Vous êtes sur la page 1sur 224

C O L L E C T I O N

Claude Lizeaux Denis Baude

re

S
SCIENCES de la VIE et de la TERRE
Programme 2011

Livre du professeur
Sous la direction de Claude Lizeaux et de Denis Baude,
ce livre a t crit par :

Denis Baude
Christophe Brunet
Bruno Forestier
Emmanuelle Franois
Yves Jusserand

04732841_001-021.indd 1

Claude Lizeaux
Paul Pillot
Stphane Rabouin
Andr Vareille

20/07/11 09:13

Sommaire
Les ressources du manuel numrique ........................................................................
Le programme de SVT 1re S .................................................................................................

Partie

Expression, stabilit et variation


du patrimoine gntique
Chapitre 1
Chapitre 2
Chapitre 3
Chapitre 4

Partie

3
5

Reproduction conforme et rplication de lADN .........................


Variabilit gntique et mutation de lADN ...................................
Lexpression du patrimoine gntique .............................................
Gnotype, phnotype et environnement .......................................

28
42
55
67

La tectonique des plaques :


histoire dun modle
Chapitre 1 La naissance dune thorie : la drive des continents ............. 79
Chapitre 2 De la drive des continents la tectonique des plaques ....... 90
Chapitre 3 a tectonique des plaques : un modle qui senrichit ................ 101

Partie

Enjeux plantaires
contemporains
Chapitre 1
Chapitre 2
Chapitre 3
Chapitre 4

Partie

Tectonique globale et ressources gologiques locales ...........


Tectonique des plaques et recherche dhydrocarbures ..........
Pratiques agricoles et gestion de lenvironnement ..................
Pratiques alimentaires et perspectives globales ........................

121
124
133
144

Corps humain
et sant
Chapitre 1
Chapitre 2
Chapitre 3
Chapitre 4
Chapitre 5

Devenir homme ou femme .....................................................................


Sexualit et procration ...........................................................................
Variation gntique et sant .................................................................
La vision : de la lumire au message nerveux ...............................
Cerveau et vision ..........................................................................................

162
171
186
201
216

Bordas /SEJER, Paris, 2011


ISBN 978-2-04-732841-5
Toute reprsentation ou reproduction, intgrale ou partielle, faite sans le consentement de lauteur, ou de ses ayants-droit, ou ayants-cause,
est illicite (article L. 122-4 du Code de la Proprit Intellectuelle). Cette reprsentation ou reproduction, par quelque procd que ce soit,
constituerait une contrefaon sanctionne par larticle L. 335-2 du Code de la Proprit Intellectuelle. Le Code de la Proprit Intellectuelle
nautorise, aux termes de larticle L. 122-5, que les copies ou reproductions strictement rserves lusage priv du copiste et non destines
une utilisation collective dune part, et, dautre part, que les analyses et les courtes citations dans un but dexemple et dillustration .

04732841_001-021.indd 2

20/07/11 09:13

Les ressources du manuel numrique


Les ressources du manuel numrique ont t rassembles et conues pour une utilisation interactive et ouverte. Elles laissent une large place la
libert pdagogique du professeur ou de lquipe
enseignante autant dans les choix de documents
ou dactivits que dans les modalits de mise en
uvre. Lune des lignes conductrices a t de permettre une mise en activit de llve dveloppant
interrogation, rflexion et recherche dexplication
tout en privilgiant son autonomie.
Ces ressources sont de divers ordres :
des vidos pour observer et mieux comprendre ;
des modlisations dynamiques de molcules en
trois dimensions ;
des diaporamas pour faciliter lexprimentation,
des outils pour les TP ;
des animations en lien avec les activits du livre ;
des schmas bilan anims ;
des fiches pour aller plus loin ;
des exercices interactifs pour sentraner et svaluer.

Des vidos pour observer


et mieux comprendre
Les vidos prsentant des manipulations de
paillasse ne se substituent pas une activit
pratique des lves :
Certaines apportent llve les pr-requis ncessaires pour aborder un thme donn. Ainsi, ltude
du cristallin ou des photorcepteurs implique une
connaissance de la place occupe par ces organes
dans lil. La vido de la dissection de lil de buf
(par ailleurs difficile raliser dans la classe) satisfait cet objectif.
Dautres peuvent se substituer une manipulation,
soit par manque de matriel, soit par un choix dlibr du professeur. Ainsi, on peut imaginer que pour
des raisons pratiques ou pdagogiques, le professeur
fasse un autre choix que la ralisation de mesures de
la vitesse de propagation dondes vibratoires dans
les roches. Lutilisation de la vido de cette manipulation sera alors utile. linverse, elle pourra servir
de guide technique pour la manipulation elle-mme.
Les vidos dactualits issues des mdias ou darchives : ces courts articles sont prcieux pour
mettre en place un questionnement, lancer un
dbat ou apporter des lments dexplication. titre
dexemple, la vido Les nitrates dans leau qui
fait tat de la pollution des eaux par les nitrates

dorigine agricole, consquence dune agriculture


intensive... ou Agriculture, produire plus sur les
possibilits daccrotre la production tout en prservant lenvironnement.
Des vidos scientifiques sorties du laboratoire ou
du service spcialis : le diagnostic de sexe par
chographie chez le ftus ou une vido du droulement de la division cellulaire.
Le site www.bordas-svtlycee.fr propose des liens
vers des ressources extrieures. Exemples de vidos :
La dcouverte du rift ocanique (extrait de lopration Famous) , une campagne de forage du
Glomar Challenger , lICSI (Intra Cytoplasmic
Sperm Injection) .

Des modlisations dynamiques


de molcules en trois dimensions
Le manuel est maill de photographies de molcules ou de complexes molculaires en trois dimensions. La plupart sont galement proposes sous
forme de modlisations dynamiques (vidos). Lobjectif nest pas de se substituer une activit de
llve avec un logiciel de traitement de donnes
molculaires (MolUSc, Rastop ou autres) mais, l
encore, de crer une situation de choix pdagogique. Les vidos ont t construites pour tre des
outils de recherche dexplication (comment lARNpolymrase ralise-t-elle une rparation de lADN ?
Pourquoi lhmoglobine S sorganise-t-elle en fibres
dans les hmaties falciformes ?, etc.)
Lutilisation peut tre collective ou dans le cadre
dun atelier.
Lindex des fichiers de coordonnes molculaires
figure la fin de chaque vido et sont tlchargeables sur le site www.bordas-svtlycee.fr.

Des diaporamas pour faciliter


lexprimentation, des outils pour les TP
Un certain nombre dactivits exprimentales requirent
le suivi par llve dun protocole rigoureux. Cest le
cas de lirradiation dune culture de levures (partie 1
chapitre 2) ou la ralisation dun antibiogramme
(partie 2 chapitre 3). Loption a t prise de proposer un diaporama guidant llve pas pas dans
la conduite de son protocole. Ce choix sapplique
notamment la mise en uvre dune PCR (partie 1
chapitre 1). Dans ce diaporama a t intgre une
part dexplication biologique du processus mis en
jeu. Le diaporama en collectif ou en libre-service est
alors un substitut de la manipulation (qui requiert
3

04732841_001-021.indd 3

20/07/11 09:13

lquipement ncessaire).
Laide la lecture de lames minces de roches
observes au microscope est un outil qui permettra llve, en balayant des microphotographies
de roches, de collecter les indications ncessaires
la dtermination des minraux. Il a sa place sur
lordinateur ct du microscope.

flux de matire ou dnergie (partie 3 chapitre 3).


Le schma bilan anim propose une progression. Il
peut tre exploit en collectif, comme support de
synthse mais galement individuellement ou en
petit groupe : les lves laborent alors par euxmmes la synthse en sappuyant sur loutil propos.

Des animations en lien avec les activits


du livre

Elles ont t rdiges la manire darticles proches


de lactualit scientifique tout en restant la porte des lves. Lintention est daller plus loin, sinterroger ou dbattre sur des problmes de socit,
de sant, denvironnement, en lien avec lhistoire
des sciences ou lhistoire des arts. Exemples : La
maladie de Huntington : une enzyme de rparation de lADN en cause , Risques solaires : profiter du soleil en toute scurit , Les terres agricoles mondiales, objet de convoitise, John Dalton
et le daltonisme (article de J. Dalton dans le Journal of science of Edinburgh, 1794).
Certaines dentre elles renvoient vers des sites
dintrt.

La comprhension dun mcanisme, dun phnomne ou dune technique peut tre facilite par un
schma. Elle sera plus facile si llve peut gnrer diffrentes situations et apprhender les consquences travers une animation. Les animations sur
la myopie, la presbytie et les corrections optiques
possibles (partie 4 chapitre 4), celles sur la tomographie sismique (partie 2 chapitre 4), les failles
transformantes (partie 2 chapitre 3) ou la formation
des ptroles en lien avec louverture de la Tthys
(partie 3 chapitre 2) en sont des exemples. Si lutilisation en collectif est possible, celle en atelier ou
libre-service reste plus adapte.

Des fiches pour aller plus loin

Des schmas bilan anims

Des exercices interactifs pour sentraner et


svaluer

Un schma bilan offre de nombreuses informations souvent trs symbolises et de faon trs synthtique. Une telle reprsentation est souvent difficile exploiter par llve dans la mesure o il
ne sait pas o dmarrer et comment en effectuer
la lecture. Ceci est encore plus vrai sil sagit dun
schma montrant un mcanisme de rgulation par
exemple (partie 4 chapitre 2), un enchanement de
causes et de consquences (partie 4 chapitre 1), un

Ils reprennent les exercices du livre (QCM, vrai ou


faux, utiliser ses comptences). Ils ne sont pas seulement un outil dvaluation mais se veulent tre
galement un instrument dapprentissage. Le choix
a donc t fait de valider ou non la rponse de
llve mais de ne pas proposer les bonnes rponses.
Llve est renvoy vers un document ou une activit lui permettant de confirmer ou de prciser ses
connaissances. Laide est disponible tout moment.

04732841_001-021.indd 4

20/07/11 09:13

Programme de Sciences de la Vie et de la Terre


en classe de Premire scientifique
(Bulletin officiel n 9 du 30 septembre 2010)

Prambule

I. LES SCIENCES DE LA VIE ET DE


LA TERRE AU LYCE
1. Les sciences de la vie et de la Terre dans le
parcours de llve en lyce
Les objectifs de lenseignement des sciences de
la vie et de la Terre
Au lyce, les sciences de la vie et de la Terre sont
une voie de motivation et de russite pour la poursuite
de la formation scientifique aprs le collge et la prparation lenseignement suprieur ; elles participent
galement lducation en matire de sant, scurit,
environnement, de tout lve qui choisira une orientation vers des filires non scientifiques. La discipline vise
trois objectifs essentiels :
aider la construction dune culture scientifique commune fonde sur des connaissances considres comme valides tant quelles rsistent lpreuve
des faits (naturels ou exprimentaux) et des modes de
raisonnement propres aux sciences ;
participer la formation de lesprit critique et
lducation citoyenne par la prise de conscience du
rle des sciences dans la comprhension du monde et le
dveloppement de qualits intellectuelles gnrales par
la pratique de raisonnements scientifiques ;
prparer les futures tudes suprieures de ceux
qui poursuivront sur le chemin des sciences et, au-del,
les mtiers auxquels il conduit ; aider par les acquis
mthodologiques et techniques ceux qui sorienteront
vers dautres voies.

cupation citoyenne qui prpare chacun lexercice de ses


responsabilits individuelles et collectives, la perspective
utilise ici conduit aux mtiers de la gestion publique,
aux professions en lien avec la dynamique de dveloppement durable et aux mtiers de lenvironnement (agronomie, architecture, gestion des ressources naturelles).
Corps humain et sant. Centre sur lorganisme
humain, cette thmatique permet chacun de comprendre
le fonctionnement de son organisme, ses capacits et ses
limites. Elle prpare lexercice des responsabilits individuelles, familiales et sociales et constitue un tremplin
vers les mtiers qui se rapportent la sant (mdecine,
odontologie, dittique, pidmiologie).
Ces trois thmatiques ne sont en rien des catgories
rigides mais bien des directions de rflexion. Elles ne se
substituent pas aux dcoupages traditionnels de la discipline (biologie et gologie par exemple) et conduisent
la dcouverte progressive des grands domaines quelle
recouvre. En particulier, les sciences de la Terre conservent une originalit quil convient de ne pas nier. Les
thmes gnraux aident montrer la cohrence globale du
champ intellectuel concern, centr sur un objet dtude
la nature et des mthodes fondes sur la confrontation
entre les ides scientifiques et les faits - naturels ou exprimentaux. Elles aident aussi situer lenseignement dispens dans la perspective de la construction dun projet
de vie propre chaque lve.
Dans chaque thmatique, la construction des savoirs
se ralise peu peu tout au long de la scolarit. Cette
continuit est conue pour faciliter la progressivit des
apprentissages, sans pour autant empcher la souplesse
ncessaire llaboration dun parcours de formation
pour chaque lve.

Trois thmatiques structurantes

Les sciences de la vie et de la Terre dans le nouveau lyce

Pour atteindre ces objectifs, les programmes sarticulent autour de trois grandes thmatiques qui, dans une
large mesure, ne sont pas indpendantes.
La Terre dans lUnivers, la vie et lvolution du
vivant. Il sagit de montrer - dans le cadre des domaines
propres aux sciences de la vie et de la Terre - que la science
construit, partir de mthodes dargumentation rigoureuses fondes sur lobservation du monde, une explication cohrente de son tat, de son fonctionnement et de
son histoire. Au-del de la perspective culturelle, cette
ligne de rflexion prpare aux mtiers les plus proches
des sciences fondamentales (recherche, enseignement).
Enjeux plantaires contemporains. Il sagit de
montrer comment la discipline participe lapprhension rigoureuse de grands problmes auxquels lhumanit
daujourdhui se trouve confronte. Au-del de la proc-

Lenseignement des sciences de la vie et de la Terre


prend en compte les objectifs gnraux de la rforme
des lyces.
Pour participer laffirmation du caractre gnraliste de la Premire, le programme de sciences de la
vie et de la Terre fait le choix daborder une palette de
thmes varis et, par consquent, accepte de ne pas trop
les approfondir. Il sagit de montrer la diversit des sujets
quabordent les sciences de la vie et de la Terre dans lespoir que chaque lve y trouvera matire rpondre ses
attentes. Les bases ainsi tablies, le plus souvent partir dtude dexemples concrets et motivants, conduiront,
dans les classes ultrieures, des approfondissements,
des gnralisations, des approches complmentaires.
Ces bases larges permettront llve de dterminer ses
choix pour le cycle terminal en connaissance de cause.
Programme

04732841_001-021.indd 5

20/07/11 09:13

Pour participer une meilleure information des


lves sur les possibilits qui soffrent eux, au-del
mme du lyce, le programme sorganise, comme cela
a t soulign, autour de thmatiques qui aident au reprage de grands secteurs dactivits professionnelles. En
outre, chaque fois que cela sera possible, les professeurs
saisiront les occasions offertes afin dattirer lattention
sur des mtiers plus prcis, dont lexercice professionnel prsente un certain rapport avec les questions abordes en classe.

mises en uvre pdagogiques, y compris les valuations.


Celles-ci prendront en compte, chaque fois que possible,
ces trois objectifs de formation.
Si les connaissances scientifiques mmoriser sont
raisonnables, cest pour permettre aux enseignants de
consacrer du temps faire comprendre ce quest le savoir
scientifique, son mode de construction et son volution
au cours de lhistoire des sciences.

Pour participer la facilitation des corrections de


trajectoires, le programme sera organis en prenant en
compte trois proccupations. Certaines thmatiques abordes seront communes aux classes de Premire scientifiques et non scientifiques (avec un niveau de prcision
diffrent). Certaines thmatiques de classe de Premire
scientifique seront traites de telle sorte que seules leurs
conclusions les plus gnrales soient ncessaires en Terminale. Certaines thmatiques de terminale scientifique
se situeront directement dans la continuit des acquis de
la classe de Seconde.

La poursuite des objectifs de formation mthodologique implique gnralement que lon mette en uvre
une pdagogie active, au cours de laquelle llve participe llaboration dun projet et la construction de
son savoir. La dmarche dinvestigation, dj pratique
lcole primaire et au collge, prend tout particulirement son sens au lyce et sappuie le plus souvent possible sur des travaux dlves en laboratoire. Des activits pratiques, envisageables pour chacun des items du
programme, seront mises en uvre chaque fois que
possible. Le professeur sassurera que les lves utilisent
des mthodes et outils diffrencis sur lensemble de lanne. Ainsi, chaque lve rencontrera dans les meilleures
conditions loccasion daller sur le terrain, de dissquer,
de prparer et raliser des observations microscopiques,
dexprimenter avec laide dun ordinateur, de modliser,
de pratiquer une recherche documentaire en ligne, etc.
Il est dusage de dcrire une dmarche dinvestigation
comme la succession dun certain nombre dtapes types :
une situation motivante suscitant la curiosit ;
la formulation dune problmatique prcise ;
lnonc dhypothses explicatives ;
la conception dune stratgie pour prouver ces
hypothses ;
la mise en uvre du projet ainsi labor ;
la confrontation des rsultats obtenus et des hypothses ;
llaboration dun savoir mmorisable ;
lidentification ventuelle de consquences pratiques de ce savoir.
Ce canevas est la conceptualisation dune dmarche
type. Le plus souvent, pour des raisons varies, il convient
den choisir quelques aspects pour la conception des
sances. Cest l aussi un espace de libert pdagogique
pour le professeur qui vrifiera toutefois qu lissue de
lanne, les diffrentes tapes auront bien t envisages.
Pour que la dmarche dinvestigation soit un rel
outil de formation, une vision qualitative plutt que quantitativeest prfrable : mieux vaut argumenter bien et lentement quargumenter mal et trop vite. Cette dmarche
constitue le cadre intellectuel appropri pour la mise en
uvre dactivits de laboratoire, notamment manipulatoires et exprimentales, indispensables la construction des savoirs de la discipline.

Pour participer la prise en compte de la diversit des lves, une grande marge de libert est laisse
aux professeurs, seuls mme de dterminer les modalits pdagogiques adaptes leur public. En outre, il
est toujours possible de diversifier les activits lintrieur dune mme classe pour traiter un mme point
du programme.

2. Les conditions dexercice de la libert pdagogique du professeur


Le programme est conu pour laisser une trs large
place la libert pdagogique du professeur et/ou de
lquipe disciplinaire. Cette libert porte sur les modalits didactiques mises en uvre, sur lordre dans lequel
seront tudis les thmes, sur les exemples choisis ainsi
que, dans une mesure raisonnable, sur lampleur de largumentation dveloppe dans le cadre de tel ou tel sujet.
Cest pour respecter la libert de choix dexemples que les
objectifs de formation sont dfinis avec un grand degr
de gnralit. Ces exemples, toujours localiss, seront
choisis, pour certains au moins, dans un contexte proche.
Nanmoins, la libert pdagogique ne saurait manciper des objectifs de formation rappels ci-dessus. Pour
aider atteindre ces objectifs, quelques principes didactiques gnraux sont rappels ci-dessous, dont il convient
de faire un usage adapt.

Les comptences : une combinaison de connaissances, capacits et attitudes


Lacquisition des connaissances reste un objectif
important de lenseignement, mais il doit tre replac
dans un tout dont font aussi partie, capacits et attitudes.
Laffirmation de limportance de cette formation intellectuelle et humaine explique le niveau de gnralit des
exigences de connaissances. Connaissances, capacits
et attitudes sont trois objectifs de formation de statuts galement respectables. Ceci conduit leur porter la mme attention au moment de la conception des
6

La dmarche dinvestigation

Les technologies de linformation et de la communication


Les technologies de linformation et de la communication seront mises en uvre en de nombreuses circonstances.

Programme

04732841_001-021.indd 6

20/07/11 09:13

Il pourra sagir de technologies gnralistes dont on


fera ici un usage spcialis, notamment Internet en utilisation conjointe avec des techniques de laboratoire classiques. Mais on veillera aussi dvelopper les savoir-faire
des lves relativement aux technologies plus spcialises, comme lexprimentation assiste par ordinateur,
technique indispensable pour une formation moderne et
efficace des lves.
Lusage de logiciels, gnralistes ou spcialiss,
est encourag. Les sciences de la vie et de la Terre participent la prparation du B2i niveau lyce.
Les productions pdagogiques, les travaux dlves,
gagneront tre exploits, en classe et hors de la classe
dans le cadre dun environnement numrique de travail (ENT).

La pratique de dmarches historiques


Lapproche historique dune question scientifique
peut tre une manire originale de construire une
dmarche dinvestigation. Lhistoire de llaboration
dune connaissance scientifique, celle de sa modification au cours du temps, sont des moyens utiles pour
comprendre la nature de la connaissance scientifique et
son mode de construction, avec ses avances et ventuelles rgressions. Il conviendra de veiller ce que
cette approche ne conduise pas la simple vocation
dune succession vnementielle et ne pas caricaturer cette histoire au point de donner une fausse ide de
la dmonstration scientifique. Si certains arguments ont
une importance historique majeure, il est rare quun seul
dentre eux suffise entraner une volution dcisive des
connaissances scientifiques ; de mme, il serait vain de
prtendre faire rinventer par les lves, en une ou
deux sances, ce qui a ncessit le travail de plusieurs
gnrations de chercheurs.

Lapproche de la complexit et le travail de terrain


Le travail de terrain est un moyen privilgi pour
lapproche de situations complexes relles. Le programme comporte, ds la classe de seconde, plusieurs
items qui se prtent bien la ralisation dun travail hors
de ltablissement (sortie gologique, exploration dun
cosystme, visite de muse scientifique, dentreprise,
de laboratoire). Un tel dplacement permettra souvent de
collecter des informations utiles pour plusieurs points du
programme et susceptibles dtre exploites plusieurs
moments de lanne.
Un tel travail de terrain doit sexercer en cohrence
avec un projet pdagogique pens dans le contexte de
ltablissement.
Les activits en laboratoire doivent aussi tre loccasion daborder des tches complexes. partir dune question globale, elles sont loccasion de dvelopper les comptences des lves et leur autonomie de raisonnement.

Lautonomie des lves et le travail par atelier


Le lycen, ds la Seconde, doit se prparer une autonomie de pense et dorganisation qui lui sera indispensable pour russir ses tudes suprieures. Les travaux

pratiques se prtent particulirement au dveloppement de


cette comptence. Pour y parvenir, il est bon de concevoir
les sances afin que llve dispose dune certaine marge
de manuvre dans la construction de sa dmarche.
La libert de choix sera parfois exploite en diffrenciant les exemples tudis au sein dune mme classe.
Chaque groupe dlves a alors en charge lorganisation
autonome de son travail, sous la conduite du professeur.
changes et dbats conduisent ensuite tirer des conclusions plus gnrales que ltude collective dun exemple
unique ne le permettrait. Ils sont en outre loccasion de
dvelopper les qualits dexpression et dcoute.

Lvaluation des lves


Ds la classe de Seconde, les valuations formatives
jouent un rle important pour aider les lves sadapter leur nouveau cadre de travail.
Les dimensions diagnostique, formative et sommative en termes de connaissances, de capacits et dattitudes ont chacune leur utilit. Le professeur choisit des
supports pertinents afin daider les lves le long de leur
parcours. Il facilite ainsi un accompagnement personnalis permettant un suivi des apprentissages et une orientation claire.
Sans exagrer le temps annuel consacr lvaluation sommative, il convient de concevoir des contrles
rguliers, de dures varies et cibls sur quelques comptences bien identifies qui varient dun contrle lautre.
Lorganisation prcise des valuations dpend de la classe
et constitue, tout au long du lyce, un cheminement progressif qui conduit au baccalaurat.
Les activits pratiques individuelles des lves, quil
convient de dvelopper chaque fois que possible, sont galement loccasion dvaluer les acquisitions des capacits techniques et exprimentales. Non seulement le suivi
de lacquisition de capacits exprimentales permet de
vrifier le dveloppement dune forme de rigueur de raisonnement spcifique aux sciences exprimentales, mais
encore, cest une prparation progressive, indispensable
ds la classe de Seconde, une forme dvaluation que
les lves pourront rencontrer au baccalaurat et au cours
de leurs tudes suprieures. Lvaluation de la capacit
communiquer loral est renforcer.

3. Les sciences de la vie et de la Terre, discipline


douverture
Les sciences de la vie et de la Terre sont une discipline ouverte sur les grands problmes de la socit
contemporaine, comme le montrent les intituls du programme eux-mmes.

Les proccupations ducatives


Les nombreuses connexions avec les objectifs ducatifs transversaux (sant, environnement, etc.) seront
mises en vidence le plus souvent possible.

La convergence avec dautres disciplines


Au-del de la parent avec les autres sciences exprimentales que sont les sciences physiques et chimiques,
Programme

04732841_001-021.indd 7

20/07/11 09:13

les programmes de sciences de la vie et de la Terre fournissent loccasion dinteractions avec dautres disciplines,
notamment avec les mathmatiques (par la formalisation
utilise et la sensibilisation une approche statistique),
la gographie (thmes de lnergie et de leau) et lEPS
(thme activit physique).

Lhistoire des arts


En continuit avec les prconisations contenues dans
les programmes de collge, il est bon de souligner que
les sciences de la vie et de la Terre peuvent tre loccasion dintressantes relations avec lenseignement dhistoire des arts. Les professeurs choisiront, en cohrence
avec le mode dorganisation de lenseignement de lhistoire des arts dans ltablissement, les modalits dinteractions qui leur conviennent.
Plusieurs sujets abords dans le programme sy prtent, bien que le choix soit fait de ne pas le souligner au
cas par cas le long du droul du programme afin de laisser toute libert de mise en uvre aux quipes.
titre dexemple, on peut citer les vocations littraires de la biodiversit ou sa reprsentation picturale ; la
statuaire du corps humain au cours dun exercice sportif.
Les vocations littraires de la vie des mineurs renseignent sur des conditions dexploitation souvent rvolues
aujourdhui. La reprsentation danimaux ou vgtaux
actuels ou disparus met en scne un dialogue entre les
connaissances scientifiques et les pratiques artistiques, etc.

II. LES SCIENCES DE LA VIE


ETDE LA TERRE EN CLASSE
DEPREMIRE S
Le programme de la classe de Premire S prend appui
sur ceux de la classe de Seconde et du collge. De plus,
il est crit de faon rendre le moins difficile possible
un changement de filire en fin ou en cours de Premire.
Les thmes abords dans les classes non scientifiques le
sont aussi dans la filire S, un autre niveau dapprofondissement scientifique. En particulier, il devrait tre
possible sans trop de difficult de prparer les preuves
scientifiques anticipes du baccalaurat de Premire
ES ou L en ayant suivi un enseignement de PremireS.
En classe de Premire S, les trois thmatiques prsentes dans le prambule gnral pour le lyce sont
dclines comme indiqu ci-dessous. Les pourcentages
proposs donnent une indication trs gnrale de la pondration souhaite entre les thmes, mais ils ne doivent
pas tre considrs comme des impratifs rigides.
Dans le thme La Terre dans lUnivers, la vie et
lvolution du vivant (50 %), on tudie :
les donnes fondamentales sur le patrimoine gntique(rplication, transcription, traduction, mutation et
variabilit gntique) ; lexplicitation de certains phnomnes molculaires permet de progresser dans lexplication au-del de la classe de Seconde ;
la tectonique des plaques dans le cadre de lhistoire dun modle ; il sagit dune approche historique
8

qui prolonge, prcise et argumente le modle tudi au


collge.
Pour aborder le thme des Enjeux plantaires
contemporains (17 %), deux questions sont traites :
dans le prolongement du programme de Seconde,
et en cho ltude historique du modle de tectonique
des plaques, on aborde la manire dont la connaissance
de la tectonique des plaques constitue souvent un cadre
de rflexion utile en gologie applique ;
le thme Nourrir lhumanit prolonge lapproche globale de lagriculture conduite en Seconde ;
il sagit de mettre en relation les besoins qualitatifs et
quantitatifs des individus en aliments et eau potable et
les problmatiques de gestion durable de la plante ; il
est loccasion de prsenter quelques notions fondamentales dcologie gnrale.
Enfin le thme Corps humain et sant (33 %)
est structur autour de trois questions :
la dualit fminin/masculin est aborde sous
langle de son ontogense pour permettre une approche
biologique des questions de sexualit ;
les relations entre la variabilit gntique et la
sant conduisent voquer la part de la gntique dans
la cause des maladies, celle des perturbations du gnome
dans le cancer, et limportance mdicale de la slection
de souches bactriennes rsistantes aux antibiotiques ;
en relation troite avec le cours de physique, la
vision est aborde sous trois angles ; le cristallin est tudi
en tant que lentille transparente vivante, les cellules photorceptrices permettent la fois de comprendre certains
aspects de la perception mais aussi daborder leur origine
volutive. Par ailleurs, le fonctionnement crbral montre
la complexit des interconnexions et de la plasticit.
Comme pour la classe de Seconde, la libert pdagogique du professeur est grande en classe de Premire S.
Cependant, la ncessit dassurer la construction dun
corpus commun de comptences conduit parfois prciser davantage ce qui est attendu. En outre, le travail en
classe sinscrit ds cette classe dans la perspective dune
prparation au baccalaurat. En particulier, un premier
entranement lpreuve des capacits exprimentales
impose une pratique pdagogique aussi concrte que
possible. Dans le mme ordre dide, une sortie de terrain est souhaitable, tout particulirement dans le cadre
de lenseignement des sciences de la Terre.
Beaucoup de points abords dans le programme
se prtent particulirement bien des approfondissements disciplinaires ou, plus encore, des dveloppements transdisciplinaires (en accompagnement personnalis, en TPE, etc.).

Programme
Le programme est prsent en deux colonnes.
Chaque thme comporte une brve introduction qui en
indique lesprit gnral.
La colonne de gauche liste les connaissances (en
caractre droit) qui doivent tre acquises par les lves
lissue de la classe de premire.

Programme

04732841_001-021.indd 8

20/07/11 09:13

En italique, la colonne de gauche comporte aussi


quelques commentaires qui prcisent et limitent les
objectifs dapprentissage, lorsque cela parat ncessaire :
en italique simple, quelques prcisions sur les
objectifs et mots-cls (ces mots-cls correspondent
des notions qui nont pas t places directement dans
le programme pour de simples questions dcriture, mais
qui doivent tre connues des lves) ;
entre parenthses, des indications sur ce qui a dj
t tudi et qui ne sera pas reconstruit en premire (ces
acquis peuvent cependant tre rappels) ;
entre crochets, quelques limites, chaque fois quil
a sembl ncessaire de rendre parfaitement explicite ce
jusquo ne doit pas aller lexigible (il sagit bien de
limites de ce qui est exigible pour les lves, ce qui ne
veut pas dire quil est interdit den parler dans le droulement de la construction du savoir) ;
les convergences les plus marquantes vers dautres
disciplines (ces relations ne sont pas indiques de faon
exhaustive).
Une nouvelle rubrique apparat dans cette colonne
par rapport au programme de Seconde. Dnomme

pistes , elle suggre des directions de rflexions susceptibles dtre exploites dans le cadre de prolongements
au-del du programme lui-mme, en TPE, accompagnement personnalis ou clubs scientifiques par exemple, de
prfrence en interdisciplinarit.
La colonne de droite indique les capacits et attitudes dont on attend quelles soient dveloppes dans le
cadre de litem dcrit.
En prambule du programme, une liste de capacits et attitudes gnrales est prsente. Celles-ci sont
communes la plupart des items qui, par consquent,
ne sont pas reprises par la suite. Il convient cependant
de ne pas les oublier et dorganiser leur apprentissage
sur lensemble de lanne.
On observera que, par souci de continuit et de cohrence, le vocabulaire utilis pour dcrire les capacits et
attitudes mises en uvre sinspire fortement de celui utilis pour le socle commun de connaissances et de comptences du collge (dcret 2006-830 du 11 juillet 2006,
encart au BOEN n 29 du 20 juillet 2006).

Capacits et attitudes dveloppes tout au long du programme


Pratiquer une dmarche scientifique (observer, questionner, formuler une hypothse, exprimenter, raisonner avec rigueur,
modliser).
Recenser, extraire et organiser des informations.
Comprendre le lien entre les phnomnes naturels et le langage mathmatique.
Manipuler et exprimenter.
Comprendre quun effet peut avoir plusieurs causes.
Exprimer et exploiter des rsultats, lcrit, loral, en utilisant les technologies de linformation et de la communication.
Communiquer dans un langage scientifiquement appropri: oral, crit, graphique, numrique.
Percevoir le lien entre sciences et techniques.
Manifester sens de lobservation, curiosit et esprit critique.
Montrer de lintrt pour les progrs scientifiques et techniques.
tre conscient de sa responsabilit face lenvironnement, la sant, le monde vivant.
Avoir une bonne matrise de son corps.
tre conscient de lexistence dimplications thiques de la science.
Respecter les rgles de scurit.
Comprendre la nature provisoire, en devenir, du savoir scientifique.
tre capable dattitude critique face aux ressources documentaires.
Manifester de lintrt pour la vie publique et les grands enjeux de la socit.
Savoir choisir un parcours de formation.

Programme

04732841_001-021.indd 9

20/07/11 09:13

Connaissances

Capacits et attitudes

Thme 1 La Terre dans lUnivers, la vie et lvolution du vivant


THME 1- A EXPRESSION, STABILIT ET VARIATION DU PATRIMOINE GNTIQUE
Ce thme sappuie sur les connaissances acquises en collge et en classe de seconde sur la molcule dADN.
Il sagit de comprendre comment la rplication et la mitose permettent une reproduction cellulaire conforme. Toutefois, la
fragilit de la molcule dADN notamment lors de la rplication est source de mutation, cause de variation gntique.
Les mcanismes de transcription et traduction expliquent lquipement protique des cellules.

Reproduction conforme de la cellule et rplication de lADN


Les chromosomes sont des structures constantes des cellules
eucaryotes qui sont dans des tats de condensation variables au
cours du cycle cellulaire. En gnral la division cellulaire est une
reproduction conforme qui conserve toutes les caractristiques
du caryotype (nombre et morphologie des chromosomes).

Recenser, extraire et exploiter des informations permettant de


caractriser le cycle cellulaire et ses phases, dans diffrents
types cellulaires.
Effectuer un geste technique en observant au microscope des
divisions de cellules eucaryotes.

Objectifs et mots-cls. Phases du cycle cellulaire : interphase


(G1, S, G), mitose.
(Collge et Seconde. Premire approche de la mitose, du
caryotype). [Limites. Les anomalies du caryotype ne sont pas
abordes ici. Le fonctionnement du fuseau mitotique est hors
programme.]
Pistes. Explication des anomalies chromosomiques; caryotypes
et dfinition des espces.
Chaque chromatide contient une molcule dADN.
Au cours de la phase S, lADN subit la rplication semiconservative. En absence derreur, ce phnomne prserve, par
copie conforme, la squence des nuclotides.
Ainsi,les deux cellules-filles provenant par mitose dune cellulemre possdent la mme information gntique.

Mettre en uvre une mthode (dmarche historique) et/ou


une utilisation de logiciels et/ou une pratique documentaire
permettant de comprendre le mcanisme de rplication semiconservative.

Objectifs et mots-cls. Il sagit de donner aux lves les


connaissances de base ncessaires sur la multiplication
cellulaire conforme aux chelles cellulaire (mitose) et molculaire
(rplication de lADN).
(Collge et Seconde. Premire approche de lADN).
[Limites. Lintervention dun ensemble denzymes et la ncessit
dune source dnergie sont seulement signales, sans souci de
description exhaustive.] Pistes. Comprendre la PCR. Calculer la
vitesse de rplication chez les eucaryotes.

Variabilit gntique et mutation de lADN


Pendant la rplication de lADN surviennent des erreurs
spontanes et rares, dont la frquence est augmente par
laction dagents mutagnes. LADN peut aussi tre endommag
en dehors de la rplication.
Le plus souvent lerreur est rpare par des systmes
enzymatiques. Quand elle ne lest pas, si les modifications
nempchent pas la survie de la cellule, il apparat une mutation,
qui sera transmise si la cellule se divise.
Une mutation survient soit dans une cellule somatique (elle
est ensuite prsente dans le clone issu de cette cellule) soit
dans une cellule germinale (elle devient alors hrditaire).
Les mutations sont la source alatoire de la diversit des allles,
fondement de la biodiversit.

10

Recenser, exploiter et interprter des bases de donnes et/ou


concevoir et raliser un protocole pour :
mettre en vidence linfluence dagents mutagnes sur des
populations humaines (UV, benzne, etc.) ;
analyser linfluence de lirradiation dune culture de levures
par des UV (suivi du taux de mortalit).
Utiliser des logiciels pour caractriser des mutations.
Recenser et exploiter des informations permettant de caractriser
la diversit alllique dune population.

Programme

04732841_001-021.indd 10

20/07/11 09:13

Connaissances

Capacits et attitudes

(Collge et Seconde. Premire approche de la variation


gntique.)
[Limites. Laction dagents mutagnes est tudie titre
dexemple, mais leur mcanisme daction na pas tre mmoris.
Aucune exhaustivit nest attendue dans la prsentation de
ces agents.]
Convergence. Mathmatiques : probabilit.
Pistes. Quantification de la mutation dans une population
cellulaire (mathmatiques) ; les agents mutagnes dans
lenvironnement (physique-chimie).

Lexpression du patrimoine gntique


La squence des nuclotides dune molcule dADN reprsente
une information. Le code gntique est le systme de
correspondance mis en jeu lors de la traduction de cette
information. quelques exceptions prs, il est commun
tous les tres vivants.
Les portions codantes de lADN comportent linformation
ncessaire la synthse de chanes protiques issues de
lassemblage dacides amins.
Chez les eucaryotes, la transcription est la fabrication, dans le
noyau, dune molcule dARN pr-messager, complmentaire
du brin codant de lADN. Aprs une ventuelle maturation,
lARN messager est traduit en protines dans le cytoplasme.

Recenser, extraire et exploiter des informations permettant


de caractriser les protines comme expression primaire de
linformation gntique.
Mettre en uvre une mthode (dmarche historique) et/ou
une utilisation de logiciels et/ou une pratique documentaire
permettant :
dapprocher le mcanisme de la transcription, et de la
traduction ;
de comprendre comment le code gntique a t lucid.

Un mme ARN pr-messager peut subir, suivant le contexte,


des maturations diffrentes et donc tre lorigine de
plusieurs protines diffrentes. [Limites. Le code gntique
nest pas mmoriser. Les rles des ARNt et ARNr ne sont
pas au programme. Les mcanismes sont tudis chez les
eucaryotes, mais lobjectif nest pas de mettre laccent sur les
diffrences entres les eucaryotes et les procaryotes. Lexistence
dune maturation de lARN pr-messager est signale, mais ses
diffrents aspects ne sont pas exigibles]
Lensemble des protines qui se trouvent dans une cellule
(phnotype molculaire) dpend :
du patrimoine gntique de la cellule (une mutation alllique
peut tre lorigine dune protine diffrente ou de labsence
dune protine) ;
de la nature des gnes qui sexpriment sous leffet de
linfluence de facteurs internes et externes varis.

Recenser, extraire et exploiter des informations ( partir


dun exemple comme la drpanocytose ou le xeroderma
pigmentosum) permettant de :
caractriser les diffrentes chelles dun phnotype ;
diffrencier les rles de lenvironnement et du gnotype dans
lexpression dun phnotype.

Le phnotype macroscopique dpend du phnotype cellulaire,


lui-mme induit par le phnotype molculaire.
(Collge et Seconde. Premire approche des diffrentes chelles
du phnotype et de la variation.)
[Limites. Ltude de la diffrenciation cellulaire nest pas au
programme; on se contente de constater que plusieurs cellules
dun mme organisme peuvent ne pas contenir les mmes
protines.]
Pistes. Perturbation de la production de protines dans une
cellule cancreuse. Diffrenciation cellulaire et expression
protique.
Programme

04732841_001-021.indd 11

11

20/07/11 09:13

Connaissances

Capacits et attitudes

THME 1-B LA TECTONIQUE DES PLAQUES : LHISTOIRE DUN MODLE


Les grandes lignes de la tectonique des plaques ont t prsentes au collge. Il sagit, en sappuyant sur une dmarche
historique, de comprendre comment ce modle a peu peu t construit au cours de lhistoire des sciences et de le complter.
On se limite quelques tapes significatives de lhistoire de ce modle.
Lexemple de la tectonique des plaques donne loccasion de comprendre la notion de modle scientifique et son mode dlaboration.
Il sagit dune construction intellectuelle hypothtique et modifiable. Au cours du temps, la communaut scientifique laffine et
le prcise en le confrontant en permanence au rel. Il a une valeur prdictive et cest souvent lune de ces prdictions qui conduit
la recherche dun fait nouveau qui, suivant quil est ou non dcouvert, conduit tayer ou modifier le modle. La solidit du
modle est peu peu acquise par laccumulation dobservations en accord avec lui. Les progrs techniques accompagnent le
perfectionnement du modle tout autant que les dbats et controverses.
Nota. partir de lexemple de la tectonique des plaques, les lves seront conduits comprendre quelques caractristiques
du mode de construction des thories scientifiques.

La naissance de lide
Au dbut du XXe les premires ides voquant la mobilit
horizontale sappuient sur quelques constatations :
la distribution bimodale des altitudes (continents/ocans) ;
les tracs des ctes ;
la distribution gographique des paloclimats et de certains
fossiles. Ces ides se heurtent au constat dun tat solide de la
quasi-totalit du globe terrestre tabli, la mme poque, par
les tudes sismiques. Lide de mobilit horizontale est rejete
par lensemble de la communaut scientifique.

Comprendre les difficults dacceptation des premires ides


de mobilit.
Raliser et exploiter des modlisations analogique et numrique
pour tablir un lien entre propagation des ondes sismiques et
structure du globe.

[Limites. Il ne sagit pas dune tude exhaustive des prcurseurs


de la tectonique des plaques, mais simplement de loccasion de
montrer la difficile naissance dune ide prometteuse.]
Convergence. Mathmatiques: distributions, frquences.

Linterprtation actuelle des diffrences daltitude moyennes entre les continents et les ocans
La diffrence daltitude observe entre continents et ocans
reflte un contraste gologique.
Les tudes sismiques et ptrographiques permettent de
caractriser et de limiter deux grands types de crotes terrestres:
une crote ocanique essentiellement forme de basalte et
de gabbro et une crote continentale constitue entre autres
de granite.
La crote repose sur le manteau, constitu de pridotite.
Objectifs et mots-cls. La dcouverte des deux lithosphres est
loccasion de fournir aux lves les donnes fondamentales sur
les principales roches rencontres (basalte, gabbro, granite,
pridotite).
(Collge et Seconde. Premire approche de la crote et de la
lithosphre.) [Limites. Ltude ptrographique se limite la
prsentation des principales caractristiques des quatre roches
cites. Bien que lobservation de lames minces soit recommande,
il nest pas attendu de faire mmoriser par les lves les critres
didentification microscopique des minraux.]
Convergences. Physique: ondes mcaniques.

Concevoir une modlisation analogique et raliser des mesures


laide de dispositifs dexprimentation assiste par ordinateur
de propagation dondes travers des matriaux de nature
ptrographique diffrente.
Observer diffrentes chelles, de lchantillon macroscopique
la lame mince, les roches des crotes ocanique et continentale
et du manteau.
Comprendre comment des observations fondes sur des
techniques nouvelles ont permis de dpasser les obstacles du
bon sens apparent.

Lhypothse dune expansion ocanique et sa confrontation des constats nouveaux


Au dbut des annes 1960, les dcouvertes de la topographie
ocanique et des variations du flux thermique permettent dimaginer
une expansion ocanique par accrtion de matriau remontant
laxe des dorsales, consquence dune convection profonde.

12

Comprendre comment la convergence des observations


ocanographiques avec les mesures de flux thermique a permis
davancer lhypothse dune expansion ocanique ractualisant
lide dune drive des continents.

Programme

04732841_001-021.indd 12

20/07/11 09:13

Connaissances

Capacits et attitudes

La mise en vidence de bandes danomalies magntiques


symtriques par rapport laxe des dorsales ocaniques,
corrlables avec les phnomnes dinversion des ples
magntiques (connus depuis le dbut du sicle) permet dprouver
cette hypothse et de calculer des vitesses dexpansion.

Comprendre comment la corrlation entre les anomalies


magntiques dcouvertes sur le plancher ocanique et la
connaissance plus ancienne de lexistence dinversion des ples
magntiques confirma lhypothse de lexpansion ocanique.
Calculer des taux dexpansion.

Objectifs et mots-cls. Cette tude est loccasion de fournir aux


lves les donnes fondamentales sur le magntisme des roches
(magntite, point de Curie).
[Limites. Un lve doit situer cet pisode de lhistoire des sciences
dans les annes 1960. La mmorisation des dates prcises et
des auteurs nest pas attendue.]
Convergence. Physique: magntisme.
Pistes. Les variations du champ magntique terrestre ; les
inversions magntiques.

Le concept de lithosphre et dasthnosphre


Au voisinage des fosses ocaniques, la distribution spatiale
des foyers des sismes en fonction de leur profondeur stablit
selon un plan inclin. Les diffrences de vitesse des ondes
sismiques qui se propagent le long de ce plan, par rapport
celles qui sen cartent, permettent de distinguer: la lithosphre
de lasthnosphre.
Linterprtation de ces donnes sismiques permet ainsi de
montrer que la lithosphre senfonce dans le manteau au
niveau des fosses dites de subduction.
La limite infrieure de la lithosphre correspond gnralement
lisotherme 1 300 oC.
Objectifs et mots-cls. Distinction claire des notions de :
lithosphre, asthnosphre, crote, manteau, subduction.
(Collge : lithosphre-asthnosphre)
[Limites. On se contente de prsenter la notion de subduction. Le
mcanisme et les consquences gologiques de ce phnomne
seront abords en terminale.]

Saisir et exploiter des donnes sur des logiciels pour mettre


en vidence la rpartition des foyers des sismes au voisinage
des fosses ocaniques.
Comprendre comment linterprtation de la distribution
particulire des foyers des sismes permet :
de dfinir la lithosphre par rapport lasthnosphre ;
de confirmer, dans le cadre du modle en construction, que
la lithosphre ocanique retourne dans le manteau.
Concevoir une modlisation analogique et raliser des mesures
laide de dispositifs dexprimentation assiste par ordinateur
de propagation dondes travers un mme matriau mais
des tempratures diffrentes pour comprendre la diffrence
entre lithosphre et asthnosphre.

Un premier modle global : une lithosphre dcoupe en plaques rigides


la fin des annes soixante, la gomtrie des failles
transformantes ocaniques permet de proposer un modle
en plaques rigides. Des travaux complmentaires parachvent
ltablissement de la thorie de la tectonique des plaques
en montrant que les mouvements divergents (dorsales),
dcrochants (failles transformantes) et convergents (zones
de subduction) sont cohrents avec ce modle gomtrique.
Des alignements volcaniques, situs en domaine ocanique
ou continental, dont la position ne correspond pas des
frontires de plaques, sont la trace du dplacement de plaques
lithosphriques au-dessus dun point chaud fixe, en premire
approximation, dans le manteau.

Raliser une manipulation analogique simple ou utiliser un


logiciel de simulation, pour comprendre que les mouvements
des plaques sont des rotations de pices rigides se dplaant
sur une sphre.
Comprendre comment dsormais des faits ne sintgrant
pas a priori avec le modle initial (volcanisme intraplaque)
permettent un enrichissement du modle (thorie des points
chauds) et non son rejet.
Corrler les directions et les vitesses de dplacements des
plaques tires des donnes palomagntiques avec celles
dduites de lorientation et des ges des alignements
volcaniques intraplaques.

(Collge : plaques lithosphriques)


[Limites. La formalisation mathmatique de la cinmatique
des plaques nest pas attendue.]
Pistes. tude gomtrique de la cinmatique des plaques
(mathmatiques); modlisation des types de failles.
Programme

04732841_001-021.indd 13

13

20/07/11 09:13

Connaissances

Capacits et attitudes

Le renforcement du modle par son efficacit prdictive


Le modle prvoit que la crote ocanique est dautant plus
vieille quon sloigne de la dorsale. Les ges des sdiments
en contact avec le plancher ocanique (programme de forage
sous-marins J.O.I.D.E.S.) confirment cette prdiction et les
vitesses prvues par le modle de la tectonique des plaques.
Le modle prvoit des vitesses de dplacements des
plaques (daprs le palomagntisme et les alignements de
volcans intraplaques). Avec lutilisation des techniques de
positionnement par satellites (GPS), la fin du XXe sicle, les
mouvements des plaques deviennent directement observables
et leurs vitesses sont confirmes.

Saisir et exploiter des informations sur cartes.


Concevoir, raliser et exploiter un modle analogique.
Raliser des mesures sur le terrain pour comprendre le principe
du GPS.
Saisir et exploiter des donnes sur des logiciels.

[Limites. Ltude des forages marins se limite linterprtation


du premier sdiment au contact de la crote magmatique.
Linterprtation des inversions magntiques enregistres dans
les sdiments des carottes de forage nest pas au programme.]
Pistes. Les systmes de positionnement satellitaire (physique,
mathmatiques).

Lvolution du modle : le renouvellement de la lithosphre ocanique


En permanence, de la lithosphre ocanique est dtruite dans
les zones de subduction et produite dans les dorsales.
La divergence des plaques de part et dautre de la dorsale permet
la mise en place dune lithosphre nouvelle partir de matriaux
dorigine mantlique. Dans les zones de subduction, les matriaux
de la vieille lithosphre ocanique sincorporent au manteau.
Objectifs et mots-cls. Il sagit de construire une reprsentation
graphique synthtique du modle global et de fournir aux
lves les donnes essentielles sur le fonctionnement dune
dorsale type.

Recenser, extraire et organiser des informations sur des images


satellitales et de tomographie sismique.
Raliser des modlisations analogiques et numriques pour
tablir les liens entre amincissement de la lithosphre, remonte,
dpressurisation et fusion partielle de lasthnosphre sousjacente et formation dune nouvelle lithosphre.

(Collge : volcanisme)
[Limites. La subduction est localise et simplement prsent
comme un lieu de destruction de lithosphre ocanique, les
phnomnes gologiques associs seront traits en terminale.
On se limite ltude dune dorsale sige de la production dune
lithosphre ocanique complte: les diffrents types de dorsales
ne sont pas au programme. Le moteur de la tectonique des
plaques sera explicit en classe de Terminale.]
Convergences. Physique : changements dtat.
Pistes. Construire un raisonnement sur des donnes gochimiques
(mathmatiques, physique) ; frontires de plaques et risques
naturels (histoire-gographie, mathmatiques).

Thme 2 Enjeux plantaires contemporains


THME 2- A TECTONIQUE DES PLAQUES ET GOLOGIE APPLIQUE
Lobjectif est de montrer que le modle de la tectonique des plaques prsente un intrt appliqu. Sans chercher donner
une vision nave selon laquelle toute application gologique pratique ncessite les concepts de la tectonique des plaques, on
choisira un exemple permettant de montrer que, parfois, ce modle permet de comprendre les conditions dexistence dune
ressource exploitable.
Lexemple sera choisi de faon introduire quelques ides concernant une histoire sdimentaire comprhensible dans le cadre
du modle de la tectonique des plaques.
Deux possibilits sont proposes, lune dapproche locale, lautre plus globale. Le professeur choisira de traiter au moins lune
de ces deux approches.

14

Programme

04732841_001-021.indd 14

20/07/11 09:13

Connaissances

Capacits et attitudes

Premire possibilit : tectonique des plaques et recherche dhydrocarbures


Le choix est fait de sintresser un champ ptrolifre ou gazier situ dans un bassin de marge passive pour comprendre les
principaux facteurs qui conditionnent la formation des gisements. En sappuyant ventuellement sur ce qui aura t tudi en
seconde, il sagit dexpliciter le constat fait alors: les gisements dhydrocarbures sont rares et prcisment localiss.
Le modle de la tectonique des plaques constitue un cadre
intellectuel utile pour rechercher des gisements ptroliers.
partir de ltude dun exemple on montre que la tectonique
globale peut rendre compte:
dun positionnement gographique du bassin favorable au
dpt dune matire organique abondante et sa conservation ;
dune tectonique en cours de dpt (subsidence) et aprs le
dpt qui permettent lenfouissement et la transformation
de la matire organique puis la mise en place du gisement.
La rare concidence de toutes ces conditions ncessaires explique
la raret des gisements dans lespace et le temps.
Objectifs et mots-cls. Lexemple tudi permet de prsenter ce
quest un bassin sdimentaire et quelques exemples de roches
sdimentaires. Il permet aussi de montrer lintrt de la tectonique
des plaques dans la comprhension du phnomne sdimentaire.
[Limites. Une prsentation exhaustive des types de bassins et de
leur contexte godynamique est hors programme. La typologie
des piges ptroliers lest galement]
Pistes. Comprendre limportance conomique dune histoire
gologique (gographie) ; ressources nergtiques et gopolitique
(histoire-gographie). Rechercher dautres contextes de gisements
dhydrocarbures, sur Terre ou ailleurs.

Recenser, extraire et organiser des informations permettant de


reconstituer le contexte gographique et gologique lpoque
du dpt lorigine de lhydrocarbure de lexemple tudi.
Dcouvrir la morphologie et la structure des marges passives
partir des profils de sismique rflexion et/ou des cartes et/
ou des coupes.
Recenser, extraire et organiser des informations, notamment
lors dune sortie sur le terrain.
Analyser les positions relatives des continents et des ocans
(Tthys ou Atlantique) lors des priodes dabsence ou de grande
accumulation de roches-mres ptrolires pour comprendre les
conditions favorables leur dpt.
Modliser la circulation de fluides de densits diffrentes non
miscibles dans des roches permables.
Concevoir une modlisation et suivre un protocole pour
comprendre comment une structure gologique associe
un recouvrement impermable constitue un pige liquide.
Reprer les grandes caractristiques dun bassin sdimentaire
et de quelques roches sdimentaires.

Deuxime possibilit : tectonique des plaques et ressource locale


Un exemple de ressource gologique est choisi dans un contexte
proche de ltablissement scolaire. Son tude (nature, gisement)
permet de comprendre que ses conditions dexistence peuvent tre
dcrites en utilisant le cadre gnral de la tectonique des plaques.

Recenser, extraire et organiser des informations notamment


lors dune sortie sur le terrain.

Objectif et mots-cls. Il sagit de montrer lintrt local et concret


du modle. Tout exemple de matriau gologique dintrt
pratique peut tre retenu. [Limites. Aucune connaissance
spcifique nest attendue.]
THME 2-B NOURRIR LHUMANIT
Le thme Nourrir lhumanit prolonge lapproche globale de lagriculture conduite en seconde. Pour cela, il ncessite la
prsentation de quelques grandes notions concernant les cosystmes et leur fonctionnement. Par comparaison, ltude dune
culture permet de comprendre la conception, lorganisation et le fonctionnement dun agrosystme; celle dun levage amne
lide dimpacts cologiques diffrents selon les agrosystmes. Enfin, ce thme permet de mettre en relation les pratiques
alimentaires individuelles et les problmatiques de gestion de lenvironnement telles que les sciences de la vie et de la Terre
permettent de les aborder scientifiquement.
La production vgtale: utilisation de la productivit primaire.

La production vgtale : utilisation de la productivit primaire


Un cosystme naturel est constitu dun biotope et dune
biocnose. Son fonctionnement densemble est permis par la
productivit primaire qui, dans les cosystmes continentaux,
repose sur la photosynthse des plantes vertes.

tudier un exemple de culture vgtale pour montrer


comment des techniques varies permettent une production
quantitativement et qualitativement adapte aux besoins.

Programme

04732841_001-021.indd 15

15

20/07/11 09:13

Connaissances

Capacits et attitudes

Lagriculture repose sur la constitution dagrosystmes


grs dans le but de fournir des produits (dont les aliments)
ncessaires lhumanit. Un agrosystme implique des flux
de matire (dont leau) et dnergie qui conditionnent sa
productivit et son impact environnemental. Lexportation
de biomasse, la fertilit des sols, la recherche de rendements
posent le problme de lapport dintrants dans les cultures
(engrais, produits phytosanitaires, etc.).
Le cot nergtique et les consquences environnementales
posent le problme des pratiques utilises. Le choix des
techniques culturales vise concilier la ncessaire production
et la gestion durable de lenvironnement.

Faire preuve desprit critique en tudiant la conduite dune


culture quant son impact sur lenvironnement.
Recenser, extraire et exploiter des informations, notamment sur
le terrain, utiliser des bases de donnes et des logiciels pour
comparer les bilans dnergie et de matire (dont leau) dun
agrosystme de production vgtale et dun cosystme peu
modifi par lHomme.
Concevoir et raliser un protocole pour mettre en oeuvre une
culture et analyser ses caractristiques et/ou utiliser des
logiciels modlisant une culture, ses bilans et sa gestion.

Objectifs et mots-cls. Il sagit de quantifier les flux dnergie


et de matire dans lagrosystme de production vgtale
(qualitativement polluants compris et quantitativement).
Cette tude permet de prsenter les principes de la rflexion qui
conduisent une pratique raisonne de lagriculture.
(Collge et Seconde. Premire approche des bases biologiques
de la production agricole.)
[Limites. Aucune exhaustivit nest attendue dans la prsentation
des pratiques agricoles et des intrants.]
Pistes. Agriculture et dveloppement durable ; agriculture
biologique / raisonne (histoire-gographie).

La production animale : une rentabilit nergtique rduite


Dans un cosystme naturel, la circulation de matire et dnergie
peut tre dcrite par la notion de pyramide de productivit.
Dans un agrosystme, le rendement global de la production par
rapport aux consommations (nergie, matire) dpend de la
place du produit consomm dans la pyramide de productivit.
Ainsi, consommer de la viande ou un produit vgtal na pas
le mme impact cologique.

Recenser, extraire et exploiter des informations, utiliser des bases


de donnes et des logiciels pour comparer les bilans dnergie
et de matire (dont leau) de diffrents levages, et comparer
production animale et production vgtale.
Faire preuve desprit critique en tudiant la conduite dun
levage quant son impact sur lenvironnement.

Objectifs et mots-cls. Il sagit de faire comprendre que la


production animale fonde sur une production vgtale
quantitativement abondante se traduit par un bilan de matire
et dnergie plus dfavorable.
Convergence. Gographie (Seconde) leau ressource essentielle.

Pratiques alimentaires collectives et perspectives globales


Les pratiques alimentaires sont dtermines par les ressources disponibles, les habitudes individuelles et collectives selon les
modes de consommation, de production et de distribution. Le but de cette partie est de montrer en quoi les pratiques alimentaires
individuelles rptes collectivement peuvent avoir des consquences environnementales globales.
lchelle globale, lagriculture cherche relever le dfi de
lalimentation dune population humaine toujours croissante.
Cependant, les limites de la plante cultivable sont bientt
atteintes : les ressources (eau, sol, nergie) sont limites tandis
quil est ncessaire de prendre en compte lenvironnement pour
en assurer la durabilit.

16

Recenser, extraire et exploiter des informations, utiliser des


bases de donnes et des logiciels pour comprendre :
limpact global des pratiques alimentaires ;
la gestion de populations et/ou de peuplements naturels.
Recenser, extraire et exploiter des informations sur la varit
des agrosystmes mondiaux et leurs caractristiques.
Recenser et comparer diffrentes pratiques culturales, du point
de vue de leur durabilit (bilan carbone, bilan nergtique,
biodiversit...).
Recenser, extraire et exploiter des informations sur les recherches
actuelles permettant damliorer la production vgtale dans
une logique de dveloppement durable.

Programme

04732841_001-021.indd 16

20/07/11 09:13

Connaissances

Capacits et attitudes

Objectifs et mots-cls. On cherche ici mettre en relation les


pratiques locales et leurs implications globales afin dinstaller
les bases de la rflexion qui conduit aux choix de pratiques. Il
sagit de montrer comment il est possible daborder la rflexion
sur ces questions en termes de bilan plantaire.
[Limites. Il ne sagit pas denseigner les choix qui doivent tre
faits, mais dintroduire les bases scientifiques ncessaires une
rflexion claire sur les choix. Aucune exhaustivit concernant
les pratiques alimentaires nest attendue.]
Convergence : Gographie (Seconde) Nourrir les hommes.

Utiliser des systmes dinformation gographique (SIG) pour


dterminer limportance des besoins (nergie, matire, sol, etc.)
de la production mondiale agricole actuelle (et son volution
rcente).

Thme 3 Corps humain et sant


THME 3- A FMININ, MASCULIN
Ltude de la sexualit humaine sappuie sur les acquis du collge. Dans une optique dducation la sant et la responsabilit,
il sagit de comprendre les composantes biologiques principales de ltat masculin ou fminin, du lien entre la sexualit et la
procration et des relations entre la sexualit et le plaisir. Ces enseignements gagneront tre mis en relation avec dautres
approches interdisciplinaire (philosophie) et/ou intercatgorielle (professionnels de sant). Il sagit daider llve la prise en
charge responsable de sa vie sexuelle.

Devenir femme ou homme


On saisira loccasion daffirmer que si lidentit sexuelle et les rles sexuels dans la socit avec leurs strotypes appartiennent
la sphre publique, lorientation sexuelle fait partie, elle, de la sphre prive. Cette distinction conduit porter lattention
sur les phnomnes biologiques concerns.
Les phnotypes masculin et fminin se distinguent par des
diffrences anatomiques, physiologiques, et chromosomiques.
La mise en place des structures et de la fonctionnalit des
appareils sexuels se ralise, sous le contrle du patrimoine
gntique, sur une longue priode qui va de la fcondation la
pubert, en passant par le dveloppement embryonnaire et ftal.
La pubert est la dernire tape de la mise en place des
caractres sexuels.

Extraire et exploiter des informations de diffrents documents,


raliser des dissections pour :
identifier les diffrences anatomiques, physiologiques et
chromosomiques des deux sexes ;
expliquer les tapes de diffrenciation de lappareil sexuel
au cours du dveloppement embryonnaire.
Traduire les diffrents mcanismes tudis sous la forme de
schmas fonctionnels.

Objectifs et mots-cls. SRY, testostrone, AMH.


(Collge et Seconde. Premire approche de la distinction
hommevfemme et de la pubert.)
[Limites. Les acquis anatomiques du collge seront seulement
rappels.]

Sexualit et procration
Chez lhomme et la femme, le fonctionnement de lappareil
reproducteur est contrl par un dispositif neuroendocrinien
qui fait intervenir lhypothalamus, lhypophyse et les gonades.
La connaissance de ces mcanismes permet de comprendre et
de mettre au point des mthodes de contraception fminine
prventive (pilules contraceptives) ou durgence (pilule du
lendemain). Des mthodes de contraception masculine
hormonale se dveloppent. Dautres mthodes contraceptives
existent, dont certaines prsentent aussi lintrt de protger
contre les infections sexuellement transmissibles.
Linfertilit des couples peut avoir des causes varies. Dans
beaucoup de cas, des techniques permettent daider les couples
satisfaire leur dsir denfant: insmination artificielle, FIVETE,
ICSI.

Traduire les mcanismes de contrle de lactivit gonadique


sous la forme de schmas fonctionnels.
Effectuer des gestes techniques pour raliser diffrentes
observations microscopiques.
Mettre en oeuvre une mthode (dmarche historique) et/ou une
utilisation de logiciels et/ou une pratique documentaire pour
expliquer le mode daction de diffrentes pilules contraceptives.
Extraire et exploiter des donnes pour relier la prvention contre
les IST (SIDA, hpatite, papillomavirus...) la vaccination ou
lutilisation du prservatif.
Recenser, extraire et organiser des informations pour comprendre
les modalits de la procration mdicalement assiste.
Percevoir le lien entre science et technique.
Argumenter, dbattre sur des problmes thiques poss par
certaines pratiques mdicales.
Programme

04732841_001-021.indd 17

17

20/07/11 09:13

Connaissances

Capacits et attitudes

Objectifs et mots-cls. Les mcanismes neuroendocrines de


contrle de la reproduction sont tudis. (Collge et lyce.
Premire approche du fonctionnement de lappareil reproducteur
et de la contraception. Premire approche de la procration
mdicalement assiste.)
[Limites. Les mcanismes cellulaires de laction des hormones, de
mme que les voies de leur synthse, ne sont pas au programme.
Il ne sagit pas de prsenter les techniques de procration
mdicalement assiste mais seulement de montrer que la
comprhension de leurs principes gnraux repose sur des
connaissances scientifiques et dvoquer leur cadre thique.]
Pistes. Biothique (philosophie); hormones naturelles/hormones
synthtiques (chimie).

Sexualit et bases biologiques du plaisir


Lactivit sexuelle est associe au plaisir.
Le plaisir repose notamment sur des phnomnes biologiques,
en particulier lactivation dans le cerveau des systmes de
rcompense .

Mettre en uvre une mthode (dmarche historique) et/ou une


utilisation de logiciels et/ou une pratique documentaire pour
mettre en vidence le systme de rcompense.

Objectifs et mots-cls. Sans chercher laisser croire que les


relations entre sexualit et plaisir ne sexpriment quen termes
scientifiques, on montre quune composante biologique existe.
[Limites. Les mcanismes crbraux du plaisir sont tudis
seulement dune faon globale (activation de zones crbrales)
sans explicitation des phnomnes cellulaires].
Pistes. ducation la sant et la sexualit.
THME 3-B VARIATION GNTIQUE ET SANT
LHomme aussi bien que les microorganismes infectieux susceptibles de lattaquer prsentent une forte variabilit gntique
issue de mutations et conserve au cours des gnrations. Ces variations prsentent des implications en matire de sant: les
Hommes ne sont pas gntiquement gaux devant la maladie et lvolution rapide des microorganismes pose des problmes
en termes de prvention et de traitement. En outre, on insiste sur le fait quen gnral, le dveloppement dune maladie ou la
mise en place dun phnotype dpend de linteraction complexe entre le gnotype et lhistoire personnelle.

Patrimoine gntique et maladie


La mucoviscidose est une maladie frquente, provoque par la
mutation dun gne qui est prsent sous cette forme chez une
personne sur 40 environ. Seuls les homozygotes pour lallle
mut sont malades.
Le phnotype malade comporte des aspects macroscopiques
qui sexpliquent par la modification dune protine.
Ltude dun arbre gnalogique permet de prvoir le risque
de transmission de la maladie.
On limite les effets de la maladie en agissant sur des paramtres
du milieu. La thrapie gntique constitue un espoir de
correction de la maladie dans les cellules pulmonaires atteintes.

