Vous êtes sur la page 1sur 51

HORS-SRIE

Rviser son bac


avec

SCIENCES DE LA VIE
inale
m
r
u
Te
uvea e
o
n
et
m
ram re
g
o
r
p
i
rem
P
e
d

Term S 1re ES, L


LESSENTIEL DU COURS
tDes fiches synthtiques
tLes points cls
du programme
tLes dfinitions cls
tLes repres importants
DES SUJETS DE BAC
t 16 sujets comments
t Lanalyse des sujets
t Les raisonnements
t Les plans dtaills
t Les piges viter

3:HIKPOA=\U\^UU:?a@k@k@b@f;

M 05407 - 1 H - F: 7,90 E - RD

Hors-srie Le Monde, avril 2012

DES ARTICLES DU DFE;<


t Des articles du Monde
en texte intgral
t Un accompagnement
pdagogique de chaque
article
UN GUIDE PRATIQUE
t La mthodologie
des preuves
t Astuces et conseils

En partenariat avec

Rviser son bac


avec

Sciences de la vie Term S


et sciences 1re, sries ES et L
(nouveaux programmes)

Avec la collaboration de :
Sylvie Grcourt
Nathalie Dolin
Didier Pol
Gwenola Champel

En partenariat avec

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Une ralisation de

SOMMAIRE
Comment optimiser vos rvisions et tre sr(e) de matriser
en profondeur les thmes et les enjeux du programme de sciences de la vie ?
Le jour du bac, comment rendre une copie qui saura faire toute la diffrence
et vous assurer la meilleure note possible ?

Sans oublier la mthodologie des preuves et les conseils pour sy prparer.

En partenariat avec
Compltez vos rvisions du bac sur www.assistancescolaire.com :
mthodologie, fiches, exercices, sujets d'annales corrigs... des outils gratuits et efficaces
pour prparer l'examen.

dit par la Socit ditrice du Monde


80, boulevard Auguste Blanqui 75013 Paris
Tl : +(33) 01 57 28 20 00 Fax : + (33) 01 57 28 21 21
Internet : http//www.lemonde.fr
Prsident du Directoire, Directeur de la publication : Louis Dreyfus.
Directeur de la Rdaction : Erik Izraelewicz Editeur : Michel Sfeir
Imprim par Grafica Veneta en Italie
Commission paritaire des journaux et publications : n0712C81975
Dpt lgal : avril 2012.
Achev d'imprimer : avril 2012
Numro hors-srie ralis par Le Monde
Le Monde rue des coles, 2012

NOURRIR L'HUMANIT (1RE)

p. 5

chapitre 01 Vers une agriculture durable


chapitre 02 Qualit des sols et de l'eau
chapitre 03 Les aliments dans notre assiette,
qualit et conservation

p. 6
p. 14

FMININ-MASCULIN ET PROCRATION (1RE ET TERM)

p. 25

chapitre 04 Devenir homme ou femme :


du sexe gntique au sexe phnotypique
chapitre 05 La rgulation de la fonction reproductrice
chapitre 06 Fcondation, grossesse et techniques
de procration mdicalement assiste
chapitre 07 Prendre en charge sa vie sexuelle

p. 18

p. 26
p. 32
p. 38
p. 44

LHISTOIRE DE LA VIE (TERM)

p. 51

chapitre 08 La recherche de parent chez les vertbrs


chapitre 09 La ligne humaine

p. 52
p. 58

STABILIT ET VARIABILIT DES GNOMES (TERM)

p. 63

chapitre 10 Gnome et innovations gntiques


chapitre 11 Miose et fcondation

p. 64
p. 70

LE SYSTME IMMUNITAIRE (TERM)

p. 75

chapitre 12 Le Sida, une maladie du systme


immunitaire
chapitre 13 Les mcanismes immunitaires
chapitre 14 Les vaccins et la mmoire immunitaire

p. 76
p. 82
p. 86

LE GUIDE PRATIQUE

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Pour vous y aider, voici une collection totalement indite !


Elle est la premire et la seule vous proposer en plus des rvisions
traditionnelles dtoffer vos connaissances grce aux articles du Monde.
Analyses scientifiques, pistes de rflexion, exemples, notions cls :
les articles sont une mine dinformations exploiter pour enrichir
vos rponses argumentes et vos tudes de documents. Trs accessibles,
ils sont signs, entre autres, par des docteurs en mdecine (Jean-Yves Nau,
Axel Kahn, Ren Frydman), une neurobiologiste (Catherine Vidal),
des chercheurs (Christophe Nguyen-The, Anne Fagot-Largeault,
Nicolas Poirier), etc. Inspire de la presse, la mise en pages met en valeur
linformation et facilite la mmorisation des points importants.
Slectionns pour leur pertinence par rapport un thme prcis
du programme, les articles sont accompagns :
tde fiches de cours claires et synthtiques, assorties des mots cls
et repres essentiels retenir ;
tde sujets de bac analyss et comments pas pas
pour une meilleure comprhension.

L'HUMANIT

K+

NH4

Ca
2+

Mg2+

K+

_
_

_
_

_
+

C.A.H.
_

_
_
_

_
_

Mg2+

NH4

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

NOURRIR

(1RE)

PO34-

Ca2+
Ca2+

MOTS CLS
BIOCNOSE
Il sagit de la totalit des tres
vivants qui peuplent le biotope :
animaux, vgtaux, bactries et
champignons.

BIOTOPE
Le biotope est lenvironnement
physico-chimique de lcosystme
(composantes inertes : sol, air,
eau, lumire, etc.).

COSYSTME
Lcosystme est compos de lassociation de deux composantes
en interaction lune avec lautre :
le biotope et la biocnose.
cosystme = biotope + biocnose.

Vers une agriculture


durable

a population humaine est en constante progression et devrait passer de 6,5 9 milliards dindividus dans le courant
du XXIe sicle. Comment nourrir lhumanit ? Lagriculture intensive est coteuse et source de pollutions. Une gestion durable
est indispensable pour le respect de lenvironnement et le maintien dune qualit sanitaire des aliments.
compltement lagrosystme ; on
est alors oblig de rajouter des
intrants (engrais, pesticides) pour
fertiliser le sol et supprimer toutes
les espces parasites.

INTRANTS
Ce sont tous les produits apports
la terre et aux cultures : eau,
semences, engrais, produit phytosanitaires ou pesticides

Les bilans dnergie


FUEFNBUJSF

NITRATES
Les nitrates, de formule NO3,
sont des substances chimiques qui
entrent dans le cycle de lazote et
sont un composant majeur des
engrais inorganiques.

OGM
Lhomme a modifi le patrimoine
gntique des organismes afin de
les doter de nouvelles proprits.
Ainsi, on peut insrer dans le gnome dune plante des gnes qui
la rendent rsistante aux insectes
ou un herbicide.

NOTION CL
Biodiversit
Le scientifique amricain Edward
O. Wilson (1929-) donne la dfinition suivante : la biodiversit est
la totalit de toutes les variations
de tout le vivant .
La biodiversit comprend donc
tous les tres vivants qui existent
sur notre plante et se dcline
en diversit cologique (milieux),
diversit des espces et diversit
gntique.
la biodiversit tient compte des
interactions dans les milieux en
changement.

Nourrir l'humanit (1re)

LESSENTIEL DU COURS

-BEJGGSFODFFOUSFDPTZTUNF
FUBHSPTZTUNF
Un cosystme est un ensemble dorganismes vivants
qui vivent et interagissent les uns avec les autres
(biocnose) et avec leur environnement (biotope). La
matire et lnergie y sont produites, consommes et
recycles avec peu de pertes, mais il est globalement
peu rentable. Les cosystmes voisins changent
galement un peu de matire et dnergie. Lhomme
prlve de la biomasse (matires organiques) dans
les cosystmes, ce qui peut dtruire leur quilibre
si la quantit de matire perdue est trop importante.
Mais, en gnral, la partie prleve reste assez faible.
Un agrosystme est bti partir dun cosystme,
naturel et quilibr. Il est modifi par la main de
lhomme pour rpondre des exigences totalement
diffrentes, savoir la production dun maximum
de biomasse pour ensuite la prlever dans un but
nutritionnel (alimentation), nergtique ou industriel. Un agrosystme prsente gnralement un seul
producteur de biomasse (le mas par exemple), toutes
les autres espces qui pourraient diminuer la rcolte
ayant t supprimes. La quantit importante de
biomasse produite et son exportation dsquilibrent

Dans un cosystme, la matire et


lnergie sont produites, consommes puis recycles avec peu de
pertes. Du fait de la trs faible
exportation de biomasse dans un
cosystme quilibr, le stock dlments tels que lazote, le phosphore
et le potassium est trs important.
Les lments puiss dans le sol
par les producteurs primaires se
retrouvent presque intgralement,
en bout de chane, nouveau dans le sol, du fait de
laction des organismes dcomposeurs.
Dans un agrosystme, les pertes de matires et
dnergies sont importantes. Une grande quantit
de biomasse produite tant exporte, lapport deau,
dengrais et de pesticides est ncessaire pour retrouver
lquilibre perdu.

Limpact de certaines pratiques


agricoles sur lenvironnement
La dforestation par le feu sintensifie pour laisser la
place aux cultures, ce qui libre une quantit norme
de dioxyde de carbone et participe au rchauffement
climatique.
Lagriculture intensive, pour la consommation ou
pour lalimentation des animaux, demande un apport
dengrais important. Ces engrais azots sont souvent
pulvriss en excs : environ 19 % de lazote apport
reste dans le sol, se transforme en nitrates et sinfiltre
vers les nappes phratiques, entran par les eaux de
pluie, ou scoule vers les fleuves, les mers et les ocans.
Les eaux surcharges en nitrates voient les algues
vertes (et autres plantes aquatiques) prolifrer, crant

un phnomne de mares vertes ou d'eutrophisation. Loxygne de leau est alors consomm en masse,
ce qui provoque la mort par asphyxie de la faune
aquatique, et dtruit lcosystme.
Les produits phytosanitaires prsentent galement
des risques importants pour lenvironnement. Ils
saccumulent dans les sols, leau, les poussires, et les
organismes vivants, et contaminent les cosystmes
environnants. Ils peuvent mme tre toxiques pour
certains animaux non viss par leur utilisation
initiale.
Leau est un bien prcieux trs ingalement rparti
sur notre plante. Lagriculture et llevage intensifs
participent cette ingalit : lirrigation des cultures
reprsente environ 70 % de la consommation en
eau. Cependant, la quantit deau ncessaire varie
beaucoup en fonction du type de production et du
type de distribution de leau.

Limpact de certaines pratiques


agricoles sur la sant
Les nitrates en excs se retrouvent galement dans
leau de boisson. Une eau est potable si elle contient
moins de 50 mg de nitrates par litre, mais ds 25 mg
par litre, la consommation de leau par les nourrissons est dconseille car pouvant provoquer la mort
par asphyxie des cellules.
Il a t dmontr que les nitrates se transforment
en substances cancrignes. Il est donc dconseill,
mme pour les adultes, de boire de leau contenant des
nitrates, mme si elle est considre comme potable.
Les produits phytosanitaires, comme le DDT ou
le chlordcone, dsormais interdits, se sont avrs
toxiques pour les vgtaux et pour les animaux et
se sont accumuls le long de la chane alimentaire.
On impute ce type de produit une augmentation
du taux de cancers, des troubles du systme nerveux,
une baisse de la fertilit et des perturbations hormonales. Parmi les produits phytosanitaires critiqus,
certains ont provoqu une brutale diminution de
la quantit dabeilles, insectes pollinisateurs indispensables la reproduction de nombreux vgtaux.

Le principe de la slection
gntique et ses consquences
sur lenvironnement et la sant
Depuis des millnaires, les agriculteurs et les leveurs
slectionnent les meilleurs reprsentants dune es-

pce animale ou vgtale pour que leur croisement


donne des individus plus vigoureux et rsistants :
les hybrides (on parle de vigueur hybride).
Intressante pour le rendement et la rsistance,
la slection gntique prsente cependant des
inconvnients majeurs : elle est catastrophique
pour la biodiversit, puisque les espces ou sousespces moins rentables sont progressivement
abandonnes et finissent par disparatre. En outre,
lespce slectionne nest pas labri dun nouvel
agent pathogne (parasite, virus, etc.) et peut tre
dcime sans quil soit possible de la remplacer par
une espce voisine.
Les OGM (organismes gntiquement modifis vgtaux) sont lobjet de violentes controverses : lpandage
dengrais nest pas forcment rduit, on a constat le
transfert de gnes dun OGM vers dautres espces
(risque de mauvaises herbes rsistantes, problme
de la prennit de lagriculture biologique, etc.) et
linnocuit des OGM, vgtaux ou animaux, pour la
sant nest pas dmontre.

Concilier production
et gestion durable
de lenvironnement
Quelques mesures peuvent tre prises pour concilier
production et gestion durable de lenvironnement :
la slection gntique, dans le respect de la
biodiversit, permet demployer moins de produits
phytosanitaires et moins dengrais ;
la micro-irrigation ainsi quune rpartition des
espces cultives en fonction des caractristiques
climatiques des rgions rduisent la consommation
deau ;
la reconstitution dcosystmes riches possdant
de nombreuses espces complmentaires est
prfrer la culture dune seule espce ;
la culture biologique diversifie doit tre dveloppe ;
la lutte biologique peut tre employe (utilisation
de recettes agricoles anciennes, oublies par une
logique de rendement et un raisonnement court
terme, telles que la symbiose entre plantes, etc.) et la
limitation des insecticides (par exemple, lutilisation
des coccinelles), etc.
Puisque les sols sont puiss et pollus, les espces
se rarfient. Il est donc temps de passer un raisonnement respectueux de lenvironnement
long terme.

TROIS ARTICLES DU MONDE CONSULTER


t1PVSOPVSSJSMBQMBOUF MhjBHSPDPMPHJFxEPJUSFNPEFMFSMhBHSJDVMUVSFp. 10

PERSONNAGE
IMPORTANT
Pre fondateur des lois lhrdit, il
ralise de nombreux croisements
entre diffrentes varits de petits
pois pour comprendre la transmission des caractres chez les hybrides.
Il est lorigine des lois de Mendel
qui dfinissent cette transmission
dune gnration lautre.
Les lois de Mendel :
premire loi : uniformit des hybrides de 1re gnration (F1) suite au
croisement de deux races pures ;
deuxime loi : sgrgation de
plusieurs couples de caractres en
deuxime gnration (F2) suite au
croisement de deux hybrides de la
1re gnration ;
troisime loi : disjonction
indpendante des caractres
hrditaires en seconde gnration (F2) suite au croisement de
deux races pures diffrant par
plusieurs caractres.

ZOOM SUR
La notion de ligne pure et hybridation chez les vgtaux.
Certains caractres des plantes sont
dtermins par un gne qui possde plusieurs versions, ou allles.
Une ligne pure pour un caractre
a les mmes allles pour le gne
considr. On obtient des lignes
pures en ralisant plusieurs fois le
croisement entre races possdant
le mme caractre. On ralise ainsi
une slection. Le croisement de lignes pures permet de matriser la
transmission du caractre. Un croisement entre varits diffrentes
donne un hybride pouvant avoir
des caractristiques intermdiaires
intressantes. Ainsi, le mas M1 a de
petits grains, le M2 de gros grains :
l'hybride peut avoir des moyens.

Lnergie chimique potentielle


de la matire organique.

(Laetitia Van Eeckhout, 9 mars 2011)

tUn flau possible combattre sans sacrifier l'agriculture p. 10-11


(Grgoire Allix, 28 juillet 2011)

t Ressources naturelles p. 11
(Jrme Porier, 5 avril 2011)

La matire organique se constitue de :


glucides (1 gr = 17 kilojoules) ;
protides (1 gr = 17 kJ) ;
lipides (1 gr = 34 kJ).
Elle contient donc de lnergie
potentielle utilise lors de la respiration ou transforme en chaleur.

Nourrir l'humanit (1re)

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

Le transfert de matire
et dnergie dans les cosystmes.
t-FTDPTZTUNFTTPOUDPOTUJUVT
dtres vivants. Ceux-ci forment
des rseaux trophiques au sein
desquels il y a des transferts de
matire et dnergie. Le rseau
alimentaire est constitu de
nombreuses chanes alimentaires
ayant des maillons communs
entre elles.
t 5PVU USF WJWBOU QSPEVJU TB
propre matire et est donc un
producteur. Les producteurs
primaires sont les vgtaux
chlorophylliens. Ils ralisent la
photosynthse cest--dire la
synthse de matire organique
partir deau, de minraux et de
dioxyde de carbone en prsence
de lumire. Lnergie lumineuse
est capte par les pigments
chlorophylliens : chlorophylles,
carotnodes, etc.
La photosynthse permet lentre
dnergie et de matire dans lcosystme.
Les producteurs secondaires, galement appels consommateurs
primaires, se nourrissent des
producteurs primaires (vgtaux)
pour raliser leur propre synthse
de matire organique.
On nomme producteurs tertiaires,
ou consommateurs secondaires,
le maillon suivant du rseau trophique : ceux-ci se nourrissent
des prcdents.
On peut aussi trouver des consommateurs quaternaires, etc.
t -FT EDPNQPTFVST CBDUSJFT 
champignons, etc.) sont le dernier
maillon des chanes alimentaires
et permettent le retour des minraux au sol.
t %VO NBJMMPO  MBVUSF EFT Sseaux trophiques, en plus du
transfert de matire et dnergie,
il y a galement des pertes.
En effet, il y a des pertes de matire puisquune partie de la
matire nest pas assimile lors
de la digestion, et est rejete sous
forme dexcrments, ou bien nest
pas utilise. De mme lors de
la respiration, une partie de la
matire organique est dgrade
et saccompagne de pertes sous
forme de chaleur.

Nourrir l'humanit (1re)

tude de documents :

Mode daction dun herbicide

Tracteur pandant un traitement phytosanitaire ou de lengrais sur un champ.

Lintitul complet du sujet

Les documents

Lamitrole est un herbicide non slectif, trs soluble


dans leau, peu persistant dans le sol o il est rapidement dcompos par voie microbienne.
partir des informations extraites des documents
1 et 2, mises en relation avec vos connaissances,
dterminez un mode daction possible de lamitrole.

Document 1
Le graphique ci-dessous reprsente les effets de
lapplication dun traitement unique lamitrole sur
des plants de bl et de haricot.
Lactivit photosynthtique des plants est mesure
entre deux et trente heures aprs le traitement.
Pendant toute la dure de lexprience, les plants sont
maintenus la lumire. Les valeurs sont exprimes
en pourcentage par rapport aux taux prsents par
des plants tmoins non-traits.

Intensit photosynthtique
par rapport une activit tmoin
de 100%

NOTIONS CLS

Document 2
Culture de grains de bl germs sur du papier filtre imprgn damitrole diffrentes concentrations
(Wolf, 1960).

Concentration
en amitrole
(mol.L1)

Taille des
jeunes plants
(mm)

Quantit de
chlorophylle par plant
(g)

Quantit de
carotnodes par plant
(g)

0 (tmoin)

105,2

56,6

12,7

1 105

98,9

46,8

11,0

2 105

93,8

26,8

6,7

4 105

77,5

7,3

1,3

1 104

72,1

2,0

0,5

2 104

38,3

1,7

0,3

Daprs The physiology and biochemistry of herbicides, Academic Press, London.

La taille des jeunes plants ainsi que leur concentration en chlorophylle et en carotnodes sont
mesures douze jours aprs la mise en culture.

Lanalyse du sujet
Ltude des documents doit vous permettre de
comprendre le mode daction de cet herbicide qui
agit sur la synthse des pigments chlorophylliens,
eux-mmes responsables de croissance des vgtaux.

100

Problmatique
Comment lherbicide agit-il pour dtruire les mauvaises herbes ?

Bl

60

Ltude des documents


I. Informations tires du document 1
Les plants de bl et de haricot ayant reu un traitement
unique lamitrol dveloppent une activit photosynthtique plus faible que les plants tmoins non-traits :

Haricot

20
2

24

30

Traitement
Daprs The physiology and biochemistry of herbicides, Academic Press, London.

)FVSFTBQSTMF
traitement

SUJET TOMB AU BAC


SUR CE THME
tude de documents
Un exemple dOGM le mas Bt 176.
(Antilles-Guyane, juin 2005)

deux heures aprs linjection, 90 % pour le haricot


et 75 % pour le bl ;
trente heures aprs, 60 % pour les deux plantes.
L'amitrol freine donc l'activit photosynthtique
des vgtaux tests.
II. Informations tires du document 2
Plus les doses damitrol imprgnant le support de
croissance sont leves, plus la taille des plants de bl est
peu importante. La teneur en pigments chlorophylliens et
carotnodes est dautant plus faible que les concentrations
d'amitrole sont importantes. Cette diminution de la
concentration en pigments photosynthtiques est
responsable du dficit de croissance.

Conclusion
En bloquant la synthse des pigments chlorophylliens,
lamitrol rduit la capacit des vgtaux capturer
lnergie lumineuse. Lactivit photosynthtique est alors
diminue et la croissance des vgtaux est ralentie.

Ce quil ne faut pas faire


tUSFWBHVFPVUSPQTVDDJODUTVS
le commentaire des documents,
ne pas citer les chiffres.
t/FQBTNFUUSFFOSFMBUJPOMFTEPDVNFOUTFOUSFFVY

Dveloppement durable
Le dveloppement durable est un
dveloppement qui rpond aux besoins du prsent sans compromettre
la possibilit, pour les gnrations
venir, de pouvoir rpondre leurs
propres besoins.
(Dfinition du dveloppement
durable par la commission
Brundtland Onu, 1987.)
Les enjeux du dveloppement durable sont multiples et relient les trois
proccupations majeures que sont
lconomie, le social et lcologie. On
peut regrouper ces enjeux en quatre
grands types :
satisfaire les besoins de chacun
aujourdhui (solidarit intra-gnrationnelle) ;
vivre dans un environnement sr
et de qualit (assurer un dveloppement humain durable) ;
grer et partager les ressources
pour demain (solidarit intergnrationnelle, transmettre) ;
produire et consommer autrement.
Empreinte cologique
Lempreinte cologique est la mesure
de la pression que lhomme exerce
sur la nature. Elle permet dvaluer la
surface ncessaire une population,
ou un individu pour rpondre sa
consommation de ressources et pour
absorber les dchets produits.
Hybridation
Croisements naturels ou artificiels
entre deux organismes de varits,
races ou espces diffrentes. Dans ce
dernier cas, on obtient un hybride
presque toujours strile chez les
animaux.
Productivit
Cette notion correspond une
quantit de biomasse produite par
unit de temps et de surface, souvent
kg/ ha/ an (kilogramme par hectare et
par an). Ainsi, on nomme productivit
primaire dun cosystme, la quantit
de matire vivante produite par les
vgtaux lors de la photosynthse
pour une surface prcise et en un
an. La productivit secondaire est la
quantit de matire vivante produite
par les consommateurs pour la mme
surface et en un an. Cette mesure de
la productivit permet de calculer le
rendement au sein de lcosystme.

Nourrir l'humanit (1re)

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

ZOOM SUR

UN SUJET PAS PAS

LES ARTICLES DU

Pour nourrir la plante, l agrocologie


doit remodeler lagriculture
Olivier De Schutter, rapporteur spcial des Nations unies pour le droit lalimentation,
invite changer de cap .

our satisfaire les besoins alimentaires de la plante, il va


falloir sensiblement augmenter la production agricole, et, ds
lors, rinvestir massivement dans
lagriculture. Massivement, mais
surtout diffremment , estime
le rapporteur spcial des Nations
unies pour le droit lalimentation,
le Belge Olivier De Schutter.
Mardi 8 mars, devant le Conseil
des droits de lhomme de lOnu
Genve, il devait appeler la communaut internationale une
rorientation radicale des investissements dans lagriculture .
Jusqualors, les politiques de
soutien lagriculture visaient essentiellement orienter celle-ci vers
un mode de production industriel.
Pour M. De Schutter, il faut prsent
quelles soutiennent lagrocologie , autrement dit quelles favorisent le dveloppement dune agriculture sappuyant sur la polyculture
plutt que la monoculture, utilisant
des semences traditionnelles plutt
quindustrielles, des biopesticides
et des engrais organiques plutt
que des produits de synthse, pour
lutter contre les espces invasives et
fertiliser les sols.
Les traductions de lagrocologie
sont par nature diverses puisqu
chaque cosystme correspond un
type de production adapt. Dans les
provinces occidentales de Tanzanie,
par exemple, lagroforesterie a per-

mis de transformer 350 000 hectares de terres, qui taient hier


appeles le dsert de Tanzanie ,
en une zone agricole riche. Car les
arbres fertilisent les sols, limitant le
recours aux engrais azots, et ils y
permettent galement une rtention
de leau de pluie.
Au Kenya, au lieu dutiliser des
pesticides, quelque 25 000 agriculteurs recourent depuis 2009
la stratgie de la rpulsion-attraction . Elle consiste planter
du Desmodium dans les champs de
mas afin den loigner les insectes
tout en les attirant aux abords des
champs. Cette simple technique
permet de doubler le rendement
tout en amliorant le sol. Par
ailleurs, le Desmodium peut servir
de fourrage.
Ces modes de production faible
utilisation dintrants, et qui prservent les ressources, peuvent tre

POURQUOI
CET ARTICLE ?
La population mondiale ne cesse
daugmenter et il est urgent de
rflchir une autre faon de grer
les agrosystmes. Le rapporteur
spcial des Nations unies pour
le droit lalimentation explique
quil faut modifier notre mode
de penser lagriculture et dve-

hautement productifs , relve M.


De Schutter, qui, dans son rapport annuel remis au Conseil des
droits de lhomme, cite toute une
srie dexpriences concluantes.
Lagrocologie, insiste-t-il, est
une rponse au dfi de la pauvret
rurale.

j$SJTFEFMBQBVWSFUx
Sappuyant sur des biopesticides
ou des engrais organiques produits
localement, utilisant des plantes
pouvant capter lazote et fertiliser
les sols, lagrocologie diminue en
effet la dpendance des agriculteurs
lgard des engrais chimiques et
les rend moins vulnrables lgard
du crdit et des subventions. Ils produisent moindre cot, sans risque
de tomber dans la spirale de lendettement, et voient leurs revenus augmenter. Lagrocologie limite aussi la
dpendance envers lnergie fossile,

loppe le concept dagrocologie


qui donne une analyse nouvelle
des problmatiques lies lagriculture intensive et suggre des
solutions concrtes.
Lagrocologie est un concept
dagriculture durable qui englobe plusieurs problmatiques :
alimentaires, conomiques,
cologiques, etc. On peut dire,
en quelque sorte, que cette ap-

contribuant ainsi lattnuation du


changement climatique.
Produire plus ne suffira pas. La
crise que nous affrontons nest pas
seulement une crise de loffre, devait
souligner, mardi, M. De Schutter.
Cest aussi une crise de la pauvret :
il faut augmenter les revenus dans
les zones rurales, o rsident 75 %
des personnes les plus pauvres, afin
quelles puissent se nourrir dignement. Et cest une crise cologique :
des mthodes de production non
durables acclrent le changement
climatique et la dgradation des sols
et puisent les rserves deau douce,
menaant terme notre capacit
nourrir la plante. Pour M. De
Schutter, ces crises peuvent tre surmontes. Pourvu que lon change
de cap .
Laetitia Van Eeckhout
(9 mars 2011)

proche de lagriculture sintgre


dans le concept de dveloppement durable. Cet article peut
tre rinvesti dans les sujets o
il est demand de faire le bilan
de lagriculture intensive et
dexpliquer les solutions pour
une gestion durable de lagriculture. Il sera aussi trs utile
pour des oraux, o la culture
gnrale est importante.

Un flau possible combattre


sans sacrifier lagriculture

eut-on stopper les mares


vertes sans condamner lagriculture bretonne ? Oui, selon

10

Nourrir l'humanit (1re)

les calculs de chercheurs de lInstitut


national de la recherche agronomique (Inra) de Rennes. Les scienti-

fiques rpondent ainsi aux craintes


du monde agricole, qui redoute qu
force de vouloir rduire les rejets

de nitrate on limine toute activit


agricole avant davoir radiqu les
algues. Au dbut des annes 1970,

POURQUOI
CET ARTICLE ?
Cet article traite un exemple
franais de pollutions par les
nitrates. Une rgion entire,
la Bretagne, est touche par la
pollution des eaux des nappes
phratiques ce qui les rend
impropres la consommation
et par la prolifration des algues
vertes ( mares vertes ) le
long du littoral en raison des
effluents chargs galement de
nitrates.

on relevait des taux de nitrate


denviron 4 mg/l dans toutes les
rivires de Bretagne , rappelle
Pierre Aurousseau, chercheur
lInra. La quantit de nitrate dans
les rivires de Bretagne atteint
aujourdhui 30 mg/l en moyenne,
avec des concentrations bien plus
leves par endroits.
Redescendre 20 mg/l naura
aucun effet sur les mares vertes.
Il faudra passer sous la barre

travers cet article, on comprend que les solutions trouver doivent prendre en compte
la fois les aspects cologiques
(protection de lenvironnement
et de la biodiversit), les aspects
conomiques de la rgion, spcialise dans llevage de porc,
mais tant aussi une rgion touristique o la qualit du littoral
doit tre prserve, les aspects
humains (sant alimentaire,
niveau de vie des agriculteurs
et de leur famille ainsi que
les consquences sur la filire

des 10 mg/l pour commencer


rendre la quantit dalgues vertes
acceptable , prvient Alain Menesguen, directeur de recherche
lInstitut franais de recherche
pour lexploitation de la mer
(Ifremer). Mission impossible
pour beaucoup dagriculteurs,
qui estiment avoir dj fait dimportants efforts : les rejets dazote
culminaient 38 mg/l en 1998.
Encore 75 000 tonnes de nitrate

agro-alimentaire et les emplois


associs).
LInra propose des solutions
afin de pouvoir lutter contre
les mares vertes mais les
agriculteurs sont inquiets face
des mesures qui peuvent avoir
dimportantes rpercussions.
Ainsi, pour une gestion durable
de lagriculture, tout changement doit tre apprhend de
faon globale.
Cet article est un bon exemple
pour illustrer un sujet sur la
pollution par les nitrates.

excdentaire scoulent chaque


anne des bassins versants bretons
vers la mer.
Selon lInra, il serait possible
de supprimer cette pollution
en jouant pour moiti sur les
apports dengrais minraux
responsables de linjection de
100 000 tonnes de nitrates dans
les terres de Bretagne chaque
anne et pour moiti sur les
nitrates dorigine animale, qui

totalisent 240 000 tonnes par


an. En clair, cela reviendrait
pandre 35 % dengrais minraux
en moins et rduire de 15 % la
taille du cheptel. Cest une baisse
sensible, mais pas monstrueuse :
la Bretagne resterait la premire
rgion dlevage de France , souligne Pierre Aurousseau. La rgion
concentre aujourdhui la moiti
du cheptel national de porcs, la
moiti des volailles et prs du
tiers des vaches laitires.
Les organisations cologistes
appellent une volution en
profondeur du secteur et une
rduction du cheptel. Mais,
au-del des agriculteurs, cest
toute la filire agroalimentaire
qui refuse dvoluer , regrette
Gilles Huet, dlgu gnral de
lassociation Eau et rivires de
Bretagne. Manire de rappeler
que les exploitants ne sont pas
seuls en cause, alors que lindustrie agroalimentaire pse 40 % de
lconomie rgionale.
Grgoire Allix
(28 juillet 2011)

Ressources naturelles
Leffet papillon, cest le principe selon lequel de petites causes peuvent produire de
grands effets. Pionnier de linvestissement socialement responsable (ISR), qui entend
appliquer les principes du dveloppement durable la gestion financire, Xavier de
Bayser est lauteur de ce petit livre qui invite penser diffremment la problmatique
de laide au dveloppement des pays pauvres.

onvaincu que le modle


de lagriculture intensive
et productiviste ne pourra
rpondre aux besoins dune plante
qui comptera bientt 9 milliards
dhabitants, il avance des solutions
concrtes. Il relate lhistoire de trois
aventures franaises de social
business vocation humanitaire.
Cre en 1994, la socit JTS a mis au
point un kit comprenant semences,
bches et outils pour cultiver un
superpotager afin de produire
des fruits et lgumes en consommant quatre fois moins deau avec
un rendement trois fois suprieur
celui dun jardin classique. Pour
combattre la dforestation en

Afrique, lorganisation non gouvernementale ProNatura a dvelopp


une technologie permettant de fabriquer du charbon vert . Il sagit
de rcuprer des rsidus agricoles
afin de les brler pour les transformer en charbon vgtal. Lpandage
des cendres permet ensuite de fertiliser les sols.
La dernire histoire nest pas la
moins surprenante. Les feuilles
des vgtaux verts contiennent en
abondance des protines, de la vitamine A et du fer, dont manquent
cruellement les personnes souffrant
de malnutrition. Do lide du
groupe coopratif France Luzerne
de fabriquer des pilules base de

luzerne concentre qui peuvent tre


facilement ingres. Avec un budget
de 5 euros par an et par enfant, affirme Xavier de Bayser, il est possible
de vaincre la malnutrition.
Le point commun de toutes ces
initiatives ? Elles visent encourager un dveloppement local
en optimisant lexploitation des
ressources des pays concerns, plutt quen tablant sur laide des pays
dvelopps. Quand un homme a
faim, mieux vaut lui apprendre
pcher que lui donner un poisson ,
dit un proverbe chinois.
Jrme Porier
(5 avril 2011)

POURQUOI
CET ARTICLE ?
Cet article prsente LEffet
papillon de Xavier de Bayser.
Les exemples proposs peuvent permettre dillustrer
un sujet de restitution de
connaissances en Term S,
dtoffer un commentaire
argument en 1re ES, L. Ils
rvlent que les solutions
trouves localement rpondent aux besoins rels des
pays concerns, favorisant
leur autonomie.

Nourrir l'humanit (1re)

11

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LES ARTICLES DU

NOTIONS CLS
CAH
Le complexe argilo-humique ou
CAH est constitu dargiles et dhumus. La surface de cet agrgat est
charge ngativement. Il est donc
capable de fixer des ions, cest une
surface dchanges des ions entre le
sol et les solutions.
Dosage
Cest la dtermination de la concentration dune substance dans un
chantillon. Il peut se faire par
comparaison avec des solutions
talons dont on connat les diffrentes concentrations de la substance. On peut alors utiliser une
chelle de teinte, un graphique ou
une relation de proportionnalit
entre un paramtre mesurable et
la concentration de la substance.
Eutrophisation
Ce processus est dclench par un
apport excessif de substances nutritives (nitrates et phosphates) dans un
milieu aquatique, entranant la prolifration des vgtaux aquatiques. Les
bactries arobies augmentent leur
consommation en dioxygne pour
dcomposer les vgtaux morts et
lorsque le dioxygne vient manquer ce sont les bactries anarobies
qui se dveloppent en dgageant des
substances toxiques (mthane, ammoniac, etc.). Les poissons et autres
organismes aquatiques meurent en
absence de dioxygne. Toutes les
mers, de nombreux lacs, rivires et
fleuves sont touchs.
Potabilit
Une eau est potable si elle respecte
des normes prcises concernant des
paramtres biologiques, physicochimiques, organoleptiques, par
exemple la teneur en ions, en
concentration bactrienne, pH,
temprature, etc.
Produit phytosanitaire
Il vise protger les plantes des
maladies ou les soigner avec,
dans la plupart des cas, lobjectif dobtenir un bon rendement.
Il fait partie des pesticides et
contient des lments actifs,
chimiques ou dorigine naturelle,
qui peuvent tre polluants pour
lenvironnement.

