciones génicas. Son las verdaderas mutaciones, porque se produce un cambio en la estructura del ADN. A pesar de todos los sistemas destinados a prevenir y corregir los posibles errores, de vez en cuando se produce alguno en la réplica, bien por colocarse una Citosina (C) en lugar de una Timina (T), o una Adenina (A) en lugar de una Guanina (G); o bien porque el mecanismo de replicación se salta algunas bases y aparece una "mella" en la copia. O se unen dos bases de Timina, formando un dímero.

Aunque se trate de un cambio de un nucleótido por otro, supondrá una alteración en la secuencia de un gen, que se traduce posteriormente en una modificación de la secuencia de aminoácidos de una proteína. Al transcribirse la mutación, al menos un triplete del ARNm , se encuentra modificado y su traducción da lugar a que se incorpore un aminoácido distinto del normal en la cadena polipeptídica. Es un cambio que aunque la mayoría de las veces va a ser perjudicial, en contadas ocasiones puede provocar que mejore un gen y gracias a esta característica se sintetice una proteína distinta , que tenga propiedades distintas o participe en la formación de estructuras más eficaces. En estos casos raros, pero esenciales para la evolución de las especies , los individuos portadores de la mutación poseen ventajas adaptativas respecto a sus congéneres , por lo que el gen mutado es posible que con el tiempo, y gracias a la selección natural, sustituya al gen original en la mayoría de los individuos que componen la población.
http://www.arrakis.es/~lluengo/mutacion.html (2 of 3)01/08/2004 10:56:44

Untitled

http://www.arrakis.es/~lluengo/mutacion.html (3 of 3)01/08/2004 10:56:44

Problemas de genitica

Problemas de Genética
q q

Herencia de un carácter Herencia de dos caracteres

Herencia de un carácter
Razona la veracidad o falsedad de la siguiente afirmación: El color de tipo común del cuerpo de la Drosophila está determinado por el gen dominante "N", su alelo recesivo "n" produce cuerpo de color negro. Cuando una mosca tipo común de raza pura se cruza con otra de cuerpo negro, ? la fracción de la segunda generación que se espera sea heterocigótica es 1/2 ?.

1.

2.

En el hombre el color pardo de los ojos "A" domina sobre el color azul "a". Una pareja en la que el hombre tiene los ojos pardos y la mujer ojos azules tienen dos hijos, uno de ellos de ojos pardos y otro de ojos azules. Averiguar: r El genotipo del padre r La probabilidad de que el tercer hijo sea de ojos azules.

3.

Como Mendel descubrió, las semillas de color amarillo en los guisantes son dominantes sobre los de color verde. En los experimentos siguientes, padres con fenotipos conocidos pero genotipos desconocidos produjeron la siguiente descendencia: Parentales A. amarillo x verde B. amarillo x amarillo C. verde x verde D. amarillo x verde Amarillo Verde 82 118 0 74 78 39 50 0 0

E. amarillo x amarillo 90

http://www.arrakis.es/~lluengo/problemas1.html (1 of 5)01/08/2004 10:56:58

Problemas de genitica
r r

Dar los genotipos más probables de cada parental En los cruces B, D, E, indíquese qué proporción de la descendencia amarilla producida en cada uno de ellos se esperaría que produjera descendientes verdes por autopolinización.

4.

La acondroplasia es una anomalía determinada por un gen autosómico que da lugar a un tipo de enanismo en la especie humana. Dos enanos acondroplásicos tienen dos hijos, uno acondroplásico y otro normal. r La acondroplasia, ?es un carácter dominante o recesivo ?. ? Por qué ?. r ? Cuál es el genotipo de cada uno de los progenitores ? ? Por qué ?. r ? Cuál es la probabilidad de que el próximo descendiente de la pareja sea normal ?. ? Y de qué sea acondroplásico ?. Hacer un esquema del cruzamiento.

5.

La fenilcetonuria (FCU) es un desorden metabólico que se hereda con carácter autosómico recesivo. Dos progenitores sanos tienen un hijo con FCU. r Indica los fenotipos y genotipos de todos los apareamientos que teóricamente pueden dar un descendiente afectado de FCU. r ? A cuál de estos tipos de apareamiento pertenece el caso descrito ?. r ? Cuál es la probabilidad de que el siguiente hijo padezca también la enfermedad ?. r ? Cuál será la probabilidad de qué un hijo normal (sano) de estos padres sea portador heterocigótico para FCU ?.

6.

La ausencia de patas en las reses se debe a un gen letal recesivo. Del apareamiento entre un toro y una vaca, ambos híbridos, ? qué proporciones genotípicas se esperan en la F2 adulta?. Los becerros amputados mueren al nacer.

7.

El albinismo es un carácter recesivo con respecto a la pigmentación normal. ? Cuál sería la descendencia de un hombre albino en los siguientes casos?: r Si se casa con una mujer sin antecedentes familiares de albinismo. r Si se casa con una mujer normal cuya madre era albina. r Si se casa con una prima hermana de pigmentación normal pero cuyos abuelos comunes eran albinos.

8.

Dos plantas de dondiego (Mirabilis jalapa) son homocigóticas para el color de las flores. Una de ellas produce flores de color blanco marfil y la otra, flores rojas. Señale los genotipos y fenotipos de los dondiegos originados del cruce de ambas

http://www.arrakis.es/~lluengo/problemas1.html (2 of 5)01/08/2004 10:56:58

Problemas de genitica

plantas, sabiendo que "B" es el gen responsable del color marfil, "R" es el gen que condiciona el color rojo y que los genes R y B son equipotentes ( herencia intermedia).

9.

? Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo?. Razonar la respuesta.

Principio de página

Herencia de dos caracteres
El pelo oscuro y el color marrón de los ojos se consideran dominantes sobre el pelo claro y ojos azules. Un varón de estas características tiene dos hijos con una mujer de pelo claro y ojos azules; uno de los hijos tiene pelo claro y ojos marrones, y el otro ojos azules y pelo oscuro. r ? Cuál es la probabilidad de que un tercer hijo tenga el pelo claro y los ojos marrones?. Razonar la respuesta.

1.

2.

En el tomate, el color púrpura del tallo está determinado por un alelo autosómico dominante "A". El alelo recesivo "a" determina tallo de color verde. Otro gen autosómico independiente controla la forma de la hoja: el alelo dominante "C" determina hoja con borde recortado y el alelo recesivo "c" determina hoja con borde entero. En la siguiente tabla se indican los resultados en tres cruces entre plantas de fenotipos diferentes. En cada caso, indique cuáles son los genotipos de los progenitores y por qué. Fenotipos de los progenitores púrpura/recortada Púrpura/entera Verde/recortada Verde/entera púrpura, recortada x verde, recortada púrpura, recortada x púrpura recortada púrpura, recortada x verde, recortada 321 144 722 101 48 231 310 50 0 107 18 0

3.

En las plantas de guisante, el alelo "L", que indica semillas lisas, es dominante sobre el alelo "l", que indica semillas rugosas, y el alelo "A" que indica color amarillo,

http://www.arrakis.es/~lluengo/problemas1.html (3 of 5)01/08/2004 10:56:58

Problemas de genitica

es dominante sobre el alelo "a" , que indica color verde. Si se cruza una variedad pura lisa de color amarillo con una variedad pura rugosa de color verde, r ?cuál es el genotipo y el fenotipo de la primera generación filial (F1) ?. r Indicar los fenotipos de la segunda generación (F2) y la proporción de cada uno de ellos que resulta de la autofecundación de las plantas de la F1.

4.

Los pollos con alas y patas recortadas reciben el nombre de trepadores. El apareamiento de este tipo de pollos con aves normales da lugar a una descendencia equilibrada entre pollos normales y trepadores. El apareamiento de pollos trepadores entre sí produce una descendencia formada por dos pollos trepadores y uno normal. El cruzamiento entre pollos normales da lugar a una progenie uniforme formada exclusivamente por aves normales. Explicar el fenómeno de forma razonada.

5.