Recenser, extraire et organiser des informations :


pour tablir le lien entre le phnotype macroscopique et le
gnotype ;
pour comprendre les traitements mdicaux (oxygnothrapie,
kinsithrapie) et les potentialits offertes par les thrapies
gniques.
tudier un arbre gnalogique pour valuer un risque gntique.

Objectifs et mots-cls. Le but est de comprendre une maladie


gnique. La mucoviscidose est suggre en raison de sa
frquence, mais le professeur pourra, sil le souhaite, choisir
un autre exemple.
Collge et Seconde. Mutation, phnotype, gnotype, relation
gne protine. [Limites: aucune connaissance concernant
une autre maladie gnique nest attendue, mais un lve doit
pouvoir ltudier partir de documents fournis. On se limite au
cas de maladies autosomales.]
Convergences. Mathmatiques : probabilits.

18

Programme

04732841_001-021.indd 18

20/07/11 09:13

Connaissances

Capacits et attitudes

Le plus souvent, limpact du gnome sur la sant nest pas un


dterminisme absolu. Il existe des gnes dont certains allles
rendent plus probable le dveloppement dune maladie sans
pour autant le rendre certain. En gnral les modes de vie et
de milieu interviennent galement et le dveloppement dune
maladie dpend alors de linteraction complexe entre facteurs
du milieu et gnome.
Un exemple de maladie (maladie cardiovasculaire, diabte
de type II) permet dillustrer le type dtudes envisageables.

Recenser, extraire et organiser des informations pour identifier :


lorigine multignique de certaines maladies ;
linfluence des facteurs environnementaux.
Comprendre que dterminer les facteurs gntiques ou non
dune maladie repose sur des mthodes particulires qui
constituent les fondements de lpidmiologie.
Comprendre les conditions de validits daffirmations
concernant la responsabilit dun gne ou dun facteur de
lenvironnement dans le dclenchement dune maladie.
Savoir choisir ses comportements face un risque de sant pour
exercer sa responsabilit individuelle ou collective.

Objectifs et mthodes. Il sagit de montrer aux lves que la


dtermination des causes dune maladie nest possible quen
utilisant un mode de pense statistique. On cherche galement
dvelopper une capacit critique face la simplicit de
certains messages affirmant le rle dterminant de tel facteur,
gntique ou non.
[Limites. Il sagit, partir de lexemple des maladies cardiovasculaires ou du diabte de type II, de montrer les principes
gnraux dune approche pidmiologique, sans formalisme
mathmatique complexe. Il ne sagit nullement de dvelopper
une expertise relle en matire dpidmiologie, mais seulement
de sensibiliser ce type dapproche.]
Pistes. tudes statistiques de problmes de sant
(mathmatiques).

Perturbation du gnome et cancrisation


Des modifications accidentelles du gnome peuvent se produire
dans des cellules somatiques et se transmettre leurs descendantes.
Elles sont lorigine de la formation dun clone cellulaire porteur
de ce gnome modifi. La formation dun tel clone est parfois le
commencement dun processus de cancrisation.
Des modifications somatiques du gnome surviennent par
mutations spontanes ou favorises par un agent mutagne.
Dautres sont dues des infections virales.
La connaissance de la nature des perturbations du gnome
responsable dun cancer permet denvisager des mesures de protection
(vitement des agents mutagnes, surveillance, vaccination).

Recenser, extraire et organiser des informations pour identifier


lorigine des facteurs de cancrisation (agents mutagnes,
infections virales). Comprendre les causes multiples pouvant
concourir au dveloppement de certains cancers (cas des
cancers pulmonaires) et identifier des mesures de prvention
possibles.
Comprendre limportance, en matire de sant publique, de
certains virus lis la cancrisation (hpatite B, papillomavirus)
et connatre les mthodes de prvention possibles.

Collge et Seconde. Mutation, premire approche de la


vaccination.
[Limites. Lintrt de la vaccination nest signal quen sappuyant
sur les acquis du collge: les mcanismes prcis de la vaccination
seront tudis en terminale. La perturbation du gnome par un
virus est prsente de faon globale seulement : ses mcanismes
seront tudis en Terminale.]
Pistes. Cancers et politiques de prvention ; cancer et sant
publique (histoire, gographie, ECJS).

Variation gntique bactrienne et rsistance aux antibiotiques


Des mutations spontanes provoquent une variation gntique
dans les populations de bactries. Parmi ces variations, certaines
font apparatre des rsistances aux antibiotiques.
Lapplication dun antibiotique sur une population bactrienne
slectionne les formes rsistantes et permet leur dveloppement.
Lutilisation systmatique de traitements antibiotiques peut
augmenter la frquence des formes rsistantes par slection
naturelle.

Concevoir et mettre en place un protocole permettant de montrer


la sensibilit de micro-organismes diffrents antibiotiques.
Recenser, extraire et organiser des informations pour :
identifier la sensibilit ou la rsistance de micro-organismes
diffrents antibiotiques ;
pour calculer le taux dapparition de rsistances dans une
population.
Comprendre, sur un exemple, lapplication du raisonnement
volutionniste en matire mdicale.
Programme

04732841_001-021.indd 19

19

20/07/11 09:13

Connaissances

Capacits et attitudes

Collge et Seconde. Mutation, frquence alllique, slection


naturelle. [Limites. Les mcanismes molculaires de la rsistance
aux antibiotiques ne sont pas au programme : si un exemple
est dcrit pour faire comprendre ce dont il sagit, il ne devra
pas tre mmoris.]
Pistes. La rsistance aux antibiotiques, les infections
nosocomiales.
THME 3-C DE LIL AU CERVEAU : QUELQUES ASPECTS DE LA VISION
Les notions doptique de la vision sont tudies en physique, ainsi que quelques donnes essentielles sur la lumire et la
couleur. Sans chercher proposer une tude exhaustive de la physiologie de la vision, cette thmatique est aborde selon trois
approches qui associent des aspects scientifiques et des implications en matire de sant.

Le cristallin : une lentille vivante


Le cristallin est lun des systmes transparents de lil
humain. Il est form de cellules vivantes qui renouvellent en
permanence leur contenu. Les modalits de ce renouvellement
sont indispensables sa transparence.
Des anomalies de forme du cristallin expliquent certains
dfauts de vision. Avec lge, sa transparence et sa souplesse
peuvent tre altres.
Convergences. Physique : optique gomtrique, fonctionnement
optique de lil.

Recenser, extraire et organiser des informations et/ou manipuler


(dissection, maquette et/ou recherche documentaire) pour :
localiser et comprendre lorganisation et le fonctionnement
du cristallin ;
comprendre certains dfauts de vision.

Pistes. Les traitements des dficiences du cristallin.

Les photorcepteurs : un produit de lvolution


La rtine est une structure complexe qui comprend les rcepteurs
sensoriels de la vision appels photorcepteurs. Celle de
lHomme contient les cnes permettant la vision des couleurs
(3 types de cnes respectivement sensibles au bleu, au vert et
au rouge) et les btonnets sensibles lintensit lumineuse.
Les gnes des pigments rtiniens constituent une famille
multignique (issue de duplications) dont ltude permet de
placer lHomme parmi les primates.
Des anomalies des pigments rtiniens se traduisent par des
perturbations de la vision des couleurs.
Le message nerveux issu de lil est achemin au cerveau
par le nerf optique.

Extraire et exploiter des informations (maquette, logiciel et/ou


recherche documentaire et/ou observations microscopiques)
pour :
comprendre lorganisation de la rtine ;
dterminer le rle des photorcepteurs ;
comprendre lorganisation des voies visuelles ;
faire le lien entre la vision des couleurs et lvolution.

Objectifs et mots-cls. Tout en voquant rapidement la complexit


de la rtine et de ses fonctions, il sagit de centrer lattention
sur les cellules photorceptrices. Leur tude permet aussi bien
dvoquer des troubles de la vision colore que de raliser une
premire approche de la place de lHomme dans lvolution.
[Limites. La physiologie de la rtine nest pas aborde. On signale
simplement llaboration globale dun message achemin par
le nerf optique.]
Convergences. Physique : lumire, couleur.
Pistes. Le daltonisme ; la vision des couleurs chez les vertbrs.

Cerveau et vision : aires crbrales et plasticit


Plusieurs aires corticales participent la vision.
Limagerie fonctionnelle du cerveau permet dobserver leur
activation lorsque
lon observe des formes, des mouvements. La reconnaissance
des formes ncessite une collaboration entre les fonctions
visuelles et la mmoire.

20

Exploiter des donnes, notamment exprimentales, pour


comprendre quune image nat des interactions entre diffrentes
aires du cortex crbral.
Recenser, extraire et organiser des informations pour comprendre
le phnomne de plasticit crbrale et son importance dans
ltablissement de diffrentes fonctions cognitives.

Programme

04732841_001-021.indd 20

20/07/11 09:13

Connaissances

Capacits et attitudes

Des substances comme le LSD perturbent le fonctionnement


des aires crbrales associes la vision et provoquent des
hallucinations qui peuvent driver vers des perturbations
crbrales graves et dfinitives.
La mise en place du phnotype fonctionnel du systme crbral
impliqu dans la vision repose sur des structures crbrales
innes, issues de lvolution et sur la plasticit crbrale au
cours de lhistoire personnelle.
De mme, la mmoire ncessaire, par exemple, la reconnaissance dun visage ou dun mot repose sur la plasticit
du cerveau.
Lapprentissage repose sur la plasticit crbrale. Il ncessite la
sollicitation rpte des mmes circuits neuroniques.

Interprter des expriences sur la maturation du cortex visuel


chez lanimal.
Interprter des observations mdicales et/ou des imageries
crbrales chez lHomme.

Objectifs et mots-cls. On cherche montrer comment la


ralisation dune fonction cognitive complexe repose sur lactivit
de plusieurs zones crbrales de faon coordonne. La maturation
des systmes crbraux lis la vision permet, partir dun
nombre limit dexemples, de prsenter la notion de plasticit
crbrale et son lien avec lapprentissage.
[Limites. Il ne sagit pas de prsenter une tude exhaustive des
aires crbrales intervenant dans la vision ni des mcanismes
prcis de la mmoire ou du langage. La notion de plasticit
crbrale est aborde partir dun nombre limit dexemples,
sans souci dexpos exhaustif de ses mcanismes.]

Programme

04732841_001-021.indd 21

21

20/07/11 09:13

22

04732841_022-073.indd 22

29/07/11 11:24

28
42
55
67

23

04732841_022-073.indd 23

29/07/11 11:24

Partie

Expression, stabilit et variation


du patrimoine gntique

Les objectifs gnraux de cette partie


Dans le nouveau programme de la classe de Premire S, cette partie sintgre au thme
plus gnral La Terre dans lUnivers, la vie et lvolution du vivant . Rappelons en effet
que trois thmatiques gnrales structurent dsormais les programmes de chacune des
annes du lyce et se retrouvent donc chaque niveau. Par commodit, les auteurs proposent cependant de bien distinguer cette premire partie de la suivante qui, bien quappartenant au mme thme, est de nature trs diffrente puisque purement gologique.
Les instructions prconisent daccorder 50 % du temps annuel lensemble de cette
grande thmatique. Il est donc raisonnable daccorder 25 % du temps annuel cette
premire partie.
Celle-ci sinscrit dans la continuit dun enseignement de biologie qui trouve une cohrence verticale du collge la classe de Terminale. En effet, au collge, les lves ont
dj effectu, en classe de Troisime, une premire approche des bases gntiques sur lesquelles reposent lunit et la diversit des tres vivants. Lvolution de la biodiversit a t
mise en vidence et relie la variation gntique. Un premier approfondissement a t
ralis en classe de Seconde : la structure de la molcule dADN est dsormais connue, sa
nature code mise en vidence et la biodiversit envisage diffrents niveaux et dans
toutes ses composantes. Le manuel propose donc deux pages qui permettent, sans perte
de temps, de mobiliser les acquis essentiels.
En classe de Premire, lapprofondissement porte tout dabord sur ltude plus prcise de
la division cellulaire et de la rplication de lADN. Ces concepts ne sont pas nouveaux :
en classe de Troisime, les lves ont dj vu que le programme gntique se retrouve
conserv dans toutes les cellules dun mme organisme. Ltude porte donc ici sur les modalits de ces mcanismes, intgrant les connaissances de la classe de Seconde concernant
la molcule dADN : tat des chromosomes, tapes de la mitose, mcanisme semi-conservatif de rplication de lADN.
Il sagit ensuite de montrer sur quoi repose la variabilit de lADN : en effet, lide dune
reproduction conforme de linformation gntique doit tre immdiatement tempre par
lexistence dune variabilit de cette molcule. La part accorde aux mcanismes qui soustendent cette variabilit (tude de laction des agents mutagnes, systmes de rparation
de lADN, devenir des mutations somatiques et germinales) est beaucoup plus importante
que dans les anciens programmes.
Enfin, cette partie du programme aborde les questions de lexpression de linformation
gntique. On retrouve ici les relations classiques entre gnotype et phnotype. Cependant, la dmarche de ce nouveau programme consiste partir de lADN pour envisager
ensuite son expression aux diffrentes chelles : phnotype molculaire dabord (synthse
des protines, code gntique) puis autres chelles du phnotype (cellulaire et de lorganisme) et enfin tude des interactions avec les facteurs environnementaux.
Cette partie du programme permet de mettre en uvre une dmarche dinvestigation :
aprs avoir pos des problmatiques prcises (les pages douverture de chapitre proposent
24

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 24

20/07/11 09:15

des documents permettant de sinterroger), les diffrentes activits permettent de pratiquer une dmarche scientifique : laboration dhypothses, recherche dinformations, exprimentation, etc. Il appartient au professeur deffectuer ces activits de faon guide ou
de laisser plus dautonomie ses lves en proposant, de temps en temps, la pratique
de tches complexes. Cest pourquoi, dans les Pistes dexploitation de chaque activit,
une problmatique gnrale a dabord t pose, suivie de quelques questions plus prcises pour aider lexploitation des documents, sans prjuger de la dmarche de rsolution que lon peut mettre en uvre.
Notons qu plusieurs reprises, il est possible dadopter une dmarche historique ou bien
de complter les activits pratiques par des aperus complmentaires sur lhistoire des
sciences (voir, en particulier, les pages Des cls pour ).
Chaque chapitre peut se prter des approfondissements (suggrs dans le programme
sous lappellation de pistes ) : on trouvera dans le manuel, la fin de chaque chapitre,
des documents Des cls pour aller plus loin pouvant servir de support pour de tels
approfondissements.
Au cours de cette partie du programme, on dveloppera ainsi diverses comptences :
Des connaissances : il sagit tout dabord de prciser la relation entre ADN et chromosomes. Le mcanisme de rplication de lADN est mis en relation avec les diffrentes tapes
de la mitose afin de montrer comment est assure la reproduction conforme de linformation gntique (maintien du caryotype au cours des gnrations cellulaires). Le phnomne
de mutation est prsent comme inhrent au processus mme de rplication et laction des
agents mutagnes est mise en vidence. Les diffrents types de mutations ponctuelles sont
rpertoris et le devenir des mutations est envisag, tant lchelle de lindividu qu celle
de lorganisme. Enfin, le lien est fait entre mutation et biodiversit gntique.
Lexpression de linformation gntique ncessite de comprendre la structure primaire des
protines et le rle essentiel de ces molcules. On dtaille ensuite les tapes de la transcription et de la traduction (existence et rle de lARN messager, code gntique). La maturation des ARN pr-messagers et lpissage alternatif permettent, ds la classe de Premire,
daller au-del du dogme un gne une protine . Le phnotype est envisag aux diffrentes chelles et la complexit des interactions avec les facteurs environnementaux permet de relativiser limportance du dterminisme gntique.
Des capacits : cette partie du programme permet la mise en uvre de nombreuses
capacits exprimentales. Lobservation du rel se fera diffrentes chelles, ncessitant
le recours au microscope optique mais aussi lobservation dlectronographies et lutilisation de logiciels de visualisation de modles molculaires. La mise en vidence des mutations ponctuelles et lexpression de linformation gntique ncessitent de matriser les
logiciels de traitement de squences nuclotidiques et protiques. Diffrentes manipulations sont proposes, ncessitant le respect de protocoles prcis (effets dune irradiation
dune culture de levures par les UV par exemple). Lexploitation et la communication des
observations et des rsultats exprimentaux ncessitent de sapproprier progressivement
le vocabulaire scientifique et les outils de communication comme le dessin dobservation,
le schma, la numrisation dimages notamment.
Des attitudes : dans cette partie, les lves prendront conscience de limportance dun
certain nombre de questions de sant et de la responsabilit tant individuelle que collective : effet des agents mutagnes, risques lis au cancer, maladies gntiques. Certaines
de ces questions seront plus prcisment tudies dans la dernire partie du programme.
Les objectifs gnraux

04732841_022-073.indd 25

25

20/07/11 09:15

Les exprimentations ralises ncessitent le respect de rgles strictes : travail dans des
conditions striles, scurit au laboratoire (utilisation dune lampe UV), etc.
Cette partie du programme est dcoupe en quatre chapitres : le chapitre 1 est consacr
ltude du cycle cellulaire (mitose et rplication de lADN). Le chapitre 2 aborde les questions lies la variabilit de lADN. Le chapitre 3 concerne lexpression de linformation
gntique et les relations gnes-protines. Le chapitre 4 envisage les diffrents aspects
des relations gnotype/phnotype, aux diffrentes chelles.

Une correspondance entre le programme officiel


et les chapitres du manuel
Connaissances

Les chapitres du manuel

Reproduction conforme de la cellule et rplication de lADN chapitre

Les chromosomes sont des structures constantes des cellules


Reproduction conforme et rplication
eucaryotes qui sont dans des tats de condensation variables au
cours du cycle cellulaire. En gnral la division cellulaire est une de lADN (pages 10-29)
reproduction conforme qui conserve toutes les caractristiques Les activits pratiques
du caryotype (nombre et morphologie des chromosomes).
Act. 1 Les chromosomes, lments permanents des cellules
Act. 2 La division cellulaire : une reproduction conforme
Chaque chromatide contient une molcule dADN.
Act. 3 Le mcanisme de la rplication de lADN

Au cours de la phase S, lADN subit la rplication semiAct. 4 Les tapes du cycle cellulaire
conservative. En absence derreur, ce phnomne prserve,
par copie conforme, la squence des nuclotides.
Ainsi, les deux cellules-filles provenant par mitose dune cellulemre possdent la mme information gntique.
Variabilit gntique et mutation de lADN

chapitre

Variabilit gntique et mutation

Pendant la rplication de lADN surviennent des erreurs


de lADN (pages 30-49)
spontanes et rares, dont la frquence est augmente par
laction dagents mutagnes. LADN peut aussi tre endommag Les activits pratiques
Act. 1 Lorigine dune variabilit de lADN
en dehors de la rplication.

Act. 2 Linfluence dune irradiation par les UV

Le plus souvent lerreur est rpare par des systmes


Act. 3 Rparation de lADN et mutations
enzymatiques. Quand elle ne lest pas, si les modifications
Act. 4 Mutations et biodiversit
nempchent pas la survie de la cellule, il apparat une mutation,
qui sera transmise si la cellule se divise.
Une mutation survient soit dans une cellule somatique (elle est
ensuite prsente dans le clone issu de cette cellule) soit dans
une cellule germinale (elle devient alors hrditaire).
Les mutations sont la source alatoire de la diversit des allles,
fondement de la biodiversit.

26

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 26

20/07/11 09:15

Connaissances
Lexpression du patrimoine gntique
La squence des nuclotides dune molcule dADN reprsente
une information. Le code gntique est le systme de
correspondance mis en jeu lors de la traduction de cette
information. quelques exceptions prs, il est commun tous
les tres vivants.
Les portions codantes de lADN comportent linformation
ncessaire la synthse de chanes protiques issues de
lassemblage dacides amins. Chez les eucaryotes, la
transcription est la fabrication, dans le noyau, dune molcule
dARN pr-messager, complmentaire du brin codant de lADN.
Aprs une ventuelle maturation, lARN messager est traduit
en protines dans le cytoplasme.

Les chapitres du manuel

chapitre

Lexpression du patrimoine gntique


(pages 50-71)

Les activits pratiques


Act. 1
Act. 2
Act. 3
Act. 4
Act. 5

La dcouverte des relations entre protines et ADN


Le transfert de linformation gntique
Le langage gntique
La traduction de lARN messager en protine
Du gnome au protome

Un mme ARN pr-messager peut subir, suivant le contexte,


des maturations diffrentes et donc tre lorigine de plusieurs
protines diffrentes.
Lensemble des protines qui se trouvent dans une cellule
(phnotype molculaire) dpend :

chapitre

Gnotype, phnotype et environnement

du patrimoine gntique de la cellule (une mutation alllique


peut tre lorigine dune protine diffrente ou de labsence (pages 72-83)
dune protine) ;
Les activits pratiques
de la nature des gnes qui sexpriment sous leffet de linfluence
de facteurs internes et externes varis.
Le phnotype macroscopique dpend du phnotype cellulaire,
lui-mme induit par le phnotype molculaire.

Act. 1 Le phnotype se dfinit diffrentes chelles


Act. 2 Phnotype molculaire et expression gntique
Act. 3 Linfluence de lenvironnement sur le phnotype

Les objectifs gnraux

04732841_022-073.indd 27

27

20/07/11 09:15

Partie

chapitre

Reproduction conforme
et rplication de lADN
Activits pratiques

Les chromosomes, lments permanents des cellules (p. 12-13)


Connaissances

Capacits et attitudes

Les chromosomes sont des structures constantes des Recenser, extraire et exploiter des informations permettant
cellules eucaryotes qui sont dans des tats de condensation de caractriser le cycle cellulaire.
variables au cours du cycle cellulaire.
Chaque chromatide contient une molcule dADN.

Les intentions pdagogiques


Au dbut de cette partie du programme, on sappuie sur les connaissances acquises par
les lves en classes de Troisime et Seconde (voir Retrouver les acquis pages 8
et 9). Lexistence des chromosomes est connue, ainsi que le fait quils sont constitus
dADN. Laccent est mis dans cette activit sur le fait que les chromosomes sont des
lments prsents en permanence, mais qui changent dtat selon le moment du cycle
cellulaire. Lide essentielle est celle dune condensation plus ou moins importante de lADN au cours du cycle cellulaire ; ce stade, on distinguera seulement la
priode de linterphase et celle de la mitose, sans entrer dans le dtail des diffrentes
phases de chacune de ces deux priodes (ce sera fait ultrieurement au cours de la
dernire activit de ce chapitre, car la phase S, notamment, ne prend son sens que si
lon a dj vu ce qutait la rplication de lADN).
Une dmarche dinvestigation peut tre initie partir du document prsent page10
(Chromosome et ADN). On peut en effet sinterroger sur la relation existant entre
ADN et chromosome (au sens du classique chromosome mitotique).
Le document 1 met en vidence la prsence permanente du matriel chromosomique
au cours du cycle cellulaire. Dans la cellule en division, la coloration au ractif de
Schiff rvle lADN formant des chromosomes nettement identifiables, alors quil
apparat dispers dans le noyau de la cellule en interphase, aucun chromosome (au
sens o les lves se le reprsentent) ntant visible. noter que la coloration de Feulgen, utilisant le ractif de Schiff, est bien spcifique de lADN : la coloration rouge
rsulte dune raction entre le dsoxyribose et la fuchsine. Lobservation des chromosomes mitotiques ou des noyaux interphasiques au microscope optique est tout
fait ralisable par les lves (pour la technique dtaille de la coloration de Feulgen,
voir ci-dessous Ressources complmentaires). Le cas particulier de lobservation
des chromosomes polytniques est propos en exercice page 29.
Le document 2 est un support facilitant ou compltant une activit pratique facilement
ralisable par les lves eux-mmes, rvlant la capacit denroulement de lADN.
28

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 28

20/07/11 09:15

Lutilisation dun logiciel de modlisation molculaire permet de visualiser un modle


de nuclosome, de raliser des mesures : contrairement ce que lon pourrait penser,
la molcule dADN ne se prsente jamais sous la forme dun simple filament mais est
enroulautour de corpuscules protiques Sans entrer dans les dtails, ce rle structurel des histones sera simplement signal.
Le document 3 vise tablir clairement lorganisation dun chromosome. La notion
de chromosome double , constitu de deux chromatides, par rapport au chromosome simple , une chromatide, a dj t vue en Troisime ; elle est essentielle
pour la comprhension du chapitre et pour la suite des tudes scientifiques (Terminale S notamment). Dans cette perspective, et pour viter des confusions frquentes
chez les lves, il apparat indispensable de matriser le vocabulaire essentiel associ
la description dun chromosome (centromre, bras courts et longs, chromatides).
Lidentit des deux chromatides dun mme chromosome est connue depuis la classe
de Troisime. Rappeler cette identit est un pralable ncessaire pour comprendre
comment la division cellulaire assure la rpartition intgrale de linformation gntique entre deux cellules-filles (activits pratiques 2). On peut aussi dj poser cette
occasion la problmatique du mcanisme de lobtention de ces deux copies identiques
de linformation gntique : ce sera lobjet des activits pratiques 3.
Mais lobjectif de ce document est de faire comprendre que dans un chromosome
mitotique, lADN est hyper-condens : un raisonnement associant ltude du schma,
lobservation des microphotographies et les donnes chiffres permet alors de proposer une explication : grce des enroulements successifs, 8,2cm dADN sont en effet
empaquets sur 7m de longueur et 0,7 m de largeur dans le chromosome humain 1.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 : Sur la photographie a, lADN forme des corps colors bien identifiables, les
chromosomes. Ces lments sont invisibles sur la photographie b, alors que lADN est
pourtant prsent, comme le rvle la coloration au ractif de Schiff. Dans ce cas, les
molcules ADN apparaissent diffusent, disperses dans lensemble du noyau cellulaire.
Doc. 3 : LADN est prsent des degrs de condensation diffrents selon le moment
du cycle cellulaire auquel la cellule se trouve.
Sur la photographie a, les molcules dADN sont trs condenses, surenroules sur
elles-mmes et forment des chromosomes courts et pais, bien observables. Sur la
photographie b, les molcules dADN sont peu condenses : elles sont donc plus longues et forment des amas filamenteux enchevtrs.
Doc. 2 et 3 : En passant de linterphase la mitose, chaque filament dADN se surenroule sur lui-mme : cet tat trs condens forme un chromosome bien individualis. La transformation inverse se produit lors du passage de la mitose linterphase.
Doc. 1 3 : Les chromosomes sont des lments permanents car ils restent prsents
chaque priode du cycle cellulaire. Cependant, ils sont visibles au microscope de faon
individualise uniquement lorsque les molcules dADN qui les constituent se surenroulent sur elles-mmes dans un tat maximal de condensation, ce qui ne se produit
que lors de la mitose. Pendant linterphase, le matriel chromosomique est bien prsent, mais les chromosomes sont invisibles au microscope car les molcules dADN
ne sont pas condenses.
Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 29

29

20/07/11 09:15

Synthse : rponse au problme rsoudre


Les diffrents aspects prsents par le matriel gntique au cours de la vie dune cellule dpendent de ltat plus ou moins condens dans lequel se trouvent les molcules
dADN. Pendant la mitose, les molcules dADN sont enroules sur elles-mmes,
trs condenses. Elles forment alors des btonnets courts et pais, bien individualiss, facilement observables : ce sont les chromosomes. En interphase, les molcules
dADN sont peu condenses et forment des amas diffus de molcules enchevtres.

3. Ressources complmentaires
Manuel numrique Bordas : vido du modle molculaire dun nuclosome.
Site ressources Bordas : modle molculaire (fichier pdb ) dun nuclosome.
Observer des chromosomes au microscope optique(Les SVT au lyce

Jean-Jacques Auclair):
http://jean-jacques.auclair.pagesperso-orange.fr/travaux/chromo/chromo1.htm

30

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 30

20/07/11 09:15

Activits pratiques

La division cellulaire : une reproduction conforme (p. 14-15)


Connaissances

Capacits et attitudes

En gnral, la division cellulaire est une reproduction Recenser, extraire et exploiter des informations permetconforme qui conserve toutes les caractristiques du tant de caractriser le cycle cellulaire et ses phases, dans
caryotype (nombre et morphologie des chromosomes). diffrents types cellulaires.
Effectuer un geste technique en observant au microscope
des divisions de cellules eucaryotes.

1. Les intentions pdagogiques


Le fait que les chromosomes soient des lments permanents des cellules ayant t
tabli au cours de lactivit 1, cette seconde activit vise dcouvrir leur comportement au cours de la division cellulaire.
Conformment au programme, cette activit prcde ltude de linterphase et de la
duplication de lADN. Cependant, cette tude ne prend son sens que si lon a dj
bien compris quau dbut de la division cellulaire, linformation gntique est prsente
dans la cellule mre en double exemplaire (chaque chromosome est double ) : ceci
peut et doit tre considr comme un acquis (vu en classe de Troisime et rappel au
cours de lactivit prcdente). Ltude de linterphase, qui est lobjet de lactivit suivante, portera donc sur la recherche des mcanismes qui assurent cette duplication.
Dans un premier temps, cette activit propose une observation concrte de cellules en
mitose, afin dtablir le droulement de lensemble du phnomne en classant des prises
de vues dans un ordre chronologique. Le document 1 prsente donc dabord un protocole permettant lobtention de prparations microscopiques contenant des cellules en
mitose. La coloration lorcine actique, facile raliser, est trs efficace mais dautres
techniques peuvent tre utilises (voir ci-dessous Ressources complmentaires ).
Cette activit ncessite de mettre en uvre de diffrentes capacits exprimentales :
suivre un protocole, raliser une prparation microscopique, utiliser le microscope,
raliser des photographies ou faire des dessins dobservation. Les diffrentes observations ralises par les lves pourront tre mutualises, mises en commun (il est en effet
difficile dobtenir en une seule prparation des cellules tous les stades de la mitose).
Les clichs obtenus peuvent tre compars aux six photographies du document 1 (ici
volontairement non classes dans lordre chronologique), afin de sassurer que lensemble des stades de la mitose a t obtenu ; il faudra ensuite les classer dans un ordre
logique et dcrire le comportement des chromosomes. Si certains stades nont pas t
observs, les photographies a f peuvent servir de document de secours.
Le document 2 propose de se focaliser sur deux moments-cls de la mitose afin dy
dcrire le comportement prcis des chromosomes et de bien comprendre la signification essentielle de ce phnomne. Les clichs obtenus par les lves lors de leur propre
manipulation ne pouvant atteindre cette dfinition, ltude de ces photographies (qui
peut faire lobjet de la ralisation de croquis) est complmentaire de lactivit propose par le document 1 pour la dcouverte de lensemble du droulement de la mitose.
Les deux photographies de la mtaphase et de lanaphase ont une excellente dfinition et un
format tel quelles permettent (presque) de distinguer individuellement les 16chromosomes
Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 31

31

20/07/11 09:15

contenus dans la cellule. Les chromosomes sont bien visibles ltat rpliqu sur la photographie a, avec leur net alignement lquateur de la cellule. La photographie b met
en vidence la formation de deux lots de chromosomes gaux en nombre, et ne comportant visiblement chacun quune seule chromatide. On montre ainsi les deux tapescls qui permettent la conservation du mme caryotype dans les deux cellules-filles.
lissue de cette tude, le comportement des chromosomes a t dcrit en totalit :
pour vrifier et associer les noms des quatre phases caractristiques de la mitose, on
proposera aux lves de se reporter au schma bilan page 23 (ou de sa version anime sur le manuel numrique). Il est galement possible de faire constater la gnralisation de ce phnomne aux cellules animales en utilisant lexercice 7 page 27.
Ltude du fuseau de division nest pas au programme : cependant, si lon juge ncessaire ou opportun de lenvisager simplement, on pourra utiliser lexercice 6 page 26.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 : Les cellules en mitose sont celles dont les chromosomes sont visibles (ADN
condens, voir activits pratiques 1). Ce sont donc les trois cellules du centre de la
plus grande image (diagonale du bas gauche vers le haut droite), ainsi que celles
des images b, d, e et f.
Dans les cellules en interphase, le noyau est bien dlimit et color mais les chromosomes ne sont pas visibles car lADN nest pas condens : ce sont les six cellules du
haut de la grande photographie et les deux photographies a et c.
Doc. 1 : Lordre chronologique est : c / f / e / b / d / a.
c : Cellule dont lenveloppe nuclaire est prsente, sans chromosome visible (interphase).
f : Les chromosomes sont visibles dans le noyau, dont lenveloppe tend disparatre.
e : Les chromosomes sont aligns lquateur de la cellule (les fibres composant
le fuseau de division sont visibles).
b : Les chromosomes scartent de lquateur et se partagent en deux lots, lun se
dirigeant vers la gauche et lautre vers la droite de la photo.
d : Deux lots de chromosomes sont constitus chacun des ples de la cellule.
a : Une cloison transversale est apparue, sparant la cellule-mre en deux cellulesfilles contenant chacun un des lots de chromosomes forms ltape prcdente.
Doc. 1 et 2 : Voir le bilan et le schma bilan des pages 20 23, notamment pour nommer les diffrentes phases de la mitose.

Synthse : rponse au problme rsoudre


Au cours de la division cellulaire, lADN se condense et les chromosomes sindividualisent. Les chromosomes se placent ensuite dans un mme plan ( quateur de la cellule ).
Puis, chaque chromosome se clive longitudinalement de telle sorte que les deux chromatides de chaque chromosome migrent chacune vers un ple de la cellule. Enfin, le cytoplasme se spare pour constituer les deux cellules et lADN se dcondense dans chacun
des deux noyaux. Ainsi, chaque cellule hrite du mme bagage chromosomique(mme
nombre et mmes types de chromosomes) : le caryotype initial est conserv.

3. Ressources complmentaires
Manuel numrique Bordas : vido(montage de microphotographies) La mitose .
Observer des chromosomes au microscope optique(Les SVT au lyce Jean-Jacques Auclair):

http://jean-jacques.auclair.pagesperso-orange.fr/travaux/chromo/chromo1.htm
32

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 32

20/07/11 09:15

Activits pratiques

Le mcanisme de la rplication de lADN (p. 16-17)


Connaissances

Capacits et attitudes

Au cours de la phase S, lADN subit la rplication semi- Mettre en oeuvre une mthode (dmarche historique) et/ou
conservative. En absence derreur, ce phnomne prserve, une utilisation de logiciels et/ou une pratique documentaire
par copie conforme, la squence des nuclotides.
permettant de comprendre le mcanisme de rplication
semi-conservative.

1. Les intentions pdagogiques


Le partage des chromosomes constat lors de lactivit prcdente pose le problme de lobtention de chromosomes doubles , deux chromatides, partir de
chromosomes simples , une chromatide, pralable indispensable la ralisation
de la mitose.
Rappelons qu ce stade, les lves savent que chaque chromatide contient une molcule dADN : la problmatique nest donc pas de dcouvrir la duplication de lADN
mais de comprendre comment cette duplication du matriel gntique est assure.
La dmarche propose dans cette activit est en grande partie historique : le mcanisme de la rplication imagin par Watson et Crick ds 1953 est prsent schmatiquement dans le document 1, et sa validation ultrieure par lexprience de Taylor
constitue le document 3.
En effet, comme on peut le constater dans la clbre publication de Watson et Crick
concernant la structure de lADN (voir ci-dessous Ressources complmentaires ), cest
bien la dcouverte de la structure de lADN qui a immdiatement suggr une hypothse
concernant le mcanisme de rplication semi-conservatif. Celui-ci est prsent dans une
version simplifie (les fragments dOkazaki ne sont pas mentionns), conformment
aux instructions du programme. Dans ce mcanisme, les deux brins dADN sont copis
simultanment sous laction de lADN-polymrase. De plus, on en est ici au stade dun
principepropos comme hypothse : limportant est de faire comprendre que chaque
brin de la molcule initiale sert de matrice pour la constitution dun brin noform.
Le document 2 apporte des complments tangibles, confortant la ralit de ce phnomne. On prsente dabord la figure classique de lil de rplication, avec un dtail
dune des fourches de rplication permettant de comprendre le mode daction de
lADN-polymrase. Une activit exprimentale de modlisation molculaire est ralisable, afin de montrer le complexe enzymatique de rplication en action.
Le document 3 revient sur les aspects historiques : il sagit dexpliquer aux lves
comment on a pu prouver la ralit du mcanisme hypothtique imagin par Watson
et Crick. Les expriences de Taylor (ralises en 1957 sur des plantes comme Vicia
faba et Bellevalia romana, donc des organismes eucaryotes) sont quasiment contemporaines de celles ralises par Meselson et Stahl en 1958 sur des procaryotes. Le
document expose lune des expriences de Taylor mais, si lon prfre, il est tout fait
possible dutiliser lexprience de Meselson et Stahl qui figure en exercice page 28.
Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 33

33

20/07/11 09:15

Lexprience de Taylor est complexe : elle ne peut tre comprise dlves de Premire
que si lon a dj tabli lhypothse du mcanisme semi-conservatif. Elle ncessite
une tude approfondie des conditions exprimentales et la ralisation de schmas des
diffrents stades.
Au pralable, il faut avoir bien compris :
quune chromatide correspond une molcule dADN ;
quune molcule dADN est forme de deux brins complmentaires.
Le vocabulaire doit tre bien maitris (ne pas confondre brin dune molcule dADN
et chromatide).
Ainsi, la mise en relation des conditions exprimentales avec les connaissances sur
la constitution des chromosomes (activit 1) et les autoradiographies historiques de
Taylor abouti la validation du mcanisme de la rplication tel quil est prsent dans
le document1 :
Aprs un cycle cellulaire sur milieu froid , chaque chromatide (donc chaque
molcule dADN) dun chromosome double est constitue dun brin ancien ayant
incorpor T radioactif et dun brin noform ne contenant pas de T radioactif. De ce
fait la radioactivit est dtectable dans les deux chromatides (bien comprendre quil
suffit que lun seulement des brins dune molcule dADN soit radioactif pour que la
chromatide impressionne lmulsion photographique).
Aprs deux cycles cellulaires et donc deux rplications sur milieu froid , chaque
chromosome double sera constitu dune molcule dADN forme de deux brins non
radioactifs et dune molcule dADN possdant un brin radioactif et lautre non.
Ceci est parfaitement conforme au mcanisme semi-conservatif propos dans le
document 1.
Pour aller plus loin, il est alors possible dexpliquer le mcanisme mis en uvre dans
la polymrisation en chane de lADN (PCR) : voir Des cls pour , page 24,
et le diaporama sur la PCR propos en ressources complmentaires dans le manuel
numrique Bordas.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 : Le mcanisme de la rplication est dit semi-conservatif car dans chacune
des molcules-filles dADN obtenues on retrouve un brin provenant de la molculemre de dpart et un brin nouvellement synthtis. Seul lun des deux brins est nouvellement form, par complmentarit des nuclotides avec lancien brin, ce dernier
tant donc conserv .
Doc. 2 : Ltude dun modle dADN-polymrase en action permet de distinguer le
complexe enzymatique de rplication, la molcule dADN initiale avec ses deux brins,
le brin dADN noform.
Doc. 1 et 3 : Voir schmas page suivante.

34

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 34

20/07/11 09:15

1re rplication
dans le milieu
sans
T radioactif

Molcule
dADN 2 brins
radioactifs

1re mitose
dans le milieu
sans
T radioactif

2e rplication
dans le milieu
sans
T radioactif

Molcule dADN
1 brin (ancien)
radioactif

Molcule dADN
1 brin (ancien)
radioactif

Molcule dADN
sans brin
radioactif

Synthse : rponse au problme rsoudre


La molcule dADN est rplique lidentique par un mcanisme semi-conservatif,
bas sur la complmentarit des nuclotides : chaque brin de la molcule dADN initiale sert de matrice pour la synthse dun deuxime brin complmentaire.

3. Ressources complmentaires
Manuel numrique Bordas : Animation La rplication de lADN .
Manuel numrique Bordas : Fiche documentaire Biographie de Watson et Crick .
Site ressources Bordas : Modle molculaire (fichier pdb ) de lADN-polymrase.
Manuel numrique Bordas : Diaporama Lamplification en chane par polymrase

ouPCR .
A Structure for Deoxyribose Nucleic Acid : Nature n171 (1953)

http://www.nature.com/nature/dna50/watsoncrick.pdf

Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 35

35

20/07/11 09:15

Activits pratiques

Les tapes du cycle cellulaire (p. 18-19)


Connaissances

Capacits et attitudes

Au cours de la phase S, lADN subit la rplication Recenser, extraire et exploiter des informations permettant
semi-conservative.
de caractriser le cycle cellulaire et ses phases.
Les deux cellules-filles provenant par mitose dune cellulemre possdent la mme information gntique.

1. Les intentions pdagogiques


Cette dernire activit du chapitre propose une synthse qui permet de caractriser
plus prcisment les diffrentes phases du cycle cellulaire. Mais surtout, il parat indispensable de bien montrer la complmentarit des phnomnes tudis au cours des
activits prcdentes : on montre ainsi que linterphase prpare la mitose et que lensemble de ces deux phnomnes constitue un cycle. La problmatique du ncessaire
contrle dun tel cycle sera pose, prparant ainsi ltude des causes du cancer, envisage dans la dernire partie du programme.
Le document 1 permet de montrer le partage du matriel gntique au cours de la
mitose en faisant appel des informations issues de lactivit 1 (coloration de lADN
dans le noyau dune cellule en interphase), de lactivit2 (droulement de la mitose,
partage des chromosomes) et de lactivit 3 (utilisation de prcurseurs radioactifs de
lADN, comme dans lexprience de Taylor). La rpartition de la radioactivit de la
cellule-mre entre les deux cellules-filles illustre clairement le partage mis en vidence dans lactivit 2.
Le document 2 permet de revenir sur la rplication de lADN en prcisant ses consquences sur la quantit dADN dans les cellules. Lexistence dune phase de rplication implique qu un instant t, il existe simultanment :
des cellules contenant une quantit simple dADN, pour lesquelles la rplication na pas encore dbut ;
dautres cellules possdant une quantit double dans lesquelles la rplication
est acheve ;
et enfin des cellules possdant une quantit intermdiaire, pour lesquelles la rplication est en cours.
Cest ce que montre ce graphique, obtenu par traitement de mesures de cytomtrie en
flux avec le logiciel WINMDI (voir ressources complmentaires ci-dessous). Il est
dailleurs possible de raliser une tude plus approfondie de faon montrer comment
on peut, partir du dnombrement de cellules ayant incorpor un prcurseur, valuer
la dure des phases du cycle cellulaire.
Ce graphique est mettre en relation avec le document 3, graphique classique de la
quantit dADN en fonction du temps, afin dy reprer les diffrentes priodes correspondant aux trois types de cellules prcits.
Le graphique du document 3 permet aussi de situer la mitose par rapport la rplication, et de constater leur alternance, aboutissant la notion de cycle cellulaire.
Les documents 2 et 3 sont aussi rapprocher du document 4, qui prsente le cycle
cellulaire avec ses diffrentes phases. On peut alors associer les diffrentes phases du
36

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 36

20/07/11 09:15

cycle (G1 / S / G2 / mitose) aux priodes A, B, C, D du graphique du document 3. Les


dures des diffrentes phases pourront galement tre relies aux donnes de cytomtrie en flux pour constater leur cohrence.
Enfin, lexistence de points de contrle est mentionne, introduisant ainsi lide que
le droulement du cycle cellulaire nest pas automatique, quil est rgul. Cette notion
nest pas dtailler mais elle est importante pour envisager dans la dernire partie
du programme (chapitre 3, activits 4 et 5 p. 286-289) le processus de cancrisation.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 : Lexprience du document 1 confirme le partage du matriel gntique de
la cellule-mre entre les deux cellules-filles. En effet, la cellule de la photo a prsente un ADN totalement radioactif (aprs culture sur milieu radioactif pendant plusieurs cycles cellulaires) ce qui aboutit un grand nombre de taches noires. Comme
la culture se poursuit sur milieu non radioactif, les nouveaux nuclotides incorpors
lors de la rplication ne sont pas radioactifs. Les taches noires visibles sur lautoradiographie proviennent donc bien de lADN de la cellule-mre, et lon constate quelles
sont moins nombreuses, et en quantit quivalente dans les deux cellules. Elles ont
donc hrit chacune dune moiti de lADN de la cellule-mre.
Doc. 2 et 3 : On note sur le graphique obtenu par cytomtrie en flux quune majorit des cellules contient une quantit dADN de 2 UA. Un autre pic, moins important, est observ pour 4 UA, et un nombre plus faible de cellules contient une quantit dADN intermdiaire.
Les cellules ayant une quantit simple dADN (2UA) sont celles qui sont en phase A
sur le graphique du document 3. Comme cette phase est la plus longue, il est logique
qu un instant t, on dnombre plus de cellules dans cet tat.
Les cellules dont la quantit dADN varie entre 2 et 4 UA sont les cellules correspondant la phase B, au cours de laquelle lADN est rpliqu.
Enfin, les cellules qui ont une quantit double dADN (4 UA) sont celles qui ont termin la rplication, mais pas encore subi la mitose : elles correspondent la phase C.
Elles sont moins nombreuses car cette phase est plus courte.
Doc. 3 et 4 : On parle de cycle cellulaire car lissue dune interphase suivie dune
mitose, on obtient deux cellules-filles qui sont dans le mme tat que la cellule-mre
initiale. Le phnomne peut ainsi se rpter : une interphase (comprenant les phases
G1, S puis G2) succde une mitose, suivie dune interphase, etc.
Doc. 1 4 : Le document 1 correspond la mitose.
Dans le document 2, les cellules les plus nombreuses (1er pic) sont en phase G1, le
second pic correspond aux cellules en phase G2, et les cellules ayant une quantit
dADN intermdiaire sont en phase S.
Dans le document 3, la priode A correspond la phase G1, la priode B correspond
la phase S, la priode C la phase G2 et la priode D correspond la mitose.

Synthse : rponse au problme rsoudre


Les principales tapes dun cycle cellulaire sont linterphase et la mitose. Linterphase
est dcoupe en une phase G1 de dure trs variable, une phase S pendant laquelle
lADN est rpliqu et une phase G2 qui prcde la mitose.
Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 37

37

20/07/11 09:15

3. Ressources complmentaires
tude du cycle cellulaire Exploitation de donnes de cytomtrie en flux

avec le logiciel WinMdi (Les SVT au lyce Jean-Jacques Auclair):


http://jean-jacques.auclair.pagesperso-orange.fr/cycle%20cellulaire/winmdi.htm
Suivi de la quantit dADN au cours dun cycle cellulaire par cytofluoromtrie

(ACCES- INRP):
http://acces.inrp.fr/acces/logiciels/externes/winmdi/winmdi-et-cycle-cellulaire/accycle.htm

38

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 38

20/07/11 09:15

Exercices

p. 26 29

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, p.350.

6 Une substance anticancreuse


a. Faux. Au contraire cette substance empche le droulement de la mitose.
b. Faux. Le taxol ne dtruit pas les cellules.
c. Vrai. En stoppant la mitose, le taxol soppose la multiplication cellulaire.
d. Vrai. En empchant la rtraction des fibres du fuseau, le taxol rend lanaphase
impossible. La mitose est donc bloque en mtaphase.

7 Le droulement de la mitose dune cellule animale


1.
d. Interphase
b. Prophase
a. Mtaphase
e. Anaphase
f. Tlophase
2. Se reporter au schma bilan page 23.
3.
d. Interphase: tape pendant laquelle les chromosomes sont dcondenss et pendant laquelle se droule la rplication de lADN.
b. Prophase: Condensation de lADN pour former des chromosomes bien individualiss.
a. Mtaphase: Regroupement des chromosomes dans le plan quatorial de la cellule.
e. Anaphase: Migration des deux lots de chromatides vers chacun des deux ples
de la cellule.
f. Tlophase : Sparation des deux cellules-filles, reformation du noyau avec
dcondensation des chromosomes.

8 Un antibiotique en action
Ltude du modle molculaire montre que la quinone vient se loger sur la gyrase
prcisment dans le site destin fixer et drouler lADN. On peut donc penser que
la quinone empche ainsi la gyrase deffectuer son action. De ce fait, lADN ne peut
tre localement droul et ne pourra tre rpliqu. La cellule ne pourra donc pas se
diviser en deux cellules contenant chacune une copie de linformation gntique.
Comme la gyrase est spcifique des bactries, cest une substance qui bloque la multiplication bactrienne.

9 Lexprience de Meselson et Stahl


1. Si lon admet le modle de rplication semi-conservative :
dans le tube 3, toutes les molcules dADN comportent un brin dADN avec 15N
et un brin dADN avec 14N. Toutes les molcules dADN ont donc la mme densit, intermdiaire entre celle des molcules dADN avec 15N et celles des molcules
dADN avec 14N.
Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 39

39

20/07/11 09:15

Tube 3

Duplication sur milieu avec 14N

en noir : brin avec 15N


en gris : brin avec 14N

dans le tube 4, la moiti des molcules dADN comportent un brin dADN avec
15N et un brin dADN avec 14N, lautre moiti comporte des molcules dADN comportant que des brins avec 14N.
Tube 4

2e duplication sur milieu avec 14N

Les rsultats obtenus sont donc parfaitement en accord avec le modle de rplication
semi-conservative de lADN.
2.

3/4 des molcules avec 14N


1/4 des molcules avec 14N/15N

aspect
du tube

40

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 40

20/07/11 09:15

10 La mitose vue sous un angle inhabituel


1. Cette phase est la mtaphase car les chromosomes sont tous regroups dans un
mme plan.
2.
Un chromosome
deux chromatides

Mtaphase de la mitose (vue polaire)

11 Lobservation de chromosomes particuliers


Les chromosomes polytniques sont au moins 10 fois plus gros que les chromosomes
habituellement observs.

Chapitre 1. Reproduction conforme et rplication de lADN

04732841_022-073.indd 41

41

20/07/11 09:15

Partie

chapitre

Variabilit gntique et mutation de lADN


Activits pratiques

Lorigine dune variabilit de lADN (p. 32-33)


Connaissances

Capacits et attitudes

Pendant la rplication de lADN surviennent des erreurs Recenser, exploiter et interprter des bases de donnes
spontanes et rares, dont la frquence est augmente pour mettre en vidence linfluence dagents mutagnes
par laction dagents mutagnes. LADN peut tre aussi sur des populations humaines (UV, benzne, etc.).
endommag en dehors de la rplication.

1. Les intentions pdagogiques


Lexistence dune variabilit de lADN est un fait qui a dj t tabli en classe de
seconde. Le premier objectif de cette activit est donc trs prcis : en sappuyant notamment sur les connaissances du chapitre 1 de la partie 1, il sagit avant tout dexpliquer
une origine possible cette variabilit delADN. Puisque les lves ont vu que lADN
tait intgralement rpliqu au cours de linterphase, on comprend aisment quune
erreur dappariement puisse survenir de temps en temps au cours de la rplication (aucun
systme de copie nest infaillible). La question de la frquence de ces erreurs se pose
alors. Le document 1 explique clairement que des erreurs spontanes peuvent survenir au cours de la rplication de lADN, mme si leur frquence est faible. Linfluence
dagents mutagnes comme le benzne, qui augmentent la frquence de ces erreurs
dappariement, sera facilement comprise laide du modle molculaire prsent ici.
Le pictogramme qui figure ct du texte associ ce document pourra tre utilis
pour sensibiliser les lves aux questions de scurit au laboratoire : des produits
comme le benzne doivent tre clairement tiquets et leur utilisation est soumise
des rgles trs prcises. noter que ltiquetage des produits chimiques volue : le
pictogramme prsent ici est celui qui doit dsormais tre utilis pour dsigner des
produits dangereux pour la sant (produits cancrignes, mutagnes, toxiques pour
les organes, la reproduction, etc.).
Le rglement CLP, Classification, Labelling and Packaging, dfinissant de nouvelles
rgles europennes de classification, dtiquetage et demballage des produits chimiques,
est entr en vigueur le 20 janvier 2009.
ce stade de ltude, on vitera autant que possible dutiliser le terme de mutation (il sera cependant difficile de lviter totalement) : en effet, il sagit ici de dterminer quels sont les mcanismes lorigine dune variabilit de lADN. Cependant,
comme on le verra dans lactivit suivante, ces erreurs sont souvent rpares : il est
donc prfrable de rserver le terme de mutation aux erreurs qui ne seront pas rpares, donc inscrites durablement dans le programme gntique cellulaire, et qui pourront, par consquent, tre transmises aux cellules-filles.
42

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 42

20/07/11 09:15

Le document 2 prsente les effets des rayonnements, principaux agents mutagnes auxquels sont soumises les populations humaines. Les dangers associs aux rayons X pourront tre rapprochs du document (photographie du haut), page 30 ( pour sinterroger ).
Lexamen du modle molculaire met en vidence un effet des UV : des liaisons covalentes se forment entre nuclotides adjacents, crant ainsi ce que lon appelle des
dimres. De tels dimres empchent le bon fonctionnement de lADN-polymrase.
Ce modle molculaire est disponible en vido sur le manuel numrique Bordas ;
le fichier pdb est propos en tlchargement sur le site ressources.
Le document 3 propose diffrentes donnes permettant de faire une tude plus pousse
mettant en vidence les dangers des rayonnements UV dans une des rgions du globe
terrestre les plus concernes, lAustralie. Un lien de cause effet lien pourra tre tabli
avec les problmatiques lies lenvironnement (amincissement de la couche dozone).
Lexercice 6 page 46 pourra tre utilis en complment ainsi que les informations de la
page Des cls pour aller plus loin page 44, qui concernent, cette fois-ci, la France.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: La mutation de lADN est un phnomne rare car une erreur dappariement au
cours de la rplication de lADN nintervient quavec une frquence trs faible : seulement une erreur pour 10millions de nuclotides rpliqus. Cependant, tant donn
le nombre de nuclotides dans lADN dune cellule (6,4 milliards de paires de nuclotides), on comprend quaprs chaque rplication, lADN dune cellule comporte ncessairement plusieurs erreurs : la mutation de lADN est donc un phnomne trs banal.
Doc. 1 et 2: Les agents mutagnes ne provoquent pas directement une modification
de la squence des nuclotides de lADN. Ils modifient lADN de telle sorte que le
fonctionnement de lADN-polymrase est perturb : ainsi, ils augmentent la frquence
des erreurs au cours de la rplication. Les agents mutagnes ont donc pour effet daugmenter la frquence des mutations.
Doc. 3: En Australie, le nombre de cancers de la peau (mlanomes) est plus important que dans dautres pays et ce nombre a augment au cours des dernires dcennies. Or, comme lindique la carte, lAustralie se caractrise par une forte intensit
du rayonnement ultraviolet parvenant au sol (du fait notamment de lamincissement
de la couche dozone). On peut donc penser que cette forte exposition aux UV provoque une augmentation de la frquence des mutations de lADN des mlanocytes,
cause de laugmentation des cas de cancers de la peau.

Synthse : rponse au problme rsoudre


Les mutations sont dues des erreurs se produisant spontanment au cours de la rplication de lADN. Des altrations de la molcule dADN peuvent aussi se produire en
dehors des priodes de rplication. Un agent mutagne est un agent (substances chimiques
comme le benzne, rayons UV, etc.) dont laction augmente la frquence des mutations.

3. Ressources complmentaires
Manuel numrique Bordas : vido de lADN altr par les UV.
Site ressources Bordas : fichier pdb dune molcule dADN altre par les UV.
Dossier de lINRS (nouvel tiquetage des produits chimiques) :

http://www.inrs.fr/htm/frame_constr.html?frame=/INRS-PUB/inrs01.nsf/IntranetObjectaccesParReference/A%20735/%24File/Visu.html
Scurit Solaire :
http://www.soleil.info/la-securite-solaire/espace-presse/banque-images/index-uv1.html
Australian Bureau of Meteorology(index UV) : http://www.bom.gov.au/uv/index.shtml
Mto France(index UV) :
http://france.meteofrance.com/france/meteo?PREVISIONS_PORTLET.path=previsionsuv
Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 43

43

20/07/11 09:15

Activits pratiques

Linfluence dune irradiation par les UV (p. 34-35)


Connaissances

Capacits et attitudes

Pendant la rplication de lADN surviennent des erreurs Concevoir et raliser un protocole pour analyser linfluence
spontanes et rares, dont la frquence est augmente de lirradiation dune culture de levures par des UV (suivi
par laction dagents mutagnes. LADN peut aussi tre du taux de mortalit).
endommag en dehors de la rplication.
Le plus souvent lerreur est rpare par des systmes
enzymatiques. Quand elle ne lest pas, si les modifications
nempchent pas la survie de la cellule, il apparat une
mutation, qui sera transmise si la cellule se divise.

1. Les intentions pdagogiques


Cette activit reprend dans les grandes lignes ce qui tait dj pratiqu auparavant en
classe de Seconde (ancien programme). Cependant, lobjectif est double : en effet, on
pourra mettre en vidence dune part leffet mutagne, dautre part leffet ltal dune
exposition de culture de levures au rayonnement ultraviolet.
Le document 1 permet de distinguer clairement deux souches de levuresde la mme
espce (Saccharomyces cerevisi) : le dterminisme gntique de la couleur prise
par les colonies de levures pourra tre simplement dduit du fait que cette couleur se
transmet au cours des divisions cellulaires lorsque les levures des deux souches sont
mises en culture. Ce constat nest cependant quune approximation trs grossire. Il
sera nanmoins suffisant pour mener bien cette activit.
ce stade, il apparat donc totalement inutile dentrer dans les dtails de la voie de
biosynthse responsable de cette coloration et des gnes qui la gouvernent, dautant
que les mcanismes biochimiques en cause peuvent tre complexes et interagissent
avec le milieu (dioxygne et temprature notamment). Il serait vain de vouloir donner
plus dexplications car les lves nont pas encore les connaissances concernant les
relations gnotype/phnotype permettant une comprhension plus prcise des mcanismes en cause.
Pour le professeur, il peut cependant tre utile de disposer des informations suivantes
afin doptimiser les conditions de russite de cette activit.
Les levures normales sont de couleur blanche.
Les levures mutantes sont de couleur rouge car elles portent une version mute du
gne Ade2 (en toute rigueur, on devrait donc les noter Ade2 mais par commodit,
elles sont le plus souvent dnommes Ade2). Or, ce gne code pour une enzyme de
la chane de biosynthse de ladnine. Si le milieu est carenc en adnine, les levures
engagent la chane des ractions biochimiques qui devraient normalement permettre
la biosynthse de ladnine mais dans ce cas, celle-ci est stoppe. En effet, du fait de
la mutation du gne Ade2, le compos intermdiaire Amino Imidazole Ribotide (not
AIR ) nest plus transform, il saccumule et soxyde en pigment rouge ( noter que
ce pigment tant toxique, les colonies de levures rouges sont parfois plus petites) :
44

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 44

20/07/11 09:15

gne Ade2
enzyme

prcurseur

AIR

prcurseur

Adnine

pigment rouge
Lexposition aux UV de levures Ade2 augmente la frquence de mutations qui rtablissent le phnotype blanc. Il peut sagir de vritables mutations rverses qui rtablissent le fonctionnement normal du gne Ade2, mais il peut aussi sagir de diverses
mutations affectant dautres gnes codant pour les enzymes de la chane de biosynthse de ladnine (pas de formation dAmino Imidazole Ribotide) ou encore de mutations affectant les gnes de la chane doxydations respiratoires (pas doxydation de
lAmino Imidazole Ribotide en pigment rouge).
noter :
Les levures Ade2 ne poussent pas si le milieu est totalement carenc en adnine. Si
le milieu est riche en adnine, elles nengagent pas la chane de biosynthse de ladnine et prennent alors une couleur blanche. Elles ne prennent une couleur rouge que
lorsque le milieu ne couvre pas tous les besoins ncessaires en adnine.
Lapparition de la couleur rouge du pigment ncessite un dlai (4-5 jours), une temprature optimale (28 30C) et la prsence de dioxygne (ne pas utiliser de parafilm). De plus, le pigment rouge est dgrad et commence disparatre au bout dune
dizaine de jours environ.
Le manuel propose les grandes lignes dun protocole exprimental. Il sera possible
dassocier les lves sa conception. Cependant, cette manipulation ncessite le respect trs strict de certaines prcautions. Le manuel numrique Bordas propose un
diaporama prcis et complet qui permet aux lves de raliser cette activit en toute
autonomie et scurit.
On trouvera, la page 49, un exercice dvaluation des capacits exprimentales ici
mises en uvre, exercice qui complte cette activit en montrant lefficacit de protections solaires (lunettes et crme) sur des levures sensibles aux UV.
Le document 2 prsente quelques rsultats avec trois photographies de qualit, directement exploitables (possibilit de dnombrement) : il peut donc servir de document de substitution si les rsultats obtenus par les lves ne savrent pas satisfaisants. Deux possibilits dexploitation et de prsentation des rsultats sont suggres
(tableau et graphe).
Ltude compare des squences gntiques des deux souches de levures est prsente
dans lactivit pratique 3 (document 2 page 37). Elle pourra donc tre ralise pour
complter cette approche exprimentale.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: On constate que les levures blanches tales sur la premire bote de Petri
ont donn des colonies de couleur blanche. De mme, les levures rouges tales sur
la deuxime bote de Petri ont donn des colonies de couleur rouge. En effet, chaque
levure dpose sur le milieu de culture a form par divisions cellulaires successives
un clone cellulaire correspondant une colonie. La conservation de la couleur initiale montre que la division cellulaire est une reproduction conforme, transmettant
les caractristiques gntiques de la cellule-mre (ici la couleur) aux cellules-filles.
Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 45

45

20/07/11 09:15

Doc. 2: On constate, dans tous les cas, que des colonies de levures se sont formes mais
que des colonies blanches sont apparues. Plus le temps dexposition est lev, moins il
y a de colonies au total, mais la proportion de colonies blanches est plus importante.
Doc. 3: Lapparition de colonies blanches sexplique par une mutation de linformation gntique des colonies rouges. Le graphique montre que le pourcentage de colonies blanches augmente en fonction du temps dexposition aux UV.

Synthse : rponse au problme rsoudre


Lirradiation de la culture de levures rouges par les UV produit deux effets :
une diminution du nombre global de colonies, cest leffet ltal, des levures ont t
tues par lexposition aux UV ;
une augmentation de la frquence de colonies de levures mutantes blanches, cest
leffet mutagne.

3. Ressources complmentaires
Kit mutagense Sordalab(Souche Ade2 et milieu de culture) :

http://www.sordalab.com/catalogue/produit.php?numprod=451
Manuel numrique Bordas : diaporama prsentant le protocole exprimental prcis

permettant aux lves de raliser lexprience de faon autonome.

46

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 46

20/07/11 09:15

Activits pratiques

Rparation de lADN et mutations (p. 36-37)


Connaissances

Capacits et attitudes

Le plus souvent lerreur est rpare par des systmes Utiliser des logiciels pour caractriser des mutations.
enzymatiques. Quand elle ne lest pas, si les modifications
nempchent pas la survie de la cellule, il apparat une
mutation, qui sera transmise si la cellule se divise.

1. Les intentions pdagogiques


Cette activit introduit une nouveaut par rapport ce qui tait couramment enseign
en lyce : en effet, on ne peut passer sous silence lexistence dun contrle et dune
rparation de lADN. En fait, il ny a vritablement mutation que lorsquune erreur
chappe aux systmes de rparation de lADN. Ceci explique que la frquence relle
des mutations est largement infrieure la frquence des erreurs de rplication.
Le document 1 prsente simplement le principe de ce contrle et de cette rparation
de lADN. En fait, il existe de multiples systmes enzymatiques : leur tude dtaille
et systmatique ne relve videmment pas du programme de Premire. Ltude dun
modle molculaire peut nanmoins savrer judicieuse de faon montrer concrtement que des enzymes sont susceptibles de se lier lADN pour le rparer. Il sagit
ici dune photolyase rparant un dimre de thymine : cet exemple a t choisi de faon
poursuivre ltude de laltration de lADN par les UV amorce au cours des activits prcdentes. Le manuel numrique Bordas propose une squence vido de ce
mme modle. Le fichier pdb , utilisable avec un logiciel de visualisation molculaire, est tlchargeable sur le site ressources Bordas.
Un schma prsente, de faon volontairement simplifie, les tapes de ce contrle et de
cette rparation. L galement, le manuel numrique en propose une version anime.
Enfin, il convient de sinterroger sur le devenir dune erreur non rpare en envisageant ce qui rsulte de la rplication suivante : on constate alors que le brin dADN
possdant lerreur conduira la formation dune molcule dADN possdant une paire
de nuclotides diffrant de la squence initiale. On obtient ainsi une mutation ponctuelle, inscrite dans le patrimoine gntique dune cellule et donc transmissible aux
cellules-filles (ce sera lobjet de lactivit pratique 4).
Le document 2 propose une autre approche consistant reprer lexistence de mutations par comparaison de squences nuclotidiques : cette tude, mene avec un logiciel
de traitement de squences nuclotidiques (Anagne ou GnieGen), permet de caractriser les trois principaux types de mutations ponctuelles prsentes par le document 3.
noter que lun des exemples permet de prolonger ltude mene chez les levures en
comparant deux versions du gne Ade2.
Les squences nuclotidiques utilises ici sont disponibles en tlchargement sur le
site ressources Bordas.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: Il est primordial que les cellules possdent des systmes efficaces de rparation
de lADN de faon corriger les erreurs invitablement commises au cours de la rplication
Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 47

47

20/07/11 09:15

de lADN ou encore les diverses altrations de lADN. En effet, sans ces systmes, la
frquence des mutations serait beaucoup plus leve et leurs consquences, nfastes pour
les cellules (effet ltal, effet mutagne), seraient beaucoup plus importantes.
Doc. 1 : Il y a vritablement mutation de lADN lorsquune altration de lADN
chappe aux systmes enzymatiques de contrle et de rparation de lADN.
Doc. 2: Les logiciels de traitement de squence comportent une fonction de comparaison mettant en vidence les diffrences entre les squences nuclotidiques.
Ainsi, il apparat que les deux squences du gne Ade2 de la levure diffrent au niveau
du nuclotide 103.
Pour les allles du gne de la globine-bta :
la squence de lallle bta-S montre une diffrence avec la squence de lallle
bta-A au niveau du nuclotide 20 ;
la squence de lallle bta-Th1 montre un dcalage avec la squence de lallle
bta-A partir du nuclotide 20 ;
la squence de lallle bta-Th2 montre un dcalage avec la squence de lallle
bta-A partir du nuclotide 28.
Doc. 2 et 3: La diffrence entre les deux allles du gne Ade2 de la levure est une
mutation par substitution (substitution de G en T en position 103). Il en est de mme
pour la diffrence entre les allles bta-S et bta-A du gne de la globine-bta (substitution du nuclotide A en T en position 20). Lallle bta-Th1 rsulte dune mutation
par dltion du nuclotide A en position 20. Lallle bta-Th2 rsulte dune mutation
par addition dun nuclotide C en position 28.

