Vous êtes sur la page 1sur 2

DNA

1)O que DNA?


2) Quais so as bases nitrogenadas do DNA?
3) Como so formadas as fitas de DNA?
4)Como so formados os nucleotdeos do DNA
5) O que Watson e Crick descobriram sobre o DNA?
6)(UFSM-RS) Numere a 2. Coluna de acordo com a 1.
Coluna 1
1 DNA
2 RNA
Coluna 2
( ) Dupla hlice
( ) Ribose
( ) Fita nica ou simples
( ) Desoxirribose
( ) Bases nitrogenadas: adenina, guanina, citosina, timina
( ) Bases nitrogenadas: adenina, guanina, citosina, uracila.
A seqncia correta :
a) 1 2 1 2 2 1
b) 2 1 1 2 2 2
c) 1 2 2 1 1 2
d) 2 1 2 1 1 2
e) 1 1 2 2 2 1
7) Se uma fita de DNA tiver constituio ATAAGCGTTAG , como ser sequncia de DNA?

8) FUVEST-SP) Qual da seqncias abaixo corresponde ao produto de transcrio do segmento


AATCACGAT
de
uma
fita
de
DNA?
a)TTACTCGTA
b)TTAGTGCTA
c)AAUCACGAU
d)UUAGUGCUA
e) UUACUCGUA
9) . Escreva a sequncia de bases da fita complementar do DNA dupla fita que apresenta uma
fita com a sequncia: ATGCCGTATGCATTGCATTC
10) Testes genticos: a cincia se antecipa doena. Com o avano no mapeamento de 100 mil
genes dos 23 pares de cromossomos do ncleo da clula (Projeto Genoma, iniciado em 1990,
nos EUA), j possvel detectar por meio de exames de DNA (cido desoxirribonuclico) a
probabilidade de uma pessoa desenvolver doenas [...]. (O Globo, 10/08/1997).
Sabe-se que o citado mapeamento feito a partir do conhecimento da sequncia de bases do
DNA. O esquema abaixo que representa o pareamento tpico de bases encontradas na molcula
de DNA :

(a)

c)

b)

d)