12

Nourrir l'humanit (1re)

LESSENTIEL DU COURS

Qualit des sols et de leau

a disponibilit et la qualit de leau sont des enjeux majeurs


du XXIe sicle. Le chimiste a un rle important : analyser
les eaux de boisson, traiter leau avant et aprs usage, la
dessaler, etc.
Quant lagriculture, elle fait intervenir des substances chimiques,
engrais et produits phytosanitaires pour augmenter les rendements et faciliter le travail de lagriculteur. Comment les choisir
et les utiliser au mieux pour ne pas appauvrir les sols et mettre
en danger nos ressources naturelles ?
Que trouve-t-on dans leau ?
Eau de source, eau minrale, eau du robinet, eau de
mer : aucune de ces eaux nest chimiquement pure !
En effet, leau est un solvant et, au cours de son cycle
naturel (ruissellement, infiltration, etc.), elle dissout
de nombreuses substances.
En examinant ltiquette dune eau minrale, on
constate que ces substances sont essentiellement des
ions, cest--dire des atomes ou groupes datomes
chargs lectriquement. Ce sont ces ions quon
dsigne souvent sous le nom de sels minraux.
Ces ions, prsents en quantits infimes (quelques
mg/L) sont essentiels pour tous les tres vivants,
animaux et vgtaux. Ainsi, leau de boisson ou
darrosage ne sert pas uniquement hydrater les
organismes, elle leur apporte aussi les sels minraux
indispensables leur croissance et au fonctionnement de leurs cellules.

Cette eau est-elle potable ?


Pour dfinir si une eau est potable, la lgislation
europenne fixe un certain nombre de normes.
Leau du robinet et les eaux de source doivent les
respecter. Par contre, les eaux minrales naturelles
possdant des vertus thrapeutiques reconnues par
lAcadmie de Mdecine peuvent ne pas respecter la
totalit des critres. Cest justement leur minralisation particulire qui leur confre leurs proprits
thrapeutiques.
Les critres de potabilit sont rpartis en diffrentes
catgories :
la qualit organoleptique (saveur, odeur, couleur,
etc.) ;
la qualit micro-biologique (absence de microorganismes pathognes) ;
les paramtres physico-chimiques (pH, temprature, minralisation, etc.) ;
la composition chimique (concentration maximale
de certaines substances toxiques ou indsirables :
mtaux lourds, nitrates, phosphates, pesticides,
hydrocarbures, etc.).
Pour vrifier le respect de ces normes, les services des
eaux et les producteurs deau en bouteille ralisent

trs rgulirement des prlvements pour analyse


qualitative et quantitative, et des organismes extrieurs (Direction des affaires sanitaires et sociales
et laboratoires agrs) effectuent des contrles
sanitaires ponctuels. Ltat publie les rsultats de
ces contrles sanitaires sur le site du ministre de
la Sant (www.sante.gouv.fr).

Rendre potable une eau naturelle


Leau qui arrive notre robinet est pompe dans
une nappe phratique, une rivire souterraine,
un lac ou un cours deau. Elle doit gnralement
subir un certain nombre de traitements avant sa
distribution :
traitements physiques pour liminer les particules
en suspension (tamisage, dcantation, filtration,
flottation) ;
traitements physico-chimiques pour faciliter
lagglomration des particules fines (floculation,
coagulation) ;
traitements biologiques pour dgrader les matires organiques biodgradables ;
traitements chimiques pour dsinfecter leau et la
protger des contaminations tout au long du circuit
de distribution (ozonation, chloration).
Il ne faut pas confondre le traitement de leau potable
avec le traitement des eaux uses, en station dpuration, avant leur rejet dans le milieu naturel. Leau
rejete par une station dpuration nest pas potable.

Eau dure ou eau douce ?


La duret dune eau dpend de sa teneur en ions
calcium et magnsium. Elle sexprime en degr
franais (f ou fH) ; on considre quune eau est trs
douce quand sa duret est infrieure 15fH, et trs
dure quand elle est suprieure 40fH.
Plus une eau est dure, plus elle entrane la formation
de tartre (dpt calcaire) dans les canalisations et les
appareils lectromnagers ; elle impose galement
laugmentation des dosages de savon, de lessive
et autres produits dtergents. Par contre, comme
eau de boisson, elle apporte plus dions calcium et
magnsium quune eau douce.

Les systmes adoucisseurs deau reposent gnralement sur des rsines changeuses dions. Les ions
calcium et magnsium sont retenus par la rsine qui
libre en change des ions sodium. Pour rgnrer la
rsine, on injecte (dans un autre circuit) une solution
riche en ions sodium, ce qui provoque la libration
des ions calcium et magnsium.

Le sol retient les minraux


Le sol nest pas une matire inerte : il est le lieu
dchanges constants entre les minraux, les vgtaux et les animaux qui y vivent.
Le complexe argilo-humique (CAH) est un lment
du sol rsultant de lagglomration de particules
argileuses et dhumus. Charg ngativement, il
retient les cations (et indirectement certains anions),
et contribue la mise en rserve, ou la libration,
des matires nutritives pour les vgtaux.
Le fonctionnement du CAH est analogue celui
de la rsine changeuse dions : il est en quilibre
avec les ions prsents dans leau infiltre dans le
sol, et des changes se produisent entre les deux.
Lorsquon apporte au sol certains cations en quantit
importante, on dplace lquilibre : le CAH va fixer
ces ions et en librer dautres. Inversement si une
plante absorbe certains minraux prsents dans
leau, le CAH va en librer jusqu ce quun nouvel
quilibre soit atteint.

Ca2+

K+
_

NH4

_
Ca2+

CAH

_
_

Mg2+

_
+

K+

_
+

contre les mauvaises herbes et les nuisibles. Ces


pratiques peuvent avoir des consquences nfastes
sur lenvironnement et la sant.
Les engrais apportent principalement les lments
azote (N), phosphore (P) et potassium (K) dont
les proportions sont adaptes en fonction du type
de culture, mais aussi des proprits du sol et des
besoins de la plante chaque tape de son cycle
de croissance. Un excs dengrais peut tre aussi
nocif pour une plante que son absence ! De plus,
lutilisation excessive dengrais peut polluer les
eaux superficielles ou souterraines et contribuer
des phnomnes tels que leutrophisation des cours
deau et les mares vertes.
Les pesticides, eux aussi, doivent tre utiliss de
manire raisonne et approprie : herbicides, fongicides, insecticides, et autres substances destines
lutter contre les nuisibles, sont gnralement peu
dgradables. Ils contribuent la pollution de leau, et
peuvent tre absorbs par des animaux et transmis
toute la chane alimentaire.

Doser les substances actives

Le dosage par comparaison est une mthode de


dosage facilement accessible, puisquelle permet de
dterminer sans calcul (ou presque) la concentration
dune substance donne dans un chantillon, en la
comparant avec une ou plusieurs solutions talons
de concentration connue de cette mme
substance. Le dosage par comparaison peut
PO34prendre plusieurs formes :
comparaison visuelle avec une chelle
de teinte (si la substance recherche est
colore, ou si on peut faire apparatre une
substance colore par raction chimique de
Ca2+
cette substance avec un ractif) ;
utilisation dun graphique liant un para_
mtre mesurable avec la concentration de
+
la solution. Ce paramtre peut tre labsorH
bance mesure par un spectrophotomtre, le
_
volume ajout dans un dosage volumtrique,
etc. ;
_
utilisation dune relation de proportionna+
lit entre un paramtre mesurable (comme
NH4
_
prcdemment) et la concentration de la
solution.

Mg2+

Modlisation du complexe argilo-humique.

Les mthodes utilises pour


augmenter les rendements
agricoles
Un agrosystme est un cosystme cr par
lhomme dont la productivit est bien suprieure
celle dun cosystme naturel. Pour augmenter le
rendement des cultures, lhomme utilise des engrais
pour fertiliser les sols et des pesticides pour lutter

DEUX ARTICLES DU MONDE


CONSULTER
t1PMMVUJPOMhB[PUFVOFMPVSEFGBDUVSF
pour l'Europe p. 16
(Laetitia Van Eeckhout, 14 avril 2011)

tDe l'herbicide Roundup mesur dans


l'eau de pluie p. 17
(Stphane Foucart, 9 septembre 2011)

ZOOM SUR
Les ions.
t -FT JPOT TPOU EFT QBSUJDVMFT
charges lectriquement. Ces dernires sont formes dun atome,
ou dun groupe datomes, qui ont
gagn ou perdu un ou plusieurs
lectrons. La valeur de la charge
lectrique de lion est indique
la fin de la formule chimique
de ce dernier, en exposant, en
multiple de la charge lectrique
lmentaire e.
Ces ions, parmi lesquels le calcium, le magnsium et le sodium,
par exemple, sont prsents dans
l'eau en quantit infime et sont
indispensables pour tous les
tres vivants, animaux et vgtaux.
t%FOPNCSFVYJPOTTPOUJEFOUJfiables par des ractions caractristiques, par exemple :
lion chlorure ragit avec une
solution de nitrate dargent,
formant un prcipit blanc qui
noircit la lumire ;
les ions calcium et magnsium
ragissent avec une solution de
noir riochrome T (NET) pH =
10 : la solution de NET vire du
bleu au rose ;
lion sulfate ragit avec une
solution de chlorure de baryum,
formant un prcipit blanc ;
lion carbonate ragit avec les
acides. On observe un dgagement gazeux de dioxyde de carbone (qui trouble leau de chaux) ;
lion potassium donne une
flamme violette lors du test la
flamme, etc.
t -B GPSNVMF EF DFSUBJOT JPOT
chargs positivement (cations) et
ngativement (anions) :
lion calcium Ca2+ ;
lion magnsium Mg2+ ;
lion potassium K+ ;
lion sodium Na+ ;
+
lion ammonium NH4 ;
+
lion hydronium H3O ;
lion chlorure C1- ;
lion nitrate NO-3 ;
lion sulfate SO24- ;
lion carbonate CO23- ;
lion hydrognocarbonate HCO-3 ;
lion phosphate PO43 - ;
lion hydroxyde HO-.

Nourrir l'humanit (1re)

13

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

tude de documents :

REPRES
t-hFBVFORVFMRVFTDIJGGSFT
884 millions de personnes nont
pas accs une eau potable de
qualit ;
2,6 milliards de personnes ne
disposent pas dinstallations
sanitaires de base ;
2 millions de personnes, surtout
des enfants, meurent la suite
dinfections lies une eau impropre la consommation.
t -BDDT  MFBV QPUBCMF EFWJFOU
un droit de lhomme grce au
texte de lOnu du 28 juillet 2010.
Le texte dclare que le droit une
eau potable propre et de qualit et
des installations sanitaires est un
droit de lhomme, indispensable
la pleine jouissance du droit la vie
(Onu, rsolution du 28 juillet 2010.)

ZOOM SUR
La pollution des cours deau en
France.
Entre janvier 2008 et dcembre
2010, on comptabilise :
643 dversements de carburants,
huiles de vidange et/ ou lubrifiants
dans les cours deau ;
7 500 tonnes dhydrocarbures
rejets dans les eaux douces dont
4 000 tonnes dans la plaine de
la Crau en aot 2009 (Bouchesdu-Rhne) et 478 tonnes dans
lestuaire de la Loire, Donges, en
mars 2008.
Ces catastrophes, qualifies de
mares noires intrieures, ont
un impact non-ngligeable sur
lenvironnement.
(Source : Galle Dupont, Forte
progression de la pollution des
cours deau en France, Le Monde,
10.03.2011.)

14

Nourrir l'humanit (1 )

t5SBJUFSMFTEPDVNFOUTTBOTMFTNFUUSFFOSFMBUJPO
t0VCMJFSEhUPGGFSTFTSQPOTFTMhBJEF
de ses connaissances.

Analyse de leau dun village


Les documents

Le sujet

Document 1
Rsultats des analyses du contrle sanitaire des eaux destines la consommation humaine.
1BSBNUSF

Valeur
+

Limite de qualit

Rfrence de qualit

Ammonium (en NH4)


Bact. ar. revivifiables 22- 68 h
Bact. ar. revivifiables 36- 44 h
Bact. et spores sulfitordu./100ml

< 0,04 mg/L


0 n/mL
0 n/mL
0 n/100 mL

0 n/100 mL

Bactries coliformes/100ml - MS

0 n/100 mL

0 n/100 mL

Carbone organique total


Chlore libre
Chlore total
Coloration

1,5 mg/L C
< 0,10 mg/LCl2
0,10 mg/LCl2
< 5 mg/L Pt

2 mg/L C

Conductivit 25 C

421 S/cm

Entrocoques / 100 ml-MS

0 n/100 mL

0 n/100 mL

Escherichia coli / 100 ml-MF


Fer total
Escherichia coli / 100ml - MF
Nitrates (en NO-3)

0 n/100 mL
<20 g/l
0 n/100 mL

0 n/100 mL

65 mg/L

50 mg/L

Nitrates (en NO-2)


Odeur (qualitatif)
Temprature de leau
Titre alcalimtrique
Titre alcalimtrique complet
Titre hydrotimtrique
pH

<0,02 mg/L
0 qualit.
10,0 C
< 1,0 F
6,8 F

0,5 mg/L

00,1 mg/L

15 mg/L Pt
200 et

1100 S/cm

Le commentaire argument
Un agriculteur du village utilise 175 kg/ha dazote
pour ses cultures de pommes de terre. Dveloppez
une argumentation pour le convaincre de diminuer
cet apport dazote aux cultures.

25 C

6,5 et

Le corrig des questions

9 unit pH

1. Dans le document 1, il sagit de reprer les paramtres dont les valeurs ne respectent pas les limites de
qualit : toutes les valeurs des paramtres sont dans

Source : ministre du Travail, de lEmploi et de la Sant.


Nitrates rsiduels en mg/kg de sol

Document 2
Devenir des engrais dans lenvironnement dans une
exploitation marachre.

100

40
20
0
0

50

100

125

150

175

%PTFEhB[PUF FOLHIB

Lessiv

Dispers dans
latmosphre

Aquifre contenant
la nappe phratique

Infiltr

Cultures marachres

Roche

Le corrig du commentaire
argument
Lanalyse du sujet du commentaire
Il sagit de convaincre un agriculteur dutiliser moins
dengrais en vous rfrant aux documents et vos
connaissances. Les rsultats et les conclusions des
documents du sujet sont rinvestir. Vous devez
rdiger une lettre lagriculteur avec des arguments
scientifiques en faveur dune rduction dengrais.

Proposition de corrig

60

Exfiltr de la

les normes lexception des nitrates dont la valeur


est de 65 mg/L alors que la limite de qualit est une
valeur infrieure 50 mg/L : le critre de potabilit
de leau nest pas respect.
2. Ltude du document 2 permet de prsenter le trajet
des engrais, il est relier vos connaissances sur
le complexe argilo-humique. La partie des engrais
qui sinfiltre dans le sol interagit avec le complexe
argilo-humique. Le document 3 traduit la quantit
de nitrates rsiduels dans une ferme produisant des
pommes de terre en fonction de lapport dazote.
Il faut donc mettre en vidence le lien entre lapport
dazote et nitrates rsiduels : en absence dapports
dazote, 48 mg/kg de nitrates rsiduels ; stabilisation
des nitrates rsiduels 60 mg/kg pour des apports
entre 110 kg/ha 137 mg/kg ; au-del de cette valeur,
excs dazote qui ne peut tre prlev par la culture.
Ainsi, un excs dapport dazote provoquera un
excs de nitrates rsiduels trs solubles dans le sol
qui, par lessivage et/ ou infiltration, provoquera
la pollution des aquifres, nappes phratiques et
rivires notamment.

NOTIONS CLS
Lutte biologique
La lutte biologique protge les
cultures des parasites et des insectes ravageurs en utilisant des
insectes entomophages (se nourrissant dautres insectes). Il existe
plusieurs milliers de ces espces.
On distingue les prdateurs et les
parasitodes. Les prdateurs se
dveloppent en attaquant dautres
insectes et se nourrissent de leurs
cadavres. Citons, par exemple, les
coccinelles qui se nourrissent de
pucerons.
Les parasitodes sont des parasites
dont la vie larvaire se droule aux
dpens dun ou plusieurs htes,
provoquant leur mort plus ou
moins long terme. Ce sont principalement des diptres ou des
hymnoptres.
Les avantages de la lutte biologique sont nombreux :
dispersion importante des insectes ;
attaque cible du ravageur ;
effet durable ;
respect de lenvironnement ;
absence de pollution ;
scurit alimentaire.

120

80

Pulvris

Les questions
Le maire de ce village a mis un avis dconseillant
provisoirement la consommation de leau du robinet.
laide des documents et de vos connaissances, rpondez aux questions suivantes :
1. Justifiez lavis mis par le maire.
2. Montrez comment lapport dazote par les agriculteurs peut tre source de pollution de leau. Votre rponse prendra en compte notamment les interactions
entre le sol et les nitrates en termes, dchanges dions.
Remarque : dans ce sujet, les documents ne sont pas
abords dans lordre et cest vous de bien reprer quel
document permet de rpondre chaque question.

< 200 g/L


0 n/100 mL

8,05 unit pH

Document 3
Quantit de nitrates restant dans le sol aprs la rcolte
en fonction de la dose dazote apporte la culture.
Lazote est un lment fertilisant mais il est galement
potentiellement polluant car son utilisation peut
conduire une accumulation de nitrates dans les
sols. Une exprimentation a t ralise au Qubec
dans une ferme produisant des pommes de terre. Les
rsultats calculs partir des donnes de 2004, 2005
et 2006 sont reports sur le
graphique suivre.
re

Ce quil ne faut pas faire

Document 4

Rendement relatif dun champ de pommes de terre


en fonction de la dose dazote applique lors de la
plantation.
Rendement relatif en %
100
50
60
40
20
0

%PTFEhB[PUFFOLHIB
0
0

50
50

100
100

150
150

Monsieur,
Vous cultivez des pommes de terre et vous utilisez 175 kg/ha dazote afin daugmenter le rendement. Au regard des
analyses et des tudes scientifiques ralises, cet apport dengrais nest pas le plus adapt. Votre objectif est, bien sr,
daugmenter votre production de pommes de terre par hectare, tout en rduisant le cot de production. Cependant,
il est galement essentiel de prserver lenvironnement des pollutions. Plusieurs arguments sont en faveur dune rduction de votre pandage dengrais. Tout dabord, les analyses deau de votre village rvlent un excs de nitrates.
Leur valeur est de 65 mg/L alors que la valeur limite de potabilit est fixe 50 mg/L. Il y a donc pollution de la nappe
phratique, ce qui rend leau du robinet impropre la consommation (document 1). Un excs de nitrates dans leau
est un risque pour la sant et plus particulirement pour les femmes enceintes et les bbs. Dans lorganisme, les
nitrates se transforment en nitrites qui rduisent les capacits de transport du dioxygne par lhmoglobine. plus
long terme, les nitrates participent la formation de nitrosamines ayant des effets cancrignes. Lexcs de nitrates
est directement li la quantit dazote pulvrise dans les champs. En effet, seule une certaine quantit dazote, sous
forme dions nitrates, peut-tre fixe par le complexe argilo-humique du sol et absorb par les plantes. Lexcs est
lessiv par les pluies et entran vers la nappe phratique et les rivires (document 2). Ce qui provoque une prolifration des algues qui consomment le dioxygne de leau aux dpens de certaines espces de poissons qui risquent de
disparatre. Les consquences sur lenvironnement sont donc importantes. Les tudes pour un champ de pommes de
terre ont montr quun apport dazote jusqu 137 kg/ha augmente peu la quantit de nitrates rsiduels (60 mg/kg) mais
quau-del laugmentation est trs importante, provoquant alors une pollution des rserves aquifres. Un apport de
175 kg/ha entrane 100 mg/kg de nitrates rsiduels (document 3).
Vous craignez une baisse de vos rendements si vous diminuez la dose dengrais azots En ralit, les mesures de
rendements pour un champ de pommes de terre montrent quils sont au maximum pour un apport de 125 kg/ha.
En dessous ou au-dessus de cette valeur, le rendement diminue (document 4) ! Au vu de tous ces lments, je vous
conseille donc de rduire votre apport dengrais 125 kg/ha, ce qui vous permettra dobtenir un rendement maximal,
de rduire votre cot de production par diminution des frais dengrais, tout en prservant la nappe phratique
des pollutions en nitrates.

Pluies acides
Les pluies acides rsultent des
pollutions atmosphriques dues
lindustrie et aux vhicules. Ce
sont essentiellement du dioxyde
de soufre (SO2) et des oxydes
dazote (NOx) qui sont transports par les vents et qui retombent
au sol avec les prcipitations.
Si lacidit nest pas neutralise,
elle provoque des dommages
sur les vgtaux, sur la faune et
la flore aquatique et modifie la
qualit des sols.
Les dgts dans les forts sont
importants, les feuilles des arbres
sont abmes, il y a dfoliation,
donc moins de photosynthse
et une rduction de la croissance
des plantes.
Les btiments galement sont
endommags puisque lacidit
attaque les pierres tendres telles
que le calcaire.
Par exemple, le Colise de Rome
ainsi que le Taj Mahal en Inde,
classs au patrimoine mondial
de lhumanit, sont altrs par les
pluies acides.

200
200

Nourrir l'humanit (1re)

15

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

LES ARTICLES DU

Pollution lazote : une


lourde facture pour lEurope

De lherbicide Roundup
mesur dans leau de pluie

Une tude sans prcdent value de 150 740 euros par habitant et par an son cot
sanitaire et financier.

Lorsquon le cherche, on finit bien souvent par le trouver. Cest, en somme, le message de
travaux rendus publics par lUS Geological Survey (USGS) fin aot, attestant de lubiquit
du glyphosate la molcule active du Roundup, lherbicide le plus utilis au monde.

ersonne nignorait que


lusage dengrais en agriculture, comme la combustion dnergies fossiles dans
lindustrie ou la forte circulation
automobile en zones urbaines,
avait un impact sur lenvironnement, travers la dispersion de
composs azots comme les nitrates. Mais jamais son cot tant
conomique que sanitaire navait
t valu en Europe. Or celui-ci
est loin dtre ngligeable, rvle
une tude rendue publique, lundi
11 avril, lors dune confrence
internationale Azote et changement global , organise par le
Centre dcologie et dhydrologie
ddimbourg (cosse).
Fruit de cinq annes de travail
men par des chercheurs de toute
lEurope, cette tude, valuation
europenne pour lazote , estime
le cot annuel des dommages
causs par lazote dans lUnion
europenne de 70 320 milliards
deuros, soit de 150 740 euros par
personne et par an.
En augmentant les rendements
agricoles, les engrais azots ont
certes permis daccompagner la
demande alimentaire croissante.
Il nempche, ce cot des dommages lis aux excs dazote dans
lair, les sols et leau, est nettement plus lev quon ne limaginait , reconnat Jean-Franois
Soussana de lInstitut national de
la recherche agronomique (Inra),
qui a pris part cette tude.
Plus de 10 millions dEuropens
rsident dans des zones o le taux
de nitrates dans leau dpasse les
seuils rglementaires, avec des
risques sur la sant sils boivent
rgulirement cette eau sans
quelle soit bien traite. La pollution azote de lair due la pulv-

16

Nourrir l'humanit (1re)

risation dengrais sur les cultures


agricoles, mais aussi lindustrie
et la circulation urbaine, entrane elle-mme la formation de
particules lorigine de maladies
respiratoires et pouvant rduire
lesprance de vie de plusieurs
mois. Cette pollution de lair aurait ainsi entran, en 2000, la
mort prmature de 300 000
400 000 personnes en Europe.
cela sajoutent les phnomnes dalgues vertes et de zones
marines biologiquement mortes
provoqus par les nitrates qui
se rpandent le long des ctes
bretonnes, en mer du Nord, en
Adriatique et dans la Baltique.
Autant de phnomnes qui
entranent des cots en matire
de sant, de traitement et dpuration des eaux, auxquels il faut
intgrer les pertes, difficilement
chiffrables, lies la dgradation
des cosystmes et laugmentation des missions de gaz effet
de serre responsable du changement climatique.
Ces cots reprsenteraient,
selon ltude, plus du double des
bnfices rsultant de lutilisation de lazote dans lagriculture
europenne. Autrement dit, seraient deux fois plus levs que
les gains de rendements agricoles
permis par le recours des engrais chimiques.
Pour les chercheurs, une prise
de conscience simpose sur la
ncessit de rduire les excs
dazote dans lenvironnement.
Cette rduction passe notamment par une volution des
pratiques agricoles lorigine
des fortes concentrations de nitrates dans les grandes rgions
de culture.
Ainsi, parmi les zones affichant

un taux trs lev de pollution de


lair par lammoniac figurent la
Bretagne et le nord de la France,
la plaine du P en Italie, le sud
de lAllemagne, le centre de la
Grande-Bretagne, les Pays-Bas,
une partie du Danemark. Autant
de rgions de cultures et dlevages intensifs.
Le choix a t fait en Europe
dune certaine spcialisation rgionale alors quune polyculture
associe de llevage permettrait une meilleure gestion de
lazote , relve Jean-Franois
Soussana. En partie du fait de
cette spcialisation rgionale,
aujourdhui, les effluents
dlevage sont davantage considrs comme un dchet quils
ne sont utiliss comme fertilisants , abonde Pierre Cellier,
autre chercheur de lInra ayant
contribu ltude, or le lisier
issu des exploitations dlevage
peut sutiliser comme engrais
organique pour les cultures vgtales . Cela permettrait de
minimiser la dispersion dazote
dans lenvironnement.
Pour Pascal Ferey, charg de lenvironnement la Fdration nationale des syndicats dexploitants
agricoles (FNSEA), encore faudrait-il
que la rglementation franaise
et europenne encourage de tels
transferts. Or dans les zones fortement exposes la pollution, dun
ct, le taux dazote organique issu
des levages est fix 170 kg maximum par hectare et par an et, de
lautre, les exploitations de cultures
de vgtaux peuvent utiliser plus
de 200 kg dazote par hectare sous
formes de produits chimiques ,
relve cet agriculteur.
Rduire les excs dazote dans
lenvironnement passe aussi, pour

POURQUOI
CET ARTICLE ?
Cet article retranscrit les
conclusions dune confrence internationale sur
le thme Azote et changement global o les
travaux des chercheurs
ont estim le cot annuel
des dommages causs par
lazote en Europe. Il sagit
dun nouvel clairage sur
le sujet travers une approche globale qui tient
compte des excs dazote
lis aux engrais, mais
aussi lindustrie et la
circulation urbaine. Les
consquences sont multiples : pollution de lair, de
leau et des sols. Les cots
prennent en considration
les dommages sur la sant
des populations, le traitement des eaux, les pertes
lies la dgradation des
cosystmes et finissent
par tre deux fois suprieurs aux bnfices.
Une modification des
pratiques agricoles mais
galement des pratiques
individuelles apparat ds
lors indispensable.

es chercheurs amricains
travaillant dans le cadre
du programme national
dvaluation de la qualit de leau
ont en effet dtect des niveaux
mesurables de glyphosate dans
la majorit des eaux de surface
des rgions agricoles, mais aussi
dans lair et leau de pluie. Ces
mesures constituent le premier
rapport sur les niveaux ambiants
de glyphosate , crivent dans leur
compte rendu Paul Capel, chimiste
lUSGS, et ses coauteurs.
Ces derniers ont collect prs
dune centaine dchantillons dair
et deau de pluie dans trois rgions
agricoles du Mississippi, de lIowa
et de lIndiana, au cours de la saison vgtative. Selon les rgions,
la molcule active du Roundup est
retrouve dans 60 % 100 % des
chantillons. Les quantits mesures demeurent faibles. Dans lair,
elles ne dpassent pas 9,1 microgrammes par litre (g/l) et 2,5 g/l
dans les prcipitations.

Les chercheurs ont aussi tent


destimer la prsence dun rejeton
du glyphosate, lacide aminomthylphosphonique (AMPA), dans
lequel il se dgrade. Celui-ci est
retrouv dans plus de 50 % des
chantillons, des niveaux comparables ceux du glyphosate.
Quel est leffet de telles doses sur
la sant humaine ? Ils sont vraisemblablement tnus. Le glyphosate
nest pas class comme carcinogne.
Quelques tudes pidmiologiques
suggrent nanmoins une incidence
lgrement accrue de cancers du sang
(lymphome non hodgkinien) chez
les utilisateurs rguliers du Roundup.
Dautres chercheurs suspectent un
effet tratogne, le glyphosate serait
responsable de malformations ftales en cas dexposition maternelle.
Quant aux dgts sur lenvironnement, ils demeurent mconnus, mais
des effets sur la faune aquatique (poissons, batraciens) ont t documents
ces dernires annes. Les quantits
pandues ne cessent de crotre. Outre-

POURQUOI
CET ARTICLE ?
Cet article donne un exemple
de contamination de leau
et de lair par un herbicide,
le Roundup, trs utilis aux
tats-Unis. La gnralisation
de cultures gntiquement
modifies, rsistantes lherbicide, y a paradoxalement

Atlantique, elles ont t favorises, ds


1996, par ladoption des cultures gntiquement modifies dites Roundup
Ready , rsistantes lherbicide. Plus
de 90 % du soja, 22 % du mas et
23 % du coton amricains sont ainsi
Roundup Ready .
Les donnes de commercialisation
suggrent que la quantit de glyphosate pandue aux tats-Unis est passe de 9 000 tonnes en 1992 plus
de 80 000 tonnes en 2007. Sans que
cette tendance haussire ne montre

favoris son pandage. Ce


produit contaminant est retrouv dans les eaux de surface en France, illustrant bien
le phnomne de dispersion
des molcules dun continent
lautre, alors quil nexiste
aucune relle possibilit de le
contrler et que les effets sur
la sant et la faune sont mal
connus.

le moindre signe dessoufflement


dans les dernires annes.
Selon un rapport de 2006 de
lInstitut franais de lenvironnement (IFEN), le glyphosate et lAMPA
sont, en France, les contaminants
les plus frquemment retrouvs
dans les eaux de surface, bien quaucune culture Roundup Ready ny
soit pratique.
Stphane Foucart
(9 septembre 2011)

les chercheurs, par une volution des habitudes individuelles.


Lusage de vhicules propres ,
la fin des longs trajets en voiture
ou encore une consommation
raisonne de viande sont en effet
autant de faons de limiter son
empreinte azote .
Laetitia Van Eeckhout
(14 avril 2011)

Nourrir l'humanit (1re)

17

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LES ARTICLES DU

BACTRIE
Micro-organisme unicellulaire
procaryote, dpourvu de membrane nuclaire. Le matriel gntique est dans le cytoplasme.

MOISISSURE
Champignon dont le myclium
forme un feutrage lorsquil se
dveloppe sur la matire organique. Il sobserve facilement sur
des fruits en dcomposition.

PATHOGNE
Se dit de tout organisme qui peut
provoquer une maladie.

TOXI-INFECTION
ALIMENTAIRE
Maladie dveloppe la suite de
lingestion daliments contamins
par des micro-organismes pathognes, bactries, virus, parasites
ou prions. Elle peut concerner de
nombreuses personnes (TIAC : toxiinfection alimentaire collective.).

PERSONNAGE
IMPORTANT

18

Nourrir l'humanit (1re)

otre organisme est constitu deau, de minraux et de molcules organiques dont la dure de vie est limite. Nous
devons donc manger, pour renouveler rgulirement nos
constituants. Des micro-organismes peuvent coloniser et transformer les aliments, ce qui peut tre bnfique ou, au contraire,
porter atteinte au plaisir gustatif ou la sant. Diffrentes techniques de conservation permettent de maintenir la qualit des
aliments et d'empcher la prolifration microbienne.
Les aliments : un bon
milieu de culture pour
les micro-organismes

Les micro-organismes sont des


tres vivants constitus dune
seule cellule. Ils puisent dans
le milieu leurs nutriments et y
rejettent leurs dchets. Chaque
espce microbienne est plus ou
moins exigeante quant aux paramtres physico-chimiques de
son milieu de vie (temprature,
pH, richesse en nutriments et en
oxygne, humidit, taux de sel). Dans
des conditions optimales, les microorganismes se reproduisent rapidement.
Un cycle de reproduction double la population
microbienne. Laliment est rapidement envahi de
micro-organismes et sensiblement transform.
Les transformations sont parfois bnfiques
lhomme, puisquelles peuvent amener la cration dautres aliments (par exemple les produits
laitiers, la bire, le pain, etc.). Elles peuvent aussi
tre nfastes, voire dangereuses, car pouvant tre
lorigine dinfections.

Lintrt des techniques de


conservation pour le consommateur
Les aliments frais sont tous coloniss par des microorganismes, ce qui peut altrer le got, la texture
et lodeur par la production de substances parfois
toxiques, provoquer des infections ou des intoxications alimentaires si la multiplication microbienne
est trop importante. Les micro-organismes sont trs
sensibles aux variations de leur environnement. Le
moindre cart par rapport leurs conditions optimales de vie peut trs vite ralentir leur croissance,
larrter compltement ou mme les tuer (effet
microbicide).
Les conservateurs vont donc agir sur un ou plusieurs
paramtres physico-chimiques de laliment, pour
maintenir ses qualits gustatives, nutritionnelles et

sanitaires, et donc loigner sa date


limite dutilisation optimale
(DLUO) ainsi que sa date limite
de consommation (DLC) :
le chauffage de laliment
est microbicide. Il est dautant plus efficace que la
temprature est leve ;
la strilisation UHT (ultrahaute temprature) strilise
ainsi totalement le lait ;
le maintien au froid permet
de ralentir la croissance des
micro-organismes mais ne les tue
pas ; cest pour cette raison quil ne
faut pas recongeler un produit dcongel
et qui na pas suffisamment cuit ;
lacide prsent naturellement dans certains aliments, comme les fruits, les protge en partie de la
contamination microbienne et de son dveloppement. Les autres aliments peuvent tre acidifis par
ajout de vinaigre (cornichons) ou de jus de citron
par exemple. Laction dun micro-organisme peut
produire un acide qui protge laliment contre les
concurrents pathognes (fermentation lactique des
produits laitiers, de la choucroute, etc.) ;
la dshydratation et la lyophilisation amnent
laliment un taux tellement bas dhumidit que
les micro-organismes meurent ou ne peuvent plus
se dvelopper ;
ladjonction dune grande quantit de sucre, dans
les confitures par exemple, fait clater les microorganismes, ce qui explique la trs longue dure de
conservation de ces produits ;
la salaison lve fortement le taux de sel lintrieur de
laliment et en diminue lhumidit, leffet sur les microorganismes est le mme que la forte teneur en sucre, etc.