Synthse : rponse au problme rsoudre


LADN est rpar grce des enzymes qui vrifient les erreurs commises au cours
de la rplication, remplacent les nuclotides mal apparis ou rparent les lsions de
lADN. Nanmoins, certaines erreurs chappent aux systmes de rparation et constituent des mutations : ainsi, dans une squence dADN, il peut y avoir substitution,
dltion ou addition dune paire de nuclotides.

3. Ressources complmentaires
Manuel numriqueBordas :

vido du modle molculaire dune photolyase rparant undimre de thymine ;


animation illustrant le principe du contrle et de la rparation de lADN par un systme
enzymatique ;
fiche documentaire La maladie de Huntington : une enzyme de rparation de lADN
en cause .
Logiciel Anagne (SCEREN-CNDP/INRP) :

http://www2.cndp.fr/lesScripts/bandeau/bandeau.asp?bas=http://www2.cndp.fr/svt/anagene/
accueil.htm
Logiciel GenieGen (Acadmie dAmines) :

http://pedagogie.ac-amiens.fr/svt/spip/rubrique.php3?id_rubrique=40
Site ressources Bordas : fichiers tlchargeables du modle molculaire dune photolyase,

des squences nuclotidiques du gne Ade2 chez la levure et de quatre allles du gne
de la globine-bta humaine.

48

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 48

20/07/11 09:15

Activits pratiques

Mutations et biodiversit (p. 38-39)


Connaissances

Capacits et attitudes

Une mutation survient soit dans une cellule somatique (elle Recenser et exploiter des informations permettant de
est ensuite prsente dans le clone issu de cette cellule) soit caractriser la diversit alllique dune population.
dans une cellule germinale (elle devient alors hrditaire).
Les mutations sont la source alatoire de la diversit des
allles, fondement de la biodiversit.

1. Les intentions pdagogiques


partir du moment o une erreur nest pas rpare et quune mutation est inscrite dans
le patrimoine gntique dune cellule, il est logique de sintresser au devenir possible dune mutation. Dans cette activit, lobjectif essentiel sera de faire comprendre
que si une mutation peut avoir des consquences trs ngatives pour un individu, le
phnomne de mutation est essentiel comme gnrateur de la biodiversit alllique
dune espce. En fait, le risque individuel associ au phnomne de mutation est le
prix payer pour lexistence dune biodiversit gntique lchelle dune population ou dune espce.
Une premire distinction fondamentale faire est celle qui existe entre mutation somatique et mutation germinale. Le document 1 prsente un exemple spectaculaire de mutation somatique : une cellule somatique mute a t lorigine dun secteur mutant correspondant ici la moiti de cette pomme. Certains seront peut-tre dubitatifs devant
cette photographie, (suspectant un maquillage Photoshop !). Son authenticit est
pourtant avre : cette pomme a t rcolte par M. Ken Morrish, un arboriculteur du
Devon, en septembre 2009 (des informations complmentaires peuvent facilement tre
obtenues, voir par exemple ci-dessous un lien vers un article de la BBC).
De fait, lexistence de secteurs mutants affectant gomtriquement une partie de
lorganisme nest pas rarissime chez les vgtaux : partir dune cellule mute, il se
forme un clone de cellules mutes restant groupes, proximit les unes des autres
(par exemple un rameau, un ptale ou un secteur de ptale dune fleur, une portion
dun fruit, etc.).
Il convient de bien prciser que les graines ne sont pas concernes : un simple rappel
de lorganisation de la fleur vue au collge peut permettre de prciser lorigine diffrente des ppins (pollen et pistil) et du fruit (rceptacle de la fleur). Cette mutation nest donc pas transmissible la descendance et ne concernera que cette pomme.
Le document 2 explique quelles conditions une mutation peut tre transmise la
descendance de lindividu. La condition est double : il faut dune part que la mutation se produise dans une cellule du tissu germinal mais aussi que la cellule mute
soit effectivement lorigine dun nouvel individu, donc participe la fcondation.
Alors toutes les cellules du nouvel individu seront porteuses de la mutation. noter
que dans ce cas, lindividu chez qui la mutation sest produite nest en gnral pas
concern par les effets directs de la mutation.
Lintrt du document 3 est dexpliquer quune nomutation devient hrditaire. Apparue pour la premire fois chez un individu, une mutation peut ensuite tre transmise de
Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 49

49

20/07/11 09:15

gnration en gnration. Bien noter que dans ce document, les deux squences dADN
reprsentes pour chaque individu ne sont pas les deux brins dune molcule dADN
mais les deux squences des deux allles situs sur les deux chromosomes homologues : un seul brin dADN est reprsent pour chaque allle. Le phnomne initial de
nomutation na rien dexceptionnel : dans le cas de la myopathie de Duchenne par
exemple, on estime que lanomalie gntique est due dans 30% des cas une nomutation (elle nexiste chez aucun des deux parents).
Le document 4 prsente lintrt de donner une estimation chiffre. Ces informations
ont t publies dans larticle Origine du polymorphisme de lADN, revue INRA Productions Animales, 2000, hors-srie Gntique molculaire (voir lien ci-dessous).
Pour lhomme, la formule de calcul prend en compte lge car les mitoses partir
des spermatogonies se produisent tout au long de la vie : le risque de mutations augmente donc avec lge. Il ne sagit pas ici de comprendre dans le dtail la faon dont
ce calcul est effectu mais de faire simplement constater que finalement tout spermatozode, tout ovule, donc tout nouvel individu, est ncessairement porteur dun certain nombre de mutations.
Lexemple prsent par le document 5 illustre parfaitement la notion, difficile mais
essentielle, apprhender et qui est lobjectif principal de cette activit. Le choix de
la diversit des allles HLA est un bon exemple, dune part car cette diversit est particulirement importante, dautre part parce quelle illustre bien lunicit gntique
des individus et donc la biodiversit gntique des populations.
Les diffrences de frquence entre les diffrentes populations nont pas de vritable
signification biologique : elles soulignent laspect alatoire du phnomne de mutation.
Donnes chiffres, graphiques ou cartes similaires ceux publis ici peuvent tre
obtenus en consultant la base de donnes The Allele Frequency Net Database
(lien ci-dessous).

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: Un organisme peut porter une mutation dans toutes ses cellules si cette
mutation est prsente dans la cellule-uf. Elle a t apporte par lun des gamtes
et sest donc produite dans une cellule germinale de lun des parents, lorigine du
gamte ayant particip la fcondation.
Doc. 3: Lapparition du cas de cancer la deuxime gnration est due une mutation
affectant le gne P53, gne qui exerce normalement un rle protecteur contre le cancer. Comme lanomalie dcele chez cet individu nexiste pas chez ses deux parents,
on peut affirmer quil sagit dune nomutation, apparue dans une cellule germinale de
lun des deux parents. Cette mutation devient alors transmissible (hrditaire) : lindividu qui en a hrit la transmise son fils.
Doc. 3 et 4: De nouveaux allles peuvent apparatre partir dun allle prexistant
qui subit une mutation dans une cellule germinale. La nouvelle version du gne pourra
alors tre transmise la descendance de lindividu et devient hrditaire, transmissible de gnration en gnration.
Doc. 5: Cest en effet grce au phnomne de mutation que de nouveaux allles peuvent se constituer et ensuite se transmettre. Ainsi, dans une espce, il existe souvent
de nombreux allles diffrents pour un mme gne,comme ici pour les gnes HLA.
Cest donc bien le phnomne de mutation qui est lorigine de la biodiversit gntique des espces.
50

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 50

20/07/11 09:15

Synthse : rponse au problme rsoudre


La diversit des allles dun gne, qui caractrise les diffrentes populations, provient des mutations qui peuvent affecter un gne initial, crant ainsi diffrentes versions de ce gne.

3. Ressources complmentaires
Des informations complmentaires sur la curieuse pomme, prsente par le document 1 :

http://news.bbc.co.uk/2/hi/uk_news/england/devon/8275419.stm
Lorigine des diffrentes parties dune pomme :

http://www.snv.jussieu.fr/bmedia/Fruits/pomme.htm
Lorigine du polymorphisme de lADN (INRA Prod. Anim., HS 2000, 37-43) :

http://www.inra.fr/productions-animales/spip.php?article728&PHPSESSID=35ef5b88212de
1fd0720d2f0ed965545
The Allele Frequency Net Database :

http://www.allelefrequencies.net/

Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 51

51

20/07/11 09:15

Exercices

p. 46 49

La correction des exercices 1 4 figure dans le manuel de llve, p.350.

6 Slip, Slop, Slap, Seek, Slide


(dans la premire impression du manuel, une faute de frappe figure dans le titre : le
dernier mot est bien Slide et non Side ).
a. Faux. Cette campagne de prvention sadresse aussi aux adultes. Mme si les jeunes
enfants sont particulirement vulnrables, les dangers des UV solaires concernent les
personnes de tout ge.
b. Vrai.
c. Vrai.
d. Faux. Dans lhmisphre Nord aussi, le rayonnement UV peut parfois tre trs
intense. Il existe aussi des bulletins dalerte aux UV en France par exemple.

5 Une mutation qui favorise les mutations


1. Les individus atteints de Xeroderma pigmentosum ont un risque trs lev de dvelopper un cancer de la peau.
Ils sont plus sensibles leffet mutagne des UV : 24 h aprs une exposition aux UV,
le nombre de dimres de thymine prsents dans leurs cellules est beaucoup plus lev
que chez les individus sains, surtout si la dose reue est importante. Par exemple, pour
une dose de 100, le nombre de dimres de thymine est 7 fois plus lev chez les individus atteints de Xeroderma pigmentosum.
Le second graphique montre que, chez un individu sain, la quantit de thymine prsente ltat de dimre diminue trs rapidement : ceci est d la rparation de lADN
effectu par les enzymes de rparation de lADN qui dtectent et corrigent ces anomalies. Chez les individus atteints de Xeroderma pigmentosum, la quantit de thymine
prsente ltat de dimre est la mme au dbut mais reste constante. Ceci montre que
le Xeroderma pigmentosum est d un dficit de la rparation de lADN.
2. Chez les deux malades, on constate que le gne qui permet de produire lenzyme
XPf rparatrice de lADN est modifi : un ou plusieurs nuclotides de la squence
sont diffrents. Il sagit de mutations par substitution de nuclotides. Comme cette
enzyme intervient dans la rparation des dimres de thymine, on peut penser quelle
est modifie chez les personnes atteintes et quelle naccomplit plus correctement son
rle. Les mutations dues aux UV ne sont alors plus rpares. Lindividu est donc beaucoup plus sensible leffet mutagne des UV.

8 Un labrador au phnotype rare


1. Il sagit ici dun cas de mutation somatique car la mutation naffecte quune partie
(non germinale) de lanimal. Loreille possde lallle E alors que le reste du pelage
ne le possde pas. Sil sagissait dune mutation germinale hrite par Spotty de lun
des gamtes de ses parents, toutes ses cellules possderaient lallle mut.
2. Cette mutation a d se produire au cours du dveloppement embryonnaire de Spotty
dans une cellule qui a t lorigine de toutes les cellules qui apparaissent colores
(pelage au niveau de loreille).
52

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 52

20/07/11 09:15

9 Une tude statistique des mutations affectant un gne


1. La squence de delF508 diffre de la squence CFTR partir du nuclotide 1522 :
on constate un dcalage de trois nuclotides correspondant une dltion des trois
nuclotidesT conscutifs en position 1522, 1523, 1524.
La squence GR42X diffre de la squence CFTR par la substitution du nuclotide G
en T en position1624. De telles diffrences sont dues des mutations de la squence
initiale. Il sagit probablement derreurs commises pendant la rplication de lADNet
qui ont ensuite chapp aux systmes de contrle et de rparation.
2.
Segments du gne CFTR

6a

13

Gne entier

Longueur (en paires de nuclotides)

53

111

216

90

164

182

724

4 444

Nombre de mutations diffrentes

27

33

120

31

51

10

159

1 312

0,51 0,30 0,56 0,34 0,31 0,05 0,22

0,30

Rapport

Nombre de mutations/
Longueur du segment

3.
Nombre de mutations/Longueur du segment

6a

13

gne
entier

Les mutations ne sont pas uniformment rparties dans le gne : le segment 6a par exemple
se caractrise par une frquence de mutations trs faible par rapport aux autres segments.

10 Tester lefficacit des protections solaires


Effet de lirradiation de la culture par les UV, sans crme solaire
Pourcentage de levures survivantes

Dure dexposition
aux UV (en s)
Chapitre 2. Variabilit gntique et mutation de lADN

04732841_022-073.indd 53

53

20/07/11 09:15

Efficacit dune protection par crme solaire (irradiation de 20 s)


Pourcentage de levures survivantes

Indice de protection

54

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 54

20/07/11 09:15

Partie

chapitre

Lexpression du patrimoine gntique


Activits pratiques

La dcouverte des relations entre protines et ADN (pages 52-53)


Connaissances

Capacits et attitudes

Les portions codantes de lADN comportent linformation Recenser, extraire et exploiter des informations permettant
ncessaire la synthse de chanes protiques issues de de caractriser les protines comme expression primaire
de linformation gntique.
lassemblage dacides amins.

1. Les intentions pdagogiques


Cette activit pratique a pour objectif dune part de familiariser les lves avec lorganisation des protines et limportance des acides amins (notion fondamentale pour
comprendre les implications du phnotype lchelle molculaire), dautre part dtablir la relation entre la succession des nuclotides dun gne et celle des acides amins de la protine correspondante (colinarit gne/protine).
Ltude de la structure de lhmoglobine (document 1) sinscrit dans un rappel des
chelles dorganisation du vivant abordes en classe de Seconde. Lobjectif est daboutir la notion selon laquelle les protines sont des macromolcules constitues dune
succession de molcules lmentaires : les acides amins. Cette organisation pourra tre
mise en parallle avec celle de lADN, dj connue. Sur un plan historique, lhmoglobine a t un sujet dtude essentiel pour la dmonstration de la relation un gne/
une protine par le squenage partiel de lhmoglobine sicklmique par Vernon
Ingram (1956). Cet exemple sera repris au chapitre suivant.
Limportance du rle des protines en relation avec leur composition en acides amins et leur structure est la notion essentielle aborde dans le document 2. Ce document permet ainsi de gnraliser les observations prcdentes. Ltude de la structure
dautres protines, en relation avec leur squence et leur fonction peut tre envisage
(insuline par exemple : voir Ressources complmentaires ci-dessous).
Quelques tapes historiques de la dmonstration de la relation entre gne et protine
sont reprises dans le document 3. Beadle et Tatum ont t les premiers mettre au
point un protocole exprimental rigoureux pour tablir les gnes mis en jeu dans des
chanes mtaboliques. Le concept un gne, une enzyme avait dj t formul
par le mdecin britannique Archibald Garrod (1909) au travers de ltude de maladies mtaboliques humaines. Ces rsultats exprimentaux tant difficiles interprter sans formation en gntique formelle, le document insiste davantage sur les expriences de Yanofsky (voir les ressources complmentaires ci-dessous) qui ont permis
de dmontrer lhypothse de la colinarit entre gne et protine. Ces expriences ont
ncessit le travail dquipes nombreuses pendant plusieurs annes afin dtablir la
squence de lenzyme dune part et dautre part la carte gntique des recombinaisons
Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 55

55

20/07/11 09:15

bactriennes. Il est noter que comme lune des cartes est une carte gntique et lautre
un squenage, le rapport de proportionnalit entre les distances nest pas parfait mais
correspond la meilleure trace accessible, plus de dix ans avant que le squenage de
lADN soit disponible. Par ailleurs, Yanofsky estimera plus tard avoir eu de la chance
de travailler sur un gne bactrien lpoque o le morcellement des gnes eucaryotes
ntait pas encore connu !

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: Une protine est une molcule de grande dimension constitue dune succession dacides amins, replie dans lespace. LADN est constitu de deux chanes
de nuclotides complmentaires, enroules en hlice. Ces deux macromolcules sont
des chanes de petites molcules. Leur organisation spatiale est par contre diffrente.
Doc. 2: Les protines ont diverses proprits qui dpendent de lordre prcis dans
lequel sont enchains leurs acides amins. Un plan de fabrication est donc ncessaire
pour que les cellules produisent des protines.
Doc. 3: Un gne code pour une protine. La position des mutations dans lADN correspond la position des acides amins modifis dans la squence de la protine. La
suite des nuclotides dun gne code pour la suite des acides amins de la protine
correspondante.
Doc. 1 3: Un gne est une portion dADN contenant les informations ncessaires
pour quune cellule produise un enchanement prcis dacides amins afin de former
une protine.

Synthse : rponse au problme rsoudre


Une protine est une succession linaire dacides amins. Cette succession est dtermine par linformation contenue dans un gne, cest--dire une suite de nuclotides
de lADN. Ainsi, la squence des nuclotides dun gne contrle la squence des
acides amins dune protine.

3. Ressources complmentaires
Manuel numrique Bordas : deux vidos La structure de lhmoglobine,

La structure delinsuline.
Site ressources Bordas : modles molculaires de lhmoglobine, de la -globine.
Journal of Biological Chemistry : article de synthse, par Yanofsky, au sujet

desestravaux autour de lhypothse nonce par Beadle One gene, one enzyme
(voir en 7epage la carte complte des mutations de la tryptophane synthase) :
http://www.jbc.org/content/278/13/10859.full.pdf+html

56

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 56

20/07/11 09:15

Activits pratiques

Le transfert de linformation gntique (pages 54-55)


Connaissances

Capacits et attitudes

Chez les eucaryotes, la transcription est la fabrication, Mettre en uvre une mthode (dmarche historique) et/ou
dans le noyau, dune molcule dARN pr-messager, com- une utilisation de logiciels et/ou une pratique documentaire
permettant dapprocher le mcanisme de la transcription,
plmentaire du brin codant de lADN.
et de la traduction.

1. Les intentions pdagogiques


Lobjectif principal de cette activit est de dcouvrir la transcription de lADN en ARN.
Cependant, la notion dARN pr-messager suppose de comprendre dj la notion
dARN messager. Cest pourquoi, pour que ce processus soit bien compris des lves
de Premire, les auteurs ont choisi de prsenter dabord lexistence et le rle de
lARNmessager, dexpliquer classiquement la transcription puis la traduction, avant
de revenir, au cours de lactivit 5, sur ltape de la maturation de lARN pr-messager.
La premire page sattache faire comprendre le rle et les proprits de lARNm,
tandis que la seconde rvle son mcanisme de synthse.
La localisation de la synthse protique (document1), est mise en vidence par un
marquage fluorescent. Lobjectif est de comprendre que chez les eucaryotes, lADN
est compartiment dans le noyau tandis que la synthse protique prend place dans
le cytoplasme.
Pour information : la publication originale, do est tire cette photographie (voir ressources complmentaires ci-dessous), est une tude de la localisation de la synthse
de lactine dans des cellules de myoblaste. Le gne a t modifi pour que les premiers acides amins du polypeptide intgrent un motif (ttracystine) dont les proprits catalytiques rvlent une couleur rouge (coloration au ReAsH). Cest le commencement de la traduction qui est donc rvl ici. La couleur verte est due un motif
GFP qui est plac la suite dans la construction gntique (permet de suivre le trajet
de la protine dactine forme).
Le document 2 permet de formuler une hypothse quant au problme de la diffrence
de compartimentation entre linformation gntique et son lieu dexpression, en mettant en vidence le lieu de synthse de lARN et sa migration dans le cytoplasme.
Cette hypothse peut tre confirme en comparant la structure de lADN avec celle
dun ARN correspondant. Ainsi, le document3 prsente une comparaison entre un
modle dun fragment dARN messager et un fragment dADN correspondant. La
correspondance entre la squence de lARN et celle du brin non transcrit est confirme par la comparaison des squences du dbut du gne de la bta-globine. Lutilisation dun logiciel de visualisation molculaire pourra montrer la diffrence chimique
entre le ribose de lARN et le dsoxyribose de lADN. Enfin, on pourra remarquer
que les filaments dARN peuvent adopter des conformations trs variables (et diffrentes de lhlice de lADN). La similarit entre les squences dARN et dADN permet dintroduire lide dune copie de lun des brins dADN.
Le mcanisme de cette transcription de lADN est tudi au travers du document4.
La micrographie lectronique replace le phnomne dans son contexte biologique et
Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 57

57

20/07/11 09:15

temporel. Le modle dARN-polymrase associe un ADN double brin et un ARN


en cours de synthse montre, laide de la coloration par nuclotides choisie, la complmentarit entre la squence du brin dADN transcrit et celle de lARNm.
Le nuclotide en cours daddition au niveau du site catalytique indique lorientation
de la raction. Le schma explicatif facilite linterprtation du phnomne.
Pour information, ce modle correspond lARN-polymrase du bactriophage T7,
qui est beaucoup plus petite et simple que les ARN-polymrases bactriennes et eucaryotes, mais est considre comme un modle pertinent pour ltude en laboratoire
des mcanismes molculaires de la transcription.
noter que lexpression de brin codant , utilise dans le programme, est viter,
car elle prte confusion et il ny a dailleurs pas unanimit quant sa signification,
y compris dans les publications scientifiques (en gnral dailleurs, le brin qualifi
de codant est plutt le brin nontranscrit). Le manuel utilise donc les termes de brin
transcrit et de brin nontranscrit , sans ambigit.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: LADN est localis dans le noyau tandis que la synthse des protines quil
contrle est situe dans le cytoplasme. Le problme est donc de savoir comment
linformation code par lADN est transmise au cytoplasme, o sont assembls les
acides amins.
Doc. 2 et 3: LARN est synthtis dans le noyau et au bout dune heure et demie
se retrouve intgralement dans le cytoplasme. Dautre part, lARN contient la mme
information que le brin non transcrit de lADN dun gne. Il pourrait donc vhiculer
linformation gntique du noyau vers le cytoplasme.
Doc. 3 et 4: LARN est form par lassemblage de nuclotides complmentaires du
brin transcrit de lADN grce laction de lARN polymrase. LARN contient ainsi
la mme squence de nuclotides que le brin non transcrit.
Doc. 4: La transcription commence au dbut du gne et se poursuit progressivement
jusqu la fin du gne. Ainsi, les ARNm forms sont de plus en plus longs au fur et
mesure de lavance de la transcription.

Synthse : rponse au problme rsoudre


Linformation de lADN ncessaire la synthse dune protine est transmise au
cytoplasme sous la forme dARNm. LARNm est form dans le noyau au cours de la
transcription par laction de lARN-polymrase. LARNm produit est une squence de
nuclotides, synthtise par complmentarit avec le brin dADN transcrit. Aprs transcription, lARN migre dans le cytoplasme au niveau du site de synthse des protines.

3. Ressources complmentaires
Manuel numrique Bordas :

vidos ARN messager, ARN-polymrase;


animation La transcription.
Site ressources Bordas : modles molculaires de lARN messager, de lARN-polymrase.
Publication sur la localisation de la traduction : The Rockefeller University Press,

doi: 10.1083/jcb.200512137
http://jcb.rupress.org/content/175/1/67.abstract

58

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 58

20/07/11 09:15

Activits pratiques

Le langage gntique (pages 56-57)


Connaissances

Capacits et attitudes

La squence des nuclotides dune molcule dADN reprsente une information. Le code gntique est le systme
de correspondance mis en jeu lors de la traduction de
cette information.

Mettre en uvre une mthode (dmarche historique) et/ou


une utilisation de logiciels et/ou une pratique documentaire
permettant de comprendre comment le code gntique a
t lucid.

1. Les intentions pdagogiques


Cette double page propose dabord une dmarche historique : il ne sagit pourtant pas
de redcouvrir le code gntique mais de comprendre quelques aspects de la mthodologie qui a permis dtablir le systme de correspondance entre acides amins et
nuclotides.
Historiquement, plusieurs hypothses ont t formules quant la nature du code gntique (voir page 66, Des cls pour mieux comprendre lhistoire des sciences , le
premier code propos par Gamow). Lexprience de Crick dcrite dans le document1
(voir ressources complmentaires ci-dessous) a permis de montrer que le code gntique est non recouvrant et quil est form de triplets de nuclotides. On pourra montrer travers lexemple dune phrase du type TON AMI LEO EST ICI que linsertion dune lettre en gardant le mme dcoupage des mots (3 lettres) rend la suite du
message incomprhensible, ce qui nest pas le cas lorsque linsertion est celle dun
nombre de lettres multiple de 3. la mme poque, Nirenberg ralise les expriences
dcisives cites dans le document 2 en travaillant sur des fractions cytoplasmiques
diffrentes, recrant in vitro un milieu de traduction contrl (voir ressources complmentaires ci-dessous). Les rsultats originaux exprims en dosage de radioactivit
dans les protines formes ont ici t rapports aux tmoins de chaque exprience, de
faon diffrencier ce qui est un dosage significatif de ce qui ne lest pas. Ces rsultats valident le code gntique prsent dans le document 3. Le document 4 permet
un rinvestissement des notions acquises lors de ltude de la transcription et propose une tude des consquences des mutations en appliquant le code gntique. Les
exceptions luniversalit du code gntique sont abordes dans lexercice8 page69.
Une version circulaire du code gntique est propose dans le guide pratique
page343.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 3: Lorsque le nombre de nuclotides insrs ou supprims nest pas un multiple de trois, le message gntique nest plus interprt correctement. La taille des
codons est donc de trois nuclotides.
Doc. 2: Le codon UUU correspond lincorporation de la phnylalanine et pas dun
autre acide amin. Les codons AAA et CCC ne correspondent pas la phnylalanine.
Doc. 3et 4: Le 7e triplet TTC au lieu de CTC. LARN correspondant sera AAG au
lieu de GAG, soit une lysine en position 7 la place dun acide glutamique.
Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 59

59

20/07/11 09:15

partir du 10e triplet, insertion dun nuclotide G. Le premier triplet AGA est remplac par GAG, soit, sur lARN correspondant, UCU au lieu de CUC, et donc leucine
au lieu de srine. Tous les acides amins suivants sont galement modifis, puisque la
lecture de tous les codons se trouve dcale.

Synthse : rponse au problme rsoudre


Linformation contenue dans la squence de lARNm dtermine la squence de la protine forme grce un systme de correspondance : trois nuclotides successifs forment un codon auquel correspond un acide amin dtermin, toujours le mme. Le
systme de correspondance entre les codons et les acides amins est le code gntique.

3. Ressources complmentaires
Manuel numrique Bordas : fiche documentaire Recherche et sant : le prix Nobel

de chimie 2009
Expriences de Crick : lecture pour la remise du prix Nobel(1962) sur le site

http://nobelprize.org/nobel_prizes/medicine/laureates/1962/crick-lecture.html
Article original dans la revue Nature (General nature of the genetic code for proteins) :

http://www.nature.com/nature/focus/crick/pdf/crick192.pd
Expriences de Nirenberg et Matthaei, article original dans la revue Proceedings

of the National Academy of Science :


http://www.ncbi.nlm.nih.gov/pmc/articles/PMC223178/?tool=pubmed

60

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 60

20/07/11 09:15

Activits pratiques

La traduction de lARN messager en protine (pages 58-59)


Connaissances

Capacits et attitudes

Aprs une ventuelle maturation, lARN messager est traduit Mettre en uvre une mthode (dmarche historique) et/ou
en protines dans le cytoplasme.
une utilisation de logiciels et/ou une pratique documentaire
permettant dapprocher le mcanisme de la transcription,
et de la traduction.

1. Les intentions pdagogiques


Dans un souci de simplification, les auteurs ont choisi de prsenter demble ltape
de la traduction, sans aborder encore ce stade la question de la maturation de lARN.
Cette tape sera prsente au cours de lactivit 5.
Le code gntique tant prsent connu, le but de cette activit est de prsenter le
droulement biologique de la traduction, de faon simplifie, puisque le rle des ARNt
et lexistence des ARNr sont placs hors des limites du programme. Le document1
situe la traduction dans son contexte biologique et prsente le rle des ribosomes.
Lorganisation du polysome pourra tre mise en parallle avec celle des units de rplication du document4 page 55. La structure tridimensionnelle du ribosome est complexe et probablement trop difficile raliser avec les logiciels de visualisation molculaire utiliss en classe. Sur cette image, cest une vue simplifie qui est prsente,
aprs en avoir effac les protines ribosomales (ne subsistent que les ARNt, ARNr et
ARNm). La lgende systme de lecture des codons correspond en fait aux ARNt.
La localisation du site catalytique serait donc au point dinsertion de ces ARNt dans
la grosse sous-unit. Le polypeptide en cours de formation est export via un tunnel
non visible ici qui traverse la grosse sous-unit.
Les mcanismes gntiques mis en jeu pour linitiation et la terminaison de la traduction sont abords au travers des comparaisons de squence du document 2 : en comparant diverses squences, on constate lexistence systmatique dun premier codon
AUG. Lexamen des fins de squence met en vidence le rle des codons non-sens
(ou codons stop ). Enfin, le schma fonctionnel du document 3 resitue les phnomnes tudis dans leur dimension temporelle. Ce schma pourra tre mis en relation
avec la microphotographie du polysome (Doc.1b).

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 3: La traduction ncessite un ARNm, un (ou plusieurs) ribosome(s) ainsi
que des acides amins. La photographie b montre que plusieurs ribosomes ralisent
simultanment la traduction dun mme ARNm.
Doc. 2: Tous les ARN messagers commencent par le mme codon AUG. Par ailleurs,
les protines formes contiennent un acide amin de moins que le nombre de codons
de lARNm. Ce dernier codon est un codon STOP, cest--dire un codon pour lequel
il ny a pas dacide amin correspondant.

Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 61

61

20/07/11 09:15

Doc. 1 et 3: Un polysome permet de produire plusieurs protines simultanment


partir dun mme ARN messager. Toutes ces protines sont donc identiques entre elles,
puisque assembles partir de la mme information.

Synthse : rponse au problme rsoudre


Linformation porte par lARNm est lue , codon aprs codon, par un ribosome
qui associe lacide amin correspondant au reste de la protine dj synthtise. La
traduction dbute au niveau dun codon dinitiation AUG et sarrte aprs rencontre
dun codon stop.

3. Ressources complmentaires
Manuel numrique Bordas : animation La traduction.

62

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 62

20/07/11 09:15

Activits pratiques

Du gnome au protome (pages 60-61)


Connaissances

Capacits et attitudes

Un mme ARN pr-messager peut subir, suivant le contexte, Mettre en uvre une mthode (dmarche historique) et/ou
des maturations diffrentes et donc tre lorigine de une utilisation de logiciels et/ou une pratique documentaire
plusieurs protines diffrentes.
permettant dapprocher le mcanisme de la transcription,
et de la traduction.

1. Les intentions pdagogiques


En conformit avec le programme qui introduit la notion de diversit des produits de
lexpression dun gne, cette double page prsente une problmatique de la gntique
daujourdhui : aprs le squenage des gnomes, il sagit de caractriser son expression, cest--dire ce que lon appelle, par analogie avec le gnome, le protome .
Cest donc dans le cadre de cette problmatique que la question de la maturation de
lARN prend tout son intrt.
En effet, chez les eucaryotes, le gne nest pas directement transcrit en ARNmessagermais en un ARN pr-messager qui devra subir une opration qualifie de
maturation.
On pourra dj faire constater que lARNmessager est en fait systmatiquement plus
court que lADN du gne auquel il correspond (ou que lARN pr-messager qui est
une copie conforme de lADN). La comparaison graphique des squences apporte
par le document1 a pour but de mettre en vidence les portions identiques (exons) et
les portions diffrentes (introns) entre ARNm et ARN pr-messager. Le guide pratique
(page343) prsente une explication plus dtaille du principe du dotplot et de son interprtation. Sur le plan manipulatoire, le dotplot ralis par le logiciel Anagne ncessite
un temps de calcul important. Il est donc adapt pour ltude de gnes courts possdant peu dintrons. Sans entrer dans les dtails de cette opration logicielle, il suffit de
constater quil ny a identit entre les squences dADN et dARNm que par tronons.
Une autre approche consiste tudier une image dhybridation entre lADN dun gne
et lARN messager correspondant (voir exercice10 page 70). Malgr les apparences,
le dotplot est cependant une mise en vidence plus directe.
Le document 2 pourra tre utilis comme une aide la lecture du dotplot et son
interprtation. Il permet dintroduire le vocabulaire propre lpissage.
Lintrt de lpissage au niveau de la diversit des protines produites est donn par
lexemple de la tropomyosine dans le document 3. Cet exemple permet de montrer
dune part quun grand nombre de protines peuvent tre produites partir dun mme
gne, par pissage alternatif de lARN pr-messager et dautre part que lpissage des
gnes varie selon les types cellulaires. On pourra remarquer que les cinq exons colors en marron sont reprsents dans tous les variants produits.
Limportance de lpissage alternatif dans la complexification de lexpression gntique est aborde dans le document 4. Sans verser dans une explication finaliste simpliste du cours de lvolution, ce document montre diffrentes stratgies gntiques
qui peuvent expliquer en partie le hiatus entre le nombre de gnes et la complexit
Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 63

63

20/07/11 09:15

des organismes (par exemple, on pourra faire constater que le nombre de gnes du
gnome humain nest effectivement pas particulirement lev). On pourra montrer
que du point de vue adaptatif, lexpression des gnes a un cot probablement dterminant pour la survie dun organisme unicellulaire. En revanche, pour un animal pluricellulaire, la flexibilit apporte par lpissage alternatif peut se traduire par un avantage slectif. Certains auteurs avancent lide selon laquelle la polyplodie chez les
organismes vgtaux pourrait tre la marque dun mcanisme adaptatif comparable :
cet aspect sera dailleurs envisag en classe de Terminale.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: LARN pr-messager est beaucoup plus long (1638 pb contre 444 pb) que
lARNm. Trois portions (entre 100 et 200, entre 300 et 500, puis entre 1400 et 1500pb)
sont communes entre les deux squences et forment lintgralit de lARNm. Les
quatre autres portions ne sont pas retrouves dans lARN messager.
Doc. 1 et 2: Les portions du dotplot rvles par des diagonales correspondent aux
exons. Les segments entre les exons successifs correspondent aux introns.
Doc. 3: Ces deux ARNm diffrent par un seul exon : lexon n3 est prsent dans la
tropomyosine du muscle stri, tandis quil est substitu par lexon n2 dans la tropomyosine du muscle lisse. Ainsi, par llimination ou lincorporation de certains exons,
un mme gne peut former des protines diffrentes.
Doc.4: Le gnome de levure contient une densit de gne plus importante, avec peu
dintrons. linverse, le gnome humain a une densit de gnes faible, contenant
une proportion dintrons trs importante. Le gnome de drosophile est intermdiaire.

Synthse : rponse au problme rsoudre


LARNm est issu de lpissage de lARN pr-messager, ce dernier rsultant directement de la transcription : des squences (les introns) sont supprimes, tandis que les
squences restantes (les exons) sont raboutes les unes aux autres. Dans la majeure
partie des cas, les exons retenus pour former lARNm peuvent varier selon le contexte
o le gne sexprime, aboutissant la formation de protines diffrentes.

3. Ressources complmentaires
Logiciel Anagne 2 (version ncessaire pour le trac de DotPlots).
Application en ligne Dotlet: http://myhits.isb-sib.ch/cgi-bin/dotlet

64

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 64

20/07/11 09:15

Exercices

p. 68 71

La correction des exercices 1 4 figure dans le manuel de llve, p.350.

6 La redondance du code gntique


Cet exercice est une application de lutilisation du code gntique en effectuant la
dmarche inverse de celle habituellement mise en uvre : trouver les codons associs un acide amin. Il ncessite aussi de pouvoir lire un modle molculaire pour
retrouver sa squence.
La bonne rponse est e : 2 (Tyr) 4 (Gly) 4 (Gly) 2 (Phe) 6 (Leu) = 384

7 Du gne au polypeptide
Ocytocine :
ARNm : UGCUACAUCCAGAACUGCCCCCUGGGC
Protine : Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly
ADH :
ARNm : UGCUACUUCCUGAACUGCCCAAGAGGA
Protine : Cys-Tyr-Phe-Leu-Asn-Cys-Pro-Arg-Gly

8 Code gntique : des exceptions la rgle


Cet exercice permet de discuter de la question de luniversalit du code gntique,
telle quelle est envisage dans le programme. Lide gnrale est que ces variantes
du code gntique sont en fait des volutions du code gntique universel retrouv
chez tous les autres tres vivants. Afin de ne pas rajouter de notion supplmentaire
(ADN extranuclaire et gnome mitochondrial), les codes gntiques mitochondriaux
ne sont pas traits.
1. Chez quelques tres vivants, la signification dun deux codons (en gnral des
codons stop) est modifie par rapport au code gntique habituel.
2. Le code gntique est quasiment universel : ces variantes sont des exceptions qui ne
concernent que quelques tres vivants. Comme ces variantes ne sont pas partages, on
peut supposer quelles drivent toutes du code gntique commun toutes les autres
espces. Il nexiste pas de code gntique qui naurait pas cette origine commune.

9 Un pissage alternatif record


Cet exercice permet dappliquer la notion dpissage alternatif et de discuter de lun
de ses avantages ( noter que la protine DSCAM serait implique dans le mcanisme combinatoire empchant un neurone de raliser une synapse avec lui-mme).
1. Le nombre de combinaisons diffrentes possibles serait de :
12 48 33 2 = 38016.
2. Lpissage alternatif permet donc de produire plusieurs protines diffrentes partir dun mme gne.

10 Une exprience dhybridation entre ADN et ARNm


Cette observation de microscopie lectronique classique ncessite, pour pouvoir tre
interprte, davoir bien compris les notions de complmentarit entre ADN et ARN,
ainsi que dtre en mesure de prvoir les consquences du morcellement des gnes.
Chapitre 3. Lexpression du patrimoine gntique

04732841_022-073.indd 65

65

20/07/11 09:15

1. Les boucles correspondent des zones o lARN et lADN diffrent, tandis que
les segments entre les boucles correspondent des squences complmentaires entre
lADN et lARNm correspondant.
2. Les squences complmentaires correspondent aux exons. Lexistence de boucles
sexplique par le fait que les introns ont t supprims de la squence de lARNm et
ne peuvent donc pas shybrider avec lADN.

11 Le fonctionnement dun antibiotique


1. La ttracycline se fixe sur la petite sous-unit du ribosome au niveau dun site proche
de la localisation de lARNm. On peut constater que lARNm est dans ce cas absent.
On peut donc supposer que la ttracycline empche la fixation de lARNm.
2. Un virus se reproduit en utilisant la machinerie de la cellule hte. Donc, dans une
cellule eucaryote (chez lHomme par exemple), un virus utilisera pour sa reproduction des ribosomes eucaryotes sur lesquels la ttracycline nagit pas. Cet antibiotique
est donc inefficace vis--vis de la reproduction dun virus.

12 Les consquences dune mutation sur la fabrication dune protine


noter que les squences compares ici ne comportent pas le codon dinitiation.
1. La comparaison simple fait apparatre un trs grand nombre de diffrences, partir
du nuclotide25. Une comparaison par alignement avec discontinuit montre cependant que la diffrence entre ces deux squences peut se rduire une seule, en dcalant la squence dun nuclotide au niveau25. On peut donc considrer que lallle
Tha 7 provient tout simplement dune mutation de lallle normal, par dltion du
nuclotide25.
2. Les deux squences diffrent compltement partir du niveau de la mutation (9eacide
amin). Mais surtout, la protine Tha7 est courte et ne comporte que 21acides amins contre 146 pour la globine normale. En effet, partir de la dltion, il y a un dcalage du cadre de lecture des codons. Ceci conduit de nombreuses diffrences
partir de ce point et, au niveau du 22ecodon, la lecture dun codon UGA, cest-dire un codon stop : la synthse protique est alors arrte ce niveau.

66

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 66

20/07/11 09:15

Partie

chapitre

Gnotype, phnotype et environnement


Activits pratiques

Le phnotype se dfinit diffrentes chelles (pages 74-75)


Connaissances

Capacits et attitudes

Le phnotype macroscopique dpend du phnotype cellu- Recenser, extraire et exploiter des informations ( partir
laire, lui-mme induit par le phnotype molculaire.
dun exemple comme la drpanocytose ou le Xeroderma
pigmentosum) permettant de caractriser les diffrentes
chelles dun phnotype.

1. Les intentions pdagogiques


Au travers des deux exemples prconiss par le programme officiel, cette activit a
pour objectif de familiariser les lves avec la mise en relation des diffrentes chelles
du phnotype. Lanalyse du document 1 permet de recenser les symptmes de la
drpanocytose lchelle de lorganisme. Le document 2 apporte des informations
quant aux causes cellulaires et molculaires de la maladie. Lexemple de la drpanocytose sera repris dans les deux activits suivantes du chapitre (expression gntique,
influence de lenvironnement sur le phnotype molculaire).
Lexemple de la maladie Xeroderma pigmentosum, trait dans le document 3, permet dtendre les premires conclusions, en reliant cette fois-ci une prdisposition au
dveloppement de mlanomes un dfaut du systme de rparation des altrations
de lADN par les UV. Lexpression Les enfants de lombre est souvent utilise
dans les mdias car ces enfants doivent effectivement vivre labri du rayonnement
solaire (lexpression Les enfants de la Lune , que lon peut aussi rencontrer, est le
titre dun documentaire et galement celui dune association : voir ressources complmentaires ci-dessous).
Les connaissances concernant les mcanismes et les consquences de ces mutations
acquises aux cours du Chapitre 2 pourront tre utilement rinvesties ici (voir notamment lexercice 7 page 47).
En mettant en parallle ces deux exemples, on peut alors dfinir la notion centrale de
ce chapitre, celle du phnotype molculaire.

Chapitre 4. Gnotype, phnotype et environnement

04732841_022-073.indd 67

67

20/07/11 09:15

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 3

Phnotype
macroscopique

Phnotype
cellulaire
Phnotype
molculaire

Phnotype drpanocytaire

Phnotype Xeroderma
pigmentosum

Anmie chronique, risque lev


daccidents vasculaires, crises
drpanocytaires (douleurs
articulaires, anmie aigu).

Hypersensibilit de la peau
aux UV (brlures de la peau,
de la corne).
Peau sche et tachete.

Hmaties dformes (en faucille)


et en faible nombre.

Cancer de la peau prcoce :


cellules pidermiques division
incontrles.

Hmoglobine formant des fibres


insolubles.

Enzymes de rparation de lADN


inefficaces.

Doc. 1 3:
Exemple du phnotype drpanocytaire :
Les molcules dhmoglobine forment des fibres qui dforment les hmaties. Les hmaties circulent moins bien, entranent une anmie et un risque daccident vasculaire.
Exemple de Xeroderma pigmentosum :
Les enzymes de rparation de lADN sont inefficaces aprs une exposition de lADN
aux UV. Des mutations saccumulent et touchent des gnes dont la mutation entrane
une multiplication incontrle. Un cancer de la peau peut alors se dvelopper.
Doc. 2 et 3: Ces deux maladies touchent des protines. Or, les protines sont le produit de lexpression des gnes. Ces deux maladies sont dues une altration des gnes
codant les chanes de lhmoglobine dans le premier cas, les enzymes de rparation
de lADNdans le deuxime cas : ce sont des maladies gntiques.

Synthse : rponse au problme rsoudre


Le phnotype lchelle molculaire, cest--dire les protines synthtises partir de
lexpression dun allle, dtermine certaines caractristiques phnotypiques lchelle
cellulaire et par consquent lchelle de lorganisme.

3. Ressources complmentaires
Matriel : Frottis sanguin normal et drpanocytaire.
BioTic INRP :

propos de Xeroderma pigmentosum :


http ://www.inrp.fr/Acces/biotic/gpe/dossiers/xeroderma/html/points.htm,
propos de la drpanocytose :
http://www.inrp.fr/Acces/biotic/gpe/dossiers/drepanocytose/html/synthese.htm
Association de malades atteints de Xeroderma pigmentosum :

http://asso.orpha.net/AXP/index2.htm
Les enfants de la Lune , documentaire ralis par Feriel Ben Mahmoud et Nicolas

Daniel en 2008, diffus pour la premire fois en France en octobre 2009 sur France 5 :
http://lesenfantsdelalune.blogspot.com/
Manuel numrique Bordas : fiche documentaire Xeroderma pigmentosum

68

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 68

20/07/11 09:15

Activits pratiques

Phnotype molculaire et expression gntique (pages 76-77)


Connaissances

Capacits et attitudes

Lensemble des protines qui se trouvent dans une cellule


(phnotype molculaire) dpend :
du patrimoine gntique de la cellule (une mutation
alllique peut tre lorigine dune protine diffrente ou
de labsence dune protine) ;
de la nature des gnes qui sexpriment sous leffet de
linfluence de facteurs internes et externes varis.

Recenser, extraire et exploiter des informations ( partir


dun exemple comme la drpanocytose []) permettant
de diffrencier les rles de lenvironnement et du gnotype
dans lexpression dun phnotype.

1. Les intentions pdagogiques


Cette activit a pour objectif de mettre en relation le phnotype cellulaire dfini prcdemment avec les gnes exprims dans une cellule. Deux aspects sont ainsi prsents : le premier concerne le rapport entre mutation des gnes et phnotype molculaire ;
le second touche lexpression diffrentielle des gnes selon les types cellulaires et
au cours du temps.
La comparaison des squences nuclotidiques et peptidiques de la bta-globine(document 1) prolonge la dcouverte du phnotype drpanocytaire (activits pratiques1).
La localisation de la mutation gntique et de sa consquence sur la squence protique (ralise avec un logiciel de traitement de squences), se poursuit logiquement
par la recherche de sa localisation spatiale dans le modle tridimensionnel de lhmoglobine. Lutilisation dun logiciel de modlisation molculaire met en vidence quil
ny a pas de changement dans lorganisation de lhmoglobine qui pourrait expliquer
cette anomalie. En revanche, la mise en vidence de la position des valines mutes dans
un dimre dhmoglobine drpanocytaire montre que lune delle est situe au point
de contact, en vis--vis de deux acides amins hydrophobes (document 1). Ainsi, les
acides amins valine, rsultant de la mutation, ont tendance crer des points daccroche entre les molcules dhmoglobine, ce qui est lorigine de la fomation des
polymres fibreux.
Le document 2 montre un aspect de la diffrenciation cellulaire avec des types cellulaires aisment observables : les cellules sanguines (mme si, en toute rigueur, hmaties
et plaquettes ne sont pas des cellules au sens strict, le raisonnement sur lexpression
des gnes peut tre appliqu leurs prcurseurs). chaque type cellulaire prsent est
associ un exemple significatif de protine spcifique. Le nombre de signaux impliqus dans la diffrenciation cellulaire des prcurseurs est important et lon pourra se
rfrer au besoin des sources dinformation plus exhaustives. Lrythropotine est
cite ici comme exemple dune de ces substances agissant sur la diffrenciation cellulaire. Lessentiel est de montrer que toutes les cellules dun mme organisme possdent la mme information gntique mais quelles nen expriment quune fraction.
Le rle des facteurs de transcription sera trait au cours de lactivit pratique suivante.
Laspect temporel de lexpression gntique est abord au travers de lexemple des
gnes de globine dans le document 3. Les mcanismes de cette rgulation gntique
sont complexes et imparfaitement connus. Ils pourraient jouer sur la compaction de la
Chapitre 4. Gnotype, phnotype et environnement

04732841_022-073.indd 69

69

20/07/11 09:15

chromatine, par une action de protines rgulatrices sur les histones et leur positionnement (enroulement de la chromatine). On pourra relier lintrt de la production de
diffrentes globines au cours du temps au mode de vie et de respiration de lembryon,
du ftus et du nouveau-n.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: Le codon GAG, en position 6 sur le gne de la bta-globine, est remplac par
le codon GTG. Ainsi, la chane peptidique forme contient une valine en position6
au lieu dun acide glutamique.
Doc. 1: La valine, acide amin hydrophobe, tablit un contact entre deux molcules
dhmoglobine. Alors que les molcules dhmoglobine sont normalement dissoutes dans
le cytoplasme, il se forme au contraire dans ce cas des polymres fibreux et insolubles.
Doc. 2: Les cellules contiennent les mmes gnes, mais au cours de leur diffrenciation, des signaux activent lexpression de certains gnes ou inhibent lexpression
dautres gnes.
Doc. 3: Il existe dans lespce humaine plusieurs gnes de globine, qui ne sexpriment que pendant une priode prcise de la vie. Le contrle de lexpression des gnes
permet donc un changement du phnotype molculaire au cours de la vie.

Synthse : rponse au problme rsoudre


Le phnotype molculaire caractrisant une cellule correspond lensemble des protines que renferme cette cellule un instant donn. Le phnotype molculaire dpend
donc des allles possds par un individu mais aussi de la rgulation de lexpression
des gnes, dans lespace et dans le temps : dans toute cellule, un moment donn,
seuls certains gnes sexpriment.

3. Ressources complmentaires
Matriel : Frottis sanguin, frottis de mlle osseuse.
Site ressources Bordas : Squences dADN codant du gne de la bta-globine

normale etdrpanocytaire. Modles molculaires correspondant un modle de dimre


dhmoglobine drpanocytaire, une molcule dhmoglobine non mute ( fin
decomparaison).
Manuel numrique Bordas : vido Hmoglobine drpanocytaire.
Biologie molculaire de la cellule (Alberts) : rgulation de lexpression des gnes

deglobine.

70

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 70

20/07/11 09:15

Activits pratiques

Linfluence de lenvironnement sur le phnotype (pages 78-79)


Connaissances

Capacits et attitudes

Lensemble des protines qui se trouvent dans une cellule Recenser, extraire et exploiter des informations [] per(phnotype molculaire) dpend de la nature des gnes qui mettant de diffrencier les rles de lenvironnement et du
sexpriment sous leffet de linfluence de facteurs internes gnotype dans lexpression dun phnotype.
et externes varis.

1. Les intentions pdagogiques


Deux aspects de laction de lenvironnement sur le phnotype cellulaire sont envisags en classe de Premire : linfluence de lenvironnement sur lexpression des gnes
elle-mme et linfluence de lenvironnement sur les molcules produits de lexpression des gnes .
Pour traiter le premier aspect, lexemple choisi est le modle dinduction des gnes
du mtabolisme du lactose qui a en partie valu lattribution du prix Nobel Jacob,
Monod et Lwoff (voir Des cls pour mieux comprendre lhistoire des sciences ,
page 66). Lanalyse du document 1 montre le phnomne dinduction gntique de
lexpression du gne Lac Z (commande la synthse de la -galactosidase) en prsence
de lactose. Il sagit ici seulement de mettre en vidence quun gne sexprime davantage sous linfluence dun facteur de lenvironnement.
Le document 2 prsente un modle molculaire qui tmoigne du recrutement de
lARN-polymrase bactrienne par la protine CAP. Pour information, la protine
CAP est active par la fixation du second messager AMPc, en absence de glucose et
prsence de lactose. Ceci entrane un changement de conformation et la fixation de
la protine CAP sur lADN qui se courbe alors en augmentant laffinit de lARNpolymrase pour le promoteur du gne. La zone de couleur rouge sur limage correspond la TATA box. Le phnomne est complexe dans ses dtails et nest donc pas
lobjet de cette tude. Cependant, on pourra utilement en retenir que les facteurs de
transcription sont des protines qui peuvent agir sur lexpression des gnes comme
des interrupteurs en fonction des signaux reus de lenvironnement. Il nest pas
fait mention ici du deuxime systme de rgulation de lopron lactose par inhibition
de la transcription (fixation du rpresseur sur le site dinitiation de la transcription).
Le document 3 reprend lexemple de la drpanocytose en mettant en relation les proprits de polymrisation de lhmoglobine HbS selon les conditions du milieu (ici oxygnation et concentration en HbS), avec les recommandations adresses aux malades
en prvention des crises. cette fin, il peut tre utile de prciser que la polymrisation de lhmoglobine est un phnomne dynamique qui, a priori, ne se produit pas
dans le corps humain compte-tenu du dbit sanguin (le temps ncessaire la polymrisation de lhmoglobine dsoxygne est suprieur la dure de trajet du sang
depuis les organes priphriques jusquaux poumons).

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: La bactrie tudie est capable dutiliser du glucose et du lactose. Cependant,
elle nest en mesure dutiliser le lactose que si elle a t mise en contact avec celui-ci
Chapitre 4. Gnotype, phnotype et environnement

04732841_022-073.indd 71

71

20/07/11 09:15

et si le glucose nest pas disponible. Cela sexplique par le fait quelle ne transcrit le
gne lacZ (permettant dutiliser le lactose) que si le lactose est le seul substrat prsent dans le milieu.
Doc. 1 et 2: Taux faible de glucose et prsence de lactose changement dactivit
de la protine CAP se lie sur lADN avant le gne lac z fixation de lARN polymrase transcription des gnes lac Z, lac Y et lac A production des protines
ncessaires au mtabolisme du lactose.
Doc. 3: Daprs les conseils adresss aux malades, le degr doxygnation (li lactivit sportive, laltitude, etc.) et lhydratation (lie la temprature, lactivit sportive,
etc.) sont des facteurs externes qui peuvent influer sur le phnotype drpanocytaire.
Doc. 3: Lorsque la concentration en dioxygne est faible, la proportion dhmaties en
faucille est maximale (proche de 100%). Ceci explique quil faille veiller maintenir une bonne oxygnation du sang. Lorsque la concentration en hmoglobine s est
double, de 0,2 0,4 gcm-3, le dlai de formation des fibres est rduit 106fois. Ceci
est relier aux mises en garde contre la dshydratation.

Synthse : rponse au problme rsoudre


Les facteurs environnementaux peuvent modifier le phnotype cellulaire en induisant des modifications dans la quantit ou la nature des gnes exprims par une cellule ou bien en modifiant les proprits physico-chimiques des protines produites
par lexpression des gnes.

3. Ressources complmentaires
Rgulation de lopron lactose : laboratoire Biologie et Multimdia UniversitParis V

http://www.snv.jussieu.fr/bmedia/operonlactose/
Rpression enzymatique chez la levure : Didier Pol (site http://www.didier-pol.

net/1IND-LEV.html#rep-cat ou manuel de TP page 67-68)


Proprits de lhmoglobine HbS(article original en anglais) :

Sicklecellhemoglobinpolymerization WA Eaton 1990 in Advances inProteinChemestry.

72

Partie 1. Expression, stabilit et variation du patrimoine gntique

04732841_022-073.indd 72

20/07/11 09:15

Exercices

p. 82 83

La correction des exercices 1 4 figure dans le manuel de llve, p.350-351.

6 Le mode daction dune hormone sexuelle


Cet exercice est une application du modle de linduction gnique. Il ncessite davoir
compris le mcanisme par lequel un facteur environnemental peut agir sur lexpression dun gne et de savoir lire le schma fonctionnel prsent.
a. Faux. Lstradiol nest pas ncessaire la production de la protine A.
b. Faux. Le rcepteur est prsent dans la cellule.
c. Faux. Lstradiol nagit pas sur la protine B.
d. Faux. Lstradiol nagit pas sur le gne.
e. Vrai.
f. Vrai.
g. Vrai.
h. Faux. Nagit pas sur le gnotype.

7 Lorigine de lalbinisme
1. La substitution dun nuclotide G en A modifie le codon 178 TGG, codant pour
Trp, en codon TAG qui est un codon stop. Ceci conduit la synthse dune protine
tyrosinase courte (177 acides amins au lieu de 530) qui naccomplit plus sa fonction et ne permet donc pas de raliser la synthse de la mlanine. Les cellules de la
peau sont alors dpigmentes.
2. La couleur de la peau est une caractristique macroscopique (phnotype macroscopique) qui dpend de la production de mlanine par les mlanocytes (phnotype cellulaire) elle mme dpendante de lquipement enzymatique de ces cellules (phnotype molculaire).

8 La couleur des hortensias


1. La couleur des fleurs dhortensias dpend de caractristiques gntiques et du pH
du sol.
2. Ce mme pied prsente des fleurs de couleurs diffrentes. Leur gnotype est identique, donc leurs diffrences sexpliquent par linfluence de facteurs environnementaux tels que le pH.

Chapitre 4. Gnotype, phnotype et environnement

04732841_022-073.indd 73

73

20/07/11 09:15

74

04732841_074-115.indd 74

20/07/11 09:16

79
90
101

75

04732841_074-115.indd 75

20/07/11 09:16

Partie

La tectonique des plaques :


histoire dun modle

Les objectifs gnraux de cette partie


Selon les textes officiels, il ne sagit pas de redcouvrir les grandes lignes du modle de
la tectonique des plaques qui sont connues depuis le collge mais, en sappuyant sur une
dmarche historique, de comprendre comment ce modle a peu peu t construit au
cours de lhistoire des sciences et de le complter. On se limite quelques tapes significatives de lhistoire de ce modle.
Lexemple de la tectonique des plaques donne loccasion de comprendre la notion de modle
scientifique et son mode dlaboration. Il sagit dune construction intellectuelle hypothtique et modifiable. Au cours du temps, la communaut scientifique laffine et le prcise
en le confrontant en permanence au rel. Il a une valeur prdictive et cest souvent lune
de ces prdictions qui conduit la recherche dun fait nouveau qui, suivant quil est ou
non dcouvert, conduit tayer ou modifier le modle. La solidit du modle est peu
peu acquise par laccumulation dobservations en accord avec lui. Les progrs techniques
accompagnent le perfectionnement du modle tout autant que les dbats et controverses.
NB : partir de lexemple de la tectonique des plaques, les lves seront conduits comprendre
quelques caractristiques du mode de construction des thories scientifiques.

Cette partie du programme permet de dvelopper un certain nombre de comptences :


Des connaissances :
la structure interne du globe dduite de la propagation des ondes sismiques ;
le concept de lithosphre et dasthnosphre ;
la distinction des deux types de crotes terrestres tant au niveau de leurs proprits
physiques que de leur ptrologie ;
le mcanisme de lexpansion des fonds ocaniques ;
le modle global de la tectonique des plaques tel quil est tabli aujourdhui, en particulier le rle des failles transformantes ;
lapport des techniques modernes (GPS, tomographie sismique) lenrichissement du
modle de la tectonique des plaques ;
les mcanismes de la cration de nouveau plancher ocanique au niveau des dorsales.
Des capacits : cette partie du programme permet de mettre en uvre diverses activits exprimentales, manipulatoires. Les lves seront amens appliquer des protocoles
exprimentaux, ExAO entre autres (propagation des ondes sismiques, modlisation des
anomalies magntiques du fond ocanique), utiliser des logiciels (par exemple pour tablir les conditions de formation dun magma au niveau des dorsales par fusion partielle
des pridotites), raliser des observations (lames minces de roches).
Les lves pratiqueront les tapes essentielles de la dmarche dinvestigation : observation, questionnement, formulation dhypothses, exprimentation, raisonnement, communication sous forme de tableaux ou de graphes.
Des attitudes : dans cette partie, les lves auront loccasion de rflchir la faon
dont une thorie, au dpart trs conteste, se transforme progressivement en un modle
76

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 76

20/07/11 09:16

admis par lensemble de la communaut scientifique ; comment galement ce modle


senrichit progressivement grce aux apports des techniques modernes renforant ainsi
son efficacit prdictive.
Cette deuxime partie du programme est dcoupe en trois chapitres :
le chapitre 1, forte connotation historique, permet de comprendre les difficults dacceptation des premires ides de mobilit des continents et comment des observations fondes
sur des techniques nouvelles ont permis de dpasser les obstacles du bon sens apparent,
le chapitre 2 permet de comprendre comment les donnes palomagntiques et sismiques ont permis de confirmer le modle de lexpansion ocanique ;
le chapitre 3 montre comment le modle de lexpansion ocanique est renforc par son
efficacit prdictive : ge des sdiments en contact avec le plancher ocanique dautant
plus vieux quils sont loigns de la dorsale, vitesses de dplacement des plaques confirmes par les donnes GPS

Une correspondance entre le programme officiel


et les chapitres du manuel
Connaissances
La naissance de lide
Au dbut du XXe, les premires ides voquant la mobilit
horizontale sappuient sur quelques constatations :
la distribution bimodale des altitudes (continents/ocans),
les tracs des ctes,
la distribution gographique des paloclimats et de certains
fossiles.
Ces ides se heurtent au constat dun tat solide de la quasitotalit du globe terrestre tabli, la mme poque, par les
tudes sismiques. Lide de mobilit horizontale est rejete par
lensemble de la communaut scientifique.

Les chapitres du manuel

chapitre

La naissance dune thorie : la drive


des continents (pages 84 -109)
Les activits pratiques
Act. 1
Act. 2
Act. 3
Act. 4
Act. 5

Wegener et la thorie de la drive des continents


Le rejet de la thorie de Wegener
La dcouverte de discontinuits lintrieur du globe
Deux crotes distingues par les ondes sismiques
Les roches de la Terre solide

La diffrence daltitude observe entre continents et ocans


reflte un contraste gologique.
Les tudes sismiques et ptrographiques permettent de
caractriser et de limiter deux grands types de crotes terrestres :
une crote ocanique essentiellement forme de basalte et
de gabbro et une crote continentale constitue entre autres
de granite.
La crote repose sur le manteau, constitu de pridotite.
Les objectifs gnraux

04732841_074-115.indd 77

77

20/07/11 09:16

Connaissances
Au dbut des annes 1960, les dcouvertes de la topographie
ocanique et des variations du flux thermique permettent
dimaginer une expansion ocanique par accrtion de matriau
remontant laxe des dorsales, consquence dune convection
profonde.
La mise en vidence de bandes danomalies magntiques
symtriques par rapport laxe des dorsales ocaniques, corrlables
avec les phnomnes dinversion des ples magntiques (connus
depuis le dbut du sicle) permet dprouver cette hypothse et
de calculer des vitesses dexpansion.
Au voisinage des fosses ocaniques, la distribution spatiale
des foyers des sismes en fonction de leur profondeur stablit
selon un plan inclin.
Les diffrences de vitesse des ondes sismiques qui se propagent
le long de ce plan, par rapport celles qui sen cartent,
permettent de distinguer : la lithosphre de lasthnosphre.
Linterprtation de ces donnes sismiques permet ainsi de
montrer que la lithosphre senfonce dans le manteau au niveau
des fosses dites de subduction.
La limite infrieure de la lithosphre correspond gnralement
lisotherme 1 300 C.

Les chapitres du manuel

chapitre

De la drive des continents


la tectonique des plaques (pages 110-133)
Les activits pratiques
Act. 1
Act. 2
Act. 3
Act. 4
Act. 5
Act. 6

Lhypothse dune expansion ocanique


Un apport dterminant : le palomagntisme
Palomagntisme et expansion des fonds ocaniques
La distinction lithosphre - asthnosphre
Des plaques rigides qui se dplacent sur une sphre
Un premier modle global : la tectonique des plaques

la fin des annes soixante, la gomtrie des failles


transformantes ocaniques permet de proposer un modle en
plaques rigides. Des travaux complmentaires parachvent
ltablissement de la thorie de la tectonique des plaques en
montrant que les mouvements divergents (dorsales), dcrochants
(failles transformantes) et convergents (zones de subduction)
sont cohrents avec ce modle gomtrique.
Des alignements volcaniques, situs en domaine ocanique
ou continental, dont la position ne correspond pas des
frontires de plaques, sont la trace du dplacement de plaques
lithosphriques au dessus dun point chaud fixe, en premire
approximation, dans le manteau.
Le modle prvoit que la crote ocanique est dautant plus
vieille quon sloigne de la dorsale. Les ges des sdiments en
contact avec le plancher ocanique (programme de forage sousmarins J.O.I.D.E.S.) confirment cette prdiction et les vitesses
prvues par le modle de la tectonique des plaques.
Le modle prvoit des vitesses de dplacements des
plaques (daprs le palomagntisme et les alignements de
volcans intraplaques). Avec lutilisation des techniques de
positionnement par satellites (GPS), la fin du XXe sicle, les
mouvements des plaques deviennent directement observables
et leurs vitesses sont confirmes.

chapitre

La tectonique des plaques,


un modle qui senrichit (pages 134-155)
Les activits pratiques
Act. 1
Act. 2
Act. 3
Act. 4
Act. 5

Lexpansion ocanique confirme par les forages


Les donnes GPS confirment la mobilit des plaques
Une vue globale de la cinmatique du globe
La dynamique de la lithosphre prcise
Lorigine de la lithosphre ocanique lucide

En permanence, de la lithosphre ocanique est dtruite dans


les zones de subduction et produite dans les dorsales.
La divergence des plaques de part et dautre de la dorsale
permet la mise en place dune lithosphre nouvelle partir de
matriaux dorigine mantlique.
Dans les zones de subduction, les matriaux de la vieille
lithosphre ocanique sincorporent au manteau.
Objectifs et mots-cls. Il sagit de construire une reprsentation
graphique synthtique du modle global et de fournir aux
lves les donnes essentielles sur le fonctionnement dune
dorsale type.

78

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 78

20/07/11 09:16

Partie

chapitre

La naissance dune thorie : la drive


des continents
Activits pratiques

Wegener et la thorie de la drive des continents (pages 90-91)


Connaissances

Capacits et attitudes

Au dbut du
les premires ides voquant la mobilit
horizontale sappuient sur quelques constatations :
la distribution bimodale des altitudes (continents/
ocans),
les tracs des ctes,
la distribution gographique des paloclimats et de
certains fossiles.

Recenser, extraire et organiser des informations partir


documents historiques.
Organiser des informations afin dtablir une relation
entre les observations de Wegener et la mobilit horizontale
des continents.