En el guisante, los caracteres tallo largo y flor roja dominan sobre tallo enano y flor blanca. ? Cuál será la proporción de plantas doble homocigóticas que cabe esperar en la F2 obtenida a partir de un cruzamiento entre dos líneas puras, una de tallo largo y flor blanca con otra de tallo enano y flor roja ?. Indicar el genotipo de todas las plantas homocigóticas que pueden aparecer en la F2. Razonar la respuesta.

6.

El color rojo de la pulpa del tomate depende de la presecia del factor R, dominante sobre su alelo r para el amarillo. El enanismo se debe a un gen recesivo d. Se dispone de una variedad homocigótica de pulpa amarilla y tamaño normal y otra enana de pulpa roja. r ? Podría obtenerse a partir de las variedades disponibles, una variedad homocigótica de pulpa roja y tamaño normal ? r ? Y una variedad de pulpa amarilla y de porte enano ?. Razónese la respuesta.

7.

La miopía es debida a un gen dominante, al igual que el fenotipo Rh+. Una mujer de visión normal Rh+, hija de un hombre Rh-, tiene descendencia con un varón miope heterocigoto y Rh-. Establézcanse los previsibles genotipos y fenotipos de los hijos de la pareja.

8.

La enfermedad de Tay-Sachs es una enfermedad hereditaria recesiva que causa la muerte en los primeros años de vida cuando se encuentra en condición homocigótica. Se piensa que los dedos anormalmente cortos, braquifalangia,se deben al genotipo heterocigótico para un gen letal, siendo normal el individuo BB. ? Cuáles son los fenotipos esperados entre niños adolescentes hijos de padres

http://www.arrakis.es/~lluengo/problemas1.html (4 of 5)01/08/2004 10:56:58

Problemas de genitica

braquifalángicos y heterocigóticos para la enfermedad de Tay-Sachs ?.

9.

Dos condiciones anormales en el hombre, que son las cataratas y la fragilidad de huesos son debidas a alelos dominantes. Un hombre con cataratas y huesos normales cuyo padre tenía ojos normales, se casó con una mujer sin cataratas pero con huesos frágiles, cuyo padre tenía huesos normales. ?Cuál es la probabilidad de ?: r Tener un hijo completamente normal r Que tenga cataratas y huesos normales r Que tenga ojos normales y huesos frágiles r Que padezca ambas enfermedades.

10.

Los ratones gordos se pueden producir por dos genes independientes. El genotipo "oo" genera un ratón gordo y estéril, llamado obeso; su alelo dominante "O" da lugar a crecimiento normal. El genotipo recesivo "aa" también produce un ratón gordo y estéril llamado adiposo, mientras que su alelo dominante ocasiona crecimiento normal. ? Qué proporciones fenotípicas de ratones gordos frente a normales podemos esperar en F1, siendo los padres de genotipo OoAa.

Principio de página

http://www.arrakis.es/~lluengo/problemas1.html (5 of 5)01/08/2004 10:56:58

Problemas ligados e influídos por el sexo

Caracteres ligados e influídos por el sexo

La teoría para poder resolver estos ejercicios la puedes encontrar picando aquí.

1.

La hemofilia es un carácter ligado al sexo. Si una mujer normal, cuyo padre era hemofílico , se casa con un varón normal. ?Qué proporción de la descendencia tendrá el gen para la hemofilia?.

2.

Una pareja en la que la visión de ambos es normal, tienen cuatro hijos. En ellos y en sus descendientes se aprecian las siguientes características: r Una hija con visión normal, que tiene un hijo normal y un hijo y una hija daltónica. r Una hija con visión normal, con tres hijas y dos hijos normales r Un hijo daltónico, con dos hijas normales. r Un hijo normal, con dos hijos y dos hijas normales. Constituye la genealogía de esta familia e indica en cada caso los genotipos probables.

3.

En las plantas, la determinación del sexo es similar a la del hombre. Se sabe que un gen ligado "l" es letal en las hembras homocigóticas. Cuando se encuentra en los machos de lugar a manchas de color amarillo-verde. El alelo dominante "L" produce color verde oscuro normal. Del cruce entre hembras heterocigóticas y machos amarillo-verde, predecir las proporciones fenotípicas esperadas en la descendencia.

4.

Consideremos simultáneamente dos caracteres influídos por el sexo; la calvicie y el dedo índice corto. Ambos caracteres se manifiestan como dominantes en el hombre y recesivo en la mujer. Un hombre heterocigótico para la calvicie y con el dedo índice normal se casa con una mujer calva y heterocigótica para el carácter de longitud de dedo. ?Qué descendencia se espera?.

http://www.arrakis.es/~lluengo/problemasexo.html (1 of 4)01/08/2004 10:57:10

Problemas ligados e influídos por el sexo

5.

Se cruzó una hembra heterocigótica para los genes recesivos "a" y "b", con un macho de fenotipo Ab. En la descendencia, el 50% de las hembras eran de fenotipo AB y el otro 50% presentaban fenotipo Ab. En los machos, aparecía el 25% de cada uno de los fenotipos AB, Ab, aB, ab. Explicar el tipo de herencia.

6.

Un gen recesivo ligado al sexo, produce en el hombre ceguera a los colores en estado hemicigótico y ceguera a los colores a las mujeres homocigóticas. Un gen influído por el sexo determina calvicie y es dominante en hombres y recesivo en mujeres. Un hombre heterocigótico calvo y con ceguera a los colores se casa con una mujer sin calvicie y con visión normal, cuyo padre no era calvo ni ciego a los colores y cuya madre era calva y con visión normal. Expectaciones de los fenotipos en los descendientes.

7.

Un gen recesivo ligado al sexo (e) causa esterilidad en los machos. A la vista del pedigrí, responder a las siguientes preguntas:

r r r

?Cuál es la probabilidad de que II1 x II2 tengan otro hijo macho normal ? ?Cuál es la probabilidad de que II3 x II4 tengan una hija normal ? ?Cuál es la probabilidad de qué II5 x II6 tengan una hija portadora?

http://www.arrakis.es/~lluengo/problemasexo.html (2 of 4)01/08/2004 10:57:10

Problemas ligados e influídos por el sexo

8.

En el siguiente árbol genealógico, los cuadros rojos representan a personas afectadas de hemofilia, enfermedad determinada por un alelo recesivo ligado al sexo.

r

r

Si la mujer II2 tuviese dos hijos varones, ? cuál sería la probabilidad de que ninguno fuera hemofílico ?. ? Cuál es la probabilidad de qué el primer hijo varón de la pareja II4 y II5 sea hemofílicoo ?.

9.

Los gatos machos domésticos pueden ser negros o amarillos. Las hembras pueden ser negras, barcinas ( con manchas amarillas y negras ) o amarillas. Si estos colores son determinados por un gen ligado al sexo, ?cómo pueden explicarse estos resultados?. r Determinar los fenotipos esperados en la descendencia al cruzar una hembra amarilla con un macho negro. r Un cierto tipo de apareamiento produce la siguiente camada de gatitos: machos negros 1/2 hembras barcinas 1/2

machos amarillos 1/2

hembras negras 1/2

r

?Qué colores tienen los progenitores ?. Otro tipo de apareamiento produce la siguientes camada de gatitos:

http://www.arrakis.es/~lluengo/problemasexo.html (3 of 4)01/08/2004 10:57:10

Problemas ligados e influídos por el sexo

machos amarillos 1/4

machos negros 1/4

hembras amarillas 1/4

hembras barcinas 1/4

?Qué colores tienen los progenitores ?.

10.

Un gen recesivo ligado al sexo, determina la hemofilia. De la información obtenida en el siguiente pedigrí, contestar las siguientes cuestiones:

r

r

r

Si II2 se casa con un hombre normal, ?cuál es la probabilidad de que su primer hijo sea un niño hemofílico ?. Suponga que su primer hijo es hemofílico. ?Cuál es la probabilidad de que su segundo hijo sea un niño hemofílico ?. Si la madre de I1 era hemofílica , ?Cuál era el fenotipo del padre de I1 ?.

http://www.arrakis.es/~lluengo/problemasexo.html (4 of 4)01/08/2004 10:57:10

Microbiología

1.