Conserver les aliments par des


mthodes chimiques
Les additifs alimentaires destins amliorer la
conservation des aliments ou des prparations

alimentaires se classent en deux grandes catgories :


les conservateurs et les antioxydants.
Les conservateurs alimentaires permettent de
limiter ou de ralentir le dveloppement des micro-organismes prsents dans laliment ou dans
lenvironnement. Ces conservateurs sont dsigns
par un code E2xx dans la liste dingrdients figurant
sur ltiquette.
Certains aliments se dgradent par raction
chimique avec le dioxygne de lair : on dit quils
soxydent. Leur aspect se modifie et leurs qualits gustatives et nutritionnelles sont modifies
(rancissement des matires grasses, noircissement
des fruits, etc.). Cette oxydation est acclre par
lexposition la lumire et la chaleur. Elle peut tre
ralentie par ladjonction dantioxydants, dsigns
par un code E3xx, qui peuvent tre dorigine naturelle (vitamine A, C et E, acide citrique, tanins, etc.)
ou artificielle (par exemple, lhydroxyanisole butyl,
dsign par le code E320).

Conserver les aliments par


des mthodes physiques
Pour viter la dgradation des aliments, on peut les
mettre labri de lair et de leau (sous vide ou sous
atmosphre protectrice), de la lumire (emballage
opaque) ou les refroidir (rfrigration).
On peut aller plus loin en utilisant les changements
dtat de leau contenue dans les aliments :
la conglation utilise la solidification de leau en
glace. Dans ces conditions, les micro-organismes ne
peuvent pas prolifrer, mais ils ne sont pas tous tus ;
la surglation utilise le mme principe mais le
SOLIDE

n
tio
ma
de
bli
oli
su
ns
tio
sa
en
nd
co

Louis Pasteur (1822-1895)


Louis Pasteur est le pionnier de la
microbiologie. Dabord physicien et
chimiste, il travaille sur la dissymtrie
molculaire puis sur les fermentations. Il dmontre que toute fermentation est due la prsence dun microorganisme et constate le rle et la
spcificit daction des microorganismes.
40 ans, Pasteur devient biologiste. Il remet en cause la doctrine
de lpoque sur la gnration
spontane et dcouvre les microorganismes qui se dveloppent en
absence de dioxygne. Il propose
le terme anarobie pour les
dsigner. Ces travaux permettent
dappliquer la mthode microbiologiste lindustrie et lagriculture.
Vers lge de 55 ans, Pasteur oriente
ses travaux vers le domaine mdical.
Il tudie les maladies infectieuses,
labore des mthodes dattnuation
de la virulence des microbes et met
au point le principe de la vaccination. Il cre une nouvelle discipline :
limmunologie. LInstitut Pasteur est
inaugur en 1888.

Les aliments dans notre assiette,


qualit et conservation

fu
sio
n
so
lid
ific
at
ion

MOTS CLS

LESSENTIEL DU COURS

vaporisation
LIQUIDE

GAZ
liqufaction

Les changements dtat physique de la matire.

refroidissement est plus rapide et la temprature


plus basse. Les produits surgels ont une dure
de conservation suprieure celle des produits
congels, et leurs proprits (texture, got,etc.) sont
mieux prserves ;
la lyophilisation permet dliminer plus de 95 %
de leau par surglation puis sublimation (passage
direct de ltat solide ltat gazeux trs basse
pression) ;
lirradiation des aliments par des rayonnements
ionisants, galement appele pasteurisation froid,
autorise en France depuis 2001, vise dtruire les
micro-organismes, ralentir le mrissement et viter
la germination.

Les inconvnients des techniques


de conservation
Les techniques de conservation utilises actuellement
peuvent prsenter des inconvnients importants :
altration des qualits gustatives de laliment
(aspect extrieur, odeur, arme, etc.). Il y a incontestablement une diffrence de got importante entre
le lait cru et le lait UHT, par exemple, car le chauffage
trs haute temprature dtruit de nombreux
composs essentiels, dont certains armes ;
altration des qualits nutritionnelles. La strilisation ou lirradiation des aliments dtruit les
vitamines. Pour cette raison, on doit en rajouter dans
le lait strilis, par exemple, pour garantir une teneur
proche de celle du lait avant traitement. Les conserves
alimentaires sont en gnral beaucoup plus sales
que laliment dorigine, ce qui augmente le got. De
plus, la strilisation UHT modifie les protines du
lait qui sont moins bien assimiles par lorganisme ;
risques pour la sant. Le sel ajout dans de nombreux produits en guise de conservateur provoque,
long terme, une dminralisation de notre squelette
qui se fragilise, et une hypertension artrielle qui
augmente fortement le risque de maladie cardiovasculaire. Le problme est tellement important quil a
t demand aux industriels de lagroalimentaire de
rduire sensiblement la teneur en sel des produits
prpars. Les additifs alimentaires conservateurs
sont galement sur la sellette : de nombreuses de
substances sont considres comme nocives pour
le tube digestif et pour lassimilation des vitamines,
comme allergnes, cancrignes, et mme dangereuses plus court terme pour la sant !

TROIS ARTICLES DU MONDE CONSULTER


t4FMBWFSMFTNBJOT QSFNJFSHFTUFQSWFOUJGp. 22
(Pascale Santi, 23 novembre 2011)

tBactrie E. Coli : faut-il douter de la scurit alimentaire ? p. 23


(Hlne David, 17 juin 2011)

tj-FTHFSNFTDPOTUJUVFOUVONJMJFVUSTGBWPSBCMFBVEWFMPQQFNFOUEFTCBDUSJFTx p. 24
(Christophe Nguyen-The, propos recueillis par Audrey Garric, 7 juin 2011)

ZOOM SUR
Lirradiation des aliments en dbats.
Lirradiation des aliments, ou
ionisation, a t mise en place
dans les annes 1960 dans le but
de dtruire les bactries, de ralentir le mrissement des fruits et
dempcher la germination. Elle
consiste bombarder les aliments
avec des rayons dlectrons acclrs ou avec des rayonnements
mis par des atomes radioactifs
(Csium 137 ou cobalt 60).
Cette technique permet une
meilleure conservation des aliments frais susceptibles dtre
transports pendant plusieurs
jours et sur de longues distances.
Nanmoins, les impacts sur la
sant long terme sont mal
connus et peu tudis par les
organismes officiels. Des laboratoires indpendants ont montr
une rduction de la teneur en
vitamines des aliments ioniss et
des risques deffets cancrignes
pour les aliments contenant des
lipides.
Le Comit franais contre lirradiation des aliments demande
que soit appliqu le principe de
prcaution alors que la technique
est de plus en plus employe.

ZOOM SUR
Une toxine contre les rides : la toxine
botulique.
La toxine botulique est scrte
par une bactrie, le Clostridium
botulinum, prsente dans le sol.
En cas dingestion, elle provoque
rapidement la mort suite la paralysie des muscles respiratoires
et locomoteurs en agissant au
niveau des synapses neuromusculaires.
Des conserves ou des salaisons
mal prpares peuvent tre lorigine de contamination mais sont
extrmement rares de nos jours.
Cette toxine est utilise trs
faible dose en chirurgie esthtique afin de rduire les rides
du visage. Des injections sont
ralises au niveau du visage et
empchent les contractions musculaires.

Nourrir l'humanit (1re)

19

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

ZOOM SUR
La prolifration des bactries.
La multiplication des cellules bactriennes comprend une phase
daccroissement de la cellule
(dimension, masse, volume) puis
une phase de division qui est la
sparation de la cellule mre en
deux cellules filles.
Dans des conditions optimales
de dveloppement (nutriments,
temprature), la population
bactrienne double toutes les
vingt minutes. Ainsi partir
dune seule cellule, en 6 heures,
la population bactrienne atteint
262 144 cellules !

REPRES
Quelques infections alimentaires
dues des micro-organismes.
tLa listriose est due une bactrie Listeria monocytognes qui
provoque un tat pseudo-grippal
et des infections mortelles du
ftus, du nouveau-n ou des enfants prmaturs.
t-FCPUVMJTNFFTUEVOFCBDtrie anarobie, le Clostridium
botulinum, qui libre une toxine,
la toxine botulique, et provoque
des paralysies en agissant sur le
systme nerveux.
t -B TBMNPOFMMPTF FTU EVF  MB
bactrie Salmonella enteridis qui
provoque des gastro-entrites
svres et des cphales.
t -IQBUJUF"FTUEVFVOWJSVT
se dveloppant dans le foie et
provoquant une jaunisse (ictre).
t -B UPYPQMBTNPTF FTU EVF  VO
protozoaire, Toxoplasma gondii.
Elle est bnigne et passe inaperue chez la personne en bonne
sant, elle peut causer des pathologies du ftus chez la femme
enceinte.
t-FTQSJPOTQSPWPRVFOUMBNBMBdie de Creutzfeldt-Jakob.
t -F TZOESPNF INPMZUJRVF
et urmique est une infection
provoque par la bactrie E. Coli
O157:H7.
Cette maladie se traduit par une
gastro-entrite aigu avec des
diarrhes sanglantes et peut entraner des lsions rnales.

20

Nourrir l'humanit (1re)

UN SUJET PAS PAS

tude de documents :
Les salmonelles

Document 3
Les documents
Effet de la temprature sur les micro-organismes.
Document 1
Une maladie lie lalimentation : la salmonellose. Bactries psychrophiles : qui peuvent vivre des
Les bactries responsables de la salmonellose sont tempratures variant de 5 30 C et dont le dveles salmonelles. On les trouve dans lintestin, les loppement est optimal 15 C.
djections et lenvironnement. Linfection se fait par Bactries thermophiles : qui sont capables de vivre
la bouche par le biais de la nourriture ou de leau des tempratures extrmement leves, mortelles
souille. La salmonellose est une maladie grave et pour la majorit des tres vivants.
souvent mortelle pour de nombreux animaux, qui Bactries saprophytes : qui sont capables de se nourrir
peut tre contagieuse pour les hommes. La salmo- de matire organique en dcomposition.
nelle est une bactrie dite "msophile" car
elle se dveloppe dans une fourchette assez + 120C strilisation
destruction des bactries et des spores
large de tempratures (5 C 47 C). Cette
bactrie existe en petit nombre dans les + 100C (bullition de l'eau)
aliments mais un taux trop lev est respon- + 90C (pasteurisation haute)
sable dune TIA (toxi-infection alimentaire) : + 65C (pasteurisation basse)
destruction des bactries pathognes
+ 60C (chaud)
la salmonellose.
Document 2
Tempratures internes de cuisson recommandes pour prserver la scurit alimentaire.
t#VG WFBVFUBHOFBV NPSDFBVYFUQJDFT
entires) :
mi-saignant, 63 C ;
point, 71 C ;
bien cuit, 77 C.
t1PSD NPSDFBVYFUQJDFTFOUJSFT
$
t7PMBJMMF QBS FYFNQMF QPVMFU  EJOEF  DBnard) :
morceaux, 74 C ;
volaille entire, 85 C.
t7JBOEF IBDIF FU NMBOHFT EF WJBOEFT
(par exemple hamburgers, saucisses, boulettes de viande, pains de viande, ragots) :
buf, veau, agneau et porc, 71 C ;
volaille, 74 C.

+ 40C

(tide)

+ 30C

+ 5C rfrigration
habituelle

limite infrieure de la dsactivation thermique


des bactries saprophytes classiques
dveloppement des bactries thermophiles
(Legionella spp.)
dveloppement rapide des bactries
mesophiles
zone de risque maximum
dveloppement lent des bactries et autres
micro-organismes

dveloppement lent des bactries psychrophiles


(Listeria spp, Yersinia enterocolitica)
dveloppement quasi-nul des autres bactries
dveloppement possible des moisissures
0C

18C

rfrigration
basse
conglation

tUSFDPOGVTEBOTTFTFYQMJDBUJPOT
t"GmSNFSTBOTVUJMJTFSEFEPOOFTTDJFOUJmRVFT
pour appuyer ses arguments.
t/FQBTSFTQFDUFSMBGPSNFEVUFYUFEFNBOE 
ici un article de presse.

Le corrig des questions


1. Linformation se trouve dans le document 3.
Parmi les techniques de conservation des aliments
cites, on peut distinguer la conglation, la cuisson,
la pasteurisation et la strilisation.
Vous devez classer ces techniques dans deux catgories : les transformations physiques savoir conglation, pasteurisation, strilisation, et les ractions
chimiques comme la cuisson.
2. Conseils : Partir des donnes du document 1 pour
reprer les caractristiques des salmonelles et les
mettre en lien avec celles du document 3 en prcisant
leffet de la temprature sur le dveloppement des
bactries. Utiliser vos connaissances sur la multiplication cellulaire des bactries.
Les salmonelles sont des bactries msophiles qui
se dveloppent dans une fourchette de temprature
entre 5 C et 47 C (document 1).
En dessous de 5 C, les salmonelles arrtent leur
dveloppement mais ne sont pas dtruites. Les
ractions chimiques ncessaires au dveloppement
ne peuvent plus se raliser.
partir de 5 C, les bactries se multiplient lentement, puis leur dveloppement saccrot avec

laugmentation de la temprature. Les conditions


optimales de temprature se situent vers 37 C. En
effet, une temprature leve favorise la prolifration des cellules. Par contre au-del de 47 C, les
bactries sont dtruites par la chaleur (documents 1
et 2).

Le corrig du commentaire
argument
Conseils : Accordez-vous un peu de fantaisie et
laissez aller votre imagination pour la rdaction de
cet article de presse.
Essayez de trouver des titres accrocheurs. Le corps du
texte doit respecter la rigueur scientifique et votre
argumentation doit sappuyer sur les documents
prcdents mais aussi sur vos connaissances scientifiques et votre culture gnrale.
Noubliez pas dutiliser des connecteurs logiques
(donc, puisque, etc.) qui mettent en vidence votre
argumentation.
Citer les valeurs de temprature avec prcision vous
permettra de gagner des points.
Lanalyse du sujet
On vous suggre lexemple traiter, savoir lachat
dun steak hach surgel. vous de convaincre le
consommateur dadopter les bonnes attitudes pour
respecter la chane du froid.
La problmatique
Au regard des conditions de dveloppement des
salmonelles, quels gestes le consommateur doit-il
adopter pour viter les intoxications alimentaires
dues la prolifration des bactries sur les aliments ?

Proposition de corrig
Des mesures simples pour une bonne hygine alimentaire !
arrt de tout dveloppement et activit
(les micro-organismes ne sont pas dtruits)

Le sujet
Les questions
1. Relevez, parmi toutes les techniques de conservation
voques, celles qui impliquent une transformation
physique et celle qui met en jeu une raction chimique.
2. Expliquez leffet de la temprature sur le dveloppement des salmonelles.

La bactrie salmonelle, du genre Salmonella.

Ce quil ne faut pas faire

Le commentaire argument
La conservation des aliments pose des problmes en
termes de sant individuelle et publique. Vous rdigerez
un article de presse visant sensibiliser les consommateurs cette question et notamment les convaincre
dadopter des attitudes responsables entre lachat dun
steak hach surgel et la consommation de celui-ci, cru
ou cuit, pour prserver leur sant.
Vous dvelopperez votre argumentation en vous appuyant sur les documents et votre culture (qui intgre,
entre autres, les connaissances acquises dans diffrents
champs disciplinaires).

Rgulirement, la multiplication de bactries pathognes sur des aliments provoque des infections qui ont
des consquences plus ou moins graves sur la sant : gastro-entrites, infections diverses En 2011, en Allemagne, une contamination des aliments par la bactrie pathogne E. Coli a ainsi provoqu plusieurs morts
et entran des lsions irrversibles de certains organes chez dautres patients.
Une autre bactrie pathogne, la salmonelle, qui se dveloppe sur les aliments, est responsable dune infection chez lhomme, la salmonellose. Or des mesures simples permettraient dviter ce genre de catastrophes !
La temprature, surveillez la temprature !
Prenons un exemple simple : vous achetez au supermarch un steak hach surgel. Que faites-vous entre
le moment de son achat et sa consommation pour viter la prolifration des micro-organismes pathognes
comme par exemple les salmonelles ? Le respect des tempratures de conservation est alors essentiel. Tout
dabord, munissez-vous dun sac isotherme ou dune glacire afin de maintenir la temprature de votre
viande surgele pendant le transport jusqu votre domicile. Ds votre arrive, placez votre steak au conglateur (-18 C) ou dcongeler dans votre rfrigrateur (5 C).
-18 C, les micro-organismes arrtent tout dveloppement mais ne sont pas dtruits. 5 C, les salmonelles
et autres micro-organismes se dveloppent trs lentement mais il est toutefois prfrable de consommer
assez rapidement votre viande. Au moment de la consommation de la viande et avant chaque repas, lavezvous les mains pour viter un apport externe de micro-organismes (les salmonelles se trouvent dans lintestin, les djections et lenvironnement).
Si vous dcidez de manger la viande crue, il faudra la consommer rapidement car les bactries prolifrent
temprature ambiante (20 C). Si vous cuisez la viande, il est conseill de la porter plus de 71 C, ce qui
dtruit toutes les bactries pathognes.
Le respect des tempratures de conservation et de cuisson, alli une bonne hygine personnelle limitent
les risques dinfections.

NOTIONS CLS
Chane du froid
Lorsquun aliment est transport,
il doit tre conditionn dans des
locaux ou des vhicules qui respectent les tempratures de conservation tout au long du transport : il
sagit de la chane du froid.
Fermentation
La fermentation est une raction
biochimique qui se ralise grce
laction denzymes microbiennes
et qui libre de lnergie partir
dun substrat organique.
Cette raction se droule en absence de dioxygne (O2), donc
en anarobiose, contrairement
la respiration qui ncessite du
dioxygne de lair (arobiose).
Suivant le type de fermentation,
diffrents produits sont synthtiss et de lnergie est libre.
Le rendement nergtique est
faible compar celui de la respiration.
Vitamines
Les vitamines sont des substances organiques ncessaires,
trs faibles doses (quelques milligrammes ou microgrammes),
puisquindispensables la croissance, au fonctionnement global
du corps et au fonctionnement de
la reproduction.
Elles jouent un rle dans lassimilation et lutilisation des nutriments. Lorganisme est capable
de synthtiser la vitamine D, la
vitamine B2 et la vitamine K, les
autres devant tre apportes par
lalimentation, notamment par
les fruits et les lgumes.
Il existe treize vitamines. On
distingue les vitamines hydrosolubles, cest--dire solubles
dans leau (vitamines B1, B2, B3,
B5, B6, B8, B9 et B12, C ou acide
ascorbique) et les vitamines liposolubles cest--dire solubles dans
les lipides (vitamines A ou rtinol,
E, K, vitamines D).
Des carences en vitamines peuvent entraner des troubles plus
ou moins graves. Ainsi une carence en vitamine C provoque
le scorbut qui se manifeste par
des troubles cutans, des troubles
dentaires, de la fatigue et une
anmie.

Nourrir l'humanit (1re)

21

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

LES ARTICLES DU

LES ARTICLES DU

Ce rflexe rduit la transmission des gastro-entrites et des maladies respiratoires,


surtout lhiver.

es pidmies de grippe,
bronchiolite, rhume et
autres affections saisonnires commencent svir
avec les premiers frimas. Trs
contagieuses, ces maladies
infectieuses touchent des
dizaines de millions de personnes chaque anne. La grippe
frappe quelque 2 millions de
Franais, les rhumes et les
rhino-pharyngites en touchent
plusieurs dizaines de millions.
Et les gastro-entrites en indisposent entre 1,5 et 3 millions.
Dans un spot tlvis, lInstitut
national de prvention et dducation pour la sant (INPES) rappelle
de bien se laver les mains. Il

faut aussi viter les contacts


rapprochs avec des personnes
malades, porter un masque,
utiliser des mouchoirs usage
unique, ou nettoyer la porte
des toilettes Autant de gestes
qui freinent la transmission
des virus, mais qui ne sont pas
encore devenus des rflexes.
Les virus des infections
respiratoires se transmettent
par des gouttelettes pulvrises
lorsquune personne tousse ou
ternue. Les particules dans
lair peuvent aussi tre contaminantes dans une pice confine. De mme, une personne
qui se mouche, ou se touche la
bouche, conserve des particules
virales sur les mains, quelle
peut transmettre dautres,
explique le docteur Christine
Jestin, mdecin de sant publique, spcialiste des maladies
infectieuses lINPES. Pour la
gastro-entrite, les modes de
transmission se font surtout

22

Nourrir l'humanit (1re)

par les mains, par exemple


en contaminant les aliments
que lon prpare si les mains
contiennent des particules
virales.
Plusieurs tudes, notamment
celle de lpidmiologiste amricaine Allison Aiello, montrent
que le lavage des mains est
trs efficace dans la prvention
des infections gastro-intestinales (il les rduirait de 31 %)
et dans une moindre mesure
des maladies respiratoires
(avec une rduction du risque
de 21 %). Une tude ralise sur
23 paires de lunettes en 2008
par le laboratoire dhygine de
la ville de Paris avait montr
la prsence de staphylocoques
sur plus dun tiers dentre elles,
rappelle le docteur Fabien Squinazi, directeur du laboratoire.
Les objets usuels, notamment
les combins tlphoniques,
sont des nids microbes.
Trs mdiatis lors de lpidmie de grippe A(H1N1) en
2009, lintrt pour le lavage
des mains est retomb depuis.
Seules les solutions hydro-alcooliques continuent dtre
utilises. Surfant sur la vague,
le fabricant Dettol a organis,
mardi 9 novembre, lInstitut Pasteur, le lancement dun
nouveau produit, No-Touch,
un distributeur automatique
infrarouge de savon liquide
antibactrien usage domestique.
45,3 % des personnes interroges dclarent se laver rgulirement les mains, 30,2 %
voquent une bonne hygine
corporelle et 14,7 % une bonne

hygine en gnral , indiquait


ltude Nicolle ralise en 2006
par lINPES avec lInstitut national de veille sanitaire (InVS).
Seuls 32 % des hommes interrogs (contre prs de 53 % des
femmes) dclaraient faire ce
geste plus de dix fois par jour.
Cette rgle dhygine lmentaire est frquemment
applique aprs un passage
aux toilettes et avant les repas :
un message classique dlivr
ds lenfance qui sinscrit dans
le cadre de normes sociales
et dans celui de la protection
contre les microbes.
Autre rflexe avoir pour
combattre les virus, arer quotidiennement sa maison ou
son appartement, surtout les
chambres : dix minutes suffisent. Et nettoyer rgulirement sanitaires, cuisine La
comprhension du rle de
lhygine, en particulier dans la
prvention des maladies infectieuses, la fin du XIXe sicle, a
permis de rduire sensiblement
la transmission de ces maladies.
Mais lavnement des vaccins,
des antibiotiques et les efforts
des pouvoirs publics ont pu
provoquer un relchement de
lattention pour lhygine, notamment des mains, mentionnent Christine Jestin et Arnaud
Gautier, de lINPES.
Des mesures spcifiques doivent tre prises avec les bbs,
plus vulnrables. En hiver,
il est prfrable quils vitent
les lieux de grande frquentation , insiste la pdiatre
Claude Guyou-Estable. LINPES
conseille de porter un masque

POURQUOI
CET ARTICLE ?
Mieux vaut prvenir que
gurir... Contre les maladies
dont les modes de transmission sont connus, la
prvention reste le meilleur
remde. Cet article reprend
les consignes lmentaires
dhygine qui permettent
dviter les infections,
notamment les gastro-entrites et les maladies respiratoires (frquent lavage
des mains, aration des
habitations). Limpact des
virus ou des bactries sur
la sant est considrable,
alors que des mesures
prventives extrmement
simples mettre en application constituent un rel
frein la propagation dune
pidmie.

pour soccuper dun bb ds


que lon a un rhume.
Mais attention, le renforcement de lhyginisme expliquerait laugmentation forte
des allergies , selon Bertrand
Delaisi, pdiatre spcialis en
pneumologie et praticien
lhpital Robert-Debr. Tous les
germes ne sont pas nos ennemis. Le corps humain comporte
des milliards de bactries, plus
que de cellules, qui ne provoquent aucune maladie dans des
circonstances normales.
Pascale Santi
(23 novembre 2010)

Bactrie E. coli : faut-il douter


de la scurit alimentaire ?
Jeudi, sept enfants originaires du Nord-Pas-de-Calais taient hospitaliss la suite
dune intoxication par une bactrie E. coli. Tous ont en commun davoir consomm
des steaks hachs ou boulettes de viande de la marque Steak Country , distribus
par les magasins Lidl. Cette affaire de sant publique survient aprs la contamination
en mai de plusieurs milliers de personnes par une autre forme de cette mme bactrie
prsente dans des graines germes (lentilles, luzerne, soja) produites en Allemagne et
responsables du dcs de 39 personnes en Europe.

ne lgislation stricte
Cest le Parlement europen et le Conseil
des ministres europen qui
dfinissent les rglements en
vigueur concernant lhygine
alimentaire, conseills par
lAutorit europenne de scurit des aliments. Appliqus
lchelle des tats membres,
ils portent sur des procdures
trs strictes et sont fonds sur
une politique dite de la ferme
la table , cense garantir la
scurit alimentaire toutes
les tapes de la production et
de la distribution des denres.
La section V du rglement europen fixant des rgles spcifiques dhygine applicables aux
denres alimentaires dorigine
animale est entirement ddie aux viandes haches, prparation de viandes et viandes
spares mcaniquement . Elle
prvoit, en dtail, les exigences
concernant les tablissements
de production, les matires
premires, lhygine gnrale
pendant la production et ltiquetage.
On y prcise aussi bien la temprature de leau destine net-

toyage des outils que les dlais


de prparation aprs labattage
des animaux ou les conditions
de la conglation des produits.
Des contrles rguliers
Afin davoir lassurance
du respect scrupuleux de ces
rglements, la Direction gn-

rale de la concurrence, de la
consommation et de la rpression des fraudes (DGCCRF) et
la Direction gnrale de lalimentation (DGAL) effectuent
rgulirement des contrles
sanitaires bass sur une analyse des risques, prenant en
compte les stades de production et les produits les plus
risqus. En 2010, la DGAL, charge notamment de la scurit
des aliments dorigine animale,
a effectu par exemple plus de
300 000 contrles en levage
et 65 000 prlvements. Les fabricants ont eux-mmes lobligation de mener des autocontrles sur leurs produits,
comme lanalyse systmatique
de chacun des lots de viande.
De mme quun restaurant
peu regardant sur lhygine
peut continuer son activit
pendant des annes sans jamais tre inquit, des acteurs
de la filire alimentaire peuvent galement passer entre les
mailles du filet des contrles. La
DGCCRF prcise qu un oprateur
tent de ne pas faire les contrles
ou respecter les rglements court
un gros risque puisquil sexpose
une peine de prison .
Ne pas confondre scurit et
qualit alimentaire
Et les risques encourus sont
les mme pour tous les fournisseurs, quels que soient leurs
clients. Il ny a pas de raison
de stigmatiser Lidl plus quune

POURQUOI
CET ARTICLE ?
Cet article explique les mesures
prises par ltat pour garantir la
scurit alimentaire. Scurit
qui a pu tre mise en doute la
suite dinfections par la bactrie
Escherichia coli en Allemagne et
lintoxication alimentaire de
plusieurs enfants en France.
LUnion europenne est dote
dune rglementation stricte qui
introduit des contrles sanitaires
aux diffrents stades de la pro-

autre chane, les contrles


sont les mmes pour tout le
monde , explique-t-on la
DGCCRF, qui prcise qu il ne
faut pas confondre la scurit
alimentaire avec la qualit alimentaire . Si dix steaks hachs achets chez Lidl valent
le mme prix quun seul steak
de boucher, ce nest en raison
de rgles sanitaires moindres,
mais parce que la qualit est infrieure. Le principal levier des
fabricants de ce type de viande
est le choix des morceaux, la
composition et le pourcentage
de graisse.
Les rsultats de lenqute en
cours sur les lots incrimins
de viande hache dtermineront sils ont effectivement
t contamins, quelles sont
les causes et sil y a eu ou
non ngligence. Les rsultats

duction des aliments. En effet,


des vrifications rgulires sont
effectues par des organismes
dtat (la DGCCRF et la DGAL),
afin de surveiller lapplication
des rgles sanitaires. Les industriels eux-mmes doivent
galement raliser des contrles.
Cependant, le consommateur
se doit de connatre les risques
de dveloppement des microorganismes afin dtre vigilant
et de veiller au respect des
conditions de conservation des
aliments quil consomme.

devraient tre connus lundi


20 juin. Le ministre de la Sant,
Xavier Bertrand, a dores et
dj annonc quil souhaitait
engager un programme de recherche pour lutter contre les
bactries en cause. Quoiquil
en soit, pour la DGCCRF, la qualit du contrle de la chane
alimentaire nest en aucun cas
mise en cause. Au contraire,
en France, le nombre dintoxications alimentaires est trs
trs bas par rapport dautres
pays comme les tats-Unis, par
exemple , o, selon lOrganisation mondiale de la sant,
76 millions de personnes par
an, soit 24,6 % de la population,
sont touches par une intoxication alimentaire.
Hlne David
(17 juin 2011)

Nourrir l'humanit (1re)

23

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Se laver les mains,


premier geste prventif

LES ARTICLES DU

La bactrie qui a dj provoqu la mort de 25 personnes en Europe et 2 700 infections


rien quen Allemagne reste toujours insaisissable. Lundi 6 juin, les premiers tests sur
des graines germes dune exploitation agricole bio allemande se sont rvls ngatifs.
Nous ne levons pas pour autant nos soupons , a toutefois prcis Gert Hahne, porteparole du ministre de la Consommation du Land de Basse-Saxe. La production de
graines germes, trs favorable la multiplication des bactries, peut tre la source de
la contamination en dpit de ces rsultats ngatifs , confirme Christophe Nguyen-The,
chercheur lInstitut national de la recherche agronomique (Inra) en microbiologie des
aliments dorigine vgtale.

onnat-on des cas dpidmies dues des bactries


E. coli contenues dans des
germes ?
La souche dEscherichia coli O104H4 est trs rare et na jamais t
lorigine dune pidmie par
le pass. Malgr tout, la bactrie
E. coli est, elle, trs rpandue sur la
plante, connue des scientifiques,
et quelques grosses pidmies
ont dj t observes sur tous
les continents.
En 1982, par exemple, une cinquantaine de personnes ont t
infectes aux tats-Unis par des
Escherichia coli O157-H7 contenues
dans des steaks hachs. En 1996, la
mme souche a aussi t observe
en cosse, o elle a touch plus de
500 personnes. La mme anne,
le Japon a recens 10 000 cas, dont

POURQUOI
CET ARTICLE ?
Cet article donne un exemple
dinfection alimentaire par
une bactrie, Escherichia coli
O157-H7 qui a provoqu des
morts en Europe et en Allemagne. Cet exemple peut tre

24

Nourrir l'humanit (1re)

huit mortels, en raison de germes de


radis. En 2000, leau courante contamine a fait 2 000 malades prs de
Toronto au Canada. En France, deux
pidmies ont t enregistres en
2005 : dans le Sud-Ouest, en raison
de steaks hachs pas assez cuits, et
dans le Calvados, o on avait dtect
la bactrie dans le camembert.
Les graines germes sont-elles
davantage exposes au dveloppement de bactries que dautres
vgtaux ?
Les graines germes sont indniablement un milieu trs favorable au
dveloppement des bactries. Ces
micro-organismes bnficient dune
ambiance trs humide et dune
temprature leve, suprieure
25 C, ncessaires leur culture.
Ils se nourrissent par ailleurs des

rinvesti dans un sujet de bac


et permet d'expliquer que la
bactrie a pu se dvelopper
facilement sur les graines
en germination puisque les
conditions de temprature
(25 C), dhumidit et la prsence de matires organiques
taient favorables.

matires organiques relargues


par la germination. Dans cet environnement propice, les bactries
se multiplient trs vite. la rcolte
des graines, aprs quelques jours, on
obtient bien plus de bactries quau
dpart, entre 10 000 et 100 000 fois
davantage selon les conditions dhumidit et de chaleur.
Au contraire, la production de
fruits et lgumes, dans des champs,
constitue un milieu trs stressant
pour ces bactries. Elles sont ainsi
exposes aux ultraviolets de la
lumire du soleil, des variations
dhumidit trs brutales et ne sont
pas adaptes pour vivre dans le
sol, en raison de la comptition
entre les micro-organismes quon
y trouve. Trs peu de ces bactries parviennent survivre dans
ces conditions. Elles meurent
progressivement aprs quelques
jours, ou quelques semaines. Ainsi,
quand on rcolte de la salade ou
des tomates, la probabilit quelles
soient contamines par la bactrie
est faible.
Les tests ngatifs raliss sur les
graines germes en Allemagne
loignent-ils tout soupon de ces
cultures ?
Non, malgr les rsultats ngatifs,

cest--dire le fait que lon na pas


retrouv de lot contamin, les
graines germes peuvent toujours
tre lorigine de lpidmie. Les
contaminations sont en effet souvent occasionnelles, sur certains
lots de graines en particulier. Or,
ces germes sont des produits dont
la dure de vie est courte. Les
lots tests nont donc rien voir
avec les lots qui ont t vendus et
consomms il y a trois semaines,
auxquels les scientifiques nont
plus accs.
Comment ces cultures pourraientelles avoir t contamines ?
Tout est possible. Les graines, si
elles savraient lorigine de lpidmie, pourraient avoir t contamines par le sol, aprs lpandage
du fumier ou en cas dintrusion
dun animal dans une parcelle rserve la culture. Mais ces graines
pourraient aussi avoir t stockes
dans une enceinte souille, laves
dans une eau impure ou encore
conditionnes sans respect des
rgles dhygine.
Christophe Nguyen-The,
propos recueillis
par Audrey Garric
(7 juin 2011)

FMININ-MASCULIN ET
PROCRATION (1RE ET TERM)

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Les germes constituent


un milieu trs favorable au
dveloppement des bactries

MOTS CLS
CHROMOSOME X
Les chromosomes sont situs
dans les cellules et contiennent
lADN, cest--dire le patrimoine
gntique.
Ltre humain possde 23 paires
de chromosomes dont 1 paire de
chromosomes sexuels.
La femme a deux chromosomes X, alors que lhomme
possde un chromosome X et un
chromosome Y.
Les chercheurs ont longtemps
cru que la diffrence entre les
deux sexes tait uniquement lie
au chromosome Y.
Ils pensaient, par ailleurs, que lun
des deux chromosomes X de la
femme tait inactif.
Or, les gnticiens, suite lanalyse du chromosome X, ont pu
confirmer que celui-ci, tait en
partie actif. Le chromosome Y ne
serait donc pas le seul responsable
des diffrences entre les hommes
et les femmes.
Cette dcouverte met aussi en
vidence que si lune des deux
copies du chromosome X est
dfectueuse par endroit, lautre
peut prendre le relais pour que la
cellule fonctionne correctement.