XXe

1. Les intentions pdagogiques


Au dbut du xxe sicle, Wegener a construit sa thorie de la drive des continents partir darguments provenant de diffrents domaines scientifiques. Il sagit ici de dtailler
ces arguments et de montrer en quoi Wegener fut un scientifique visionnaire et rvolutionnaire par son approche pluridisciplinaire des questions gologiques du moment.
Le document 1 dcrit les ides du dbut du xxe sicle concernant lorigine des chanes
de montagnes et des bassins ocaniques la surface de la Terre (voir page 88). Ce
document montre en quoi Alfred Wegener est en opposition avec les conceptions de
lpoque.
Les documents 2 et 3 apportent les principaux arguments de Wegener sur lesquels il
appuie sa thorie de la drive des continents. Lobjectif ici est de montrer aux lves
les diffrents domaines scientifiques des arguments et la pertinence des observations.
Un extrait des crits de Wegener permet de comprendre sa dmarche.
Le document 4 a pour objectif de montrer que Wegener, en sappuyant cette fois sur
les analyses statistiques des altitudes terrestres, distingue une crote ocanique dense
dune crote continentale plus lgre. Les lves peuvent donc comprendre que la
thorie de la contraction de la Terre admise lpoque pour expliquer les reliefs en
surface est remise en cause.
travers ces activits, les lves apprhendent la faon dont peut slaborer une thorie scientifique.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Lexistence dun ocan entre deux continents est explique lpoque par
un effondrement des masses continentales entre ces continents. La mobilit verticale
Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 79

79

20/07/11 09:16

des continents est donc admise. Cependant, le principe de lisostasie soppose de


tels dplacements et Wegener sappuie sur ce principe pour rfuter la thorie de la
contraction de la Terre.
Doc. 2: On observe ici une correspondance quasi parfaite des ctes, des formations
rocheuses anciennes (boucliers), de la rpartition des fossiles de lre primaire. Ces
arguments, avancs par Wegener permettent de penser que les continents africain et
sud-amricain taient probablement runis lre primaire.
Doc. 3: La rpartition actuelle des dpts glaciaires dge primaire devient cohrente
en runissant les continents concerns comme sur le schma prsent.
Doc. 4: La distribution bimodale des altitudes terrestres renforce lide dun dplacement horizontal des masses continentales lgres (SiAl) sur une couche plus dense
(SiMa) formant les fonds ocaniques.

Synthse : rponse au problme rsoudre


Les donnes scientifiques prsentes par Wegener (donnes gologiques, palontologiques, paloclimatiques et statistiques avec la distribution des altitudes terrestres) vont
toutes dans le sens dun dplacement horizontal des continents depuis lre Primaire.

3. Ressources complmentaires
Manuel numrique Bordas :

animation montrant la drive des continents sur une mappemonde avec illustration
des arguments de Wegener;
fiche documentaire Biographie de Wegener.
Site Plante Terre ENS Lyon: ltat des connaissances lpoque de Wegener,

la naissance de la thorie de la drive des continents et son rejet.


http://planet-terre.ens-lyon.fr/planetterre/XML/db/planetterre/metadata/LOM-derivecontinents-wegener.xml
Bibliographie

A. Hallam, Une rvolution dans les Sciences de la Terre, d. Points Science, 1976.
G. Gohau, Histoire de la tectonique, des spculations sur les montagnes la tectonique
des plaques, Ed. Vuibert, 2010.

80

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 80

20/07/11 09:16

Activits pratiques

Le rejet de la thorie de Wegener (pages 92-93)


Connaissances

Capacits et attitudes

Ces ides se heurtent au constat dun tat solide de la


quasi-totalit du globe terrestre tabli, la mme poque,
par les tudes sismiques. Lide de mobilit horizontale
est rejete par lensemble de la communaut scientifique.

Recenser, extraire et organiser des informations afin de


documents historiques.
Comprendre la nature provisoire, en devenir, du savoir
scientifique.

1. Les intentions pdagogiques


Le document 1 a pour but :
de reprer sur un sismogramme les diffrents types dondes sismiques et dindiquer
lexistence dondes de volume ;
de dcrire les tudes sismiques, ralises au dbut du xxe sicle, qui exploitent les
trajectoires supposes des ondes sismiques de volume lintrieur du globe terrestre.
Ce document montre donc que les sismologues du dbut du xxe sicle (principalement Gutenberg) prouvent que la Terre est solide jusqu 2 900km de profondeur.
Le document 2 indique en quoi la thorie de Wegener fut rejete par la communaut
scientifique de lpoque et principalement par le gophysicien Jeffreys. Les lves
comprennent que les connaissances de lpoque sur la dynamique du globe terrestre ne
sont pas suffisantes pour accepter une thorie pourtant base sur de solides arguments.
Le document 3 a pour objectif dindiquer aux lves que des avances scientifiques, ici
la dcouverte de la radioactivit par Marie Curie, peuvent enrichir une thorie. Ainsi,
Holmes, partisan de la thorie de Wegener, va proposer un modle dans lequel le moteur
de la drive des continents serait des mouvements de convection au sein du manteau, euxmmes ayant pour origine la chaleur issue de la dsintgration dlments radioactifs.
Un extrait dun discours de Jeffreys relate la faon dont ce modle est lui aussi rejet.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les tudes sismiques montrent que la Terre interne est solide jusqu une
grande profondeur, au moins 2 900 km. Ainsi, du fait de la trs grande rsistance de
cette Terre solide , les forces invoques par Wegener pour dplacer les continents
en surface sont trs insuffisantes.
Doc. 2: Wegener propose trois forces principales susceptibles de dplacer des continents en surface : la rotation de la Terre, leffet de mare et la force dEtvs. Pour
Jeffreys, ces forces sont trs nettement insuffisantes pour vaincre la rsistance de la
Terre. Sans moteur convaincant, la thorie de la drive des continents est alors rejete.
Doc. 3: Le modle propos par Holmes intgre la dcouverte de la radioactivit par
Marie Curie. Pour Jeffreys, lide dune convection mantellique nest pas convaincante. Il qualifie dextraordinaires les conditions permettant ce mcanisme
dexpliquer la drive des continents. Il ne donne donc aucune validit scientifique
ce modle.
Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 81

81

20/07/11 09:16

Synthse : rponse au problme rsoudre


La Terre tant solide jusqu une grande profondeur, elle prsente une rsistance beaucoup trop leve pour tre dforme par les forces invoques par Wegener.

3. Ressources complmentaires
Manuel numrique Bordas : Fiche documentaire La controverse Wegener-Jeffreys.
Bibliographie : A. Hallam, Une rvolution dans les Sciences de la Terre, d. Points

Science, 1976.

82

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 82

20/07/11 09:16

Activits pratiques

La dcouverte de discontinuits lintrieur du globe (pages 94-95)


Connaissances

Capacits et attitudes

Les tudes sismiques au dbut du XXe sicle mettent en vidence la prsence de discontinuits lintrieur du globe :
la discontinuit de Moho entre la crote et le manteau, la
discontinuit de Gutenberg entre le manteau et le noyau.

Recenser, extraire et organiser des informations afin de


documents historiques.
Comprendre le lien entre les phnomnes naturels et le
langage mathmatique.
Manipuler des modles scientifiques.

1. Les intentions pdagogiques


Concernant la structure interne du globe, les lves ont vu au collge la distinction
entre la lithosphre et lasthnosphre. Ici, il sagit de prciser ce modle avec la mise
en vidence denveloppes terrestres majeures : crote, manteau, noyau. La connaissance des enveloppes crote et manteau est indispensable aux lves pour apprhender la suite du chapitre.
Le document 1 illustre lutilisation dun modle permettant une analogie entre les
proprits des ondes lumineuses et celles des ondes sismiques lorsquelles arrivent sur
une surface sparant deux milieux dans lesquels les vitesses de propagation des ondes
sont diffrentes. Ce modle permettra aux lves de comprendre le comportement des
ondes de volumeP etS lors de leur passage lintrieur du globe.
Le document 2 dcrit une utilisation possible du logiciel Sismolog. En utilisant ce
logiciel, les lves apprhendent les trajectoires des ondes sismiquesP lintrieur du
globe. Ces modlisations sont mises en lien avec les travaux historiques de Gutenberg
et Lehmann. Les lves en dduisent deux discontinuits majeures de la Terre profonde.
laide des documents 3, 4 et 5 les lves visualisent comment, partir denregistrements sismiques, Mohorovicic mit en vidence au dbut du xxesicle, une discontinuit entre la crote et le manteau, appele depuis Moho. Lintrt de lutilisation
de loutil mathmatique est ici mis en exergue.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les ondes sismiques se propagent dans le globe terrestre comme les ondes
lumineuses le font dans les milieux transparents. Concernant leur trajectoire, on parle
de rais sismiques par analogie aux rais lumineux. Enfin, sur une surface sparant deux
milieux dans lesquels les vitesses de propagation des ondes sont diffrentes (surface
de discontinuit), les ondes sismiques comme les ondes lumineuses sont rflchies et
rfractes selon les lois de Descartes.
Doc. 2: partir de ltude des trajectoires des ondes sismiques lintrieur du globe
terrestre, deux discontinuits sont mises en vidence : une 2 900km de profondeur
sparant le manteau du noyau externe (discontinuit de Gutenberg) et une 5 100km
de profondeur sparant le noyau externe et la graine (discontinuit de Lehmann).
Doc. 3, 4 et 5: la suite dun sisme situ au sud de Zagreb, Mohorovicic constate
la succession de deux trains dondes P sur les sismogrammes obtenus dans les stations
Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 83

83

20/07/11 09:16

loignes du sisme. Il en dduit que certaines ondes ont suivi un trajet direct (ondesPg)
alors que dautres sont passes dans des milieux plus profonds o elles ont t acclres (ondes Pn) avant de regagner la surface en avance par rapport aux ondes
directes. La connaissance des proprits des ondes qui se propagent paralllement
une surface de discontinuit lorsquelles arrivent avec un angle dincidence prcis
(incidence limite), a permis Mohorovicic de mettre en vidence une discontinuit
entre la crote et le manteau 54km de profondeur sous la Croatie.

Synthse : rponse au problme rsoudre


Ltude de la trajectoire des ondes sismiques de volume, avec les phnomnes de
rfraction et de rflexion sur des surfaces de discontinuit, a permis de mettre en vidence diffrentes discontinuits lintrieur du globe terrestre : le Moho ente la crote
et le manteau (entre7 et 70km de profondeur), la discontinuit de Gutenberg entre
le manteau et le noyau 2 900km de profondeur et celle de Lehmann entre le noyau
externe et la graine 5 100km de profondeur.

3. Ressources complmentaires
Matriel : ncessaire pour modliser le trajet des ondes sismiques dans deux milieux

diffrents.
Logiciel Sismolog (Ed. Chrysis)
Site ressources Bordas : histoire de la science des tremblements de terre Jean-Paul Poirier,

Professeur au laboratoire de Gomatriaux.


http://www.ipgp.fr/pages/060802.php

84

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 84

20/07/11 09:16

Activits pratiques

Deux crotes distingues par les ondes sismiques (pages 96-97)


Connaissances

Capacits et attitudes

La diffrence daltitude observe entre continents et ocans


reflte un contraste gologique.
Les tudes sismiques permettent de caractriser et de
limiter deux grands types de crotes terrestres : une crote
ocanique et une crote continentale.
La crote repose sur le manteau.

Recenser, extraire et organiser des informations afin


dtablir une relation entre les donnes sismiques et la
distinction crote continentale - crote ocanique.
Exprimer et exploiter des rsultats en utilisant les technologies de linformation et de la communication.
Percevoir le lien entre sciences et techniques.

1. Les intentions pdagogiques


partir de lanalyse statistique des altitudes terrestres, Wegener avait distingu une
crote continentale et une crote ocanique formant la crote terrestre. Lobjectif est
de montrer comment des techniques actuelles, ici des donnes sismiques rcentes, permettent de valider cette distinction.
Le document 1 dcrit une activit exprimentale ralisable en classe par les lves. Il
sagit de mesurer la vitesse de propagation dondes sismiques dans des roches de nature
diffrente. Cette activit ncessite lutilisation de barres de roches denviron un mtre
de longueur et de 55cm de section. Les deux capteurs pizomtriques sont relis
un cordon jack branch la prise son de lordinateur. Le logiciel Audacity permet
de visualiser larrive des ondes au niveau des deux capteurs avec un certain dcalage
qui peut tre mesur sur lcran (Attention : une erreur sest glisse dans le tirage des
spcimens destins aux professeurs, lchelle des temps nest pas en dix millimes de
seconde mais en cent millimes de seconde ; cette erreur est corrige dans le tirage du
manuel destin aux lves). Connaissant la distance sparant les deux capteurs et le temps
mis par les ondes pour effectuer cette distance, les lves calculent la vitesse des ondes.
Pour une barre de granite par exemple, la vitesse trouve est denviron 4kms 1. Ce
calcul ralis dans des barres de roches de nature diffrente montre des vitesses diffrentes. Un tableau rappelle les vitesses mesures par les gophysiciens dans les roches
constituant les enveloppes terrestres : crote continentale, crote ocanique et manteau.
Il est alors possible de discuter des limites du modle avec les lves.
Le document 2 aborde une technique moderne, la sismique rflection, qui permet
dtablir un profil des structures profondes et dy superposer les vitesses des ondesP
mesures. Lobjectif ici est de montrer quune distinction nette est possible entre crote
continentale, crote ocanique et manteau. noter tout de mme, quau niveau du
golfe du Lion, la zone qui prolonge la crote continentale est considre par les gologues comme de la crote intermdiaire et non de la crote ocanique.
Attention : sur le profil sismique, les petits carrs gris indiquant les vitesses ne sont
pas correctement placs, il faut tous les descendre de 5mm (cette erreur est corrige
dans le tirage du manuel destin aux lves).

2. Les pistes de travail


Information dduites de lanalyse des documents
Doc. 1: Dans le modle prsent, le paramtre qui influence la vitesse de propagation des ondes sismiques est la nature des roches. Les roches ayant une densit diffrente, la vitesse des ondes sismiques varie.
Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 85

85

20/07/11 09:16

Doc. 2: Au niveau de la marge du golfe du Lion, diffrentes vitesses dondes sismiques sont enregistres. En associant ces vitesses avec linterprtation du profil et
les vitesses mesures dans diffrentes roches, on distingue trois couches :
au nord-ouest, une couche o les vitesses sont de lordre de 6,2 kms 1, forme de
granite : il sagit de la crote continentale ;
vers le sud-est, une couche moins paisse avec des vitesses de lordre de 6,7
6,8kms 1, forme de basaltes et gabbro ; il sagit de la crote ocanique ;
une couche sous-jacente o les vitesses sont un peu suprieures 8kms 1 et constitue de pridotite : cest le manteau suprieur.

Synthse : rponse au problme rsoudre


La vitesse de propagation des ondes sismiques dpend, en particulier, de la densit
des milieux traverss. Les roches ayant des densits diffrentes, il est possible de distinguer des enveloppes terrestres en fonction des roches qui les constituent. Ainsi, la
crote ocanique constitue de basaltes et de gabbros prsente des vitesses dondes
sismiques suprieures celles qui sont mesures dans la crote continentale constitue de granite.

3. Ressources complmentaires
Manuel numrique Bordas :

Vido Mesure de la vitesse de propagation des vibrations dans des roches de nature
diffrentes (dispositif avec Audacity ).
Power Point dune confrence de Michel Seranne (CNRS-Universit de Montpellier II) :

Louverture du Golfe du Lion et la godynamique de la Mditerrane Occidentale.


http://www.gm.univ-montp2.fr/spip/IMG/pdf/MargeGolfeLion.pdf
Lien : prsentation du principe de la sismique rflection (site IFREMER).

http://www.ifremer.fr/drogm_uk/Realisation/Vulgar/Sismique/sismic.htm

86

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 86

20/07/11 09:16

Activits pratiques

Les roches de la Terre solide (pages 98-99)


Connaissances

Capacits et attitudes

La diffrence daltitude observe entre continents et ocans


reflte un contraste gologique.
Les tudes ptrographiques permettent de caractriser
et de limiter deux grands types de crotes terrestres :
une crote ocanique essentiellement forme de basalte
et de gabbro et une crote continentale constitue entre
autres de granite.
La crote repose sur le manteau, constitu de pridotite.

Recenser, extraire et organiser des informations afin


dtablir une relation entre les donnes ptrographiques
et la distinction crote continentale crote ocanique.
Observer laide du microscope polarisant.

1. Les intentions pdagogiques


Dans lactivit prcdente, les lves ont compris que la distinction crote continentale et crote ocanique suggre par Wegener tait conforte par les donnes sismiques actuelles. Lobjectif est de montrer que les donnes ptrographiques valident
aussi cette distinction.
Les documents 1 4 illustrent ltude macroscopique et microscopique des roches
constituant les enveloppes terrestres, granite pour la crote continentale, basalte et
gabbro pour la crote ocanique et pridotite pour le manteau suprieur. Cette activit conduit les lves identifier les minraux et les lments chimiques majeurs de
ces roches et donc des enveloppes considres.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 4: Crotes continentale et ocanique se distinguent par les roches qui les
constituent et donc par les minraux suivants :
pour la crote continentale, quartz, feldspaths et micas ;
pour la crote ocanique, feldspaths et pyroxnes ;
pour le manteau, olivines et pyroxnes.
Dun point chimique, Si et Al sont les lments principaux de la crote continentale,
Si et Mg ceux de la crote ocanique et Si, Fe et Mg ceux du manteau.

Synthse : rponse au problme rsoudre


Wegener avait vu juste en distinguant deux types de crotes terrestres. En effet, si lon
met part loxygne qui est majoritaire dans tous les minraux :
les continents, forms essentiellement de granite, contiennent en majorit du silicium (Si) et de laluminium (Al), le SiAl pour Wegener ;
la crote ocanique contient en majorit du silicium et du magnsium (Mg), le SiMa
pour Wegener.
En revanche, le modle actuel diffre de la pense de Wegener. La crote continentale est certes moins dense que la crote ocanique, mais elle repose sur le manteau
suprieur, et non sur la crote ocanique.

3. Ressources complmentaires
Manuel numrique Bordas :

Outil interactif daide la lecture de lames minces de roches observes au microscope.


Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 87

87

20/07/11 09:16

Exercices

p. 106 109

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, p.351.

6 La vitesse des ondes sismiques


Cet exercice peut tre propos en relation avec le document 1 page 92. Il permet de
prciser les proprits des diffrents types dondes sismiques.
Les bonnes rponses sont : a ; c ; d.

7 La profondeur du Moho sous les Alpes


1. Voir schma document 5 page 95.
2. La profondeur du Moho partir de chaque sisme :
Sisme 2 : 32,4 km
Sisme 3 : 41,1 km
Sisme 4 : 24,9 km
Sisme 5 : 38,3 km
Sisme 6 : 39,4 km
Sisme 7 : 26,2 km
Sisme 8 : 22,6 km
3. La profondeur du Moho est ici variable. Lpaisseur moyenne de la crote continentale est de 30 km. On constate quau niveau des reliefs levs des Alpes, la crote
continentale est paissie (sismes 2, 3, 5 et 6). En bordure de ces reliefs levs, la
crote continentale est amincie (sismes 4, 7 et 8).

8 Drive des continents et biodiversit


Les continents taient runis en une masse unique appele Pange jusqu la fin du
Trias, il y a 200Ma. La faune et la flore prsentaient alors une certaine homognit.
La fracturation de la Pange en plusieurs masses continentales a cr un isolement
dune partie de la faune et de la flore. On constate alors une augmentation du nombre
de familles animales, passant de 200 il y a 200Ma 700 il y a 65Ma. Une relation peut donc tre tablie entre la drive des continents et une augmentation de la
biodiversit. La drive gntique, tudie en classe de Seconde, peut expliquer cette
augmentation du nombre de groupes lie lisolement gographique dune partie des
populations animales et vgtales.

9 La structure de la Lune interne


Schma reprsentant la structure interne de la Lune dduite des donnes sismiques.
On constate une premire acclration de la vitesse des ondes P et S vers 50 60 km de
profondeur avec des vitesses similaires celle du globe terrestre : il peut sagir dune
crote comparable celle de la Terre. Un ralentissement de la vitesse des ondes P et
S est visible vers 300km jusqu 500 km de profondeur puis les vitesses augmentent
nouveau et se stabilisent vers 1 000km de profondeur. De 60 1 000km de profondeur, il sagirait du manteau lunaire.
Au-dessous de 1 000km, on observe un ralentissement des ondes S marquant la prsence dun noyau.
88

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 88

20/07/11 09:16

10 Une roche nigmatique la surface de la Terre


Lobservation dune lame mince de lherzolite montre la prsence majoritaire de minraux
dolivine, associs quelques pyroxnes. La comparaison de la composition chimique
dune lherzolite avec celle dun basalte, dun gabbro et dune pridotite montre :
une relative pauvret en SiO2, en Al2O3 et CaO comme la pridotite ;
une relative richesse en MgO comme la pridotite.
La lherzolite est donc une roche appartenant la famille des pridotites qui sont les
roches qui constituent le manteau terrestre. La prsence dune telle roche est donc surprenante en surface de la Terre. Un contexte tectonique particulier, li lorogense
pyrnenne, a permis cette roche mantellique daffleurer aujourdhui. ltang de
Lerz (do le nom lherzolite), on marche sur le manteau .

Chapitre 1. La naissance dune thorie : la drive des continents

04732841_074-115.indd 89

89

20/07/11 09:16

Partie

chapitre

De la drive des continents


la tectonique des plaques
Activits pratiques

Lhypothse dune expansion ocanique (pages 112-113)


Connaissances

Capacits et attitudes

Au dbut des annes 1960, les dcouvertes de la topographie ocanique et des variations du flux thermique permettent dimaginer une expansion ocanique par accrtion de
matriau remontant laxe des dorsales, consquence
dune convection profonde.

Recenser, extraire et organiser des informations partir


de documents historiques.
Organiser des informations afin dtablir une relation
entre les diffrentes dcouvertes scientifiques et la thorie
de Hess.
Comprendre la nature provisoire, en devenir, du savoir
scientifique.

1. Les intentions pdagogiques


lissue du premier chapitre, les lves ont compris comment Wegener a imagin
sa thorie de la drive des continents et le rejet de cette thorie par la communaut
scientifique de lpoque. Nous nous situons ici quelques dizaines dannes plus tard,
aprs la Seconde Guerre mondiale et nous allons voir quune meilleure connaissance
des ocans a permis de ractualiser et de prciser les ides de Wegener.
Les documents 1 et 2 permettent aux lves dtablir un lien entre les avances technologiques et les dcouvertes scientifiques. En effet, on dcrit ici la technique utilise pendant les campagnes ocanographiques afin deffectuer des relevs de la topographie des fonds ocaniques ainsi que les rsultats obtenus. Lorigine de ces reliefs
ne fut pas explique dans un premier temps.
Le document 3 illustre la rpartition du flux gothermique la surface de la Terre.
Lobjectif ici est de montrer que ces mesures ont permis dattribuer un rle important au phnomne de convection mantellique imagin par Holmes dans la dynamique
globale de la Terre.
laide du document 4, on montre que lensemble des nouvelles donnes scientifiques de lpoque ont amen Hess proposer la thorie du double tapis roulant .
Les lves peuvent alors comparer cette thorie avec celle de Wegener.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: laide de sonars, il est possible dtablir des relevs topographiques
des fonds ocaniques. Les reliefs mis en vidence au fonds des ocans, en particulier
les dorsales ocaniques, ont grandement particip la construction du modle de la
90

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 90

20/07/11 09:16

tectonique des plaques avec lide dune expansion des fonds ocaniques partir de
ces dorsales.
Doc. 3: Le manteau semble plus chaud laplomb des dorsales et de certains bassins
situs lintrieur des arcs insulaires. Lexistence dingalits thermiques au sein du
manteau terrestre suggre un rle important jou par la convection.
Doc. 4: La thorie de Wegener et celle de Hess-Dietz admettent lexistence dune
crote continentale plus lgre se dplaant horizontalement la surface de la Terre.
Cependant, Hess pense que les continents, solidaires du manteau suprieur, seraient
transports sur une sorte de double tapis roulant et non en fendant les fonds ocaniques comme le suggrait Wegener. De plus, pour Hess et Dietz, la crote ocanique
ne supporterait pas les continents mais se formerait au niveau de dorsales et disparatrait au niveau des fosses, do lexpression sea floor spreading . Enfin, Hess propose comme moteur cette mobilit horizontale des continents lvacuation, par le phnomne de convection, de la chaleur du manteau issue de dsintgrations nuclaires.

Synthse : rponse au problme rsoudre


La mise en vidence des dorsales ocaniques prsentant un flux gothermique trs
lev, associe lide dune convection mantellique nonce par Holmes, a conduit
Hess et Dietz proposer lhypothse dune expansion des fonds ocanique en double
tapis roulant .

3. Ressources complmentaires
Site Plante Terre ENS Lyon : lhistoire de la tectonique des plaques.

http://planet-terre.ens-lyon.fr/planetterre/XML/db/planetterre/metadata/LOM-histoiretectonique-plaques.xml

Chapitre 2. De la drive des continents la tectonique des plaques

04732841_074-115.indd 91

91

20/07/11 09:16

Activits pratiques

Un apport dterminant : le palomagntisme (pages 114-115)


Connaissances

Capacits et attitudes

La dcouverte du palomagntisme et dune drive appa- Recenser, extraire et organiser des informations partir
rente des ples va faire renatre lide dune mobilit hori- de documents historiques
Recenser, extraire et organiser des informations afin
zontale des continents.
dtablir une relation entre le palomagntisme et la mobilit des continents.
Utiliser les TICE.

1. Les intentions pdagogiques


Nous allons voir que la dcouverte du palomagntisme a t fondamentale dans
lavance des ides sur la mobilit horizontale des continents. Afin de comprendre
ces dcouvertes, il est ncessaire de connatre les caractristiques du champ magntique terrestre actuel. Cest lobjet des documents 1 et 2.
Le document 1 invite les lves dterminer la position des ples Nord gographique
et magntique laide de Google Earth. Il sagit de prciser les coordonnes en latitude et longitude des ples. On montre que ces deux ples ne sont pas confondus
mais proches lun de lautre. Une estimation de la distance les sparant est possible.
Le document 2 expose toutes les caractristiques du champ magntique terrestre
actuel en prcisant lorientation de laiguille dune boussole selon les lignes de champ.
laide du document 3, les lves comprennent quune roche contenant des minraux particuliers peut garder en mmoire les caractres du magntisme terrestre du
lieu et de lpoque de sa formation. Les caractristiques de ce magntisme fossile sont
mesurables et peuvent tre exploites pour dterminer la position dun palople
une poque donne et en un lieu donn.
Le document 4 expose deux cas : la position du palople en diffrents lieux mais
une poque prcise et la position du palople en un mme lieu mais diffrentes
poques. En considrant quil ne peut y avoir quun seul ple Nord magntique une
poque donne, les lves peroivent limportance du palomagntisme dans la ractualisation de lide dune mobilit horizontale des continents.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 : Les ples Nord magntique et gographique sont localiss prcisment
laide de Google Earth avec le fichier magnetisme1S.kmz . Les latitudes et les longitudes sont prcises. Les deux ples ne sont pas confondus et sont distants denviron 600km. Une tude similaire est possible avec les ples Sud.
Doc. 2: Dans lhmisphre Nord comme dans lhmisphre Sud, laiguille de la boussole pointe en direction du ple Nord magntique.
Doc. 3:. Une roche telle quun basalte dvie laiguille dune boussole. La prsence
de ce magntisme fossile au sein de ces roches est exploite.
92

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 92

20/07/11 09:16

Doc. 4: Le document a dcrit la position du palople dtermine partir dchantillons de mme ge mais prlevs sur des continents diffrents. On constate que pour
cette poque plusieurs paloples sont trouvs. Or il ne peut y avoir quun seul ple
Nord magntique une poque donne. Ce sont donc les continents sur lesquels ont
t raliss les prlvements qui se sont dplacs.
Ltude des paloples prsents sur le document b permet de penser que les deux
continents (Amrique et Afrique) taient runis jusqu 250Ma. Ensuite, ils se sont
spars et ont driv pour occuper leur position actuelle.

Synthse : rponse au problme rsoudre


En considrant quil ne peut y avoir quun seul ple Nord (ou un seul ple Sud) magntique une poque donne, la seule faon dtablir une correspondance entre les diffrents paloples trouvs est dimaginer une mobilit horizontale des continents.

3. Ressources complmentaires
Site de lInstitut de Physique du Globe de Paris : le palomagntisme. Une vido

dun entretien avec Y. Gallet et des articles expliquant le palomagntisme :


http://www.ipgp.fr/pages/0214.php
Le site de lUniversit de Kyoto apportera de nombreux renseignements sur :

le magntisme terrestre http://wdc.kugi.kyoto-u.ac.jp/index.html


les variations dintensit de ce magntisme Animation of secular variation in
geomagnetic total intensity for the last 400 years http://wdc.kugi.kyoto-u.ac.jp/igrf/anime/
index.html
Bibliographie

A. Hallam, Une rvolution dans les Sciences de la Terre, d. Points Science, 1976.

Chapitre 2. De la drive des continents la tectonique des plaques

04732841_074-115.indd 93

93

29/07/11 11:25

Activits pratiques

Palomagntisme et expansion des fonds ocaniques (pages 116-117)


Connaissances

Capacits et attitudes

La mise en vidence de bandes danomalies magntiques


symtriques par rapport laxe des dorsales ocaniques,
corrlables avec les phnomnes dinversion des ples
magntiques (connus depuis le dbut du sicle) permet
dprouver cette hypothse et de calculer des vitesses
dexpansion.

Organiser des informations afin dtablir une relation entre


le palomagntisme et lexpansion des fonds ocaniques.
Manipuler des modles scientifiques.
Percevoir le lien entre sciences et techniques.

1. Les intentions pdagogiques


Cette activit est en lien troit avec la prcdente : le palomagntisme, avec ltude
des paloples, a apport un argument majeur en faveur dune mobilit horizontale
des continents. Nous allons voir ici que le palomagntisme des fonds ocaniques va
tre dterminant.
Le document 1 expose les techniques utilises dans les annes 1950 pour enregistrer
le magntisme des fonds marins. Linterprtation par les lves des enregistrements
obtenus ncessite des prcisions concernant lexistence dinversions du champ magntique terrestre au cours des temps gologiques. Les lves peuvent aussi constater une
symtrie de part et dautre de la dorsale des anomalies magntiques.
Le document 2 a pour objectif de rendre moins abstrait les enregistrements dcrits
dans le document 1. On illustre ici une manipulation ralisable par les lves laide
dun modle simple. Les aimants sont disposs de faon ce que lenregistrement
du champ magntique montre des variations avec des valeurs positives et des valeurs
ngatives. Il sagit dtablir un lien avec les enregistrements dcrits dans le docment 1.
Le document 3 expose les relations qui ont t tablies dans les annes 1960 entre
diffrentes donnes : les anomalies magntiques des fonds ocaniques (en peau de
zbre ), le calendrier des inversions magntiques et lge des basaltes des fonds ocaniques. partir de ces relations, les lves constatent une symtrie par rapport laxe
de la dorsale de lensemble de ces donnes. Ils peuvent alors calculer une vitesse dexpansion des fonds ocaniques dans cette rgion de lAtlantique Nord.
Le document 4 permet de revenir une approche historique avec la description des
travaux de Vine et Matthews. Les lves comprennent comment ces deux chercheurs
ont rapproch les donnes du palomagntisme avec lide de Hess du double tapis
roulant . Ainsi, lide de lexpansion des fonds ocaniques tait accepte.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: La prsence danomalies magntiques enregistres au fond des ocans
est relier avec la mise en vidence dinversions du champ magntique au cours des
temps gologiques et lexistence dans les basaltes (les aimants dans le modle) dun
magntisme fossile. Une anomalie positive sexplique par laddition du champ magntique actuel avec le champ palomagntique de mme polarit (aimants normaux
dans le modle). Une anomalie ngative sexplique par la prsence dun champ palo94

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 94

20/07/11 09:16

magntique de polarit inverse (aimants inverses dans le modle) qui se soustrait


au champ actuel.
Doc. 3: La mise en relation des donnes du palomagntisme avec lge des basaltes
des fonds ocaniques permet de calculer une vitesse dexpansion. Le rsultat trouv
ici pour lAtlantique Nord est denviron 1,8cm par an de part et dautre de la dorsale
soit une vitesse dexpansion de 3,6cm par an.
Doc. 4: Les travaux de Vine et Matthews permettent de comprendre que le plancher
ocanique se met en place partir de magma remontant laxe de la dorsale. En refroidissant, ce magma acquiert une aimantation dont la polarit est normale ou inverse
selon la priode. Ainsi, en sloignant de laxe de la dorsale les anomalies magntiques + et alternent et lge des fonds ocaniques augmente.

Synthse : rponse au problme rsoudre


Les donnes majeures du palomagntisme dcrites sont les inversions du champ magntique terrestre au cours des temps gologiques et les anomalies magntiques au fond
des ocans formant des bandes parallles entre elles et symtriques par rapport laxe
de la dorsale. Ces donnes, mises en relation avec lge des basaltes des fonds ocaniques, ont apport la preuve que le plancher ocanique est en perptuelle expansion.

3. Ressources complmentaires
Matriel : Teslamtre; diffrents aimants.

Chapitre 2. De la drive des continents la tectonique des plaques

04732841_074-115.indd 95

95

20/07/11 09:16

Activits pratiques

La distinction lithosphre asthnosphre (pages 118-119)


Connaissances

Capacits et attitudes

Au voisinage des fosses ocaniques, la distribution spatiale des foyers des sismes en fonction de leur profondeur
stablit selon un plan inclin.
Les diffrences de vitesse des ondes sismiques qui se
propagent le long de ce plan, par rapport celles qui sen
cartent, permettent de distinguer : la lithosphre de
lasthnosphre.
Linterprtation de ces donnes sismiques permet ainsi
de montrer que la lithosphre senfonce dans le manteau
au niveau des fosses dites de subduction.
La limite infrieure de la lithosphre correspond gnralement lisotherme 1 300 C.

Recenser, extraire et organiser des informations partir


de modles.
Exprimer et exploiter des rsultats, lcrit, loral,
en utilisant les technologies de linformation et de la
communication.

1. Les intentions pdagogiques


En classe de Quatrime, les lves ont dj abord la distinction lithosphre asthnosphre et la notion de plaques lithosphriques rigides se dplaant sur lasthnosphre moins rigide. Il sagit ici de montrer aux lves les donnes qui ont permis aux
scientifiques de proposer une telle distinction.
Les documents 1 et 2 apportent des arguments scientifiques qui ont amen imaginer, dans les zones de subduction, le plongement dune zone froide dans un manteau plus chaud.
Le document 1 illustre limportance de ltude des ondes sismiques. Les lves comprennent quun lien est tabli entre la propagation des ondes sismiques dans les zones
de subduction et la densit des milieux traverss.
Le document 2 montre une modlisation des isothermes au niveau des zones de subduction dduite de la mesure du flux gothermique dans ces zones. Ce modle est en
accord avec les donnes du document 1.
Le document 3 apporte une touche historique avec les travaux de Wadati Benioff
concernant la rpartition des foyers sismiques dans les zones de subduction et les
interprtations dOliver et Isacks. On comprend ici la distinction entre une lithosphre
rigide et lasthnosphre ductile.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: La vitesse des ondes sismiques dpend en partie de la densit des milieux traverss. Les anomalies thermiques dduites de ltude des enregistrements des ondes
permettent de reprer une zone froide laplomb de la fosse ocanique et une zone
chaude sous larc volcanique.
Doc. 2: Le modle des isothermes dduit des mesures du flux gothermique dans
les zones de subduction montre une zone froide qui plonge sous la zone volcanique.
Cette zone froide est lorigine de lacclration des ondes sismiques (sisme superficiel du doc.1).
96

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 96

20/07/11 09:16

Doc. 3: La prsence sous le continent, au niveau du Japon, de foyers sismiques en


grande profondeur, disposs selon un plan inclin, sur une paisseur denviron 100km,
est interprte comme une couche rigide qui senfonce dans le manteau. Cette couche
rigide et froide (doc.1 et2) appele lithosphre est distingue de lasthnosphre ductile, la base de la lithosphre correspondant lisotherme 1 300C.

Synthse : rponse au problme rsoudre


Ltude des ondes sismiques et du flux gothermique dans les zones de subduction
montre la prsence danomalies thermiques avec une zone froide qui plonge dans le
manteau plus chaud. Ces donnes sont en accord avec celles tires de la prsence et
de la rpartition des foyers sismiques en profondeur qui montrent une zone rigide de
100km dpaisseur qui senfonce dans le manteau. Ainsi, lithosphre rigide et froide
est distingue de lasthnosphre ductile et plus chaude.

3. Ressources complmentaires
Logiciel : Sismolog (Ed. Chrysis)
Site de lInstitut de Physique du Globe de Paris : Banque de donnes des derniers

sismes de magnitude suprieure 6,3 : http://geoscope.ipgp.fr/

Activits pratiques

Des plaques rigides qui se dplacent sur une sphre (pages 120-121)
Connaissances

Capacits et attitudes

la fin des annes soixante, la gomtrie des failles trans- Recenser, extraire et organiser des informations afin
formantes ocaniques permet de proposer un modle en dtablir une relation entre les failles transformantes et le
plaques rigides.
dplacement des plaques rigides.
Manipuler des modles scientifiques.

1. Les intentions pdagogiques


En classe de Quatrime, les lves ont vu que la partie externe de la Terre est forme
de plaques lithosphriques rigides animes de mouvements lorigine des dformations. Ces dplacements ont t jusque-l dcrits sur un planisphre. Or, ces dplacements seffectuent sur le globe terrestre, cest--dire sur une surface sphrique. Il
sagit ici de comprendre comment des plaques rigides se dplacent sur une sphre en
exposant les dcouvertes historiques associes.
Le document 1 prsente la gomtrie des failles transformantes, tranches profondes
perpendiculaires laxe des dorsales ocaniques.
Le document 2 situe les foyers sismiques le long dune dorsale ocanique. Lobjectif ici est de montrer une continuit entre laxe des dorsales et une partie des failles
transformantes. Ainsi, les lves comprennent que ces failles correspondent des frontires de plaques en coulissage.
Le document 3 propose une manipulation ralisable en classe laide dun globe terrestre (sur lequel apparat le relief des fonds ocaniques), dun papier calque et dun
Chapitre 2. De la drive des continents la tectonique des plaques

04732841_074-115.indd 97

97

20/07/11 09:16

compas. Cette manipulation est mettre en relation avec le document4 qui expose
lhypothse plaquiste de Morgan en 1967 en lien avec la cintique eulrienne. On
comprend ici que ltude des failles transformantes permet de reconstituer le dplacement des plaques rigides sur le globe.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les failles transformantes dcalent laxe des dorsales ocaniques. Il sagit
dune frontire de plaque en coulissage.
Doc. 2: Les failles transformantes ne prsentent une activit sismique que sur la partie qui dcale laxe des dorsales. Cette localisation appuie le fait que ces failles transformantes sont des frontires de plaques en coulissage.
Doc. 3 et 4: Les failles transformantes sont assimiles des petits cercles centrs sur
le mme axe. Ainsi, le dplacement des plaques rigides sur le globe correspond une
rotation autour dun axe, dit axe eulrien, passant par le centre de la Terre. Les ples
de rotation appels ples eulriens (distincts des ples gographiques) permettent de
reconstituer les dplacements des plaques.

Synthse : rponse au problme rsoudre


La dcouverte des failles transformantes par Wilson a permis de comprendre et de
reconstituer le dplacement de plaques rigides sur le globe terrestre. Ainsi, lhypothse plaquiste propose par Morgan avec le dplacement de plaques lithosphriques la surface du globe a pu tre argumente.

3. Ressources complmentaires
Manuel numrique Bordas : Animation prsentant les failles transformantes

et le mouvement des plaques autour de leur ple de rotation.


Site ressources Bordas : lien pour une vido prsentant la dcouverte du rift ocanique

(extrait de lopration Famous) : les pillows-lavas, les failles, lenvironnement.


Document Cerimes : http://www.cerimes.fr/la-banque-dimages/les-pillow-lava.html

Activits pratiques

Un premier modle : la tectonique des plaques (pages 122-123)


Connaissances

Capacits et attitudes

Des travaux complmentaires parachvent ltablissement de la thorie de la tectonique des plaques en montrant
que les mouvements divergents (dorsales), dcrochants
(failles transformantes) et convergents (zones de subduction) sont cohrents avec ce modle gomtrique.
Des alignements volcaniques, situs en domaine ocanique ou continental, dont la position ne correspond pas
des frontires de plaques, sont la trace du dplacement de
plaques lithosphriques au dessus dun point chaud fixe,
en premire approximation, dans le manteau.

Comprendre la nature provisoire, en devenir, du savoir


scientifique.
Recenser, extraire et organiser des informations afin
dtablir une relation entre le volcanisme de point chaud
et la thorie de la tectonique des plaques.

98

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 98

20/07/11 09:16

1. Les intentions pdagogiques


Cette double page montre comment, la fin des annes 1960, lensemble des donnes ont t regroupes dans une thorie appele tectonique des plaques. Cette thorie, accepte prsent par la communaut scientifique, a t enrichie par la dcouverte des points chauds qui semblaient, a priori, ne pas sy intgrer.
Le document 1 dcrit les travaux de jeunes chercheurs, en particulier Le Pichon, qui
aboutissent proposer un premier modle global avec une surface terrestre dcoupe
en six plaques lithosphriques ainsi que les mouvements aux frontires.
Les documents 2 et 3 exposent le volcanisme de point chaud. On montre ici comment
lexplication de ce volcanisme, qui bien qutant le plus souvent intraplaque, sintgre
tout de mme au modle de la tectonique des plaques.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: En intgrant lensemble des donnes gologiques de lpoque (donnes sismiques, volcaniques, palomagntiques, cintiques), les chercheurs Morgan, Mc Kenzie et Le Pichon proposent un premier modle o la surface de la Terre est dcoupe en
six plaques lithosphriques. Les mouvements relatifs des plaques aux diffrentes frontires sont prciss : mouvements divergents aux dorsales, mouvements dcrochants
au niveau des failles transformantes, mouvements convergents aux fosses ocaniques.
Doc. 2: Le volcanisme de point chaud est, dans la plupart des cas, situ au sein mme
des plaques et non aux frontires des plaques. Il semble donc chapper au modle global propos dans le document1.
Doc. 3: La thorie des points chauds propose par Morgan permet dexpliquer les alignements dles volcaniques. La direction de la plaque Pacifique au-dessus du point
chaud dHawa a t NNO-SSE de 65Ma 44Ma puis NO-SE par la suite. La
vitesse de dplacement de la plaque est denviron 8,5cm par an.

Synthse : rponse au problme rsoudre


Le volcanisme intraplaque de points chauds est expliqu par Morgan. Un point chaud,
quasi immobile dans le manteau profond, alimente le volcanisme de surface et perfore
rgulirement la plaque lithosphrique qui se dplace au-dessus. Il en rsulte des alignements dles volcaniques, les les les plus loignes du volcanisme actuel tant les
plus anciennes. Ce phnomne apporte donc un argument supplmentaire la thorie de la tectonique des plaques.

3. Ressources complmentaires
Manuel numrique Bordas : Animation prsentant le volcanisme de point chaud

(explication de lalignement des les volcaniques).

Chapitre 2. De la drive des continents la tectonique des plaques

04732841_074-115.indd 99

99

20/07/11 09:16

Exercices

p. 130 133

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, p.351.

6 Une vitesse dexpansion variable dun ocan lautre


Les bonnes rponses sont : a et d.

7 Le palomagntisme, un marqueur de la mobilit continentale


Le vecteur inclinaison de laimantation thermo-rmanente (ATR) du blocA est tangent
la ligne de champ magntique actuel du lieu. Concernant les trapps du Deccan (blocB),
le vecteur inclinaison nest pas tangent la ligne de champ magntique actuel du lieu.
Afin de rendre ce vecteur tangent une ligne de champ, le blocB doit tre dplac
environ 20 de latitude vers le sud. Le palomagntisme, avec laimantation thermormanente des roches des trapps du Deccan, permet de penser que ces trapps se sont
formes au niveau du point chaud de lle de la Runion situe 21 de latitude sud.

8 La sparation du bloc corso-sarde et du continent


1. Les mesures palomagntiques montrent deux directions diffrentes pour laxe passant les ples magntiques de lpoque. Or, une poque donne (ici le Permien), il
ne peut y avoir quune seule direction pour cet axe. La seule faon de les faire correspondre est de ramener la Corse contre la cte provenale.
2. partir du point A, lisobathe 2 000m longe les ctes provenale et languedocienne ainsi que les ctes de la Corse et de la Sardaigne. Le bassin algro-provenal
prend donc une forme enV.
3. Les donnes palomagntiques et bathymtriques amnent donc penser que le
bloc corso-sarde sest spar de la France la faveur dune rotation vers le sud-est,
avec comme axe de rotation le pointA.

9 Une clbre faille active : la faille de San Andreas


Les dformations associes lactivit de la faille de San Andreas sont spectaculaires
et apparaissent nettement dans le paysage. On observe de grandes fractures sur des
centaines de kilomtres avec des cours deau et des valles, dcals horizontalement.
Parmi les trois grands types de failles distingus par les gologues, la faille de San
Andreas est une faille dcrochante.
Les gologues assimilent la faille de San Andreas une faille transformante. Ces grandes
failles sont des structures qui dcalent laxe des dorsales ocaniques sur de grandes
distances avec une importante activit sismique. En effet, la faille de San Andreas est
situe en continuit de la dorsale du Pacifique-Est dont on constate quelle dcale
laxe sur plusieurs milliers de kilomtres. De plus, elle possde une importante activit sismique.

10 Une microplaque dans le Pacifique


La rgion tudie se situe dans la continuit de la dorsale du Pacifique-Est proximit de lle de Pques. Les gologues qualifient cette rgion de microplaque
le de Pques pour diverses raisons. En premier lieu, elle possde une intense activit sismique sur ses contours tout comme les plaques lithosphriques de grande dimension. De plus, ses contours sont des reliefs considrs comme tant des frontires de
plaques : une petite partie de la dorsale du Pacifique-Est, des failles transformantes et
une zone de compression due la rotation de la microplaque.
100

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 100

20/07/11 09:16

Partie

chapitre

La tectonique des plaques :


un modle qui senrichit
Activits pratiques

Lexpansion ocanique confirme par les forages (pages 136-137)


Connaissances

Capacits et attitudes

Le modle prvoit que la crote ocanique est dautant Saisir et exploiter des informations sur carte ou SIG.
plus vieille quon sloigne de la dorsale. Les ges des
sdiments en contact avec le plancher ocanique (programme de forage sous-marins J.O.I.D.E.S) confirment
cette prdiction et les vitesses prvues par le modle de
la tectonique des plaques.

1. Intentions pdagogiques
Cet ensemble dactivits, motivantes pour les lves, les place en position de recherche
darguments en faveur de lexpansion ocanique prcdemment dduite de mesures
gophysiques : donnes palomagntiques, flux gothermique et topographie des
fonds ocaniques.
Partant du modle de lexpansion ocanique et de leurs acquis sur la nature du plancher ocanique dune part, lexistence dune sdimentation ocanique dautre part, les
lves peuvent trouver des consquences prvisibles du modle.
Les supports de ces activits permettent aussi de replacer une tape de lhistoire de
la construction du modle de la tectonique. En quelques dizaines dannes, grce aux
progrs de la technologie, ltude du domaine sous-marin (qui reprsente les de la
surface du globe) a donn au modle de la tectonique des plaques des arguments irrfutables : expansion ocanique et disparition de la lithosphre ; elle a aussi permis
de confirmer la dualit de nature entre la crote ocanique et continentale La cohrence des rsultats obtenus dans tous les forages fait que la thorie de la tectonique
des plaques est dsormais fonde sur des faits dobservation directs.
travers le document 1, on sinforme des campagnes de forages des fonds ocaniques permettant daccder au basalte et aux sdiments du plancher ocanique. On
souligne les aspects technologiques lis au carottage ainsi que lacclration aprs la
Seconde Guerre mondiale des projets des grands instituts ocanographiques ainsi que
la volont internationale de mutualiser les efforts. Utiliss depuis longtemps par les
prospecteurs de ptrole au niveau du plateau continental, les forages profonds dbutent en 1964. Le programme de forage J.O.I.D.E.S (Joint Oceanographic Institutions
for Deep Earth Sampling), mis au point en 1968 par lensemble des laboratoires ocanographiques des tats-Unis, est tendu en 1974 une collaboration internationale
(France, Allemagne Fdrale, Royaume-Uni, Japon, URSS sous le nom de programme
Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 101

101

20/07/11 09:16

I.P.O.D) puis en 1984 dautres participants (dont le Canada et lAustralie) sous le


nom O.D.P (Ocean Drilling Program). Au milieu des annes 1990, prs de mille puits
sont fors dans locan mondial. Ainsi, le puits 504B du programme I.P.O.D (international program for Ocean Drilling) au large du Costa Rica, sous 4 000mtres deau et
400mtres de sdiments, a travers presque 1 200m de crote ocanique, des basaltes
aux dolrites et aux gabbros.
On utilise les rsultats des sites de forage visualisables sous Google Earth (qui permet
aussi de superposer la morphologie du fond des ocans au niveau de la zone concerne) pour faire prouver les consquences prvisibles du modle du double tapis roulant mis par Hess en 1960. On peut constater lpaisseur croissante de sdiments
ainsi que la profondeur croissante du toit du basalte au fur et mesure de lloignement de la ride mdioatlantique (sites16 21) mais aussi la symtrie. Ces donnes
permettent de construire, avec un tableur, une reprsentation graphique, centre sur la
ride Atlantique Sud, et figurant lvolution de lpaisseur de sdiments et de la profondeur du toit du basalte.
Tous les prlvements montrent que les consquences prvisibles du modle sont
vrifies.
Le document 2 permet dprouver la solidit du modle de lexpansion en corrlant les vitesses dexpansion dduites des sdiments et celles dduites des inversions
palomagntiques dans lAtlantique Nord. On peut ainsi faire calculer pour diffrentes priodes les vitesses douverture (Miocne, ocne, Crtac suprieur et infrieur ainsi que Jurassique).
Le document 3 montre que la vitesse douverture est variable selon la dorsale (sans
entrer dans le dtail des dorsales rapides et lentes).
Enfin, les documents 1 3 offrent des supports entranant les lves mieux se situer
dans lespace et dans le temps : les SIG (Google Earth), les cartes 2D construites
partir de donnes de forages diffrentes chelles, ainsi que la construction possible
dune coupe ouest-est au niveau de lAmrique du Sud, permettent aux lves de changer dchelles et de mode de visualisation.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Le processus de formation des fonds ocaniques par expansion partir des
dorsales ocaniques implique que ceux-ci soient de plus en plus anciens en sloignant
des rides ; en consquence, les accumulations sdimentaires doivent tre de plus en
plus anciennes et paisses pour atteindre leur maximum en bordure des continents.
Si le modle de lexpansion ocanique est valide alors les vitesses dexpansion doivent tre confirmes.
Le schma demand doit reprsenter des sdiments qui spaississent mesure que
lon sloigne de la dorsale.
Doc. 2: Les valeurs trouves montrent de bonnes corrlations : ainsi, sur la partie est de
la dorsale, les valeurs dexpansion trouves partir des sdiments sont de 1,53cman 1
(ocne), 1,70 cman 1 (Crtac suprieur) et 1,71 cman 1 (Crtac infrieur).
La comparaison avec les vitesses dduites de lge et de la position des anomalies
palomagntiques concordent bien (1,52cman 1 pour locne, 1,58cman 1 pour
le Crtac suprieur et 1,68cman 1 pour le Crtac infrieur).
Doc. 3: La comparaison de la vitesse douverture de diffrents domaines ocaniques
peut se raliser en comparant la surface de sdiments de mmes ges laffleurement.
102

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 102

20/07/11 09:16

Plus cette surface est importante plus la vitesse douverture est leve. La dorsale
Est-Pacifique ainsi que la dorsale Indienne du sud-est sont des dorsales o la vitesse
dexpansion est leve (au contraire de la dorsale de lAtlantique Nord ou encore la
dorsale Atlantique-ocan Indien). Les valeurs opposes actuelles peuvent tre reprsentes par un taux douverture de 1,5cman 1 dans le jeune ocan de la mer Rouge
18cman 1 pour la dorsale est-pacifique.
Dans locan Atlantique, les ges les plus anciens reconnus sont Jurassique ( 180Ma)
puis, successivement, Crtace et Tertiaire en se rapprochant de la ride. Il en va de
mme dans lAtlantique Sud, avec cependant un dcalage de temps, louverture de
celui-ci dbutant au Crtac infrieur (140 110Ma). Nulle part la crote ocanique est plus vieille que le Jurassique infrieur (180Ma). Aucun forage na rencontr de crote ocanique palozoque, ni mme triasique confirmant la dualit ocanscontinents et la jeunesse des ocans qui soppose la vieillesse des continents.

Synthse : rponse au problme rsoudre


La possibilit daccs direct aux roches constitutives du plancher ocanique permet
de confirmer le modle de lexpansion ocanique de Hess. Lge, lpaisseur, la succession des sdiments dans les colonnes stratigraphiques obtenues par forages confirment partout le modle du double tapis roulant . Lge et la profondeur du toit du
basalte confirment aussi lexpansion. De plus, les vitesses douverture dduites des
sdiments concordent parfaitement avec les donnes gophysiques obtenues partir
des anomalies palomagntiques.

3. Ressources complmentaires
Liens sur le site ressources Bordas :

Entretiens avec Mathilde Cannat, chercheur IPGP-CNRS, et des membres de lquipe qui
aborde les diffrents aspects des campagnes de gosciences marines VIDEO : http://www.
ipgp.fr/pages/062003.php
Donnes sur lge des sdiments : http://www.ngdc.noaa.gov/mgg/image/crustalimages.
html
Donnes cartographiques sur lpaisseur des sdiments : http://www.ngdc.noaa.gov/mgg/
sedthick/sedthick.html
Des informations sur le site European Consortium for Ocean Drilling Research
(ECORD) : http://www.ecord.org/edu/education.html et un accs aux forages de 1968
jusquen 2011 : http://brg.ldeo.columbia.edu/logdb/
Atlas des formations superficielles et des donnes morpho-bathymtriques : http://wwz.
ifremer.fr/drogm/Cartographie/Atlas-numeriques
Article de Xavier Le Pichon (1977), 1967-1977 ; ten years of marine geology
and geophysics , retraant les arguments en faveur de lexpansion ocanique. Nature
(Macmillan Journals), 1977-06, Vol. 267, N. 5614, p. 765-769 : http://archimer.ifremer.fr/
doc/00000/5206/
Vido prsentant une campagne de forages du Glomar Challenger (technique
de carottage, exploitation des chantillons). Les commentaires sont en anglais mais
les images suffisent.
http://www.criticalpast.com/video/65675043177_The-Glomar-Challenger_Doctor-M-N-APeterson_Discovery-in-the-Deep_Animation

Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 103

103

20/07/11 09:16

Activits pratiques

La mobilit des plaques confirme par les donnes GPS (pages 138-139)
Connaissances

Capacits et attitudes

Le modle prvoit des vitesses de dplacements des Raliser des mesures sur le terrain pour comprendre le
plaques (daprs le palomagntisme et les alignements principe du GPS.
de volcans intraplaques). Avec lutilisation des techniques Saisir et exploiter des donnes sur des logiciels.
de positionnement par satellites (GPS) la fin du XXe sicle
les mouvements des plaques deviennent directement
observables et leurs vitesses confirmes.

1. Les intentions pdagogiques


Dans le cadre de lhistoire de la construction du modle, une fois le modle de lexpansion ocanique valid par les donnes obtenues partir de forages, les techniques
de gopositionnement vont permettre de visualiser directement des mouvements au
niveau des plaques lithosphriques.
La dmarche employe entrane les lves discuter un modle tabli et la prciser.
Le GPS ou Global Positionning System a t dvelopp par le dpartement de la
dfense amricaine en 1978. Il permet le positionnement prcis en latitude, altitude
et longitude de nimporte quel lieu quelles que soient lheure et les conditions mtorologiques. Cette technique a permis de valider le dplacement identique (vitesse
angulaire constante) de tous les points dune mme plaque et donc, par l mme de
confirmer lexistence de cette plaque. De plus, la prcision des mesures (de lordre
du millimtre) a permis de prciser les comportements des plaques leur frontire.
travers le document 1, on comprend que grce au nombre important de satellites
utiliss, cette technique permet de suivre le dplacement de tout rcepteur au sol.
la diffrence dautres techniques de gopositionnement comme DORIS ou ARGOS,
ce sont les satellites qui mettent un signal et lobjet au sol qui reoit. On mesure
alors le temps de trajet de limpulsion. En le multipliant par la vitesse de la lumire,
on en dduit la distance entre le satellite et la station. Si trois satellites effectuent une
mesure simultane, on peut calculer nimporte quelle position par triangulation. Les
donnes GPS lies la tectonique des plaques ont une prcision de lordre du millimtre. Pour mesurer un dplacement dune plaque, on matrialise un point de manire
simple. Il suffit en fait de poser un clou, qui est un cylindre en inox. sa verticale, une antenne est positionne, la mesure obtenue permet de trouver la position du
clou en latitude, longitude et altitude. Quelques centaines de rcepteurs sont fixs
au sol et fournissent donc des mesures en continu (rseau mondial de lIGS : International GPS System). La relative simplicit de linstallation au sol, la multiplicit et
la continuit des mesures ainsi que leur prcision constituent les atouts du GPS pour
ltude du dplacement des plaques lithosphriques.
partir dune banque de donnes GPS, llve peut construire ou exploiter des graphiques correspondant la latitude ou longitude de la balise en fonction du temps.
Ce travail de construction vectorielle afin de dduire la rsultante des vitesses longitudinale et latitudinale est loccasion de travailler en relation avec les mathmatiques.
On exploite les documents 2 et 3 afin de montrer que les mouvements enregistrs par
GPS confirment les donnes palomagntiques en Islande.
Enfin, le document 4 permet de montrer que les donnes GPS concordent avec les
donnes du volcanisme de point chaud.
104

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 104

20/07/11 09:16

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Lintrt du GPS (ou Global Positionning System) est quil permet le positionnement prcis de nimporte quel lieu en longitude, latitude et altitude, quelles que
soient lheure et les conditions mtorologiques.
Doc. 2 et 3: Les mouvements enregistrs par GPS confirment les donnes palomagntiques en Islande. Les enregistrements du document2 permettent de comprendre
comment les donnes graphiques peuvent tre reprsentes par des vecteurs dont la
rsultante donne la direction et la vitesse de dplacement du point (balise REYK).
Une application peut alors tre ralise pour la balise HFN : direction NE et vitesse
de 20,5mman1. Les mouvements sont donc opposs de part et dautre de la dorsale avec des vitesses similaires. Le document3 permet destimer la vitesse douverture au niveau de la dorsale de Kolbeinsey partir des ges des diffrents basaltes. Le
calcul, au niveau de la partie nord de la dorsale merge, permet dobtenir des valeurs
denviron 2,2cman1 ce qui concorde avec les donnes GPS.
La comparaison des donnes obtenues par des mesures gologiques sur une moyenne
de 3 Ma et des donnes instantanes GPS confirme et prcise les directions et
vitesses de dplacements des plaques lithosphriques.
Doc. 4 : Le calcul du cfficient directeur des droites de latitude et de longitude
(yb-ya / xb - xa) donne les valeurs de +3,5 pour la latitude (dplacement vers le nord)
et de 6,6 pour la longitude (dplacement vers louest). En utilisant une construction
vectorielle, on peut valuer la vitesse de dplacement de la balise HILO en moyenne
(sur 10ans) 7,5cman1 direction nord-ouest. La vitesse de dplacement, calcule
entre les les de West maui et de Haleakala, donne une valeur de 7,78 cman 1, celle
obtenue entre les les Walanoe et Koolau, une valeur de 4,27cman1, celle entre les
les Kahoolawa et Koala de 16,5cman1. On peut ainsi constater que la direction
du dplacement est sensiblement la mme mais que la vitesse varie de faon importante au cours du temps en augmentant de 4,27 16,6cman1. On est ainsi amen
constater que les donnes GPS fournissent une image instantane du dplacement dune plaque lithosphrique alors que les donnes du volcanisme de point chaud
offrent une image de lvolution de la vitesse de dplacement dune plaque au cours
de priodes gologiques plus longues.

Synthse : rponse au problme rsoudre


Les mesures GPS apportent une preuve au dplacement des plaques lithosphriques.
Il ressort de ces techniques que lon obtient des vitesses instantanes de dplacement des plaques parfaitement en accord avec les valeurs moyennes calcules sur plusieurs Ma partir de donnes gologiques (donnes palomagntiques et volcanisme de
point chaud). Le nombre important de balises au sol permet de vrifier que la vitesse
angulaire de tous les points dune mme plaque est identique et donc de confirmer
quune plaque lithosphrique est une unit rigide non dformable.

3. Ressources complmentaires
Site ressources Bordas:

Ressource sur les systmes embarqus, de leur fonctionnement leurs principales


missions en particulier le systme NAVSTAR-GPS et GALILEO http://www.educnet.
education.fr/orbito/system/default.htm
Banque de donnes de la NASA sur les dplacements de 2000 balises GPS depuis
environ une dizaine dannes http://sideshow.jpl.nasa.gov/mbh/series.html

Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 105

105

20/07/11 09:16

Activits pratiques

Une vue globale de la cinmatique du globe (pages 140-141)


Connaissances

Capacits et attitudes

Le modle prvoit des vitesses de dplacements des Raliser des mesures sur le terrain pour comprendre le
plaques (daprs le palomagntisme et les alignements principe du GPS.
de volcans intraplaques. Avec lutilisation des techniques Saisir et exploiter des donnes sur des logiciels.
de positionnement par satellites (GPS), la fin du XXe sicle,
les mouvements des plaques deviennent directement
observables et leurs vitesses confirmes.

1. Les intentions pdagogiques


Cet ensemble dactivits est une suite directe des activits prcdentes afin de gnraliser lensemble du globe lapport des mesures obtenues par gopositionnement
permettant ainsi davoir une vision globale de la cinmatique des plaques et de redfinir le nombre et le contour des principales plaques tectoniques.
Les documents 1 et 2 montrent comment, grce aux donnes GPS, le modle initial
6plaques a t enrichi 11 puis 12plaques et comment les frontires de plaques ont
t prcisment dfinies. Il sagit donc de montrer que la multitude des donnes tablissant le dplacement des plaques a permis de crer des modles de cinmatique intgrant lensemble des mthodes de mesure aussi bien gologiques que godsiques. Il
est intressant de montrer que, loin dtre fixiste, la vision de la tectonique des plaques
volue par la confrontation des diffrents modles. Enfin, dans ce cadre, il peut tre
motivant de rflchir la validit dun modle un instant donn, preuve en est, les
nombreux articles et ouvrages traitant du nombre de plaques et microplaques lithosphriques la surface du globe. La confrontation du modle initial 6 plaques en 1967
et dun modle actuel 14plaques peut permettre de faire merger la problmatique.
Cette tude est loccasion de distinguer les mouvements relatifs des plaques visualiss au niveau des frontires de plaques et les mouvements rels des plaques calculs partir dun repre fixe.
Les documents 2 et 3 indiquent comment le modle NUVEL-1 (Northwestern University VELocity), tabli en 1990, propose une synthse des dplacements relatifs
des plaques. Construire le modle revient prciser le nombre et la gomtrie des
plaques dune part, estimer les valeurs de leur rotation dautre part. Plusieurs types
de reprsentations de ce modle sont proposs : le premier, prsent dans le document2, donne, pour chaque frontire de plaque, la direction et lamplitude du mouvement de part et dautre de cette frontire. Il sagit donc de mouvements relatifs dont
les vitesses moyennes sont estimes sur les trois derniers millions dannes partir
de donnes gologiques.
Le document 3 permet de comprendre que les mmes donnes NUVEL-1 peuvent
tre exprimes en considrant cette fois un repre suppos fixe (par exemple les
points chauds ou encore une plaque comme la plaque antarctique). On obtient alors
un modle illustrant des mouvements absolus moyens sur trois millions dannes.
Ce modle peut tre mis en relation avec un modle godsique mesurant des donnes absolues instantanes .
106

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 106

20/07/11 09:16

Le systme DORIS comprend un rseau permanent dune cinquantaine de balises


mettrices rparties de faon homogne la surface de la Terre, ainsi quun rcepteur embarqu sur satellite. Les signaux radiolectriques mis en permanence par les
balises au sol, sont reus par le satellite avec une frquence dcale par rapport la
frquence mise (effet Doppler). Ils fournissent ainsi une mesure de la vitesse relative du satellite par rapport la Terre. De lanalyse de ces mesures, on dduit entre
autres la trajectoire prcise du satellite ainsi que la position des balises, leurs dplacements la surface terrestre.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: On constate que six plaques nouvelles apparaissent par rapport au modle
initial 6plaques dfini par Le Pichon en 1968 : il sagit des plaques Philippines,
Cocos, Carabes, Nazca, Arabie et Amrique du Nord/Sud. Ce sont les donnes GPS
dune part et les donnes sismiques dautre part qui ont permis de dfinir ces nouvelles plaques aux frontires des plaques majeures, elles sont souvent caractrises
par des dplacements rapides (par exemple la plaque de Nazca).
Doc. 2: Diverses frontires sont reprables par la direction et le sens des vecteurs
dplacement : des frontires o il y a expansion ocanique (divergentes), subduction ou collision (convergence) et frontires transformantes (coulissage). Des vitesses
variables (indiques au niveau des vecteurs) caractrisent les zones concernes.
Doc. 3: La comparaison de ces deux modles montre une excellente corrlation (par
exemple au niveau de lle de La Runion mais aussi de Papeete) qui tend prouver
une certaine constance dans les vitesses et les directions des dplacements.

Synthse : rponse au problme rsoudre


Les donnes gologiques et les donnes godsiques (GPS) permettent de construire
des modles cinmatiques exprimant des mouvements relatifs ou absolus des plaques
sur une moyenne de trois millions dannes. Les donnes GPS et DORIS permettent de
calculer des dplacements absolus instantans . La corrlation entre ces diffrents
modles est trs bonne ce qui tend prouver une certaine stabilit temporelle dans la
localisation et lintensit des mcanismes lorigine des dplacements lithosphriques.

3. Ressources complmentaires
Site ressources Bordas :

Informations sur le systme DORIS http://www.aviso.oceanobs.com/fr/doris/index.html


Article de Xavier Le Pichon (1970) Plate kinematics and tectonic montrant
comment les premiers calculs de cinmatique ont t raliss par Le Pichon bien avant
le gopositionnement Actes Coll. ALLEGRE-MATTAUER, 1-73. Open Access version :
http://archimer.ifremer.fr/doc/00000/5027/

Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 107

107

20/07/11 09:16

Activits pratiques

La dynamique de la lithosphre prcise (pages 142-143)


Connaissances

Capacits et attitudes

En permanence, de la lithosphre ocanique est dtruite Recenser, extraire et organiser des informations de tomodans les zones de subduction et produite dans les dorsales. graphie sismique.
Dans les zones de subduction, les matriaux de la vieille
lithosphre ocanique sincorporent au manteau.