Morfología y estructura.
Las bacterias son microorganismos procariotas de organización muy sencilla. La célula bacteriana consta:
r

citoplasma. Presenta un aspecto viscoso, y en su zona central aparece un nucleoide que contiene la mayor parte del ADN bacteriano, y en algunas bacterias aparecen fragmentos circulares de ADN con información genética , dispersos por el citoplasma: son los plásmidos. La membrana plasmática presenta invaginaciones, que son los mesosomas, donde se encuentran enzimas que intervienen en la síntesis de ATP, y los pigmentos fotosintéticos en el caso de bacterias fotosintéticas. En el citoplasma se encuentran inclusiones de diversa naturaleza química. Muchas bacterias pueden presentar flagelos generalmente rígidos, implantados en la membrana mediante un corpúsculo basal . Pueden poseer también, fimbrias o pili muy numerosos y cortos, que pueden servir como pelos sexuales para el paso de ADN de una célula a otra Poseen ARN y ribosomas característicos, para la síntesis de proteinas. pared celular es rígida y con moléculas exclusivas de bacterias.

r

2.

El éxito evolutivo de las bacterias se debe en parte a su versatilidad metabólica. Todos los mecanismos posibles de obtención de materia y energía podemos encontrarlos en las bacterias. Según la fuente de carbono que utilizan, los seres vivos se dividen en autótrofos, cuya principal fuente de carbono es el CO2 , y heterótrofos cuando su fuente de carbono es materia orgánica. Por otra parte según la fuente de energía, los seres vivos pueden ser fototrofos, cuya principal fuente de energía es la luz, y los organismos quimiotrofos, cuya fuente de energía es un compuesto químico que se
http://www.arrakis.es/~lluengo/microbio.html (1 of 5)01/08/2004 10:58:57

Nutrición

Microbiología

oxida.

Atendiendo a las anteriores categorías, entre las bacterias podemos encontrar las siguientes formas, como puede apreciarse en el esquema: 1. Las bacterias quimioheterótrofas, utilizan un compuesto químico como fuente de carbono , y a su vez, este mismo compuesto es la fuente de energía. La mayor parte de las bacterias cultivadas en laboratorios y las bacterias patógenas son de este grupo. 2. Las bacterias quimioautótrofas, utilizan compuestos inorgánicos reducidos como fuente de energía y el CO2 como fuente de carbono. Como por ejemplo, Nitrobacter, Thiobacillus. 3. Las bacterias fotoautótrofas, utilizan la luz como fuente de energía y el CO2 como fuente de carbono. Bacterias purpureas. 4. Las bacterias fotoheterótrofas, utilizan la luz como fuente de energía y biomoléculas como fuente de carbono. Ejemplos como Rodospirillum y Cloroflexus.

3. Reproducción

Generalmente las bacterias se reproducen por bipartición, como se ve en el siguiente esquema:

http://www.arrakis.es/~lluengo/microbio.html (2 of 5)01/08/2004 10:58:57

Microbiología

Tras la duplicación del ADN, que esta dirigida por la ADN-polimerasa que se encuentra en los mesosomas, la pared bacteriana crece hasta formar un tabique transversal separador de las dos nuevas bacterias. Pero además de este tipo de reproducción asexual, las bacterias poseen unos mecanismos de reproducción sexual o parasexual, mediante los cuales se intercambian fragmentos de ADN . Puede realizarse por :
r

TRANSFORMACION: Consiste en el intercambio genético producido cuando una bacteria es capaz de captar fragmentos de ADN, de otra bacteria que se encuentran dispersos en el medio donde vive. A continuación puedes verlo es un esquema y en una animación .

http://www.arrakis.es/~lluengo/microbio.html (3 of 5)01/08/2004 10:58:57

Microbiología

r

CONJUGACIÓN: En este proceso, una bacteria donadora F+ transmite a través de un puente o pili, un fragmento de ADN, a otra bacteria receptora F-. La bacteria que se llama F+ posee un plásmido, además del cromosoma bacteriano. Puedes verlo en el esquema siguiente y su correspondiente animación.

http://www.arrakis.es/~lluengo/microbio.html (4 of 5)01/08/2004 10:58:57

Microbiología

r

TRANSDUCCIÓN: En este caso la transferencia de ADN de una bacteria a otra , se realiza a través de un virus bacteriófago, que se comporta como un vector intermediario entre las dos bacterias. También puedes ver el proceso en esquema y animación

http://www.arrakis.es/~lluengo/microbio.html (5 of 5)01/08/2004 10:58:57

Virus

Un virus es un agente genético que posee un ácido nucléico que puede ser ADN o ARN, rodeado de una envuelta de proteína. Los virus contienen toda la información necesaria para su ciclo reproductor; pero necesitan para conseguirlo a otras células vivas de las que utilizan orgánulos y moléculas. Los virus pueden actuar de dos formas distintas: Reproduciéndose en el interior de la célula infectada, utilizando todo el material y la maquinaria de la célula hospedante. q Uniéndose al material genético de la célula en la que se aloja, produciendo cambios genéticos en ella.
q

Por eso se pueden considerar los virus como agentes infecciosos productores de enfermedades o como agentes genéticos que alteran el material el material hereditario de la célula huésped.

REPRODUCCIÓN DE LOS VIRUS
http://www.arrakis.es/~lluengo/virus.html (1 of 4)01/08/2004 10:59:28

Virus

La única función que poseen los virus y que comparten con el resto de los seres vivos es la de reproducirse o generar copias de sí mismos, necesitando utilizar la materia, la energía y la maquinaria de la célula huésped, por lo que se les denomina parásitos obligados. No poseen metabolismo ni organización celular, por lo que se les situa en el límite entre lo vivo y lo inerte. Los virus una vez infectan a una célula,pueden desarrollar dos tipos de comportamiento, bien como agentes infecciosos produciendo la lisis o muerte de la célula o bien como virus atenuados, que añaden material genético a la célula hospedante y por lo tanto resultan agentes de la variabilidad genética. Ambos casos han sido estudiados con detalle en los virus bacteriófagos, y aquí puedes ver en unos dibujos esquemáticos:

En los dos casos de infección el proceso empieza de esta forma: 1. Fase de fijación (a): Los virus se unen por la placa basal a la cubierta de la pared bacteriana. 2. Fase de contracción (b): La cola se contrae y el ácido nucléico del virus se empieza a inyectar. 3. Fase de penetración (c): El ácido nucléico del virus penetra en el citoplasma de la bacteria, y a partir de este momento puede seguir dos ciclos diferentes:

http://www.arrakis.es/~lluengo/virus.html (2 of 4)01/08/2004 10:59:28

Virus

1. En el ciclo lítico el ADN bacteriano fabrica las proteínas víricas y copias de ácidos nucléicos víricos. Cuando hay suficiente cantidad de estas moléculas, se produce el ensamblaje de la proteína y el A.N. vírico y se liberan al medio, produciendo la muerte de la célula. 2. En el ciclo lisogénico se produce cuando el genoma del virus queda integrado en el genoma de la bacteria, no expresa sus genes y se replica junto al de la bacteria. El virus queda en forma de profago.