CHROMOSOME Y
Le chromosome humain Y mesure seulement un tiers de la
taille du chromosome X et possde dix fois moins de gnes.
Mais il possde le gne SRY (sexedetermining-region Y) qui intervient dans la diffrenciation du
sexe masculin.

GONOSOMES
Les gonosomes sont galement
appels chromosomes sexuels :
chromosomes X et Y.

OVOGONIES
Les ovogonies sont des cellules
lorigine des ovocytes provenant
de la diffrenciation des cellules
germinales dans les ovaires.

SPERMATOGONIES
Les spermatogonies sont des
cellules lorigine des spermatozodes, provenant de la diffrenciation des cellules germinales
primordiales dans les testicules.

26

LESSENTIEL DU COURS

Devenir homme ou femme : du sexe


gntique au sexe phnotypique

e sexe dun individu est tout dabord dtermin par ses caractristiques gntiques qui s'affirment lors du dveloppement embryonnaire. Celles-ci permettent didentifier physiquement le sexe du nouveau-n. Lidentit sexuelle, quant elle,
se construit au contact de notre socit et de notre culture ; elle
ne doit pas tre confondue avec lorientation sexuelle qui relve
de lintimit de chacun.
Sexe gntique et sexe
phnotypique
Chez les mammifres, les mles et les femelles se
distinguent non seulement par leur dimorphisme
sexuel, mais galement par leurs chromosomes et
par quelques gnes.
La dtermination du sexe commence ds la
fcondation. Les mles possdent deux htrochromosomes X et Y, tandis que les femelles possdent une paire XX. Il en rsulte que les mles
produisent des spermatozodes X ou Y en proportions gales, tandis que les femelles produisent
uniquement des ovocytes X. Le sexe gntique (ou
gnotypique) est donc dtermin la fcondation
en fonction du chromosome sexuel apport par le
spermatozode.
Le chromosome Y a une rgion qui na pas dhomologue sur X et possde, par consquent, des gnes
qui lui sont propres. Ceux-ci nexistent quen un
seul exemplaire chez le mle et sont absents chez
la femelle.
Le sexe phnotypique correspond aux autres caractres sexuels : les caractres sexuels primordiaux
(gonades), les caractres sexuels primaires (voies
gnitales et organes gnitaux) et les caractres sexuels
secondaires (diffrences morpho-anatomiques, comportements sexuels).

L'intervention du gnotype
dans ltablissement du
phnotype sexuel
Ltude dtres humains porteurs danomalies chromosomiques et les travaux exprimentaux sur la
souris ont montr que, quel que soit le nombre de
chromosomes X, tous les embryons porteurs dun
chromosome Y deviennent mles et tous ceux qui
en sont dpourvus deviennent femelles.
Le chromosome Y porte, dans sa rgion non homologue
de X, un gne appel SRY (sexe-determining region Y). Au
dbut du dveloppement embryonnaire, la gonade
est indiffrencie, cest--dire quelle est identique
chez les embryons mles et femelles. Lactivit
du gne SRY induit le fonctionnement en cascade
dautres gnes qui conduisent la diffrenciation
de la gonade en testicule. En labsence du gne SRY

Fminin-masculin et procration (1re et Term)

(ou si la protine SRY est dfectueuse), la gonade se


diffrencie en ovaire.
Dans lespce humaine, cette priode de diffrenciation dure trois semaines partir de la cinquime
semaine de gestation. Le gne SRY est un gne
matre qui dclenche lexpression en cascade
de nombreux gnes. Il est hautement conserv chez
tous les mammifres tudis. Comme tous les gnes,
son expression peut tre influence par des facteurs
environnementaux.

Les tapes de la diffrenciation


de lappareil sexuel au cours du
dveloppement embryonnaire
Au dbut du dveloppement, la gonade indiffrencie est accompagne de deux types de canaux
issus des reins embryonnaires : les canaux de Wolff,
potentiellement mles, et les canaux de Mller,
potentiellement femelles. Tous deux dbouchent
dans un sinus urognital indiffrenci. Lvolution
de ces canaux est indirectement lie lactivit du
gne architecte SRY car elle dpend de la prsence
ou de labsence dhormones testiculaires.
La testostrone et lhormone anti-mllerienne
contrlent en effet la masculinisation du tractus
gnital. La testostrone est lhormone sexuelle mle
de ladulte. Elle est produite par les cellules interstitielles du testicule (cellules de Leydig) et entrane
le dveloppement des voies gnitales mles partir
des canaux de Wolff. Lhormone anti-mllerienne
est produite par les cellules de Sertoli des tubes
sminifres et provoque la disparition des canaux
de Mller.
linverse, en labsence dhormones testiculaires,
se produit la fminisation du tractus gnital.
Les canaux de Mller persistent alors, tandis que
les canaux de Wolff disparaissent, et les follicules
ovariens commencent se former.

Les transformations observes


la pubert
La pubert dbute gnralement entre 8 et 13 ans
chez la fille, et entre 10 et 14 ans chez le garon. Les
appareils gnitaux arrivent maturit, ce qui donne
aux individus la capacit de procrer. La production

Principe de la diffrenciation sexuelle.

de gamtes matures est continue chez lhomme :


les spermatozodes sont en effet fabriqus au fur
et mesure pendant tout le reste de sa vie. Chez la
femme, le stock de futurs ovocytes est dj constitu
la naissance : leur maturation sera discontinue et
suivra les cycles des hormones sexuelles, raison de
la production dun ovocyte mature tous les 28 jours,
au moment de lovulation. La production stoppera
larrt de la scrtion des hormones strognes,
vers lge de 50 ans : cest la mnopause.
Les pics hormonaux dstrognes et de progestrone chez la jeune femme, de testostrone chez le
jeune homme, permettent le dveloppement des
caractres sexuels secondaires qui sont laboutissement du sexe phnotypique de lindividu :
chez la femme, la pilosit se dveloppe en particulier sous les aisselles et au niveau du pubis, les seins
augmentent de volume, les hanches slargissent, les
rgles apparaissent ;
chez lhomme, la pilosit se dveloppe de manire
gnrale sur tout le corps, et en particulier au niveau du
visage, les cordes vocales spaississent et la voix devient
plus grave (cest la mue), la musculature se dveloppe, le
pnis et les testicules augmentent de volume.

Lidentit sexuelle et lorientation


sexuelle
Lidentit sexuelle se forge partir de la combinaison
de plusieurs paramtres :
les sexes gnotypique et phnotypique, cest--

dire les caractristiques


gntiques et morphologiques de lindividu,
qui dmontrent son
appartenance physique
lun ou lautre des
deux sexes ;
le ressenti propre
chaque individu,
qui est en gnral en
accord avec les sexes
gnotypique et phnotypique. Linverse est
possible toutefois, on le
constate chez les individus dits transsexuels
qui ressentent et revendiquent une identit
sexuelle oppose leur
sexe gntique : une
femme transsexuelle
revendique une identit
masculine, un homme
transsexuel revendique
une identit fminine ;
les normes sociales et
culturelles imposes ds
le plus jeune ge au travers des jeux denfant, des
comportements, coupes
de cheveux, tenues vestimentaires induits ou
imposs, etc. Le conditionnement social est tel
quune petite fille au fort caractre et tendance
bagarreuse, par exemple, sera traite de garon
manqu .
Lorientation sexuelle nappartient qu la
sphre prive, elle est souvent issue dune prise de
conscience la pubert de son attirance pour une
personne de sexe oppos (htrosexualit) ou du
mme sexe (homosexualit).
Lorientation homosexuelle se heurte souvent
des clichs qui associent une femme homosexuelle
un aspect et un comportement de type masculin,
un homme homosexuel un aspect et un comportement de type fminin.
Ces caractristiques supposes sont sans fondement et loin dtre gnralises.

DEUX ARTICLES DU MONDE


CONSULTER
tj/PVTBWPOTUPVTEFTDFSWFBVY
EJGGSFOUTxp. 30
(Propos recueillis par Anne Chemin,
22 novembre 2007)

tUne naissance sur 5 000


en Europe p. 31
(Catherine Vincent, 2 dcembre 2009)

MOTS CLS
AUTOSOMES
Tous les chromosomes non
sexuels possds par lindividu.

TRANSGNSE
Ou transgense. Technique qui
consiste introduire un ou plusieurs
gnes dans le patrimoine gntique
dun organisme vivant afin quil sy
exprime. La transgnse permet
dtudier la fonction des gnes et est
galement utilise pour lobtention
de nouvelles varits vgtales,
appeles OGM.

DATES CLS
t 1912 : Mise en vidence de la
prsence de deux chromosomes X
chez la femme, un chez lhomme.
Le chromosome Y nest pas identifi.
t1923 : Observation du chromosome Y.
t 1956 : Dcouverte du nombre
de chromosomes humains grce
au progrs de la microscopie :
23 paires, dont une paire de chromosomes sexuels.
t1959 : Les travaux des chercheurs
montrent que la prsence ou non
du chromosome Y est en relation
avec le sexe des gonades.
t 1964 : Dcouverte quil existe
des hommes avec deux chromosomes X (1 sur 20 000).
t1984 : Mise en vidence de lexistence de remaniements chromosomiques entre X et Y lors du
crossing-over miotique. Le chromo-some X possde alors le gne
SRY, normalement prsent sur Y.
t   Transgnse du gne SRY
dans des cellules ufs de souris.
Afin de confirmer le rle du gne
SRY dans la diffrenciation des
gonades vers le sexe masculin,
lquipe du professeur Koopman
a ralis, en 1991, la transgnse
du gne SRY. Il sagissait disoler le
fragment dADN contenant le gne
SRY et de linjecter dans des cellules
ufs de souris. Ils ont constat que,
dans plusieurs cas, les embryons de
gnotype XX ont dvelopp des testicules et des voies gnitales mles.
Mais la prsence des deux chromosomes X na pas permis la formation des spermatozodes chez les
souris.

Fminin-masculin et procration (1re et Term)

27

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

BON SAVOIR
Cascade dactivation du gne SRY
Le gne SRY permet la synthse
dune protine SRY ou protine TDF
qui agit sur le gne SOX9 du
chromosome 17 qui, lui-mme,
fabrique la protine SOX 9 dont
la cible est le gne de lAMH, situ
sur le chromosome 19. Ce dernier
synthtise lhormone anti-mllrienne dans les cellules de Sertoli
des tubes sminifres.
Les free-martins
Chez les bovins, lorsque des jumeaux de sexe diffrents se dveloppent dans lutrus maternel,
les femelles sont gnralement
striles et prsentent des organes
gnitaux plus ou moins normaux.
Le free-martinisme peut se rencontrer chez le mouton, le porc et
la chvre mais reste peu frquent
chez ces espces. Plusieurs anomalies sont observes la naissance :
gonades de taille rduites et dpourvues de cellules germinales ;
les voies gnitales drivant des
canaux de Mller sont interrompues ou absentes ;
les canaux dfrents et les
glandes accessoires sont souvent
prsents ;
les organes gnitaux externes
sont de type femelle.
En 1917, deux quipes de chercheurs, Keller et Tandler en Autriche, Lillie et Chapin aux tatsUnis constatrent que :
les free-martins et leurs jumeaux
sont des faux jumeaux (2 ufs
distincts) ;
il ny a pas danomalies de type
free-martin dans les portes de
mme sexe ;
si, dans les portes gmellaires
htrosexues (mles et femelles),
il ny a pas danastomoses vasculaires au niveau du placenta, le
ftus femelle est normal.
Leurs travaux permirent de
conclure quune hormone scrte par les testicules du jumeau mle, et vhicule par le
sang jusquau jumeau femelle,
tait responsable de la masculinisation des organes gnitaux
internes des free-martins. Les
connaissances actuelles confirment laction de la testostrone
et de lhormone anti-mllrienne.

28

UN SUJET PAS PAS

Restitution des connaissances :


La diffrenciation du sexe masculin
et du sexe fminin
Lintitul complet du sujet
Comparez la diffrenciation du sexe masculin et du
sexe fminin et les mcanismes physiologiques mis
en jeu, de la fcondation la naissance. Vous raliserez
un expos soign qui comprendra une introduction,
un dveloppement structur, une conclusion et
au moins un schma comparatif. Les tapes de la
diffrenciation des organes gnitaux externes sont
exclues.

Lanalyse du sujet
Il sagit dexpliquer la diffrenciation des deux sexes
lors du dveloppement embryonnaire, limportance
du contrle gntique et le contrle hormonal.

La problmatique
Comment seffectue la diffrenciation des sexes
masculin et fminin de la fcondation la naissance,
et comment interviennent les mcanismes physiologiques ?

sur sa partie propre, le gne SRY qui gouverne la


synthse dune protine SRY. Cette protine active
lexpression de plusieurs gnes architectes, permettant la diffrenciation de la gonade indiffrencie
en testicule. Chez lembryon fminin, les gonades
indiffrencies se transforment en ovaires. Le sexe
gntique dtermine le sexe phnotypique.
b) Dterminisme de la diffrenciation des voies gnitales sous contrle hormonal
La testostrone produite par les cellules de Leydig
permet le maintien des canaux de Wolff lorigine
de lpididyme, du canal dfrent, des vsicules sminales et de la prostate. Lhormone anti-mllrienne
produite par les cellules de Sertoli des tubes sminifres, entrane la rgression des canaux de Mller.
Chez la femme, les canaux de Wolff rgressent et les
canaux de Mller persistent et sont lorigine de
lutrus, du vagin et des oviductes.

Conclusion

Introduction
Il faut traiter la diffrenciation des sexes
masculin et fminin au cours du dveloppement embryonnaire, puis les mcanismes
physiologiques.

II. Les mcanismes physiologiques de la diffrenciation des sexes masculin et fminin


a) Dterminisme des gonades sous contrle gntique
Chez lembryon masculin, le chromosome Y possde

Fminin-masculin et procration (1re et Term)

ZOOM SUR

Dterminisme du sexe phnotypique


Lintitul complet du sujet

L'tude du document

Certains individus prsentent diverses anomalies


relatives aux chromosomes sexuels.
partir de lexploitation du document, prcisez les
relations entre sexe gntique et sexe phnotypique.

Daprs le document propos, les individus de


phnotype masculin prsentent (sauf dans un cas)
un chromosome Y dans leur caryotype. Et, en labsence
de chromosome Y (sauf dans un cas), les individus
prsentent un phnotype fminin. Les deux exceptions
rares observes prcdemment doivent correspondre
des anomalies des chromosomes sexuels X ou Y.
En effet, lexistence dhommes de caryotype 44 A + XX
dmontre que la prsence dun chromosome sexuel Y
nest pas indispensable la ralisation du sexe masculin.
Cest normalement le chromosome Y qui est porteur du
gne SRY, mais seule la prsence dans le caryotype de
ce gne SRY importe. Dans le cas propos, le gne SRY
doit tre port par un chromosome X qui a subi une
recombinaison.
Chez femmes de caryotype 44 A + XY, cest labsence
du gne SRY sur le chromosome Y (qui a subi une
recombinaison et la perte du gne SRY) qui dtermine
leur phnotype fminin.

Le document
Dterminisme du sexe phnotypique (A = autosomes).
Phnotypique

Caryotypes

Fminin

Masculin

Le plus
frquent

44 A + XX

44 A + XY

Rare

44 A + X

44 A + XXY

Rare

44 A + XY
et sans gne
SRY

44 A + XX
(prsence
du gne
SRY

Rare

44 A + XXX

44 A + XYY

Lanalyse du sujet
Lanalyse danomalies relatives aux chromosomes
sexuels permet de prciser les relations entre le sexe
gntique et le sexe phnotypique.
On ne demande pas ici une tude aussi dtaille que
dans le sujet prcdent puisquil sagit dune tude
de documents.
Vous devez essentiellement exploiter le document
avec prcision et mettre en vidence limportance
du gne SRY dans la mise en place du phnotype
masculin.
Les mcanismes physiologiques, cest--dire hormonaux, peuvent tre cits en conclusion, mais il nest
pas ncessaire de les expliquer.

Le plan dtaill
du dveloppement
I. Comparaison entre la diffrenciation des
sexes masculin et fminin
a) Stade indiffrenci
Les embryons mle et femelle ont le mme
aspect. Les gonades sont indiffrencies.
Deux types de canaux : les canaux de Wolff
et les canaux de Mller.
b) Stade de diffrenciation des gonades
Diffrenciation des gonades en testicules
chez le mle et en ovaires chez la femelle.
Le sexe gonadique se diffrencie partir du
sexe gntique.
c) Stade de diffrenciation des voies gnitales
On passe du sexe gonadique au sexe phnotypique. Chez le mle, les canaux de Wolff
donnent les voies gnitales. Chez la femelle, Schma-bilan.
les canaux de Mller se dveloppent en voies
gnitales femelles. Les organes ne seront fonctionnels
qu la pubert.

tude de document :

La problmatique
Quels sont les liens entre le sexe gntique et le sexe
phnotypique ?

Conclusion
Lexpression du gne SRY est ncessaire la mise
en place du phnotype sexuel masculin. Le gne
SRY gouverne la synthse dune protine SRY. Cette
protine active lexpression de plusieurs gnes architectes permettant la diffrenciation de la gonade
indiffrencie en testicule. Chez lembryon fminin,
en labsence de ce gne, les gonades indiffrencies
se transforment en ovaires. Le sexe gntique dtermine le sexe gonadique. La diffrenciation des voies
gnitales est ensuite sous contrle hormonal, testostrone et hormone anti-mllrienne, permettant la
formation des voies masculines. Le sexe gonadique
permet le passage au sexe phnotypique. La pubert
constituera la dernire tape de la mise en place du
sexe phnotypique.

Ce quil ne faut pas faire


tUVEJFSDIBRVFDPMPOOFEVUBCMFBV
sans les mettre en relation.
t3DJUFSTPODPVST

SUJETS TOMBS AU BAC SUR CE THME

Ce quil ne faut pas faire


t1BSUJSEVTDINBEFTZOUITFFUMFYQMJRVFS
t3DJUFSMFDPVSTEFMBOOF
t/FQBTSPSHBOJTFSWPTDPOOBJTTBODFT
en fonction du sujet.

tude des documents


Les anomalies de la diffrenciation sexuelle. (Sujet national, juin 2005)
Identification du sexe gntique et explication dun phnotype particulier de Madame X.
(Sujet national, juin 2007)
Acquisition dun appareil gnital mle. (Polynsie, juin 2010)

Farinelli.

Carlo Broschi dit Farinelli nat


Andra (Royaume de Naples) en 1705
et meurt Bologne en 1782. Il appartient une famille de petite noblesse.
Castr 7 ou 8 ans, il devient llve de
Porpora, grand professeur de chant.
Durant ses tudes Naples, il est le
protg des frres Farina et adopte
le surnom de Farinelli pour leur
marquer sa reconnaissance. Dune
virtuosit exceptionnelle, Farinelli
fera le tour des cours dEurope puis
passera vingt ans la cour dEspagne
auprs de Philippe V, puis de son fils
Ferdinand. Il finira sa vie Bologne,
en Italie.
La castration ralise avant la pubert
permet au chanteur de conserver sa
voix de soprano, tout en bnficiant
dun volume sonore du fait de la
capacit thoracique de ladulte. Labsence de testostrone empche la
mue vocale ainsi que la descente du
larynx. Les castrats apparaissent au
XVIe sicle, surtout en Italie et disparaissent la fin du XIXe sicle.

STATISTIQUES
La pubert.
Des tudes ont montr que la pubert
avait lieu vers 13 ans chez la moiti
des filles et vers 14,8 ans chez la moiti
des garons. Cette tude repose sur
des enqutes afin de connatre lge
des premires rgles chez la fille et,
pour les garons, le dveloppement
corporel, la mue de la voix et des indicateurs de maturit sexuelle comme
la masturbation. Pour 9 filles sur 10,
les premires rgles interviennent
entre 11 et 14 ans et, pour les garons,
le pic de croissance intervient entre
13 et 17 ans. (Source : Ined)

Fminin-masculin et procration (1re et Term)

29

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

LES ARTICLES DU

LES ARTICLES DU

Ltre social chappe toujours au dterminisme biologique. Entretien avec Catherine


Vidal, neurobiologiste.

es cerveaux des femmes


sont-ils diffrents de ceux des
hommes ?
Oui et non. Oui, parce que le cerveau
contrle les fonctions physiologiques associes la reproduction,
qui sont diffrentes selon le sexe.
Non, parce que le cerveau est le
sige de la pense et, pour que
cette pense merge, le cerveau a
besoin dtre stimul par lenvironnement. Cest un facteur essentiel.
la naissance, seulement 10 % des
connexions entre les neurones sont
prsentes. Les 90 % restants vont
se construire progressivement au
gr des influences de la famille,
de lducation, de la culture, de la
socit. Ainsi le cerveau, grce
ses formidables proprits de
plasticit , fabrique sans cesse des
nouveaux circuits de neurones en
fonction de lexprience vcue par
chacun. Il en rsulte que nous avons
tous des cerveaux diffrents. Cest
bien ce que montrent les nouvelles
techniques dimagerie crbrale
comme limagerie par rsonance
magntique (IRM) : la variabilit
dans la forme et le fonctionnement
du cerveau entre les individus dun
mme sexe lemporte sur la variabilit entre les sexes.

Ces rsultats contredisent les


observations des neurologues du
XIXe sicle sur la taille des cerveaux
Pour la plupart des neuroanatomistes de lpoque, le fait que
les hommes aient en moyenne
un cerveau plus gros que celui des
femmes ntait pas li leur stature,
mais leur supriorit intellectuelle.
Pourtant, on savait par les rapports
dautopsie quil nexiste aucun
rapport entre la taille du cerveau
et lintelligence. Ce qui compte en
matire de cerveau et dintelligence,
ce nest pas la quantit mais bien la

30

qualit des connexions entre les


neurones.
On dit souvent que les femmes ont
une forte aptitude au langage et
que les hommes, se reprent mieux
dans lespace. Cette ide reue a-telle un fondement scientifique ?
Cette vision simpliste remonte
la thorie des deux cerveaux
lance il y a quarante ans ! Des tudes
cliniques avaient montr quil existait
des asymtries entre les deux hmisphres. De l, le pas a t un peu vite
franchi pour expliquer les diffrences
entre les sexes par des diffrences
de latralisation crbrale. Ainsi, les
comptences des femmes pour le
langage seraient dues un hmisphre gauche dominant, tandis que
les bons scores des hommes dans
lorientation spatiale et en mathmatiques viendraient dun hmisphre
droit plus performant. Ces ides sont
de nos jours compltement dpasses. Limagerie crbrale montre
que les deux hmisphres sont en
communication permanente et
quune fonction comme le langage
recrute une dizaine daires crbrales
dans les deux hmisphres, indpendamment du sexe.
On dit aussi que lagressivit est
lie, chez les hommes, la prsence
dune hormone mle, la testostrone. Cette ide a-t-elle un fondement scientifique ?
Chez les rats et les souris, il y a un
lien entre le taux de testostrone
et lagressivit. De mme, les hormones sexuelles jouent un rle trs
important chez les animaux dans les
comportements de rut et daccouplement qui correspondent la priode
dovulation de la femelle. Mais ltre
humain chappe ce dterminisme.
Le moment des rencontres et le choix
du partenaire nont plus rien voir

Fminin-masculin et procration (1re et Term)

avec les hormones, lagressivit


non plus. Au cours de lvolution,
lHomo sapiens a t dot dun cerveau unique en son genre avec un
cortex crbral qui a d se plisser
en circonvolutions pour arriver
tenir dans la bote crnienne. Si on
dplisse virtuellement ce cortex,
on obtient une surface de 2 m2 sur
3 mm dpaisseur ! Cest dix fois plus
que chez le singe. Et notre cortex est
beaucoup moins rceptif laction
des hormones. Voil pourquoi lhumain est capable de court-circuiter
les programmes biologiques associs
laction des hormones. Sur le plan
comportemental, tout ce qui relve
de lhumain se fait dabord sur des
constructions mentales.
Pour vous, le masculin et le fminin
sont donc avant tout des notions
culturelles ?
la naissance, le petit humain
ne connat pas son sexe, il va devoir
lapprendre mesure que se dveloppent ses capacits mentales. Entre

POURQUOI
CET ARTICLE ?
La journaliste interroge la
neurobiologiste Catherine Vidal sur la problmatique des
diffrences entre hommes et
femmes et les influences respectives des facteurs biologiques et
de lenvironnement. Son regard
est orient vers le fonctionnement du cerveau humain et
remet ainsi en cause des ides
reues (supriorit intellectuelle
des hommes, etc.).
Pour Catherine Vidal, les influences hormonales existent
et ne sont pas ngligeables mais
le comportement humain relve

1 an et demi et 2 ans, seulement 10 %


des enfants sont capables de se
dsigner en tant que garons ou
filles. Cest linfluence du milieu
familial, social, scolaire qui va faire
que lenfant va progressivement
adopter des comportements correspondants aux schmas identitaires
masculins ou fminins.
Si dailleurs les contraintes biologiques jouaient un rle majeur dans
les comportements des hommes et
des femmes, on devrait sattendre
observer des traits invariants communs toutes les civilisations. Ce
nest pas le cas. lchelle de lindividu ou de la socit, il napparat
pas de loi universelle qui diffrencie
les conduites des hommes et des
femmes. La rgle gnrale est celle
de la diversit culturelle, rendue possible par les formidables proprits
de plasticit du cerveau humain.
Propos recueillis
par Anne Chemin
(22 novembre 2007)

Une naissance
sur 5 000 en Europe
D

ISORDERS OF SEX DEVELOPMENT (DSD) : cest sous


ce terme que lintersexualit a fait son entre dans le vocabulaire mdical, par un consensus
international adopt en 2005
Chicago. Contrairement aux transsexuels, qui ont le sentiment dappartenir lautre sexe que celui
que la biologie leur a assign, les
intersexuels ou hermaphrodites
prsentent une ambigut sexuelle
constitutive, provenant dune anomalie dans le dterminisme des
gonades (ovaires et testicules) ou
dans la diffrenciation des organes
gnitaux. Cest une ambigut de
ce type que prsente, peut-tre, la
jeune Sud-Africaine Caster Semenya, gagnante du 800 m fminin
aux Mondiaux dathltisme de
Berlin en aot 2009.
En Europe, un nouveau-n
sur 5 000 est concern soit, en
France, environ 200 nouveau-ns
par an. Dans lhmisphre nord,
plus de 50 % des DSD touchent des
personnes dont le sexe gntique

est fminin (XX), aux ovaires correctement diffrencis, mais qui


ont reu de trop grandes quantits
dhormones mles (ou andrognes).
Ce dsquilibre est d une maladie
des surrnales : celles-ci fabriquent
plus dandrognes quelles ne devraient, ce qui virilise les embryons
fminins. On compense ce drglement par un traitement base
de cortisone. Les petites filles ainsi
suivies seront fertiles, mais prsenteront des signes de virilit.
Autre forme frquente dintersexualit, le syndrome dinsensibilit aux andrognes concerne
cette fois des personnes dont le
sexe gntique est masculin (XY),
et se caractrise par une absence de
rcepteurs aux andrognes. Si labsence est totale, lenfant deviendra
une femme strile XY. Si elle est partielle, il est difficile de dterminer sil
sera plutt dapparence masculine
ou fminine lge adulte. ct
de ces deux formes frquentes, on
dnombre une trentaine dautres
causes dambigut sexuelle.

POURQUOI
CET ARTICLE ?
Ce texte fait le point sur un
dsquilibre appel disorders
of sex development (DSD)
qui introduit une ambigit
quant au sexe phnotypique
dun embryon, alors mme
que la dtermination de son
sexe gntique lors de la fcondation sest bien droule.
Le DSD est d une anomalie

Dans tous les cas, les personnes


atteintes de DSD naissent avec
des organes gnitaux atypiques.
Pour accder une sexualit normale , il leur faut en gnral
subir une ou plusieurs oprations.
Aux tats-Unis, des associations de
dfense des droits des intersexus
militent pour que ces interventions ne soient pas pratiques
la naissance, mais un ge o le

dans le dterminisme des gonades, conduisant lembryon


recevoir trop dandrognes (cas
dun embryon de sexe gntique XX) ou y tre insensible
(cas dun embryon de sexe gntique XY). Cette intersexualit, ou hermaphrodisme, est
donc le rsultat dune altration
gntique. Il est important de
bien la distinguer de la transsexualit qui, elle, ne relve pas
de la gntique.

patient peut dcider lui-mme de


son sexe dassignation. La plupart
des mdecins estiment quant
eux quune intervention rapide
aprs la naissance reste prfrable,
pour que lenfant puisse grandir
en se situant comme garon ou
comme fille.
Catherine Vincent
(2 dcembre 2009)

essentiellement de constructions mentales labores par


lducation, de la culture et de
la socit. Il ny a pas dun ct
les femmes et de lautre les
hommes, mais des individus
possdant tous des cerveaux
diffrents, ce qui fait la richesse
de lespce humaine.
Les informations donnes
par cet article peuvent tre
utilises dans des questions
relatives lidentit masculine
et fminine o lon tente de
distinguer la part de linn et
de lacquis dans notre comportement et largir la rflexion
aux problmes de lorientation
sexuelle.

Fminin-masculin et procration (1re et Term)

31

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Nous avons tous


des cerveaux diffrents

MOTS CLS
CYCLE OVARIEN
Caractris par lvolution cyclique
des follicules ovariens.
maturit, les follicules subissent
lovulation puis forment un corps
jaune. Cette volution est associe
une scrtion cyclique dhormones ovariennes : strognes
et progestrone.

CYCLE UTRIN
volution cyclique de lendomtre
utrin sous laction des hormones
ovariennes.

CYCLE MENSTRUEL
Comprend les cycles ovarien et
utrin dont les modifications
priodiques se ralisent environ
tous les 28 jours.

DIPLODE
Se dit dune cellule ou dun organisme dont les chromosomes sont
identiques deux deux et peuvent
tre associs par paires dhomologues. On note 2n, le nombre de
chromosomes.

GONADOSTIMULINES
Appeles galement gonadotrophines ou hormones gonadotropes. Hormones hypophysaires
stimulant le fonctionnement des
gonades (FSH et LH).

La rgulation de la fonction
reproductrice

la pubert, le tractus gnital devient fonctionnel. Le fonctionnement de lappareil gnital, dont dpendent la production des gamtes et la gestation, est contrl par les
hormones sexuelles : testostrone chez l'homme, strognes et
progestrone chez la femme.

Les fonctions des testicules


partir de la pubert, les testicules assurent une double
fonction : dune part la production des gamtes mles
(spermatozodes), dautre part la scrtion de lhormone
sexuelle mle, la testostrone.
La spermatogense se droule dans les tubes sminifres, tandis que la production de testostrone est assure
par les cellules interstitielles, ou cellules de Leydig, situes
entre les tubes sminifres. Au cours de la spermatogense, des cellules diplodes indiffrencies mais capables de se renouveler, les spermatogonies, sengagent
dans la diffrenciation en devenant des spermatocytes.
Ces derniers subissent la miose et donnent des spermatides haplodes qui se diffrencient en spermatozodes
mobiles lors de la spermiogense.
Chez lhomme, environ 3 mL de sperme mlange de
spermatozodes et de scrtions des glandes annexes
sont mis chaque jaculation avec une concentration
moyenne de 100 millions de spermatozodes par mL, ce
qui reprsente environ 300 millions de spermatozodes.
HYPOTHALAMUS
GnRH

HAPLODE
Se dit dune cellule ou dun organisme dont le noyau contient uniquement un seul chromosome de
chaque pair. On note n le nombre
de chromosomes.

SERVOMCANISME
Mcanisme dont la valeur de
consignes est priodiquement
modifie. On parle de servomcanisme dans le cas du fonctionnement de laxe hypothalamo-hypophysaire chez la femme.

32

cibles
priphriques

cellules
FSH et LH
HYPOPHYSE
ANTRIEURE
FSH
LH
circulation
gnrale

Processus par lequel des cellules


haplodes sont formes partir
de cellules diplodes, notamment
les gamtes.

Hormone produite par des neurones et libre dans le sang.

neurones
hypothalamiques
(GnRH)
rtroactions ngatives

MIOSE

NEUROHORMONE

LESSENTIEL DU COURS

FSH

circulation
gnrale

LH

testostrone

tube
sminifre
(cellules de
Sertoli)

cellules
interstitielles
(ou cellules
de Leydig)

vaisseaux
sanguins

Principe de la rgulation physiologique de laxe gonadotrope


mle.

Lactivit des testicules


La scrtion de testostrone et la production des spermatozodes sont stimules par deux gonadostimulines
hypophysaires, FSH (Follicule stimulating hormone)

Fminin-masculin et procration (1re et Term)

et LH (Luteinizing hormone). La production de ces


hormones dpend elle-mme de la scrtion pulsatile
de gonadolibrine, ou GnRH (Gonadotopin releasing
hormone), une neurohormone hypothalamique.
Lhypothalamus est un centre nerveux qui subit des
influences du reste du systme nerveux. Il permet ainsi
la mise en relation entre environnement et reproduction.
Le taux de testostrone est maintenu un niveau
sensiblement constant grce la rtroaction ngative
que cette hormone exerce sur laxe hypothalamohypophysaire. Il en rsulte un freinage de lactivit de ce
complexe et, par consquent, une baisse de la production
des gonadostimulines puis de celle de la testostrone.
linverse, si la concentration de testostrone diminue, il
y a production accrue de gonadostimulines. Le taux de
testostrone ne varie que dans des limites troites.
Par son action sur les cibles priphriques, lhormone
mle est indispensable au bon fonctionnement du
tractus gnital, au maintien des caractres sexuels
secondaires ainsi qu la spermatogense.