1. Les intentions pdagogiques


Il sagit de montrer comment, grce la tomographie sismique, lintrieur du globe
est devenu accessible et comment cette technique a permis de confirmer la dynamique
de la lithosphre. La comprhension du principe sur lequel fonctionne la tomographie
est intressant plusieurs titres : il permet de rinvestir les notions sur la nature et la
propagation des ondes sismiques (Partie 2 Chapitre 1), il permet de comprendre que
lobtention des anomalies de propagation repose sur lacceptation dun modle sismique du globe (le modle PREM) ce qui permet dapprhender de faon rigoureuse
les cartes tomographiques.
Cette double page dactivits permet de comprendre comment, grce ces techniques de tomographie sismique au dbut des annes 1990, le devenir de la lithosphre ocanique au niveau des zones de subduction a pu tre prcis. On peut faire
prendre conscience aux lves que la tomographie sismique est une technique actuelle
essentielle pour cartographier les mouvements mantelliques lorigine des dplacements tectoniques et que les diffrentes donnes recueillies sont lorigine de diffrents modles de circulation mantellique. Cest une nouvelle fois la preuve que les
donnes obtenues font voluer le modle.
Le document 1 permet daborder sommairement la technique de tomographie (du grec
tom, coupe) sismique. Tout comme la tomographie mdicale, elle permet dimager
lintrieur dune structure. La technique est fonde sur le trajet et la vitesse de propagation des ondes sismiques lintrieur du globe terrestre. Pour ltude des structures superficielles, les signaux sismiques sont gnrs partir dun trou de forage,
puis enregistrs par un ensemble de gophones (ou dhydrophones) dans un second
trou de forage. Pour ltude des structures profondes, les ondes sismiques gnres
lors des tremblements de terre sont utilises. Le principe de la tomographie est fond
sur le fait que la vitesse de propagation des ondes sismiques dans un matriau est relative ses proprits mcaniques et thermiques.
Les vitesses de propagation obtenues sont compares aux prvisions de vitesse donnes
par le modle PREM (Preliminary Reference Earth Model de Dziewonski et Anderson en 1981) qui est un modle sismologique de la Terre reprsentant lvolution de
la vitesse des ondes P et S en fonction de la profondeur. Par exemple, la prsence dun
corps plus froid acclre les ondes sismiques qui le traversent, un corps plus chaud
ralentit les ondes : on obtient donc des anomalies de propagation de vitesse par rapport
une vitesse thorique. En multipliant les stations denregistrement, on peut dterminer la gomtrie spatiale de ces anomalies de vitesse. Par des traitements mathmatiques de lensemble des donnes, une coupe et une reprsentation 3D de la rpartition
spatiale des vitesses de propagation des ondes sismiques peuvent tre obtenues.
108

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 108

20/07/11 09:16

Les diffrents supports prsents dans les documents 2 et 3 (cartes 2D, coupe en 2D
et bloc diagramme en 3D) entranent les lves travailler dans les trois dimensions
de lespace et passer dune reprsentation une autre.
Pour analyser le document 3, on pourra utiliser, en la simplifiant, linformation suivante : la zone de transition entre la fin de lasthnosphre et le dbut du manteau infrieur se manifeste par un changement dans la nature des minraux (lolivine est progressivement remplace par la phase spinelle, elle-mme remplace par un assemblage
provskite et magnsiowstite 670km) ce qui induit une modification de la densit
et de la viscosit la transition manteau suprieur et manteau infrieur. Il semblerait donc logique que les plaques subductes ne franchissent pas cette barrire, ce qui
est le cas pour la coupe au niveau de la mer ge mais pas pour lAmrique centrale.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: La tomographie sismique est base sur ltude des vitesses de propagation des ondes sismiques lintrieur du globe, et plus prcisment sur lexistence de
vitesses plus leves (ou plus faibles) que la moyenne attendue si les matriaux traverss taient thermiquement homognes. Le document2 montre que deux zones mantelliques peuvent avoir des comportements diffrents. Les cartes des vitesses montrent
une trs bonne corrlation entre la position des rgions lentes et chaudes en profondeur
(rouge fonc) et la prsence des dorsales ocaniques en surface, qui sont les zones o
les plaques lithosphriques sont fabriques en continu partir du manteau, par accrtion de lithosphre. Ainsi, 100km de profondeur sous la dorsale pacifique existe
une forte anomalie ngative de vitesse des ondes S traduisant lexistence dune zone
plus chaude. Au contraire, laplomb de la pninsule indienne existe une zone mantellique prsentant une forte anomalie positive de vitesse traduisant un matriau plus
froid que lenvironnant, une faible anomalie positive peut tre aussi repre au niveau
du Prou et du Chili, zone de subduction. Il est important dinsister sur le fait que la
carte obtenue correspond aux anomalies 100km de profondeur et donc quune autre
carte, ralise une profondeur plus grande montrerait une autre image du manteau.
Doc. 3: On peut visualiser le devenir de la lithosphre ocanique par les zones bleues
indiquant une forte anomalie positive des vitesses. Au niveau de la mer ge, la zone
froide pntre jusqu environ 670km de profondeur puis elle sincorpore au manteau. En revanche, la coupe au niveau de lAmrique centrale montre un plongement
beaucoup plus important de la lithosphre ocanique jusqu 2 900km, cest--dire
jusqu la limite manteau infrieur et noyau.
La reconstitution en 3D de lintrieur du manteau suprieur et infrieur indique une
rpartition complexe des zones froides et chaudes, plus ou moins en continuit, et suggre des mouvements verticaux mais aussi horizontaux de matire dans le manteau.

Synthse : rponse au problme rsoudre


Les donnes tomographiques sont des donnes essentielles pour argumenter dune
dynamique de la lithosphre. Cette dernire est cre au niveau des dorsales partir
de matriau chaud induisant, jusqu 200km de profondeur, une trs forte anomalie
ngative de la vitesse des ondes sismiques. La lithosphre disparat dans le manteau
au niveau des zones de subduction, caractrises en profondeur par une acclration
de la vitesse des ondes.
Actuellement, la tomographie sismique est un outil indispensable pour identifier les
mouvements de matire dans le manteau lorigine de la dynamique et du renouvellement de la lithosphre ocanique.
Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 109

109

20/07/11 09:16

3. Ressources complmentaires
Manuel numrique Bordas : animation prsentant le principe de la tomographie sismique.
Site ressources Bordas: site les dossiers du CNRS concernant diffrentes mthodes

pour caractriser la disparition de la lithosphre au niveau des zones de subduction dont la


tomographie.

110

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 110

20/07/11 09:16

Activits pratiques

Lorigine de la lithosphre ocanique lucide (pages 144-145)


Connaissances

Capacits et attitudes

La divergence des plaques de part et dautre de la dorsale tablir le lien entre amincissement de la lithosphre, remonpermet la mise en place dune lithosphre nouvelle partir te, dpressurisation et fusion partielle de lasthnosphre
de matriaux dorigine mantellique.
sous-jacente et formation dune nouvelle lithosphre.

1. Les intentions pdagogiques


Il sagit de fournir les donnes essentielles sur le fonctionnement dune dorsale type
en relation avec la cration de la lithosphre ocanique. La dmarche vise consiste
mettre en relation diffrents paramtres gophysiques et gochimiques (le changement dtat solide-liquide, les compositions chimiques des roches, lvolution de la
pression et de la temprature en profondeur) avec le mouvement divergent des plaques
au niveau des dorsales.
Une dmarche dinvestigation peut tre mise en uvre avec lensemble des documents
proposs : elle permet de comprendre dans quelles conditions se forme la lithosphre
ocanique au niveau des dorsales. Pour cela, des donnes vues auparavant peuvent tre
mobilises : flux gothermique, expansion ocanique et divergence de part et dautre
de la dorsale, roches constitutives de la crote ocanique et du manteau. De nouveaux faits dobservation (faille Vema) ou exprimentaux (diagramme de fusion partielle sous presse enclume de diamant) permettent denvisager un scnario de formation des roches de la crote ocanique. Ce scnario peut tre prouv grce un
logiciel de simulation permettant de raliser une fusion partielle de la pridotite, den
dduire les conditions de pression et temprature ncessaires et de faire le lien avec
le gotherme de dorsale.
On retrouve dans le document 1 des donnes sur la faille Vema. Explore en 1988
grce aux progrs raliss sur lautonomie des submersibles, la zone de fracture Vema,
avec une longueur de prs de 320km et une profondeur des plus importantes constitue lune des failles les plus tudies au monde. Du point de vue morphologique, la
topographie de la zone transformante est marque par une dpression de 5 000mtres
de profondeur. Lorigine de cette faille est rechercher dans les diffrences de vitesse
linaire dcartement en relation avec la distance du ple eulrien (chapitre2).
On envisage dans le document 2 des arguments en faveur de lorigine mantellique
des roches de la crote ocanique. Laccent peut tre mis sur la mise au point, dans
les annes 1965-1970, dun instrument fondamental pour ltude exprimentale de
la fusion des matriaux : la presse enclume de diamant. Actuellement, le domaine
de pression et temprature accessible par cette technique couvre pratiquement tout le
domaine de pression et de temprature que lon rencontre lintrieur de la Terre et
des plantes telluriques : pression jusqu 500GPa (5millions datmosphres) et temprature jusqu 5 000K.
Dans le document 3, on montre quen appliquant au logiciel de simulation des conditions bien particulires de pression et de temprature, on obtient la fusion dbutante
de la pridotite.
Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 111

111

20/07/11 09:16

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les diffrentes roches constitutives de la lithosphre ocanique sont le basalte,
le gabbro et la pridotite.
Doc. 2: La comparaison de la pridotite, du basalte et gabbro donne une bonne corrlation pour la teneur en silicium et en oxygne. En revanche, on peut observer une
teneur beaucoup plus leve dans les basaltes et gabbros des lments chimiques suivants : calcium, sodium, potassium (dans une moindre mesure fer) et beaucoup plus
faible pour laluminium et le magnsium. En admettant que la pridotite est la roche
source, on peut constater, par comparaison, que sa fusion partielle 15 % produit un
liquide ayant chimiquement la composition des basaltes. La diffrence de composition chimique entre le liquide de fusion et la pridotite source sexplique par le fait
que tous les minraux dune roche ne fondent pas la mme temprature et les lments chimiques vont avoir des comportements diffrents lors de la fusion. Certains
lments sont dits hygromagmatophiles cest--dire quils passent prfrentiellement dans le liquide. Cest le cas des alcalins K, Na, Ca.
Doc. 3: Lensemble des couples de points pression-temprature (P en kbar, T en C)
forme une courbe appele solidus regroupant les conditions minimales ncessaires au
dbut de fusion. Quelques points peuvent tre identifis : (0,3 ; 1 100) ; (2 ; 1 120) ;
(4 ; 1 150) ; (6,5 ; 1 200). On peut ensuite rechercher si ces conditions sont runies au
niveau ocanique. La comparaison du gotherme ocanique moyen et celui dune dorsale montre une diffrence majeure. Pour des profondeurs situes entre 10 et 25km,
la temprature existante est beaucoup plus leve sous une dorsale. En suivant lvolution des conditions laplomb dune dorsale, de la profondeur vers la surface, on
observe quil y a une baisse trs importante de la pression sans quil y ait de diminution nette de temprature. Ces conditions particulires permettent de crer des conditions favorables au dbut de fusion partielle des pridotites.

Synthse : rponse au problme rsoudre


La rponse au problme pos ncessite de faire une synthse des diffrentes informations apprises. Ainsi, la divergence des plaques de part et dautre de la dorsale (Activits pratiques3) entrane un amincissement de la lithosphre et une remonte locale
des pridotites asthnosphriques qui subissent donc une baisse de pression sans quasidiminution de temprature (rfrences aux images de flux gothermique et de tomographie sismique laplomb des dorsales). Ces conditions sont lorigine de la fusion
partielle de la pridotite et de la production dun liquide magmatique de composition
chimique diffrente de la roche source. Moins dense, ce liquide slve et saccumule
dans une chambre magmatique. La cristallisation lente en profondeur produit des gabbros alors que linjection de magma vers la surface produit des basaltes. Enfin, la pridotite rsiduelle constitue la base de cette lithosphre nouvellement forme.

3. Ressources complmentaires
Site ressources Bordas:

Article de D. H. Green and A. E. Ringwood (1967): The genesis of basaltic magmas.


Contributions to Mineralogy and Petrology 1967b; Volume 15, Number 2, p103-190 http://
petrology.oxfordjournals.org/content/49/4/587.full#ref-22
Logiciel :

Pression, Temprature et formation des roches (d. JEULIN).

112

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 112

20/07/11 09:16

Exercices

p. 152 155

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, p.351.

6 Fusion partielle de la pridotite


1. Le gotherme est reprsent par une courbe qui traduit laugmentation de la temprature des roches en fonction de la profondeur (et donc de la pression). laplomb
dune dorsale la temprature moyenne en profondeur est suprieure celle existant
laplomb dune plaine abyssale ou encore dune zone de subduction. Ceci est particulirement marqu dans les 100 premiers kilomtres.
2. La fusion partielle de la pridotite ncessite que le gotherme recoupe les conditions de temprature et de pression reprsentes par la droite solidus . Seul le gotherme de dorsale permet cette fusion dbutante entre 20 et 120km de profondeur car
il recoupe le solidus de la pridotite.
3. Ce document ne permet pas dexpliquer la formation de magma dans les zones de
subduction car le gotherme de subduction ne recoupe aucune profondeur le solidus
de la pridotite. Ceci pose le problme de lorigine du magmatisme de subduction.

7 Les sdiments ocaniques et lexpansion de lAtlantique Nord


1. Ces deux forages de lAtlantique Ouest, raliss par carottage et distants de 710km
lun de lautre, montrent une succession de sdiments dont lpaisseur et lge sont
diffrents. Ainsi, le forage le plus proche de la dorsale (forage B) est constitu de
399mtres de sdiments avant datteindre le basalte alors que le forageA correspond
une carotte de 720mtres. Les sdiments les plus gs du forageA sont reprsents par le Crtac infrieur g de 105Ma alors que les sdiments les plus vieux du
forageB correspondent au Miocne terminal g de 7Ma. Les deux forages montrent sensiblement une sdimentation identique en ce qui concerne le quaternaire et
le pliocne.
2. Ces sdiments confirment le modle de lexpansion ocanique. Dans ce modle,
le plancher ocanique form au niveau de la dorsale sloigne de part et dautre de
celle-ci en subissant une subsidence. Les sdiments surmontant le basalte correspondent aux sdiments stant dposs juste aprs le refroidissement du basalte nouvellement form. Ainsi, plus on sloigne de la dorsale plus le toit du basalte est ancien
ce qui confirme le modle. Lenfoncement de la lithosphre ocanique est confirme
par la profondeur de locan (4 482m au niveau du forageA pour seulement 3 883m
pour le forageB) ainsi que par lpaisseur des sdiments (720m pour A contre 399m
pour B).
3. La vitesse douverture estime partir du forageB est de 5cman1 selon la formule v = d/t, avec d = 350 105cm et t = 7 106an.
La vitesse douverture estime partir du forageA est de 1,01cman1 selon la formule v = d/t, avec d = 1 060 105 cm et t = 105 106 an.
La vitesse douverture est donc variable, la vitesse moyenne estime partir de nombreux relevs est de 2,5cman1.

8 Les roches lunaires


1. partir des planches de dtermination, les minraux suivants sont identifiables :
du pyroxne (minraux bruns et bleu violac), des feldspaths (minraux blancs et gristres), de lolivine (minraux multicolores).
Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 113

113

20/07/11 09:16

2. Labsence de microlithes et de verre ainsi que la taille rduite des cristaux permet
de proposer une texture microgrenue ayant subit un refroidissement rapide mais non
brutal donc relativement proche de la surface.
3. La roche terrestre qui correspond le mieux la composition minralogique de cette
roche lunaire est le gabbro. Il sagit donc dun microgabbro lunaire form non par
tectonique des plaques (absente sur la Lune) mais suite une fusion lie aux impacts
mtoritiques.

9 Le sisme dHati tait-il prvisible ?


1. La construction des vecteurs permet de qualifier et de quantifier les mouvements
absolus de trois balises GPS au sol : SCUB appartenant la plaque nord-amricaine,
JAMA et CRO1 appartenant la plaque carabe. Les vecteurs peuvent tre tracs par
construction vectorielle simple sur la zone rouge agrandie dcalque en utilisant les
donnes GPS du tableau du document1.
2. La balise SCUB montre un dplacement en direction du nord-ouest (vitesse de
7 cman 1), les balises JAMA et CRO1 indiquent un dplacement en direction du
nord-est (respectivement de vitesse 9,3cman1 et 16,8cman1).
La plaque nord-amricaine se dplace donc vers le nord-ouest alors que plaque carabe
se dplace vers le nord-est.
3. Les frontires de plaques figures au niveau des les de Cuba et Hati sont des failles
transformantes. La ville de Port-au-Prince se situe entre deux ensembles de ces failles
appartenant une microplaque (plaque Gonave). Une zone de subduction existe et
scinde lle dHati en deux selon une direction nord-ouest sud-est.
Les contraintes saccumulent au niveau de ces failles comme le montre la localisation
des sismes majeurs de magnitude >7 ayant eu lieu entre 1562 et 1946. (Attention :
une erreur sest glisse dans la lgende de la carte : cest magnitude >7 et non <7).
La zone qui a trembl appartient lextrmit dune de ces failles transformantes rsultant du mouvement oppos des plaques nord-amricaine et carabe.

10 Dorsale et point chaud


Cette activit visant reconstituer et comprendre les mouvements des plaques indienne
et africaine associe au point chaud de lle de la Runion ncessite une bonne connaissance de la notion de point chaud.
1. Les mouvements absolus de trois balises SEY1, REUN et DGAR permettent de
caractriser la direction et la vitesse de dplacement des plaques indienne et africaine. La plaque africaine se dplace en direction du nord-est avec une vitesse de
2,33cman1 au niveau de la balise REUN et de 2,98 au niveau de la balise SEY1.
La plaque indienne se dplace sensiblement dans la mme direction de 5,9cman1.
2. La carte permet, laide des points chauds, de calculer la vitesse de dplacement
moyenne de la plaque africaine depuis 40Ma entre les pointsA etB. La vitesse obtenue est de 3,125cman1 (1250 105 / 40 106) ce qui globalement est plus rapide
quactuellement.
3. Le logiciel permet de faire apparatre le mouvement relatif de la plaque indienne
par rapport la plaque africaine en rendant la balise REUN fixe. Le vecteur rsultant
correspond une direction nord-est mais une vitesse de 2,15cman1.
114

Partie 2. La tectonique des plaques : histoire dun modle

04732841_074-115.indd 114

20/07/11 09:16

4. La dorsale de Carlsberg de direction NO-SE provoque un dplacement de la plaque


africaine vers le SO et un dplacement de la plaque indienne vers le NE. Ce dplacement li louverture au niveau de la dorsale de Carlsberg se surajoute au dplacement global des deux plaques africaine et indienne dans la mme direction NE. Leurs
vitesses de dplacement actuelles diffrentes sexpliquent par la dorsale de Carlsberg.
En effet, avant son apparition, les diffrents volcans de points chauds appartenaient
la mme plaque, la dorsale a alors pris naissance au niveau des points B-C (autrefois
confondus mais aujourdhui distants de 1 100km) reprsentant un difice volcanique
de mme ge. Son fonctionnement cre ainsi une vitesse diffrentielle entre les deux
plaques actuelles.

Chapitre 3. La tectonique des plaques : un modle qui senrichit

04732841_074-115.indd 115

115

20/07/11 09:16

116

04732841_116-155.indd 116

20/07/11 09:17

121
124
133
144

117

04732841_116-155.indd 117

20/07/11 09:17

Partie

Enjeux plantaires
contemporains

Les objectifs gnraux de cette partie


Conformment au programme, le manuel regroupe dans cette partie des chapitres portant sur des sujets trs diffrents mais qui sinscrivent dans la thmatique Enjeux plantaires contemporains . Rappelons quil sagit l de lun des trois thmes qui structurent
dsormais les programmes de chacune des trois annes du lyce. En classe de Seconde,
les lves ont abord, dans ce mme cadre, des sujets lis aux ressources nergtiques
et au dfi alimentaire. Malgr lapparente diversit des sujets abords, il y a donc un fil
directeur commun aux chapitres de cette partie : il sagit de montrer comment les Sciences
de la vie et de la Terre participent lapprhension des grands problmes contemporains
auxquels lhumanit daujourdhui se trouve confronte.
Les instructions prconisent daccorder 17 % (soit 1/6) du temps annuel lensemble de
cette partie.
On remarquera bien entendu que le premier sujet Tectonique des plaques et gologie
applique est trs li aux questions de gologie envisages dans la partie 2. On peut
donc aussi considrer ce premier sujet comme de la gologie applique, prolongation de
la gologie fondamentale prcdemment tudie.
Pour ce premier sujet, il est donc indispensable que la partie de gologie fondamentale ait t traite.
Deux approches sont proposes ; comme stipul dans le programme, il appartient au professeur de choisir lune de ces deux approches :
Ltude dune ressource gologique locale : dans ce cas, il est particulirement indiqu de fonder une partie de cet enseignement sur une sortie gologique. Le manuel propose un exemple
prcis qui peut trs bien tre transpos dautres situations : aprs ltude dun matriau courant, on recherche les indices traduisant son origine puis on replace sa gense dans le contexte
de la godynamique rgionale, elle-mme tributaire de la tectonique globale.
La seconde approche propose dexpliquer les conditions ncessaires la formation
dun gisement ptrolier. On sappuie sur le modle de la tectonique des plaques et sur les
connaissances de la classe de Seconde (fossilisation de la matire organique) pour expliquer pourquoi les gisements dhydrocarbures sont rares et localiss. partir dune tude
de la rpartition mondiale des gisements, le manuel propose une srie de documents qui
rpondent cette problmatique dans le cas du plus grand gisement ptrolier du monde,
situ dans la pninsule arabique.
Le second sujet Nourrir lhumanit prolonge ltude initie sur la mme thmatique
en classe de Seconde. On se situe dabord lchelle des cosystmes puis on envisage
les consquences, lchelle plantaire, des choix effectus en matire de pratiques agricoles et dhabitudes alimentaires.
Cette partie du programme permet de dvelopper les comptences suivantes :
Connaissances : elles portent sur les proprits des roches, ltude des indices palontologiques quelles peuvent renfermer, les modalits de la formation dun gisement (tude dun
bassin sdimentaire). Dans le cas des hydrocarbures, cest aussi loccasion dtudier la tectonique des marges passives, le phnomne de subsidence, les proprits des roches rservoir .
118

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 118

20/07/11 09:17

Le thme Nourrir lhumanit ncessite de dterminer les composantes dun cosystme


(cultiv ou non), de prciser sa structure, son fonctionnement. Les notions de pyramides
cologiques, de production et de productivit, de bioaccumulation ou encore dempreinte
cologique seront tablies.
Des comptences : elles sont ici trs varies. Il peut sagir des diverses comptences
que lon met en uvre au cours dune sortie gologique, des classiques techniques dobservation et danalyse dchantillons gologiques, de la recherche dinformations dans des
documents scientifiques comme des cartes, des profils sismiques, etc. Le thme Nourrir
lhumanit permet lui aussi une tude de terrain mais se prte galement des exprimentations de laboratoire, ou des activits de modlisation.
Des attitudes : cest une composante importante de ce thme, qui vise sensibiliser
les lves lapport des sciences dans des enjeux contemporains qui impliquent des choix
de socit. On montrera aux lves comment faire preuve desprit critique en pratiquant
une analyse objective et argumente, sans a priori. Ce thme doit aussi prparer chacun
lexercice de sa responsabilit individuelle et citoyenne en tant capable dvaluer les
consquences des ses propres pratiques, tant en matire dnergie que dhabitudes alimentaires. Il peut, en outre, ouvrir des perspectives sur lintrt de certains mtiers mconnus (voir les pages Des cls pour ).
Ce thme est dcoup en quatre chapitres : les deux premiers concernent la gologie, mais
un choix sera fait par le professeur entre les deux approches proposes. Les deux autres
chapitres sont relatifs au thme Nourrir lhumanit .

Une correspondance entre le programme officiel


et les chapitres du manuel
Connaissances

Les chapitres du manuel

THME 2A TECTONIQUE DES PLAQUES ET GOLOGIE APPLIQUE

Tectonique des plaques et ressource locale

chapitre

Un exemple de ressource gologique est choisi dans un contexte


proche de ltablissement scolaire. Son tude (nature, gisement)
permet de comprendre que ses conditions dexistence peuvent
tre dcrites en utilisant le cadre gnral de la tectonique des
plaques.

Tectonique globale et ressources


gologiques locales (pages 160-169)

Tectonique des plaques et recherche dhydrocarbures

chapitre

Le modle de la tectonique des plaques constitue un cadre


intellectuel utile pour rechercher des gisements ptroliers.

Tectonique des plaques et recherche


dhydrocarbures (pages 170-187)

partir de ltude dun exemple, on montre que la tectonique


globale peut rendre compte :
dun positionnement gographique du bassin favorable au
dpt dune matire organique abondante et sa conservation ;
dune tectonique en cours de dpt (subsidence) et aprs
le dpt qui permettent lenfouissement et la transformation
de la matire organique puis la mise en place du gisement.

Les activits pratiques


Act. 1 Un exemple de ressource gologique : le calcaire
Act. 2 Lorigine de la pierre du pont du Gard
Act. 3 La tectonique lorigine des calcaires coquilliers

Les activits pratiques


Act. 1
Act. 2
Act. 3
Act. 4

Des gisements ptroliers ingalement rpartis


Une conservation difficile des dpts organiques
Un exemple de gisement ptrolier remarquable
Mise en place des gisements et tectonique globale

La rare concidence de toutes ces conditions ncessaires explique


la raret des gisements dans lespace et le temps.
Les objectifs gnraux

04732841_116-155.indd 119

119

20/07/11 09:17

Connaissances

Les chapitres du manuel

THME 2B NOURRIR LHUMANIT


La production vgtale : utilisation de la productivit primaire chapitre

Un cosystme naturel est constitu dun biotope et dune


Pratiques agricoles et gestion
biocnose. Son fonctionnement densemble est permis par la
productivit primaire qui, dans les cosystmes continentaux, de lenvironnement (pages 188-207)
repose sur la photosynthse des plantes vertes.
Les activits pratiques
Lagriculture repose sur la constitution dagrosystmes grs dans Act. 1 Le fonctionnement dun cosystme naturel
le but de fournir des produits (dont les aliments) ncessaires Act. 2 Les agrosystmes : des cosystmes cultivs
lhumanit. Un agrosystme implique des flux de matire Act. 3 Pratiques culturales et environnement
(dont leau) et dnergie qui conditionnent sa productivit Act. 4 Pratiques agricoles et dveloppement durable
et son impact environnemental. Lexportation de biomasse,
la fertilit des sols, la recherche de rendements posent le
problme de lapport dintrants dans les cultures (engrais,
produits phytosanitaires, etc.).
Le cot nergtique et les consquences environnementales
posent le problme des pratiques utilises. Le choix des
techniques culturales vise concilier la ncessaire production
et la gestion durable de lenvironnement.

La production animale : une rentabilit nergtique rduite

chapitre

Dans un cosystme naturel, la circulation de matire et


dnergie peut tre dcrite par la notion de pyramide de
productivit.

Pratiques alimentaires
et perspectives globales (pages 208-225)

Dans un agrosystme, le rendement global de la production par


rapport aux consommations (nergie, matire) dpend de la
place du produit consomm dans la pyramide de productivit.

Les activits pratiques

Ainsi, consommer de la viande ou un produit vgtal na pas


le mme impact cologique.

Act. 1
Act. 2
Act. 3
Act. 4

Le dfi alimentaire mondial


Les levages : des agrosystmes peu efficaces
Pratiques alimentaires et environnement global
Quelles agricultures pour demain ?

Pratiques alimentaires collectives et perspectives globales


lchelle globale, lagriculture cherche relever le dfi de
lalimentation dune population humaine toujours croissante.
Cependant, les limites de la plante cultivable sont bientt
atteintes : les ressources (eau, sol, nergie) sont limites tandis
quil est ncessaire de prendre en compte lenvironnement pour
en assurer la durabilit.

120

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 120

20/07/11 09:17

Partie

chapitre

Tectonique globale et ressources


gologiques locales
Activits pratiques

Un exemple de ressource gologique : le calcaire (pages 162-163)


Connaissances

Capacits et attitudes

Un exemple de ressource gologique est choisi dans un Recenser, extraire et organiser des informations.
contexte proche de ltablissement scolaire.

1. Les intentions pdagogiques


Il est possible par exemple, au cours dune sortie pdagogique, dtudier une ressource
gologique locale exploite par lHomme.
Le document 1 illustre diverses utilisations par lHomme des roches calcaires, roches
trs rpandues dans le sous-sol franais. Le calcaire est une roche connue des lves
depuis le collge : en classe de Cinquime, laction de leau sur cette roche a t tudie avec les diverses consquences sur le model des paysages.
Les documents 2 et 3 focalisent ltude de lutilisation dune roche calcaire sur un
exemple prcis : le pont du Gard. Il sagit dun exemple spectaculaire dexploitation
dune ressource gologique locale, la roche utilise provenant dune carrire situe
quelques centaines de mtres du site.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: Le calcaire est une roche pouvant tre utilise comme matriau de construction. Il est aussi utilis dans la fabrication du ciment. On trouve aussi, de faon trs
localise, du calcaire bitumineux.
Doc. :. Le site du pont du Gard est propice une sortie pdagogique avec la visite du
site particulirement bien amnag et de la carrire de lEstel proximit, do ont
t extraites les roches du pont.

Synthse : rponse au problme rsoudre


LHomme utilise les roches calcaires soit directement dans la construction de btiment ou de monuments soit en les intgrant dans la fabrication de produits industriels
comme le ciment, ou encore en exploitant le bitume quil contient parfois.

3. Ressources complmentaires
Site officiel du pont du Gard (avec une rubrique service ducatif ):

http://www.pontdugard.fr/
Chapitre 1. Tectonique globale et ressources gologiques locales

04732841_116-155.indd 121

121

20/07/11 09:17

Activits pratiques

Lorigine de la pierre du pont du Gard (pages 164-165)


Connaissances

Capacits et attitudes

Ltude de la ressource gologique (nature, gisement) Recenser, extraire et organiser des informations afin de
permet de comprendre ses conditions dexistence.
comprendre lorigine de la pierre du pont du Gard.

1. Les intentions pdagogiques


Dans un deuxime temps, une tude dtaille de la ressource gologique est ncessaire afin de comprendre lorigine de sa prsence.
Le document 1 expose une tude dtaille de la pierre du pont du Gard ralisable par
les lves, sur le terrain ou en classe.
Le document 2, obtenu en partie laide du site InfoTerre, permet de situer la rpartition des calcaires coquilliers dans le sud-est de la France. Cette rpartition est mettre
en relation avec la prsence des grandes failles de la rgion.
Le document 3 dcrit le contenu fossilifre des calcaires coquilliers et fait appel au
principe dactualisme afin de reconstituer les conditions de formation de ces calcaires.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: La pierre du pont du Gard est une roche calcaire constitue de divers fragments
fossiles, en particulier des fragments de coquilles, do le nom de calcaire coquillier.
Doc. 2:. Les calcaires coquilliers dans le sud-est de la France sont dats de 20 millions dannes. Ces calcaires, prsents dans diffrents sites, sont localiss proximit
de la faille de Nmes et ne dpasse pas la faille des Cvennes.
Doc. 3 : En appliquant le principe dactualisme, on peut penser que les calcaires
coquilliers tudis se sont forms en milieu marin, faible profondeur (entre 0 et
100m de profondeur).
Une mer peu profonde tait donc prsente dans le sud-est de la France il y a 20 Ma.

Synthse : rponse au problme rsoudre


La pierre du pont du Gard est un calcaire coquillier form dans une mer peu profonde,
il y a environ 20 Ma, partir de fragments issus de divers animaux marins : coquilles
dhutres, de chlamys, plaques de balanes, tests et piquants doursins.

3. Ressources complmentaires
Site officiel du pont du Gard (avec une rubrique service ducatif ):

http://www.pontdugard.fr/
Lithothque nationale avec entre sur lensemble des lithothques acadmiques :

http://www.educnet.education.fr/svt/ressources-numeriques/banques-de-donnees/litho

122

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 122

20/07/11 09:17

Activits pratiques

La tectonique lorigine des calcaires coquilliers (pages 166-167)


Connaissances

Capacits et attitudes

Ltude de la ressource gologique (nature, gisement) Recenser, extraire et organiser des informations afin dtapermet de comprendre que ses conditions dexistence blir une relation entre la ressource gologique locale et la
peuvent tre dcrites en utilisant le cadre gnral de la tectonique des plaques.
tectonique des plaques..

1. Les intentions pdagogiques


Les documents 1 et 2 ont pour but de dcrire les vnements tectoniques qui ont
affect la rgion du sud-est de la France lOligocne et au Miocne. La connaissance de ces vnements permet aux lves de comprendre comment cette rgion a
pu tre envahie par une mer peu profonde au cours de la transgression du Miocne.
Le document 3 illustre la transgression du Miocne avec les limites ctires en Europe
et dans le sud-est de la France. Ce document a aussi pour objectif dexpliquer comment
ces calcaires dposs dans une mer peu profonde se retrouvent actuellement en surface.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2 : Au cours de lOligocne, le sud-est de la France est affect par une tectonique en extension qui a pour consquence ltirement du littoral, un amincissement de la crote continentale vers le sud-est et un rchauffement global de celle-ci.
Puis, au dbut du Miocne, la zone dextension sest dcale vers le sud-est. La crote
continentale du littoral languedocien nest plus tire et se refroidit (avec pour consquence une subsidence thermique). Lextension associe la subsidence thermique
entrane un enfoncement modr du littoral du sud-est de la France et favorise lenvahissement de la rgion par la mer (transgression).
Doc. 3 : Il sagit de mettre en relation ce document avec le document 2 de la p.164.
On constate alors que les limites de la mer Miocne dpassent de peu la faille de
Nmes. On explique alors la formation des calcaires coquilliers dans le sud-est de la
France. Lmersion de ces calcaires sexplique par une rgression la fin du Miocne
mais aussi par des phnomnes gologiques de grande ampleur qui sont encore discuts au sein de la communaut scientifique.

Synthse : rponse au problme rsoudre


Une phase dextension associe une subsidence thermique explique lenfoncement
modr du littoral sud-est de la France, favorise lenvahissement par la mer de la rgion
au cours du Miocne. Dans cette mer peu profonde (200m) se dposent alors les calcaires coquilliers. Une phase de rgression et des vnements tectoniques permettent
ensuite ces calcaires dmerger et dtre accessibles en surface.

3. Ressources complmentaires
Site InfoTerre, des donnes goscientifiques du BRGM :

http://infoterre.brgm.fr

Chapitre 1. Tectonique globale et ressources gologiques locales

04732841_116-155.indd 123

123

20/07/11 09:17

Partie

chapitre

Tectonique des plaques


et recherche dhydrocarbures
Activits pratiques

Des gisements ptroliers ingalement rpartis (pages 172-173)


Connaissances

Capacits et attitudes

Les gisements dhydrocarbures sont rares et prcisment Recenser, extraire et organiser des informations permettant
localiss.
de reconstituer le contexte gographique et gologique
lpoque du dpt lorigine de lhydrocarbure de lexemple
tudi.

1. Les intentions pdagogiques


Les documents proposs ici permettent de mettre en vidence la trs ingale rpartition des ressources en combustibles fossiles. Il sagit de montrer que les gisements
dhydrocarbures sont rares, prcisment localiss sur la plante et que les priodes
de formation des roches mres sont inquitablement rparties au cours de des temps
gologiques. Ce constat permet de poser le problme des conditions gologiques prvalant la formation de ces ressources tant convoites.
Le document 1 prsente tout dabord la difficult destimer les rserves mondiales de
ptrole. En effet, cette estimation dpend de facteurs techniques (les progrs technologiques permettent dimaginer exploiter des gisements inaccessibles pour le moment),
des facteurs conomiques (des gisements trop coteux exploiter peuvent devenir
rentables avec laugmentation du prix du baril), des facteurs politiques (certains pays
sous-estiment ou surestiment leurs ressources des fins stratgiques). On distingue
ainsi des rserves prouves, probables et possibles.
Grce aux cartes et graphique du document 1, les lves sont amens concevoir la
trs ingale rpartition gographique des gisements ptroliers et constater la prdominance du Moyen-Orient et de ses champs ptroliers gants. Le bassin dAlGhawar
et le gisement de gaz du North Dome, respectivement plus important bassin ptrolier et plus grand gisement de gaz naturel mondial sont prsents. Leur gologie fera
lobjet des activits pratiques 4.
Le document 2 permet de constater lingale rpartition temporelle des priodes de
formation des roches mres ptrolires. En confrontant ces priodes aux variations
eustatiques, il permet en outre de mettre en vidence le lien existant entre les transgressions marines et la formation des roches mres des hydrocarbures.
Le document 3 amne lide que les transgressions marines (et donc les priodes de
formation des roches mres ptrolires) sont lies lactivit des dorsales ocaniques.
124

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 124

20/07/11 09:17

Une premire corrlation peut ainsi tre tablie entre la tectonique globale et la formation des ptroles.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les principales rgions ptrolires sont le golfe Persique, le golfe du Mexique,
le Texas, le Canada, la mer du Nord, la Russie, mais aussi le Venezuela, le Niger, une
partie de lIndonsie et de lAustralie. Dans la pninsule arabique, il y a des gisements de ptrole gants. Ils sont situs autour du golfe Persique, principalement en
Arabie Saoudite, en Irak, au Kowet et en Iran. Ce sont les principales rserves ptrolires mondiales. Le Moyen Orient renferme sans doute lui seul prs des deux tiers
des rserves mondiales.
Doc. 2: Cest au Palozoque (Silurien et Dvonien) que se sont formes les roches
mres du ptrole de lAmrique du Nord mais cest au Msozoque (plus particulirement au Jurassique et au Crtac) que se sont dposs les sdiments organiques
lorigine du ptrole du Moyen-Orient et de la mer du Nord. Les rserves vnzuliennes se sont elles formes plus tardivement (Cnozoque).
Doc. 3: Toutes les priodes de formation des roches mres ptrolifres sont des priodes
de transgression marine : le niveau moyen des mers augmente, les rivages se dplacent vers lintrieur des continents. lchelle des temps gologiques, les variations
du niveau marin lchelle mondiale (variations eustatiques) sont dues aux variations
dactivit des dorsales ocaniques. Ce sont des priodes de forte activit des dorsales
(forte production magmatique, forte intumescence thermique) qui sont responsables
des transgressions marines (leau est chasse du bassin ocanique vers le domaine
continental par laugmentation de volume des dorsales).
La formation des roches mres ptrolifres semble donc facilite par une forte activit des dorsales ocaniques.

Synthse : rponse au problme rsoudre


Les gisements ptroliers sont trs ingalement rpartis dans lespace, la pninsule arabique, tant particulirement riche en ressources exploitables.
Les priodes de formation des roches mres ptrolifres sont galement trs ingalement rparties au cours des temps gologiques. Les priodes de forte expansion ocanique savrent trs propices la formation du ptrole.

3. Ressources complmentaires
Les roches carbones fossiles, obscur objet du dsir (une confrence trs intressante

et de nombreux documents utilisables) :


http://planet-terre.ens-lyon.fr/planetterre/XML/db/planetterre/metadata/LOM-carbonefossile-G-Dromart.xml

Chapitre 2. Tectonique des plaques et recherche dhydrocarbures

04732841_116-155.indd 125

125

20/07/11 09:17

Activits pratiques

Une conservation difficile des dpts organiques (pages 174-175)


Connaissances

Capacits et attitudes

partir de ltude dun exemple, on montre que la tectonique globale peut rendre compte :
dun positionnement gographique du bassin favorable
au dpt dune matire organique abondante et sa
conservation ;
dune tectonique en cours de dpt (subsidence) et aprs
le dpt qui permettent lenfouissement et la transformation de la matire organique.

Recenser, extraire et organiser des informations permettant de reconstituer le contexte gographique et gologique lpoque du dpt lorigine de lhydrocarbure
de lexemple tudi.
Dcouvrir la morphologie et la structure des marges
passives partir des profils de sismique rflexion et/ou
des cartes et/ou des coupes

1. Les intentions pdagogiques


Les transgressions marines favorisent le dveloppement de vastes marges continentales
o se dpose une matire organique propice la formation de roches mres ptrolifres. Nanmoins, pour que des sdiments organiques conduisent la formation de
roches mres, il convient que la matire organique soit prserve et pour cela quelle
soit soustraite laction des minralisateurs arobies. Lobjectif de cette double page
est ainsi de montrer comment la tectonique des plaques influence la prservation de
la matire organique dpose. En modifiant le positionnement gographique des bassins, elle influence le phnomne dupwelling et les conditions anoxiques (absence
de courants de fond oxygns) ; en provoquant des distensions, elle permet lenfouissement des dpts.
Le document 1 est le rsultat de la prospection des sdiments ocaniques actuels. Il
indique la teneur en carbone des sdiments marins superficiels. Il permet dassocier
la prsence de carbone aux sdiments des marges continentales et plus particulirement aux argiles (et aux marnes).
Le document 2 prsente la productivit primaire des ocans. Ce document est une
synthse de diffrentes observations (notamment des tudes satellitaires de la concentration des eaux superficielles en chlorophylle). Il met particulirement en vidence
les zones dupwelling riches en matire organique. La confrontation des documents1
et 2 montre que les zones de forte production de matire organique ne sont pas forcment les zones les plus riches en sdiments organiques.
Le document 3 apporte une explication aux constats raliss partir de la confrontation des documents 1 et 2. Il donne une information concernant la circulation thermohaline et le phnomne dupwelling.
Le document 4 prsente la tectonique favorable lenfouissement. Conformment aux
directives du programme officiel, un profil sismique de marge passive est prsent. Il
montre trs clairement la prsence de blocs basculs, de failles normales et lallure des
corps sdimentaires typiques des marges passives (sdiments syn-rifts et post-rifts).

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: Les zones de forte production primaire ne sont pas forcment des zones
o lon trouve dans les sdiments de fortes teneurs en matire organique. Par exemple,
126

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 126

20/07/11 09:17

mme si au niveau de lAtlantique Nord ou des ctes brsiliennes et vnzuliennes,


la productivit primaire est trs forte (suprieure 200 grammes de carbone par mtre
carr et par an), le taux de carbone dans les sdiments est faible ou trs faible (infrieur 0,5 %).
Doc. 1, 2 et 3: Les ctes brsiliennes et vnzuliennes, le nord de lAtlantique sont
marqus par la prsence de courants ocaniques profonds. Froids et bien oxygns,
ils brassent les sdiments et favorisent la minralisation du carbone organique. Ces
secteurs sont pour cela pauvres en sdiments organiques mme si leur productivit
est importante.
Doc. 3: Les zones de forte productivit correspondent au phnomne dupwelling.
Celui-ci facilite les conditions anoxiques (absence doxygne) favorables la prservation de la matire organique morte. En effet, au niveau des zones dupwellings, la
production primaire des eaux de surface est tellement importante que la dgradation
de la matire organique morte consomme tout le dioxygne disponible. La consommation du dioxygne par les bactries minralisatrices tant suprieure la capacit
de renouvellement des eaux au contact des sdiments par les courants, il se cre sur le
fond une zone trs faible teneur en oxygne qui favorise la prservation de la matire
organique gnre en surface.
Doc. 4: La tectonique des plaques favorise la formation des hydrocarbures par la cration de bassins sdimentaires propices lenfouissement de la matire organique et
ainsi sa transformation. Ces bassins sdimentaires se trouvent au niveau des marges
passives des ocans.

Synthse : rponse au problme rsoudre


Les sdiments organiques sont conservs lorsquils sont placs dans des bassins o ils
peuvent tre enfouis et soustraits laction de loxygne. Cest le cas au niveau des
marges continentales passives lorsque les continents sont placs de telle sorte que ces
sdiments sont prservs des courants ocaniques profonds.

Chapitre 2. Tectonique des plaques et recherche dhydrocarbures

04732841_116-155.indd 127

127

20/07/11 09:17

Activits pratiques

Un exemple de gisement ptrolier remarquable (pages 176-177)


Connaissances

Capacits et attitudes

Objectifs et mots-cls. Lexemple tudi permet de prsen- Reprer les grandes caractristiques dun bassin sdimenter ce quest un bassin sdimentaire et quelques exemples taire et de quelques roches sdimentaires.
de roches sdimentaires. Il permet aussi de montrer lintrt
de la tectonique des plaques dans la comprhension du
phnomne sdimentaire.

1. Les intentions pdagogiques


Afin de rpondre aux exigences du programme officiel, le choix des auteurs sest
port naturellement sur le plus grand gisement ptrolier mondial : celui de Ghawar
en Arabie Saoudite. Ce gisement a t dcouvert en 1948, son exploitation a dbut
en 1951. 65% de toute la production de ptrole de lArabie Saoudite de 1948 2000
provient de Ghawar. Son exploitation reprsente environ 6% de la production mondiale quotidienne.
Le document 1 prsente les caractristiques du bassin sdimentaire, lge et lampleur de la sdimentation.
Le document 2 montre un profil sismique du bassin permettant de constater lexistence de failles que lon peut dater du dbut du secondaire (Trias).
Le document 3 apporte des informations sur la nature des sdiments et permet de
retrouver les caractristiques du gisement. Il est possible didentifier les roches mres,
rservoir et couverture.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Le champ ptrolifre de Ghawar prsente un effondrement du socle qui est
dcoup en blocs plus ou moins basculs les uns par rapport aux autres. Il montre une
accumulation de plusieurs milliers de mtres de roches disposes en strates (roches
sdimentaires). Ces roches se sont donc dposes au sein de ce bassin sdimentaire
pendant des centaines de millions dannes du Palozoque au Cnozoque.
Doc. 2: Des failles sont visibles sur le profil sismique du bassin. Il est difficile de dire
sil sagit de failles normales ou inverses mais il est possible de dire quelles recoupent les terrains palozoques et mme le dbut du Trias. Elles sont en revanche recouvertes par tous les terrains du Jurassique et du Crtac. On pense que ces failles ont
structur le bassin, jouant tout dabord en failles normales ; elles se sont formes lors
dun phnomne de rifting qui a permis le basculement des blocs de crote (dbut du
Msozoque, sdimentation syn-rift). Cest la priode douverture dun vaste domaine
ocanique. Ensuite, cette rgion a fonctionn en marge passive et a permis le dpt
dune importante sdimentation (Jurassique-Crtac, sdimentation post-rift). Enfin,
bien plus tard, la rgion a subi une compression qui a fait rejouer ces failles dune
manire inverse, ce qui explique la difficult relative de lecture aujourdhui sur le
profil sismique. Des plis sont galement visibles sur le document 1 et tmoignent de
lhistoire de ce bassin.
128

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 128

20/07/11 09:17

Doc. 3: La roche mre de Ghawar est le calcaire de la formation Hanifa (Oxfordien).


Il renferme en effet un taux de carbone organique important. Ce carbone organique,
enfoui au sein du bassin, a cuit sous leffet de laugmentation de la temprature conscutivement lenfouissement et il a form un fluide qui peu peu a migr vers le sommet du bassin. Il a rencontr la formation du Tithonien (des vaporites compactes et
impermables) et sest trouv bloqu. On le trouve ainsi dans la formation poreuse
immdiatement situe sous cette roche couverture : la formation Arab (kimmridgien)
qui constitue donc la roche rservoir au niveau de laquelle il faut forer pour exploitation le prcieux or noir.

Synthse : rponse au problme rsoudre


Un bassin ptrolifre est une ancienne marge passive, un bassin sdimentaire prsentant laccumulation dimmenses strates de roches sdimentaires de diverses natures.
On y trouve des roches mres trs riches en carbone organique, des roches poreuses
servant de rservoir et des roches couvertures impermables bloquant la migration
des fluides ptroliers. Au sein de ce bassin sdimentaire, il existe des structures tectoniques (failles, plis) qui ont favoris dune part lenfouissement des sdiments et ainsi
la formation du ptrole, dautre part la formation de piges lorigine de la concentration des fluides ncessaire la constitution du gisement.

3. Ressources complmentaires
Tout savoir sur le bassin ptrolier dAl Ghawar (en anglais) :

http://www.searchanddiscovery.com/documents/2004/afifi01/index.htm

Chapitre 2. Tectonique des plaques et recherche dhydrocarbures

04732841_116-155.indd 129

129

20/07/11 09:17

Activits pratiques

Mise en place des gisements et tectonique globale (pages 178-179)


Connaissances

Capacits et attitudes

partir de ltude dun exemple, on montre que la tectonique globale peut rendre compte :
dun positionnement gographique du bassin favorable
au dpt dune matire organique abondante et sa
conservation ;
dune tectonique en cours de dpt (subsidence) et
aprs le dpt qui permettent lenfouissement et la transformation de la matire organique puis la mise en place
du gisement.
La rare concidence de toutes ces conditions ncessaires
explique la raret des gisements dans lespace et le temps.

Analyser les positions relatives des continents et des


ocans (Tthys ou Atlantique) lors des priodes dabsence
ou de grande accumulation de roches-mres ptrolires
pour comprendre les conditions favorables leur dpt.
Recenser, extraire et organiser des informations permettant de reconstituer le contexte gographique et gologique lpoque du dpt lorigine de lhydrocarbure
de lexemple tudi.

1. Les intentions pdagogiques


Lobjectif ici est reconstituer les conditions palo-tectoniques prvalant la formation du ptrole en Arabie Saoudite. Il sagit de comprendre comment ces immenses
rserves ont pu se mettre en place : conditions de formation des roches mres puis de
formation des gisements. travers cet exemple, llve est amen comprendre que
les conditions propices la formation des gisements ptroliers sont nombreuses : tectonique propice la production dune biomasse quantitativement importante, disposition des continents compatibles avec une prservation de la matire organique forme,
distension permettant laccumulation et lenfouissement de la matire en vue de sa
transformation puis compression favorisant le pigeage du rsultat de la transformation.
Les documents 1 et 2 apportent les informations pour comprendre les conditions de
formation des roches mres :
tectonique en divergence (morcellement de la Pange) favorisant la productivit (climat chaud, forte production de CO2) et les conditions de dpt (extension des marges
continentales, transgression marine) ;
positionnement propice des continents et absence des glaces polaires empchant la
prsence de courants profonds oxygns favorisant les conditions anoxiques.
Les documents 3 et 4 mettent en vidence les conditions tectoniques assurant la formation des gisements. La prsence des piges ptrole est relier la fermeture de
locan Tthys. La pninsule arabique est replace larrire de la zone de collision.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: La forte activit des dorsales ocaniques, conscutivement lexpansion
de limmense ocan Tthys au Jurassique et au Crtac, a favoris :
la production de CO2 et ainsi un rchauffement climatique important ;
une transgression marine majeure permettant le dveloppement de vastes marges
continentales.
Une vaste production de matire organique a ainsi t rendue possible au niveau de
ces marges, ce qui a favoris la formation des roches mres.
130

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 130

20/07/11 09:17

Doc. 2: La fermeture de locan Tthys a provoqu la formation de plis, elle a fait


rejouer des failles normales en failles inverses. En raccourcissant les anciennes marges
passives, elle a contribu former des piges au sein desquels les fluides ptroliers
ont pu saccumuler. La pninsule arabique occupe de ce fait une place de choix ,
situe larrire de la zone de collision, elle est compresse mais ni trop ni trop peu,
ce qui a favoris la mise en place dimmenses gisements.
Doc. 1 4: Diverses conditions tectoniques sont ncessaires pour former un gisement ptrolier. Il faut :
une tectonique favorable au dpt et la prservation de la matire organique (un
positionnement particulier des continents qui interdisent un brassage des sdiments, un
climat chaud, une richesse en CO2 favorisant la productivit de matire organique) ;
une tectonique favorable lenfouissement de la matire organique (des marges
passives subsidentes) ;
une tectonique compressive favorable la mise en place des gisements dhydrocarbures (un raccourcissement de la marge passive avec la formation de plissements).

Synthse : rponse au problme rsoudre


Les conditions propices la formation des gisements ptroliers sont nombreuses : tectonique propice la production dune biomasse quantitativement importante, disposition des continents compatibles avec une prservation de la matire organique forme,
distension permettant laccumulation et lenfouissement de la matire en vue de sa
transformation puis compression favorisant le pigeage du rsultat de la transformation.
Ces conditions de la formation, multiples, nont t que rarement runies au cours
des temps gologiques.

3. Ressources complmentaires
Site du Paleomap project :

http://www.scotese.com

Chapitre 2. Tectonique des plaques et recherche dhydrocarbures

04732841_116-155.indd 131

131

20/07/11 09:17

Exercices

p. 186 187

La correction des exercices Tester ses connaissances figure la fin du manuel


de llve, p.351 et 352.

5 Le ptrole de la mer du Nord (p. 186)


Il faut choisir les rponses :
b- Le secteur de la mer du Nord a t tir dans une direction Nord-Ouest, Sud-Est.
d- La lithosphre continentale a t tire au Trias.
e- La lithosphre continentale nest plus tire depuis le Crtac suprieur.

6 Le ptrole du bassin de lOrnoque au Venezuela


1. Les roches mres se sont formes lors de louverture de locan Atlantique; nous
sommes en bordure de lAtlantique; le socle prsente un enfoncement, tmoin dune
subsidence; le socle prsente une accumulation de strates sdimentaires, il est recoup
par des failles. Tout cela semble montrer quil sagit dun bassin sdimentaire type
marge passive.
2. La fentre huile est le domaine de temprature et de pression au sein duquel la
matire organique est simplifie sous forme de fluide ptrolier. Avec la profondeur, la
temprature augmente si bien qu partir dun certain degr denfouissement la matire
organique est cuite , elle est simplifie et les fluides forms migrent vers la surface.
Les gisements se trouvent donc naturellement ici au-dessus de la roche mre, au-dessus
du toit de la fentre huile. Ils se trouvent bloqus par une roche couverture suite
leur migration partir de la roche mre.
3. Plus les forages sont profonds, plus lhuile (ptrole) a une temprature leve. Ceci
est parfaitement logique puisque plus on va profond dans le bassin sdimentaire et
plus la temprature slve.

7 Activit des dorsales et formation des ptroles


1. Plus la production de crote ocanique augmente et plus la temprature et le niveau
marin augmentent (inversement, plus la production de crote ocanique diminue et
plus le niveau marin et la temprature baissent). Paralllement, cest au moment o
la production de crote ocanique est importante, lorsque le niveau marin est haut,
quil fait chaud, quil y a le plus de formation de ressources ptrolires. Tous ces paramtres semblent donc tre lis.
2. Lorsque les remontes de magma sont plus intenses sous les dorsales, celles-ci se
dilatent thermiquement. Elles diminuent ds lors lespace que peut occuper leau dans
le bassin ocanique. Leau de mer est alors chasse sur les continents, cest le phnomne de transgression. Ces pisodes transgressifs sont particulirement propices au
dveloppement du plancton sur les marges continentales et ainsi la production de
biomasse. Ceci dautant plus que le climat est chaud, que latmosphre est riche en
CO2 favorable la photosynthse.
Il faut donc comprendre que lorsque les dorsales ocaniques sont actives, que la production de crote ocanique est grande, alors les conditions deviennent propices la
formation des roches mres ptrolifres.

132

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 132

20/07/11 09:17

Partie

chapitre

Pratiques agricoles
et gestion de lenvironnement
Activits pratiques

Le fonctionnement dun cosystme naturel (p.190-191)


Connaissances

Capacits et attitudes

Un cosystme naturel est constitu dun biotope et dune


biocnose. Son fonctionnement densemble est permis par
la productivit primaire qui, dans les cosystmes continentaux, repose sur la photosynthse des plantes vertes.
Dans un cosystme naturel, la circulation de matire et
dnergie peut tre dcrite par la notion de pyramide de
productivit.

Recenser, extraire et exploiter des informations, notamment


sur le terrain, utiliser des bases de donnes et des logiciels
pour comparer les bilans dnergie et de matire (dont
leau) dun agrosystme de production vgtale et dun
cosystme peu modifi par lhomme.

1. Les intentions pdagogiques


Le thme Nourrir lhumanit prolonge lapproche globale de lagriculture conduite
en classe de Seconde. Pour cela, il ncessite la prsentation de quelques grandes
notions concernant les cosystmes naturels et leur fonctionnement. Cest lobjectif
de ces premires activits.
Le document 1 rappelle la notion dcosystme dj aborde en Seconde et prcise
celles de biotope et de biocnose. La prsentation de lcosystme forestier caducifoli
permet une introduction la complexit de la biocnose et des relations quelle entretient avec les divers paramtres du biotope. En particulier, linfluence des arbres sur la
luminosit, la temprature, lhygromtrie, la vitesse du vent est signale et pourra tre
rinvestie dans les activits 2 et 4 de ce chapitre, ainsi que dans lactivit4 du chapitre4. Les interactions biotope/biocnose constituent un premier aspect de la dynamique dun cosystme.
Les documents 2 et 3 sont consacrs un second aspect de cette dynamique : au
sein de lcosystme, la matire et lnergie circulent. On sappuie sur les acquis de
Seconde sur la photosynthse, la productivit primaire et la dperdition nergtique
dun maillon lautre des chanes alimentaires (voir p.158). Ces notions sont rappeles et illustres par lexemple de lcosystme forestier. Cest loccasion daborder
la complexit des relations alimentaires au sein dun cosystme naturel et dinsister
sur la forme pyramidale des niveaux trophiques successifs. Cette complexit fera cho
lextrme simplification des biocnoses de certains agrosystmes (voir les activits pratiques2 et 4) ; la reprsentation pyramidale des productivits sera utile dans ce
chapitre pour comprendre la notion de bioaccumulation des pesticides (voir activits
pratiques3) et dans le chapitre suivant pour comparer les consquences cologiques
de la consommation de produits animaux et vgtaux (p. 212-213).
Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 133

133

20/07/11 09:17

noter que la reprsentation nest ici pas lchelle : le maillon vgtaux devrait
en effet tre 20fois plus large que le maillon des herbivores. Enfin, le document 2
permet de constater que la matire est en grande partie recycle lchelle de lcosystme grce aux processus de photosynthse, de respiration et de fermentations.
L encore, il sagit de prparer la comparaison qui pourra tre faite avec un agrosystme (activit 2).

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 : Les arbres forment en fort un couvert qui modifie tout un ensemble de paramtres du biotope, comme le montre le schma suivant :
Quelques effets des arbres sur le biotope forestier

Prsence des arbres


en peuplement serr

Vitesse du vent
divise par 10 au sol

Dpt de 3 8 kg de
poussires par mtre
carr de sol

80 % de la lumire
est intercepte

Humidit augmente
de 10 %

50 %
des prcipitations
sont interceptes

Temprature
maximale diminue
de 1 2 C

Doc. 1 et 2 : Les feuilles et branches mortes tombes au sol constituent une source
de matires organiques alimentant les dcomposeurs du sol (bactries, vers, champignons). Ceux-ci se nourrissent de ces matires organiques et celles-ci sont peu
peu minralises. Les matires minrales ainsi libres sont absorbes par les vgtaux
et participent leur croissance. Le prlvement systmatique des feuilles et branches
mortes appauvrirait donc le sol en matires organiques, puis en matires minrales.
Sa fertilit diminuerait et finalement la croissance des vgtaux en serait affecte.
Doc. 3 :
Productivit des herbivores : 2500 / 50000 = 0,05 (ou 5 %)
Productivit des carnivores de 1er ordre : 50 / 2 500 = 0,02 (ou 2 %)
Productivit des carnivores de 2e ordre : 1 / 50 = 0,02 (ou 2 %)
Doc. 3 : Seuls 5% de lnergie contenue dans les vgtaux sont fixs dans la matire
organique des herbivores. De toute la matire organique des herbivores, 2% seulement se retrouvent dans la matire organique des carnivores de 1er niveau. Il en va de
mme entre les carnivores de 1er et de 2e niveau. Dun niveau trophique lautre, ce
nest donc quune trs petite fraction de lnergie qui est transmise et stocke sous
forme de matires organiques. On peut donc reprsenter les productivits successives
sous la forme dune pyramide.

Synthse : rponse au problme rsoudre


Dans un cosystme, la matire circule dun maillon lautre de chacune des chanes
alimentaires. La productivit primaire (biomasse vgtale produite par photosynthse)
constitue toujours le 1er maillon. La matire organique est, un moment ou un autre,
finalement dcompose et minralise, donc rutilisable par les vgtaux. Dans un
cosystme naturel, la matire est donc en majeure partie recycle localement.
134

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 134

20/07/11 09:17

Cependant, seule une petite partie de la matire dun niveau trophique se retrouve
transforme en matire constitutive du niveau trophique suivant : la quantit dnergie dcrot donc fortement dun niveau lautre du rseau trophique.

3. Ressources complmentaires
Pour retrouver les notions de base de lcologie : B. Fischesser, M.-F. Dupuis-Tate, Le

guide illustr de lcologie, ditions de la Martinire, 1996.


P. Duvigneaud, La synthse cologique, ditions Douin, 1984.

Activits pratiques

Les agrosystmes : des cosystmes cultivs (p.192-193)


Connaissances

Capacits et attitudes

Lagriculture repose sur la constitution dagrosystmes


grs dans le but de fournir des produits (dont les aliments)
ncessaires lhumanit. Un agrosystme implique des
flux de matire (dont leau) et dnergie qui conditionnent
sa productivit. Lexportation de biomasse, la fertilit des
sols, la recherche de rendements posent le problme de
lapport dintrants dans les cultures (engrais, produits
phytosanitaires, etc.).

Concevoir et raliser un protocole pour mettre en uvre


une culture et analyser ses caractristiques et/ou utiliser
des logiciels modlisant une culture, ses bilans et sa gestion.
Recenser, extraire et exploiter des informations, notamment sur le terrain, utiliser des bases de donnes et des
logiciels pour comparer les bilans dnergie et de matire
(dont leau) dun agrosystme de production vgtale et
dun cosystme peu modifi par lHomme.

1. Les intentions pdagogiques


Les pages prcdentes ont permis aux lves de consolider et denrichir leurs connaissances sur les cosystmes naturels. Il sagit prsent dutiliser ces outils conceptuels (biotope, biocnose, flux de matire et dnergie, pyramide des productivits)
pour comprendre les spcificits dun cosystme cultiv (agrosystme) par rapport
un cosystme naturel.
Le document 1 ractive, sur la base dun exemple simple et relativement connu, les
notions de production agricole issues du collge et de la classe de Seconde. Litinraire
technique du mas (ensemble des actes appliqus une production vgtale) est prsent et sert de support pour mettre en vidence les transformations du biotope et de
la biocnose afin de favoriser la production de biomasse (mas ensilage) ou de grain.
Cest loccasion dintroduire le rle de leau dirrigation et des pesticides. Concernant les flux de matire, on voque les exportations lies aux rcoltes, les restitutions
lies lenfouissement des rsidus de culture, les apports dengrais minraux et organiques. Limportance cruciale dun quilibre dans les flux de matire est tudie grce
aux documents suivants.
Dans le document 2, une modlisation dun agrosystme ralisable en classe est propose aux lves. Elle peut tre ralise concrtement (voir le protocole dtaill sur le
site ressources) condition de la planifier correctement dans le temps. Elle peut dans
Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 135

135

20/07/11 09:17

ce cas tre loccasion de travailler la dmarche exprimentale : formulation de problmatiques, dhypothses, adaptation et mise en uvre du protocole, collecte et analyse
de rsultats... Avec ou sans mise en uvre concrte, le document permet daboutir
lide dun puisement des rserves nutritives du milieu du fait des rcoltes successives. Limportance dune compensation des exportations apparat donc en creux
avec la baisse progressive de la productivit primaire.
Le document 3 illustre la gestion de la fertilit dans un agrosystme rel, en reprenant lexemple du champ de mas. Cette fois, lapproche est quantitative et permet de
concrtiser ce que peut tre la gestion de la fertilit (mthode du bilan azot) pour
un agriculteur.

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 : Fin avril, le sol est dsherb chimiquement ou mcaniquement. Aprs la leve
des graines de mas, des herbicides permettent nouveau de limiter lenherbement.
La biodiversit des champignons et des insectes est aussi rduite par lutilisation de
fongicides et dinsecticides. En novembre, le labour permet denfouir les herbes qui
auraient pouss aprs la rcolte.
Doc. 2 : La biomasse rcolte devrait diminuer progressivement si lon effectue de
nombreux cycles culturaux. En effet, chaque cycle de la matire est exporte hors de
lcosystme cultiv, du fait de la rcolte. Dans le modle, la solution nutritive nest
pas renouvele : les rserves dazote, de phosphore, de potassium auront donc tendance spuiser, limitant ainsi la croissance des vgtaux et la productivit primaire.
Doc. 3 : Pour maintenir la fertilit du sol, lagriculteur doit compenser les exportations
dlments chimiques, en effectuant des apports dengrais minraux ou organiques :
lment
chimique

Exportation
(rcolte)

Pertes par
lessivage

Restitution

Apports
naturels

Bilan

Apports
dengrais

206

30 50

35

30

206 + (30 50) 35 30

171 191

36

ngligeable

2,5

36 2,5

33,5

216

ngligeable

52

2,1

216 52 2,1

161,9

Ca

36

ngligeable

14,3

10,1

36 14,3 10,1

11,6

Valeurs en

kgha1an1

Synthse : rponse au problme rsoudre


Lagriculteur dispose de plusieurs moyens pour assurer la productivit de ses cultures :
apport dengrais organiques ou minraux, traitement par des pesticides, irrigation.

3. Ressources complmentaires
Manuel numrique Bordas: fiche documentaire Culture du mas et gestion

de la ressource en eau.
Agreste , la statistique, lvaluation et la prospective agricole (site du ministre

de lAgriculture). Ce portail donne accs de trs nombreuses donnes quantitatives


sur lagriculture franaise, frquemment actualises :
http://agreste.agriculture.gouv.fr/
M. Mazoyer et L. Roudart, Histoire des agricultures du monde, ditions du Seuil, 2002.
Une synthse sur les besoins nutritifs du mas, les carences, la fertilisation minrale

etorganique de cette culture, la mthode du bilan azot :


http://www.cipf.be/fr/files/Ferti_mais.pdf
136

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 136

20/07/11 09:17

Activits pratiques

Pratiques culturales et environnement (p.194-195)


Connaissances

Capacits et attitudes

Le cot nergtique et les consquences environnemen- Faire preuve desprit critique en tudiant la conduite dune
tales posent le problme des pratiques utilises. Le choix culture quant son impact sur lenvironnement.
des techniques culturales vise concilier la ncessaire
production et la gestion durable de lenvironnement.