Y en esta secuencia animada, puedes ver a un virus en acción...

http://www.arrakis.es/~lluengo/virus.html (3 of 4)01/08/2004 10:59:28

Virus

http://www.arrakis.es/~lluengo/virus.html (4 of 4)01/08/2004 10:59:28

Formas acelulares

Cuando todavía no nos han revelado los virus toda su información, aparecen en el mundo microscópico otras formas acelulares de menor tamaño, capaces de causar enfermedades. Estas formas son los viroides y los priones. 1. Viroides Son moléculas de ARN circular que carecen de cualquier protección 3. Priones. Son agentes patógenos formados por una proteína ( proteína del prión o PPr ) Producen entre otras, la enfermedad de las "vacas locas" o encefalopatía bovina espongiforme. Esta proteína se acumula en el cerebro de animales enfermos , dando lugar a la estructura esponjosa de la corteza cerebral que da nombre a la enfermedad. Los priones, o las enfermedades producidas por priones, tienen un comportamiento sorprendente, por un lado se transmiten verticalmente , como cualquier enfermedad hereditaria típica, mientras que por otro lado se comportan de manera infectiva, transmitiéndose horizontalmente, mediante contagios que pueden darse entre individuos de distintas especies. La proteína del prión (PrP) normal, tiene una secuencia de aminoácidos, (estructura primaria) idéntica a la proteína del prión patógena. La diferencia entre las dos recae en la estructuras secundaria y terciaria ,

Proteína del prión normal

Proteína del prión patógena Proteína patógena infectando a una normal

La proteína normal es muy rica en hélices alfa, la proteína patógena lo es en láminas beta.

http://www.arrakis.es/~lluengo/acelular.html (1 of 3)01/08/2004 11:00:05

Formas acelulares

Estructura terciaria de la proteína del prión Estructura secundaria en hélice y lámina Este cambio de configuración es crucial, ya que las proteínas con láminas beta son muy resistentes a las enzimas proteolíticas, al calor y no se disuelven en agua. Pero sobre todo, la proteína alterada tiene una característica única: interacciona con una molecula de proteína normal, le cambia la conformación y la hace capaz de convertir las estructuras de más proteínas normales. Ahí radica al parecer, el poder infectivo de los priones. En el esquema siguiente se intenta explicar este proceso.

Puede ocurrir que la proteína patógena infecte individuos que producen proteína normal (a), como ha ocurrido por ejemplo al consumir las vacas
http://www.arrakis.es/~lluengo/acelular.html (2 of 3)01/08/2004 11:00:05

Formas acelulares

piensos elaborados a partir de de ovejas enfermas. En este caso la proteína patógena origina un cambio conformacional de la proteína normal (b), transformando las hélices alfa de su estructura proteíca en láminas beta. Las nuevas proteínas patógenas inducen el cambio en otras normales, lo cual produce un efecto de "cascada".

http://www.arrakis.es/~lluengo/acelular.html (3 of 3)01/08/2004 11:00:05

Inmunología

EL CONCEPTO DE INMUNIDAD :
En la lucha por la existencia, los organismos están expuestos a una legión de invasores que son los microorganismos como virus, bacterias, protozoos, hongos o las moléculas producidas por ellos. Para impedir los efectos tóxicos de ellos, los animales han desarrollado a lo largo de la evolución una serie de mecanismos de defensas, y de ellos el más sofisticado es el sistema inmunitario.

1. Defensas inespecíficas r Barreras externas s Piel s Mucosas s Secreciones r Células fagocitarias s Micrófagos s Macrófagos 2. Defensas específicas r La respuesta humoral s Antígeno y anticuerpo s La reacción antígeno-anticuerpo r La respuesta celular s Tipos de células del sistema s Mecanismo de acción s Comunicación entre las células del sistema

Defensas inespecíficas
Dentro de este apartado, se incluyen aquellas defensas del organismo, cuya respuesta es la misma, con independencia del tipo de microorganismo que intenta colonizarnos. Barreras externas: Para invadir el cuerpo de los animales, los microorganismos deben atravesar su piel o bien penetrar por alguno de sus orificios naturales. La piel de los mamíferos es una barrera mecánica gracias a su grosor, al proceso de queratinización y a la descamación de las capas externas. Figura 1. Estructura esquemática de las barreras defensivas primarias

http://www.arrakis.es/~lluengo/inmunologia.html (1 of 9)01/08/2004 11:01:26

Inmunología

Además la secreción de las glándulas sebáceas y el sudor determinan la existencia de un pH ácido. Por añadido, la flora bacteriana de la piel impide el asentamiento y desarrollo de otros microbios que se depositan sobre ella. En las aberturas naturales, como boca, ano, vías respiratorias, urogenitales y digestivas, las barreras defensivas son las secreciones mucosas que recubren los epitelios. En la saliva, en la secreción lacrimal y en la secreción nasal, existe una enzima, la lisozima; en el esperma la espermina, ambas con función bactericida. La secreción ácida del epitelio vaginal y de los conductos digestivos, forman un ambiente desfavorable para el desarrollo de microorganismos. En las mucosass respiratorias, los microbios y las partículas extrañas quedan atrapados en el mucus y son eliminados mediante el movimiento ciliar de las células epiteliales, por la tos y el estornudo. La piel y todas estas secreciones reciben el nombre de barreras defensivas primarias. (Figura 1).
Principio de página

Células fagocitarias
Los fagocitos son células con capacidad fagocitaria, que pueden destruir sustancias extrañas y células envejecidas, a las que engloban con sus pseudópodos para luego digerirlas en el citoplasma.

http://www.arrakis.es/~lluengo/inmunologia.html (2 of 9)01/08/2004 11:01:26

Inmunología

1. Los neutrófilos, denominados micrófagos, son los más abundantes y los que presentan mayor actividad fagocitaria. Acuden al lugar de la infección atravesando la pared de los capilares sanguíneos (diapédesis), para llegar a los tejidos y fagocitar a los gérmenes patógenos.
Los neutrófilos realizan un proceso de heterofagia que les causa la muerte, como expresa De Duve ( La célula viva, Ed. Labor )" Los leucocitos están creados de tal manera que sólo una vez en la vida les está permitido comer opíparamente. Se fabrican en la médula ósea, y de ella salen, cargados de enzimas lisosómicas y de otras armas mortíferas, en busca de enemigos. Cuando los encuentran, devoran tantos como pueden. Poco después mueren a consecuencia de esta jugarreta de la selección natural, que les lleva a cometer semejante acto de gula, fatal para ellos; pero destinado aun bien superior, el de todo el organismo." El resultado de esta batalla origina el pus, que no es más que el montón de cadáveres de bacterias y fagocitos.

2. Los macrófagos, procedentes de los monocitos de la sangre, emigran a los distintos tejidos recibiendo diversos nombres. La reserva de macrófagos constituye el sistema retículo endotelial (S.R.E.), interviene en la defensa, destrucción de células viejas y regeneración de los tejidos. Se trata de un conjunto de células, que en cierto modo, dirigen la complicada red de procesos encaminados a eliminar la infección y regenerar los tejidos dañados, para ello liberan interleucinas 1 , que se comporta como un mensajero inmunitario y ejerce su acción sobre la totalidad del organismo.
Principio de página

Defensas específicas
Las defensas específicas se basan en el reconocimiento de los determinantes antigénicos localizados en la superficie del germen patógeno oo en las toxinas producidas por éstos. Una vez que el sistema inmunitario reconoce la naturaleza del antígeno, lanza contra él dos tipos de respuestas, que actúan de modo secuencial: 1. La respuesta humoral, basada en la síntesis de anticuerpos por los linfocitos B 2. La respuesta celular , mediada por linfocitos T, que destruyen los microorganismos portadores de dicho antígeno, y las células propias si están infectadas pro ellos.
http://www.arrakis.es/~lluengo/inmunologia.html (3 of 9)01/08/2004 11:01:26

Inmunología

La respuesta humoral. En el plasma sanguíneo , se encuentran un tipo particular de globulinas que tienen la capacidad de de reaccionar específicamente con las partículas extrañas ( antígenos ), anulando su posible efecto patógeno. Se las denomina genéricamente inmunoglobulinas o anticuerpos.

Antígeno y anticuerpo

Así se denomina antígeno a cualquier sustancia extraña que, introducida en el interior de un organismo, provoque una respuesta inmunitaria, estimulando la producción de anticuerpos.

Los anticuerpos son proteínas pertenecientes al grupo de las gamma-globulinas o inmunoglobulinas, constituidas por la asociación de cuatro cadenas polipeptídicas unidas entre sí mediante puentes disulfuro, dos cadenas se denominan pesadas y las otras dos ligeras. A su vez, cada una de las cadenas ligeras y pesadas, incluye una región variable, cuya secuencia de aminoácidos es peculiar de cada anticuerpo, y una región constante, con la misma secuencia en todos los anticuerpos.