La manifestation de lactivit
de lappareil reproducteur
DIF[MBGFNNF
Chez la femme, lappareil reproducteur a une activit
cyclique qui se manifeste notamment au niveau des
ovaires (cycle ovarien) et de lutrus (cycle utrin).
Le cycle ovarien comprend deux phases spares
par lovulation : la phase pr-ovulatoire, ou phase
folliculaire, caractrise par la croissance folliculaire, et
la phase post-ovulatoire, ou phase lutale, caractrise
par la formation du corps jaune.
Le complexe hypothalamo-hypophysaire contrle
lactivit des ovaires, notamment la maturation des follicules et le dveloppement du corps jaune (luteus = jaune
en latin). Il assure ainsi une production cyclique des
hormones sexuelles : strognes pendant la phase
folliculaire et progestrone pendant la phase lutale. En
outre, un pic scrtoire des gonadostimulines provoque
lovulation, en moyenne tous les 28 jours.
Les hormones sexuelles agissent sur lutrus (myomtre
et endomtre) en dterminant les transformations
cycliques (phase de prolifration puis phase de scrtion) qui le rendent apte recevoir un ventuel
embryon. Elles agissent galement sur ltat de la glaire
cervicale qui devient ainsi permable aux spermatozodes au moment de lovulation.

Le dclenchement de lovulation
Chez la femme, comme chez lhomme, le fonctionnement du tractus gnital dpend surtout de laxe
hypothalamo-hypophysaire ; une scrtion pulsatile
de GnRH stimule la production des gonadostimulines
FSH et LH.
chaque cycle, la FSH stimule la croissance folliculaire et la LH provoque la scrtion dstrognes.
Lorsquun des follicules a atteint la maturit (follicule
de Graaf), un pic scrtoire de LH dclenche lovulation, cest--dire la libration de lovocyte, et la reprise
de sa miose, bloque en prophase I depuis la formation de lovaire, bien avant la naissance. Lovocyte est
alors recueilli par le pavillon de la trompe, tandis que
les restes du follicule se transforment en corps jaune,
vritable glande endocrine temporaire productrice
de progestrone.

Le dterminisme des cycles sexuels


rtroaction
ngative HYPOTHALAMUS

freinage

LH FSH
(ng/ml -1)

HYPOPHYSE

concentration
FSH
sanguine faible

strognes
augmentation
lente

200
100

GnRH

HYPOPHYSE

LH
gonadostimulines

premire partie
du cycle

300

rtroaction

HYPOTHALAMUS + ngative

GnRH neurohormone

OVAIRE
maturation folliculaire

Cycle des hormones hypothalamo-hypophysaires


400

Au cours du dveloppement embryonnaire, environ


6 millions dovocytes sont forms, mais les deux tiers
disparaissent avant la naissance et il nen reste plus que
300 000 la pubert. Le plus souvent, un seul ovocyte
est mis lors de lovulation. Au cours de la vie dune
femme, seulement 400 450 ovocytes seront donc
disponibles pour la fcondation.

activation
+

augmentation
pic de LH

OVAIRE
ovulation

follicules

milieu du
cycle
strognes
augmentation
rapide

Principe de la rgulation par rtroactions de laxe gonadotrope


femelle.

Cycle ovarien et des hormones ovariennes


futur
ovule

ovule
mis

follicule
mr

jeune
follicule
phase folliculaire

300
250
200
150
100
50
0

corps
jaune

phase lutale

stradiol
(pg/ml-1)

progestrone
(g/ml-1)

Cycle utrin

30
25
20
15
10
5

vaisseau sanguin
glande

muqueuse
utrine
muscle
utrin

phase prolifrative
rgles

phase scrtoire

2 4 6 8 10 12 14 16 18 20 22 24 26 28 jours
phase pr-ovulatoire
phase post-ovulatoire

ovulation

Synchronisation des cycles de lovaire et de lutrus.

DEUX ARTICLES DU MONDE CONSULTER


t-BEDPVWFSUFEFWSBJTGBVYKVNFBVY
CSBOMFDFSUBJOTBDRVJTFONBUJSF
de reproduction p. 36
(Jean-Yves Nau, 28 mars 2007)

tProfesseur Axel Kahn, gnticien molculaire :


j6OUSBWBJMEhVOFJNQPSUBODFGPOEBNFOUBMF
DPOTJESBCMFFUEhVOFUSTHSBOEFQPSUF
DPOPNJRVFx p. 37
(Propos recueillis par Jean-Yves Nau, 25 fvrier 1997)

Le contrle du cycle sexuel dpend dun servomcanisme. Au dbut du cycle, les strognes, produits
par les follicules ovariens, exercent une rtroaction
ngative sur laxe hypothalamo-hypophysaire. Le taux
dstrognes augmente ainsi lentement. Toutefois,
lorsquune concentration critique en strognes est
atteinte, la rponse de laxe hypothalamo-hypophysaire
aux hormones sexuelles sinverse et la rtroaction devient positive. Il sensuit un pic de LH, qualifi de dcharge
ovulante, qui provoque lovulation. Ce double systme
de rtroaction dabord ngative puis positive entretient
lactivit cyclique de lovaire. Les strognes produits
provoquent la prolifration de la muqueuse utrine
(limine la fin du cycle prcdent lors des rgles). La
progestrone, scrte par le corps jaune, provoque la
phase de scrtion de lutrus et exerce une rtroaction
ngative sur laxe hypothalamo-hypophysaire. Sans
nidation, le corps jaune dgnre, la progestrone chute
et la partie superficielle de lendomtre est limine
(rgles). S'il y a un embryon, de nouveaux mcanismes
de rgulation se mettent en place permettant son
maintien et son dveloppement.

La mnopause
La mnopause est larrt dfinitif des cycles menstruels, en raison de la diminution de la rserve de
follicules ovariens. Les primates sont une exception :
chez la plupart des mammifres, les ovaires restent
fonctionnels jusqu la mort. Sur le plan hormonal,
la mnopause saccompagne dune diminution de
la scrtion des strognes et dune augmentation
de la scrtion des gonadostimulines hypophysaires.
Lge moyen de la mnopause est 50-51 ans Une
strilit physiologique lie au vieillissement de
lutrus peut se dclarer avant la mnopause.

REPRES
Lappareil gnital masculin.
Lappareil gnital est un ensemble
dorganes intervenant dans la reproduction. Chez lhomme, ces organes
sont surtout externes avec le pnis
(ou verge) et les testicules contenus
dans les bourses. Par ailleurs, lappareil gnital masculin est en relation
avec lappareil urinaire puisque
lurine est limine par le mme
conduit que le sperme, lurtre, mais
de faon non simultane.
Lappareil gnital masculin est
construit pour fabriquer des spermatozodes et les transmettre la
femme. Il comporte ainsi :
t MF QOJT PV PSHBOF EBDDPVQMFment ;
t EFVY UFTUJDVMFT  PV HMBOEFT
sexuelles, productrices des spermatozodes ou cellules reproductrices, encore appeles gamtes
mles ;
tEFVYDPOEVJUTHOJUBVYPVTQFSmiductes, par lesquels sachemine
le sperme avant datteindre lurtre ;
tEFVYWTJDVMFTTNJOBMFTFUVOF
prostate : glandes annexes assurant, par leur scrtion, la bonne
qualit du sperme.
Lappareil gnital fminin.
Chez la femme, lappareil gnital
comporte surtout des organes
internes, situs dans labdomen.
Seule la fente vulvaire entoure
de replis de peau (grandes et petites lvres) apparat lextrieur.
Par ailleurs, lappareil urinaire et
lappareil gnital prsentent des
conduits bien distincts.
Lappareil gnital fminin est fait
pour permettre la production
dovules, la fcondation et la gestation. Il prsente ainsi :
t MF WBHJO PV PSHBOF EBDDPVQMFment ;
t EFVY PWBJSFT PV HMBOEFT
sexuelles produisant les ovules
ou gamtes femelles ;
tEFVYUSPNQFTVUSJOFT DPOEVJUT
par lesquels sachemine lovule
entran par les battements des
cils des parois des trompes ;
tVOVUSVTPVPSHBOFEFMBHFTtation dans lequel se fixe luf
quand il y a eu fcondation et qui
est lorigine des rgles.

Fminin-masculin et procration (1re et Term)

33

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

NOTION CL
Rtroaction ou rtrocontrle
Systme de rgulation par lequel
un paramtre influence en retour
le fonctionnement du systme
qui le rgule. Par exemple, les diffrentes concentrations dstrognes exercent un rtrocontrle
ngatif ou positif sur le complexe
hypothalamo-hypophysaire.

UN SUJET PAS PAS

Restitution organise des


connaissances : Les hormones
de lhomme adulte

ZOOM SUR
Les ovocytes.
Dans lespce humaine, les gamtes
femelles sont prsents dans lovaire
avant la naissance. Ce sont des ovocytes de deuxime ordre, cest-dire des cellules reproductrices qui
nont pas termin leur maturation.
Contrairement aux spermatozodes, les ovocytes sont de grosses
cellules arrondies et immobiles,
bourres de rserves qui seront
utilises par lembryon au dbut
du dveloppement. Dans lovaire,
les ovocytes sont entours de nombreuses cellules non reproductrices
qui constituent un follicule. Initialement, les ovocytes entours de
quelques cellules aplaties forment
des follicules primordiaux.
Au cours du dveloppement folliculaire, lovocyte grossit en accumulant des rserves tandis que les
cellules folliculaires se multiplient
en formant une couche de cellules
continue autour de lovocyte aboutissant la formation dun follicule
primaire.
Le spermatozode humain.
Le spermatozode humain prsente, davant en arrire :
tVOFUUFDPOUFOBOUOPUBNNFOU
le noyau et un systme perforateur
de la membrane ovulaire ;
tVOFQJDFJOUFSNEJBJSFSFOGFSNBOU
la centrale nergtique ncessaire au
fonctionnement de ce gamte ;
tVOnBHFMMFPVGPVFUBTTVSBOU QBS
ses battements, la mobilit indispensable cette cellule fcondante.
Ces cellules minuscules, dont la
longueur est de lordre de 70 micromtres (un micromtre = un millime
de millimtre), sont produites en trs
grand nombre et de faon continue
dans les testicules.

34

Des spermatozodes.

Lintitul complet du sujet


Lhomme adulte produit des spermatozodes de faon
continue.
Prsentez les mcanismes hormonaux et les structures responsables de cette production.
Votre rponse sera organise selon un plan apparent et
accompagne dun schma fonctionnel.

L'analyse du sujet
Le sujet invite prsenter lorganisation dun testicule, la localisation de la spermatogense puis
expliquer le rle de la testostrone et de la rgulation
par le complexe hypothalamo-hypophysaire dans la
production continue des spermatozodes.

La problmatique
Comment les mcanismes hormonaux interviennentils dans la production des spermatozodes et comment
les structures responsables de la fabrication des spermatozodes se caractrisent-elles ?

Le plan dtaill du dveloppement


I. Les testicules : structures responsables de la fabrication des spermatozodes
Les testicules, ou gonades mles, sont constitus

Fminin-masculin et procration (1re et Term)

par un grand nombre de tubes sminifres trs fins,


pelotonns les uns sur les autres et entre lesquels se
situent des cellules endocrines, les cellules de Leydig.
Les spermatozodes sont fabriqus au niveau de la
paroi des tubes sminifres, entre les cellules de Sertoli
qui constituent ces tubes.
Ds la pubert, des cellules diplodes, les spermatogonies, situes sur le bord externe des tubes sminifres se diffrencient en gamtes haplodes, les
spermatozodes. Cette transformation fait intervenir
les deux divisions de la miose ; elle se ralise du
bord vers le centre des tubes sminifres, on parle de
diffrenciation centripte. Ainsi, les spermatozodes se
trouvent au niveau de la lumire des tubes sminifres
afin dtre vacus dans les voies gnitales. Cette production est continue durant toute la vie de lhomme
mais, avec lge, cette activit testiculaire diminue sans
pour autant sarrter compltement. Les cellules de
Leydig scrtent lhormone mle, la testostrone, de
la pubert la mort de lindividu, en une production
continue mais pulsatile. La testostrone est indispensable la fabrication des spermatozodes.
II. Les mcanismes hormonaux
La scrtion de testostrone ncessaire la fabrication
des spermatozodes nest pas autonome, puisquelle est
sous la dpendance de laxe hypothalamo-hypophysaire.

a) Contrle par lhypophyse


Lhypophyse antrieure contrle le fonctionnement
des testicules par lintermdiaire de la scrtion de
deux gonadostimulines : la LH et la FSH. La LH (hormone lutinisante) stimule les cellules de Leydig qui
scrtent en rponse la testostrone. La FSH (Folliculo
stimuline hormone) agit au niveau testiculaire sur la
synthse de protines qui constitueront les rcepteurs la testostrone. La FSH active indirectement
la production de spermatozodes.
b) Contrle par lhypothalamus
Lhypothalamus contrle les scrtions des hormones hypophysaires qui sont indispensables au
fonctionnement du testicule par lintermdiaire
dune neurohormone : la GnRH qui est produite
par des amas de neurones hypothalamiques dont
lactivit rythmique entrane la scrtion pulsatile.
c) Rtroaction exerce par la testostrone
Pour assurer le fonctionnement de lappareil sexuel
mle, la concentration plasmatique de testostrone
doit tre maintenue constante. Or la testostrone se
dgrade constamment, sa concentration dans le sang
varie rgulirement, ce qui demande une rgulation
permanente.
Ce sont les cellules du complexe hypothalamo-hypophysaire qui dtectent les variations du taux de testostrone : elles mettent alors des messages cods en

modulation damplitude de neurohormone (GnRH) et


dhormones (LH, FSH) qui agissent sur les cellules de
Leydig rgulant la libration de testostrone.
Ainsi, le maintien de la concentration plasmatique
de testostrone une valeur stable rsulte dune
rtroaction ngative exerce par lhormone ellemme sur le complexe hypothalamo-hypophysaire
contrlant sa scrtion.

Conclusion
Le maintien de la concentration constante de testostrone, indispensable la fabrication des spermatozodes, repose sur une boucle de rgulation
qui comprend trois niveaux de contrle : hypothalamique, hypophysaire et testiculaire.

Spermatozodes vus au microscope.

Ce quil ne faut pas faire

Schma-bilan : les mcanismes hormonaux contrlant la


production des spermatozodes.

t5SBJUFSEFMBEJGGSFODJBUJPOEFMBHPOBEFMPSTEV
dveloppement embryonnaire.
t1BSMFSEFMBDUJPOEVHOFSRY et aborder
le sexe gntique et le sexe phnotypique.
t%UBJMMFSMFTUBQFTEFMBNJPTF

SUJETS TOMBS AU BAC SUR CE THME


Restitution organise des connaissances
Relation ovaires et utrus. (Sujet national, septembre 2010)
tude des documents
La production des gamtes mles. (Polynsie, septembre 2003)
Des processus biologiques contrls par des hormones. (Amrique du Nord, juin 2005)
Le rle des oestrognes. (Amrique du Nord, juin 2009)

REPRES
La fabrication normale des gamtes
lors de la miose.
Au cours de sa formation, chaque
gamte reoit au hasard un chromosome de chacune des 23 paires. Ainsi,
les gamtes produits par un individu sont gntiquement diffrents.
Les cellules femelles portant deux
chromosomes X dans la 23e paire,
les gamtes femelles, ou ovules, portent toujours un chromosome X.
Les cellules mles contenant un
chromosome X et un chromosome Y dans la 23e paire, les gamtes
mles, ou spermatozodes, peuvent
porter soit un chromosome X, soit
un chromosome Y.
Le processus qui permet, partir de la cellule mre de gamtes
diplodes (2n), de produire des
cellules haplodes (n) est appel
miose et comprend plusieurs
tapes. Avant la miose, une duplication des chromosomes se produit, chaque chromosome possde
alors deux chromatides.
La premire division de la miose,
dite rductionnelle, conduit la formation de deux cellules ne possdant quun seul chromosome deux
chromatides de chaque paire par
sparation des paires dhomologues.
La seconde division, dite quationnelle, conduit la formation
de quatre gamtes possdant un
chromosome de chaque paire,
chaque chromosome ne possdant
quune seule chromatide.
On retrouve pour les deux divisions, la prophase, la mtaphase,
lanaphase et la tlophase.
La duplication des chromosomes.
La division dune cellule de
ltre humain est prpare par
la duplication de chacun de ses
46 chromosomes. Pour cela, chaque
chromosome se fabrique une copie
strictement identique. Le chromosome et sa copie sont appels
chromatides et restent solidaires
en un point nomm centromre.
Ainsi, la duplication est la fabrication dun chromosome deux
chromatides, partir dun chromosome simple une chromatide.
Elle se droule dans le noyau des
cellules.

Fminin-masculin et procration (1re et Term)

35

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

LES ARTICLES DU

LES ARTICLES DU

Une anomalie a permis de constater que deux enfants taient ns de la fcondation dun
seul ovocyte par deux spermatozodes. Un phnomne encore jamais mis en vidence.

n dogme de la physiologie
de la reproduction humaine vient dtre bris,
avec la dcouverte de jumeaux qui
ne sont ni tout fait vrais ni tout
fait faux . Signs de Mikhail
Golubovsky (Duke University, Durham, Caroline du nord), Vivienne
Souter (Banner Good Samaritan
Medical Center, Phnix, Arizona)
et David Bonthron (Universit de
Leeds, Royaume-Uni), les dtails de
cette dcouverte sont publis dans
les colonnes de la revue spcialise
Journal of Human Genetics. Ils ont
t diffuss, lundi 26 mars, via le site
dinformations de la revue Nature.
Cest la suite de lidentification
dune anomalie sexuelle chez lun
des deux jumeaux que mdecins
et gnticiens ont t conduits d-

POURQUOI
CET ARTICLE ?
Cet article montre que les
connaissances en biologie
peuvent tre tout moment
remises en causes par de nouvelles dcouvertes. Ici il sagit
de la naissance de jumeaux
qui sont le rsultat de la fcondation dun ovule par deux
spermatozodes. Or, jusqu
prsent, les tudes avaient
montr que, dans lespce
humaine, la polyspermie tait
bloque suite des modifications molculaires de la membrane de lovocyte et de la zone
pellucide. Ces jumeaux sont
des chimres cest--dire que
leurs cellules ne possdent pas

36

couvrir quil existait, contrairement


ce que lon observe chez les vrais
jumeaux, des diffrences notables
dans la constitution des patrimoines
gntiques des deux enfants. Pour
autant, ces patrimoines prsentent
des similitudes qui font que lon ne
peut pas non plus les considrer
comme de faux jumeaux.
Les vrais jumeaux sont issus
dun ovocyte fcond par un seul
spermatozode et qui sest ensuite
naturellement dupliqu, tandis
que les faux jumeaux correspondent deux ovocytes fconds
sparment et simultanment
par deux spermatozodes. Or les
deux enfants qui font lobjet de la
publication du Journal of Human
Genetics ne correspondent aucun
de ces deux cas de figure.

toutes le mme matriel gntique, alors que dans les circonstances classiques, toutes
les cellules possdent le mme
patrimoine gntique avec
la moiti des chromosomes
dorigine paternelle et lautre
moiti dorigine maternelle.
Ce cas particulier montre
que nos connaissances sur la
fcondation et la gmellit
sont encore incompltes et
ces exceptions vont peut-tre
permettre de faire progresser
la science.
Vous pouvez utiliser les dcouvertes de cet article lors
dun examen oral pour une
question sur la fcondation
dans le cadre dune ouverture
lactualit scientifique.

Fminin-masculin et procration (1re et Term)

$IJNSFT
Ils sont tous deux dots des
mmes gnes hrits de leur
mre, via lovocyte dont ils sont
issus. En revanche, des diffrences
existent quant aux gnes hrits de leur pre. Pour Vivienne
Souter, spcialiste de gntique,
une seule hypothse peut ici tre
envisage : ces jumeaux semiidentiques sont issus de la fcondation simultane dun mme
ovocyte par deux spermatozodes,
avant la duplication de lovocyte
doublement fcond et le dveloppement de deux embryons.
Aux yeux de leur mre, ces
deux enfants taient des vrais
jumeaux ne prsentant aucun
trouble particulier. Lattention
du corps mdical a toutefois t
attire par lexistence, chez lun
dentre eux, dune forme dhermaphrodisme, anomalie sexuelle
caractrise par la coexistence de
tissus ovariens et testiculaires. Des
analyses gntiques ont ensuite
mis en lumire le fait que les deux
enfants taient des chimres, les
cellules de leur organisme ntant
pas toutes constitues du mme
matriel gntique.
Cette dcouverte soulve de
nombreuses questions et remet en
cause un acquis tenu pour fondamental : limpossibilit dobserver
dans lespce humaine le phnomne de polyspermie, caractris par la fcondation dun mme
ovocyte par plus dun spermatozode. Ds quun spermatozode
entreprend de pntrer au sein de
lovocyte, une srie de modifications molculaires surviennent,
tant au niveau de la membrane

ovocytaire que de la zone pellucide, cette structure qui entoure la


cellule sexuelle fminine.
Larrimage du spermatozode
provoque notamment la libration dune onde de dpolarisation
rapide qui conduit, schmatiquement, un durcissement de la zone
pellucide. Celle-ci devient ainsi un
obstacle absolu la pntration
dautres spermatozodes et confre
ensuite une protection lembryon,
qui se dveloppera durant quelques
jours au sein de cet espace.
Aprs larrimage du spermatozode lovule, les deux membranes fusionnent, avant que les
deux patrimoines gntiques, le
paternel et le maternel, sassocient. Les autres lments du spermatozode, comme le flagelle et
les mitochondries, qui pntrent
normalement dans lovocyte au
moment de la fcondation, sont
en suite limins.
Comment comprendre que les
obstacles la polyspermie puissent tre contourns sans nuire
au dveloppement ultrieur des
embryons et des ftus ? Mikhail
Golubovsky avait suggr, en 2003,
dans la revue Human Reproduction,
quun tel scnario ne pouvait tre
formellement exclu.
Il y a encore une srie dlments qui ne sont pas claircis dans
la gntique des jumeaux et de la
gmellit, souligne aujourdhui le
biologiste. Nous devons conserver
les yeux ouverts et nous attendre,
dans ce domaine, dautres situations inhabituelles.
Jean-Yves Nau
(28 mars 2007)

Professeur Axel Kahn, gnticien


molculaire : Un travail dune importance
fondamentale considrable et dune trs
grande porte conomique
Pourquoi ne parvenait-on pas, jusqu prsent, faire en sorte que le patrimoine hrditaire dune cellule adulte puisse redonner naissance un autre individu gntiquement similaire ?

eules les cellules germinales


et les cellules embryonnaires
trs prcoces, cellules que lon
qualifie de totipotentes , sont
capables de donner tous les tissus et
toutes les cellules dun organisme.
Une cellule qui a commenc de se
diffrencier pour devenir une cellule de foie, de cerveau, de peau, de
cur, etc. (cellule dite somatique)
na plus cette totipotence. Dans chacune des cellules dun organisme, il
y a bien la totalit des gnes composant le patrimoine hrditaire
de lindividu. Mais ces gnes sont,
au sein des cellules somatiques,
comme figs dans une structure
qui empche de les ractiver tous
en mme temps. Ces gnes sont
endormis, non rveillables pourraiton dire. Or pour crer un organisme
entier il faut que tous les gnes
soient ractivs, ceux du foie, du
cerveau, de la peau, du cur, etc.
quoi tient dans ce contexte la
russite des chercheurs de lquipe
cossaise ?
Prcisment au fait quils ont
russi rveiller des gnes dont on
ignorait quils fussent rveillables.
Et ils ont russi cette gageure en
plaant le gnome dune cellule somatique dans un milieu particulier,
le cytoplasme dun uf fcond
dont a enlev le noyau, milieu qui
a un potentiel de rveil hors de
lordinaire. Cette russite est le fruit
dun ttonnement exprimental.
Elle tient aussi pour partie au hasard. Cest en effet en cherchant
vrifier dautres travaux que cette
quipe a t conduite utiliser les
noyaux dune ligne de cellules
somatiques particulires, quelque

POURQUOI
CET ARTICLE ?
Le professeur Axel Kahn explique
les avances des connaissances
scientifiques concernant les mcanismes en jeu lors de la diffrenciation des cellules et de la perte de
leur totipotence.

peu crevardes , dont ils espraient quils ne se dvelopperaient


pas. Or, chose tout fait extraordinaire, quand ils ont plac un noyau
de cellule fibroblastique, il y a eu
effectivement reprogrammation
du patrimoine hrditaire de la
cellule fibroblastique, dveloppement embryonnaire et naissance
dun animal.
Quelle est la porte du travail
qui sera publi dans le prochain
numro de lhebdomadaire britannique Nature sur le clonage de
moutons adultes ?
Il sagit selon moi dun travail
dune importance fondamentale
considrable et dune trs grande
porte conomique. Au plan fondamental il sagit l dune ouverture
importante qui va nous permettre
dtudier quels sont les mcanismes
molculaires qui, dans les cellules
somatiques, empchent la totipotence et par quelles voies on peut
retourner la totipotence. Ces voies
et ces mcanismes sont trs mal
connus et sont trs importants en
biologie. Ce sont ces mcanismes qui
maintiennent veills ou endormis
de manire stable les diffrents gnes
dans les diffrents chromosomes.

De nombreuses quipes mnent


des recherches sur les problmes
de greffes de tissus et sur la possibilit dorienter la diffrenciation
dune cellule somatique rendue
pralablement totipotente, ce qui
permet de travailler sur des cellules somatiques et non pas sur
des cellules embryonnaires ce qui

Dun point de vue agronomique, cest


videmment le clonage des tres les
plus intressants. On peut envisager,
comme le font les chercheurs cossais, diffrentes perspectives dans
le champ de la mdecine humaine.
Enfin on ne peut pas ne pas parler
des animaux disparus ou en voie de
disparition. Imaginez, comme dans
le cas des ours des Pyrnes, des
individus qui dans un cosystme
donn risquent de disparatre. On
pourrait envisager de multiplier ainsi
aisment leur nombre.
tes-vous nanmoins inquiet de
lusage qui pourrait tre fait de cette
technique de clonage dans lespce
humaine tout particulirement ?
Bien videmment des questions
importantes se posent et doivent
tre poses. Il sagit l dune technique de clonage des mammifres
et ce titre tout ce qui a t dit
sur linterdiction du clonage dans
lespce humaine reste valable et
doit continuer tre appliqu. On
ne doit pas masquer une difficult
qui pourrait soulever de trs graves
questions : le recours cette technique pour lutter contre la strilit.
Aujourdhui pour lutter contre la
strilit masculine humaine, de

soulve des problmes de biothique consquents.


Vous pouvez utiliser les rflexions de cet article dans des sujets sur le clonage, les problmes
dthiques lis aux techniques
du traitement de la strilit ou
aux nouvelles perspectives de la
recherche mdicale.

nombreuses quipes ont recours la


micro-injection de spermatozodes
non fcondants dans lovocyte fminin. Dautres ont galement recours
des cellules sexuelles masculines
immatures situes plus en amont
dans la ligne germinale mle.
Quest-ce qui interdira, un jour,
davoir recours au noyau dune
cellule somatique pour donner
naissance un tre humain ? Dans
ce cas lenfant ne serait pas exactement le jumeau de son pre dans la
mesure o le gnome de ce dernier
aurait t ractiv grce au systme
mitochondrial de la mre.
Pourquoi tes-vous oppos, traitement de la strilit ou pas, au
clonage des tres humains ?
Je suis effectivement, comme de
trs nombreux de mes collgues
totalement et dfinitivement oppos lutilisation de la technique
du clonage dans lespce humaine.
Et ce pour une raison thique tout
fait claire qui tient au fait que la
dignit de chaque tre humain est
lie au fait quil nest semblable
aucun autre.
Propos recueillis par Jean-Yves Nau
(25 fvrier 1997)

Fminin-masculin et procration (1re et Term)

37

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

La dcouverte de vrais faux


jumeaux branle certains acquis
en matire de reproduction

ZOOM SUR
La vie intra-utrine de lembryon,
puis du ftus.
t %T MF ECVU EF MB WJF JOUSB
utrine, lembryon, puis le ftus,
se trouve reli au placenta maternel par le cordon ombilical.
t1BSBJMMFVST MFNCSZPO DPNNF
plus tard le ftus, vit dans une
cavit remplie de liquide amniotique et protge par une membrane transparente ou amnios :
il mne une vie intra-utrine
aquatique.
t %BOT DFU FOWJSPOOFNFOU  MF
ftus effectue des mouvements
que sa mre peut ressentir ds
le 4e mois.
t*MQFVUSBHJS JMEPSU JMTWFJMMF JM
suce son pouce et peut se retourner ds le 6e mois.
tQBSUJSEVe mois, il serait susceptible de vivre hors de lutrus,
mais il naurait pas alors atteint
sa taille normale.
t"V e mois, lenfant se retourne
et se prsente tte en bas, puis il
bouge moins car il manque de
place.
t-BOBJTTBODFTFQSPEVJUMBmO
du 9 e mois.
t *M BSSJWF RVF EFT FOGBOUT OBJTsent avant terme, ils sont plus
fragiles : on parle alors denfants
prmaturs.
t -B OVUSJUJPO GUBMF TF SBMJTF  
partir du placenta maternel, par
le cordon ombilical qui contient
plusieurs vaisseaux sanguins.
Des changes ont lieu par l'intermdiaire d'une fine membrane entre
le sang maternel et le sang ftal,
sans quil y ait, pour autant, de mlange entre les deux sangs. Lartre
maternelle apporte au ftus, par
exemple, le glucose et loxygne
indispensables sa croissance.
Le ftus rejette du dioxyde de
carbone et des dchets, par une
veine, dans le sang maternel.
Si le placenta est impntrable
de nombreux microbes et
certaines substances chimiques, il
laisse cependant passer des virus
et des substances toxiques.
Cest pourquoi, il est fortement
dconseill aux femmes enceintes
de boire de lalcool et de fumer car
si la mre boit beaucoup et/ ou
fume : le ftus boit et fume aussi !

38

LESSENTIEL DU COURS

Fcondation, grossesse et
techniques de procration
mdicalement assiste

recouvrir : cest la nidation. La grossesse commence


alors et dure en moyenne 260 jours.

Les manifestations du dbut de


la grossesse
progestrone
et strognes

es mammifres sont vivipares et la rencontre des gamtes,


qui seffectue dans lorganisme maternel, est notamment
lie la date dovulation et ltat du tractus gnital. Ces
deux paramtres sont contrls par les hormones sexuelles,
tout comme ltablissement et le maintien de la grossesse. La
connaissance des mcanismes impliqus dans la reproduction
a rendu possible la dissociation de la sexualit et de la reproduction, grce la matrise de la procration. Elle a aussi permis
une aide mdicalise la procration en cas dinfertilit.
-BSFODPOUSFEFTHBNUFT
et la fcondation
EBOTMFTQDFIVNBJOF
la suite de lmission du sperme dans le vagin, les
spermatozodes doivent dabord franchir le col de
lutrus. Ce passage nest possible quau moment de
lovulation, lorsque la glaire cervicale prsente une
structure favorable. Les spermatozodes remontent
ensuite les voies gnitales femelles, de lutrus
jusquaux trompes, o se produit la rencontre avec le
gamte femelle et la fcondation.
Sur les 300 millions de spermatozodes mis, seuls
quelques dizaines atteignent lovule. Au cours de leur
migration, les spermatozodes acquirent la capacit
fconder lovocyte : cest la capacitation.
La dure de vie des spermatozodes dans les voies
gnitales femelles, tant limite environ 48 h,
comme celle de lovocyte libre, la rencontre des gamtes ne peut avoir lieu que pendant la brve priode
fconde de quelques jours autour de lovulation.
La fcondation dclenche la fin de la miose de lovocyte (bloqu en mtaphase II depuis lovulation) et la
reprise de son activit mtabolique. La segmentation
de luf commence immdiatement, alors quil
entame sa migration vers lutrus.

La nidation

trompe
nidation
de luf
rencontre
des gamtes
et fcondation
ovule
ovulation

ovaire
glaire
cervicale
vagin

muqueuse
utrine
muscle utrin
col de l'utrus
spermatozodes
dposs lors d'un
rapport sexuel

La fcondation et la nidation.

Environ une semaine aprs la fcondation, lembryon


a atteint la cavit utrine, grce aux mouvements
ciliaires et musculaires de la trompe, et adhre la
surface de lendomtre. ce stade, lembryon est un
blastocyste, caractris par une cavit et deux groupes
de cellules aux potentialits diffrentes, le bouton
embryonnaire et le trophoblaste.
Le bouton embryonnaire est un massif interne de
cellules encore indiffrencies
noyau du
lorigine de lembryon proprement
spermatozode
dit, tandis que le trophoblaste est
tte
un tissu qui enveloppe lembryon
spermatique
et participe la formation du
noyau
placenta. Son activit, notamment
de l'ovule
celle des enzymes hydrolytiques
quil scrte, permet lembryon
cytoplasme
de senfoncer activement dans
la muqueuse utrine, riche ce
moment-l en vaisseaux sanguins
Ce schma montre la fusion du noyau du spermatozode (aprs la pntration
de la tte spermatique dans l'ovule) avec le noyau de l'ovule.
et en glandes (phase scrtoire du
cycle utrin). Lembryon pntre
La fusion des noyaux des gamtes.
dans lendomtre qui finit par le

Fminin-masculin et procration (1re et Term)

axe hypothalamohypophysaire
rtroaction
ngative

action sur les cibles


priphriques

placenta
corps jaune
HCG

action trophique sur


l'endomtre
action sur
les cibles
priphriques

Schma simplifi des corrlations hormonales au dbut de


la grossesse.

La premire manifestation de la grossesse est


labsence de rgles ; elle rsulte du maintien en activit du corps jaune, qui produit de la progestrone et
assure ainsi la persistance de lendomtre.
En dpit de la chute de LH qui a lieu en fin de cycle,
non seulement le corps jaune se maintient, mais il se
dveloppe et produit de plus en plus de progestrone. En
effet, lembryon produit une hormone, lhormone chorionique gonadotrope (HCG), dont laction sur le corps
jaune est similaire celle de la gonadostimuline LH.
Ds ce stade, il est possible de dtecter la grossesse par
la mise en vidence de lhormone HCG dans le plasma
ou dans les urines. Cest ce qui est ralis dans les tests
de grossesse du commerce fonds sur des techniques
immunologiques.
En outre, le placenta commence rapidement
synthtiser des strognes et de la progestrone
qui se substituent progressivement aux hormones
scrtes par le corps jaune. Pendant la grossesse,
toute nouvelle ovulation est bloque.

Les techniques de surveillance


de la grossesse
La surveillance mdicale normale de la grossesse utilise
diffrentes techniques pour veiller son bon droulement et prvenir les pathologies maternelles et ftales.
Des moyens dexploration (chographie) et danalyse
(dosages chimiques, analyses microbiologiques,
amniocentse, choriocentse, caryotype) permettent
ainsi dtablir un diagnostic, de prvenir lapparition
dune maladie ou de proposer si ncessaire une interruption volontaire de grossesse (IVG).