1. Les intentions pdagogiques


Il sagit ici de montrer quelles consquences peuvent avoir les pratiques agricoles
modernes sur lenvironnement et, par extension, sur la sant humaine.
Ltude est mene partir de deux cas bien documents : les apports excessifs dazote
et leurs consquences sur la pollution des nappes phratiques et des eaux superficielles dune part, lutilisation dun insecticide forte rmanence environnementale
(le chlordcone) dautre part.
Le document 1 prsente, partir dun extrait de rapport ministriel, la problmatique
des nitrates lchelle franaise. Il fait le lien entre des pratiques agricoles intensives,
des apports excessifs dazote dans les sols, leutrophisation des eaux superficielles et
le phnomne de mare verte.
La complexit des causes lorigine de cette pollution est esquisse dans le document 2 : on constate que des quantits gales dengrais azot nont pas forcment le
mme effet, selon la texture du sol. Ltude prsente des rsultats obtenus avec le logiciel STICS (INRA). Il sagit dun outil destin aux chercheurs, donc trs performant.
Cependant sa prise en main est assez rapide : il est envisageable de prolonger ltude
de ce document en faisant raliser par les lves dautres simulations simples (variations de lpaisseur du sol, de la culture, de la nature de lengrais utilis).
Le document 3 aborde le problme de la pollution de lenvironnement par le chlordcone. partir de cet exemple, la dangerosit dune utilisation mal matrise des pesticides chimiques est analyse : risques lis la dissmination des produits dans latmosphre, le sol, leau, risques lis leur rmanence dans lenvironnement, leur
toxicit large spectre, leur accumulation au sein de la pyramide cologique. Le
danger pour lenvironnement naturel est, comme dans lexemple prcdent, reli un
danger pour lHomme : certains risques associs une contamination de nos aliments
et boissons par le chlordcone sont aujourdhui tablis.

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 : Lapport excessif dazote sur les terres agricoles est une cause de leutrophisation. Lazote excdentaire rsulte dun mauvais quilibre entre les besoins des plantes
(cultures, prairies) et les pandages dengrais minraux et deffluents dlevage. Les
consquences de leutrophisation sont la prolifration des bactries, la consommation
du dioxygne de leau, lasphyxie de la faune aquatique et, finalement, sa disparition.
Doc. 2 : Sur sol sableux, la fertilisation azote pratique napporte aucune amlioration du rendement en grains. En revanche, elle permet damliorer la teneur en azote
Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 137

137

20/07/11 09:17

des grains, qui augmente mesure que la dose dengrais azot augmente. Cependant, on constate que si on multiplie par quatre les apports dammonitrates (de 55
220kgha1), on multiplie aussi la lixiviation de lazote par quatre (de 8 32kgha1).
Lapport excessif dengrais azots de type ammonitrates est donc lun des facteurs qui
favorisent la pollution des nappes phratiques par les nitrates. La comparaison avec
la mme simulation ralise sur sol argileux montre que des apports croissants dammonitrates peuvent amliorer les rendements (jusqu 110 kg dazote par ha) et la
teneur en azote des grains. Contrairement au cas prcdent, la lixiviation reste faible
(environ 5kgha-1) et naugmente pas si on augmente les apports dazote. La nature
sableuse du sol est donc un second facteur qui favorise la pollution des nappes phratiques par les nitrates.
Doc. 3 : Le chlordcone est trs peu biodgradable : il persiste dans leau et contamine les vgtaux. Puis il subit une bioaccumulation : il est stock dans les graisses
des consommateurs. Les cosystmes fonctionnant de manire pyramidale (il faut en
moyenne 10kg de nourriture pour produire 1kg dtre vivant), la concentration du
chlordcone est multiplie par 10 dun niveau trophique au suivant, comme lindique
la pyramide du document 3.
Doc. 3 : Le chlordcone est toxique pour le systme nerveux, le foie, les rgulations
hormonales et la reproduction. Il augmente le risque de cancer de la prostate.

Synthse : rponse au problme rsoudre


Lagriculture intensive peut poser des problmes de sant et denvironnement : lexcs
dazote provoque une eutrophisation des milieux aquatiques, se caractrisant par une
prolifration en surface de vgtaux verts. Lutilisation inconsidre de pesticides
peut se traduire par laccumulation de produits toxiques dans les diffrents maillons
des chaines alimentaires.

3. Ressources complmentaires
Manuel numrique Bordas: fiche documentaire Pratiques culturales et environnement:

la fertilisation raisonne.
Observation et statistiques de lenvironnement: Ce site prsente linformation et les

donnes sur lenvironnement assembles par le service de lObservation et des Statistiques


(SOeS) du Commissariat gnral au dveloppement durable (CGDD). Il donne entre autre
accs loutil de cartographie interactive Geodd France :
http://www.stats.environnement.developpement-durable.gouv.fr/
Accder aux rsultats danalyses de leau du robinet de votre commune :

http://www.sante.gouv.fr/resultats-du-controle-sanitaire-de-la-qualite-de-l-eau-potable.html
Union des Industries de la Fertilisation (UNIFA): Ce site prsente le point de vue de

lindustrie des engrais sur les fonctions remplies par ces produits, sur leurs utilisations,
mais aussi sur leurs consquences environnementales et sur la sant humaine :
http://www.unifa.fr/index.php
Pages du site consoGlobe : portail Internet ddi au dveloppement durable et

la nouvelle consommation responsable , consacres aux rsidus de pesticides dans nos


aliments :
http://www.consoglobe.com/developpement-durable-et-consommation-ecologique/
Observatoire des rsidus de pesticides, site gouvernemental. On y trouvera de

nombreuses informations utiles, entre autre sur le chlordcone :


http://www.observatoire-pesticides.gouv.fr/index.php
Pesticides, agriculture et environnement. Expertise scientifique collective. Synthse

du rapport dexpertise ralis par lINRA et le Cemagref la demande du ministre de


138

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 138

20/07/11 09:17

lAgriculture et de la Pche (MAP) et du ministre de lcologie et du Dveloppement


Durable (MEDD), dcembre 2005 :
http://www.observatoire-pesticides.fr/upload/
bibliotheque/704624261252893935317453066156/pesticides_synthese_inra_cemagref_pdf
Cancers et pesticides, I. Baldy et P. Lebailly, Supplment la revue du Praticien pp 40-44,

vol. 57, 15 juin 2007. Monographie faisant le point sur le suivi dune cohorte de 175000
agriculteurs franais concernant les liens ventuels entre leurs usages de pesticides et le
dveloppement de cancers :
http://references-sante-securite.msa.fr/files/SST/SST_1200049491062_CANCERS_ET_
PESTICIDES.pdf

Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 139

139

20/07/11 09:17

Activits pratiques

Pratiques agricoles et dveloppement durable (p.196-197)


Connaissances

Capacits et attitudes

Mettre en relation les pratiques agricoles locales et leurs


implications globales (les limites de la plante cultivable
sont bientt atteintes : les ressources (eau, sol, nergie)
sont limites afin dinstaller les bases de la rflexion qui
conduit aux choix de pratiques.

Recenser, extraire et exploiter des informations


sur la varit des agrosystmes mondiaux et leurs
caractristiques.
Recenser et comparer diffrentes pratiques culturales,
du point de vue de leur durabilit (bilan carbone, bilan
nergtique, biodiversit...).

1. Les intentions pdagogiques


Le premier objectif de ces activits est de mettre en vidence la diversit des agrosystmes. Il nest bien entendu pas question de dresser un panorama, mme partiel, de
cette diversit lchelle plantaire. Il ne sagit pas non plus de montrer que selon les
climats et les sols, les cultures sont ncessairement diffrentes. On sintresse plutt
ici la diversit des composantes humaines des agrosystmes, du point de vue des
techniques, mais aussi de leur insertion conomique, culturelle et environnementale.
Deux exemples sont tudis comparativement : les documents 1 et 3 constituent
des monographies succinctes de deux agrosystmes tropicaux bass sur la culture du
bananier. Des informations complmentaires sur ces deux types dagrosystmes sont
apportes par le document 4, qui permet par ailleurs de constater leurs diffrences en
termes de biodiversit, dimpacts environnementaux (sol, eau, pesticides, engrais),
et de productivit. Ltude de ces documents peut tre loccasion de montrer la complexit des questions poses par les agricultures contemporaines : chaque agrosystme
ses avantages et ses inconvnients, sur des plans diffrents, des chelles diffrentes.
Le document 2 fait rfrence aux bases historiques de la notion de dveloppement
durable, en citant un extrait du rapport Brundtland publi en 1987 par la Commission mondiale sur lenvironnement et le dveloppement des Nations Unies. Il dfinit
le dveloppement durable et insiste sur la ncessaire prise en compte des sphres cologiques, conomiques et sociales pour le mettre en uvre.

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 2 : Quelques caractristiques dun dveloppement durable.
Viable : qui peut vivre. Un dveloppement durable doit concilier cologie et conomie : lun ne peut aller sans lautre. La destruction des cosystmes sape la base
de lconomie, tandis quune prservation intransigeante de lenvironnement bloque
lactivit conomique. Un quilibre doit tre trouv entre les deux composantes pour
assurer la viabilit du modle de dveloppement.
Vivable : o lon peut vivre commodment. Le concept de dveloppement durable
prsente aussi une interface entre les sphres sociale et cologique. Si les socits
humaines ont lgitimement vocation utiliser les ressources naturelles pour la satisfaction de leurs besoins, certains modes de vie et la croissance dmographique contribuent dtruire lenvironnement, donc le rendre de moins en moins vivable, habi140

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 140

20/07/11 09:17

table. L aussi, un quilibre doit tre recherch de faon prserver lenvironnement


(et la sant) tout en permettant la satisfaction des besoins essentiels des humains.
quitable : qui procde de faon juste en respectant les droits de chacun. Le dveloppement durable des socits humaines passe aussi par la recherche dun quilibre
entre les forces sociales et conomiques. Cest la dimension politique de ce concept :
afin dassurer la durabilit du dveloppement, il convient de rduire les ingalits et
de promouvoir la justice.
Doc. 1 4 : Le jardin crole valorise la biodiversit cultive (cultures associes) et
prserve la biodiversit spontane (pas ou peu de pesticides). Il prserve leau et les
sols (paillage, travail du sol superficiel, restitutions organiques). Il contribue ainsi un
monde vivable. Les productions sont valorises sur les marchs locaux, en circuit court
et satisfont des besoins conomiques, sociaux, culturels Les termes de lchange
sont donc relativement quitables. En revanche, la productivit de ce type dagrosystme est faible : on ne peut imaginer quil puisse, lui seul, satisfaire les besoins de
9milliards dhumains majoritairement urbains.
La plantation bananire a, quant elle, une productivit beaucoup plus forte. Ce type
dagriculture industrielle joue un rle majeur dans la scurit alimentaire mondiale.
Pourtant, il pose aussi de graves problmes de viabilitet dhabitabilit des cosystmes : perte de biodiversit, gaspillage deau, dgradation des sols, cot nergtique
de la production, de son transport et de sa commercialisation

Synthse : rponse au problme rsoudre


La diversit des agrosystmes repose sur des pratiques agricoles trs diffrentes les
unes des autres. Les pratiques artisanales de proximit prservent lenvironnement, la
biodiversit mais ont en gnral une faible productivit. Lagriculture intensive tente
de rpondre au dfi alimentaire mondial mais pose souvent des problmes denvironnement ou de sant.

3. Ressources complmentaires
La banane, sa culture, son commerce(site des Nations Unies) :

http://www.unctad.org/infocomm/francais/banane/culture.htm
Notre avenir tous - Le rapport Brundtland, fondateur du concept de dveloppement

durable :
http://www.wikilivres.info/wiki/Rapport_Brundtland

Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 141

141

20/07/11 09:17

Exercices

p. 204 207

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, page 352.

6 Les effets des pesticides sur la procration humaine


On constate que chez les hommes exposs aux pesticides agricoles (ruraux), le nombre
de spermatozodes par mL de sperme est en baisse de 77%. De plus, la mobilit des
spermatozodes est amoindrie de 17 %. Chez les femmes rurales, la frquence des
accouchements prmaturs est triple, celle des naissances denfants de faible poids
multiplie par 2,6. Il apparat donc clairement quune forte exposition aux pesticides
altre la fonction de procration.

7 Une pratique agricole : la fertilisation azote


Daprs le document 3, les trois rgions considres (Centre, le-de-France, Bourgogne) sont spcialises dans les grandes cultures (mas grain, tournesol, crales
paille, colza). Sur la carte de ce document, on voit en effet que celles-ci couvrent plus
de 85% des surfaces cultives. Le document 1 nous apprend que ces cultures ncessitent une fertilisation azote : la photographie a montre que la croissance du mas
est trs affecte si les plantes sont carences en azote. Cest pourquoi la quasi-totalit
des surfaces consacres aux grandes cultures reoit une fertilisation azote, comme
le montre le graphe b. Le document 2 permet de prciser la nature des engrais azots
utiliss : 65 90 % des surfaces en grandes cultures sont fertilises avec de lazote
uniquement minral. Cela sexplique du fait de la spcialisation rgionale des fermes
franaises : les fumiers et lisiers qui pourraient tre utiliss pour fertiliser les sols du
Centre, de la Bourgogne et de lle-de-France se trouvent dans les rgions dlevage,
comme la Normandie, la Bretagne et les Pays de Loire.

8 Lagriculteur face la pnurie deau


1. Pertes de rendements pour une satisfaction de 60 % des besoins : tournesol : 15% ;
bl ou sorgho : 25% ; pois ou soja : 38 % ; mas : 52 %.
2. Dans une rgion sche, il sera prfrable de cultiver le tournesol, le bl ou le sorgho, plutt que le pois, le soja ou le mas.
3. On sait que le rendement du mas est trs affect par le manque deau ; ce nest
pas le cas pour le tournesol. Il est donc logique de constater que 44,5 % des surfaces
cultives en mas grain sont irrigues, alors que 2 % seulement des surfaces cultives
en tournesol le sont. De plus, le mas ncessite une irrigation de juin aot, ce qui
consomme en moyenne 1300m3 ha1. Le tournesol nest irrigu quen juillet, do
une consommation plus modre, de 600 m3 ha1 en moyenne.
Les rendements du pois et du soja sont affects de la mme faon par le manque deau.
Pourtant les proportions de surfaces irrigues et les consommations deau lhectare
sont nettement suprieures pour le soja. Cela sexplique par le dcalage de ces deux
cultures dans le calendrier agricole : le soja est une culture dt (irrigation en juillet
et aot) tandis que le pois est une culture de printemps (irrigation en mai).

9 Comparer deux paysages agricoles


1. Sur le schma du paysage a, devront apparatre les zones enherbes, les cultures, la
haie, les zones boises. Sur le schma du paysage b, on verra surtout une vaste zone
cultive et un petit bosquet sur la ligne dhorizon.
142

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 142

20/07/11 09:17

2. La biodiversit est probablement plus forte dans le paysage a. Au niveau vgtal,


on distingue plusieurs espces darbres et darbustes, des buissons, des plantes herbaces. Il est probable que ces vgtaux soient la base de rseaux trophiques assez
riches (insectes, oiseaux). Le paysage b ne montre, au contraire, aucune biodiversit naturelle : seule la plante cultive est visible.

10 Le pilotage dune culture sous contrainte hydrique


Les capacits attendues sont les suivantes :
tre capable de justifier la ncessit de trouver un compromis entre rendement et
consommation deau.
Utiliser le logiciel STICS avec laide de la fiche technique.
Respecter les consignes : seuls les paramtres apports deau et paillage du sol seront
modifis; trois valeurs par paramtre au maximum.
Adopter une dmarche dinvestigation : formuler des hypothses, ne faire varier
quun paramtre la fois, tester diverses combinaisons judicieuses.
Collecter des rsultats (sous la forme dun tableau numrique).
Effectuer un calcul simple laide dun tableur.
Proposer une solution au problme pos et justifier sa rponse.
Exemples de rsultats avec et sans paillage, classs du plus efficace au moins efficace :

Apports deau
(en mm)

Rendement
(en t de grains/ha)

Efficacit de leau
(en m3/t de grains)

Paillage

Sans
paillage

Paillage

Paillage

Sans
paillage

Sans
paillage

65

65

86

90

86

90

3,77

3,04

3,95

3,95

3,18

3,23

17,2

21,4

21,8

22,8

27,0

27,9

Chapitre 3. Pratiques agricoles et gestion de lenvironnement

04732841_116-155.indd 143

143

20/07/11 09:17

Partie

chapitre

Pratiques alimentaires
et perspectives globales
Activits pratiques

Le dfi alimentaire mondial (p. 210-211)


Connaissances

Capacits et attitudes

lchelle globale, lagriculture cherche relever le dfi Utiliser des systmes dinformation gographique (SIG)
de lalimentation dune population humaine toujours pour dterminer limportance des besoins (nergie, matire,
croissante.
sol, etc.) de la production mondiale agricole actuelle (et
son volution rcente).

1. Les intentions pdagogiques


En introduction ltude des enjeux alimentaires de notre poque, il convient de dfinir les grandes caractristiques et tendances de la production agricole et de la consommation alimentaire mondiale. Les lves ont appris en Seconde que la croissance
dmographique des pays pauvres dune part, lingale rpartition des ressources et
de la consommation dautre part provoquent une hausse du prlvement effectu par
lhumanit sur la productivit primaire, des tensions sur lutilisation des terres et de
leau, une baisse de la biodiversit, une dgradation des sols Ces activits pratiques
permettent de revenir sur ces notions, den prciser certains aspects, et dexercer les
lves lutilisation de banques de donnes en ligne (FAOSTAT, UNEP) et dun SIG
(UNEP Geo Data Portal).
Du point de vue de la consommation alimentaire, les documents 1 et 2 apportent des
informations quantitatives et qualitatives qui montrent que la situation alimentaire mondiale sest amliore depuis 1961 (la disponibilit alimentaire moyenne a augment)
mais aussi que de grandes ingalits gographiques persistent. On constate ainsi que
dans les pays les plus pauvres (exemple du Niger), la part des produits animaux dans
lnergie alimentaire reste de lordre de 10%, tandis quelle atteint 35% dans un pays
riche (exemple de la France). Entre ces deux situations extrmes, le cas de la Chine
illustre ce quest une transition alimentaire : partir de 1980, le dveloppement conomique de ce pays saccompagne dune consommation croissante de produits animaux, faisant passer leur contribution la ration nergtique quotidienne de 8 % en
1980 21% en 2007. Croissance dmographique, amlioration des niveaux de vie et
augmentation de la consommation des aliments de luxe tels que les produits animaux se combinent et provoquent une forte augmentation de la demande alimentaire.
En consquence, les ressources agricoles sont de plus en plus sollicites lchelle
mondiale. Le choix a t fait de sappuyer sur un exemple : celui des engrais phosphats (document 3). La ressource est minire, non renouvelable lchelle du temps
144

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 144

20/07/11 09:17

humain. Les rserves ne sont pas en voie dpuisement court terme, mais pourraient
ltre moyen terme (un sicle) comme le montrent les chiffres de lUSGS. Le lien est
fait avec la dmographie et lconomie : la carte fait apparatre que parmi les quatre
principaux consommateurs de phosphates, on trouve la Chine, lInde et le Brsil. Lindice du prix des engrais traduit le dsquilibre croissant entre demande dintrants agricoles et ressources naturelles disponibles pour leur production.

2. Pistes dexploitation
Informations dduites de lanalyse des documents

Population ( 109 habitants)

Doc. 1 et 2 : Graphe complt partir des donnes FAOSTAT sur la production mondiale de viande de 1961 2009 :
Consommation
mondiale
en viandes

Production agricole
( 1011 kg pour les lgumes
et crales)
Consommation en viande
( 107 kg)

La population mondiale est passe entre 1961 et 2009 de 3 6,8 milliards dindividus, soit une croissance de 127 %. On constate que la production de crales progresse quant elle de 188%, celle de lgumes de 326 %, celle de viande de 294 %.
La production alimentaire progresse plus vite que la population mondiale : la quantit daliments disponible par habitant augmente donc au cours de cette priode, en
moyenne mondiale. Comme le montre le document 2, cela cache cependant des ingalits rgionales : certains pays trs pauvres voient leur consommation de viande
stagner un niveau trs faible (Niger) tandis que dautres, en plein dveloppement,
voient la part de viande dans la ration alimentaire quotidienne progresser nettement
(cest le cas de la Chine).
Doc. 1 3 : La croissance dmographique dune part, laugmentation du niveau de vie
moyen dautre part provoquent au niveau mondial une augmentation de la demande
alimentaire. Pour rpondre ces besoins, de nouvelles terres sont mises en culture,
et on cherche amliorer les rendements agricoles. Cela se traduit par une hausse de
la demande en engrais (et autres intrants agricoles). Dans le cas des phosphates par
exemple, une pression plus forte sexerce sur les ressources minires, ce qui fait augmenter le prix des engrais phosphats.

Synthse : rponse au problme rsoudre


Pour rpondre au dfi alimentaire lanc par lactuelle croissance dmographique,
lagriculture mondiale doit accrotre les surfaces cultives. Cependant, les rserves en
Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 145

145

20/07/11 09:17

terres cultivables tant limites, il faut aussi amliorer les rendements pour permettre
une augmentation de la production agricole.

3. Ressources complmentaires
FAOSTAT : base de donnes de la FAO.

http://faostat.fao.org/default.aspx?lang=fr
M. Mazoyer et L. Roudart, Histoire des agricultures du monde, ditions du Seuil, 2002.
Lagriculture mondialise, J.-P. Charvet, La documentation franaise, dossier n8059,

sept. oct. 2007.


Alimentation (Comportement et pratiques alimentaires), volution de la

consommation. Article de lEncyclopdia Universalis prsentant, entre autres, lvolution


de la consommation alimentaire au cours de lHistoire, en lien avec les changements socioconomiques.
Sur le site de lUNIFA (Union des industries de la fertilisation), des donnes

statistiques sur la production et les livraisons dengrais en France, de la fin du xixe


sicle nos jours.
http://www.unifa.fr/le-marche-en-chiffres/la-fertilisation-en-france.html
Banque de donnes mondiales sur la production, les changes, la demande de

produits minraux. De nombreuses donnes concernent les engrais azots, phosphats et


potassiques:
http://minerals.usgs.gov/minerals/
Base de donnes en ligne et systme dinformation gographique du PNUE

(Programme des Nations Unies pour lEnvironnement). On y trouvera des donnes sur
lvolution au cours du temps de la production et de la consommation des divers engrais
dans le monde.
http://geodata.grid.unep.ch/

146

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 146

20/07/11 09:17

Activits pratiques

Les levages : des agrosystmes peu efficaces (p. 212-213)


Connaissances

Capacits et attitudes

Dans un agrosystme, le rendement global de la production


par rapport aux consommations (nergie, matire) dpend
de la place du produit consomm dans la pyramide de
productivit. Ainsi, consommer de la viande ou un produit
vgtal na pas le mme impact cologique.

Recenser, extraire et exploiter des informations, utiliser des


bases de donnes et des logiciels pour comparer les bilans
dnergie et de matire (dont leau) de diffrents levages,
et comparer production animale et production vgtale.
Faire preuve desprit critique en tudiant la conduite dun
levage quant son impact sur lenvironnement.

1. Les intentions pdagogiques


Aprs la mise en vidence dune consommation de plus en plus forte de produits animaux lchelle mondiale (activits prcdentes), on centre prsent lattention des
lves sur les consquences environnementales de ce changement dhabitudes alimentaires. Ici, ce sont surtout les consquences locales qui sont envisages. Les consquences globales seront tudies dans les activits des pages suivantes.
Il sagit donc, dans un premier temps, de mettre en vidence que lefficacit nergtique dun levage est bien infrieure celle dune culture. Cest lobjet des documents 1 et 2. Outre les donnes chiffres apportes par ces documents, on sappuiera
utilement sur le rappel de la notion de pyramide des productivits (voir p. 191). Remis
dans une perspective cologique, le faible rendement nergtique des productions animales apparat alors non comme un dfaut des systmes dlevage, mais comme une
caractristique intrinsque du vivant.
Le document 3 aborde un autre aspect de ce mme phnomne : les consommations
deau pour produire divers aliments sont compares. Rapportes lunit de valeur
nergtique par un calcul simple, les consommations deau des aliments dorigine animale apparaissent jusqu 70 fois suprieures celles des aliments dorigine vgtale.
Le document 4 introduit une autre situation dlevage, celle des piscicultures de saumons. Lexemple permet de montrer que si les levages dherbivores sont peu efficaces, cest encore pire pour les levages de carnivores, du fait mme de leur position
dans la pyramide de productivit. Les consquences environnementales de ces levages de poissons seront abordes dans les activits suivantes (document 4 page 215).

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 et 2 : Il faut environ 8 kg daliment vgtal pour quune vache produise 1 kg
de poids vif. La valeur nergtique de laliment consomm pour produire 1kg animal est donc de 85675=45 400 kJ. La part dnergie consacre la croissance
effective de lanimal est donc de 100 6300 /45400 =13,9 %. Sur 1kg de poids
vif, 390g seulement sont sous forme de viande. La part dnergie vgtale que lon
retrouve dans la viande est donc de 0,3913,9=5,41 %.

Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 147

147

20/07/11 09:17

Doc. 3 :
La production d1 kJ de

utilise un volume deau de

Pomme de terre

0,03 L

Bl

0,08 L

Riz

0,09 L

Lait

0,29 L

ufs

0,46 L

Porc

0,75 L

Volaille

0,82 L

Buf

2,14 L

Doc. 4 : Il faut environ 365jours pour produire un saumon de 5kg. La croissance est
considre comme linaire pour chacune des phases de croissance dont les dures sont
fournies dans le tableau du document4. On peut donc calculer pour chaque phase la
croissance quotidienne. Cela permet laide du tableur de calculer la masse dun saumon, jour aprs jour jusqu ce quil atteigne son poids commercial de 5kg, puis la
biomasse prsente dans une cage de 50000individus. Connaissant, grce au tableau
du document 4, la quantit de granuls distribuer en fonction de la biomasse des
poissons, on en dduit la quantit de granuls consomm par la cage quotidiennement,
ainsi que son cumul au cours de la croissance des saumons. On constate alors quil
faut 319550 kg de granuls pour produire les 50000 saumons de 5 kg, soit 6,4 kg de
granuls par saumon, ou 1,28 kg de granuls pour 1kg de saumon commercialisable.
Le texte du document 4 nous apprend que 6 kg de poissons fourrages sont ncessaires
pour fabriquer 1 kg de granuls pour saumon. La production d1kg de saumon ncessite donc 7,7 kg de poissons fourrages.
Doc. 1 4 : La production animale ncessite en amont la production des aliments destins aux animaux. Le rendement de conversion nergtique tant faible (infrieur
10%) lefficacit des levages est ncessairement plus faible que celle des cultures.
Cest galement pourquoi les levages consomment beaucoup plus deau que les
cultures, quantit dnergie gale. Lefficacit est encore plus rduite dans le cas
dun levage de prdateurs, tels que les saumons.

Synthse : rponse au problme rsoudre


La production d1kg de viande ncessite la production de 8 kg daliments vgtaux.
De mme, la production d1kg de poisson ncessite de produire 7,7kg de poissons
fourrages eux-mmes obtenus partir daliments vgtaux.
quantits gales, la production de viande ou de poisson exige donc beaucoup plus
de ressources que la production de bl.

148

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 148

20/07/11 09:17

Activits pratiques

Pratiques alimentaires et environnement global (p.214-215)


Connaissances

Capacits et attitudes

Mettre en relation les pratiques alimentaires locales et leurs


implications globales (les limites de la plante cultivable
sont bientt atteintes : les ressources (eau, sol, nergie)
sont limites) afin dinstaller les bases de la rflexion qui
conduit aux choix de pratiques.

Recenser, extraire et exploiter des informations, utiliser


des bases de donnes et des logiciels pour comprendre :
limpact global des pratiques alimentaires ;
la gestion de populations et/ou de peuplements naturels.

1. Les intentions pdagogiques


En prolongement des activits prcdentes (pages 212 et 213), on envisage prsent
quelques consquences globales de nos pratiques alimentaires.
Une premire consquence est tudie dans les documents 1 et 2 : il sagit de la
contribution de nos aliments et de nos choix alimentaires au rchauffement climatique.
On pourra insister sur le fait que 30% des gaz effet de serre librs par les activits humaines sont lis la production de nos aliments et que la production dun kilogramme de steak hach en libre 230fois plus que celle dun kilogramme de pommes
de terre! Lattention pourra aussi tre attire sur le fait que ces valeurs tiennent compte
non seulement de la production agricole, mais aussi de ce que cela suppose en amont
et en aval. Le document 2 vise faire rflchir les lves sur les consquences de leurs
habitudes alimentaires. La ralisation de bilans carbone individuels laide dun site
internet spcialis pourra tre loccasion dinitier un dbat sur ce thme.
Le document 3 explore quelques-unes des consquences cologiques de la demande
croissante de viande, sur lexemple des relations inattendues entre la destruction des
cosystmes tropicaux et le contenu de nos assiettes. Le lien est fait entre le steak que
nous savourons et la dforestation, la dgradation qualitative et quantitative des sols
et des eaux en Amazonie.
Le document 4 fait cho ltude dun levage de saumons, mene dans lactivit prcdente (p. 213). Sous la plume de spcialistes de cette question, ce document dcrit
les consquences dramatiques de la surpche sur les populations de poissons sauvages,
lchelle de locan mondial.

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 et 2 : Du fait de leur mauvais rendement nergtique, les aliments dorigine
animale librent pour leur production beaucoup plus de gaz effet de serre que ceux
dorigine vgtale. Cest pourquoi ils dgradent nettement le bilan carbone des consommateurs comme Yvan. Parmi les autres facteurs dfavorables, on note la consommation de fruits et lgumes exotiques ou hors saison, qui consomment de lnergie pour
leur transport, leur conservation, leur stockage ce qui libre des gaz effet de serre.
Lutilisation dengrais minraux, de pesticides chimiques par lagriculture conventionnelle (non biologique) dgrade aussi le bilan carbone des aliments quelle produit par
rapport aux mmes aliments issus de lagriculture biologique. Limiter la consommation de viande, favoriser la consommation de produits locaux, de saison, issus de lagriculture biologique contribue donc lutter contre le drglement climatique.
Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 149

149

20/07/11 09:17

Doc. 3 : Le soja destin au btail franais provient entre autre de lagriculture brsilienne. Il sagit de cultures intensives qui provoquent la pollution des sols tropicaux
du fait de lutilisation de pesticides. Le steak que nous mangeons en France contribue donc polluer les sols amazoniens.
Doc. 4 : Les poissons dlevage sont des prdateurs de premier ordre (niveau trophique3). Lorsque nous les consommons, nous sommes donc des prdateurs de second
ordre (niveau trophique 4). Cette pratique modifie profondment les biocnoses marines
en puisant les populations de petits poissons sauvages, utiliss comme fourrage
pour nourrir les poissons dlevage.

Synthse : rponse au problme rsoudre


Nos comportements alimentaires individuels ont des consquences parfois insouponnes sur lenvironnement plantaire : contribution au rchauffement climatique du fait
du rejet de CO2 ncessaire la production des aliments, surexploitation de milieux
naturels par exemple.

3. Ressources complmentaires
Manuel numrique Bordas: fiche documentaire Manger de la viande nuit-il

lenvironnement?
Monoculture de soja : consommer de faon responsable de la viande pour baisser

notre impact sur les forts. Rapport du WWF (source du document 3 p 91).
http://www.protegelaforet.com/sites/default/files/FICHE_SOJA_PC.pdf
Des sites pour valuer son bilan carbone personnel :

http://www.calculateurcarbone.org/
http://www.coachcarbone.org/
Des gaz effet de serre dans mon assiette ? Une affiche informative et ludique

permettant de faire le lien entre nos habitudes alimentaires et le rchauffement climatique.


http://www.coachcarbone.org/ccarbone-static/data/documents/guide_RAC_GES_assiette.pdf
Des informations trs dtailles sur la contribution au rchauffement climatique

de nos habitudes alimentaires.


http://www.coachcarbone.org/ccarbone-static/data/documents/guide_RAC_GES_assiette.pdf

150

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 150

20/07/11 09:17

Activits pratiques

Quelles agricultures pour demain ? (p.216-217)


Connaissances

Capacits et attitudes

Le choix des techniques culturales vise concilier la nces- Recenser, extraire et exploiter des informations sur les
saire production et la gestion durable de lenvironnement. recherches actuelles permettant damliorer la production
Il est ncessaire de prendre en compte lenvironnement vgtale dans une logique de dveloppement durable.
pour en assurer la durabilit.

1. Les intentions pdagogiques


Les activits de ce chapitre et du prcdent ont montr que de nombreux problmes
rsultent des pratiques agricoles et alimentaires les plus rpandues aujourdhui. Ces
pages apportent un clairage sur quelques pistes explores par les agriculteurs, les
scientifiques, les consommateurs, pour trouver des solutions et assurer la durabilit de
notre alimentation. Deux grandes pistes sont voques, celle dune agriculture industrielle de haute technologie et celle dune agriculture paysanne er cologique. Il ne
sagit pas de les opposer mais de faire apparatre des alternatives, dinitier la rflexion
sur la complexit des rponses apporter, sur la possible complmentarit entre des
solutions trs diffrentes.
Le document 1 prsente lexemple de la slection gntique du mas. Trois tapes
majeures sont abordes, leurs avantages et inconvnients compars : la slection de varits paysannes, la slection de varits hybrides, lobtention de varits transgniques.
Le document 2 prsente lagriculture de prcision, une autre piste technologique,
adapte une agriculture industrielle. Le manuel de Seconde illustre (p. 151) lutilisation de capteurs embarqus pour cartographier trs prcisment le rendement dune
culture de bl et pourra tre utilis comme source complmentaire cette occasion.
Le document 3 sappuie sur lexemple de lagroforesterie pour montrer que les pratiques agricoles anciennes ne prsentent pas que des inconvnients. Leur adaptation aux
contraintes imposes par la modernit est un des objets de la recherche agronomique.
Les savoirs traditionnels et scientifiques se conjuguent dans le cas de lagroforesterie pour apporter des solutions innovantes aux problmes de productivit, de conservation des sols et de leau, de changement climatique, drosion de la biodiversit
Enfin le document 4 voque une innovation organisationnelle travers lexemple des
AMAPP. Il permet de montrer que les scientifiques et les agriculteurs ne sont pas les
seuls pouvoir contribuer la recherche de solutions : les citoyens que nous sommes
tous ont aussi des moyens dagir en changeant leurs habitudes de consommation, en
participant la rorganisation des filires de distribution des denres alimentaires

Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 151

151

20/07/11 09:17

2. Pistes dexploitation
Informations dduites de lanalyse des documents
Doc. 1 :
Varits paysannes

Varits hybrides

Varits transgniques

Agriculteur

Scientifiques

Scientifiques

Par prlvement
sur la rcolte

Achat auprs
des semenciers industriels

Achat auprs
des semenciers industriels

Productivit

Faible

Forte

Forte

Stabilit des caractristiques

Faible

Forte

Forte

Biodiversit varitale

Forte

Faible

Faible

Rsistance aux alas

Forte

Faible

Faible

Utilisation dintrants

Faible

Forte

Forte

Mode dobtention
Approvisionnement en semences

Doc. 2 : Lagriculture de prcision permet dajuster les pratiques agricoles au plus


prs des besoins de la plante (eau, engrais, pesticides). Cela limite la consommation de ces intrants, en augmente lefficacit, ce qui contribue lamlioration des
rendements et la protection de lenvironnement.
Doc. 3 : Les effets attendus dun dveloppement de lagroforesterie sont principalement les suivants :
Augmentation de la productivit primaire agricole.
Lutte contre le rchauffement climatique.
Lutte contre lrosion des sols (ruissellement, vent).
conomie dengrais et lutte contre leutrophisation des eaux.
Renforcement de la biodiversit en zone agricole et diminution de la consommation de pesticides (dveloppement des espces utiles).
Doc. 4 : Les AMAPP contribuent au dveloppement dune conomie solidaire entre
ville et campagne et le prix de vente des produits est quitable : elles se soucient donc du social. Les techniques de production des agriculteurs adhrents sont
annonces comme respectueuses de lenvironnement : les AMAPP se soucient
aussi dcologie. Enfin, les AMAPP visent soutenir, maintenir les producteurspaysans locaux : elles se soucient dconomie. A la croise de ces trois proccupations sociale, cologique et conomique, les AMAPP sinscrivent bien dans les critres du dveloppement durable.

Synthse : rponse au problme rsoudre


Pour assurer la durabilit de notre alimentation, producteurs et consommateurs sont
conduits rechercher toujours plus dinnovations scientifiques et technologiques mais
peuvent aussi trouver des solutions dans des savoir-faire et pratiques traditionnels.

3. Ressources complmentaires
Manuel numrique Bordas: fiche documentaire Amlioration gntique et poissons

dlevage
Groupement National Interprofessionnel des Semences et Plants. Site de rfrence

prsentant le point de vue des professionnels sur la production des semences et


lamlioration varitale. Consulter en particulier lespace pdagogique.
http://www.gnis.fr/
152

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 152

20/07/11 09:17

Pour amorcer un dbat autour des OGM :

http://www.linternaute.com/science/environnement/dossiers/06/0602-bons-ogm/
httpp://www.fao.org/french/newsroom/focus/2003/gmo1.htm
Film documentaire : C. Serreau, Solutions locales pour un dsordre global, ditions

Montparnasse, 2010.
Agrimonde : opration prospective Agricultures et alimentations du monde en

2050conduite de juin 2006 dcembre 2008 par lINRA et le CIRAD.


http://www.paris.inra.fr/prospective/projets/agrimonde
Site de lassociation franaise dagroforesterie:

http://www.agroforesterie.fr/
Mouvement interrgional des AMAP:

http://miramap.org/

Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 153

153

20/07/11 09:17

Exercices

p. 224 225

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, page 352.

6 volution de la consommation alimentaire en France


1. et 2.

Total consomm

Moyenne
1803-1812

Moyenne
1960-1964

1970

2005

300

687

650

578

Dont produits animaux

72

229

226

200

Dont produits vgtaux

228

458

424

378

produits animaux
produits vgtaux
(en kg/personne/an)

3. Variations de la consommation de chaque catgorie daliment entre 1803-1812 et


2005 :
Variation (en %)
pain

63

pommes de terre

+ 243

fruits et lgumes

+ 292

huiles

+ 900

sucre

+ 600

poisson

+ 267

viande

+ 375

ufs

+ 367

lait

+ 29

fromage

+ 800

beurre

+ 300

4. On constate que la quantit totale daliments consomme en une anne par un franais a plus que doubl entre 1803 et 2005. Elle semble aujourdhui en diminution de
11 % par rapport 1970. Par ailleurs, on voit que la part daliments dorigine animale
a progress : elle est passe de 24 % en 1803-1812 35 % partir de 1970 et jusqu
2005. Parmi les produits animaux qui ont le plus progress, on trouve les fromages
(+ 800 %), les viandes (+ 375 %) et les ufs (+ 367 %). Parmi les aliments dorigine
vgtale, la consommation de pain a rgress de 63 %, tandis que celles des huiles et
du sucre ont trs fortement progress. Au cours du xxesicle, la France a donc connu
une transition alimentaire, dun rgime de pnurie, bas sur les crales vers un rgime
dabondance, plus riche en graisses, en sucre, en produits dorigine animale.
154

Partie 3. Enjeux plantaires contemporains

04732841_116-155.indd 154

20/07/11 09:17

7 Combien de kilomtres dans mon assiette ?


1. Pour assembler tous les ingrdients du yaourt, les constituants de son contenant et
de son emballage, puis pour lacheminer jusqu la table du consommateur, 9 115kilomtres auront d tre parcourus.
2. Cette distance correspond un quart du tour de la Terre. Tout au long de ces kilomtres, de lnergie a t dpense. Lutilisation de carburants fossiles libre des gaz
effet de serre dans latmosphre et contribue au rchauffement climatique.
3. On peut favoriser le remplacement des nergies fossiles par des nergies renouvelables ; on peut aussi rapprocher les lieux de production des consommateurs, en favorisant des filires courtes (produits du terroir ). On peut enfin veiller limiter le
gaspillage des kilomtres alimentaires, en grant mieux son rfrigrateur afin de ne
plus jeter de produits prims.

Chapitre 4. Pratiques alimentaires et perspectives globales

04732841_116-155.indd 155

155

20/07/11 09:17

156

04732841_156-224.indd 156

20/07/11 09:18

162
171
186
201
216

157

04732841_156-224.indd 157

20/07/11 09:18

Partie

Corps humain
et sant

Les objectifs gnraux de cette partie


Cette partie du programme regroupe trois thmatiques a priori assez diffrentes avec la
sexualit, les maladies gntiques et les mcanismes de la vision. Elles permettent cependant toutes daborder des questions de sant humaine, de responsabilit individuelle et
dducation la sant.
Les chapitres traitant de la sexualit sappuient assez largement sur des acquis des classes
de Quatrime et de Troisime : les systmes de rgulation des fonctions de reproduction
chez lhomme et la femme ont t abords, ainsi que les autres questions lies la contraception, la PMA et aux IST. Il y a cependant des nouveauts avec la mise en place des
appareils gnitaux et les bases physiologiques de la sexualit.
Les acquis de Troisime et de Premire sont galement importants pour le chapitre concernant les variations gntiques. Il sera en effet ncessaire de savoir ce quest un gne, un
allle, une mutation pour bien comprendre les exemples proposs. Il y a de nombreux
points aborder en un temps relativement limit. Les documents proposs permettent
donc aux enseignants de travailler les notions, capacits et attitudes attendues sans y
passer trop de temps. Ils pourront galement choisir de dtailler plus ou moins certains
points en fonction des choix quils auront faits.
Cette partie du programme permet de dvelopper un certain nombre de comptences :
Des connaissances : On va tout dabord reconstituer les tapes biologiques dterminant ltat masculin ou fminin dun individu. Puis les diffrents aspects de la sexualit
seront envisags : sa rgulation hormonale, son contrle par des techniques mdicales
visant augmenter ou diminuer la fertilit, le volet hygine et sexualit avec ltude
des IST et enfin une premire approche du dterminisme du comportement sexuel. Puis
un chapitre sera consacr aux liens entre les variations gntiques et la sant. Ces variations gntiques pourront concerner lindividu avec le dveloppement de maladies comme
la mucoviscidose, les maladies cardiovasculaires ou le cancer ; elles seront galement examines chez les bactries car lapparition de formes de rsistance aux antibiotiques chez
ces dernires risque de poser des problmes important dans un avenir proche. Enfin, les
mcanismes de la vision seront tudis, en cherchant comprendre les rles du cristallin,
de la rtine et la formation des images dans le cerveau.
Des capacits : Le chapitre 3 donne de nombreuses occasions de travailler sur des
logiciels de modlisation molculaire ou danalyse de squences. Il permet galement de
faire des exprimentations avec la ralisation dantibiogrammes. Les chapitres 1 et 2 sont
de bons supports pour travailler la technique du schma fonctionnel, quil soit crer ou
complter : systme de rgulation, actions des hormones de synthse, construction du
phnotype sexuel, facteurs jouant sur le comportement sexuel. La transcription de phnomnes biologiques en schmas ncessite un travail mental complexe qui pourra donc
tre dvelopp ici. Il y a enfin de nombreuses occasions de lancer des dbats, et de discuter sur des points de biothique.
158

Partie 4. Corps humain et sant

04732841_156-224.indd 158

20/07/11 09:18

Des attitudes : Le bon droulement dun dbat, dune discussion ne peut se faire que
sil y a respect de lopinion des autres. On pourra galement ici travailler la notion de responsabilit civique au travers de comportements risque et de conseils dhygine ou
de suivis mdicaux. La ralisation dun antibiogramme ncessite enfin de respecter des
consignes de scurit strictes.

Une correspondance entre le programme officiel


et les chapitres du manuel
Connaissances

Les chapitres du manuel

THME 3-A FMININ, MASCULIN


Devenir femme ou homme

chapitre

Devenir homme ou femme (pages 234-251)


Les phnotypes masculin et fminin se distinguent par des Les activits pratiques
diffrences anatomiques, physiologiques, et chromosomiques. Act. 1 Lorigine commune dappareils gnitaux diffrents
La mise en place des structures et de la fonctionnalit des Act. 2 Du sexe chromosomique au sexe gonadique
appareils sexuels se ralise, sous le contrle du patrimoine Act. 3 Sexe gonadique et dveloppement des voies gnitales
gntique, sur une longue priode qui va de la fcondation Act. 4 La mise en place des caractres sexuels de ladulte
la pubert, en passant par le dveloppement embryonnaire
et ftal.
La pubert est la dernire tape de la mise en place des
caractres sexuels.
Sexualit et procration

chapitre

Chez lhomme et la femme, le fonctionnement de lappareil Sexualit et procration (pages 252-2177)


reproducteur est contrl par un dispositif neuroendocrinien
qui fait intervenir lhypothalamus, lhypophyse et les gonades. Les activits pratiques
La connaissance de ces mcanismes permet de comprendre et
de mettre au point des mthodes de contraception fminine
prventive (pilules contraceptives) ou durgence (pilule du
lendemain). Des mthodes de contraception masculine
hormonale se dveloppent. Dautres mthodes contraceptives
existent, dont certaines prsentent aussi lintrt de protger
contre les infections sexuellement transmissibles.

Act. 1
Act. 2
Act. 3
Act. 4
Act. 5
Act. 6
Act. 7

La double fonction des glandes gnitales


Rguler la fonction de reproduction chez lhomme
Rguler la fonction de reproduction chez la femme
La contraception hormonale chez la femme
La prvention contre les IST
Linfertilit et laide la procration
Sexualit et bases biologiques du plaisir

Linfertilit des couples peut avoir des causes varies. Dans


beaucoup de cas, des techniques permettent daider les couples
satisfaire leur dsir denfant : insmination artificielle, Fivete,
ICSI.
Sexualit et bases biologiques du plaisir
Lactivit sexuelle est associe au plaisir.
Le plaisir repose notamment sur des phnomnes biologiques,
en particulier lactivation dans le cerveau des systmes de
rcompense .

Les objectifs gnraux

04732841_156-224.indd 159

159

20/07/11 09:18

Connaissances

Les chapitres du manuel

THME 3-B VARIATION GNTIQUE ET SANT


Patrimoine gntique et maladie

Chapitre

Variation gntique et sant (pages 278-301)


La mucoviscidose est une maladie frquente, provoque par la
mutation dun gne qui est prsent sous cette forme chez une
personne sur 40 environ. Seuls les homozygotes pour lallle
mut sont malades.
Le phnotype malade comporte des aspects macroscopiques
qui sexpliquent par la modification dune protine.
Ltude dun arbre gnalogique permet de prvoir le risque de
transmission de la maladie.

Les activits pratiques


Act. 1 La mucoviscidose, un exemple de maladie gntique
Act. 2 La prise en charge dun patient atteint de mucoviscidose
Act. 3 Des maladies gntiques dpendantes de
lenvironnement
Act. 4 Une altration du gnome peut voluer en cancer
Act. 5 Lorigine de la cancrisation
Act. 6 La rsistance bactrienne aux antibiotiques

On limite les effets de la maladie en agissant sur des paramtres


du milieu. La thrapie gntique constitue un espoir de
correction de la maladie dans les cellules pulmonaires atteintes.
Le plus souvent, limpact du gnome sur la sant nest pas un
dterminisme absolu. Il existe des gnes dont certains allles
rendent plus probable le dveloppement dune maladie sans
pour autant le rendre certain. En gnral les modes de vie et
le milieu interviennent galement, et le dveloppement dune
maladie dpend alors de linteraction complexe entre facteurs
du milieu et gnome.
Un exemple de maladie (maladie cardiovasculaire, diabte
de type II) permet dillustrer le type dtudes envisageables.
Perturbation du gnome et cancrisation
Des modifications accidentelles du gnome peuvent se
produire dans des cellules somatiques et se transmettre
leurs descendantes. Elles sont lorigine de la formation dun
clone cellulaire porteur de ce gnome modifi. La formation
dun tel clone est parfois le commencement dun processus
de cancrisation.
Des modifications somatiques du gnome surviennent par
mutations spontanes ou favorise par un agent mutagne.
Dautres sont dues des infections virales.
La connaissance de la nature des perturbations du gnome
responsable dun cancer permet denvisager des mesures de
protection (vitement des agents mutagnes, surveillance,
vaccination).
Variation gntique bactrienne et rsistance aux antibiotiques
Des mutations spontanes provoquent une variation gntique
dans les populations de bactries. Parmi ces variations, certaines
font apparatre des rsistances aux antibiotiques.
Lapplication dun antibiotique sur une population bactrienne
slectionne les formes rsistantes et permet leur dveloppement.
Lutilisation systmatique de traitements antibiotiques peut
augmenter la frquence des formes rsistantes par slection
naturelle.

160

Partie 4. Corps humain et sant

04732841_156-224.indd 160

20/07/11 09:18

Connaissances

Les chapitres du manuel

THME 3-C DE LIL AU CERVEAU : QUELQUES ASPECTS DE LA VISION


Le cristallin : une lentille vivante

Chapitre

La vision : de la lumire au message

Le cristallin est lun des systmes transparents de lil nerveux (pages 302-323)
humain. Il est form de cellules vivantes qui renouvellent en Les activits pratiques
permanence leur contenu. Les modalits de ce renouvellement Act. 1 Le cristallin : une lentille vivante
sont indispensables sa transparence.
Act. 2 La rtine : une mosaque de photorcepteurs
Des anomalies de forme du cristallin expliquent certains Act. 3 Les rles complmentaires des photorcepteurs
dfauts de vision. Avec lge sa transparence et sa souplesse Act. 4 Vision des couleurs et parent chez les primates
peuvent tre altres.
Act. 5 De la rtine au cerveau
Les photorcepteurs : un produit de lvolution
La rtine est une structure complexe qui comprend les rcepteurs
sensoriels de la vision appels photorcepteurs. Celle de
lHomme contient les cnes permettant la vision des couleurs
(3 types de cnes respectivement sensibles au bleu, au vert et
au rouge) et les btonnets sensibles lintensit lumineuse.
Les gnes des pigments rtiniens constituent une famille
multignique (issue de duplications) dont ltude permet de
placer lHomme parmi les primates.
Des anomalies des pigments rtiniens se traduisent par des
perturbations de la vision des couleurs.
Le message nerveux issu de lil est achemin au cerveau par
le nerf optique.
Cerveau et vision : aires crbrales et plasticit

Chapitre

Cerveau et vision (pages 325-334)


Plusieurs aires corticales participent la vision.

Les activits pratiques

Limagerie fonctionnelle du cerveau permet dobserver leur Act. 1 La vision : une construction crbrale
activation lorsque lon observe des formes, des mouvements. Act. 2 Des substances qui perturbent la vision
La reconnaissance des formes ncessite une collaboration entre Act. 3 Apprentissage et plasticit crbrale
les fonctions visuelles et la mmoire.
Des substances comme le LSD perturbent le fonctionnement
des aires crbrales associes la vision et provoquent des
hallucinations qui peuvent driver vers des perturbations
crbrales graves et dfinitives.
La mise en place du phnotype fonctionnel du systme crbral
impliqu dans la vision repose sur des structures crbrales
innes, issues de lvolution et sur la plasticit crbrale au
cours de lhistoire personnelle.
De mme, la mmoire ncessaire, par exemple, la
reconnaissance dun visage ou dun mot repose sur la plasticit
du cerveau.
Lapprentissage repose sur la plasticit crbrale. Il ncessite la
sollicitation rpte des mmes circuits neuroniques.

Les objectifs gnraux

04732841_156-224.indd 161

161

20/07/11 09:18

Partie

chapitre

Devenir homme ou femme


Activits pratiques

Lorigine commune dappareils gnitaux diffrents (p. 236-237)


Connaissances

Capacits et attitudes

Les phnotypes masculin et fminin se distinguent Extraire et exploiter des informations de diffrents docupar des diffrences anatomiques, physiologiques, et ments, raliser des dissections pour identifier les diffchromosomiques.
rences anatomiques, physiologiques et chromosomiques
des deux sexes.

1. Les intentions pdagogiques


Les documents proposs ici permettent de retracer les tapes de la construction de
lappareil reproducteur au cours de lembryogense.
Le document 1 est une chographie permettant de dterminer le sexe de lenfant
natre. Cela constitue un bon point dentre dans le chapitre car il sagit dune situation familire, les lves auront dj rencontr dans leur famille des cas o cette
question a proccup de futurs parents. Il nest pas question en revanche de former
la dtermination du sexe par examen chographique, mais juste dapporter une illustration renvoyant des expriences personnelles. On peut ici voir que ce sexe est dterminable avant la naissance par chographie, mais seulement partir dune certaine
date. La dtermination du sexe par chographie pourra tre illustre laide dune
vido prsente sur le manuel numrique Bordas.
Le document 2 dcrit laspect des organes gnitaux la naissance. Il pourra tre rapproch des schmas prsents dans les pages acquis et reprsentant laspect de
ces appareils chez un adulte. On pourra alors discuter des tapes accomplies lors du
dveloppement embryonnaire et de celles qui restent encore venir. Il est possible
ce stade de rflchir des hypothses de formation, une observation rapide pouvant
se rvler trompeuse: en effet, ltablissement dhomologies entre les deux appareils
peut conduire penser quil existe un stade commun initial avec gonades et canaux
et que ces derniers se dveloppent dans le sens mle ou femelle.
On pourra galement dcouvrir cette organisation partir dune dissection si le professeur le souhaite. Cela donne loccasion de partir dune observation concrte et dune
manipulation du rel. La souris reprsentera un modle simple qui se prtera parfaitement cette dmarche.
Le document 3 permet de rentrer dans les mcanismes de mise en place des appareils
gnitaux, la comparaison entre le stade initial, laspect 8 semaines et celui la naissance est renforc par un code couleur. Llve pourra ainsi rechercher lorigine des
diffrents lments. Pour reprendre la dmarche prcdente, llve peut confronter
ses hypothses ce stade initial. Il va comprendre alors quil y a une seule gonade,
162

Partie 4. Corps humain et sant

04732841_156-224.indd 162

20/07/11 09:18

mais deux catgories de canaux. Il peut ensuite continuer sur ce principe en imaginant les mcanismes et les organes impliqus dans lvolution du stade indiffrenci.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 3: Avant 8 semaines, les examens chographiques ne permettent pas de dire
quel sera le sexe de lenfant natre. De plus, le document 3 montre lexistence
cette date dun stade initial commun aux deux sexes. Il prsente deux gonades daspects identiques et deux systmes de canaux (canaux de Wolff et canaux de Mller).
Par la suite, des volutions sont constates. Les gonades deviennent des testicules ou
des ovaires. Puis une seule catgorie de canaux va se dvelopper, lautre disparaissant: les canaux de Wolff se maintiennent pour les embryons masculins alors que ce
sont les canaux de Mller qui perdurent pour les embryons fminins.
Doc. 2 et 3: Premire homologie: la gonade. Les deux sexes possdent une paire
de gonades formes partir des gonades indiffrencies: testicules du ct masculin
et ovaires du ct fminin.
Deuxime homologie: les canaux. On trouve des voies gnitales faisant communiquer les gonades avec lextrieur. Mais en fait, cette homologie nest quapparente
car les canaux masculins et fminins drivent de deux structures embryonnaires diffrentes: les canaux de Wolff et de Mller.
Troisime homologie : les organes externes. On trouve des structures drives du
tubercule gnital (pnis ou clitoris) et des structures drives des tubercules labioscrotaux (scrotum ou lvres).

Synthse : rponse au problme rsoudre


Un embryon de moins de 8 semaines prsente une bauche dappareil gnital identique pour les deux sexes. Ensuite, la gonade va voluer soit en testicule, soit en ovaire.
Enfin, un seul des deux types de canaux va subsister et se dvelopper pour donner
les voies gnitales.

3. Ressources complmentaires
Manuel numrique Bordas: vido montrant la lecture du sexe dun embryon par

chographie.

Chapitre 1. Devenir homme ou femme

04732841_156-224.indd 163

163

20/07/11 09:18

Activits pratiques

Du sexe chromosomique au sexe gonadique (p. 238-239)


Connaissances

Capacits et attitudes

La mise en place des structures et de la fonctionnalit des


appareils sexuels se ralise, sous le contrle du patrimoine
gntique, sur une longue priode qui va de la fcondation
la pubert, en passant par le dveloppement embryonnaire et ftal.

Extraire et exploiter des informations de diffrents documents, raliser des dissections pour expliquer les tapes
de diffrenciation de lappareil sexuel au cours du dveloppement embryonnaire.
Traduire les diffrents mcanismes tudis sous la forme
de schmas fonctionnels.

1. Les intentions pdagogiques


La construction dun appareil sexuel mature se fait globalement en trois tapes (diffrenciation de la gonade, diffrenciation des voies gnitales et achvement du phnotype la pubert). Cest la premire de ces tapes qui est prsente ici.
Le document 1 traite du sexe caryotypique. Le dterminisme chromosomique du sexe
est connu depuis la classe de Troisime. En Premire, llve va sinterroger sur le
rle plus prcis de ces chromosomes sexuels en formulant des hypothses. Il ne sagit
pas dtre exhaustif sur les diffrents types danomalies, ni de les dcrire, mais juste
de comprendre la logique de masculinisation ou de fminisation.
Le document 2 prcise le rle des chromosomes, et plus particulirement celui du
chromosome Y. Les photos et les schmas permettent de conclure lexistence dun
gne de masculinisation qui sera tudi par la suite.
Le document 3 prsente le gne SRY et le document 4 explique comment ce gne
agit, en activant dautres gnes responsables de la masculinisation. Un exercice propos page 251 offre loccasion de travailler plus concrtement sur ce point en mettant
en vidence linteraction entre la protine TDF et lADN. On peut alors faire un lien
entre le patrimoine gntique (la squence du gne SRY) et le phnotype sexuel (masculin ou fminin) et expliquer ce lien par laction de la protine TDF.
Les coordonnes molculaires de la protine (fichiers .pdb) ncessaires pour ces activits sont sur le site ressources. Le manuel numrique Bordas propose une vido
(animation en 3D) de la protine TDF.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: La prsence dun chromosome Y est systmatiquement associe un phnotype globalement masculin, alors que son absence donne des phnotypes plutt fminins. On peut donc penser que cest la prsence ou labsence du chromosome Y qui
dtermine le sexe de lindividu. La fertilit ou la strilit constates semblent lies au
nombre de chromosomes prsents.
Doc. 2:Garon XX: le schma doit montrer que pour un des deux chromosomes X,
un fragment a t remplac par un fragment de chromosome Y.
Fille XY: le schma doit montrer quun fragment du chromosome Y est remplac par
un fragment de chromosome X.
164

Partie 4. Corps humain et sant

04732841_156-224.indd 164

20/07/11 09:18

On peut supposer que le fragment du chromosome Y chang est responsable de la


masculinisation de lembryon. Il doit donc porter un gne de masculinisation.
Doc. 3 et 4:On voit sur le document 3 que le chromosome Y porte un gne masculinisant nomm SRY. Ce gne permet la synthse dune protine nomme TDF qui est
capable de se fixer sur lADN. Cette fixation va activer dautres gnes responsables
de la construction effective du phnotype masculin.
En labsence du gne SRY et de la protine TDF, les gnes de masculinisation ne sont
pas activs et lembryon va voluer spontanment dans le sens fminin.

Synthse : rponse au problme rsoudre


La prsence dun chromosome Y dtermine un dveloppement masculin de la gonade.
Ce chromosome porte, en effet, un gne masculinisant nomm SRY. En labsence de
chromosome Y et donc du gne SRY, la gonade devient un ovaire.

3. Ressources complmentaires
Manuel numrique Bordas: Vido Modlisation tridimensionnelle: protine TDF et

ADN.
Site ressources Bordas:

Modle molculaire de la protine TDF et squence du gne SRY.

Chapitre 1. Devenir homme ou femme

04732841_156-224.indd 165

165

20/07/11 09:18

Activits pratiques

Sexe gonadique et dveloppement des voies gnitales (p. 240-241)


Connaissances

Capacits et attitudes

La mise en place des structures et de la fonctionnalit des


appareils sexuels se ralise, sous le contrle du patrimoine
gntique, sur une longue priode qui va de la fcondation
la pubert, en passant par le dveloppement embryonnaire et ftal.

Extraire et exploiter des informations de diffrents documents, raliser des dissections pour expliquer les tapes
de diffrenciation de lappareil sexuel au cours du dveloppement embryonnaire.
Traduire les diffrents mcanismes tudis sous la forme
de schmas fonctionnels.

1. Les intentions pdagogiques


ce stade, les mcanismes de diffrenciation de la gonade sont lucids ; il reste
maintenant comprendre comment se font les transformations des voies gnitales.
Lhypothse pose est celle dune influence directe de la gonade (testicule ou ovaire).
Elle va pouvoir tre vrifie partir de diffrents documents.
Le document 1 propose une approche historique et exprimentale de ces mcanismes.
Il permet galement de mettre en vidence le ct spontan de la fminisation.
Le document 2 prsente une anomalie constate chez la vache. On peut ici avoir une
dmarche explicative et aboutir lide dun contrle hormonal de la masculinisation.
Ces deux premiers documents suffisent donc pour construire le schma global: fminisation spontane, masculinisation sous contrle hormonal. Il va falloir par la suite
identifier les hormones en cause et leur rle prcis.
Le document 3 prsente une approche exprimentale pour dterminer le rle de la
testostrone. Cette hormone est en gnral connue des lves et associe assez facilement au testicule. Il est donc logique de commencer par vrifier son implication dans
la masculinisation de lappareil reproducteur. Les expriences proposes montrent
galement que la testostrone nest pas la seule responsable de cette masculinisation.
Le document 4 identifie la deuxime hormone en cause: lAMH. Le document est
trs simple et permet une lecture quasiment directe du rle de lAMH.
Le document 5 va permettre de rinvestir les mcanismes de masculinisation dcouverts ici. On propose donc aux lves un cas clinique quils doivent tenter dexpliquer. Il peut tre utile davoir au pralable ralis ou fait raliser un schma fonctionnel prsentant les dterminismes chromosomiques et hormonaux du sexe.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1:Lvolution dun embryon castr se fait toujours dans un sens fminin. Lovaire
nintervient donc pas, et cest bien la prsence ou labsence de testicule qui dtermine
le sens de la diffrenciation des voies gnitales.
Doc. 2 et 3:Le free-martin correspond la masculinisation dun embryon fminin,
due la prsence dun jumeau masculin. La seule communication possible entre les
deux embryons est la voie sanguine. On peut donc penser une influence hormonale
pour cette masculinisation.
166

Partie 4. Corps humain et sant

04732841_156-224.indd 166

20/07/11 09:18

Les expriences de Jost le confirment: linjection de testostrone, une hormone produite par le testicule, stimule le dveloppement des canaux de Wolff.
Doc. 4 et 5:Les personnes atteintes du syndrome dinsensibilit aux andrognes ont
un caryotype normal. La gonade volue donc en testicule qui va produire les deux hormones masculinisantes: testostrone et AMH. Les cellules de ces individus ne sont pas
sensibles la testostrone qui ne peut donc pas jouer son rle: les canaux de Wolff ne
sont donc pas stimuls et disparaissent; les organes gnitaux externes nvoluent pas
vers le sens masculin et sont donc typiques dun phnotype fminin (clitoris, lvres,
vagin). En revanche, lAMH joue son rle et provoque la disparition des canaux de
Mller, il ny a donc ni trompes ni utrus.

Synthse : rponse au problme rsoudre


Le testicule produit de la testostrone qui stimule le dveloppement des canaux de
Wolff en pididyme et canaux dfrents. Il produit galement de lAMH responsable
de la disparition des canaux de Mller. En labsence de ces deux hormones (non secrtes par un ovaire), les canaux de Wolff disparaissent et ceux de Mller se dveloppent spontanment en utrus et trompes.

Chapitre 1. Devenir homme ou femme

04732841_156-224.indd 167

167

20/07/11 09:18

Activits pratiques

La mise en place des caractres sexuels de ladulte (p. 242-243)


Connaissances

Capacits et attitudes

La pubert est la dernire tape de la mise en place des Extraire et exploiter des informations de diffrents documents, raliser des dissections pour expliquer les tapes
caractres sexuels.
de diffrenciation de lappareil sexuel au cours du dveloppement embryonnaire.
Traduire les diffrents mcanismes tudis sous la forme
de schmas fonctionnels.

1. Les intentions pdagogiques


Lobjectif ici est de traiter de la pubert comme dernire tape de la mise en place du
phnotype sexuel.
Les documents 1 et 2 prsentent les transformations pubertaires chez les garons et
les filles en lien avec les productions hormonales. Il sagit globalement dlments
dj vus au collge, mais qui seront utiles rappeler. Il y a galement une diffrence
importante concernant la perception de ces lments par un collgien ou un lycen.
En effet, la pubert dbute ou va dbuter pour un lve de Quatrime, alors quelle
est souvent acheve pour un lve de Premire.
Lobjectif nest pas de reprendre en dtail ces points mais plutt de replacer ces vnements pubertaires comme la dernire tape de la mise en place du phnotype sexuel
qui vient clturer celles vues prcdemment.
Le document 3 permet de mettre en vidence la mise en fonctionnement des appareils reproducteurs au moment de la pubert. On voit la prsence de gamtes, ovocytes et spermatozodes. Le professeur pourra galement proposer des observations
au microscope de coupes dovaires et de testicules, les lves devant alors indiquer si
les organes observ sont fonctionnels ou non. Sur ce mme principe, on pourra galement demander aux lves de raliser des prparations microscopiques partir de
testicules ou dovaires de souris pour rechercher la prsence de gamtes.
Le document 4 aborde le volet psychologique des transformations pubertaires. Ce
document ouvre sur la question du comportement sexuel qui sera abord dans le chapitre suivant. Il permet daborder galement les questions de responsabilit individuelle
qui apparaissent avec la maturit sexuelle. Le professeur pourra choisir de dvelopper
ces points ici, ou plus tard, quand il traitera des IST et de la rgulation des naissances.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:Chez les filles, on constate que les modifications pubertaires (pilosit,
hanches, seins) se font entre 8 et 14 ans, cest--dire une priode o la production des strognes par les ovaires augmente fortement. On peut donc supposer que
cette hormone est responsable du dveloppement des caractres sexuels secondaires
fminins la pubert.
De la mme faon, chez les garons, il y a une concordance de temps entre les modifications pubertaires (mue de la voix, poils pubiens) et une hausse de la production
168

Partie 4. Corps humain et sant

04732841_156-224.indd 168

20/07/11 09:18

de testostrone. L encore, on pourra conclure sur un rle de la testostrone dans le


dveloppement des caractres sexuels secondaires.
Doc. 3:La comparaison des ovaires avant et aprs la pubert montre que des ovules
ont commenc leur maturation. Cette mme comparaison au niveau du testicule met
en vidence la prsence de spermatozodes aprs la pubert. Les glandes deviennent
donc fonctionnelles en produisant des gamtes.
Doc. 4: la fin de la pubert, les organes sexuels sont fonctionnels et produisent des
gamtes. En parallle, la psychologie des adolescents a chang et ils commencent
ressentir une attirance sexuelle pour dautres personnes. Un individu pubre est donc
apte se reproduire au niveau physiologique et comportemental, la construction du
phnotype sexuel est donc acheve.