La unión antígeno-anticuerpo es específica, cada anticuerpo reconoce y se une a un determinado antígeno. Esta unión se realiza por medio de uniones intermoleculares entre el antígeno y la zona del anticuerpo, y da lugar al complejo antígeno-anticuerpo según el modelo llave-cerradura. Las reacciones antígeno-anticuerpo tienen diversas consecuencias y existen varios tipos de reacciones:

La reacción antígeno-anticuerpo.

http://www.arrakis.es/~lluengo/inmunologia.html (4 of 9)01/08/2004 11:01:26

Inmunología

En este caso el antígeno se encuentra disuelto, y al unirse los anticuerpos a los antígenos se forman unos macrocomplejos moleculares, formándose como una red tridimensional que debido a su tamaño precipita.

En las reacciones de aglutinación, un anticuerpo puede unirse a la vez a dos antígenos, asímismo cada antígeno puede unirse a varios anticuerpos y formar un entramado de complejos antígeno-anticuerpo.

http://www.arrakis.es/~lluengo/inmunologia.html (5 of 9)01/08/2004 11:01:26

Inmunología

Si el antígeno es una sustancia tóxica, la unión con el anticuerpo provoca su neutralización, de modo que no puede ejercer su efecto tóxico.

http://www.arrakis.es/~lluengo/inmunologia.html (6 of 9)01/08/2004 11:01:26

Inmunología

El anticuerpo puede recubrir al antígeno para que sea reconocido por los fagocitos, esta reacción se llama opsonización , y es como si los antígenos fueran más "sabrosos" para ser fagocitados.

Principio de página

Respuesta celular
1. Tipos de células del sistema. Las células plasmáticas se forman en la médula roja de los huesos y trás un proceso de diferenciación , pasan a la sangre. Uno de estos tipos de células son los linfocitos. Algunos adquieren sus propiedades en la misma médula ósea: son los linfocitos B. Otros van a especializarse al timo, una glándula situada entre la tráquea y el esternón: son los linfocitos T. FORMACIÓN MADURACIÓN ALMACENAMIENTO Órganos secundarios Circulatorio Órganos linfáticos, bazo, amígdalas, apéndice, p. Peyer DISTRIBUCIÓN

Órganos primarios Medula ósea M. ósea: linfocitos B

http://www.arrakis.es/~lluengo/inmunologia.html (7 of 9)01/08/2004 11:01:26

Inmunología

Timo

Timo: linfocitos T

Linfático

Finalizado el proceso de especialización, los linfocitos B y T pasan a los ganglios, al bazo y a los demás órganos linfoides y algunos de ellos se incorporan a la corriente sanguínea, donde permanecen a la espera de entrar en contacto con los antígenos. 2. Mecanismo de acción. Cuando se detecta la presencia de un antígeno, un macrófago lo fagocita y lo transporta a los ganglios linfáticos. Allí presenta fragmentos del antígeno a los linfocitos T, que produce la formación de linfocitos T citotóxicos, que pueden destruir directamente las células infectadas , y de linfocitos T auxiliares, que facilitan el desarrollo de los linfocitos B.

Los linfocitos T citotóxicos presentan en su superficie unas moléculas receptoras semejantes a los anticuerpos, mediante las cuales se unen específicamente a los antígenos de la membrana de las células. El linfocito inyecta sus enzimas en el interior de la célula y provoca
http://www.arrakis.es/~lluengo/inmunologia.html (8 of 9)01/08/2004 11:01:26

Inmunología

su degradación. Este tipo de linfocitos es el responsable del rechazo en los transplantes de tejidos. Los linfocitos B se activan ante la presencia del antígeno y se encargan de elaborar un anticuerpo específico. Sin embargo, no empiezan a producir este anticuerpo hasta que no reciben la "señal" de los linfocitos T auxiliares. Finalmente, superada la infección, otro tipo de linfocitos T supresores se encargan de detener las reacciones inmunitarias. 3. Comunicación entre las células del sistema Ante la presencia del antígeno, los linfocitos T auxiliares responden segregando una serie de mediadores, las interleucinas o interleuquinas que activan otros glóbulos blancos ( macrófagos y linfocitos ). Las mejor conocidas son las interleucinas 1 y 2 (IL-1, IL-2 en el esquema). La interleucina 1 actúa como mediador soluble en el proceso de inflamación y como factor de crecimiento y diferenciación de las células B. La interleucina 2 es el factor de crecimiento y diferenciación de las células T.
Principio de página

http://www.arrakis.es/~lluengo/inmunologia.html (9 of 9)01/08/2004 11:01:26

Actividades microbiología

Nivel de dificultad de los ejercicios

sencillos

medios

avanzados

1. 2. 3. 4.

?Qué quiere decir la palabra "microbio"?. ?Qué tipos de microbios has estudiado?. ?Qué seres vivos pertenecen al reino Monera?. ?Qué seres unicelulares conoces?. Indica alguno de ellos que sean perjudiciales para el hombre o para la biosfera y otros que sean beneficiosos. ?Por qué no se incluyen los virus en ningún Reino?. ?Qué grupos de microbios pueden producir enfermedades en un ser vivo?. ?En qué grupo de microbios existen organismos autótrofos?. Definir los siguientes términos: fimbrias, prión, bacteria fermentadora, bacteriófago, transcriptasa inversa, transformación bacteriana. Los microorganismos constituyen un conjunto muy heterogéneo desde el punto de vista taxonómico: r Cita dos que presenten una organización procariota. r Menciona otras dos cuya organización sea eucariota. r Cita dos que tengan una organización vírica. r Partiendo de uno de los tres apartados anteriores, indica la forma de vida de los dos ejemplos, señalando en cada caso si es inocua, beneficiosa o perjudicial para los seres humanos u otros seres vivos.

5. 6. 7. 8.

9.

http://www.arrakis.es/~lluengo/actimicr.html (1 of 6)01/08/2004 11:01:36

Actividades microbiología

10.

En el año 1928, Alexander Fleming advirtió " de forma casual" que el moho que había contaminado un cultivo de estafilococos había hecho desaparecer a su alrededor las colonias bacterianas. Esta observación fue el punto de partida de las investigaciones que, con los años, demostrarían que el moho del género Penicillium segrega una sustancia destructora de las bacterias patógenas. ( El azar sólo favorece a los espíritus preparados, Pasteur ). r Desde el punto de vista de la investigación, comenta brevemente el significado de la frase de Pasteur. r Di el significado de estos términos: moho, estafilococo y bacteria patógena r ?Qué es un cultivo de microorganismos ?. ?Cómo se realiza?. r ?Cuáles son las principales aportaciones de Pasteur a la ciencia?. ?En qué época vivió ?. Para llevar a cabo el estudio y la clasificación de los microbios se utilizan diversas tecnicas : r Enumera las más importantes. r Explica dos de ellas r Indica la forma de vida de los microorganismos saprófitos. En el laboratorio se realiza un cultivo a 37:C de Escherichia coli que se inicia a partir de 2ml de una solución con 105 células/ml. Si a la temperatura indicada las bacterias se dividen cada 20 minutos, determinar el número de bacterias del cultivo al cabo de 20 minutos, de 40 minutos, de 80 minutos y 2 horas. Representar gráficamente los resultados. En el proceso de la respiración las bacterias usan diferentes sustancias como aceptores finales de electrones. Identificar las categorías metabólicas o los géneros de bacterias que realizan las siguientes transformaciones químicas durante la respiración: 14. 15. 16. 17. 18. ión sulfato a.... ión sulfuro nitrógeno molecular a....amoníaco etanol (vino) a....ácido acético (vinagre) dióxido de carbono a....metano oxígeno molecular a....agua

11.

12.

13.

19.