Les moyens mdicaux permettant


de lutter contre linfertilit
dun couple
Certains moyens permettent dexplorer la fonction
reproductrice des hommes et des femmes (spermogramme, hystrographie, etc.).

Un couple est dclar infertile au bout de deux annes


de rapports sexuels rguliers sans grossesse. Linfertilit peut tre dorigine masculine ou fminine. Chez
lhomme, les spermatozodes peuvent tre par exemple
absents, peu mobiles ou anormaux. Chez la femme,
linfertilit peut tre lie, par exemple, un trouble de
lovulation, une muqueuse utrine anormale ou une
obstruction partielle ou totale des trompes.
Les techniques de procration mdicalement assiste peuvent, dans certains cas, tre une solution
linfertilit des couples :
linsmination artificielle consiste, aprs une
stimulation ovarienne, introduire directement
dans lutrus les spermatozodes du conjoint (IAC)
ou dun donneur anonyme (IAD) ;
la FIVETE ou fcondation in vitro et transfert dembryon, consiste, aprs une forte stimulation ovarienne
et un dclenchement dune ovulation multiple,
recueillir les ovocytes obtenus et pratiquer une
fcondation in vitro. Un ou deux des embryons
produits sont ensuite implants dans lutrus ;
lICSI (Intra cytoplasmic sperm injection) consiste
injecter directement dans lovocyte un spermatozode au cours de la fcondation in vitro, puis
implanter lembryon dans lutrus.

-FTQSPCMNFTEFCJPUIJRVF
soulevs par la procration
mdicalement assiste
Les progrs importants des techniques de procration
mdicalement assiste ncessitent un encadrement
juridique afin de fixer les rgles les concernant. En effet
la manipulation des gamtes, leur prlvement (qui
peut donner ?), leur conservation (combien, quelle dure ?), la manipulation des embryons et leur slection,
la dtermination de lge limite des femmes pour la
FIVETE et les conditions pour en bnficier toutes ces
problmatiques ncessitent la rflexion des comits
dthique afin dlaborer des lois cohrentes.

QUATRE ARTICLES DU MONDE


CONSULTER
t$hFTUVOFFIV ! p. 41
(Anne Chemin, 6 octobre 2010)

tMme assiste, la fertilit dcrot


avec l'ge p. 42
(7 novembre 2011)

tLois de biothique : le choix du


statu quo, hlas ! p. 42
(8 fvrier 2011)

tUn tri gntique pourra tre pratiqu


parmis les embryons in vitro p. 43
(Jean-Yves Nau, 31 mars 1998)

PERSONNAGE
IMPORTANT
Simone Veil
Ne en 1927, Simone Veil est une
femme politique. Ministre de la
Sant en 1974, elle promulgue la
Loi Veil , le 17 janvier 1975, qui
lgalise le droit lavortement.

REPRES
Priode de fcondit de la femme
Cette priode stend environ du
9e jour aprs les rgles, jusquau
16 e jour du cycle car les spermatozodes peuvent survivre environ
5 jours dans les voies gnitales
fminines, tandis que lovule, plus
fragile, meurt 2 jours aprs lovulation. Tout acte sexuel non protg,
ralis dans cet intervalle, peut
donc conduire une naissance.
Remarque : le jour dovulation
peut lgrement varier en fonction
de la dure du cycle et des femmes.
Dure de la grossesse
Lembryon simplante dans la muqueuse utrine (nidation) 6 7 jours
aprs la fcondation et sy maintient ensuite environ 260 jours soit
38 semaines de gestation au total.
chographie du ftus
Le dveloppement embryonnaire
qui conduit la mise en place des
principaux organes dure environ
deux mois, lissue desquels lembryon est devenu un ftus possdant les organes caractristiques
du bb humain. Ds cette priode,
il est possible de reconnatre les
organes du ftus par chographie
et didentifier dventuelles anomalies de dveloppement. Des ultrasons sont envoys dans lutrus,
ils se rflchissent sur lembryon,
permettant ainsi de reconstituer
une image informatique. Sur une
image dchographie obtenue aprs
12 semaines damnorrhe, on observe la tte, le tronc et les membres
du ftus, ainsi que le cordon ombilical qui le relie au placenta, assurant
les changes entre la mre et le ftus.
Le ftus se dveloppe dans la cavit amniotique remplie de liquide
amniotique qui apparat en noir sur
limage en raison de labsence de
rflexion des ultrasons.

Fminin-masculin et procration (1re et Term)

39

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

Les principales causes de strilit.


t -B TUSJMJU DIF[ MB GFNNF QFVU
tre due :
des troubles de lovulation (dans
20 35 % des cas) ;
une obstruction ou altration des
trompes (dans 25 45 % des cas) ;
une altration de la glaire cervicale empchant la rceptivit au
sperme (dans 10 15 % des cas).
t -B TUSJMJU DIF[ MIPNNF QFVU
tre due :
un dfaut de spermatogense
avec soit une absence compte de
spermatozodes dans ljaculat
(azoospermie), soit un nombre de
spermatozodes infrieur 30 millions/ mL (oligospermie), soit une
mobilit insuffisante des spermatozodes (asthnospermie), soit
un nombre de spermatozodes
anormaux trop important (tratospermie) ;
une obstruction ou une malformations des voies spermatiques ;
des troubles de lrection.
Les recherches sur des cellules
souches issues dembryons humains.
t&O MFT4VJTTFTPOUBQQSPVW
par rfrendum une loi permettant
de faire des recherches sur des cellules souches issues dembryons
humains. Les cellules souches embryonnaires ont la particularit de
navoir aucune spcialit et de pouvoir donner naissance toutes sortes
de cellules. En tudiant ces cellules,
les chercheurs tentent de dcouvrir
quels sont les ordres leur donner
pour obtenir des cellules cardiaques,
nerveuses, etc. Une fois spcialises,
ces cellules pourraient tre greffes
et soigner de nombreuses maladies.
t 6UJMJTFS EFT FNCSZPOT IVNBJOT
pour la recherche reste une question dlicate, loin de faire lunanimit. Toutefois, la loi suisse nautorise que lutilisation de cellules
souches issues dembryons fconds artificiellement et ne pouvant
pas donner lieu une grossesse. Les
couples devront donner leur accord
et chaque projet est tudi par la
commission dthique. Par ailleurs,
cette loi interdit la production
dembryons sur lesquels seraient
prleves des cellules souches.

40

Restitution des connaissances :


FIVETE, strilit et thique

Ce quil ne faut pas faire


t5SBJUFSEFMJOTNJOBUJPOBSUJmDJFMMF
t%POOFSEFTPQJOJPOTOPOPCKFDUJWFTQBSSBQQPSU
aux problmes dthiques.

Lintitul complet du sujet


Certains couples font appel la procration mdicalement assiste, notamment la fcondation in vitro et
le transfert dembryons (FIVETE).
Dans un expos structur, vous prciserez dans quels
cas le mdecin propose une FIVETE un couple. Ensuite
vous montrerez en quoi cette technique de la FIVETE peut
poser des problmes dthique.

Lanalyse du sujet
Ce sujet amne envisager les diffrentes causes de
strilit dun couple, dorigine masculine ou fminine, pouvant tre rsolues par la FIVETE. On fait
ensuite appel votre rflexion et vos connaissances
pour expliciter en quoi la FIVETE peut soulever des
problmes thiques.

La problmatique
En quoi la FIVETE peut-elle rsoudre les problmes
de strilit dun couple ? En quoi cette technique
soulve-t-elle des questions dthique ?

Introduction
La FIVETE, ou fcondation in vitro et transfert dembryon, consiste pratiquer une fcondation in vitro
aprs avoir recueilli les ovocytes, obtenus grce

Fminin-masculin et procration (1re et Term)

Cest une FIV !

une stimulation ovarienne forte et le dclenchement


dune ovulation multiple. Par la suite, un ou deux des
embryons produits sont implants dans lutrus. Cette
technique peut tre une solution la strilit dun couple.

Depuis la naissance dAmandine, en 1982, 200 000 enfants sont ns dune fcondation in vitro en France. Une rvolution tranquille contre la strilit.

Le plan dtaill du dveloppement

lle a 28 ans, un prnom


clbre et une histoire hors
du commun : le 24 fvrier
1982, Amandine est devenue
le premier bb-prouvette
franais. N lhpital AntoineBclre Clamart (Hauts-deSeine), ce bb vtu dun pull
ray dont la photo a fait le tour
du monde a ouvert le bal des
enfants-FIV : selon la chercheuse lise de La Rochebrochard, chaque classe de maternelle compte aujourdhui un ou
deux enfants dont la conception
a t aide mdicalement .
Certains sont issus dune stimulation ovarienne, dautres dinsminations artificielles, mais un
tiers ont vu le jour grce une
fcondation in vitro (FIV).
La, qui vient de fter ses
8 ans, fait partie de ces bbsprouvette : la fcondation a
eu lieu en laboratoire et lembryon a ensuite t implant
dans lutrus de sa mre. Elle
est belle, elle est nickel lcole,
un vrai Speedy Gonzalez ! plaisante son pre, Olivier Combe.
Mais on la attendue trs longtemps : les premires visites
mdicales ont eu lieu en 1995.
Il a fallu sept ans de piqres, de
stimulations et de protocoles
mdicaux pour quelle soit l.
Ctait trs dur, a laisse des
traces, mais a marche. On
voulait mme lappeler Dsire,
cest un signe, non ?
Depuis la naissance dAmandine, plus de 200 000 enfants
ont t conus, en France, grce
la FIV. La proportion de naissances obtenues par la seule
technique de la FIV na cess de
progresser au cours des vingt
dernires annes, passant de
0,52 % des enfants en 1998
1,74 % en 2006, prcise lise de
La Rochebrochard dans Popu-

I. La FIVETE rpond certaines causes de strilit dans


un couple.
a) Strilit fminine
La cause la plus frquente dutilisation de cette
technique est lobstruction des trompes chez la
femme. En effet, une telle obstruction empche la
rencontre de lovule et des spermatozodes dans les
voies fminines. La FIVETE permet dviter le passage
de lovule par la trompe.
Elle peut aussi tre utilise en cas de troubles de
lovulation, et sera alors prcde dune stimulation
ovarienne particulire.
b) Strilit masculine
En cas de dfaut de mobilit des spermatozodes ou
dune concentration trop faible dans le sperme, on
utilise une variante de la FIVETE, lICSI ou injection
intra-cytoplasmique de spermatozodes dans lovule
grce une microseringue. La fcondation est aide
puisque lon injecte in vitro le spermatozode dans
lovule grce une microseringue.
II. Des problmes dthique sont soulevs par la FIVETE.
a) Lge des couples
Il est possible de raliser cette technique sur une
femme mnopause en utilisant une donneuse
dovules. Une rflexion sur lge des couples qui peuvent bnficier de cette technique est donc ncessaire.
b) Les tests gntiques
Les tests gntiques sur lembryon avec le PDI (diagnostic primplantatoire) permettent, techniquement
de choisir le sexe de lenfant en plus des recherches
danomalies gntiques. De mme, une slection
dembryons avant implantation, pour des critres
autres que la sant, pose des problmes dthique.

Conclusion
La FIVETE est une technique qui permet de rsoudre
certains problmes de strilit mais qui possde
un pourcentage de russite assez faible et requiert,
souvent, plusieurs essais.

SUJETS TOMBS AU BAC


SUR CE THME
tude de documents
Un exemple de strilit chez la femme (Sujet
national, septembre 2005)
Pubert et grossesse (Liban, juin 2005)

lation et socits, publication


de lInstitut national dtudes
dmographiques. Si la tendance
se poursuivait, plus de 2 % des
enfants pourraient tre conus
par FIV, en France, en 2010.
Cette technique dveloppe,
en France, par Ren Frydman et
Jacques Testart, les pres scientifiques dAmandine, a sign le
dclin dune maldiction : la strilit. Grce la FIV, mais aussi
aux autres techniques dassistance mdicale la procration
(AMP), la plupart des strilits
fminines et masculines ont
aujourdhui trouv un palliatif.
Le parcours est souvent
trs long, les dceptions nombreuses, mais au fil des ans les
techniques se sont profondment amliores : aujourdhui,
20 25 % des tentatives sont
couronnes de succs.
Ce fut le cas pour milie Larretche, 34 ans, mre dun petit
Oscar de 4 ans et demi et de deux
jumelles de 16 mois, Adlie et
Camille. Quand on a appris que
lon avait tous les deux un souci,
on tait un peu en flottement,
ce nest videmment pas facile
vivre, raconte-t-elle. Mais on
y a cru et on sest accroch. En
2005, on sest rendu lhpital Antoine-Bclre et on a eu
beaucoup de chance, la premire
tentative a russi, ctait Oscar !
Deux ans plus tard, le couple
recontacte lhpital et, cette
fois, la deuxime tentative est la
bonne. Ctaient les jumelles !,
sourit milie Larretche. Nous
avons t trs bien accompagns et les enfants sont un tel
merveillement quon oublie
tout. Mais le parcours reste une
preuve : on met sa vie notamment sa vie professionnelle
entre parenthses et on ne pense
plus qu a. Quand il faut aller

un rendez-vous hospitalier
7 heures du matin et quon
est oblig de quitter son travail
en plein aprs-midi pendant
plusieurs jours, il faut avoir un
super-chef !
Au fil des ans, lassistance mdicale la procration a loign le
spectre de la fertilit, mais aussi
boulevers en profondeur notre
vision de la famille en ajoutant
de nouveaux visages lhistoire
de la naissance dun enfant. Aujourdhui, 95 % des insminations, des FIV et des transferts
dembryons congels sont ralises avec les gamtes du couple,
mais 5 % de ces gestes font appel
un don de sperme, dovules
ou dembryons. La figure du
donneur a donc donn lieu
nombre de dbats thiques, dont
le premier porte videmment sur
la question de lanonymat.
Lassistance mdicale la procration a galement ouvert la
voie de nouvelles demandes
parentales. En dissociant clairement la sexualit de la reproduction, la FIV et linsmination
artificielle avec donneur ont fini
par donner des ides aux clibataires mais aussi aux couples
POURQUOI
CET ARTICLE ?
Ce texte dresse un bilan de la
FIV travers des tmoignages
qui montrent que la technique
reste trs contraignante.
Chaque tentative na que 20
25 % de chance de russite.
Lassistance mdicale la
procration soulve de nombreux problmes dthique
(anonymat des donneurs de
spermes, dovules ou dembryons, rponse donner aux

homosexuels. En France, des


dizaines de couples de femmes
partent ainsi tous les ans aux
Pays-Bas, en Finlande, en Belgique ou en Sude pour se
faire insminer tandis que des
couples dhommes recherchent,
eux, des mres porteuses prtes
sengager dans une FIV aux
tats-Unis, en Inde ou au Canada.
En France, ces procdures sont
interdites : les lois de biothique
de 1994 et 2004 rservent lassistance mdicale la procration
aux couples htrosexuels qui
font tat dune infertilit mdicalement diagnostique ou qui
risquent de transmettre une
maladie grave leur enfant. Lors
du dbat sur la rvision des lois
de biothique, des dputs, des
psychanalystes, des chercheurs
et des avocats ont cependant
plaid en faveur de louverture
de lAMP l infertilit sociale .
Une voie clairement carte par
le gouvernement, qui souhaite,
au contraire, raffirmer la finalit mdicale des techniques
daide la procration.
Anne Chemin
(6 octobre 2010)
demandes dinsmination
des clibataires, des couples
de femmes homosexuelles
ou la recherche de mres
porteuses pour les couples
dhommes). Ces techniques
ont ainsi cr de vritables
dbats de socit, en faisant
voluer la vision de la famille.
La lgislation varie d'un pays
europen un autre.
Vous pouvez utiliser les donnes de cet article dans des
sujets traitant de la matrise
de la procration.

Fminin-masculin et procration (1re et Term)

41

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

ZOOM SUR

LES ARTICLES DU

LES ARTICLES DU

LES ARTICLES DU

ans son rapport 2010 sur


lassistance mdicale
la procration (AMP) en
France, lagence de biomdecine
met en garde contre linfertilit
lie lge. Aprs 40 ans, un tiers
des femmes en dsirant nauront

pas denfant. La chute de la fertilit


chez les hommes est significative
ds 45 ans.
Ainsi, il est faux de croire que
lAMP permet davoir un enfant
nimporte quel ge , prcise
lagence. On note aprs 40 ans

une diminution des grossesses


aprs insmination artificielle et
fcondation in vitro (FIV), et une
augmentation des fausses couches
lies notamment lge masculin.
Pour la FIV, les taux daccouchement sont de 12 % 38 ans, de 9 %

POURQUOI
CET ARTICLE ?
Cette brve peut-tre
utilise dans un sujet de
restitution des connaissances sur les techniques
de PMA ou dans des questions concernant leurs
limites (vieillissement des
patients).
40 ans et de 6 % 42 ans.

(7 novembre 2010)

Lois de biothique :
le choix du statu quo, hlas !

out a pour a ! Trois ans dintenses


dbats, des tats gnraux organiss
grands frais dans tout le pays, des avis
consultatifs rendus par toutes les instances de
rflexion sur lthique pour, finalement, dcider
de ne rien changer : la dception suscite par la
rvision des lois de biothique, examines partir de mardi 8 fvrier lAssemble nationale, est
la hauteur des attentes quelle avait souleves.
Certes, le gouvernement navait pas enclench ce processus par choix : le rexamen des
lois est rendu obligatoire tous les cinq ans, afin
dadapter le droit aux volutions de la science
et de la socit. Mais, en ne concdant rien, sur
aucune des pistes explores lors du dbat, la
majorit transforme les lois de biothique
la franaise en lun des arsenaux les plus
conservateurs dEurope.
Depuis 1994, anne des premires lois de
biothiques, la France se targue de bnficier
dune lgislation cohrente et structure autour de trois grands principes : primaut de
la personne humaine, non patrimonialit
du corps humain, anonymat et gratuit du
don. Les textes rglementent notamment
lassistance mdicale la procration (insmination artificielle et fcondation in vitro)
en la rservant exclusivement aux couples
htrosexuels.
La premire rvision des lois, en 2004, avait
t consacre la question du clonage thrapeutique : le lgislateur avait alors admis, du

42

bout des lvres, les recherches sur les cellules


souches embryonnaires, tout en conservant
symboliquement le principe de linterdiction.
Sept ans aprs, le dbat, de scientifique, est
devenu socital. Fallait-il ouvrir le bnfice de
laide la procration aux femmes clibataires
ou aux homosexuelles, sachant que plusieurs
centaines denfants naissent chaque anne
de couples de Franaises qui se sont rendues
ltranger bnficier de ces techniques ?
Fallait-il faire droit la demande de certaines
femmes infertiles en autorisant les mres
porteuses ? Fallait-il, enfin, accepter de lever
lanonymat des donneurs de gamtes alors
que les enfants issus dun tel don demandent
connatre leurs origines ?
Ce dernier sujet paraissait lun des moins
controverss, la plupart des pays occidentaux stant dots dun dispositif juridique
permettant une leve partielle ou totale de

POURQUOI
CET ARTICLE ?
Les lois de biothique ont
t rexamines en 2011, la
lgislation imposant jusqu
prsent de les rtudier
tous les cinq ans en raison
des volutions scientifiques

Fminin-masculin et procration (1re et Term)

lanonymat des donneurs de gamtes. Par la


voix de son ancienne ministre de la Sant,
Roselyne Bachelot, le gouvernement y a donc
sembl, un temps, dispos.
Las, sur ce point comme sur les autres, la
majorit a finalement oppos une fin de nonrecevoir. Se rfugiant derrire la permanence
de notre lgislation, le gouvernement et les
dputs UMP ont prfr le confort du statu
quo au dfi de devoir rpondre de nouvelles
demandes sociales.
Et, pour faire bonne mesure, les dputs
sapprtent clore dfinitivement le dbat
en supprimant lobligation de rvision priodique des lois. Considr comme pionnier il y
a quinze ans, le cadre biothique la franaise,
la trane de nos voisins europens, est en
passe de devenir un carcan.

et de la socit. Or, aucun


changement na t apport
aux textes de 2004, ce qui
montre que les dbats entre
les lgislateurs, les scientifiques et les politiques sont
trs controverss et que les
volutions de la socit vont
parfois trs vite, le lgislateur

Un tri gntique pourra tre pratiqu


parmi les embryons in vitro

clame de longue date par


de nombreux spcialistes
hospitalo-universitaires
de gntique et de gyncologieobsttrique, la technique dite du
diagnostic primplantatoire
(ou DPI) va dornavant pouvoir
tre dveloppe en France. Un dcret dapplication des lois de biothique publi au Journal officiel
du 27 mars prcise les conditions
dans lesquelles cette technique
controverse pourra, concrtement, tre mise en uvre.
Le DPI consiste analyser le patrimoine gntique dune cellule
prleve sur un embryon humain
conu par fcondation in vitro.
Il a pour objectif la recherche
de la prsence ou de labsence
dune anomalie gntique chez
cet embryon, cr partir des
cellules sexuelles dun couple prsentant un risque lev de donner
naissance un enfant porteur
dune anomalie transmissible
de manire hrditaire. Seuls les

embryons indemnes de cette anomalie sont, ultrieurement, placs


dans lutrus de la future mre, les
autres tant dtruits.
Fruit des dernires avances de
la gntique molculaire, le DPI
permet ainsi dviter la femme
concerne davoir recours lavortement, pratique habituellement
mise en uvre lorsque le diagnostic est effectu pendant la grossesse, au moyen du diagnostic
prnatal. Au dbut des annes 80,
lors des dbats pralables la promulgation des lois de biothique,
une vive controverse avait oppos
les partisans et les adversaires
de cette technique. Les premiers
ne voyaient dans le DPI quune
amlioration des procds du
diagnostic prnatal alors que
les seconds dmontraient quil y
avait l une mthode permettant
deffectuer un tri gntique
des embryons humains ouvrant
la voie une forme moderne
deugnisme.

jUJUSFFYDFQUJPOOFMx
Prvu par les lois de biothique
de 1994, le DPI ne pouvait jusqu
prsent tre mis en pratique en
France, faute de dcret dapplication. Cette situation avait conduit
un groupe de spcialistes hospitalo-universitaire lancer, dans
les colonnes du Monde, un appel
au gouvernement pour obtenir la
publication de ce texte (Le Monde
du 26 fvrier 1997). Un an plus tard,
cest chose faite. Le dcret prcise
notamment les conditions dans
lesquelles linformation devra tre

POURQUOI
CET ARTICLE ?
Dans le cadre de la fcondation
in vitro, le diagnostic primplantatoire (ou DPI) est lanalyse du gnome dun embryon.
Il peut permettre dviter des
avortements, en dtectant

donne au couple concern et celles


dans lesquelles devront uvrer les
quipes spcialises autorises
pratiquer le DPI. Seule la pathologie lie lanomalie gntique
parentale susceptible dtre transmise peut tre recherche chez
lembryon au cours des analyses
conduisant ce diagnostic , prcise le dcret. La loi prvoit quant
elle que le DPI ne peut tre autoris
qu titre exceptionnel .
Jean-Yves Nau
(31 mars 1998)

prcocement des anomalies


gntiques, mais prsente
galement le risque de drives
eugnistes, sil est employ
pour faire du tri gntique.
La loi franaise encadre donc
strictement lutilisation du DPI
afin dviter un mauvais usage
de cette technique.

(8 fvrier 2011)

ayant bien du mal prendre


position.
Les informations apportes
par cet article peuvent tre
rinvesties dans un sujet qui
appelle une rflexion de
biothique en lien avec les
techniques de procration
mdicalement assiste.

Fminin-masculin et procration (1re et Term)

43

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Mme assiste, la fertilit


dcrot avec lge

MOTS CLS
CONTRACEPTIF
Mthode qui vise empcher
la fcondation (contraception=
contre la conception).

CONTRAGESTIF
Mthode qui soppose au dveloppement dune grossesse dbutante (contragestif= contre la
gestation).

ZOOM SUR
Les infections sexuellement transmissibles.
Les infections sexuellement
transmissibles (IST) se transmettent lors de rapports sexuels.
Non-traites, elles peuvent avoir
des consquences plus ou moins
importantes.
Pour la plupart, la gurison est
possible avec un traitement appropri.
t-BTZQIJMJTFTUEVFVOFCBDU
rie.
Si on ne la soigne pas, elle provoque des lsions du cerveau, des
nerfs, du cur, des yeux et des
artres.
Un traitement antibiotique permet la gurison.
t -FT QBQJMMPNBWJSVT TPOU EFT
virus qui peuvent provoquer le
cancer du col de lutrus. Un vaccin est disponible.
t -IQBUJUF # FTU EVF  VO WJSVT
qui entrane des risques de cirrhose et de cancer du foie. Un
vaccin existe.
t -FT DIMBNZEJPTFT TPOU EVFT 
des bactries, les Chlamydia, et
peuvent provoquer la strilit et
des grossesses extra-utrines.
t -F Sida ou VIH est d au virus
VIH. La sropositivit peut voluer vers le Sida.
t-FTCMFOOPSBHJFTHPOPDPDDJRVFT
sont dues des bactries et peuvent tre responsable de strilit.
t6OFTVSWFJMMBODFFTUSBMJTFQBS
lInstitut de veille sanitaire qui
publie rgulirement les rsultats
de ses tudes.
Exemple : en 2009, 150 000 personnes taient sropositives pour
le VIH mais seulement un tiers
tait inform de sa contamination.

44

LESSENTIEL DU COURS

Prendre en charge sa vie sexuelle


(contraception, contragestion,
prvention des IST)

a prise en charge de sa vie sexuelle par un individu passe par


une bonne connaissance des cycles hormonaux. En effet,
ceux-ci jouent un rle important dans la procration, la comprhension des mthodes contraceptives et contragestives et des
techniques de procration mdicalement assiste. Des mesures
dhygine peuvent empcher la propagation des infections sexuellement transmissibles (IST) qui peuvent tre cause de strilit.

Les diffrentes mthodes


contraceptives
Les mthodes dauto-observation, qui sont les plus
anciennes, ncessitent une abstinence priodique :
la mthode Ogino est fonde sur le fait que les
cellules reproductrices (les ovules et les spermatozodes) ont une dure de vie nexcdant pas quelques
jours. Le risque de fcondation est donc limit si les
rapports sexuels ont lieu plusieurs jours avant ou
aprs lovulation. On estime ainsi que la fcondation
est possible pendant une priode denviron 6 jours,
priode dtermine en fonction de la date du premier
jour des rgles ainsi que de la dure du cycle ;
la mthode des tempratures repose sur le fait que
lovulation se traduit par une augmentation de la temprature corporelle de quelques diximes de degr.
Cette augmentation peut-tre dcele par la femme
grce une prise de temprature chaque matin au
rveil (il faut sassurer que la hausse de temprature
observe nest pas due une autre cause !). On estime
ainsi que la femme nest pas fconde entre le 3e jour de
temprature haute et le premier jour des rgles ;
la mthode dobservation de la glaire cervicale ou
(mthode Billings) permet galement lestimation de
la priode dovulation. Elle ncessite de recueillir un
peu de pertes vaginales pour en observer la couleur
et la consistance, qui varient en fonction des priodes
du cycle menstruel.

Fminin-masculin et procration (1re et Term)

Toutes ces mthodes, qui requirent une bonne


connaissance de soi et des observations sur plusieurs
mois, ont une fiabilit extrmement limite, ce qui
permet de penser quaucune dentre elles nest adapte, par exemple, la sexualit des adolescents. Par
ailleurs, il est important de noter que 50 % des premiers rapports interviennent sans aucune mthode
contraceptive et que 20 % des grossesses surviennent
suite un premier rapport.
Dautres mthodes, beaucoup plus sres et adaptes
chaque cas, sont maintenant la disposition des
couples. Cest le cas, par exemple, des mthodes
locales :
le prservatif (tube en latex fin) droul sur la verge
en rection, avant le rapport sexuel, empche que les
spermatozodes mis ne parviennent au contact de
lovule. La fcondation est donc impossible. Il ne doit
servir quune seule fois et ne doit pas tre perc. Par
ailleurs, il constitue la seule protection contre les
maladies sexuellement transmissibles (MST) et, en
particulier, contre le Sida ;
le diaphragme pos lintrieur du vagin, constitue
une barrire qui empche la pntration des spermatozodes. Il ne protge pas des MST et doit tre
adapt lanatomie de la femme. Cest une mthode
ncessitant une certaine habitude et qui doit tre
associe lutilisation de spermicides ;
les spermicides se prsentent sous la forme de
gel, dponge ou de tampon plac dans le vagin, qui
assurent la destruction des spermatozodes ;
le strilet est plac par le gyncologue dans lutrus
de la femme. Peu employ avant une premire grossesse, il agit en empchant la nidation de luf dans
lutrus, mais les mdicaments anti-inflammatoires
(comme laspirine) diminuent son efficacit. En
gnral, il est pos pour une dure de 3 5 ans. Il
est toutefois ncessaire de consulter rgulirement
afin que le gyncologue sassure quil ny a pas de
problme. Cest un moyen de contraception trs sr.
Les contraceptifs oraux (pilules) agissent sur les cycles
hormonaux. Il existe plusieurs types de pilules selon
la composition chimique et le dosage des hormones.

La pilule a pour effet de modifier ponctuellement les


taux plasmatiques des hormones ovariennes, ce qui
a pour consquences possibles :
de perturber le rtrocontrle de ces hormones sur le
complexe hypothalamo-hypophysaire et de bloquer
ainsi lovulation et donc la fcondation ;
de sopposer aux modifications de la paroi interne
de lutrus et dempcher ainsi la nidation ;
de rendre la glaire cervicale impermable aux
spermatozodes, de freiner leur progression et dempcher ainsi la fcondation.
Le choix de la pilule est dict par lge, les antcdents mdicaux, le tabagisme et lacceptation
psychologique. Cest le moyen de contraception le
plus sr (efficacit de 100 %), mais il ncessite une
prise rgulire et des contrles frquents par un
spcialiste car il peut y avoir des effets indsirables
ou des contre-indications.
Les pilules dites normodoses ou stroprogestatives sont composes dun strogne et dun
progestatif de synthse. Chaque plaquette comprend
21 pilules prendre quotidiennement partir du
premier jour des rgles. Pendant les 7 jours suivants,
les rgles apparaissent. Ces pilules empchent la
production de FSH et de LH, et donc le dveloppement des follicules et lovulation. Elles exercent un
rtrocontrle ngatif sur les complexe hypothalamohypophysaire. Elles provoquent lpaississement de
la glaire cervicale et lamincissement de lendomtre.
Les pilules progestatives ou micropilules, contiennent un progestatif maintenant la glaire cervicale
paisse et lendomtre peu pais.
En cas de rapports sexuels non-protgs ou acciden-

TROIS ARTICLES DU MONDE


CONSULTER
t%FTTQDJBMJTUFTThBMBSNFOUEFMhBVHNFOUBUJPOEFTBWPSUFNFOUTDIF[MFTBEPTp. 48
(lemonde.fr avec AFP, 7 mars 2011)

t-hMFEF'SBODFMBODFTPOjQBTTTBOU
DPOUSBDFQUJPOx p. 48-49
(Laetitia Clavreul, 27 avril 2011)

t-FQSFEFMBGPOEBUJPOin vitro Nobel


de mdecine p. 49-50
(Catherine Vincent, 6 octobre 2010)

tellement mal protgs


(oubli de la pilule habituelle, dchirement
du prservatif), lutilisation de la pilule du
lendemain est possible, rapidement (dans
les trois jours aprs le
rapport non-protg)
et aprs consultation
mdicale. Ce type de pilule apporte des doses
importantes de progestatifs qui perturbent lovulation et agissent sur lutrus (glaire et muqueuse),
empchant la nidation.

Les modes daction


des contragestifs
Les contragestifs empchent la nidation et la
gestation, aprs fcondation.
Il existe une interruption volontaire de grossesse
(IVG) mdicamenteuse : la prise de la pilule RU 486
qui doit seffectuer sous surveillance mdicale
jusqu la neuvime semaine de grossesse. Il s'agit
d'une antihormone, cest--dire que la molcule
prsente une partie analogue la progestrone et
peut se fixer sur les rcepteurs de cette dernire.
Elle empche laction de la progestrone sur la
muqueuse utrine et provoque le retour des rgles
et lexpulsion de lembryon car elle est associe
un mdicament qui provoque des contractions
utrines. On parle de pilule abortive.
Depuis 1975, la loi Veil a lgalis lavortement. LIVG
chirurgicale peut se raliser jusqu 14 semaines
aprs les dernires rgles. Pour un motif mdical danger pour la mre ou ftus prsentant des
malformations graves lIVG est autorise pendant
toute la dure de la grossesse. Les mineures doivent
se faire accompagner par une personne majeure de
leur choix ou par une association.

-FTNFTVSFTEIZHJOF
et de prvention respecter
pour viter la contamination
et la propagation des IST
Les IST sont les infections sexuellement transmissibles qui se transmettent entre individus lors
de contacts sexuels non protgs et sont dues
des bactries, des virus, des protozoaires ou des
champignons. Certaines dentre elles provoquent des
strilits, mme aprs un seul rapport contaminant.
Des mesures simples de protection sont possibles :
se faire vacciner, quand cela est possible, contre
les IST (hpatite B, papillomavirus, etc.) pour ne pas
contracter la maladie ;
utiliser un prservatif masculin ou fminin ;
pratiquer un dpistage, anonyme et gratuit, aprs
un rapport sexuel risque, de faon bnficier
dun traitement rapide en cas dinfection et ainsi en
limiter les consquences.

DATES CLS
t 1942 : Lavortement est un crime
au regard de la loi, passible de la
peine de mort.
t 1956 : Le Dr Gregory Pincus (19031967) et son assistant mettent au
point le premier contraceptif oral,
dite pilule stroprogestative.
t 1963 : La premire pilule est commercialise en France.
t 1967 : La contraception devient
lgale (loi Neuwirth). Cette loi autorise la fabrication de contraceptifs,
leur vente en pharmacie sur ordonnance mdicale avec autorisation
parentale pour les mineures.
t 1968 : La pilule est disponible
pour toutes les femmes et pas seulement pour les femmes maries.
t 1974 : La contraception est rembourse.
t 1975 : Linterruption volontaire
de grossesse (IVG) est lgalise (Loi
Veil).
t 1982 : Linterruption volontaire
de grossesse est rembourse par la
scurit sociale.
t 1980 : La pilule abortive (RU 486)
est dcouverte.
t 1978 : Le premier bb-prouvette
voit le jour en Grande-Bretagne.

REPRES
Les diffrents types de pilules.
t Les pilules qui associent des
strognes de synthse et un
progestatif :
des dosages dstrognes variables : 15, 20, 30, 35, 50 microgrammes ;
des progestatifs diffrents ;
des variations de dosages des
strognes et des progestatifs au
cours de la plaquette pour les pilules biphasiques et triphasiques ;
des dosages constants pour les
monophasiques.
t-FTQJMVMFTTVSPVKPVST
les pilules qui associent un strogne naturel et un progestatif ;
les strognes sont identiques
ceux de la femme ;
les dosages dstrognes et de
progestrone varient au cours de
la plaquette pour la pilule squentielle ;
les pilules contenant uniquement un progestatif.