Synthse : rponse au problme rsoudre


La pubert voit la mise en fonctionnement des glandes gnitales qui se mettent produire gamtes et hormones. Ces dernires sont responsables du dveloppement des
caractres sexuels secondaires (pilosit, morphologie, psychologie).

3. Ressources complmentaires
Manuel numrique Bordas: Fiche documentaire La cryptorchidie, une mise en place

inacheve.

Chapitre 1. Devenir homme ou femme

04732841_156-224.indd 169

169

20/07/11 09:18

Exercices

p. 106 109

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, p.350 353.

6 Comprendre une exprimentation


1. La prsence de souris XX au phnotype mle montre que le gne SRY, aux fonctions masculinisantes, a t intgr dans leur gnome.
On peut galement voir que, chez les souris c (XX mles), la sonde correspondant
au gne SRY est dtectable, alors que celle correspondant au reste du chromosome
Y ne lest pas.
2. Souris a: il y a prsence de la sonde SRY et de la sonde chromosome Y.
Cette souris possde donc un chromosome Y porteur du gne SRY. Elle a donc un
phnotype mle normal.
Souris b: il ny a ni la sonde SRY ni la sonde chromosome Y. Cette souris
possde donc deux chromosomes X normaux. Elle a donc un phnotype femelle normal.
Souris c: il ny a pas la sonde chromosome Y, la souris possde donc deux
chromosomes X. En revanche, on note la prsence de la sonde SRY: la prsence
de ce gne explique la masculinisation de la souris.

7 Le contrle hormonal du phnotype sexuel masculin


1. Lexprience 2 montre que la prsence de testostrone permet le maintien des
canaux de Wolff. On a donc identifi le rle de cette hormone.
2. Si lon compare laction de la testostrone seule avec laction du testicule complet
(exprience 1), on peut voir un autre effet : la disparition du canal de Mller. Le testicule doit donc produire une autre hormone agissant sur ces canaux. Cette hormone
va donc faire disparatre les canaux de Mller.

8 Des hommes utrus !


1. Lhomme prsente un caryotype masculin normal avec un chromosome X et un
chromosome Y: le caryotype nexplique donc pas lanomalie. La production de testostrone correspond une production normale; en revanche, celle dAMH reste
zro tout le temps alors quelle devrait augmenter au premier mois de grossesse. Labsence dAMH empche la destruction des canaux de Mller qui voluent donc pour
donner un utrus. La prsence de testostrone a permis le dveloppement des voies
masculines partir des canaux de Wolff, puis la mise en fonctionnement des organes
gnitaux la pubert. On peut donc avoir ainsi la prsence dun utrus chez un homme
fertile.

170

Partie 4. Corps humain et sant

04732841_156-224.indd 170

20/07/11 09:18

Partie

chapitre

Sexualit et procration
Activits pratiques

La double fonction des glandes gnitales (p. 254-255)


Connaissances

Capacits et attitudes

Chez lhomme et la femme, le fonctionnement de lappareil


reproducteur est contrl par un dispositif neuroendocrinien qui fait intervenir lhypothalamus, lhypophyse et
les gonades.

Traduire les mcanismes de contrle de lactivit gonadique sous la forme de schmas fonctionnels.
Effectuer des gestes techniques pour raliser diffrentes
observations microscopiques.

1. Les intentions pdagogiques


Les programmes officiels demandent de reprsenter la rgulation hormonale de la
fonction de reproduction par un schma fonctionnel. La plupart des lments constitutifs de ce schma ont dj t abords au collge et reprsentent donc des acquis.
Cependant, il est probable que certains points aient t oublis ce qui rend presque
indispensable le fait de les revoir. Les deux premires pages de ce chapitre reprennent
donc les fonctions de reproduction chez la femme et chez lhomme. Ltude des documents proposs pourra tre complte, si le professeur le dsire, par des observations
microscopiques de coupes dovaires, dutrus et de testicule.
Le document 1 montre la premire fonction du testicule laide dune photo sur
laquelle les spermatozodes se voient nettement. Un schma permet de mieux comprendre lorganisation interne du testicule et la nature des tubes sminifres. Si une
dissection est ralise, on pourra demander aux lves douvrir le testicule pour observer lenchevtrement des tubes sminifres.
Le document 2 aborde la fonction hormonale du testicule. Lessentiel est ici de visualiser les deux types de tissus cellulaires, ddis la production hormonale ou celle
des gamtes; il sagit ensuite de comprendre que la production de testostrone est
faite de faon constante. lissue de ltude de ces deux premiers documents, on peut
dbuter la ralisation du schma fonctionnel avec la double fonction testiculaire et le
rle de la testostrone.
Le document 3 se veut lquivalent du document 1 pour la fonction fminine. On y voit
la production de gamte par lovaire. En croisant son tude avec celle du document 4,
llve peut retracer lvolution du follicule ovarien sur un cycle.
Le document 4 contient des lments utiles pour construire le cycle folliculaire, mais
il aborde surtout la fonction hormonale de lovaire. Le lien fait entre graphique et photographies permet de mieux apprhender les raisons des cycles de productions hormonales. Comme pour la rgulation masculine, on peut ici commencer schmatiser
les deux fonctions de lovaire: production dovocytes et production dhormones. Il
sera galement possible de demander une comparaison avec les deux fonctions pour
Chapitre 2. Sexualit et procration

04732841_156-224.indd 171

171

20/07/11 09:18

mettre en vidence les quivalences (gamtes, hormones) et les diffrences (continu,


cyclique, nombre de gamtes produits).

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: On voit que le testicule contient de longs tubes sminifreset que les spermatozodes sont produitsau niveau de la paroi. Ils vont ensuite cheminer le long des
tubes pour tre stocks dans lpididyme. Lors dune jaculation, ils passeront dans
le canal dfrent, seront mlangs au liquide sminal pour constituer le sperme qui
sera mis lextrieur.
Doc. 2: Le testicule contient deux types de tissus, les tubes sminifres ddis la
production de gamtes, et des cellules de Leydig, situes entre ces tubes. Les cellules
de Leydig produisent une hormone, la testostrone: mme si cette scrtion prsente
de petits pics de scrtion toutes les 4 heures environ, on peut considrer que le taux
plasmatique de testostrone est globalement constant. Cette hormone va agir sur les
cellules des tubes sminifres pour stimuler la spermatognse. Elle agira galement
sur dautres cellules de lorganisme pour stimuler le dveloppement des caractres
sexuels secondaires.
Doc.3: Lovaire contient des follicules, structures contenant diffrents tissus (thques,
granulosa) et un ovocyte. Au cours de la phase folliculaire, un de ces follicules se
dveloppe, les cellules folliculaires se divisent activement et font grossir le follicule.
Arriv maturit, ce follicule se dchire et libre lovocyte dans les trompes au cours
de lovulation. Les cellules de la granulosa voluent alors en cellules lutales et le follicule prend le nom de corps jaune. On entre dans la phase lutale qui sachve avec
la disparition du corps jaune.
Doc. 4:Le follicule produit des hormones, mais comme il volue au cours du cycle,
les productions hormonales voluent galement.
En phase folliculaire, thques et granulosa produisent de lstradiol qui stimule la
muqueuse utrine. La production augmente avec le dveloppement du follicule.
Aprs lovulation, en phase lutale, les cellules de la thque continuent produire
de lstradiol, les cellules lutales produisant, elles, de la progestrone qui stimule
galement la muqueuse utrine. Le corps jaune se dveloppe puis dgnre, ce qui
explique la monte puis la chute des taux hormonaux pendant cette phase.
En fin de phase lutale, le corps jaune a presque disparu et produit trs peu dhormones. Ntant plus stimule, la muqueuse utrine est partiellement limine au cours
des rgles.

Synthse : rponse au problme rsoudre


La premire fonction des glandes sexuelles est la production de gamtes: les ovaires
produisent des ovules et les testicules des spermatozodes. La seconde fonction est
une fonction hormonale: lovaire secrte de lstradiol et de la progestrone et le testicule scrte de la testostrone.

172

Partie 4. Corps humain et sant

04732841_156-224.indd 172

20/07/11 09:18

Activits pratiques

La rgulation du fonctionnement testiculaire (p. 256-257)


Connaissances

Capacits et attitudes

Chez lhomme et la femme, le fonctionnement de lappareil


reproducteur est contrl par un dispositif neuroendocrinien qui fait intervenir lhypothalamus, lhypophyse et
les gonades.

Traduire les mcanismes de contrle de lactivit gonadique sous la forme de schmas fonctionnels.
Effectuer des gestes techniques pour raliser diffrentes
observations microscopiques.

1. Les intentions pdagogiques


La fonction du testicule a t prsente prcdemment. Pour complter le schma de
rgulation, il faut prsent ajouter les lments contrlant cette fonction. Les documents proposs laissent le choix entre deux approches. La premire est un travail autonome des lves qui devront retrouver seuls les organes impliqus et leurs fonctions.
La seconde approche partira dune tude plus directe du document 3 afin de fixer le
principe du fonctionnement de laxe hypothalamo-hypophysaire, puis on laissera les
lves retrouver les dtails de ce fonctionnement du ct masculin.
Le document 1 prsente lhypophyse et son fonctionnement. On ne doit en retenir
que sa position et les hormones produites: LH et FSH.
Le document 2 montre la fonction de ces deux hormones. Il permet de complter le
schma fonctionnel en y ajoutant lhypophyse et son action sur la spermatogense et
la production de testostrone.
Le document 3 dcrit les relations existant entre lhypophyse et lhypothalamus. Il
peut tre utilis la suite des deux prcdents documents pour complter le schma
en y ajoutant lhypothalamus et son contrle.
Le document 4 permet de terminer le schma de rgulation avec le rtrocontrle ngatif exerc par la testostrone sur le complexe hypothalamo-hypophysaire.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:Lhypophyse produit deux hormones, LH et FSH. Le document 2 montre
quun pic de LH est toujours suivi par une augmentation de la production de testostrone. On peut donc supposer que la LH agit sur les cellules de Leydig en stimulant la
production de testostrone. La FSH va agir, elle, sur les tubes sminifres et stimule
la production de spermatozodes par ces derniers.
Doc. 3 et 4:Le document 3 montre laction de lhypothalamus dans la rgulation de
la production de testostrone: cette glande nerveuse produit une neurohormone, la
GnRH qui va aller stimuler la production de LH et de FSH par les cellules hypophysaires. La photographie du document 4 indique que la testostrone peut se fixer et agir
sur les cellules de lhypothalamus. Le graphique montre que labsence de testostrone est responsable dune hausse de la production de LH. La testostrone agit donc
sur les cellules de lhypothalamus (et de lhypophyse) en diminuant leur activit, ce
qui constitue un rtrocontrle ngatif.
Doc.14:Le schma doit comporter les diffrents organes impliqus: hypothalamus, hypophyse et testicule en diffrenciant chez ce dernier les cellules de Leydig et
Chapitre 2. Sexualit et procration

04732841_156-224.indd 173

173

20/07/11 09:18

celles des tubes sminifres. Le schma doit, laide de flches, montrer les actions
des diffrentes hormones qui relient ces organes: GnRH (stimulant lhypophyse), LH
(stimulant les cellules de Leydig), FSH (stimulant les cellules des tubes sminifres)
et testostrone (stimulant les cellules des tubes sminifres et les caractres sexuels
secondaires). Il doit enfin indiquer le rtrocontrle ngatif exerc par la testostrone
sur lhypothalamus et lhypophyse.

Synthse : rponse au problme rsoudre


La testostrone exerce un rtrocontrle ngatif sur le complexe hypothalamo-hypophysaire. Si le taux sanguin de testotrone vient augmenter, le rtrocontrle ngatif
saccentuera et la production des gonadostimulines LH et FSH va baisser. La consquence finale sera donc une stimulation moindre du testicule qui va produire moins
de testostrone et lcart sera corrig.

174

Partie 4. Corps humain et sant

04732841_156-224.indd 174

20/07/11 09:18

Activits pratiques

La rgulation du fonctionnement ovarien (p. 258-259)


Connaissances

Capacits et attitudes

Chez lhomme et la femme, le fonctionnement de lappareil


reproducteur est contrl par un dispositif neuroendocrinien qui fait intervenir lhypothalamus, lhypophyse et
les gonades.

Traduire les mcanismes de contrle de lactivit gonadique sous la forme de schmas fonctionnels.
Effectuer des gestes techniques pour raliser diffrentes
observations microscopiques.

1. Les intentions pdagogiques


La mme dmarche que celle entreprise du ct masculin va pouvoir tre mene ici
avec les mcanismes contrlant le fonctionnement de lovaire. Le fonctionnement de
lovaire a t vu prcdemment (production dhormones et de gamtes) et il est plus
complexe que celui du testicule chez lhomme. Le fait davoir commenc par la rgulation masculine a donc permis de poser les bases du systme avec notamment le complexe hypothalamo-hypophysaire et lexistence dun rtrocontrle qui se retrouvent
du cot fminin. Cest pour cette raison que lanatomie de ce complexe nest pas prsente ici. Au vu du temps disponible pour traiter cette partie du programme, il parat
difficile dexpliquer la totalit des vnements hormonaux qui contrlent le cycle
ovarien. Laccent a donc t mis ici sur le dclenchement de lovulation qui peut tre
considr comme lvnement majeur.
Il est possible de traiter cette partie laide de logiciels de simulation si le professeur
souhaite consacrer du temps cela, mais les programmes officiels demandent essentiellement de traduire les mcanismes par un schma fonctionnel et non de reconstituer lensemble du systme de rgulation.
Les documents 1 et 2 prsentent les actions des hormones hypophysaires sur lovaire.
Le schma classique du document 1 montre le synchronisme qui existe entre le cycle
hormonal ovarien et celui de lhypophyse. On peut alors faire un lien entre les deux
et vrifier ce lien partir de ltude du document 2.
Le document 3 montre lexistence de diffrents rtrocontrles. Des graphiques permettent de retrouver ceux exercs par lstradiol; ceux lis la progestrone sont
juste cits. Cela correspond au choix fait de privilgier la comprhension du dclenchement de lovulation parmi les diffrents processus hormonaux.
Le document 4 permet de reconstituer les tapes menant lovulation. Il mlange des
photographies ( lchelle) et des graphiques pour que les lves puissent mieux apprhender les changements qui soprent. Ils peuvent ainsi facilement comprendre que le
follicule grossit et produit davantage dstradiol. Le lien avec lexploitation du document 3 amnera lide dune inversion du rtrocontrle exerc par cette hormone.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: La LH est secrte essentiellement vers le 14e jour du cycle. Le pic de
LH constat est responsable du dclenchement de lovulation. La FSH prsente galement un pic au moment de lovulation, mais elle est produite galement en phase folliculaire. Le document 2 montre le lien qui existe entre le taux de FSH et la taille des
follicules. Le rle de la FSH est donc de stimuler la croissance des follicules ovariens.
Chapitre 2. Sexualit et procration

04732841_156-224.indd 175

175

20/07/11 09:18

Doc. 3: t0, le dbut de la perfusion dstradiol est suivi dune baisse du taux de
LH. On a donc ici un rtrocontrle ngatif. En revanche, quand t1, on injecte une
forte dose dstradiol, le taux de LH remonte. Cest donc qu forte dose, lstradiol exerce un rtrocontrle positif sur lhypothalamus et lhypophyse. On voit galement que le rtrocontrle exerc par la progestrone est ngatif quel que soit le taux.
Doc. 4:On voit que la taille du follicule augmente fortement au cours de la phase
folliculaire: le diamtre va plus que doubler entre le 8e et le 14e jour du cycle. Il est
donc logique que ce follicule plus gros produise davantage dstradiol: le taux plasmatique est multipli par 7. Ce taux finit par dpasser le seuil dclenchant un rtrocontrle positif. Lstradiol va donc stimuler lhypophyse qui va produire de fortes
quantits de LH, ce qui dclenchera lovulation. Le complexe hypothalamo-hypophysaire dtecte donc la prsence dun follicule mr par sa forte production dstradiol.
Doc. 1 4:Le schma doit comporter les diffrents organes impliqus: hypothalamus, hypophyse, ovaire (avec les follicules en croissance) et utrus. Le schma doit,
laide de flches, montrer les actions des diffrentes hormones qui relient ces organes:
GnRH (stimulant lhypophyse), LH (dclenchant lovulation), FSH (stimulant la croissance des follicules), progestrone et stradiol (ces deux hormones stimulant lutrus
ainsi que les caractres sexuels secondaires). Il doit enfin indiquer les trois rtrocontrles exercs par les hormones ovariennes sur lhypothalamus et lhypophyse (positif pour lstradiol forte dose, ngatif pour lstradiol faible dose et ngatif pour
la progestrone quelle que soit la dose).

Synthse : rponse au problme rsoudre


La production de FSH en dbut de phase folliculaire stimule la croissance dun follicule ovarien qui va produire de plus en plus dstradiol. Peu avant la fin de cette
phase, le taux dstradiol devient suprieur au seuil et se met exercer un rtrocontrle positif sur lhypothalamus et lhypophyse. La production des gonadostimulines
va donc montrer un pic de FSH et de LH, ce dernier tant responsable du dclenchement de lovulation. Le follicule clat volue en corps jaune qui subsiste pendant
toute la phase lutale.

176

Partie 4. Corps humain et sant

04732841_156-224.indd 176

20/07/11 09:18

Activits pratiques

La contraception hormonale chez la femme (p. 260-261)


Connaissances

Capacits et attitudes

La connaissance de ces mcanismes permet de comprendre


et de mettre au point des mthodes de contraception
fminine prventive (pilules contraceptives) ou durgence
(pilule du lendemain). Des mthodes de contraception
masculine hormonale se dveloppent.

Mettre en uvre une mthode (dmarche historique) et/


ou une utilisation de logiciels et/ou une pratique documentaire pour expliquer le mode daction de diffrentes
pilules contraceptives.

1. Les intentions pdagogiques


Lobjectif indiqu dans les programmes officiels est de retrouver le principe des mthodes
contraceptives utilises ou en cours de dveloppement et de comprendre que la mise au
point de ces mthodes a ncessit une bonne comprhension des mcanismes de rgulation. On pourra ici tudier les principales mthodes contraceptives fminines rgulires et durgence pour comprendre le mode daction des principes actifs contenus.
Le document 1 donne le contenu des pilules contraceptives. Les lves peuvent alors
faire le lien avec ce quils savent des analogues naturels de ces hormones de synthse.
Ils peuvent donc proposer un mode daction pour ces pilules. Les photographies de
plaquettes de pilules peuvent tre compltes par lobservation de boites relles de
pilules avec le contenu exact indiqu dessus ou sur les notices. Cela peut tre loccasion de comparer les doses des diffrents produits et de montrer quil existe diffrents
types de pilules pouvant rpondre des situations diffrentes.
Le document 2 prsente lvolution des taux dhormones ovariennes et hypophysaires
avec et sans prise de pilule contraceptive. Ce document est un incontournable que les
lves doivent tre en mesure dinterprter. Ils doivent y retrouver laction sur lutrus et expliquer les rgles, mais galement le rtrocontrle ngatif exerc sur lhypophyse qui la met au repos ainsi que lovaire. Il permet donc de vrifier laction des
molcules de synthse imagine prcdemment.
Les documents 3 5 traitent de la contraception durgence. Lobjectif est le mme
que pour la contraception rgulire, mais la dmarche est diffrente car les molcules
actives sont inconnues des lves. On part donc ici du contenu, puis on recherche laction
des molcules partir de documents graphiques. On pourra donc dterminer quel
niveau du systme de rgulation ces pilules agissent. Le document3 donne galement
des indications sur la faon dutiliser une contraception durgence.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:Une pilule classique contient des hormones de synthse (strognes et
progestatifs). Ces hormones exercent un rtrocontrle ngatif sur lhypophyse; celleci ne produit donc plus de LH et de FSH. Sans FSH, les follicules ne grossissent plus,
et sans LH, il ny a plus dovulation possible. Lovaire est donc maintenu au repos;
il ne produit plus dovocyte ni dhormones ovariennes (ou trs peu).
Chapitre 2. Sexualit et procration

04732841_156-224.indd 177

177

20/07/11 09:18

Doc. 3:Le terme de contraception durgence dsigne une mthode utiliser dans les
jours qui suivent un rapport sexuel non protg. Elle est donc utiliser de faon exceptionnelle quand les mthodes de contraception rgulire ont fait dfaut.
Doc 4 et 5:Le graphique du document 4 montre que la prise de lvonorgestrel inhibe
la production de LH, sans le pic au 14e jour; lovulation nest donc pas dclenche.
Lactate duripristal agit au niveau de lutrus. En se fixant sur les rcepteurs de la
progestrone, il empche cette hormone de stimuler les cellules de la muqueuse utrine. On a donc des rgles plus prcoces qui empchent un embryon ventuellement
cr de venir simplanter dans lutrus.

Synthse : rponse au problme rsoudre


La connaissance du fonctionnement de la rgulation de la fonction de reproduction
a permis de mettre au point des mthodes contraceptives. Certaines visent reproduire le rtrocontrle ngatif exerc par les hormones ovariennes. Dautres cherchent
dclencher des rgles prcoces ou bloquer lovulation.

3. Ressources complmentaires
Manuel numrique Bordas: Vido La pilule du surlendemain: molcules de

progestrone, lvonorgestrel, ulipristal (modlisations tridimensionnelles).


Site ressources Bordas: modles molculaires de la progestrone, du lvonorgestrel

et de luripristal.

178

Partie 4. Corps humain et sant

04732841_156-224.indd 178

20/07/11 09:18

Activits pratiques

La prvention contre les IST (p. 262-263)


Connaissances

Capacits et attitudes

Dautres mthodes contraceptives existent, dont certaines Extraire et exploiter des donnes pour relier la prvention
prsentent aussi lintrt de protger contre les infections contre les IST (Sida, hpatite, papillomavirus, etc.) la
sexuellement transmissibles.
vaccination ou lutilisation du prservatif.

1. Les intentions pdagogiques


Le programme demande de relier certaines pratiques conseilles la protection contre
les IST. Il nest donc pas ncessaire de dcrire dans le dtail les diffrentes IST, mais
bien de montrer ce quest une IST, puis de montrer que le prservatif est une mthode
contraceptive qui offre en plus une protection contre certaines IST. Les rles du dpistage, de la prvention et de la vaccination seront ensuite mis en vidence.
Le document 1 dfinit ce quest une IST et en donne quelques exemples sans viser
lexhaustivit. Cela peut tre le point de dpart de recherches documentaires sur lun
ou lautres de ces exemples pour dterminer les agents responsables, les modes de
contamination, les effets, les consquences sur la sant
Le document 2 traite de la mthode de prvention la plus vidente: le prservatif. Il
permet de montrer que ce prservatif protge efficacement contre certaines IST, mais
que, dune part, cette protection nest pas absolue, dautre part, elle ne concerne pas
toutes les IST.
Les documents 3 et 4 donnent des informations sur deux autres aspects des politiques
de sant publique: le dpistage et la vaccination. Les deux exemples proposs sont
ceux indiqus dans les programmes officiels, savoir lhpatite B et le papillomavirus. On peut ici discuter de lefficacit des deux stratgies de lutte. Ces deux infections seront galement abordes dans le chapitre 3 de cette mme partie, pour montrer leur lien avec le dveloppement de cancers. Un autre dcoupage du programme
est donc possible selon le choix du professeur.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: Lutilisation du prservatif offre une bonne protection contre certains agents
des IST comme le virus du SIDA, celui de lhpatite B ou le gonocoque. Cette protection nest cependant pas absolue, car le risque de contamination par le VIH est ainsi
rduit de 80% et non 100%. De plus, certains agents infectieux peuvent tre transmis
par voie cutane (exemple du papillomavirus), le prservatif est donc alors inefficace.
Doc. 1 et 3:Lhpatite B peut voluer vers un cancer hpatique, une maladie souvent
mortelle. La politique de vaccination contre lhpatite B mene Taiwan dans les annes
1980 a permis de rduire de faon importante les dcs dus un cancer du foie. Cest
pour cela que les autorits conseillent la vaccination contre le virus de lhpatite B.
Doc. 3 et 4:La campagne de dpistage du cancer permet aux femmes de savoir si
elles sont infectes. En cas de test positif, un suivi spcifique visera reprer un cancer du col dbutant pour le prendre en charge le plus prcocement possible et augmenter les chances de gurison.
Chapitre 2. Sexualit et procration

04732841_156-224.indd 179

179

20/07/11 09:18

En parallle, la vaccination des femmes limite le risque de contamination par le papillomavirus. Elle doit tre faite imprativement avant le dbut de la vie sexuelle, cest-dire avant quune adolescente puisse tre expose au papillomavirus.

Synthse : rponse au problme rsoudre


Il y a trois axes principaux dans la lutte contre les IST:
Lutilisation de prservatifs, masculin ou fminin, permet dviter la contamination
par certains agents infectieux.
Des dpistages permettent de connatre ltat dun patient. En cas de test positif, Il
fera lobjet dune surveillance plus attentive et pourra adopter un comportement responsable vis--vis de ses partenaires sexuels.
Des campagnes de vaccination ont pour objectif de protger les populations avant
la contamination ventuelle.

3. Ressources complmentaires
Lien vers le portail de lINPES consacr aux IST:

http://www.info-ist.fr/

180

Partie 4. Corps humain et sant

04732841_156-224.indd 180

20/07/11 09:18

Activits pratiques

Linfertilit et laide la procration (p. 264-265)


Connaissances

Capacits et attitudes

Linfertilit des couples peut avoir des causes varies.


Dans beaucoup de cas, des techniques permettent daider
les couples satisfaire leur dsir denfant : insmination
artificielle, Fivete, ICSI.

Recenser, extraire et organiser des informations pour


comprendre les modalits de la procration mdicalement
assiste.
Percevoir le lien entre science et technique.
Argumenter, dbattre sur des problmes thiques poss
par certaines pratiques mdicales.

1. Les intentions pdagogiques


Les techniques de PMA sont multiples, avec des protocoles trs diffrents. Il nest
donc pas possible ni utile de les tudier tous avec une classe. Lobjectif est donc de
comprendre la dmarche de traitement dun couple infertile: identifier les causes de
linfertilit, puis proposer une solution adapte. La technique illustre ici est celle de
la fcondation in vitro car elle est emblmatique de la PMA pour les lves.
Le programme demande galement de discuter des limites lgales et thiques de la
PMA, cela pourra se faire partir de recherches documentaires (par exemple partir
darticles de priodiques), et en sappuyant sur les documents proposs dans les cls,
page 273, lexercice 6 p. 274 ou le site ressources.
Le document 1 prsente rapidement les causes majeures de linfertilit masculine:
la mauvaise qualit du sperme. Il est possible de conjuguer ltude de ces documents
avec des observations de spermatozodes au microscope, pour donner une meilleure
ide aux lves de la taille et de laspect rel de ces cellules.
Le document 2 aborde les deux principales causes dinfertilit fminine. Il y en a
dautres, mais moins frquentes et plus complexes. De plus, les problmes dcrits sur
les documents 1 et 2 peuvent tre rsolus par la ralisation dune FIV, ce qui permet de
faire un lien avec les documents de la page suivante. Dautres techniques peuvent galement tre proposes comme linsmination artificielle; dans ce cas, des recherches
documentaires peuvent permettre de trouver des rponses.
Le document 3 dcrit les diffrentes tapes dune FIV. Cette description pourra sappuyer
sur une animation prsente dans le manuel numrique Bordas. Une vido sur lICSI
sera accessible par le biais dun lien partir du site ressources. Toutefois, lobjectif
indiqu dans le programme nest pas de faire un descriptif exhaustif des mthodes de
PMA existantes, ni de dcrire en dtail une de ces mthodes. Il est plutt de montrer
que ces mthodes sappuient sur une bonne connaissance des mcanismes hormonaux
contrlant la fcondation et le dbut de la grossesse.
Le document 4 va dans ce sens en proposant la description dun protocole de stimulation hormonale. Llve peut ainsi comprendre quune FIV ne peut se faire sans un
parfait contrle des cycles ovariens et utrins.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:Du ct masculin, on peut avoir une production insuffisante de spermatozodes, ou une abondance de formes anormales. Du ct fminin, la production
Chapitre 2. Sexualit et procration

04732841_156-224.indd 181

181

20/07/11 09:18

des ovocytes peut crer des difficults. On peut galement observer des trompes bouches, ce qui rend impossible la rencontre des gamtes ou la migration dun embryon
vers lutrus.
Doc. 3 et 4:Il faut tout dabord collecter les gamtes; cela pose peu de problmes
pour les spermatozodes produits en continu, mais les ovocytes sont plus dlicats
prlever. On ralise ainsi des stimulations ovariennes en utilisant des hormones hypophysaires de synthse.
Puis les gamtes doivent tre mis en contact, ce qui impose de les placer dans un
milieu adapt. Dans certains cas, la raret des spermatozodes ou leur faible mobilit
impose de recourir une ICSI, cest--dire une implantation directe dans lovocyte.
Ensuite lembryon doit tre implant dans lutrus. Celui-ci doit tre parfaitement
dvelopp et prt pour la nidation, ce qui peut tre fait laide dhormones ovariennes
de synthse.
Enfin un suivi de la grossesse est ncessaire pour vrifier la bonne implantation des
embryons et contrler leur nombre.

Synthse : rponse au problme rsoudre


La PMA ncessite de bien comprendre les tapes de la fcondation pour pouvoir dtecter les causes de linfertilit. Ensuite, des techniques comme la FIVETE demandent
lutilisation dhormones pour stimuler la production dovocytes par les ovaires, puis
pour prparer lutrus la nidation. Ces hormones de synthse miment leffet dhormones naturelles (LH, FSH, strognes, progestatifs).

3. Ressources complmentaires
Site ressources Bordas: animation expliquant le protocole dune FIVETE.
Lien vers une vido traitant de lICSI: Extrait du magazine de la Sant France 5

http://www.facebook.com/video/video.php?v=1182548770203

182

Partie 4. Corps humain et sant

04732841_156-224.indd 182

20/07/11 09:18

Activits pratiques

Sexualit et bases biologiques du plaisir (p. 266-267)


Connaissances

Capacits et attitudes

Lactivit sexuelle est associe au plaisir.


Mettre en uvre une mthode (dmarche historique) et/ou
Le plaisir repose notamment sur des phnomnes bio- une utilisation de logiciels et/ou une pratique documentaire
logiques, en particulier lactivation dans le cerveau des pour mettre en vidence le systme de rcompense.
systmes de rcompense .

1. Les intentions pdagogiques


Les facteurs contrlant le comportement sexuel sont multiples et les programmes officiels demandent de mettre laccent sur lun dentre eux: le systme de rcompense.
Les documents proposs ici dcrivent donc ce systme et abordent galement rapidement les autres facteurs (hormones, cognition, affectif). On pourra dbuter le chapitre
par une interrogation des lves sur la nature de ces facteurs, sur leur importance relative chez lHomme et chez dautres animaux. Ltude des documents proposs viendra ensuite confirmer ces hypothses et/ou apporter dautres lments. Un questionnement des lves donnera probablement des rponses impliquant un rle du cerveau
dans le comportement sexuel, mais il ny aura sans doute pas plus de prcisions. Ce
rle est extrmement complexe et fait encore aujourdhui lobjet de recherches et de
dbats dans le monde scientifique. Il conviendra donc ici de sen tenir aux grandes
lignes: implication du cortex et du systme de rcompense.
Le document 1 prsente les mcanismes du systme de rcompense. Lexemple pris
ne concerne pas le comportement sexuel, mais une exprience historique qui permet
de bien comprendre le processus de renforcement. Lexplication en reste au niveau
fonctionnel: un acte stimule le cerveau, et le plaisir ressenti renforce la ncessit daccomplir nouveau cet acte. La recherche de plaisir sexuel peut donc tre un moteur
du comportement sexuel.
Le document 2 apporte un clairage sur les organes lis la fonction dcrite prcdemment. On voit ici les zones du cerveau impliques dans le renforcement. Des logiciels permettent de faire des simulations pour mieux comprendre ces mcanismes si
le professeur souhaite dvelopper ce point. Une animation permettant de comprendre
le fonctionnement global du systme de rcompense est galement propose sur le
manuel numrique Bordas.
Le document 3 aborde le niveau molculaire du systme avec la prsentation de la
dopamine. On peut ainsi passer dun stimulus externe la production dun neurotransmetteur.
Le document 4 largit la question du dclenchement du comportement sexuel avec
la prsentation succincte des autres facteurs.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: Le systme de rcompense est li une zone du cerveau responsable
dune sensation de plaisir quand elle est stimule. Lindividu va ensuite rechercher
reproduire ce stimulus pour prouver nouveau ce plaisir.
Chapitre 2. Sexualit et procration

04732841_156-224.indd 183

183

20/07/11 09:18

Lacte sexuel stimule des zones rognes et active les circuits de la rcompense dans
le cerveau; on prouve donc une sensation de plaisir. Les individus vont chercher
reproduire cette sensation de plaisir, donc vont reproduire lacte sexuel. La recherche
de plaisir conduit donc vers laccomplissement de lacte sexuel.
Doc. 3: La dopamine est lie une sensation de plaisir, sa libration par les circuits
de rcompense est en effet responsable du dclenchement de cette sensation.
Un nouveau stimulus dclenche une production de dopamine, donc un certain plaisir. En revanche, un stimulus connu est anticip, cest--dire que le plaisir est ressenti
avant le stimulus lui-mme car le sujet reconnat la situation.
Une stimulation des organes gnitaux dclenche une sensation de plaisir, donc une
libration de dopamine. Le sujet va donc rechercher reproduire ce plaisir et reproduira les situations permettant de produire de la dopamine.
Doc. 4: Le comportement sexuel est sous leffet de diffrents facteurs. Parmi ceuxci, on trouve la production dhormones sexuelles, la captation de phromones mises
par le partenaire ou linfluence du contexte social et culturel. Chez lHomme, le cerveau, complexe, donne une part prpondrante aux facteurs cognitifs. Le comportement
sexuel nest donc plus dirig par les hormones et les phromones, mais plutt par une
recherche de plaisir et de relationnel. La reproduction nest donc plus la seule finalit
de lacte sexuel, ni mme la principale; cest pour cela que le qualificatif de comportement rotique remplace celui de comportement reproducteur chez lHomme.

Synthse : rponse au problme rsoudre


Le systme de rcompense est responsable dune sensation de plaisir quand il est stimul. Lacte sexuel est responsable de la lactivation de ce systme, et lHomme cherchera reproduire ce plaisir. Il y a donc bien un lien fort entre lactivation du systme
de rcompense et le dclenchement dun acte sexuel.

3. Ressources complmentaires
Site ressources Bordas: animation expliquant fonctionnement du systme de rcompense.
Lien vers un logiciel gratuit permettant de comprendre le fonctionnement du systme

de rcompense: http://svt.ac-dijon.fr/dyn/article.php3?id_article=270

184

Partie 4. Corps humain et sant

04732841_156-224.indd 184

20/07/11 09:18

Exercices

p. 274 277

La correction des exercices Tester ses connaissances figure la fin du manuel de


llve, pages 352 et 353.

6 PMA, thique et lgislation


a. Vrai. Cest la mre porteuse qui est reconnue comme seul parent.
b. Faux. Il y a ncessit dtre domicili au Royaume-Uni. Lenfant devra en outre
tre conu partir dau moins un des gamtes des deux parents.
c. Vrai. La lgalisation dune pratique dans un pays permet des parents franais de
recourir la gestation pour autrui dans ce pays. En revanche, lors du retour en France,
la reconnaissance par ltat des droits parentaux risque de poser problme.
d. Faux. En plus des problmes juridiques, se pose la question du statut du corps de
la femme. Doit-on autoriser la location de son corps par une mre porteuse?

7 Rgulation de la production de testostrone


Le document 1 montre que lajout de LH augmente la production de testostrone.
Cet ajout est en revanche sans effet si lon bloque artificiellement laction de la LH.
On en conclut donc que la LH stimule la production de testostrone par le testicule.
Le document 2 montre une production de LH par des rats castrs plus forte que pour
les rats tmoins. Comme les rats castrs ne produisent plus de testostrone, on suppose que celle-ci exerce un rtrocontrle ngatif sur lhypophyse.
Au final, lhypophyse mesure le taux de testostrone grce au rtrocontrle, une hausse
limite lactivit hypophysaire et donc la production de LH. Avec moins de LH, le testicule est moins stimul et produit moins de testostrone ; lcart est donc corrig.

8 La contraception hormonale sans pilule


En prsence dun anneau vaginal, le taux dstradiol est maintenu une valeur basse
et les follicules ovariens sont tous de petite taille. Les hormones de synthse contenues
dans lanneau exercent un rtrocontrle ngatif permanent sur lhypophyse. Celle-ci ne
produit donc presque plus de LH et de FSH ce qui maintient lovaire au repos: pas de
croissance folliculaire donc pas dovulation et peu dhormones ovariennes produites.

9 Le dclenchement de lovulation
1. La taille du follicule ovarien augmente fortement pendant le cycle (de 0,1 15 mm).
2. Plus un follicule est gros, plus il produit dhormones! Il est donc logique de voir
une augmentation du taux dstradiol en phase folliculaire.
3. Le document 2 montre que la production de LH par les cellules hypophysaires est
stimule par lajout de doses croissantes dstradiol. On voit galement que la prsence de GnRH est ncessaire cette production de LH. Ces observations mettent en
vidence lexistence dun rtrocontrle positif exerc par lstradiol sur lhypophyse
quand sa production est forte.
Bilan : quand le follicule est mr, il produit de grandes quantits dstradiol ; le rtrocontrle devient donc positif et lhypophyse augmente fortement sa production de LH.
Le pic de LH qui en dcoule dclenche lovulation.

Chaptire 2. Sexualit et procration

04732841_156-224.indd 185

185

20/07/11 09:18

Partie

chapitre

Variation gntique et sant


Activits pratiques

La mucoviscidose, un exemple de maladie gntique (p. 280-281)


Connaissances

Capacits et attitudes

La mucoviscidose est une maladie frquente, provoque


par la mutation dun gne qui est prsent sous cette forme
chez une personne sur 40 environ. Seuls les homozygotes
pour lallle mut sont malades.
Le phnotype malade comporte des aspects macroscopiques qui sexpliquent par la modification dune protine.
Ltude dun arbre gnalogique permet de prvoir le risque
de transmission de la maladie.

Recenser, extraire et organiser des informations pour


tablir le lien entre le phnotype macroscopique et le
gnotype.
tudier un arbre gnalogique pour valuer un risque
gntique.

1. Les intentions pdagogiques


Le programme demande de mettre en vidence le lien entre une altration du gnome
par mutation et le dveloppement dune maladie. Dans un premier temps, on aborde
ltude dun lien gntique absolu o la prsence des allles morbides se traduit systmatiquement par le dveloppement de la maladie. Lexemple de la mucoviscidose
trait ici est celui demand par le programme. On pourra utiliser les documents proposs pour dcrire les caractristiques de cette maladie aux diffrentes chelles: tout
dabord lchelle de lorganisme, celle de lorgane et de la cellule ensuite, enfin lchelle
molculaire avec la mutation sur lADN et sa consquence sur la protine produite.
Dans une deuxime partie, un arbre gnalogique simple permet dinitier les lves
au calcul de risque. Le professeur pourra traiter dautres exemples de maladies gntiques sil le souhaite, mais lexhaustivit dans ce domaine nest pas un objectif affich dans les programmes. En revanche, la dmarche qui consiste relier une anomalie de lADN des manifestations cliniques peut tre rinvestie sur une autre maladie
en utilisant lexercice 8 p. 299 qui traite de la phnylctonurie.
Le document 1 aborde la maladie avec ses manifestations cliniques. On part ainsi du
phnotype macroscopique, puis on va chercher expliquer ce phnotype laide des
niveaux cellulaire et molculaire. Lensemble des manifestations nest pas report ici,
on se contente des principales que sont les atteintes pulmonaires et digestives. Limportant est de comprendre le lien entre les deux: des cellules pithliales produisent un
excs de mucus, ce qui obstrue des canaux. On fait donc ici le lien entre lchelle
macroscopique et lchelle cellulaire.
Le document 2 passe au niveau cellulaire; la comparaison dune cellule pithliale
normale avec une cellule provenant dun malade permet de comprendre lorigine de
lanomalie: la protine CFTR. On passe ici de lchelle cellulaire lchelle molculaire. Comme la molcule incrimine est une protine, le lien avec lADN est ais.
186

Partie 4. Corps humain et sant

04732841_156-224.indd 186

20/07/11 09:18

Le document 3 boucle lexplication de la mucoviscidose avec des comparaisons de


squences dADN et de protines. Le professeur pourra sil le souhaite laisser les lves
dcouvrir ces anomalies et leurs consquences en utilisant les fichiers disponibles sur
le site ressources: il y trouvera les squences du gne et de la protine CFTR, ainsi
que les fichiers pdb du fragment de la protine CFTR comprenant la mutation.
Le document 4 propose un arbre gnalogique afin de calculer un risque de dvelopper la maladie. Llve trouvera les informations la disposition du mdecin gnticien qui ralise ce calcul : les antcdents familiaux reprsents par un arbre, les
conditions dexpression et la localisation de lallle mut et enfin la frquence de cet
allle dans la population normale.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:Le document 1 indique que les anomalies pulmonaires sont dues un
excs de production de mucus qui obstrue les bronches. On retrouve cela pour les anomalies digestives, mais, dans ce cas, ce sont les canaux pancratiques qui sont obstrus. Ce sont les cellules pithliales produisant ce mucus qui sont en cause. Plus prcisment, un canal permettant la sortie de chlore de la cellule nexiste plus pour les
personnes atteintes. Lorigine de la maladie est donc rechercher dans les protines
CFTR qui composent normalement ce canal.
Doc. 2 et 3: Il est not dans le document 2 que la protine CFTR dun patient atteint
de mucoviscidose compte un acide amin de moins quune protine CFTR normale.
Il est donc possible que cette anomalie modifie la forme 3D de la protine et rende
impossible laccomplissement de sa fonction. Le document 3 confirme labsence de
cet acide amin, en position 508. Il montre galement que cette absence est due une
mutation de lADN avec la dltion de trois nuclotides aux positions 1522 1524.
Doc. 4: Lenfant III.3 est malade et possde donc deux allles m (muts): il a en reu
un de chacun de ses deux parents. Comme ceux-ci sont sains, ils possdent un allle N
(normal) et sont donc htrozygotes (N/m). La probabilit pour un tel couple davoir
un enfant malade est de 1/4, ce qui est trs suprieur aux 1/4100 rencontrs pour la
population gnrale. III.1 et III.2 sont sains, ils ne pourront avoir un enfant malade
que sils sont tous deux htrozygotes. On ne connat pas les antcdents de III.1, on
considre donc quil a un risque de 1/32 dtre htrozygote. Pour III.2, on sait que
ses parents sont htrozygotes; le risque pour ce couple davoir un enfant sain htrozygote est de 2/3. Si le couple form par III.1 et III.2 est htrozygote, le risque
davoir un enfant malade sera de 1/4. La probabilit finale est donc de 1/32 2/3 1/4
soit 1/192. Le risque est plus faible que pour le couple prcdent, mais encore trs
suprieur aux 1/4100 de la population gnrale.

Synthse : rponse au problme rsoudre


Les patients atteints de mucoviscidose possdent deux allles muts pour le gne CFTR.
Leur expression donne une protine CFTR anormale, incapable dassurer sa fonction
de canal chlore dans la membrane des cellules pithliales. La consquence pour
ces cellules est une production excessive de mucus qui va obstruer certains conduits
comme les bronches ou les canaux pancratiques. Les patients montrent donc des difficults respiratoires et digestives.

Chapitre 3. Variation gntique et sant

04732841_156-224.indd 187

187

20/07/11 09:18

3. Ressources complmentaires
Site de lassociation vaincre la mucoviscidose qui contient de nombreuses ressources

concernant la maladie, les soins, et ltat des recherches:


http://www.vaincrelamuco.org/
Site de la fondation Lejeune consacr la thrapie gnique de la mucoviscidose:

http://www.genethique.org/doss_theme/dossiers/therapie_genique/acc.therapie.htm
Dossier thmatique de lINSERM sur la thrapie gnique de la mucoviscidose:

http://www.inserm.fr/thematiques/immunologie-hematologie-pneumologie/dossiers-dinformation/therapie-genique

188

Partie 4. Corps humain et sant

04732841_156-224.indd 188

20/07/11 09:18

Activits pratiques

Les traitements mdicaux de la mucoviscidose (p. 282-283)


Connaissances

Capacits et attitudes

On limite les effets de la maladie en agissant sur des


paramtres du milieu. La thrapie gntique constitue
un espoir de correction de la maladie dans les cellules
pulmonaires atteintes.

Recenser, extraire et organiser des informations pour


comprendre les traitements mdicaux (oxygnothrapie,
kinsithrapie) et les potentialits offertes par les thrapies
gniques.

1. Les intentions pdagogiques


Les traitements et perspectives de traitement qui sont prsents ici ne visent pas lexhaustivit. Ils donnent juste une ide de ce qui peut se faire et permettent aux lves de
comprendre les deux types de stratgies: corriger les problmes induits par lanomalie gntique et corriger lanomalie gntique elle-mme. Il est donc important avant
daborder cette partie que les mcanismes de la mucoviscidose aient t bien compris.
Pour aller plus loin, de nombreux sites utiles fournissent des dinformations complmentaires comme celui de lassociation vaincre la mucoviscidose.
Les documents 1 et 2 dcrivent les principaux soins et traitements que reoit quotidiennement un patient atteint de mucoviscidose. Ils sont relier aux anomalies pulmonaires et digestives constates sur les pages prcdentes. Un encadr dresse un
bilan de limpact de ces traitements sur lesprance de vie des malades. Il sera utile
de chercher actualiser ces donnes pour montrer leur volution au cours des annes
avec les progrs de la mdecine. On pourra utiliser pour cela le registre franais de
la mucoviscidose dit tous les ans par lassociation vaincre la mucoviscidose
pour prsenter ltat de la maladie en France.
Le document 3 dcrit succinctement le principe de la thrapie gnique. Il pourra tre
complt selon le choix du professeur par des recherches documentaires pour dtailler
ce principe ou chercher les dernires avances dans ce domaine. Des liens utiles sont
prsents cette fin sur le site ressources.
Le document 4 dcrit deux des nombreuses tudes concernant la thrapie gnique de
la mucoviscidose. On peut, laide de ces documents, montrer une certaine russite
de ces exprimentations et mesurer le chemin restant parcourir. Encore une fois, des
recherches documentaires permettront dactualiser ces donnes.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: Chez les patients atteints de mucoviscidose, les bronches sont encombres par du mucus. La kinsithrapie respiratoire et ladministration de mdicaments
fluidifiants cherchent liminer cet excs de mucus. Les traitements antibiotiques permettent dviter le dveloppement dinfections bronchiques.
Les canaux pancratiques bouchs empchent la libration des enzymes pancratiques
dans le tube digestif; des complments contenant ces enzymes sont donc prescrits aux
patients pour faciliter lassimilation des graisses.
Doc. 3: Un fragment dADN contenant lallle normal du gne dficient est insr
dans un vecteur (par exemple un virus). Celui-ci a comme rle de transporter ce fragChapitre 3. Variation gntique et sant

04732841_156-224.indd 189

189

20/07/11 09:18

ment dans les cellules atteintes et de faciliter son intgration puis son expression. La
cellule va donc possder un nouvel exemplaire du gne CFTR dans son gnome, et
lexpression de ce gne donnera une protine CFTR fonctionnelle. La production
excessive de mucus par les cellules pithliales est donc stoppe.
Doc. 3 et 4: Les patients traits expriment bien le gne transfr, et le niveau dexpression est suprieur au seuil jug minimal pour corriger lanomalie. Le problme est
que cette correction est limite dans le temps (les cellules ayant intgres le gne meurent et sont renouveles pas des cellules dpourvues du gne CFTR fonctionnel); il
faut donc envisager des administrations rgulires du vecteur pour maintenir le niveau
dexpression du gne CFTR un niveau satisfaisant. Ces administrations peuvent se
faire par arosols, une mthode simple ralisable par le patient sans aide mdicale.

Synthse : rponse au problme rsoudre


La prise en charge classique cherche limiter les effets de la maladie en liminant les
excs de mucus dans les bronches et en donnant des enzymes pancratiques en complment alimentaire. Malheureusement, ces techniques ne peuvent empcher une lente
dgradation de ltat du patient. On cherche donc en parallle mettre au point une
thrapie gnique. Un gne fonctionnel serait alors insr dans le gnome des cellules
pithliales qui pourraient lexprimer et ainsi produire un mucus normal. Ces techniques ne sont pas encore au point, mais des pistes prometteuses existent.

190

Partie 4. Corps humain et sant

04732841_156-224.indd 190

20/07/11 09:18

Activits pratiques

Maladies gntiques et facteurs environnementaux (p. 284-285)


Connaissances

Capacits et attitudes

Le plus souvent, limpact du gnome sur la sant nest pas Recenser, extraire et organiser des informations pour
un dterminisme absolu. Il existe des gnes dont certains identifier :
allles rendent plus probable le dveloppement dune
lorigine multignique de certaines maladies ;
maladie sans pour autant le rendre certain. En gnral les
linfluence des facteurs environnementaux ;
Comprendre que dterminer les facteurs gnmodes de vie et le milieu interviennent galement, et le
dveloppement dune maladie dpend alors de linteraction
tiques ou non dune maladie repose sur des mthodes
complexe entre facteurs du milieu et gnome.
particulires qui constituent les fondements de
Un exemple de maladie (maladie cardiovasculaire, diabte
lpidmiologie ;
de type II) permet dillustrer le type dtudes envisageables.
Comprendre les conditions de validits daffirmations concernant la responsabilit dun gne ou dun
facteur de lenvironnement dans le dclenchement
dune maladie.
Savoir choisir ses comportements face un risque
de sant pour exercer sa responsabilit individuelle ou
collective.

1. Les intentions pdagogiques


Considrer la mucoviscidose comme une maladie gntique va de soi pour un lve.
Il existe un allle malade, un allle normal et il suffit donc danalyser le gnome pour
savoir si lindividu est atteint ou pas. Pour des maladies comme les maladies cardiovasculaires ou le diabte de type 2, cela est moins vident. Dune part, le lien gntique nest pas absolu, dautre part, les gnes en cause sont souvent trs nombreux
et mal connus. Ltude du dterminisme de ces maladies passe donc par autre chose
quune simple comparaison de squences et ncessite une mthode nouvelle pour les
lves: lpidmiologie. Les documents proposs ici vont donc permettre tout dabord
de prciser les facteurs en cause dans le dclenchement de maladies cardiovasculaires
mais il dtaille les tapes des tudes pidmiologiques qui ont permis de produire les
donnes. Lobjectif est donc double: comprendre la dmarche, et conclure laide
des rsultats obtenus lissue de cette dmarche.
Le choix a t fait de ne prsenter ici que les maladies cardiovasculaires, limportant tant de comprendre la dmarche et la multiplicit des facteurs en cause. Ajouter
une maladie et les mcanismes ncessaires sa comprhension risque de compliquer
la tche. En particulier, les auteurs nont pas abord le diabte de type 2 (sauf dans
lexercice7 p.299) car il fait lobjet dune tude dtaille dans le programme de la
classe de Terminale Scientifique.
Le document 1, comme dit prcdemment, dcrit les tapes dune tude pidmiologique. Ces tapes fondamentales se retrouvent dans les diffrents types dapproches
utilises en pidmiologie. Limportant est de comprendre que lanalyse se fait sur la
base dune tude statistique de deux groupes dindividus slectionns.
Les rsultats obtenus montrent de faon claire que des facteurs gntiques et environnementaux ont une influence sur le dclenchement des maladies cardiovasculaires. Le choix de la
mort subite permet au professeur de partir des dfibrillateurs, installs de plus en plus souvent
dans les lieux publics, puis de questionner sur leur utilit. Cela offre une entre dans le thme.
Chapitre 3. Variation gntique et sant

04732841_156-224.indd 191

191

20/07/11 09:18

Le document 2 aborde ltape suivante dans la dmarche: une fois quun lien entre
une maladie et le gnome a t tabli, il reste identifier le ou les gnes en cause. On
pourra tablir des parallles avec la dmarche dcrite dans le document 1 (constitution de groupes, gestion statistique).
Le document 3 prsente ltape finale avec la vrification exprimentale de limplication dun gne dans le dclenchement dune maladie cardiovasculaire.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les sujets participant ltude sont tout dabord slectionns, puis une enqute
permet de dterminer dans quel groupe les placer. On les suit ensuite pour dterminer
si il y a un lien entre le facteur considr et la survenue dune maladie.
Le graphique de gauche montre que lexistence dantcdents familiaux de mort subite
multiplie par deux le pourcentage de dcs constats pour cette mme cause. On peut
donc penser une piste gntique pour le dclenchement de cette maladie. Le graphique de droite indique que le risque de dcs par mort subite augmente avec lIMC.
Lobsit est donc un facteur important dans la survenue de cette maladie.
Doc. 2: La recherche dun gne impliqu reprend des lments de la dmarche en
pidmiologie: constitution de deux groupes (avec antcdents et sans antcdents) et analyse statistique des rsultats. En revanche, cette fois, on examine les
squences en cherchant des fragments de squences qui se retrouvent plus frquemment chez les individus malades. Ces fragments doivent appartenir des gnes prdisposant cette maladie.
Doc. 3:Une hausse de lexpression du gne Galnt2 diminue le taux plasmatique de
HDL et inversement. Les protines HDL permettent de transporter le cholestrol jusquau
foie et viter quil ne se dpose sur les artres. Une baisse du taux de HDL peut donc
favoriser la formation de caillots sanguins et donc daccidents vasculaires. Il y a donc
bien un lien entre le gne Galnt2 et le risque de survenue de maladies vasculaires.

Synthse : rponse au problme rsoudre


La mise en vidence du lien entre un facteur (gntique ou environnemental) et une
maladie se fait par une tude pidmiologique. On constitue deux groupes, un seul des
deux tant concern par le facteur. Une analyse statistique du nombre de cas constat
dans les deux groupes permet de conclure sur la ralit de linfluence du facteur.

192

Partie 4. Corps humain et sant

04732841_156-224.indd 192

20/07/11 09:18

Activits pratiques

Une altration du gnome peut conduire au cancer (p. 286-287)


Connaissances

Capacits et attitudes

Des modifications accidentelles du gnome peuvent se


produire dans des cellules somatiques et se transmettre
leurs descendantes. Elles sont lorigine de la formation
dun clone cellulaire porteur de ce gnome modifi. La
formation dun tel clone est parfois le commencement
dun processus de cancrisation.

1. Les intentions pdagogiques


Le cancer est une maladie connue de tous, mais dont les mcanismes sont en fait mal
connus par les lves, voire pas du tout. Ces deux pages prsentent les grandes lignes
du processus de cancrisation. Comme souvent dans ce chapitre, on ne rentre pas trop
dans les dtails, lobjectif tant de montrer que la formation dune cellule cancreuse
est lie des mutations de lADN.
Le document 1 donne les tapes amenant la formation dune cellule cancreuse.
Lessentiel est de comprendre quune succession de mutations amne la cration de
cette cellule. Les tapes ne sont pas dtailles. On peut ici comprendre que la formation dune cellule cancreuse rpond un principe de slection naturelle qui sexerce
au sein des cellules dun organisme: les cellules porteuses de la mutation sont avantages donc simposent.
Le document 2 permet de montrer que les tumeurs reprsentent des clones, une mtastase forme partir dun tissu pulmonaire et qui se dveloppe dans un tissu hpatique
gardera des caractristiques de cellule pulmonaire. Il donne galement des rponses
des questions que les lves risquent de se poser : quest-ce quune mtastase ?
Quest-ce quune tumeur? Comment une tumeur peut provoquer la mort dun patient?
Le document 3 permet de vrifier limplication de mutations de certains gnes dans le
dveloppement de cellules cancreuses. Lexemple choisi est celui de la protine p53.
Cest un exemple classique, simple et donc facile illustrer de multiples faons. Ici, on
commence par montrer le lien qui existe entre ce gne et le dveloppement de cancers.
Le professeur trouvera sur le manuel numrique Bordas une vido 3D de la protine p53 et de son mode daction.
Le document 4 poursuit ltude du gne p53. Une fois que limplication du gne est
avre, on passe ltude des diffrents allles. Les squences proposes permettent
de comparer des cellules diffrentes. La comparaison entre diffrentes cellules cancreuses permet de comprendre que diffrentes mutations de ce gne existent; celle
de deux cellules cancreuses dun mme individu amne lide de clone cellulaire
porteur de la mutation.
Les fichiers permettant de comparer en classe les squences ou dobserver la molcule
p53 lie lADN sont disponibles sur le site ressources et le manuel numrique Bordas.

Chapitre 3. Variation gntique et sant

04732841_156-224.indd 193

193

20/07/11 09:18

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2: Le premier vnement est une mutation de lADN dune cellule pulmonaire. La cellule mute nest pas limine par le systme immunitaire et possde
un avantage par rapport aux autres cellules pulmonaires, ce qui lui permet de subsister et de se diviser. Dautres mutations continuent faire voluer ce nouveau tissu;
les cellules qui le composent deviennent immortelles, ne rpondent plus aux signaux
internes et se divisent activement sans aucun contrle. On a alors un clone de cellules
cancreuses formant une tumeur. Cette tumeur grossit, stimule le dveloppement de
vaisseaux sanguins pour venir lalimenter. Des cellules cancreuses peuvent alors se
dtacher de la tumeur primaire et circuler par le systme sanguin. Elles iront se fixer
dans un autre organe et tre le point de dpart dune tumeur secondaire ou mtastase.
Doc. 3: Le graphique montre que lexpression du gne p53 est responsable de la disparition de la tumeur chez des souris. Le qualificatif de suppresseur de tumeur est
donc justifi.
Doc. 4: Toutes les cellules cancreuses sont porteuses dune mutation du gne de la
p53. On peut donc supposer que ces mutations rendent la protine p53 non fonctionnelle et favorise donc le dveloppement de tumeurs. On voit par ailleurs que les diffrentes cellules dune mme tumeur sont porteuses des mmes mutations, une tumeur
reprsente donc un clone de cellules cancreuses (toutes identiques).

Synthse : rponse au problme rsoudre


Les cellules somatiques subissent continuellement des mutations au niveau de lADN.
La plupart sont limines par diffrents systmes, mais certaines subsistent et donnent au final une cellule cancreuse. Celle-ci ne rpond plus aux signaux de lorganisme et se divise activement pour former une tumeur. La mutation de gnes impliqus dans llimination de telles cellules comme celui de la p53 favorise ce processus
de cancrisation.

3. Ressources complmentaires
Manuel numrique Bordas: Vido Modlisation tridimensionnelle de la protine p53,

suppresseur de tumeurs.

194

Partie 4. Corps humain et sant

04732841_156-224.indd 194

20/07/11 09:18

Activits pratiques

La cancrisation, un processus complexe (p. 288-289)


Connaissances

Capacits et attitudes

Des modifications somatiques du gnome surviennent par


mutations spontanes ou favorise par un agent mutagne.
Dautres sont dues des infections virales.
La connaissance de la nature des perturbations du
gnome responsable dun cancer permet denvisager des
mesures de protection (vitement des agents mutagnes,
surveillance, vaccination).

Recenser, extraire et organiser des informations pour


identifier lorigine des facteurs de cancrisation (agents
mutagnes, infections virales).
Comprendre les causes multiples pouvant concourir au
dveloppement de certains cancers (cas des cancers pulmonaires) et identifier des mesures de prvention possibles.
Comprendre limportance, en matire de sant publique,
de certains virus lis la cancrisation (hpatite B, papillomavirus) et connatre les mthodes de prvention possibles.

1. Les intentions pdagogiques


La dfinition des mutations et des facteurs mutagnes a t aborde dans un autre
chapitre, on peut donc se contenter ici de rinvestir ces connaissances et de travailler
seulement sur la nature des facteurs mutagnes responsables des cancers prsents.
Il sera galement important de montrer les origines plurifactorielles de ces cancers
et de ne pas laisser penser que les facteurs illustrs par les documents sont les seuls
exister. Pour laction des virus, les programmes officiels imposent les exemples du
papillomavirus et de lhpatite B qui ont dj t abords dans le chapitre prcdent
traitant des IST. Le choix a t fait de ne traiter ici que lexemple du papillomavirus
pour bien en dvelopper les mcanismes et les implications.
Les documents 1 et 2 prsentent trois facteurs jouant un rle dans les cancers pulmonaires. Le choix a t fait de donner le facteur gntique et deux facteurs environnementaux parmi les plus classiques. On peut donc ainsi arriver la notion de dclenchement plurifactoriel pour ces cancers. Les tudes prsentes reprennent la dmarche
pidmiologique vue prcdemment. Le premier graphique concernant les antcdents
familiaux est loccasion de dvelopper un regard critique vis--vis des rsultatsobtenus. Limpact du gnome ne peut tre tabli avec assurance que pour les cancers prcoces, et les lves devront comprendre que les rsultats obtenus ne donnent pas toujours des rsultats positifs.
Le document 3 fait le lien avec un autre type de facteur que sont les infections virales.
Il sagit dune tude pidmiologique facile interprter pour tablir ce lien.
Le document 4 poursuit ltude de linfluence des infections papillomavirus. Le lien
est tabli et va maintenant tre expliqu en montrant laction du virus sur la protine
p53. Un parallle est donc tabli avec ce qui a t abord sur ce sujet page 287 et le
professeur pourra mme choisir de traiter le rle de la p53 en partant de lexemple
du papillomavirus.
Le document 5 termine sur cette thmatique en traitant du dpistage.

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1 et 2:On voit que le risque de dvelopper un cancer pulmonaire est peu prs
le mme que lon ait des antcdents familiaux ou pas. En revanche, un cas de cancer
Chapitre 3. Variation gntique et sant

04732841_156-224.indd 195

195

20/07/11 09:18

prcoce chez un parent proche multiplie par 5 le risque den dvelopper un soi-mme.
Il y a donc sans doute une part gntique dans le dclenchement des cancers pulmonaires. Les deux autres tudes montrent que lexposition des fumes de tabac ou
un air pollu augmentent considrablement le risque de dvelopper ce type de cancer.
Il y a donc de multiples facteurs favorisant la formation dun cancer pulmonaire, mais
aucun ninduit ce dveloppement de faon obligatoire, ils ne font quaugmenter le risque.
Doc. 3 et 4: Plus de 80% des femmes ayant dvelopp un cancer du col de lutrus
montrent une infection par le papillomavirus contre moins de 20% pour les autres.
Il y a donc bien un lien entre une infection par le papillomavirus et le dveloppement
dun cancer de lutrus. On voit sur le document 4 que des protines virales dtruisent
les protines p53. Or, on a vu prcdemment le rle protecteur de cette protine contre
la formation de cellules cancreuses.
Doc. 5: Le dpistage des infections par le papillomavirus permettent de reprer les
femmes prsentant un risque accru de cancer du col de lutrus. Elles pourront tre
suivies attentivement pour rechercher la prsence de cellules anormales indiquant un
cancer dbutant. Ces dpistages et la prise en charge prcoce des cancers a permis de
faire reculer le nombre de dcs de faon importante depuis une trentaine dannes.

Synthse : rponse au problme rsoudre


De nombreux facteurs agissent sur le dveloppement des cancers; leur point commun
est cependant de ntre ni ncessaires ni suffisants pour ce dveloppement. Ils ne font
quaugmenter le risque. Parmi ces facteurs, on trouve des facteurs gntiques, mais
surtout de nombreux facteurs environnementaux comme le tabagisme, la pollution
atmosphrique ou linfection par certains virus comme le papillomavirus.

3. Ressources complmentaires
Manuel numrique Bordas:

Fiche documentaire Papillomavirus et cancer: comment sen protger?


Site ressources Bordas: ressource sur les modes de prvention contre le papillomavirus.
Site de lInstitut National du Cancer :

http://www.e-cancer.fr/
Site de lInstitut Gustave Roussy :

http://www.igr.fr/fr/page/les-cancers_95

196

Partie 4. Corps humain et sant

04732841_156-224.indd 196

20/07/11 09:18

Activits pratiques

La rsistance bactrienne aux antibiotiques (p. 290-291)


Connaissances

Capacits et attitudes

Des mutations spontanes provoquent une variation


gntique dans les populations de bactries. Parmi ces
variations, certaines font apparatre des rsistances aux
antibiotiques.
Lapplication dun antibiotique sur une population bactrienne slectionne les formes rsistantes et permet leur
dveloppement. Lutilisation systmatique de traitements
antibiotiques peut augmenter la frquence des formes
rsistantes par slection naturelle.

Concevoir et mettre en place un protocole permettant


de montrer la sensibilit de microorganismes diffrents
antibiotiques.
Recenser, extraire et organiser des informations pour :
identifier la sensibilit ou la rsistance de microorganismes diffrents antibiotiques
calculer le taux dapparition de rsistances dans une
population.
Comprendre, sur un exemple, lapplication du raisonnement volutionniste en matire mdicale.