En la gráfica siguiente se representa la evolución de un cultivo bacteriano estándar. Compararla con los resultados obtenidos en el ejercicio 12 y predecir el comportamiento de aquel cultivo. Proponer una explicación de la fase estacionaria que sucede a la fase de crecimiento en todo cultivo de bacterias en el laboratorio.

http://www.arrakis.es/~lluengo/actimicr.html (2 of 6)01/08/2004 11:01:36

Actividades microbiología

20. 21.

Define los siguientes términos: opsonización, vacunación, alergia, neutralización, aglutinación, antígeno. Durante mucho tiempo se postuló la existencia de otro tipo celular que intervendría en los fenómenos inmunitarios: los linfocitos T supresores, o Ts. Las funciones de dichos linfocitos serían las siguientes: r Neutralizar la acción de los linfocitos Ta, Tc y B que hubieran sido activados contra células del propio organismo durante su maduración. r Neutralizar la acción de las células plasmáticas que elaboran anticuerpos, contra una infección que ya ha sido superada. r Neutralizar la acción de los mastocitos y granulocitos basófilos cuando han sido neutralizados los antígenos que provocaron su acción. Sin embargo, nunca se ha llegado a aislar e identificar a ningún tipo celular con estas funciones, y en cambio, los tres fenómenos antes descritos han sido explicados de otras maneras más satisfactorias. Repasando lo aprendido sobre la actuación de todos los tipos de células inmunitarias, explica detenidamente cómo se llevan a cabo las tres acciones antes referidas.

22.

?Por qué los linfocitos T y B necesitan la cooperación de los macrófagos para desempeñar sus funciones. De qué manera potencian los linfocitos T la acción de los macrófagos?. Indica los distintos tipos de inmunoglobulinas y explica a qué se debe su especificidad respecto al antígeno.

23.

http://www.arrakis.es/~lluengo/actimicr.html (3 of 6)01/08/2004 11:01:36

Actividades microbiología

24. 25. 26.

?A qué se llama memoria inmunológica?. ? A qué se debe este fenómeno?. A partir del conocimiento de las células que infecta el VIH, explica los síntomas de la enfermedad ( infecciones oportunistas y desarrollo de tumores). Los García son una familia compuesta por el padre, Pedro, que es hemofílico y padece el sida.; la madre Elena, es seropositiva; una hija de 6 años, Miriam, no está infectada y un hijo Sergio de 15 meses, también tiene el sida. Formula una hipótesis y razónala, acerca de cómo pudo infectarse cada uno de los miembros de la familia.

27.

Indica cuatro situaciones de riesgo que hay que evitar para prevenir el contagio del VIH y otras cuatro en las que, a pesar de algunos prejuicios, no hay riesgo de contagio. Uno de los problemas más graves del trasplante de órganos es el rechazo del órgano trasplantado. r Explica este fenómeno desde el punto de vista bioquímico. r Relaciónalo con alguna de las características de las proteínas. r ?Por qué el riesgo de rechazo disminuye con la consanguinidad?: Una mujer a la que se detectó un cáncer de mama, fue sometida a cirugía, quimioterapia, radioterapia y, al cabo de cierto tiempo, un trasplante de médula. ? Podrías explicar para qué fueron necesarios los distintos tratamientos?: ?Por qué los quemados corren más riesgos de infecciones?. Describe el proceso de aglutinación en las transfusiones de sangre. ?Qué es un choque anafiláctico?. ?Por qué se dice que la respuesta de los linfocitos B es humoral y la de los linfocitos T es celular?. Con la información que se encuentra en el tema de Inmunología, rellena el siguiente cuadro:

28.

29.

30. 31. 32. 33. 34.

http://www.arrakis.es/~lluengo/actimicr.html (4 of 6)01/08/2004 11:01:36

Actividades microbiología

Células

Función

Defensa inmunitaria (humoral/celular) o inespecífica

Neutrófilos Linfocitos citotóxicos Plaquetas Macrófagos Células asesinas Células plasmáticas Eritrocitos 35. 36. 37. ?En qué consiste el fenómeno de la autoinmunidad?. ?A qué tipos de inmunidad corresponden la vacunación y la sueroterapia?. Define qué es un antígeno. ?Qué moléculas pueden desempeñar la función de antígeno?. ?Qué características de la piel hacen que sea una importante barrera defesiva?.

38.

q

q

q

http://www.arrakis.es/~lluengo/actimicr.html (5 of 6)01/08/2004 11:01:36

Actividades microbiología

http://www.arrakis.es/~lluengo/actimicr.html (6 of 6)01/08/2004 11:01:36

Untitled

q q

Herencia de un carácter Herencia de dos caracteres

Herencia de un carácter
Razona la veracidad o falsedad de la siguiente afirmación: El color de tipo común del cuerpo de la Drosophila está determinado por el gen dominante "N", su alelo recesivo "n" produce cuerpo de color negro. Cuando una mosca tipo común de raza pura se cruza con otra de cuerpo negro, ? la fracción de la segunda generación que se espera sea heterocigótica es 1/2 ?.

1.

2.

En el hombre el color pardo de los ojos "A" domina sobre el color azul "a". Una pareja en la que el hombre tiene los ojos pardos y la mujer ojos azules tienen dos hijos, uno de ellos de ojos pardos y otro de ojos azules. Averiguar: r El genotipo del padre r La probabilidad de que el tercer hijo sea de ojos azules.

3.

Como Mendel descubrió, las semillas de color amarillo en los guisantes son dominantes sobre los de color verde. En los experimentos siguientes, padres con fenotipos conocidos pero genotipos desconocidos produjeron la siguiente descendencia: Parentales A. amarillo x verde B. amarillo x amarillo C. verde x verde D. amarillo x verde Amarillo Verde 82 118 0 74 78 39 50 0 0

E. amarillo x amarillo 90
r r

Dar los genotipos más probables de cada parental En los cruces B, D, E, indíquese qué proporción de la descendencia amarilla

http://www.arrakis.es/~lluengo/actimend.html (1 of 12)01/08/2004 11:02:00

Untitled

producida en cada uno de ellos se esperaría que produjera descendientes verdes por autopolinización.

4.

La acondroplasia es una anomalía determinada por un gen autosómico que da lugar a un tipo de enanismo en la especie humana. Dos enanos acondroplásicos tienen dos hijos, uno acondroplásico y otro normal. r La acondroplasia, ?es un carácter dominante o recesivo ?. ? Por qué ?. r ? Cuál es el genotipo de cada uno de los progenitores ? ? Por qué ?. r ? Cuál es la probabilidad de que el próximo descendiente de la pareja sea normal ?. ? Y de qué sea acondroplásico ?. Hacer un esquema del cruzamiento.

5.

La fenilcetonuria (FCU) es un desorden metabólico que se hereda con carácter autosómico recesivo. Dos progenitores sanos tienen un hijo con FCU. r Indica los fenotipos y genotipos de todos los apareamientos que teóricamente pueden dar un descendiente afectado de FCU. r ? A cuál de estos tipos de apareamiento pertenece el caso descrito ?. r ? Cuál es la probabilidad de que el siguiente hijo padezca también la enfermedad ?. r ? Cuál será la probabilidad de qué un hijo normal (sano) de estos padres sea portador heterocigótico para FCU ?.

6.

La ausencia de patas en las reses se debe a un gen letal recesivo. Del apareamiento entre un toro y una vaca, ambos híbridos, ? qué proporciones genotípicas se esperan en la F2 adulta?. Los becerros amputados mueren al nacer.

7.

El albinismo es un carácter recesivo con respecto a la pigmentación normal. ? Cuál sería la descendencia de un hombre albino en los siguientes casos?: r Si se casa con una mujer sin antecedentes familiares de albinismo. r Si se casa con una mujer normal cuya madre era albina. r Si se casa con una prima hermana de pigmentación normal pero cuyos abuelos comunes eran albinos.

8.

Dos plantas de dondiego (Mirabilis jalapa) son homocigóticas para el color de las flores. Una de ellas produce flores de color blanco marfil y la otra, flores rojas. Señale los genotipos y fenotipos de los dondiegos originados del cruce de ambas plantas, sabiendo que "B" es el gen responsable del color marfil, "R" es el gen que condiciona el color rojo y que los genes R y B son equipotentes ( herencia intermedia).

http://www.arrakis.es/~lluengo/actimend.html (2 of 12)01/08/2004 11:02:00

Untitled

9.

? Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo?. Razonar la respuesta.

Principio de página

Herencia de dos caracteres
El pelo oscuro y el color marrón de los ojos se consideran dominantes sobre el pelo claro y ojos azules. Un varón de estas características tiene dos hijos con una mujer de pelo claro y ojos azules; uno de los hijos tiene pelo claro y ojos marrones, y el otro ojos azules y pelo oscuro. r ? Cuál es la probabilidad de que un tercer hijo tenga el pelo claro y los ojos marrones?. Razonar la respuesta.

1.

2.

En el tomate, el color púrpura del tallo está determinado por un alelo autosómico dominante "A". El alelo recesivo "a" determina tallo de color verde. Otro gen autosómico independiente controla la forma de la hoja: el alelo dominante "C" determina hoja con borde recortado y el alelo recesivo "c" determina hoja con borde entero. En la siguiente tabla se indican los resultados en tres cruces entre plantas de fenotipos diferentes. En cada caso, indique cuáles son los genotipos de los progenitores y por qué. Fenotipos de los progenitores púrpura/recortada Púrpura/entera Verde/recortada Verde/entera púrpura, recortada x verde, recortada púrpura, recortada x púrpura recortada púrpura, recortada x verde, recortada 321 144 722 101 48 231 310 50 0 107 18 0

3.

En las plantas de guisante, el alelo "L", que indica semillas lisas, es dominante sobre el alelo "l", que indica semillas rugosas, y el alelo "A" que indica color amarillo, es dominante sobre el alelo "a" , que indica color verde. Si se cruza una variedad pura lisa de color amarillo con una variedad pura rugosa de color verde,

http://www.arrakis.es/~lluengo/actimend.html (3 of 12)01/08/2004 11:02:00

Untitled
r r

?cuál es el genotipo y el fenotipo de la primera generación filial (F1) ?. Indicar los fenotipos de la segunda generación (F2) y la proporción de cada uno de ellos que resulta de la autofecundación de las plantas de la F1.

4.

Los pollos con alas y patas recortadas reciben el nombre de trepadores. El apareamiento de este tipo de pollos con aves normales da lugar a una descendencia equilibrada entre pollos normales y trepadores. El apareamiento de pollos trepadores entre sí produce una descendencia formada por dos pollos trepadores y uno normal. El cruzamiento entre pollos normales da lugar a una progenie uniforme formada exclusivamente por aves normales. Explicar el fenómeno de forma razonada.

5.

En el guisante, los caracteres tallo largo y flor roja dominan sobre tallo enano y flor blanca. ? Cuál será la proporción de plantas doble homocigóticas que cabe esperar en la F2 obtenida a partir de un cruzamiento entre dos líneas puras, una de tallo largo y flor blanca con otra de tallo enano y flor roja ?. Indicar el genotipo de todas las plantas homocigóticas que pueden aparecer en la F2. Razonar la respuesta.

6.

El color rojo de la pulpa del tomate depende de la presecia del factor R, dominante sobre su alelo r para el amarillo. El enanismo se debe a un gen recesivo d. Se dispone de una variedad homocigótica de pulpa amarilla y tamaño normal y otra enana de pulpa roja. r ? Podría obtenerse a partir de las variedades disponibles, una variedad homocigótica de pulpa roja y tamaño normal ? r ? Y una variedad de pulpa amarilla y de porte enano ?. Razónese la respuesta.

7.

La miopía es debida a un gen dominante, al igual que el fenotipo Rh+. Una mujer de visión normal Rh+, hija de un hombre Rh-, tiene descendencia con un varón miope heterocigoto y Rh-. Establézcanse los previsibles genotipos y fenotipos de los hijos de la pareja.

8.

La enfermedad de Tay-Sachs es una enfermedad hereditaria recesiva que causa la muerte en los primeros años de vida cuando se encuentra en condición homocigótica. Se piensa que los dedos anormalmente cortos, braquifalangia,se deben al genotipo heterocigótico para un gen letal, siendo normal el individuo BB. ? Cuáles son los fenotipos esperados entre niños adolescentes hijos de padres braquifalángicos y heterocigóticos para la enfermedad de Tay-Sachs ?.

http://www.arrakis.es/~lluengo/actimend.html (4 of 12)01/08/2004 11:02:00

Untitled

9.

Dos condiciones anormales en el hombre, que son las cataratas y la fragilidad de huesos son debidas a alelos dominantes. Un hombre con cataratas y huesos normales cuyo padre tenía ojos normales, se casó con una mujer sin cataratas pero con huesos frágiles, cuyo padre tenía huesos normales. ?Cuál es la probabilidad de ?: r Tener un hijo completamente normal r Que tenga cataratas y huesos normales r Que tenga ojos normales y huesos frágiles r Que padezca ambas enfermedades.

10.

Los ratones gordos se pueden producir por dos genes independientes. El genotipo "oo" genera un ratón gordo y estéril, llamado obeso; su alelo dominante "O" da lugar a crecimiento normal. El genotipo recesivo "aa" también produce un ratón gordo y estéril llamado adiposo, mientras que su alelo dominante ocasiona crecimiento normal. ? Qué proporciones fenotípicas de ratones gordos frente a normales podemos esperar en F1, siendo los padres de genotipo OoAa.

Principio de página

q

ALELOS MÚLTIPLES. PROBLEMAS DE SERIES ALÉLICAS.

q

Alelos múltiples
Hasta ahora, en todos los casos vistos, un gen tenía dos formas diferentes de expresarse; pero puede ocurrir que un mismo gen tenga múltiples formas de presentarse, en cuyo caso decimos que tenemos una serie de alelos múltiples. En estos casos, ha de establecerse la jerarquía de dominancia de unos alelos sobre otros. Los alelos múltiples más conocidos dentro de la especie humana son los de los grupos sanguíneos AB0. Existen tres formas alélicas, representadas por los alelos "A", "B", "0". Los alelos A y B son codominantes entre sí y su característica principal es que cada uno de ellos codifica la síntesis de una proteína específica que se localiza en la superficie de los glóbulos rojos; son el antígeno A y el antígeno B. La forma alélica 0 es recesiva con respecto a los alelos A y B y a su vez no produce ningún antígeno. La jerarquía de dominancia en este caso es :

A = B > 0
http://www.arrakis.es/~lluengo/actimend.html (5 of 12)01/08/2004 11:02:00

Untitled

Genotipo

AA, A0

BB, B0 B

AB 00 AB 0

Fenotipo A
Principio de página

Problemas de series alélicas
1. Si un hombre de grupo sanguíneo AB se casa con una mujer de grupo A, cuyo padre era de grupo 0. ? Qué grupos sanguíneos se puede esperar entre sus hijos y con qué frecuencia ?.

2.

Un hombre de grupo sanguíneo A y una mujer de grupo sanguíneo B tienen cuatro hijos, de los cuales, uno pertenece al grupo AB, otro al 0, otro al B, y otro al A. Señalar razonanadamente el genotipo de los padres.

3.

La herencia del color de la piel en las reses, está determinado por una serie de alelos múltiples, con la siguiente jerarquía de dominancia:

S > sh > sc > s
El alelo "S" determina una banda de color blanco alrededor del cuerpo que se denomina cinturón holandés. El alelo "sh" produce manchas tipo Hereford, , el color sólido es el resultado del alelo "sc" y las manchas tipo Holstein, están producidas, están producidas por el alelo "s". Machos con cinturón holandés, homocigóticos son cruzados con hembras tipo Holstein. Las hembras de la F1 son cruzadas con machos tipo Hereford de genotipo "sh sc". Predecir las frecuencias genotípicas y fenotípicas de la descendencia.

4.