Fminin-masculin et procration (1re et Term)

45

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

Alternatives la pilule classique.

Document 2
Graphique montrant les variations de la concentration de LH au cours du temps chez une femme sans
traitement et chez une femme aprs un traitement
au lvonorgestrel.

3500

LH est une hormone naturelle scrte par lhypophyset. LHO : jour du pic de LH chez une femme
sans traitement. LH + 2 : deuxime jour suivant
le pic de LH chez une femme sans traitement.
Source : http://svt.ac-dijon.fr, adapt de larticle
original de Marions et al. Emergency contraception with mifepristone and levonorgestrel :
mechanism of action, Obstet. Gynecol 2002, 100 :
65 71.

Lintitul complet du sujet


laide des documents 1 et 2 et de vos connaissances,
rdigez un message expliquant cette internaute en
quoi la prise de la pilule du lendemain ne peut pas
tre considre comme une interruption volontaire
de grossesse.

Ce quil ne faut pas faire


t$PNNFOUFSMFTEPDVNFOUTVOVO
sans les relier dans un texte global.
t/FQBTBSHVNFOUFSTDJFOUJmRVFNFOU
t/FQBTSJOWFTUJSWPTDPOOBJTTBODFTTVS
le rle du pic de LH dans le dclenchement
de lovulation.

Lanalyse du sujet
Pour rpondre au sujet, vous devez utiliser avec
prcision lexploitation des documents et vos
connaissances en les organisant de faon logique
pour que votre rponse se prsente sous forme
dune argumentation scientifique rpondant la
problmatique souleve par la jeune femme. Il est

LH (units
arbitraires)

3000

sans traitement

2500
administration de lvonorgestrel 2 jours avant
lovulation (LH2)

2000
1500
1000
500

Fminin-masculin et procration (1re et Term)

LH+14

LH+12

LH+10

LH+8

0
temps/ pic de LH

important de mettre en relation les informations


des diffrents documents et vos connaissances.
Votre message l'internaute doit expliquer que la
pilule du lendemain contient des progestatifs qui provoquent la suppression du pic de LH donc labsence
dovulation. Sil ny a pas ovulation, il ne peut y avoir
de grossesse donc la pilule du lendemain nest pas
une pilule abortive (contrairement la pilule RU 486).
Vous gagnerez des points si vous indiquez clairement la problmatique ds le dbut de votre texte,
si vous citez des valeurs chiffres lorsque vous commentez des courbes et si vous mettez en vidence la
chronologie des vnements physiologiques.

SUJETS TOMBS AU BAC SUR CE THME


tudes de documents
Mode daction du RU486 (Nouvelle-Caldonie,
septembre 2009)
Hormone (Sujet zro, 2012)

Il existe dautres mthodes hormonales que la pilule. Leur principe daction reste similaire celui
de la pilule.
t -BOOFBV DPOUSBDFQUJG  JM TBHJU
dun anneau plac au niveau
du col de lutrus pendant trois
semaines par cycle et contenant
des hormones.
t-JNQMBOUNJTFOQMBDFQPVSUSPJT
ans sous la peau de la face interne
du bras, il dlivre de faibles quantits de progestatif de synthse.
t -F QBUDI  QMBD TVS MB QFBV
(fesse, torse, bras ou abdomen),
il diffuse par voie transcutane
un stroprogestatif de synthse.
t-FQSPHFTUBUJGJOKFDUBCMFPOSBlise une injection intramusculaire
dun progestatif de synthse.
t-FSIU hormonal (systme intrautrin hormonal) : il est mis en
place pendant cinq ans dans lutrus par le mdecin et diffuse du
lvonorgestrel.

ZOOM SUR
La strilisation contraceptive.

La problmatique
La pilule du lendemain provoque t-elle un avortement ?

Proposition de corrig
Bonjour,
Je comprends que tu sois proccupe suite la prise de la pilule du lendemain il y a quelques semaines. Tu tinterroges pour savoir si la pilule du lendemain a provoqu un avortement (interruption volontaire de grossesse
ou IVG) et a donc arrt une grossesse dbutante... Une meilleure connaissance du mode daction de cette pilule
va te rassurer !
En tudiant la notice de ta pilule Norlevo, tu constateras quelle contient une substance active, le lvonorgestrel, appartenant aux progestatifs. Cette pilule est un contraceptif durgence qui doit tre utilis dans les 12 72 h suivant le
rapport sexuel non-protg, elle permet dviter une grossesse. Elle ne fonctionne pas si la femme est dj enceinte.
Alors comment fonctionne cette pilule ?
Chez la femme, lovulation est provoque par un pic de LH. La LH est une hormone secrte par lhypophyse. Si lon
compare les taux de LH chez une femme sans traitement et chez une femme qui a pris Norvelo, on constate une
disparition du pic de LH chez cette dernire.
Au moment de lovulation (LHO), le taux de LH est denviron 2 200 units arbitraires chez la femme sans traitement, il
est infrieur 500 units arbitraires, chez la femme traite avec lvonorgestrel. Le taux de LH augmente lgrement
LH +2, environ 700 units arbitraires puis diminue les jours suivants. Il ny a donc plus de pic de LH suite au traitement.
Cela signifie que la pilule du lendemain empche lovulation. Les progestatifs contenus dans la pilule du lendemain agissent directement sur le complexe hypothalamo-hypophysaire par rtroaction ngative pour freiner la
scrtion de LH.
Or tu sais que, pour quil y ait une grossesse, il faut une ovulation suivie dune fcondation par un spermatozode
puis implantation de lembryon dans la muqueuse de lutrus.
Jespre que ces explications te rassurent. La pilule du lendemain ne provoque aucunement un avortement mais
empche une grossesse en bloquant lovulation chez la femme.

t$IF[MFTGFNNFT POQSPDEFMB
ligature des trompes de Fallope ou
lobturation des trompes.
t$IF[MFTIPNNFT POTFDUJPOOFMFT
canaux dfrents (qui transportent
les spermatozodes) sous anesthsie
locale. Cette action est irrversible
mais il y a possibilit de conserver
pralablement du sperme dans une
banque de sperme.
Une anomalie chromosomique :
la trisomie 21.
Ltude du caryotype trisomique
montre quil comporte 47 chromosomes dont 3 chromosomes 21, au
lieu de 46 chromosomes et une seule
paire de chromosomes 21 ; do le
nom de trisomie 21. La trisomie 21
rsulte dun partage ingal des chromosomes lors de la production des
gamtes : certains gamtes reoivent
24 chromosomes au lieu de 23. La
rencontre dun des ces gamtes avec
un autre gamte 23 chromosomes,
lors de la fcondation, aboutit une
cellule-uf 47 chromosomes.

Fminin-masculin et procration (1re et Term)

47

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

46

Document 1
Extrait de la notice dune pilule du lendemain : Norlevo
La substance active est le lvonorgestrel. Les autres
composants sont le lactose monohydrat, lamidon de
mas, la povidone, la silice collodale anhydre, le starate de magnsium. Le lvonorgestrel appartient un
groupe de mdicaments appels progestatifs. Chaque
bote de Norlevo 1,5 mg contient un comprim de
1,5 mg de lvonorgestrel. Cette contraception durgence
doit tre utilise le plus tt possible, de prfrence dans
les 12 heures et au plus tard dans les 72 heures (3 jours)
aprs le rapport sexuel non-protg, ou en cas dchec
de la mthode de contraception. Il est plus efficace si
vous le prenez ds que possible aprs un rapport sexuel
non-protg. Norlevo ne permet dviter une grossesse
que si vous le prenez dans les 72 heures qui suivent
un rapport sexuel non-protg. Il ne fonctionne pas
si vous tes dj enceinte.

LH+6

t-FQSJODJQFEBDUJPOEFMBQJMVMF
masculine est le mme que pour
la pilule stroprogestative fminine, puisquil sagit dempcher
la formation des spermatozodes.
Ladministration de testostrone, par rtrocontrle ngatif
sur le complexe hypothalamushypophysaire permet de bloquer
la fabrication des spermatozodes.
Plutt quune pilule, il s'agirait
d'injecter tous les deux ou trois
mois un gel ou de poser un implant sous la peau.
Lefficacit nest pas totale puisque
20 % des hommes continuent
produire du sperme et les effets
secondaires persistent (prise de
poids, acn, augmentation du
cholestrol).
Des blocages dordre culturel existent galement.
l'heure actuelle, lindustrie
pharmaceutique et les laboratoires dlaissent leurs recherches
et la commercialisation nest pas
encore dactualit !

Les documents
Document de rfrence
Message trouv sur un forum de discussion :
Jai d prendre la pilule du lendemain il y a
quelques semaines, et je narrive pas men remettre.
Pour moi, la prendre, a veut tout simplement dire
que si bb il y a eu, je me suis faite avorter. Mon
compagnon ne comprend pas du tout mon opinion.
Pour lui, cest juste le rattrapage dun accident []
Source : forum aufeminin.com.

LH+4

t-B'POEBUJPO#JMM(BUFTmOBODF
des travaux de chercheurs sur
une contraception masculine
reposant sur les ultra-sons.
Il semblerait possible de rendre
strile un homme pendant six
mois, suite un traitement des
testicules aux ultrasons. Cette
technique non-douloureuse, peu
coteuse, parat rversible.
Des tudes complmentaires doivent tre ralises pour confirmer
la rversibilit de la technique,
lefficacit et linnocuit du traitement, ainsi que labsence deffets
secondaires.

REPRES

La pilule du lendemain

LH+2

t-BNPMDVMF)WQFSNFUUSBJUEF
crer une contraception destine
aux hommes. Cette molcule
contrle le pH du sperme. Or une
certaine acidit du sperme permet une meilleure mobilit des
spermatozodes.
Ainsi, la molcule Hv1 pourrait rsoudre des problmes dinfertilit
masculine mais aussi prvenir des
grossesses non-dsires. (Source :
Journal Cell.)

LH0

Des pistes pour une contraception


masculine.

tude de documents :

LH2

ZOOM SUR

UN SUJET PAS PAS

LES ARTICLES DU

Des spcialistes salarment de laugmentation


des avortements chez les ados

faut dducation la
sexualit, difficults daccs la contraception : le
nombre davortements ne cesse
daugmenter chez les adolescentes,
ont dplor des spcialistes, loccasion dun forum lundi 7 mars
Paris sur le droit linterruption
volontaire de grossesse (IVG) en
2011, prsid par le professeur Isral
Nisand.
La France est dans une situation
de paradoxe contraceptif , a rappel la sociologue et dmographe
Nathalie Bajos, de lInstitut national
de la sant et de la recherche mdicale (Inserm) : alors que la contraception est largement diffuse, le
recours linterruption volontaire
de grossesse ne flchit pas (environ 227 000 chaque anne). Il est
mme en augmentation chez les
plus jeunes.
En 2006, 13 230 IVG ont t ralises sur des mineures, selon un
rapport de lInspection gnrale
des affaires sociales (IGAS) doctobre 2009, un chiffre en hausse
continue (10 722 en 2002). Avec les
18-25 ans, cest la seule tranche de
population o l IVG est en augmentation, a relev le Pr Nisand.
On fait comme si la sexualit des
ados nexistait pas
Nous navons pas fait ce quil
fallait , a accus le gyncologueobsttricien (CHU de Strasbourg),
farouche dfenseur du droit des

femmes exercer leur choix. Il


a accus en particulier labsence
dducation la sexualit lcole,
pourtant devenue une obligation
lgale depuis la loi du 4 juillet 2001.
Il ny a aucune rgion de France
o cette loi est applique parce quil
ny a aucune volont politique de
la faire appliquer , a dnonc le
Pr Nisand, qui a lui-mme impuls
en Alsace une dynamique de prvention en milieu scolaire. On
fait comme si la sexualit des ados
nexistait pas , a regrett le spcialiste, mettant en cause les lobbies
religieux ou de parents dlves.
Il a tmoign des difficults rencontres sur le terrain trouver des
intervenants qualifis, surmonter
les problmes demploi du temps
ou encore les ides reues des chefs
dtablissement, citant par exemple
lun dentre eux pour qui seules les
filles pouvaient tre concernes.
Il a aussi tmoign de la mconnaissance, malgr des apparences
trompeuses, des adolescents : Ils
simaginent que pendant le premier rapport on ne risque rien,
que pendant les rgles on ne risque
rien
Pour un accs gratuit et anonyme
la contraception
Le Pr Nisand revendique un
droit de ladolescent la confidentialit de sa sexualit , avec
notamment un accs anonyme et
gratuit la contraception sans

que les parents soient informs


par la Scurit sociale aujourdhui
seulement possible dans les centres
de planification familiale, en
centre-ville , inaccessibles pour
la majorit des jeunes. L IVG est
anonyme et gratuite. La pilule du
lendemain est anonyme et gratuite, mais pas la contraception. On
marche sur la tte ! a-t-il dnonc.
Reste que limmense majorit
des femmes ayant recours lIVG
avaient une contraception, y compris les mineures, a relev Nathalie
Bajos. Elle a point la rigidit de la
norme contraceptive , domine
par la pilule, qui ne suit pas lvolution de la sexualit de la femme. Le
passage mal ngoci du prservatif
la pilule est ainsi une des causes
dIVG chez les plus jeunes, a-t-elle
indiqu.

La psychologue et psychanalyste Sophie Marinopoulos


(Nantes) a insist de son ct
sur la trace que laisse une
IVG sur le psychisme, en particulier chez des jeunes filles.
Linconscient est rancunier , a-t-elle mis en garde. Le
Pr Nisand a soulign dautre part
que le droit lIVG est devenu
fragile et mrite dtre protg .
Si le droit lIVG est effectivement acquis, la menace plane sur
les moyens matriels, a-t-il expliqu : centres IVG qui ferment sans
redploiement des moyens, dficit
de formation des mdecins Une
mauvaise mto pour le droit
des femmes.
lemonde.fr avec AFP
(7 mars 2011)

POURQUOI CET ARTICLE ?


Cet article souligne la contradiction entre les possibilits
de contraception existantes actuellement et la hausse des
avortements chez les adolescentes. Ce paradoxe dmontre
limportance de linformation et de lducation la sexualit.
Le milieu scolaire se doit de prendre en charge cette ducation
car beaucoup dides fausses entourent encore la sexualit. Par
ailleurs, le Pr Nisand plaide pour un accs la contraception
anonyme, gratuit et pouvant se faire indpendamment des
parents. De plus, lIVG et la pilule du lendemain sont gratuits
mais la contraception ne lest pas, ce qui semble incohrent.
Cet article peut tre rutilis dans un sujet sur la contraception
et la matrise de la procration.

Lle-de-France lance
son pass sant contraception
159 000 adolescentes pourront accder gratuitement et anonymement une contraception.

L
48

a rgion le-de-France a lanc,


mardi 26 avril, un pass
sant contraception , au

lyce polyvalent lisa-Lemonnier


dans le 12e arrondissement de Paris.
Luc Chatel, ministre de lducation

Fminin-masculin et procration (1re et Term)

nationale, associ au dispositif,


accompagnait Jean-Paul Huchon,
le prsident (PS) du conseil rgional.

Ce dispositif consiste remettre


aux jeunes, leur demande, par
linfirmire de leur tablissement,

des coupons (consultation chez un


gnraliste ou un gyncologue, prise
de sang, dlivrance de contraceptifs
pour trois six mois) qui leur permettront daccder gratuitement et
anonymement une contraception.
Ils pourront ainsi se passer dune
concertation avec leurs parents. Les
lves inscrits en seconde ou en
niveau quivalent (apprentis) en
seront les bnficiaires prioritaires.
Au total, 159 000 jeunes sont susceptibles de souhaiter se le procurer,
selon la Rgion.
Les jeunes ayant besoin dune
contraception, rgulire en particulier, sont confronts diffrents
obstacles , est-il expliqu sur le
site de lle-de-France, qui cite le
manque de confidentialit du circuit
de remboursement puisque les
jeunes sont inscrits sur la carte vitale
de leurs parents jusqu 18 ans , les
problmes de financement ou une

mconnaissance du sujet. La mesure


vise notamment faire baisser le
nombre de grossesses non-dsires
et davortements chez les mineures.
Au niveau national, plus de 13 200
IVG ont t ralises sur des mineures en 2006, selon linspection
gnrale des affaires sociales, un
chiffre en forte augmentation. Le
gyncologue Isral Nisand estime
cependant quil est sous valu et
plus proche de 15 000. Il a t charg
par le gouvernement de rflchir
lide dune contraception anonyme
et gratuite pour les mineures.
Sgolne Royal, qui en tant que prsidente de la rgion Poitou-Charentes
avait lanc des chques contraception en 2009, sest rjouie que llede-France prenne le relais . Dans sa
rgion, elle sest oppose du ministre
de lducation nationale de faire distribuer ses pass contraception par
les infirmires scolaires. Ils sont donc

POURQUOI
CET ARTICLE ?
Cet article complte le prcdent en mettant en avant
des mesures prises en le-deFrance pour permettre aux
adolescents davoir accs, de
faon gratuite et anonyme,
des moyens contraceptifs, des

disponibles depuis 2010 chez les


professionnels de sant libraux,
mais pas dans les lyces. Mme Royal
dit envisager, puisque M. Chatel sest
montr favorable au dispositif lanc
en le-de-France, de faire de nouveau
parvenir le pass contraception
aux infirmires scolaires.
Au ministre de lducation, on
insiste sur la ncessit de privilgier
lducation la sexualit , ce que

consultations chez un mdecin


et aux analyses ncessaires,
sans avoir passer par leurs
parents. Ces dispositions prises
par la rgion rvlent une prise
de conscience dune situation
paradoxale (moyens contraceptifs existants et hausse des
avortements) quil est faut
rsoudre.

permettra le pass francilien en


privilgiant lcoute et le conseil
personnalis . Une valuation sera
mene dici fin 2011. Luc Chatel souhaite quelle soit alors prsente
lAssociation des rgions de France
et lensemble des responsables
acadmiques.
Laetitia Clavreul
(27 avril 2011)

Le pre de la fcondation
in vitro Nobel de mdecine
Le Britannique Robert Edwards est rcompens pour des travaux qui ont permis plus
de 4 millions de naissances.

e prix Nobel de physiologie


et de mdecine tait peine
annonc, ce lundi 4 octobre,
que Louise Brown ragissait par
courrier lectronique. Maman
et moi sommes tellement heureuses quun des pionniers de la
fcondation in vitro reoive enfin
la reconnaissance quil mrite ,
a comment cette jeune femme
de 32 ans.
Premier enfant au monde
avoir t conu en prouvette, celle
qui dit considrer Robert Edwards
comme un grand-pre naurait
pas vu le jour sans la tnacit de
ce Britannique qui vient, lge de
85 ans, dtre rcompens par le
comit Nobel pour le dveloppement de la fcondation in vitro
(FIV). Un biologiste dont ceux qui
ont travaill avec lui soulignent

louverture desprit, et qui, toute


sa carrire durant, a t port par
une motivation profonde : aider
les couples ayant des problmes
de fertilit avoir des enfants.
Ce Nobel est largement mrit. Mieux vaut tard que jamais ! ,
a dclar le professeur Martin
Johnson, pour qui Bob a amen
lobsttrique et la gyncologie
lge moderne . Aujourdhui
spcialiste des sciences reproductives lUniversit britannique de
Cambridge, il a travaill en tant
qutudiant, dans les annes 1960,
avec ce chercheur hors normes.

j5SBJUEFGPVx
Dans ce temps-l, seuls quelques
biologistes dans le monde commenaient matriser la reproduction in vitro, et seulement chez

lanimal. Une poigne de lapins


taient ns de ces efforts, en 1959
aux tats-Unis, en 1963 en France.
Mais globalement, la technique ne
marchait pas. Pour sengager dans
ce type de recherches, il fallait tre
fou, ou visionnaire.
Robert Edwards tait visionnaire. Il na pas seulement t
en avance sur son temps sur la FIV,
mais galement sur le diagnostic gntique primplantatoire,
sur limportance des cellules
souches embryonnaires, ainsi que
par ses rflexions sur lthique
et le rle de la lgislation dans
ce domaine , prcise le professeur Johnson. Mais lhomme
aujourdhui rcompens, trop
fatigu pour commenter lvnement, nen avait pas moins
dclar, il y a quelques annes,

avoir t trait de fou cette


poque pionnire.
N Manchester en 1925, pre
de cinq filles qui lui ont donn
onze petits-enfants, Robert Edwards avait obtenu son professorat en 1955 lUniversit ddimbourg (cosse), avec une thse sur
le dveloppement embryonnaire
chez les souris. En 1963, il avait
commenc travailler lUniversit de Cambridge la Mecque
de la physiologie de la reproduction animale. L, trs vite, il eut
cette ide folle : tudier la
fcondation in vitro non pas chez
la lapine, mais directement chez
ltre humain.
En 1968, pour la premire fois,
ses recherches dbouchent sur la
cration de la vie. Jamais je noublierai ce jour o jai regard dans

Fminin-masculin et procration (1re et Term)

49

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LES ARTICLES DU

LES ARTICLES DU

50

chances de russite, voire sur la


justification de cette recherche
Chapeau bas !
Le 25 juillet 1978, Louise Brown
venait au monde lhpital
dOldham, dans la banlieue de
Manchester. Avec son collgue
gyncologue Patrick Steptoe
mort en 1988, et donc inligible
au Nobel , Robert Edwards tait
parvenu mener terme une
fcondation humaine en prouvette. Et cela en dpit du fait il le
prcisa par la suite que les deux
hommes avaient d stopper leurs
recherches deux ans durant faute
de financement.
ceux qui, dans un premier
temps, avaient prdit que la petite Anglaise resterait lexception,
lavenir montra rapidement quil
sagissait bel et bien dune rvolution mdicale et thique. En
trente ans, les techniques de la
procration mdicalement assiste (PMA) ont repouss les fron-

Fminin-masculin et procration (1re et Term)

tires de la strilit, bouscul les


lois naturelles de la reproduction,
engendr des scandales et des
espoirs inimaginables jusqualors.
Il y a encore quatre ou cinq
ans, on voyait Bob Edwards dans
les congrs. Il donnait son avis
sur tous les sujets qui ont driv
de la fcondation in vitro. Il tait
trs cout, trs pertinent , dit le
professeur Nisand, qui voque un
homme dune grande conscience
thique . Lglise catholique ne
voit pas moins en lui lauteur dune

technique qui conduit la destruction dlibre dembryons ,


comme le rappelle lencyclique
Dignitas Personae de 2008.
Cambridge, o les professeurs
Edwards et Steptoe ont fond le premier centre mondial de fcondation
in vitro (le Bourn Hall Clinic), plus de
10 000 bbs-prouvette sont ns
ce jour. Dans le monde, ils sont plus
de 4 millions.
Catherine Vincent
(6 octobre 2010)

L'HISTOIRE

DE LA VIE (TERM)

POURQUOI CET ARTICLE ?


Cet article est un hommage au travail du britannique Robert
Edwards, prix Nobel de mdecine, pre de la fcondation in vitro.
On souligne sa persvrance malgr les difficults et lincomprhension de ses collgues. Son ouverture desprit qui lui a permis
dapprhender les problmes dthique qui allaient tre soulevs
suite aux progrs des techniques. Ses travaux ont permis de
rsoudre les problmes de strilit de nombreux couples.
rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

le microscope, et o jai vu quelque


chose dtrange dans les cultures.
Il y avait un blastocyste [un embryon] humain qui me regardait.
Jai pens : on y est arriv ! , a-t-il
racont. La matrise de lensemble
du processus nen tait pourtant
qu ses prmices. Il fallut dix ans
de plus, et toute son intelligence et
sa pugnacit, pour la mener bien.
Cest un modle , estime
le professeur Isral Nisand, gyncologue-obsttricien au CHU
de Strasbourg. Il a eu une
formidable intuition, double
dune tnacit incroyable. Entre
le moment o il a commenc
travailler sur le sujet et celui o
il a atteint son objectif, il sest
coul treize ans : il y a beaucoup
de chercheurs qui se dcourageraient pour moins ! Mais lui a
continu, insist, modifi ses milieux de culture Ctait dautant
plus mritoire quon tait autour
de lui assez incrdule sur ses

NOTIONS CLS
Caractres analogues/
homologues
Les caractres analogues se ressemblent mais nont pas la mme
origine. Les caractres homologues ont la mme origine mais
pas forcment la mme fonction.
Cladogramme
Le cladogramme est un arbre
qui traduit des liens de parent,
arbre dont les nuds (points de
rencontre entre une branchemre et deux branches-filles) sont
fonds sur des caractres drivs
exclusifs En dautres termes, le
cladogramme dit "qui partage
quoi avec qui" et donc "qui est le
plus proche parent de qui" et non
pas "qui descend de qui".
(G. Lecointre, La construction
de phylognies , APBG 1995 ; 1 :
109-36.)
Parent
Chercher la parent cest chercher le groupe frre, et non lanctre. Il sagit de chercher pour
un groupe (ou une espce) donn,
le groupe avec lequel il partage
un caractre exclusif, cest-dire quil ne partage avec aucun
autre groupe. Cela ne conduit
pas chercher lanctre au sens
propre (au sens gntique), car
celui-ci restera toujours inconnaissable. Cela conduit plutt
dduire certains des caractres
que devait possder cet anctre,
caractres drivs qui dfinissent
le groupe.
(G. Lecointre, op. cit.)
Phylognie
Une phylognie est une figure
arborescente qui est fonde sur
le concept de descendance avec
modifications des caractres Reconnatre deux tats, lun driv
de lautre, cest reconnatre une
modification qui a ncessairement t transmise de gnration
en gnration jusquaux organismes que nous observons
(G. Lecointre, op. cit.)
Vertbr ttrapode
Le vertbr ttrapode possde
deux paires de membres et un
cou.

52

L'histoire de la vie (Term)

LESSENTIEL DU COURS

La recherche de parent
chez les vertbrs

n dpit de la formidable biodiversit atteste par les


milliards despces disparues et par les quelque deux
millions despces identifies dans la nature actuelle, le
monde vivant est avant tout caractris par une remarquable
unit. En effet, des caractristiques fondamentales partages par tous les organismes rvlent une origine commune
remontant 3,5 milliards dannes (Ga) malgr les diffrences
acquises au cours de lvolution. Les divisions fondamentales
de la classification au sein dun rgne (animal, vgtal, etc.)
les embranchements ou phylums regroupent les espces qui
partagent un mme plan dorganisation.
Dterminer les liens de parent

Le principe utilis pour dterminer les liens de


parent consiste identifier ltat ancestral dun
caractre et ses tats drivs apparus au cours de
lvolution, de faon remonter de proche en proche
des descendants leur anctre commun.
Les caractres de mme origine volutive ou embryonnaire sont appels caractres homologues ,
mme sils assurent parfois des fonctions diffrentes. Ils se distinguent des caractres analogues
qui, eux, assurent les mmes fonctions sans avoir
la mme origine volutive, comme par exemple les
ailes des insectes et celles des oiseaux.
Ainsi, tous les vertbrs ttrapodes (amphibiens,
reptiles, oiseaux, mammifres) descendent dun
anctre commun vieux de quelque 350 millions
dannes. Ils possdent, en effet, un mme plan
dorganisation, marqu en particulier par un squelette interne comportant une colonne vertbrale
et deux paires de membres. Ces derniers sont des
caractres homologues puisquils ont la mme
origine ; le membre antrieur, qui peut tre une
aile, un bras, une patte, une palette natatoire, etc. a
volu diffremment dans les quatre classes de vertbrs ttrapodes, partir dune structure commune
prsente chez leur anctre commun.

La reconnaissance des homologies


EBOTDFSUBJOTDBSBDUSFT
On recherche des homologies aux diffrents
niveaux dorganisation. Mme si tous les tres
vivants partagent une origine commune qui se
traduit notamment par une remarquable unit
biochimique, gntique et cellulaire, les espces
se distinguent par des particularits molculaires,
anatomiques, morphologiques, physiologiques,
embryonnaires, larvaires, comportementales, etc.

La comparaison de ces diffrents types de caractres


entre groupes despces appartenant au mme
phylum (mollusques, arthropodes, vertbrs, etc.)
permet de reconnatre les homologies.
On a vu que les membres antrieurs des vertbrs
ttrapodes sont homologues, mais on peut aussi
identifier des homologies jusquau niveau molculaire, notamment entre gnes ou protines. Ainsi,
des protines appartenant des espces diffrentes
comme les globines (hmoglobine, myoglobine) et
les gnes qui les codent sont homologues.
Le degr dhomologie entre les caractres hrits
dun anctre commun est un marqueur du degr
de parent entre les espces. Pour les espces
fossiles, le nombre de caractres pris en compte
est forcment plus limit car, en gnral, seules les
parties dures de lorganisme (squelette, coquille)
sont conserves. Dans certains cas favorables, on
peut cependant aussi tudier leur ADN (ADN fossile).

valuer le degr de parent entre


MFTFTQDFT
Les squences de molcules informatives gnes et
protines se prtent particulirement bien lanalyse
informatique, ce qui permet de quantifier prcisment
leur degr de similitude et donc de parent.
Les gnes homologues drivent dun gne ancestral
provenant de leur anctre commun. Plus lanctre
commun est loign dans le temps, plus les gnes
accumulent de mutations, et plus ils diffrent par
leur squence. La comparaison deux deux de
ces squences permet ainsi dvaluer la distance
volutive entre les espces et de complter les informations obtenues par lanalyse dautres caractres.
Plus le nombre de caractres pris en compte est
important et plus les rsultats sont prcis. On peut
ainsi reconstituer les filiations entre espces.

L'arbre phylogntique
Un arbre phylogntique est un diagramme traduisant les relations de filiation entre les espces et
leur plus proche anctre commun. Il faut cependant
noter que ces anctres sont hypothtiques puisque
dduits de lanalyse des caractres homologues, par
dfinition diffrents du caractre ancestral.
On a pu ainsi construire larbre du vivant qui montre les
relations phylogntiques entre les espces et remonte
de proche en proche jusqu lorigine de la vie, il y a
quelque 3,5 milliards dannes. La figure ci-dessous prsente la partie de cet arbre correspondant aux reptiles,
aux oiseaux et aux mammifres, dont lanctre commun hypothtique est dat de 350 millions dannes.

tortues serpents lzards

crocodiles

La notion danctre commun est thorique puisquelle


est dfinie par un ensemble de caractres homologues, retrouvs dans un groupe despces qui en ont toutes hrit.
Elle permet dtablir les nuds de larbre phylogntique.
linverse, les fossiles correspondent des espces
relles ayant vcu durant une priode gologique donne
et ne concident pas ncessairement avec ces nuds.
Ainsi, on considre que le chimpanz et lhomme descendent dun anctre commun qui vivait il y a 7 10 millions
dannes. Cependant, on ne dispose daucun critre pour
lidentifier avec certitude bien que lon connaisse divers
fossiles appartenant la ligne des primates , ni pour
savoir combien de temps il a pu exister.

OISEAUX

MAMMIFRES

La place
de lhomme
dans la nature

La classification des tres


vivants sefforce de placer
ptrosaures
65 Ma
les diffrentes espces sur
plsiosaures
dinosaures
ichthyosaures dinosaures
larbre phylogntique du
saurischiens ornithischiens
vivant en identifiant leurs
relations de parent.
135 Ma
Ainsi, lhomme appartient
lordre des primates, qui
REPTILES
inclut les prosimiens et
les simiens (singes et ho 203 Ma
minids).
thocodontes
thrapsides
250 Ma
Il fait partie, avec les
grands singes (gorille et
?
chimpanz), du groupe
295 Ma
plycosauriens
des hominids et appartient avec ses reprsenanapsides
diapsides
synapsides
tants fossiles au groupe
355 Ma
des hominins.
Comme tous les mamanctre commun hypothtique
mifres, lhomme est un
Ma = Millions d'annes
vertbr amniote (embryon entour par un amLa surface des figurs est proportionnelle au nombre d'espces
nios) et ttrapode. Cette
Arbre phylogntique des reptiles, oiseaux et mammifres.
dernire caractristique a t acquise beaucoup
plus tt au cours de lvolution et est partage par
Existe-t-il des fossiles danctres les batraciens, les reptiles et les oiseaux.
Enfin, il partage avec tous les autres animaux des
communs ?
Il nest pas possible de trouver de fossiles danctres caractristiques encore plus anciennes, comme
communs car les notions de fossile et danctre par exemple la nature de ses cellules qui sont
eucaryotes.
commun sont de natures diffrentes.

TROIS ARTICLES DU MONDE CONSULTER


t1MVTJFVSTUIPSJFT RVFMRVFTDPOUSBEJDUJPOT CFBVDPVQEhJODPOOVFTp. 55
(Jean-Paul Dufour, 11 dcembre 1998)

t-FTHOFTEVEWFMPQQFNFOUCPVTDVMFOUMhBSCSFHOBMPHJRVFEVSHOFBOJNBM p. 56
(Catherine Vincent, 13 aot 1999)

tUne fabuleuse machine remonter le temps p. 57


(Catherine Vincent, 2 juin 1995)

REPRES
Lapparition de la vie sur la Terre.
La Terre sest forme il y a 4,5 milliards dannes, en mme temps
que lensemble du systme solaire.
Sa temprature externe devait
alors tre trs leve cause des
multiples impacts de mtorites et
dun volcanisme intense. Perdant
progressivement de la chaleur dans
lunivers, sa temprature externe
sest ensuite abaisse. La vapeur
deau contenue dans latmosphre
terrestre sest alors condense, formant les pluies diluviennes lorigine des premires tendues deau.
Cest dans leau quapparurent les
premires formes de vie supposes,
1 milliard dannes aprs la naissance du systme solaire.
Les scientifiques font lhypothse
que ces formes de vie se sont
construites partir de molcules
organiques, constituants de base
des tres vivants (glucides, lipides,
protides). Une tape importante
dans la conqute de la vie est lorganisation des molcules originelles
en cellules, elles-mmes capables
de sauto-reproduire.
Lorigine des premires molcules
organiques.
Deux hypothses saffrontent
propos de lorigine des premires
molcules organiques.
La plus ancienne suppose que les
premires matires organiques
proviennent de gaz dorigine
volcanique : dioxyde de carbone,
monoxyde de carbone, azote, hydrogne sulfureux, gaz ammoniac
et mthane.
Les molcules organiques se
seraient ensuite dissoutes dans
leau des ocans primitifs. En
1954, deux chercheurs, Miller et
Urey, dmontrrent quil tait
possible de fabriquer de nombreuses molcules organiques en
laboratoire en soumettant des
gaz volcaniques des dcharges
lectriques de 60 000 volts.
La seconde hypothse, plus rcente, qui sappuie sur la dtection
dacides amins dans les comtes,
voudrait que ces molcules soient
dorigine interstellaire et soient
tombes dans les ocans primitifs.