1. Les intentions pdagogiques


La notion dantibiotiques et leur rle ont normalement dj t abords en classe
de Troisime. Mme si un rappel de ces dfinitions nest pas inutile, on cherchera
davantage ici montrer un effet pervers de lutilisation de ces molcules en mdecine avec lapparition de formes de rsistance. Cest loccasion de rinvestir galement
les notions vues en classe de Seconde et de Troisime sur les mcanismes de slection naturelle. Ltude des documents prsents sur ces deux pages peut tre complte, selon le choix du professeur, par des comparaisons de squences ou la ralisation
dun antibiogramme; il pourra pour cela utiliser lexercice10 p. 301. Les squences
ainsi quun diaporama dcrivant les tapes de la ralisation de lantibiogramme sont
sur le manuel numrique Bordas.
Le document 1 permet de rattacher la rsistance bactrienne aux antibiotiques une
mutation dun gne.
Le document 2 relie ensuite le dveloppement dune population rsistante une slection naturelle des porteurs de la mutation.
Les documents 3 et 4 font enfin le lien entre les pratiques mdicales de ces dernires
dcennies et le dveloppement de formes rsistantes. Le cas des bactries super-rsistantes est loccasion de faire rflchir les lves sur les consquences dans le futur
court, moyen et long terme (voir aussi Pour aller plus loin, p. 296).

2. Les pistes de travail


Informations dduites de lanalyse des documents
Doc. 1: Les bactries produisent des enzymes capables de dtruire certains antibiotiques. Une mutation du gne de cette enzyme peut lui permettre de dtruire de nouvelles molcules antibiotiques. La bactrie dveloppe donc une nouvelle rsistance.
Doc. 2: Les mutations se font au hasard. Si un antibiotique est ajout au milieu de vie
de bactries, seules celles possdant la mutation survivront. Elles vont donc se multiplier et lensemble de la population devient rsistante lantibiotique.
Doc. 3: On voit une bonne correspondance entre la consommation des antibiotiques
qui est multiplie par 4 en 10 ans et le pourcentage de formes rsistantes qui varie
Chapitre 3. Variation gntique et sant

04732841_156-224.indd 197

197

20/07/11 09:18

dans les mmes proportions. Cest donc lutilisation importante des antibiotiques en
mdecine qui est responsable de laugmentation des formes rsistantes.
Doc. 4: Les souches bactriennes rsistantes se multiplient et lon voit apparatre des
bactries contre lesquelles trs peu dantibiotiques savrent rester efficaces. Il est donc
important de limiter au maximum lemploi de ces molcules pour viter de continuer
slectionner les formes rsistantes dans lavenir.

Synthse : rponse au problme rsoudre


Cest un principe de slection naturelle qui explique lapparition de bactries rsistantes aux antibiotiques. Lutilisation de ces molcules en mdecine constitue une
pression slective qui slectionne les souches porteuses de mutations leur permettent
de rsister. Les populations voluent donc et risquent de rsister toutes les molcules disponibles dans lavenir.

3. Ressources complmentaires
Manuel numrique Bordas:

DiaporamaRalisation dun antibiogramme;


Fiche documentaireLes bactries font de la rsistance.

198

Partie 4. Corps humain et sant

04732841_156-224.indd 198

20/07/11 09:18

Exercices

p. 298 301

La correction des exercices Tester ses connaissances figure la fin du manuel


de llve, page 353.

6 La dmarche pidmiologique
a. Faux. On ne prend pas le risque de rendre malades des personnes en les exposant
volontairement un composant suspect dangereux. On regarde donc dans le pass
et les habitudes alimentaires de ces personnes pour voir sils ont t exposs au composant A ou non.
b. Vrai. Cette dmarche remplace celle propose en a.
c. Vrai. Il faut veiller ne faire varier quun seul facteur entre les deux groupes, sinon
linterprtation risque dtre fausse.
d. Faux. Des cas de cancers peuvent apparatre sans influence de facteur mutagne.
On va donc plutt regarder la diffrence du nombre de cas entre les deux groupes.
e. Faux. Le groupe expos montre un nombre de cas de cancers identique au groupe
non expos, mais leffectif total est deux fois plus petit. Le calcul du pourcentage
donne 7 % pour le groupe expos et 2,6 % pour le groupe non expos. On voit
donc bien un risque plus important en cas dexposition au composant alimentaire A.

7 Le diabte de type 2
1. Le tableau met en vidence un risque lev de dveloppement dun diabte de type2
si un membre de la famille proche est atteint. On suppose donc que des allles partags par les frres et surs sont responsables de ce risque plus lev. Lorigine gntique du diabte de type 2 est mise en vidence par cette tude.
2. Le graphique montre que le risque de dvelopper un diabte de type 2 augmente
de faon rgulire avec lIMC des individus. Un mode de vie sdentaire, une alimentation trop riche en sucres et en graisses, favorisent donc lobsit, elle-mme lie
un risque lev de dveloppement de diabte de type 2.

8 La phnylctonurie
1. Comme le dveloppement nerveux ne se fait pas normalement chez les sujets atteints,
il parat intressant de proposer le test de dpistage des nourrissons, pour pouvoir
mettre en place un traitement le plus rapidement possible en cas de test positif.
2. Les parents du ftus 2 ont dj eu un enfant malade, ils sont donc tous les deux
porteurs de lallle malade. Comme celui-ci est rcessif, III.2 et III.3 sont tous deux
htrozygotes. Le ftus 2 a une chance sur 4 dtre atteint avec des parents htrozygotes.
III.7 est extrieur la famille et na pas dantcdents familiaux connus, il a donc une
probabilit de 1/60 dtre htrozygote. Son pouse a des frres et surs malades, elle
a donc des parents htrozygotes. Elle a donc 2 chances sur 3 dtre htrozygote le
calcul final donne 2/3 1/60 1/4 soit 1/360.
3. Dans les deux cas, le risque est suprieur aux 1/16 000 de la population gnrale.

Chapitre 3. Variation gntique et sant

04732841_156-224.indd 199

199

20/07/11 09:18

9 Lvolution de lesprance de vie aux tats-Unis


Le premier graphique montre une progression parallle de lesprance de vie en
France et aux tats-Unis jusque vers les annes 1980. partir de cette date, la pente
pour les tats-Unis sinflchit et lon observe mme un dbut de baisse sur les dernires annes. Lobsit peut tre mise en cause car on voit une proportion de personnes en surpoids ou obses presque trois fois plus forte aux tats-Unis. Les habitudes alimentaires en sont la cause.
Le dernier graphique montre un lien existe entre lobsit et le risque de survenue dun infarctus du myocarde: il est presque trois fois plus fort en cas dobsit
extrme. On peut donc supposer que la baisse de lesprance de vie aux tats-Unis
peut sexpliquer par un taux dobsit trs lev, responsable de maladies comme les
maladies cardiovasculaires.

200

Partie 4. Corps humain et sant

04732841_156-224.indd 200

20/07/11 09:18

Partie

chapitre

La vision : de la lumire
au message nerveux
Activits pratiques

Le cristallin : une lentille vivante (p. 304-305)


Connaissances

Capacits et attitudes

Le cristallin est lun des systmes transparents de lil


humain. Il est form de cellules vivantes qui renouvellent
en permanence leur contenu. Les modalits de ce renouvellement sont indispensables sa transparence.
Des anomalies de forme du cristallin expliquent certains
dfauts de vision. Avec lge sa transparence et sa souplesse
peuvent tre altres.

Recenser, extraire et organiser des informations et/ou


manipuler (dissection, maquette et/ou recherche documentaire) pour :
localiser et comprendre lorganisation et le fonctionnement du cristallin ;
comprendre certains dfauts de vision.

1. Les intentions pdagogiques


Lobjectif de cette activit est trs prcis et bien exprim par le programme : en effet,
le fonctionnement optique de lil est dsormais du ressort du programme de sciences
physiques. Il sagit donc uniquement de montrer que, malgr son apparente homognit et sa transparence, le cristallin est nanmoins un organe vivant. Ses particularits seront loccasion de rinvestir des connaissances sur le fonctionnement cellulaire
vu auparavant (cycle cellulaire, expression gntique, etc.). En aucun cas il ne sagit
donc dexpliquer ici la formation dune image par lil : ce doit tre fait en cours de
physique. Il en sera de mme des dfauts purement optiques de la vision (myopie,
hypermtropie) qui sont galement du ressort de lenseignement de sciences physiques.
Comme le prcise lintroduction du programme, le programme de sciences de la vie
et de la Terre fait le choix daborder une palette de thmes varis et, par consquent,
accepte de ne pas trop les approfondir . Il convient donc de ne pas trop sappesantir sur ce premier aspect de la vision : cest pourquoi les auteurs proposent de ne pas
sattarder sur une tude anatomique de lil. On trouvera, en ouverture du chapitre,
page 302, une photographie et un schma qui permettent de sinterroger sur le rle
des diffrentes structures constituant lil.
Pour ceux qui le souhaitent, la version numrique du manuel propose une vido prsentant la dissection de lil de buf.
Demble, le document 1 prsente les particularits anatomiques et fonctionnelles
du cristallin : on trouvera dans cette prsentation des caractristiques communes
tout organe vivant, mais aussi des particularits, en lien notamment avec la transparence du cristallin. Le processus daccommodation est brivement dcrit : lexercice7,
page321 permet ventuellement daller un peu plus loin (on comprend alors pourquoi
Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 201

201

20/07/11 09:18

la contraction du muscle ciliaire produit paradoxalement un relchement du cristallin


et une augmentation de sa vergence).
Le document 2 se situe lchelle cellulaire : il montre quelques particularits structurales, ultrastructurales et fonctionnelles des cellules du cristallin. Il ne sagit pas de
faire une tude exhaustive et approfondie des cellules du cristallin et de leur fonctionnement, mais de mettre en relation certains aspects de ce fonctionnement avec la proprit essentielle du cristallin qui est sa transparence.
Le document 3 permet de rinvestir des connaissances sur la vie cellulaire abordes
dune faon gnrale dans la premire partie du programme de Premire S : cycle cellulaire, expression de linformation gntique notamment. Les informations apportes
par ce document permettent llve de trouver lexplication certains phnomnes :
on comprend en effet que le cristallin fonctionne sur les mmes grands principes que
toute cellule (mitose, expression dune information gntique, renouvellement du
contenu cellulaire) mais selon des modalits trs particulires. La photographie exceptionnelle propose ici peut tre relie celle du document 2 : on comprend comment
on peut passer dune cellule banale nucle (reprable dans lassise externe antrieure
du cristallin) de longues cellules en rubans, arques et anucles.
Les anomalies de la vision prsentes par le document 4 (presbytie et cataracte) sont
les seules qui peuvent tre associes une perturbation du fonctionnement biologique
du cristallin (rappelons que myopie et hypermtropie sont dues des phnomnes purement gomtriques lis en gnral la profondeur plus ou moins importante de lil).
Dans le cadre dune dmarche dinvestigation ou dune tche complexe, lensemble
des documents de cette page fournit tous les lments pour comprendre et expliquer
presbytie et cataracte, deux dfauts trs courants de la vision.
La version numrique du manuel propose une animation expliquant le phnomne de
presbytie et sa correction.
On trouvera page 319, Des cls pourmieux comprendre lhistoire des arts , une
relation intressante entre lvolution de la peinture de Monet et la cataracte dont le
peintre a t atteint.
La page 318, Des cls pour aller plus loin , prsente les techniques modernes du
traitement des dficiences du cristallin (implant notamment). Elle pourra donc complter cette premire approche.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 : La fonction du cristallin est de laisser passer la lumire venant de lextrieur
de lil, en assurant une convergence des rayons lumineux. Le degr de vergence du
cristallin est variable, ce qui permet laccommodation, cest--dire la mise au point
dune image nette sur la rtine lors de la vision dobjets rapprochs.
Doc. 2:
Forme paralllpipdique, en ruban , perpendiculaire au trajet des rayons lumineux pas de dispersion ;
Cellules sans organites, sans noyau, protines en rseau cristallin, cytoplasme sous
forme de gel transparence ;
Nutrition partir de nutriments solubles transmis par diffusion (pas de capillaires
sanguins) transparence.
Doc. 2 et 3 : Les cellules du cristallin ont une vie qui repose sur les mmes principes
que ceux qui rgissent la vie de toute cellule : mtabolisme exploitant des nutriments
202

Partie 4. Corps humain et sant

04732841_156-224.indd 202

20/07/11 09:18

fournis aux cellules, mitoses, expression dun programme gntique, renouvellement


du contenu cellulaire. Cependant, les modalits de ce fonctionnement sont trs particulires :
lapport des nutriments ne se fait pas par les capillaires sanguins mais par simple
diffusion partir de lhumeur aqueuse ;
linformation gntique est exploite au dbut de la vie cellulaire puis le noyau est
limin, ce qui explique la transparence du contenu cellulaire mais aussi les capacits limites quont ces cellules pour se rparer ;
enfin, les cellules du cristallin se distinguent par leur exceptionnelle longvit.
Doc. 4 : La presbytie sexplique par un vieillissement normal des cellules du cristallin. En effet, laccommodation ncessite une trs bonne lasticit des cellules du cristallin. Comme ces cellules ne sont pas renouveles, il est comprhensible que cette
lasticit diminue avec lge.
Les cellules du cristallin ne se renouvellent pas et perdent rapidement leur noyau : elles
ne pourront donc plus exploiter linformation gntique pour remplacer des protines
dficientes par exemple. Ainsi, contrairement aux autres tissus, les lsions subies par
le cristallin et qui peuvent altrer sa transparence sont difficilement rpares.

Synthse : rponse au problme rsoudre


Les cellules du cristallin sont dpourvues de noyau et dautres organites et leur cytoplasme est parfaitement transparent. Elles laissent donc passer la lumire. Elles ont une
forme trs allonge et sont agences en un ensemble biconvexe qui assure la convergence des rayons lumineux. Leur lasticit permet une modification de la forme gnrale du cristallin et donc laccommodation.

3. Ressources complmentaires
Manuel numrique Bordas :

vido de la dissection de lil de buf;


animation expliquant le phnomne de presbytie et sa correction.

Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 203

203

20/07/11 09:18

Activits pratiques

La rtine : une mosaque de photorcepteurs (p. 306-307)


Connaissances

Capacits et attitudes

La rtine est une structure complexe qui comprend les


rcepteurs sensoriels de la vision appels photorcepteurs.
Celle de lHomme contient les cnes permettant la vision
des couleurs (trois types de cnes respectivement sensibles
au bleu, au vert et au rouge) et les btonnets sensibles
lintensit lumineuse.

Extraire et exploiter des informations (maquette, logiciel


et/ou recherche documentaire et/ou observations microscopiques) pour :
comprendre lorganisation de la rtine ;
dterminer le rle des photorcepteurs.

1. Les intentions pdagogiques


Cette activit permet de comprendre le rle fondamental jou par la rtine dans la
vision. Ce sera loccasion de dcouvrir larchitecture de la rtine et les deux catgories de photorcepteurs qui la constituent. Leur rle de rcepteur sensoriel (gense
dun signal nerveux en rponse un stimulus) sera mis en vidence.
Le document 1 prsente une belle observation microscopique de la rtine : cette microphotographie pourra complter des observations microscopiques faites par les lves
eux-mmes. Lobjectif est dabord de constater que la rtine est bel et bien un tissu
nerveux, constitu de neurones : trois couches principales de neurones sont identifiables. En leur sein, la couche la plus externe prsente des cellules trs particulires,
sensibles la lumire : ce sont les photorcepteurs, cnes et btonnets. Bien entendu,
on observe bien moins de fibres et de connexions nerveuses que de corps cellulaires :
il faut faire comprendre quune coupe trs fine a t ralise et que si cette coupe
passe par un grand nombre de corps cellulaires, il est beaucoup plus rare que le plan
de coupe contienne des fibres sur une grande longueur.
Le schma permet dtablir la correspondance avec la photographie et de comprendre
les trajets inverses de la lumire et du message nerveux.
Le document 2 propose une spectaculaire observation des cnes et btonnets par
microscopie lectronique balayage (en fait, on nobserve ici que les segments terminaux de ces cellules). On pourra aussi exploiter la belle photographie douverture
de chapitre, page 303. noter que le diamtre des cnes est trs variable (ils sont
beaucoup plus gros dans la rgion priphrique de la rtine). Les deux encadrs permettent de trouver les informations essentielles concernant les caractristiques structurales des cnes et des btonnets qui tapissent la rtine.
Lintrt du document 3 est de confirmer le rle de rcepteur sensoriel, plus particulirement de photorcepteur, attribu aux cnes et aux btonnets. Dune faon plus
gnrale et sans aller trop loin, il sagit ici de bien faire comprendre que la vision est,
biologiquement, un phnomne nerveux. En effet, les photorcepteurs prsentent une
modification de leur potentiel lectrique quand ils sont soumis un stimulus lumineux.
On pourra signaler, sans entrer dans les dtails de la transduction, que cette proprit
est dpendante de la prsence dun pigment photosensible dans ces cellules. noter
que la rponse du photorcepteur varie en amplitude, en fonction de lintensit de la
stimulation, jusqu une certaine limite (saturation). On verra ultrieurement (page 313)
que le message nerveux prsente, lui, dautres caractristiques (variation en frquence).
204

Partie 4. Corps humain et sant

04732841_156-224.indd 204

20/07/11 09:18

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: Les cellules photorceptrices de la rtine sont les cnes et les btonnets.
Elles sont localises dans la couche cellulaire la plus externe de la rtine.
Doc. 1: Chaque photorcepteur est li un neurone bipolaire, lui-mme connect
un neurone ganglionnaire dont le prolongement cytoplasmique constitue une fibre du
nerf optique.
Doc. 3Cette tude montre que le cne ragit un stimulus lumineux par une variation
du potentiel lectrique de sa membrane. Cette cellule est donc sensible la lumire.
De plus, on constate que plus lintensit du stimulus est importante, plus la variation
du potentiel lectrique lest galement, jusqu une valeur qui semble tre maximale.
Doc. 1 3:La rtine est un tissu nerveux car elle est constitue dun ensemble de
cellules nerveuses interconnectes. Elle possde la proprit de ragir par une variation de potentiel lectrique une stimulation extrieure (ici la lumire), ce qui est une
proprit caractristique dun rcepteur sensoriel.

Synthse : rponse au problme rsoudre


Les cellules photorceptrices de la rtine constituent lassise cellulaire priphrique
de cette fine membrane. Ce sont de petites cellules, allonges et trs fines, renfermant un pigment photosensible et ragissant un stimulus lumineux par une variation de potentiel lectrique. Ces cellules sont connectes des neurones qui forment
les fibres du nerf optique.

3. Ressources complmentaires
Le cerveau tous les niveaux : les photorcepteurs :

http://lecerveau.mcgill.ca/flash/i/i_02/i_02_m/i_02_m_vis/i_02_m_vis.html

Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 205

205

20/07/11 09:18

Activits pratiques

Les rles complmentaires des photorcepteurs (p. 308-309)


Connaissances

Capacits et attitudes

La rtine est une structure complexe qui comprend les


rcepteurs sensoriels de la vision appels photorcepteurs.
Celle de lHomme contient les cnes permettant la vision
des couleurs (trois types de cnes respectivement sensibles
au bleu, au vert et au rouge) et les btonnets sensibles
lintensit lumineuse.
Des anomalies des pigments rtiniens se traduisent par
des perturbations de la vision des couleurs.

Extraire et exploiter des informations (maquette, logiciel


et/ou recherche documentaire et/ou observations microscopiques) pour :
comprendre lorganisation de la rtine ;
dterminer le rle des photorcepteurs.

1. Les intentions pdagogiques


Cette activit complte la prcdente : aprs avoir compris que la rtine est un tissu
nerveux tapiss dune multitude de cellules photosensibles et quil existe deux grands
types de photorcepteurs, il est logique de sinterroger sur leurs rles respectifs.
Le document 1 permet de constater la trs ingale rpartition des photorcepteurs
dans la rtine. Le graphique est accompagn dune schmatisation plat de cette
rpartition : noter que lon observe non seulement une variation de la densit relative
des deux types de photorcepteurs mais aussi une variation importante du diamtre
des cnes (les cnes de la fova sont beaucoup plus fins). Cette ingale rpartition
est rapprocher de la diffrence dacuit visuelle entre la vision centrale et la vision
priphrique. On tablit donc une premire relation entre les proprits de la vision
et la rpartition spatiale des diffrents photorcepteurs. La mise en relation du graphique montrant lacuit visuelle en fonction de lexcentricit et la densit des cnes
et btonnets conduit la comprhension de limportance de la fova dans la vision
diurne : la fova correspond la densit maximale des cnes, permettant la vision en
couleurs avec la meilleure acuit. Il faut bien faire comprendre que lessentiel de la
vision diurne implique cette zone restreinte de la rtine (do les consquences de la
DMLA, voir exercice 6 page 320).
Le document 2 exploite diffrentes informations concernant les proprits des diffrents photorcepteurs (notamment celles vues au cours de lactivit prcdente) : il
permet alors une comparaison de la vision nocturne et de la vision diurne. Comme la
vision nocturne fait appel aux btonnets, actifs seulement pour un faible clairement
et que ceux-ci ne permettent pas la perception des couleurs, cette dimension de la
vision du monde nest pas perceptible dans de telles conditions. Par ailleurs, ltude
de la rpartition des btonnets dans la rtine(doc.1), relie aux informations de ce
document, permet de montrer que la meilleure acuit visuelle nocturne est obtenue
quand les objets observs ne sont pas situs sur laxe optique. Cest pour une excentricit de 20 degrs que limage dun objet se forme sur la rtine dans la zone o elle
comporte la densit maximale des btonnets.
Cependant, ds que les conditions dclairement sont suffisantes, cest la vision diurne
impliquant les cnes qui est mise en uvre (les btonnets sont alors saturs et inoprants).
206

Partie 4. Corps humain et sant

04732841_156-224.indd 206

20/07/11 09:18

La complmentarit des deux types de photorcepteurs rtiniens est ainsi mise en vidence.
Avec le document 3, on approfondit le rle des cnes dans la vision des couleurs :
ceci permettra dune part de mieux comprendre limportance des pigments contenus dans les photorcepteurs, dautre part de prparer lactivit suivante qui fait le
lien entre la vision des couleurs et lvolution. Le rle des opsines est donc prcis
et matrialis par la comparaison de leur spectre dabsorption. Une tude de leurs
modles molculaires (une vido est propose dans la version numrique du manuel)
permet de constater la grande similitude de ces molcules. On comprend ensuite que
la vision des couleurs repose sur un dterminisme gntique : en, effet, on rinvestit ici les connaissances de la premire partie du programme sur la relation gne-protine. Ltude du daltonisme vient confirmer ce constat ; dans le cadre dune dmarche
dinvestigation, il est dailleurs tout fait possible de proposer comme objectif motivant cette activit la recherche de la cause du daltonisme. noter que le test propos
ici nest quune approche du test dIshihara qui comporte en ralit de nombreuses
mires. Dans le cas prsent, un daltonien deutranope (qui ne peroit pas le vert) ne
distinguera pas le chiffre 5.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: La vision centrale se fait au niveau de la fova, essentiellement garnie
de cnes. Ceux-ci tant peu sensibles, elle ncessite un plus fort clairement (vision
diurne). Du fait de la densit maximale des cnes, lacuit visuelle est excellente dans
ces conditions. Comme cette vision implique les diffrentes catgories de cnes, la
vision des couleurs est possible.
La vision priphrique fait, quant elle, appel aux portions de rtine situes en dehors
de la fova, plus riches en btonnets quen cnes. Du fait des caractristiques des
btonnets, la vision priphrique est donc possible mme si lclairement est faible
(vision nocturne) ; en revanche, la vision priphrique est peu prcise. Les btonnets
ne permettent pas de distinguer les couleurs (une seule sorte de photorcepteurs) et la
vision seffectue donc en nuances de gris .
Doc. 1 et 2: La lecture ncessite un bon clairement puisquelle est ralise par les
cnes (photorcepteurs ultra-majoritaires dans la fova), qui sont peu sensibles (moins
que les btonnets). Or, cette zone o la densit des cnes est maximale est de petite
taille : pour que limage du texte se forme continuellement sur cette zone, lil doit
suivre la ligne, mot mot en permanence, de faon trs prcise.
Doc. 3:En effet, chez une personne qui ne peut pas produire dopsine sensible au
vert, une radiation lumineuse verte ne pourra tre perue que par les cnes sensibles
au rouge. Comme le montre les spectres dabsorption, une radiation verte (ex. 525 nm)
sera absorbe avec la mme intensit par les cnes sensibles au rouge quune radiation rouge (ex. 625 nm). Ces deux couleurs seront donc perues de la mme faon.
Doc. 3:Il existe dautres anomalies de la vision des couleurs. Par exemple, dautres
formes de daltonisme sont dues labsence dopsine sensible au rouge ou labsence dopsine sensible au bleu (beaucoup plus rare). Dans tous ces cas, lensemble
des nuances colores ne sont restitues qu partir de deux sources au lieu de trois :
de ce fait, certaines couleurs sont perues de faon identique et sont donc confondues.
Lachromatopsie, due labsence totale dopsines, existe mais est rarissime : dans ce
cas, le sujet ne voit le monde quen nuances de gris.
Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 207

207

20/07/11 09:18

Synthse : rponse au problme rsoudre


Les cnes sont des photorcepteurs relativement peu sensibles la lumire mais permettant une vision trs prcise. Lexistence de trois types de cnes, renfermant des
pigments diffrents, permet une vision trichromatique des couleurs. La trs grande
densit des cnes dans la fova (rgion centrale de la rtine), permet la vision centrale
diurne (exigeant un bon clairement) que lon utilise par exemple au cours de la lecture.
Les btonnets sont beaucoup plus sensibles la lumire, mais ils ne permettent de
percevoir ni les dtails ni les couleurs. La prdominance des btonnets dans la rgion
priphrique de la rtine permet nanmoins une vision dans de faibles conditions
dclairement.

3. Ressources complmentaires
Manuel numrique Bordas :

fiche documentaire Un nouvel implant a permis unaveugle de dchiffrer des lettres et


des mots ;
fiches documentaires Une affection chronique, ladgnrescence maculaire lie lge
(DMLA) , John Dalton et le daltonisme ;
vido des trois modles molculaires des opsines.
Site ressources Bordas : modles molculaires des diffrentes opsines (fichiers pdb).
Les daltoniens , un site bien document sur ce sujet :

http://daltoniens.fr/
Le test dIshihara : explications compltes sur le site du Syndicat National

desOphtalmologistes de France (SNOF) http://www.snof.org/vue/couleurs4.html

208

Partie 4. Corps humain et sant

04732841_156-224.indd 208

20/07/11 09:18

Activits pratiques

Vision des couleurs et parent chez les primates (p. 310-311)


Connaissances

Capacits et attitudes

Les gnes des pigments rtiniens constituent une famille Extraire et exploiter des informations (maquette, logiciel
multignique (issue de duplications) dont ltude permet et/ou recherche documentaire et/ou observations microscopiques) pour faire le lien entre la vision des couleurs et
de placer lHomme parmi les primates.
lvolution.

1. Les intentions pdagogiques


Lobjectif de cette activit est de montrer que lon peut utiliser ce que lon sait des
modalits de la perception des couleurs comme mode dtablissement dune parent
entre lHomme et dautres espces animales. On montre ainsi que le concept dvolution repose sur des arguments bien tablis. Cest travers cette activit que lide
dune complexification des gnomes reposant sur la constitution de familles multigniques est aborde. Cette notion importante sera rinvestie en classe de Terminale : il
convient donc de ne pas ngliger cet aspect.
Le document 1 complte les informations tablies au cours de lactivit prcdente
concernant les bases gntiques de la vision des couleurs : la similitude apparente
entre les trois opsines ayant t tablie visuellement par lobservation des modles
molculaires, il apparait ncessaire de recourir dautres outils pour faire une comparaison plus prcise de la squence des acides amins des trois opsines humaines. On
peut, pour mener bien une telle activit, utiliser le logiciel Phylogne ou encore
Anagne (bien noter quil sagit ici dune matrice des diffrences). On rinvestit
alors les connaissances de la partie1 du programme sur la relation gne-protine : la
similitude des opsines traduit une similitude des gnes qui codent pour ces protines.
Le document 2 est purement explicatif et informatif : en effet, si lon peut tirer de
ltude prcdente un argument en faveur de lorigine commune des gnes codant pour
les diffrentes opsines, il serait vain de chercher en faire deviner le mcanisme. Nanmoins, ce document permet de mettre les lves en situation dactivit : en exploitant
le modle propos ici dune faon gnrale, il leur sera demand de lappliquer prcisment au cas de la famille multignique des opsines.
Avec le document 3, on sintresse au cas dautres espces de mammifres. Cette
premire approche, trs simple, consiste comparer les squences des allles du gne
codant pour lune des opsines pour quatre primates et un mammifre non-primate.
La comparaison des portions de squences montre la grande ressemblance entre les
espces de primates, et un moindre degr avec la Souris ; ces informations sont concordantes avec celles du tableau. On peut ainsi dores et dj regrouper lHomme avec
les autres primates (plus grande proximit quavec la Souris) et prciser la place de
lHomme au sein de ce groupe (trs grande proximit gntique avec le Chimpanz).
Le document 4 va un peu plus loin : en reliant les informations donnes ici avec ce
qui a t vu prcdemment (document 2 notamment), on met en vidence que certaines espces ont acquis un gne supplmentaire, celui de lopsine V, et donc quun
enrichissement du gnome a effectivement eu lieu au cours lhistoire volutive des primates, permettant la plupart dentre eux de bnficier dune vision trichromatique
(contrairement la plupart des mammifres non primates).
Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 209

209

20/07/11 09:18

Le document 5 est un arbre phylogntique simplifi des espces prsentes dans le


document 3. Les lves ont dj vu ce type darbre au collge en classe de 3e et sont
donc en mesure de lanalyser. La mise en relation des informations des documents 3
et 4 avec ce dernier document permet de raliser une synthse et de montrer la parent
entre les primates trichromates. La Souris et le Samiri tant dichromates, lacquisition
du gne de lopsineV peut donc tre situe aprs la divergence de la ligne du Samiri. LHomme est ainsi plac parmi les primates trichromates, comme le Macaque et
le Chimpanz (daprs les documents3 et 4) et possde une parent plus troite avec
ce dernier (comme les comparaisons du document3 le montrent).

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: Les pigments rtiniens (opsines) prsentent de grandes similitudes. La
squence de lopsine sensible au bleu prsente plus de 40 % didentit avec la squence
de lopsine sensible au rouge. Cette dernire possde plus de 95 % didentit avec celle
de lopsine au vert. Ces protines sont bien entendues codes par des gnes. Il serait
trs surprenant que de telles similitudes soient dues au simple hasard. Il est beaucoup
plus logique de faire lhypothse que ces gnes ont en fait une origine commune, ce
qui expliquerait alors lexistence de telles similitudes.
Les diffrences entre ces gnes peuvent alors facilement sexpliquer : lADN tant
relativement instable (voir Partie 1 chapitre 2), des mutations ponctuelles saccumulent au cours du temps, ce qui diffrencie peu peu ces gnes, initialement identiques.
Doc. 1 et 2: Le schma sera construit partir de celui du document 2.
Une premire duplication, sur deux chromosomes diffrents (7 et X), suivie de mutations ponctuelles aboutit au gne B et au gne R. Ensuite, une duplication du gneR,
cette fois-ci sur le mme chromosome (X), aboutira aprs mutations ponctuelles diffrencier le gne V.
Doc 2. et 4: Le document 2 propose un mcanisme denrichissement du gnome
partir dun unique gne ancestral. De fait, le document 2 montre que certaines espces
de primates possdent deux gnes codant pour deux opsines alors que dautres en ont
trois. On peut donc penser que la duplication gnique qui a dot certains primates dun
troisime gne codant pour lopsine verte sest produite au cours de lhistoire volutive des primates : tous les primates qui descendent du premier primate ayant bnfici de cette innovation sont donc dots dune vision trichromatique.
Doc 3. 5:Daprs le document 3, tous ces mammifres sont apparents car leur gne
qui code pour lopsine sensible au bleu prsente de grandes similitudes. Le degr de
similitude permet daffiner cette parent : ainsi, par exemple, on peut faire un regroupement des quatre espces de primates (trs nettement plus apparentes entre-elles
quavec la souris). Au sein de ce groupe, et pour la mme raison, cest le Chimpanz
qui apparat le plus troitement apparent avec lHomme. Le document 4 confirme et
prcise cette parent : parmi ces mammifres, trois espces seulement (le Macaque,
lHomme et le Chimpanz) ont une vision trichromatique (ils possdent en plus le gne
de lopsine sensible au vert) : elles sont donc plus troitement apparentes, comme le
montre cet arbre phylogntique.

Synthse : rponse au problme rsoudre


Ltude compare des pigments rtiniens chez les primates rvle de grandes similitudes. Cette similitude est un argument scientifique tablissant une troite parent entre
210

Partie 4. Corps humain et sant

04732841_156-224.indd 210

20/07/11 09:18

ces espces. Une tude plus prcise montre quil sest produit, au sein du groupe des
primates, un phnomne denrichissement du gnome, la base de la vision trichromatique qui caractrise lHomme et dautres primates. Ltude compare des pigments
rtiniens montre donc que la vision est bel et bien un produit de lvolution des espces.

3. Ressources complmentaires
Site ressources Bordas : squences nuclotidiques des gnes des opsines pour diffrentes

espces animales (fichiers exploitables avec Anagne ou GnieGen).

Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 211

211

20/07/11 09:18

Activits pratiques

De la rtine au cerveau (p. 312-313)


Connaissances

Capacits et attitudes

Le message nerveux issu de lil est achemin au cerveau Extraire et exploiter des informations (maquette, logiciel et/ou
par le nerf optique.
recherche documentaire et/ou observations microscopiques) pour comprendre lorganisation des voies visuelles.

1. Les intentions pdagogiques


Lactivit qui clt ce chapitre a pour but de montrer que la vision est effectivement
une fonction qui ncessite une activit nerveuse : il sagit donc de prsenter les voies
le long desquelles circulent les messages nerveux issus de la rtine et de montrer que
voir est une activit impliquant ncessairement une partie du cerveau. Il ne sagit ici
que dune premire approche. Le rle du cerveau dans la vision sera dtaill dans le
chapitre suivant.
Les auteurs proposent de commencer par montrer que la vision implique le cerveau :
ainsi la problmatique du lien entre rtine et cerveau et de la nature des messages circulant se trouvera clairement pose. Cette faon de procder sinscrit donc parfaitement dans une dmarche dinvestigation.
Les images du document 1 (obtenues par tomographie par mission de positons et
IRM) permettent de montrer lexistence dune spcialisation des rgions du cerveau,
et en particulier de localiser les aires visuelles au niveau occipital. Limage correspondant aux mots crits constitue une premire approche de la liaison entre vision et
langage qui sera dtaille dans le chapitre 5.
Le document 2 permet de prciser les informations tires du document 1. On y voit
que laire visuelle occipitale est une carte du champ visuel : chaque portion du
champ visuel (et donc de la rtine) correspond une partie du cortex visuel primaire. On
remarque de plus que la portion du champ visuel dont limage se forme sur la fova
est celle laquelle correspond la plus grande surface corticale. Ceci montre la liaison
entre la densit des photorcepteurs et la surface corticale correspondante. ce stade,
on se contentera de cette premire approche (cortex visuel primaire). Les rles plus
complexes des autres aires visuelles seront envisags au cours du chapitre 5.
Le trajet des voies visuelles est prsent sur le document 3. La mise en relation des
deux images, lune montrant le point aveugle de la rtine (et donc le dpart des fibres
nerveuses issues de la rtine), lautre montrant la suite des voies visuelles, permet de
bien visualiser la connexion entre les photorcepteurs rtiniens et le cortex occipital.
Lexistence du point aveugle (zone dpourvue de photorcepteurs) pourra tre
mise en vidence grce la clbre exprience de Mariotte (voir lexercice, page323).
Cest bien ce stade de ltude que la mise en vidence de cette particularit de la
rtine se justifie.
Le document 4 permet enfin une approche simplifie de la nature de linformation
circulant par les voies visuelles dcouvertes dans le document 3. Les messages nerveux sont de nature lectrique et sont cods en frquence. En premire approche, on
considrera quun stimulus lumineux engendre une salve de potentiels daction, la ra212

Partie 4. Corps humain et sant

04732841_156-224.indd 212

20/07/11 09:18

lit tant cependant bien plus complexe. En comparant un tel message avec la rponse
lectrique dun cne un stimulus nerveux (document 3 page 307), on peut dailleurs
constater, sans entrer dans les dtails, quun traitement du message nerveux a t ralis au sein mme de la rtine.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1:Limage obtenue par tomographie par mission de positons alors que lindividu lit des mots montre que larrire du cerveau ainsi quune zone situe sur la partie
arrire-droite sont actives. Ce sont les seules zones actives, et elles diffrent de celles
actives lors dune stimulation auditive. La vision est donc associe une activit de
rgions prcises du cerveau, qui apparaissent spcialises dans la fonction visuelle.
Doc. 2: La zone occipitale (arrire du cerveau) qui est active par des stimulations
visuelles (document 1) est une cartographie du champ visuel : chaque secteur de
ce cortex correspond une partie du champ visuel. Les zones du champ visuel correspondant la fova (la partie de rtine la plus riche en cnes) sont reprsentes
dans le cerveau par une zone trs tendue. On remarque que lhmisphre crbral
droit correspond au champ visuel gauche.
Doc. 2 et 3:Voir schma bilan page 317 : le champ visuel gauche est peru par les
deux moitis droites des rtines des deux yeux. Les messages nerveux partant de la
moiti droite de la rtine de lil gauche passent par les fibres du nerf optique gauche
et rejoignent les messages issus de la moiti droite de la rtine de lil droit et passant, elles par les fibres du nerf optique droit (jonction au niveau du chiasma optique).
Ces deux groupes de fibres sont ensuite relies au cortex occipital droit.
Doc. 4 : Le message transmis depuis la rtine est compos de signaux lectriques
dont le nombre est en relation avec lintensit de la stimulation : cest un message
nerveux. Les stimulus lumineux sont ainsi cods par la frquence des signaux constituant ce message nerveux.

Synthse : rponse au problme rsoudre


Le message visuel est transmis au cerveau sous la forme dun message nerveux (salves
de variations du potentiel lectrique des fibres nerveuses) qui cheminent le long des
nerfs optiques. Dans le cerveau, les voies visuelles se croisent en partie avant de
rejoindre la partie arrire du cerveau, dnomme cortex visuel. Larrive de ces messages dans cette partie du cerveau engendre une perception visuelle.

3. Ressources complmentaires
Manuel numrique Bordas : fiche documentaire Anton Rderscheidt (1892-1970) .
Le cerveau tous les niveaux, la vision :

http://lecerveau.mcgill.ca/flash/d/d_02/d_02_cr/d_02_cr_vis/d_02_cr_vis.html

Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 213

213

20/07/11 09:18

Exercices

p. 320 323

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, page 353.

6 La dgnrescence maculaire lie lge


La DMLA correspond une disparition progressive, plus ou moins rapide, des cnes
de la partie centrale de la rtine. En consquence, il se forme une tache noire dans le
centre du champ visuel. Inversement, le sujet est facilement bloui car la vision seffectue avec les btonnets, photorcepteurs trs sensibles la lumire. Le handicap est
trs important car le sujet ne peut, par exemple, plus lire (perte de la partie centrale du
champ visuel, trs mauvaise acuit de la vision priphrique, mauvaise perception des
couleurs). Cependant, la ccit ne sera pas totale car les btonnets ne sont pas atteints.

7 Le mcanisme de laccommodation
Dans la premire impression des spcimens, les quatre affirmations ont t numrotes dans lordre : a, b, d, c. Lordre normal (a, b, c, d) sera rtabli dans la rimpression du manuel destin aux lves.
a. Faux. En A, le muscle ciliaire est relch (diamtre plus grand).
b. Vrai. En B, le muscle ciliaire tant contract, les filaments diminuent leur traction et le cristallin prend sa forme naturellement plus bombe, donc plus convergent.
c. Vrai. En A, le relchement du muscle ciliaire provoque une tension des filaments
qui tire le cristallin. Celui-ci est donc moins bomb donc moins convergent.
d. Faux. En B, le muscle ciliaire est contract (diamtre plus petit).

8 Acuit visuelle et structure de la rtine


1. Dans la rgion de la fova, la rtine ne comporte que des cnes, en forte densit
(180000par mm2). Chaque cne est reli un neurone intermdiaire et finalement
une fibre du nerf optique.
En rgion priphrique, la trs grande majorit des photorcepteurs sont des btonnets (20fois plus de btonnets que de cnes). Le cblage stablit par convergence,
de telle sorte quune mme fibre du nerf optique transmet les messages issus de plusieurs btonnets.
2. Les cnes permettent une meilleure acuit visuelle. Dans la fova, leur nombre,
leur petite dimension et le cblage de la rtine permettent de transmettre au cerveau
des informations diffrentes pour des points trs rapprochs. En rgion priphrique,
la perception par les btonnets, moins nombreux, plus gros et convergents ne permet
pas une telle acuit visuelle : des points rapprochs donneront naissance un message finalement transmis par la mme fibre du nerf optique et ne seront donc pas distingus les uns des autres.

9 Le trajet des voies visuelles


1. Les lsions C et D suppriment toutes les voies nerveuses qui arrivent au cortex
visuel droit. Or, on constate dans ce cas une ccit du champ visuel gauche peru par
chacun des deux yeux. Le champ visuel droit, en revanche, est peru correctement.
Ainsi :
le cortex visuel de lhmisphre droit peroit le champ visuel gauche ;
le cortex visuel de lhmisphre gauche peroit le champ visuel droit.
214

Partie 4. Corps humain et sant

04732841_156-224.indd 214

20/07/11 09:18

2. Pour lil droit :


Une lsion en A se traduit par la ccit totale de lil droit : le nerf optique issu de
lil droit transmet donc tous les messages nerveux issus de lil droit.
Une lsion en B se traduit par une ccit partielle : le sujet ne peroit plus le champ
visuel droit peru par lil droit. Cela signifie que les fibres nerveuses de lil droit
qui peroivent cette partie du champ visuel (ct nasal de la rtine) ont t sectionnes.
Les lsions en C et D entranent une ccit partielle du champ visuel gauche. Cela
signifie que les fibres nerveuses issues de lil droit et correspondant la perception
du champ visuel gauche (ct temporal de la rtine) ont t sectionnes. En revanche,
le champ visuel droit, est peru correctement : cela signifie que ces sections nont pas
affect les fibres nerveuses issues de lil droit permettant de percevoir la partie droite
du champ visuel (ct nasal de la rtine de lil droit).
Ainsi, les fibres nerveuses issues de lil droit sont toutes regroupes dans le nerf
optique droit. Au niveau du croisement des nerfs optiques, la moiti des fibres nerveuses (celles correspondant la perception du champ visuel gauche, donc issues du
ct temporal de la rtine) restent dans la partie droite du cerveau. Lautre moiti,
celles correspondant la perception du champ visuel droit, donc issues du ct nasal
de la rtine) traversent la zone de croisement et rejoignent le cortex visuel de lhmisphre gauche.
Cest videmment linverse pour lil gauche.

10 Pigments rtiniens et parent entre espces


1. Cette comparaison rvle un degr de similitude important (suprieur 47%) de
la squence des acides amins de lopsine sensible au bleu entre toutes les espces. Si
on considre quune telle similitude ne peut tre due un simple hasard, cela signifie
quelle traduit une parent entre ces espces.
2. Une opsine est une de protine, elle est donc code par un gne. Du fait des nombreuses similitudes constates, il faut admettre que toutes ces espces ont hrit ce
gne dun anctre commun. Depuis, au cours de lhistoire volutive de chaque espce,
chaque gne a pu subir indpendamment des mutations ponctuelles, ce qui les diffrencie.
3. Puisque les diffrences constates sont dues des mutations ponctuelles accumules au cours du temps, on peut considrer que le taux didentits entre deux opsines
traduit le temps coul depuis la divergence entre les deux espces. Il est donc possible de prciser le degr de parent entre les espces : ici, lespce la plus proche de
lHomme est le Macaque, la plus loigne est la Poule.

11 Lexprience de Mariotte
Lorsque le livre est loign, lil droit peroit le rond et la croix, mais lorsque lon
rapproche limage (vers 25 cm environ), la croix semble disparatre
Schma : se reporter par exemple au schma du document 1 page 306. Dans la rgion
du nerf optique, on constate labsence de photorcepteurs et de neurones, lespace tant
occup par le regroupement des fibres constituant le nerf optique. Dans cette rgion,
aucun stimulus nerveux ne peut donc gnrer un message nerveux visuel.
Si les images de la croix et du rond se forment chacune sur une rgion comportant
des photorcepteurs, la croix et le rond sont vues. la distance de 25 cm, limage de
la croix se forme exactement sur la rgion du nerf optique, dpourvue de photorcepteurs : elle nest donc pas perue.
Chapitre 4. La vision : de la lumire au message nerveux

04732841_156-224.indd 215

215

20/07/11 09:18

Partie

chapitre

Cerveau et vision
Activits pratiques

La vision : une construction crbrale (p. 326-327)


Connaissances

Capacits et attitudes

Plusieurs aires corticales participent la vision.


Limagerie fonctionnelle du cerveau permet dobserver
leur activation lorsque lon observe des formes, des mouvements. La reconnaissance des formes ncessite une
collaboration entre les fonctions visuelles et la mmoire.

Exploiter des donnes, notamment exprimentales,


pour comprendre quune image nat des interactions entre
diffrentes aires du cortex crbral.
Interprter des observations mdicales et/ou des imageries crbrales chez lHomme.

1. Les intentions pdagogiques


Cette activit a pour but de montrer que la perception visuelle est finalement une activit crbrale et quelle est ralise par des traitements spars des diffrents aspects
de la scne vue, puis dune intgration des informations perues par le cortex visuel
tout instant. Comme les programmes le recommandent, les documents font appel
des tudes de cas cliniques et des rsultats dexploration fonctionnelle du cerveau.
Les exemples prsents ici sappuient pour une large part sur les travaux clbres de
Semir Zeki (University College London).
Ainsi, le document 1 prsente le cas dun individu souffrant dun dfaut de perception des couleurs (identifiable daprs la comparaison du tableau de Mondrian et de
sa reproduction) suite la lsion dune zone prcise du cortex visuel (aire V4). En
revanche, les formes, leur position dans le champ visuel, sont bien perues.
Le document 2 permet de localiser cette aire visuelle ainsi quune seconde aire, cette
fois associe la perception des mouvements. La comparaison de ces images dexploration fonctionnelle permet de se rendre compte quil existe des zones diffrentes
pour traiter deux aspects dune scne observe, ces deux aires tant situes dans des
endroits distincts du cortex visuel. Conformment au programme, il ne sagit pas ici
dentrer dans une description anatomique du cerveau pour localiser prcisment ces
aires visuelles. Elles sont cites ici uniquement pour donner lide dun traitement
spar des informations visuelles.
Le document 3, par ltude dun second cas clinique, montre lexistence dune troisime zone spcialise cette fois dans le traitement des informations relatives aux
formes prsentes dans une image. En effet, ici la couleur et le mouvement ninterviennent pas : le sujet est incapable de reconnatre les objets leur seule forme. Dans leur
vcu quotidien, les sujets atteints de tels troubles utilisent souvent uniquement la couleur pour identifier les objets, ce qui conduit, invitablement, de nombreuses erreurs.
Cette prsentation est ncessairement schmatique : la ralit est beaucoup plus complexe, plusieurs aires visuelles secondaires pouvant tre impliques dans la vision des
couleurs par exemple.
216

Partie 4. Corps humain et sant

04732841_156-224.indd 216

20/07/11 09:18

Le document 4 ralise la synthse des informations tires des documents 1, 2 et 3 :


trois zones corticales spcialises traitent chacune une partie des informations de
limage, et lintgration de ces traitements permet une perception visuelle unique, qui
est donc bien une activit crbrale complte.
Cette activit crbrale se fait de faon diffrente dun individu lautre : dans le cas
dune illusion d optique de type image ambige, comme celle prsente dans le
document 5, la mme image (et donc la mme stimulation rtinienne) ne produit pas
la mme perception. Chacun intgre dans la perception visuelle des informations qui
lui sont propres et qui ne sont pas ncessairement les mmes dun individu un autre.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2: Le tableau de Mondrian est caractris par sa richesse en couleurs : sa
vision active laire V4 (document 2) tandis quune lsion de cette mme aire crbrale se traduit par un dficit de la vision des couleurs du tableau (les autres caractristiques de la vision comme la forme ou la disposition spatiale ntant pas affectes). On peut donc penser que V4 est responsable de la vision des couleurs. Le second
tableau (document 2B) suggre le mouvement et active laire V5. On peut penser que
cette aire permet la vision des mouvements.
Doc. 3:Laire V3 intervient dans la perception des formes. En effet, les patients qui
prsentent des lsions dans cette zone crbrale sont incapables de reconnatre la forme
dun modle parmi un ensemble de propositions, et se fondent surtout sur la couleur
des objets pour les reconnatre.
Doc. 1 4: Quand un individu voit une scne, les messages nerveux issus de la rtine
arrivent dans la rgion occipitale du cerveau et activent simultanment plusieurs aires
spcialises. Laire V3 assure la perception des formes, laire V4 celle des couleurs
et laire V5 celle des mouvements. Lensemble de ces informations permet de reconnatre lensemble des lments de la scne, aboutissant ainsi une perception unique,
intgrant les diffrentes informations parvenant au cortex visuel.
Doc. 5: Illusion doptique nest pas une expression adapte ici. Il sagit plutt
dune illusion crbrale , puisque cest le cerveau qui interprte de faon diffrente
les mmes informations visuelles pour construire les images des deux portraits. Cest
finalement le cerveau qui donnera chacun la perception visuelle de limage observe.
Autres exemples : limage propose en ouverture de chapitre (page 324) donne lillusion dun mouvement. Alors que les formes sont bien videmment parfaitement statiques, le cerveau ajoute limpression de mouvement du fait de la forme en spirale
de cet ensemble. De nombreux autres exemples peuvent tre trouvs : voir Ressources complmentaires ci-dessous.

Synthse : rponse au problme rsoudre


Aprs son arrive au cortex visuel, le message nerveux visuel est trait par plusieurs
aires crbrales spcialises dans la perception des formes, des couleurs, des mouvements. Lensemble est ensuite intgr en une perception visuelle unifie.

3. Ressources complmentaires
Manuel numrique Bordas : fiche documentaire LIRM (bases physiques) .
Logiciel de visualisation des donnes de neuroimagerie EduAnatomist :

http://acces.inrp.fr/acces/ressources/neurosciences/Banquedonnees_logicielneuroimagerie/
eduanatomisi
Chapitre 5. Cerveau et vision

04732841_156-224.indd 217

217

20/07/11 09:18

Banque de donnes de neuroimagerie :

http://acces.inrp.fr/acces/ressources/neurosciences/Banquedonnees_logicielneuroimagerie/
test-architecture-neuropeda/architecture-de-la-banque-de-donnees-neuropeda-1/architecturede-la-banque-de-donnees-neuropeda
Donnes de neuroimagerie sur la vision des couleurs et les aires associes :

http://acces.inrp.fr/acces/ressources/neurosciences/Banquedonnees_logicielneuroimagerie/
test-architecture-neuropeda/fiches-pedagogiques/1-irm/1-3-imagerie-fonctionnelle/1-31-sensibilite-motricite/1-3-1-3-vision/1-3-1-3-3-vision-des-couleurs/1-3-1-3-3-vision-des-couleurs
Donnes de neuroimagerie sur la vision des mouvements et les aires associes :

http://acces.inrp.fr/acces/ressources/neurosciences/Banquedonnees_logicielneuroimagerie/
test-architecture-neuropeda/fiches-pedagogiques/1-irm/1-3-imagerie-fonctionnelle/1-3-1sensibilite-motricite/1-3-1-3-vision/1-3-1-3-2-vision-des-mouvements/1-3-1-3-2-vision-desmouvements
Le cerveau tous les niveaux : la vision :

http://lecerveau.mcgill.ca/flash/d/d_02/d_02_cr/d_02_cr_vis/d_02_cr_vis.html
Les illusions doptique :

http://ophtasurf.free.fr/illusions.htm

218

Partie 4. Corps humain et sant

04732841_156-224.indd 218

20/07/11 09:18

Activits pratiques

Des substances qui perturbent la vision (p. 328-329)


Connaissances

Capacits et attitudes

Des substances comme le LSD perturbent le fonction- Interprter des observations mdicales et/ou des imageries
nement des aires crbrales associes la vision et pro- crbrales chez lHomme.
voquent des hallucinations qui peuvent driver vers des
perturbations crbrales graves et dfinitives.

1. Les intentions pdagogiques


ce stade, les lves ont bien compris que la vision est bien plus quun phnomne
optique puisque la perception visuelle ncessite la gense, le transfert et le traitement
dun message nerveux. Lobjet de cette activit est de montrer que la chimie intervient dans ce processus et donc de comprendre comment des substances chimiques
peuvent perturber la vision.
Cette activit se prte bien une dmarche dinvestigation : le document 1 permet
dtablir le constat que des substances chimiques, parfaitement connues, peuvent gnrer des hallucinations visuelles. Conformment au programme, lexemple du LSD est
prsent : son origine et ses effets sont prciss. On trouvera, page 337, des informations complmentaires et une ouverture intressante sur lhistoire des arts et lhistoire
des sciences ( Mal des ardents et peinture, histoire du LSD, etc.). Ltude du modle
molculaire du LSD est ncessaire car elle sera exploite par la suite pour comprendre
lorigine possible des hallucinations engendres par cette substance. Lexemple de la
ktamine et de la psilocybine sont donns pour ne pas restreindre le champ des hallucinognes au seul LSD. Enfin, lencadr permet de dvelopper le volet ducation
la sant , indispensable au cours de cette tude : en effet, il faut bien faire comprendre que toutes ces substances ont des consquences dltres qui vont bien audel de leur simple effet hallucinogne.
Aprs avoir constat que des substances chimiques telles que le LSD peuvent perturber
la perception visuelle, on sintresse naturellement au mcanisme susceptible dexpliquer cet effet. Le document 2 fournit les connaissances indispensables pour mettre
des hypothses explicatives. Lobjectif essentiel est de montrer que des substances
chimiques (les neurotransmetteurs) jouent un rle primordial dans la transmission du
message nerveux au niveau des synapses. Une approche concrte peut tre ralise par
un examen attentif des lectronographies. noter que la qualit des documents permet de mener une relle investigation : par exemple, la vue de dtail montre parfaitement lexocytose des vsicules synaptiques (le terme nest pas connatre, mais le
phnomne permet de comprendre comment une substance chimique peut tre dverse au contact du neurone postsynaptique).
Le document 3 permet de prouver que ces substances (en loccurrence la psilocybine) activent effectivement les rcepteurs la srotonine. Ce document permet galement de souligner les rles varis attribus la srotonine (voir les prcisions donnes en lexique) et montre la grande rpartition de ces rcepteurs dans le cerveau. Il
convient donc de ne pas en rester une vision trop simpliste de lhallucination et de
comprendre que les perturbations engendres par la consommation dune substance
peuvent aller bien au-del de la simple hallucination visuelle.
Chapitre 5. Cerveau et vision

04732841_156-224.indd 219

219

20/07/11 09:18

lissue de cette tude, on pourra utiliser le schma bilan (et sa version anime propose dans le manuel numrique) pour visualiser lensemble de ces mcanismes.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1: La ktamine modifie la perception visuelle de lenvironnement puisque les
formes apparaissent courbes, distordues , comme lillustre bien la photographie.
Le LSD a quant lui un effet hallucinogne : en effet, il gnre une perception visuelle
(visions colores) qui ne correspond pas une stimulation de la rtine des yeux par
de la lumire. Ces substances ont une action beaucoup plus profonde sur le fonctionnement crbral : hallucinations en tous genres (visuelles et auditives), modification
de ltat de conscience, troubles psychiques.
Doc. 2: La transmission du message nerveux au niveau dune synapse est chimique
car la fente synaptique est un espace dans lequel les signaux lectriques ne se propagent pas. ce niveau, cest la libration dune substance chimique, le neurotransmetteur, qui permet la transmission du message.
Doc. 3:Cette tude montre que la psilocybine peut se fixer sur les rcepteurs srotonine du cerveau, puisque ceux-ci sont plus activs en prsence de cette drogue.
Doc. 1 3: La comparaison des modles molculaires montre que le LSD possde
une similitude de forme tridimensionnelle avec la srotonine, qui est un neurotransmetteur crbral intervenant notamment dans la perception sensorielle. Le LSD est
donc capable de se fixer (comme la psilocybine) sur les rcepteurs synaptiques de la
srotonine. On peut penser que la fixation du LSD gnre des messages nerveux transmis au cortex visuel, messages qui ne correspondent pas des stimulations visuelles
relles, ce qui explique les hallucinations visuelles. La srotonine tant un neurotransmetteur trs rpandu dans dautres zones du cerveau, ceci explique les perturbations
autres que visuelles.

Synthse : rponse au problme rsoudre


Des substances chimiques peuvent perturber la perception visuelle car leur similitude de
forme avec certains neurotransmetteurs crbraux leur permet de se fixer sur les rcepteurs de ces neurotransmetteurs, au niveau de synapses impliques dans la transmission
ou le traitement du message nerveux visuel. La perception visuelle est alors altre.

3. Ressources complmentaires
Manuel numrique Bordas :

vido permettant une visualisation et une comparaison des modles molculaires de la


srotonine, du LSD, de la psilocybine et de lecstasy;
animation du schma bilan (page 335) montrant comment des substances exognes
peuvent perturber la transmission chimique du message nerveux au niveau dune synapse;
fiche documentaire Drogue, un danger pour soi et pour les autres .
Site ressources Bordas : modles molculaires (fichiers pdb ) du LSD et de la

srotonine.

220

Partie 4. Corps humain et sant

04732841_156-224.indd 220

20/07/11 09:18

Activits pratiques

Apprentissage et plasticit crbrale (p. 330-331)


Connaissances

Capacits et attitudes

La mise en place du phnotype fonctionnel du systme


crbral impliqu dans la vision repose sur des structures
crbrales innes, issues de lvolution et sur la plasticit
crbrale au cours de lhistoire personnelle.
De mme la mmoire ncessaire par exemple la reconnaissance dun visage ou dun mot repose sur la plasticit
du cerveau.
Lapprentissage repose sur la plasticit crbrale. Il ncessite la sollicitation rpte des mmes circuits neuroniques.

Recenser, extraire et organiser des informations pour


comprendre le phnomne de plasticit crbrale et son
importance dans ltablissement de diffrentes fonctions
cognitives.
Interprter des expriences sur la maturation du cortex
visuel chez lanimal.
Interprter des observations mdicales et/ou des imageries crbrales chez lHomme.

1. Les intentions pdagogiques


En sappuyant sur lexemple de la construction du phnotype impliqu dans la
vision , il sagit de montrer que le fonctionnement crbral nest pas fig ds la naissance. Au contraire, il se construit progressivement au gr des expriences vcues et
peut mme subir dimportants remaniements, y compris chez ladulte. On montre ainsi
ltonnante facult de plasticit du fonctionnement crbral. Cest aussi loccasion
de revenir sur les relations entre gnotype et phnotype : la vision du monde requiert
bien entendu des structures biologiques innes, caractristiques de lespce, et rsultant de lvolution, mais slabore en interaction avec lenvironnement pour finalement constituer un phnotype visuel propre chaque individu.
Cette double page propose une slection de documents scientifiques dont lexploitation permet de fonder trs concrtement ces notions, qui peuvent paratre au premier
abord difficiles apprhender.
Le document 1 est destin montrer lexistence dune organisation fonctionnelle du
systme visuel, de lil au cortex visuel, que lon retrouve ds la naissance chez tous
les primates. On montre ainsi limportance de l inn , cest--dire des structures
biologiques complexes, rsultat de lvolution, et qui sont videmment indispensables
la fonction visuelle.
Dans cette technique trs particulire, les acides amins injects (en gnral de la proline) sont incorpors dans des protines dont certaines sont transportes jusqu lextrmit des neurones o elles sont impliques dans le fonctionnement synaptique. Une
fraction de ces protines est libre dans lespace synaptique, dgrade en acides amins dont certains sont absorbs par le neurone postsynaptique. Grce ce transport
transneuronal dacides amins marqus, on peut visualiser les circuits neuronaux correspondant lun des deux yeux. Cette exprience rvle donc bien lexistence de circuits neuronaux actifs ds la naissance, de la rtine jusquau cortex visuel. noter que
lorganisation du cortex visuel est trs particulire (il sagit ici dune coupe ralise
dans le plan du cortex, comme sil tait vu du dessus) : chez le macaque, les domaines
correspondant chacun des deux yeux forment des bandes alternes de 0,5mm environ qui occupent des surfaces peu prs gales au moment de la naissance (lobservation de lautoradiographie est ralise avec clairage sur fond noir de telle sorte que
les grains dargent apparaissent en clair).
Chapitre 5. Cerveau et vision

04732841_156-224.indd 221

221

20/07/11 09:18

Lexprience prsente par le document 2 montre que cette fonctionnalit inne peut
tre modifie par lexprience individuelle prcoce : on met donc ici en vidence limportance de l acquis .
Le texte et les schmas associs doivent tre bien tudis afin de comprendre le protocole de ces expriences : notamment, il convient de bien distinguer la priode pendant
laquelle le chaton est priv de vue et le moment o ltude des neurones est ralise
(ge adulte). Dans la deuxime exprience, on constate (sans lexpliquer) la diminution
globale de lactivit des neurones due la longue priode de privation monoculaire,
mais il faudra surtout attirer lattention sur le fait quil ny a, dans ce cas, pas ou peu
dimpact sur la rpartition des neurones actifs (contrairement la premire exprience).
La seconde partie de lactivit illustre la plasticit crbrale, y compris chez ladulte,
partir de lexemple de la lecture en Braille.
Le document 3 met en vidence le changement possible de fonction des aires corticales associes la vision chez les non-voyants. Celles-ci sont en effet sollicites
pour la lecture des mots crits en Braille, cest--dire perus par lintermdiaire du
sens du toucher. Une sorte de reprogrammation des neurones des aires visuelles
leur permet dtre utiliss pour une tche diffrente, du fait de labsence de stimulations visuelles reues par le non-voyant. On pourra y associer le cas tonnant de la
vision avec la langue prsent la page336 ( Des cls pour aller plus loin ).
Lexprience rcente relate par le document 4 montre que cette reprogrammation
peut avoir lieu chez une personne voyante sentranant lire le Braille dans les conditions dun non-voyant (sans stimulation visuelle). Lintrt de cette exprience est de
dmontrer que cette volution peut se produire trs rapidement et de faon transitoire.
Une plasticit crbrale court terme est ainsi mise en vidence. Elle ne peut donc
reposer sur une restructuration anatomique du cerveau mais plutt sur lactivation de
circuits neuronaux dj existants.

2. Les pistes dexploitation


Informations dduites de lanalyse des documents
Doc. 1 et 2:La photographie rvle lexistence de bandes claires qui prouvent que
les acides amins radioactifs ont t transports depuis la rtine de lil droit jusquau
cortex visuel. Ceci montre donc bien lexistence dun circuit neuronal biologiquement
actif, depuis la rtine jusquau cortex visuel. On peut noter que la surface du cortex
correspondant chacun des deux yeux est quivalente.
Doc. 2: Lexprience ralise chez le jeune chaton montre quaprs rouverture de
lil occlus (et mme longtemps aprs cette rouverture, lge adulte), les neurones
correspondant lil qui a t priv de stimulation ne sont plus actifs. Ainsi, si lil
nexerce pas sa fonction visuelle, les neurones qui lui correspondent perdent dfinitivement leur fonctionnalit. Il nen va pas de mme chez le chat adulte.
Cest la raison pour laquelle une cataracte chez le jeune doit tre imprativement opre. Si ce nest pas le cas, la perte de fonctionnalit du systme nerveux visuel correspondant lil malade risque dtre dfinitive, rendant inutile une opration tardive.
Doc. 3:Les aires visuelles du patient non-voyant sont actives lorsquil lit du Braille,
ce qui nest pas le cas pour une personne voyante. Cela signifie que les neurones de
cette partie occipitale du cerveau ont chang de fonction : au lieu de traiter les messages nerveux venant de la rtine, ils traitent maintenant ceux qui proviennent des
rcepteurs tactiles des doigts.
222

Partie 4. Corps humain et sant

04732841_156-224.indd 222

20/07/11 09:18

Doc. 3 et 4:Le document 3 montre que les neurones peuvent changer de fonction (tre
reprogramms ), et le document 4 confirme ce fait puisque les personnes voyantes
entranes lire le Braille les yeux bands voient temporairement certains de leurs
neurones normalement impliqus dans la vision se mettre traiter des informations
tactiles. Les aires crbrales nont donc pas une spcialisation stricte et dfinitive,
leur fonction dpend des stimulations sensorielles reues. Cest la plasticit crbrale.

Synthse : rponse au problme rsoudre


Le fonctionnement crbral impliqu dans la perception visuelle repose sur des structures innes, fonctionnelles ds la naissance. Cependant, il ncessite aussi que la fonction visuelle soit exerce, notamment au plus jeune ge : le phnotype visuel se construit
donc galement grce lexprience individuelle. La spcialisation et le fonctionnement des territoires crbraux ne sont pas figs mais peuvent subir des remaniements,
y compris chez ladulte.

3. Ressources complmentaires
Manuel numrique Bordas : fiche documentaire Notre il voit dabord en gros .

Chapitre 5. Cerveau et vision

04732841_156-224.indd 223

223

27/07/11 11:39

Exercices

p. 338

La correction des exercices Tester ses connaissances figure dans le manuel de


llve, page 353.

6 Le cerveau se rorganise sans cesse


Daprs cette tude, lapprentissage de la lecture reposerait sur le phnomne de plasticit crbrale. En effet, il nexisterait pas ds la naissance une aire crbrale dont le
rle serait prdtermin pour la lecture : chez les personnes illettres, cette zone est
utilise pour la reconnaissance des visages. La zone de reconnaissance des mots, que
lon trouve chez les personnes sachant lire, se formerait par reconversion dune partie
de la zone initialement dvolue la reconnaissance des visages. Elle est plus importante si la personne sait bien lire. Cette reconversion, qui tmoigne de la plasticit du
cerveau, est possible chez ladulte comme pendant lenfance.

N dditeur : 10164604
Imprim en France par ?????????????
Dpt lgal : 2011
224

04732841_156-224.indd 224

20/07/11 09:18