Una serie de alelos múltiples gobierna la intensidad de la pigmentación en el ratón. D= color completo, d= color diluído y dl= es letal en homocigosis. El orden de dominancia es :

D > d > dl
http://www.arrakis.es/~lluengo/actimend.html (6 of 12)01/08/2004 11:02:00

Untitled

Un ratón de color completo portador del gen letal es apareado con un individuo de color diluído también portador del gen letal. La F1 es cruzada con el padre diluído: r ?Qué proporción fenotípica puede esperarse de la descendencia viable ? r ? Qué porcentaje de la descendencia con color completo es portadora del gen letal ?. r ? Qué porcentaje de la descendencia con color diluído lleva el gen letal ?

5.

El color de la concha de un molusco está controlado por una serie alélica que determina los siguientes fenotipos: marrón, rosa, amarillo intenso y amarillo pálido. Se hicieron cruzamientos entre varias razas puras, obteniendo la siguiente descendencia: PARENTALES rosa x a. intenso rosa x a. pálido a. intenso x a. pálido marrón x rosa marrón x a. pálido
r r

F1 ROSA ROSA A. INTENSO ROSA MARRÓN

Interpretar los resultados Se puso a aparear un individuo de color amarillo intenso con otros dos, uno de fenotipo amarillo intenso y otro rosa El individuo amarillo intenso deja 16 descendientes que son. 4 amarillo intenso, 8 rosa, 4 amarillo pálido Suponiendo que sólo uno de los otros dos individuos actuó como padre, s ? cuál será su fenotipo ? s ? Qué genotipos presentan el padre, la madre y los descendientes?. .

6.

El sistema de grupos sanguíneos AB0, está determinado por tres alelos A, B, 0. 1. Indicar las proporciones fenotípicas que se espera en la descendencia de los cruzamientos siguientes: s AA x AB s AA x B0 s AA x A0 s A0 x A0

http://www.arrakis.es/~lluengo/actimend.html (7 of 12)01/08/2004 11:02:00

Untitled

A0 x AB 2. En una clínica se mezclan por error 4 recién nacidos. Los grupos sanguíneos de estos niños son : 0, A, B, AB. Los grupos sanguíneos de las cuatro parejas de padres son : s AB x 0 s A x 0 s A x AB s 0 x0 Indicar qué niño corresponde a cada pareja.
s

7.

En la familia de la ilustración se indican los grupos sanguíneos de cada individuo ( los hombres se representan con un cuadrado y las mujeres con un círculo ). Uno de los miembros de la genealogía tiene un grupo sanguíneo no explicable en base al tipo de herencia del carácter. Indicar de qué persona se trata. Indicar cuál de estas dos explicaciones es la más probable: r La persona en cuestión es hijo/hija extramatrimonial de la persona que figura como su madre en la genealogía. r Hubo una confusión (cambio de niño/a) en la clínica en que nació esta persona. La persona señalada con una flecha se casa con un hombre que tiene un grupo sanguíneoo AB. Determine qué grupos sanguíneos pueden tener sus hijos, así como la probabilidad de cada uno de ellos.

1.

La hemofilia es un carácter ligado al sexo. Si una mujer normal, cuyo padre era hemofílico , se casa con un varón normal. ?Qué proporción de la descendencia tendrá el gen para la hemofilia?.

http://www.arrakis.es/~lluengo/actimend.html (8 of 12)01/08/2004 11:02:00

Untitled

2.

Una pareja en la que la visión de ambos es normal, tienen cuatro hijos. En ellos y en sus descendientes se aprecian las siguientes características: r Una hija con visión normal, que tiene un hijo normal y un hijo y una hija daltónica. r Una hija con visión normal, con tres hijas y dos hijos normales r Un hijo daltónico, con dos hijas normales. r Un hijo normal, con dos hijos y dos hijas normales. Constituye la genealogía de esta familia e indica en cada caso los genotipos probables.

3.

En las plantas, la determinación del sexo es similar a la del hombre. Se sabe que un gen ligado "l" es letal en las hembras homocigóticas. Cuando se encuentra en los machos de lugar a manchas de color amarillo-verde. El alelo dominante "L" produce color verde oscuro normal. Del cruce entre hembras heterocigóticas y machos amarillo-verde, predecir las proporciones fenotípicas esperadas en la descendencia.

4.

Consideremos simultáneamente dos caracteres influídos por el sexo; la calvicie y el dedo índice corto. Ambos caracteres se manifiestan como dominantes en el hombre y recesivo en la mujer. Un hombre heterocigótico para la calvicie y con el dedo índice normal se casa con una mujer calva y heterocigótica para el carácter de longitud de dedo. ?Qué descendencia se espera?.

5.

Se cruzó una hembra heterocigótica para los genes recesivos "a" y "b", con un macho de fenotipo Ab. En la descendencia, el 50% de las hembras eran de fenotipo AB y el otro 50% presentaban fenotipo Ab. En los machos, aparecía el 25% de cada uno de los fenotipos AB, Ab, aB, ab. Explicar el tipo de herencia.

6.

Un gen recesivo ligado al sexo, produce en el hombre ceguera a los colores en estado hemicigótico y ceguera a los colores a las mujeres homocigóticas. Un gen influído por el sexo determina calvicie y es dominante en hombres y recesivo en mujeres.

http://www.arrakis.es/~lluengo/actimend.html (9 of 12)01/08/2004 11:02:00

Untitled

Un hombre heterocigótico calvo y con ceguera a los colores se casa con una mujer sin calvicie y con visión normal, cuyo padre no era calvo ni ciego a los colores y cuya madre era calva y con visión normal. Expectaciones de los fenotipos en los descendientes.

7.

Un gen recesivo ligado al sexo (e) causa esterilidad en los machos. A la vista del pedigrí, responder a las siguientes preguntas:

r r r

?Cuál es la probabilidad de que II1 x II2 tengan otro hijo macho normal ? ?Cuál es la probabilidad de que II3 x II4 tengan una hija normal ? ?Cuál es la probabilidad de qué II5 x II6 tengan una hija portadora?

8.

En el siguiente árbol genealógico, los cuadros rojos representan a personas afectadas de hemofilia, enfermedad determinada por un alelo recesivo ligado al sexo.

http://www.arrakis.es/~lluengo/actimend.html (10 of 12)01/08/2004 11:02:00

Untitled

r

r

Si la mujer II2 tuviese dos hijos varones, ? cuál sería la probabilidad de que ninguno fuera hemofílico ?. ? Cuál es la probabilidad de qué el primer hijo varón de la pareja II4 y II5 sea hemofílicoo ?.

9.

Los gatos machos domésticos pueden ser negros o amarillos. Las hembras pueden ser negras, barcinas ( con manchas amarillas y negras ) o amarillas. Si estos colores son determinados por un gen ligado al sexo, ?cómo pueden explicarse estos resultados?. r Determinar los fenotipos esperados en la descendencia al cruzar una hembra amarilla con un macho negro. r Un cierto tipo de apareamiento produce la siguiente camada de gatitos: machos negros 1/2 hembras barcinas 1/2

machos amarillos 1/2

hembras negras 1/2

r

?Qué colores tienen los progenitores ?. Otro tipo de apareamiento produce la siguientes camada de gatitos:

machos amarillos 1/4

machos negros 1/4

hembras amarillas 1/4

hembras barcinas 1/4

?Qué colores tienen los progenitores ?.

http://www.arrakis.es/~lluengo/actimend.html (11 of 12)01/08/2004 11:02:00

Untitled

10.

Un gen recesivo ligado al sexo, determina la hemofilia. De la información obtenida en el siguiente pedigrí, contestar las siguientes cuestiones:

r

r

r

Si II2 se casa con un hombre normal, ?cuál es la probabilidad de que su primer hijo sea un niño hemofílico ?. Suponga que su primer hijo es hemofílico. ?Cuál es la probabilidad de que su segundo hijo sea un niño hemofílico ?. Si la madre de I1 era hemofílica , ?Cuál era el fenotipo del padre de I1 ?.

http://www.arrakis.es/~lluengo/actimend.html (12 of 12)01/08/2004 11:02:00

Sign up to vote on this title
UsefulNot useful