L'histoire de la vie (Term)

53

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

Lordre dapparition des vertbrs.


t -B EDPVWFSUF EDBJMMFT GPTTJMJses dans des terrains sdimentaires gs denviron 530 millions
dannes permet de penser que les
premiers vertbrs sapparentent
aux poissons.
t"V%WPOJFO JMZBFOWJSPONJMlions dannes), les surfaces marcageuses qui recouvrent la Terre laissent
merger des formes de vie nouvelles.
Ds lors, des poissons quips de
poumons rudimentaires apparaissent. Lichtyostga est ainsi le premier
amphibien capable de marcher sur le
continent : cest le premier ttrapode
(75 millions dannes).
t*MZBNJMMJPOTEBOOFT MFDMJmat plus sec favorise la multiplication des tres vivants capables de
rsister la scheresse (protection
des ufs par une coquille, protection de la peau par des tguments
pais, etc.). Les reptiles, totalement
adapts au milieu continental, partent alors la conqute du monde.
t-FTQSFNJFSTNBNNJGSFTBQQBraissent il y a seulement 225 millions dannes.
t 2VBOU BVY QSFNJSFT USBDFT
doiseaux, elles datent denviron
160 millions dannes.

ZOOM SUR
Les membres des vertbrs ttrapodes : exemple dhomologie.
La comparaison des membres de diffrents vertbrs ttrapodes une
tortue (reptile), un pigeon (oiseau),
une chauve-souris et un homme
(mammifres) montre que tous
ces vertbrs possdent un membre
antrieur form dune paule, dun
bras, dun avant-bras, dun poignet
et dune main munie de doigts.
Cette comparaison rvle donc un
mme plan dorganisation.
Ltude compare des squelettes
des membres postrieurs met en
vidence une structure semblable.
Cette similarit de lanatomie est le
signe dune parent entre les quatre
groupes de vertbrs ttrapodes.
Il apparat donc logique de supposer lexistence, dans le pass, dun
anctre commun ces diffrents
groupes.

54

L'histoire de la vie (Term)

tude de document :

Larbre phylogntique de quelques


vertbrs
Le document

Ce quil ne faut pas faire


Comparer le positionnement des espces
sur larbre phylogntique sans regarder
le nombre de caractres communs drivs.

2. Dites pourquoi le groupe des poissons nexiste pas


dans le cadre dune classification phylogntique.

Lanalyse du sujet
Ce sujet invite rflchir sur les deux conceptions
de classification. La premire, traditionnelle, repose
sur lobservation des caractres anatomiques et
morphologiques possds par les groupes. Lautre
est phylogntique et repose sur la recherche dun
ou plusieurs caractres que deux groupes partagent
en exclusivit (caractres communs drivs).

Le corrig

Arbre phylogntique de quelques vertbrs.


En gras et souligns : vertbrs appartenant lancien groupe
des poissons. En italique : tats drivs des caractres tudis.

Lintitul complet du sujet


Lancien systme de classification reposait essentiellement sur des critres morphologiques et anatomiques.
Ainsi, on regroupait sous le terme poissons des vertbrs aquatiques munis de nageoires. Dans le cadre de
la classification phylogntique reposant sur des critres
de parent volutive, le groupe des poissons nexiste pas.
partir de lexploitation du document, rpondez aux
questions suivantes :
1. Dterminez, en le justifiant, qui, du requin ou du rat,
est le plus proche parent du saumon.

1. Le requin possde deux caractres ltat driv :


vertbre et mchoire.
Le saumon possde trois caractres ltat driv :
vertbre, mchoire et squelette osseux.
Le rat possde cinq caractres ltat driv : vertbre,
mchoire, squelette osseux, squelette interne monobasal et poumons alvols.
Plus le nombre de caractres ltat driv communs
entre espces est grand et plus leur parent est
proche. Le requin possde deux caractres ltat
driv en commun avec le saumon alors que le rat
en possde trois. Le rat est donc le plus proche parent
du saumon.
2. La lamproie, le requin, le saumon, le clacanthe,
le dipneuste et le rat possdent en commun des
vertbres, ce qui est un caractre ltat driv.
Ils ont tous un anctre commun possdant des
vertbres, ce qui a permis de les classer dans le
groupe des vertbrs. Mais ils ne possdent pas
ensemble les mmes caractres ltat driv, ils ne
partagent pas danctre commun exclusif. Le groupe
des poissons nexiste donc pas dans la classification
phylogntique.

SUJETS TOMBS AU BAC SUR CE THME


tudes de documents
Larbre phylogntique de diffrentes espces. (Sujet national, septembre 2005)
Larbre phylogntique de quatre vertbrs. (Liban, juin 2006)
Parents entre les tres vivants actuels et fossiles. (Sujet national, septembre 2008)
Recherche de lappartenance un groupe. (Sujet national, juin 2010)

Plusieurs thories, quelques


contradictions, beaucoup dinconnues

e terrain a t srieusement
dbroussaill par Jean
Lamarck et Charles Darwin.
Depuis la publication de leurs thories, en 1800 puis en 1859, la science
a progress. Hormis quelques rares
partisans dune interprtation littrale de la Gense, plus personne ne
doute que lhomme et le singe partagent un aeul commun. Mieux :
ltude des fossiles a montr que
les premiers anctres des grands
groupes animaux daujourdhui
se sont diffrencis il y a environ
540 millions dannes, la faveur
dun big bang zoologique , lexplosion cambrienne (Le Monde du
5 janvier 1996).
Le chemin parcouru peut paratre norme. Ces grands jalons
poss grce lanalyse des fossiles
ont t complts par la biologie.
Luniversalit du code gntique
de tous les tres vivants est une
confirmation de leur origine commune. Les gnes, toujours, ont
permis de prciser les liens de
parent entre les diffrentes espces et leur comparaison fournit
galement une horloge qui recoupe grosso modo les dductions
de palontologues.
Mais, dans tous les cas, il ne sagit
que dindices indirects montrant
ou suggrant qu telle poque
telle espce prsentait tel aspect.
Entre ces petits cailloux sems sur
la route de lvolution, cest le noir
complet. Les scientifiques sont dsormais persuads que Darwin avait
globalement raison, au moins sur le
principe. Mais ils nont gure avanc
sur la connaissance des rouages du
mcanisme qui nous a fait passer de
lalgue bleue originelle lHomo
sapiens branch sur Internet.
La thorie de lvolution des espces ? Lassemblage dun certain
nombre de propositions en un tout,
le plus cohrent possible, mais qui
comporte encore normment dinconnues , explique le gnticien
des populations Andr Langaney.
Notre travail consiste chercher

en permanence rfuter les thories


afin de les remplacer par dautres,
plus performantes. Et quand on ne
peut ni contredire ni vrifier, il faut
avoir le courage de reconnatre que
lon ne sait pas. Volontiers provocateur, ce chercheur qui se partage
entre le Musum national dhistoire
naturelle de Paris et luniversit de
Genve se mfie des systmes et
des certitudes. Et nhsite pas les
dnoncer. Pour lui, la plupart des
grandes propositions en matire
dvolution sont actuellement en
dbat . Sont en concurrence.
Le gradualisme qui veut, comme
le pensait Darwin, que lvolution se
fasse graduellement, en continu, na
jamais pu tre dmontr, hormis
dans le cas despces trs proches
dites jumelles . Les fossiles ne
permettent pas de combler par des
chanons manquants les trous
entre des tats dj trs diffrencis.
Le no-lamarckisme qui affirme
que le caractre nouveau dvelopp
par un seul individu pourrait tre
transmis directement ses descendants ds la premire gnration
(comme le pensait non pas Lamarck
lui-mme mais certains de ses successeurs dont Darwin). Cette thse a t
rfute . Mais, estime Andr Langaney, certaines donnes de la gntique
comme les gnes sauteurs ou des

POURQUOI
CET ARTICLE ?
Cette petite histoire des
sciences permet de constater que la comprhension des
mcanismes concourant lvolution des espces fait appel
de plus en plus de disciplines
scientifiques diffrentes. Ainsi,
botanique, anatomie compare,
gntique des populations, gntique molculaire, archologie, etc., apportent des lments
de rponse partir desquelles
des thories sont labores.

rtrovirus laissent planer quelques


doutes sur des cas particuliers.
Linfluence de la slection naturelle, en revanche, nest pas conteste. Elle existe, cela a t prouv.
Mais pas dans tous les cas, et elle
nexplique pas tout.
La thorie neutraliste prfre
nanmoins lignorer en premire
approximation. Elle montre que les
mutations et la drive gntiques
suffisent faire avancer lvolution
molculaire, sans intervention de la
slection naturelle. Lvolution gntique est la base de la thorie des
horloges molculaires permettant de
dater les divergences ancestrales des
espces. Cest une ralit, vrifie et
confirme, insiste Andr Langaney.
Il semble que lintervention de la
slection y soit marginale, mme si
elle joue un rle important dautres
niveaux. Lennui, cest que lon
na aucune ide de la manire dont
fonctionne le mcanisme gntique
de la transmission des caractres
quantitatifs tels que les dimensions,
les formes ou les proportions. En
clair, lvolution gntique (support
de lhorloge molculaire) ne se superpose pas celle des caractres
physiques des populations.
La notion d quilibres ponctus , enfin, simpose de plus
en plus. Toutes les observations

la lecture de cet article, on


comprend quil est trs difficile dlaborer une thorie qui
englobe toutes les donnes
actuelles (sachant quil y a encore beaucoup dinconnues).
La science est toujours en volution et les thories et conceptions, sans cesse en dbat.
Dans le cadre de lenseignement de Terminale S, cette
connaissance de lhistorique
des thories permet de
mieux comprendre le fil
conducteur qui oriente les
diffrentes recherches ainsi

confirment que les spciations


se produisent assez rapidement
souvent en rponse des changements dans lenvironnement
presque toujours au sein de petites
populations marginales, isoles
dans une niche cologique, une
le diffrente du milieu o
sbat la population mre.
On sait aussi que, dans ces circonstances, lvolution se traduit par des
diffrences chromosomiques importantes. Cest ainsi, par exemple, que
le chromosome numro 2, grand et
unique chez lhomme, correspond
deux petits chromosomes chez les
autres primates.
Mais, si ces mutations peuvent
empcher linterfcondit entre
espces, elles ne changent en rien
lapparence des individus qui en
sont porteurs. L encore, un lment dexplication manque.
En fait, conclut Andr Langaney, la
formation des espces met sans doute
en jeu un grand nombre de mcanismes diffrents. cet gard, estimet-il, les travaux de Suzanne Rutherford
et Susan Lindquist semblent trs
importants . Ils fournissent une cl
supplmentaire pour la confirmation
de lvolution par sauts.
Jean-Paul Dufour
(11 dcembre 1998)

que les problmatiques souleves. Le passage dune classification traditionnelle une


classification phylogntique
montre que les conceptions
des scientifiques voluent au
regard des nouvelles donnes
apportes par les recherches.
Lors dun examen oral, ces
bases de connaissances vous
seront utiles et peuvent tre
galement rinvesties, sans
exhaustivit, dans une introduction ou une conclusion
dun sujet de restitution des
connaissances.

L'histoire de la vie (Term)

55

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

REPRE

LES ARTICLES DU

LES ARTICLES DU

LES ARTICLES DU

Le petit ver dont nous sommes tous issus, celui qui le premier dans le rgne animal dveloppa une symtrie bilatrale, a-t-il t injustement considr ? Loin davoir une morphologie rudimentaire, possdait-il un plan dorganisation complexe ? Faute dos et de coquilles, les fossiles ne parlent pas de lui. Mais la mconnaissance dont il faisait lobjet vient
dtre partiellement comble par trois quipes de chercheurs, franais, britanniques et
amricains, dont les travaux conjoints ont t publis rcemment dans la revue Nature.

ongtemps, tout parut simple.


Dans le grand arbre de lvolution des espces, pensait-on, les
diffrentes familles avaient merg
graduellement, dans un ordre de
complexit croissante. Puis vint lre
de la phylognie molculaire ,
mthode dtude la plus rcente
et la plus novatrice dont disposent
actuellement les volutionnistes.
Son principe ? Mesurer les variations
que prsente un mme gne, ou un
mme groupe de gnes existant chez
diffrentes espces. Plus ces variations sont grandes, plus les espces
sont considres comme loignes
les unes des autres.

Lintimit
des organismes
En pntrant ainsi dans lintimit
hrditaire des organismes vivants,
la gntique se rvle depuis une
dizaine dannes une prcieuse allie
de la palontologie, seule discipline
jusqualors habilite retracer la gnalogie du vivant. Et elle bouleverse,
du mme coup, un certain nombre
dides reues.
Publie il y a deux ans, une tude
fonde sur cette mthodologie avait
ainsi jet le trouble chez les spcialistes de lvolution des vers. Elle sappuyait sur une petite structure gntique commune toutes les cellules
vivantes, lARN ribosomique. Son
analyse mit en vidence des liens de
parent entre des espces jusqualors
insouponns. Dune part, entre
les vers plats et des groupes dorganisation plus complexe, tels les
annlides (lombrics, sangsues), les
mollusques ou les brachiopodes
(animaux marins coquille bivalve) ;
dautre part, entre les vers ronds et

56

L'histoire de la vie (Term)

les arthropodes (insectes, crustacs,


arachnides), animaux avec lesquels
ils nont, a priori, pas grand-chose
en commun.

(SDFBVYHOFT
j)PYx
Comme souvent en matire de
phylognie molculaire, ces rsultats demandaient tre confirms.
Avec dautant plus de rigueur que la
squence gntique dARN utilise
nest pas considre par les experts
comme tant dune fiabilit absolue. Cest dsormais chose faite,
ainsi quen tmoigne larticle de
Nature. Une tude particulirement
exhaustive mene par trois quipes
complmentaires qui, toutes, ont
choisi de reconstituer lhistoire de
ces organismes primitifs grce une
famille de gnes bien particulire :
les gnes de dveloppement Hox .
Dcouverts chez la mouche drosophile, les gnes du dveloppement
se sont rvls, ces vingt dernires
annes, jouer un rle essentiel dans
le dveloppement embryonnaire
des animaux. Parmi eux, la famille

POURQUOI
CET ARTICLE ?
Les organismes sans coquille
ni squelette ne laissent pas
de traces fossiles, ce qui pose
problme pour ltude de leur
volution et de leur place dans
les arbres phylogntiques. La
phylognie molculaire permet dapporter des lments
de rponse par ltude de lARN
ribosomique chez plusieurs

des gnes Hox a une place part.


Sexprimant le long de laxe antropostrieur du corps, ces gnes servent
diffrencier les diffrents territoires
anatomiques de lembryon. Parce
quils sont nombreux et, surtout, trs
fortement conservs dune espce
une autre, leur complexe reprsente un matriel de choix pour tracer
grands traits larbre molculaire
du rgne animal. Avec lavantage
supplmentaire, comme le souligne
lvolutionniste Philippe Vernier (Institut Alfred-Fessard, CNRS), d allier
la structure et la fonction . Et, donc,
dclairer avec plus de prcision encore lhistoire des tres vivants.
En comparant les complexes
Hox de diverses espces, puis en
extrapolant leurs rsultats pour
remonter le temps, les chercheurs
ont tout dabord confirm, comme
ils lespraient, les conclusions
faites par leurs prdcesseurs sur
les vers ronds et les vers plats. Avec,
en prime, une surprise de taille.
Alors que nous pensions compter
un nombre de gnes Hox dautant
plus faible que lespce tudie tait

espces, limportance des diffrences permettant de quantifier lloignement gntique.


Toutefois, les rsultats de cette
tude ne peuvent eux seuls affirmer les liens de parent entre
diffrentes espces. La correspondance des connaissances
sur les gnes de dveloppement
(gnes Hox), responsable de la
mise en place du plan dorganisation antro-postrieur des
organismes lors du dveloppe-

primitive, une dizaine de gnes ont


t retrouvs, presque systmatiquement, chez toutes les espces ,
rsume Renaud de Rosa, volutionniste au Centre de gntique molculaire du CNRS (Gif-sur-Yvette,
Essonne) et premier signataire de
ces travaux. Selon toute vraisemblance, le ver qui fut lanctre
commun aux animaux symtrie
bilatrale autrement dit tous
les animaux connus, except les
coraux, mduses et ponges possdait donc, lui aussi, un complexe
Hox de grande taille, poursuit-il. On
peut donc supposer que sa morphologie tait nettement plus complexe
que ce quon souponnait.
Un ver pas si simple que cela,
qui permettra peut-tre daborder
sous un angle nouveau la fameuse
explosion cambrienne , au
cours de laquelle apparurent, il y a
540 millions dannes, la plupart des
familles animales que lon connat
aujourdhui.
Catherine Vincent
(13 aot 1999)

ment embryonnaire, et la phylognie molculaire ont permis


de confirmer les rsultats.
Cet article illustre le dveloppement de la gntique
molculaire en complment
des donnes palontologiques
pour ltablissement des phylognies. Il peut tre rinvesti
dans un sujet de restitution
organise des connaissances ou
pour un examen oral.

Une fabuleuse machine


remonter le temps
Des dizaines voire des centaines de chercheurs ont aujourdhui pris en marche la fabuleuse machine remonter le temps que constitue ltude de lADN ancien pour mieux
comprendre lorigine et lhistoire des espces vivantes, commencer par la ntre.

orsque Russell Higuchi,


chercheur de lquipe dAllan Wilson luniversit de
Berkeley (Californie), parvient
en 1984 extraire de lADN des
muscles dsschs dun quagga,
personne ne croit encore lintrt de ces travaux. Disparu la fin
du XIXe sicle, lanimal, mi-zbre,
mi-cheval, pose pourtant une
nigme. En comparant ses petites
squences dADN celles despces
contemporaines, Higuchi parvient
la rsoudre et situer le quagga
dans larbre phylogntique du
cheval. Pour la premire fois, des
gnes fossiles permettent den
savoir plus sur une espce aujourdhui teinte.

Os et dents
La brche est ouverte, mais
ils sont encore peu nombreux
sy engouffrer. Svante Pbo,
membre lui aussi de lquipe dAllan Wilson, sera des premiers.
Ce jeune Sudois dfraie tout
dabord la chronique, en 1985,
en annonant avoir prlev du
matriel gntique sur une momie gyptienne plus de deux fois
millnaire. Mais cest en 1988,
pour avoir extrait de lADN du cerveau dun homme enseveli depuis
7 000 ans dans une tourbire de
Little-Salt-Spring (Floride), quil
apporte sa premire contribution vritable la connaissance
de lhistoire de lhumanit. Il
constate en effet que ces fragments de gnes ne correspondent
aucune population connue parmi les Amrindiens. Ce qui prcise,
tout en la compliquant un peu
plus, la carte de nos hypothses
sur le peuplement du Nouveau
Monde. Laventure de larchologie
molculaire commence.

Un an plus tard, elle franchit


une nouvelle tape. Grce aux
travaux dune jeune chercheuse
franaise, Catherine Hnni
(CNRS URA 1160, institut Pasteur
de Lille), la communaut scientifique dcouvre que lon peut
isoler de lADN, non seulement
de quelques vestiges humains
exceptionnellement conservs,
mais aussi de simples fragments
dos, ou de dents. Deux autres
quipes, anglaise et japonaise,
parviennent simultanment la
mme conclusion.
Moyennant un traitement
physico-chimique ad hoc, il
devient possible, en thorie,
dtudier le matriel gntique
fossile de nimporte quel site
archologique ! Laubaine est
trop belle, cette fois, pour que
les chercheurs la ddaignent.
Associe aux donnes
de larchologie et de la
palontologie, ltude de lADN
de nos anctres peut contribuer
clairer quantit de zones
dombre qui subsistent sur notre
pass. Par exemple sur lorigine
de lagriculture, la domestication
des espces animales et vgtales,
lvolution des maladies
gntiques ou infectieuses, et
mme sur les rgles sociales qui
prvalaient dans les socits
prhistoriques , rsument
Terry et Keri Brown, deux jeunes
chercheurs de luniversit de
Manchester (Grande-Bretagne),
respectivement biochimiste
et biologiste molculaire, qui
figurent parmi les pionniers
de cette nouvelle discipline
archologique. Pour le moment,
il est vrai, les recherches qui ont
abouti un rsultat probant se
comptent encore sur les doigts

dune main. Quelle sappuie sur


des donnes palontologiques,
iconographiques ou gntiques,
larchologie est une science
qui prend son temps, et qui
noffre ses certitudes quaprs
de multiples recoupements. De
ltude de lADN ancien, il ne faut
donc, dans ce domaine, attendre
aucune rvolution. Simplement des
prcisions sur des points de dtail
ceux l mmes qui, bien souvent,
font tant dfaut pour tayer les
grandes lignes de notre histoire.
Des exemples ? Parmi les plus
convaincants figure ltude mene
par Erika Hagelberg (dpartement
danthropologie biologique
de luniversit de Cambridge,
Grande-Bretagne), sur les premires populations des les du Pacifique sud. Selon lhypothse gnralement admise, les premiers
colons y seraient parvenus en
deux vagues de migrations successives, toutes deux originaires
de lAsie du Sud-Est. La premire,
datant de 50 000 35 000 ans,
aurait peupl la rgion priphrique de larchipel, la Mlansie.
La seconde, beaucoup plus rcente (3 600 ans), aurait amen
un groupe dhabiles navigateurs,
lesquels auraient cette fois pouss
leurs canos jusquaux rivages les
plus reculs de Polynsie.
Cette thorie est taye par deux
types de donnes. Dune part, par
les diffrences linguistiques existant aujourdhui entre populations
mlansiennes et polynsiennes.
Dautre part, par la facture spcifique des anciennes poteries polynsiennes, trs similaire celle qui
prvalait, il y a 6 000 ans, dans les
rgions de Tawan ou de Chine du
Sud. Thorie solide, donc, mais que
modifient lgrement les donnes

rcentes de la gntique. Aprs


avoir extrait lADN de plusieurs
squelettes humains retrouvs sur
des sites polynsiens datant de
2 700 1 800 ans (donc supposs uniquement peupls par la
deuxime vague de migration),
Erika Hagelberg a compar ces
squences gntiques celles
des populations actuelles. Ses
conclusions sont formelles : contre
toute attente, on retrouve sur ces
sites des singularits gntiques
typiques de la population mlansienne. Ce qui prouve, avec une
quasi-certitude, que les premiers
colons de Polynsie ne venaient
pas seulement dAsie, mais aussi
de cette le.
Catherine Vincent
(2 juin 1995)

POURQUOI
CET ARTICLE ?
Cet article explique lavance des techniques de
prlvement de lADN et
son importance pour la
comprhension de lorigine et de lhistoire des
tres vivants. Il illustre
limportance de la phylognie molculaire dans
les recherches actuelles. Il
est maintenant possible de
travailler sur des gnes fossiles. Ltude des ADN fossiles va pouvoir complter
ou confirmer les rsultats
des travaux darchologie
ou de palontologie et toffer les donnes concernant
les mouvements de populations.

L'histoire de la vie (Term)

57

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Les gnes du dveloppement bousculent


larbre gnalogique du rgne animal

MOTS CLS
HOMINID
Le terme hominid runit les lignes
du gorille, du chimpanz et de
lhomme. C'est une upture avec la
classification traditionnelle qui runissait lorang-outan, le gorille et le
chimpanz sous le terme de pongids.

HOMININS
Ce terme est rserv aux reprsentants de la ligne humaine.

ZOOM SUR
Lhomme et le chimpanz.
Lhomme et le chimpanz espce la
plus proche de la ntre sur larbre phylogntique du vivant descendent
dun anctre commun ayant vcu
il y a 7 10 millions dannes. Aujourdhui, le genre Homo ne compte
plus quune seule espce Homo sapiens , dont la forme actuelle est
apparue il y a 100 000 200 000 ans.
Les outils raliss par les premiers
reprsentants du genre Homo.
Les premiers outils sont des galets
amnags, ou choppers, rsultant
denlvements dclats laide dun
percuteur afin dobtenir un ct
tranchant. Puis les bifaces apparaissent : dabord rudimentaires, ils
sont ensuite de plus en plus finement
retouchs et permettent dobtenir une
lame coupante. Les grattoirs en silex,
plus grossiers, servent racler, raboter, aiguiser. On trouve, par la suite,
des pointes de flches en silex, des
harpons, aiguilles ou sagaie raliss
dans de los. Les outils sont de plus en
plus prcis et spcialiss dans leurs
fonctions et ont des tailles varies.

LESSENTIEL DU COURS

La ligne humaine

-FTDBSBDUSFTTRVFMFUUJRVFT
spcifiques de la ligne humaine

a place de lespce humaine dans larbre phylogntique


du vivant se dduit, comme celle des autres espces,
de ses relations de parent avec les espces voisines,
en loccurrence les primates actuels et les fossiles. Pour
comprendre comment sest faite lvolution de lhomme
depuis son anctre commun avec les grands singes ce quil
est convenu dappeler lhominisation , il faut identifier ce qui
caractrise la ligne humaine et rechercher lapparition de
ces caractristiques dans les formes fossiles. On peut ainsi
dterminer quelle priode est apparu ou sest transform tel
ou tel caractre. La comparaison avec nos plus proches parents
volutifs, les chimpanzs, permet ensuite de comprendre
comment les deux lignes ont volu depuis leur sparation.

Les liens de parent entre


lhomme et les grands singes

-FTDSJUSFTEBQQBSUFOBODFMB
ligne humaine

Lhomme et les grands singes (chimpanz, gorille)


sont morphologiquement et anatomiquement plus
proches entre eux quils ne le sont des autres primates.
Le caryotype de lhomme diffre de celui du chimpanz par une paire de chromosomes (46 contre 48),
mais on retrouve chez lhomme un chromosome
rsultant de la fusion de deux chromosomes prsents chez le chimpanz. En outre, 13 chromosomes
sont identiques dans les deux espces tandis que
les autres chromosomes ne sont affects que par
des modifications dampleur limite (additions,
inversions de segments, etc.).
Sur le plan molculaire, on estime quelque 98 %
lidentit gntique des deux espces.
Ces similitudes rvlent une parent troite ; les
deux lignes se seraient en effet spares de leur
anctre commun il y a 7 10 millions dannes.

La ligne humaine est caractrise par trois sries de caractres apparus successivement : la bipdie, le dveloppement du cerveau (marqu par laugmentation du
volume crnien au dtriment de la face) et lexistence
de productions culturelles (outils, gravures, peintures
rupestres, etc.). Un fossile qui prsente au moins un de
ces caractres appartient la ligne humaine cest un
hominin mais nest pas forcment un anctre direct
de lhomme actuel.
De nos jours, la ligne humaine est reprsente par
la seule espce Homo sapiens mais elle a t prcde au cours de son volution par de nombreuses
espces fossiles dhominins (Homo erectus, Homo
habilis) et, plus anciennement encore, par un autre
genre, Australopithecus, qui a comport lui aussi de
nombreuses espces.
On suppose que la bipdie, en librant la main, a
permis chez les premiers hominins un dveloppement de lhabilet manuelle et a favoris en retour
le dveloppement psychomoteur et la capacit
fabriquer des outils.

Lucy.
Cette Australopithque dcouverte
en thiopie date de 3 millions dannes. Le squelette a t reconstitu
40 % grce aux 52 fragments osseux
dcouverts. Les Australopithques
sont de petite taille, prsentent
une faible capacit crnienne, sont
bipdes mais le bassin reste large et
leur dmarche devait tre balance avec un mouvement des bras.
La forme du bassin ne permettait pas
la course debout.

58

L'histoire de la vie (Term)

Une pierre polie.

Comparaison des caryotypes de lhomme et du chimpanz.

Une pierre taille.

Lvolution de la ligne humaine, commence il y a


environ 7 10 millions dannes, a t rapide lchelle
des temps gologiques.

base du crne rendant laxe tronc-tte perpendiculaire


laxe visuel ; chez le chimpanz : position postrieure
du trou occipital plus proche de celle des quadrupdes).
La figure ci-contre localise les principales diffrences
entre les squelettes des deux primates.

Qu'est ce que lvolution


humaine buissonnante ?
Mme si lhomme actuel et les grands singes descendent dun anctre commun, la ligne humaine, comme
les autres, na pas volu linairement. chaque
tape, lvolution, totalement imprvisible en raison
du caractre alatoire des mutations et des conditions
cologiques, a pu prendre des directions diverses.

Principales caractristiques de lhominisation.

Lacquisition la plus prcoce qui diffrencie lhomme


des autres hominids, comme les grands singes,
et qui caractrise les hominins est la bipdie. Le
chimpanz utilise, en effet, ses quatre membres pour
se dplacer au sol (marche quadrupde) et dans les
arbres (brachiation).
La bipdie est lie diverses modifications du squelette qui permettent de caractriser les hominins et de
les distinguer, par exemple, de leur plus proche parent,
le chimpanz. Ces transformations sont :
une modification de la colonne vertbrale (quatre
courbures au lieu dune seule) ;
une rduction de la longueur des membres antrieurs par rapport aux membres postrieurs qui
sallongent et deviennent verticaux ;
un raccourcissement et un largissement du bassin
(insertion des muscles anti-gravit) ;
un dplacement de laxe de larticulation du fmur
(jambe verticale) ;
un dplacement vers lavant du trou occipital (chez
lhomme : position antrieure du trou occipital la

Les nombreux fossiles dhominins et les traces de


leur activit, dcouverts au hasard des fouilles, ne
reprsentent donc pas ncessairement une succession despces descendant les unes des autres.
Ces fossiles peuvent aussi bien tre des anctres de
lhomme actuel que des reprsentants de branches
disparues depuis. Quelques uns dentre eux prsentent dailleurs des tats primitifs de certains
caractres tels que la mandibule. Une autre preuve de
cette volution buissonnante est la coexistence de
diffrentes espces dhominins pendant de longues
priodes, comme par exemple les Australopithques
et Homo habilis ou lhomme de Nanderthal et
lhomme actuel.
Ainsi, larbre phylogntique des hominins ressemble plus un buisson avec de multiples branches
qu une simple succession linaire de formes descendant les unes des autres.

Les principaux reprsentants


fossiles de la ligne humaine

On regroupe les nombreux restes fossiles appartenant la ligne humaine (hominins) en deux genres
principaux, Australopithecus et Homo.
Les Australopithques, dont on dcouvre des fossiles
de plus en plus gs, sont les plus anciens primates
prsentant des caractres squelettiques caractristiques de la bipdie et sont donc les plus
anciens hominins (de 5 Ma 1 Ma).
Les espces du genre Homo possdent,
QUATRE ARTICLES DU MONDE CONSULTER
en outre, des caractres drivs crniens
(augmentation du volume crbral et rt%FTTDJFOUJmRVFTSFNFUUFOUFODBVTFMFTPSJHJOFT
duction de la face) et leurs fossiles sont
de l'homme moderne p. 61
associs une industrie lithique. Les plus
(lemonde.fr avec AFP, 3 avril 2007)
anciens dentre eux sont les Homo habilis,
dats de 2,5 Ma, et uniquement connus
t-h"GSJRVFBVTUSBMFMJWSFEFVYOPVWFBVY
en Afrique. Homo erectus, apparu en
BVTUSBMPQJUIRVFTp. 61-62
Afrique il y a environ, 1,5 Ma, a colonis
(H.M., 10 avril 2010)
lancien monde et pourrait tre lanctre de
lhomme de Nanderthal, un Homo sapiens
t)PNNFFUDIJNQBO[QSPDIFTEBOTMFTHOFT
archaque disparu sans descendance il y
et le temps p. 62
a environ 40 000 ans. Lespce humaine
(Christiane Galus, 19 avril 2006)
actuelle, Homo sapiens sapiens, serait
apparue il y a 100 000 200 000 ans en
t-hPSBOHPVUBO OPUSFDPVTJOp. 62
Afrique ou au Proche-Orient et a, depuis,
(29 janvier 2011)
colonis toute la plante.

ZOOM SUR
Des ralisations artistiques.
Dcouverte en 1940, la grotte de
Lascaux en Dordogne, dans la valle de la Vzre est un vritable
muse dart parital palolithique
(17 000 ans).
Cest labb Henri Breuil qui effectua, avec son quipe, les premires
tudes de la grotte.
Lentre de la grotte est situe
185 m daltitude et domine de
120 m le fond de la valle.
La grotte prsente sept secteurs
orns avec la salle des taureaux, le
diverticule axial, la nef, le passage,
le cabinet des flins, labside et
le puits.
Lart palolithique est reprsent
par le dessin et la gravure, mais
Lascaux il sagit essentiellement
de peinture.
Liconographie se limite trois
thmes fondamentaux : les animaux, les reprsentations humaines et les signes. Le bestiaire
compte 600 reprsentations avec
surtout le cheval puis le cerf, lauroch, le bouquetin, le bison, lours
et le flin.
Les techniques employes taient
trs simples : utilisation de silex,
pigments, pinceaux et pochoirs
en peaux.
La main tait trs souvent utilise
comme pochoir.
En raison de problmes de conservation, la grotte est ferme au public depuis 1963.

PERSONNAGE
IMPORTANT
Yves Coppens
N en 1934, ce palontologiste et
paloanthropologue de renomme internationale participe,
en 1974, une expdition de
recherche avec des chercheurs
thiopiens et amricains pendant
laquelle est dcouvert le fossile
nomm Lucy Hadar.
Ce nom est choisi en raison de la
chanson des Beatles (Lucy in the sky
with diamonds) coute par lquipe.
Actuellement ce chercheur participe des nombreuses instances
nationales et internationales en
lien avec sa discipline.

L'histoire de la vie (Term)

59

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

La vie de Charles Darwin.


t   Le 12 fvrier, naissance
Shrewsbury (Angleterre) de
Charles Darwin. Lamarck prsente
sa thorie transformiste.
t   Le 27 dcembre, Darwin
sembarque comme naturaliste sur
le Beagle pour un voyage autour
du monde qui durera cinq ans.
t   Le Beagle fait escale
aux Galapagos, o il note des
variations dans la forme des becs
des pinsons ce qui inspirera sa
thorie.
t   Premire esquisse, par
Darwin, dun arbre volutionnaire
figurant dans son Notebook on
Transmutation of Species.
t  er juillet) : Prsentation
Londres darticles en commun
avec Wallace sur la Perptuation
des varits et des espces par les
moyens naturels de la slection.
t OPWFNCSF
Publication
de lOrigine des espces au moyen
de la slection naturelle ou la Prservation des races favorises dans
la lutte pour la vie.
tGregor Mendel, fondateur
de la gntique, publie dans lindiffrence gnrale Recherches sur
des hybrides vgtaux.
tDarwin livre ses vues sur
lorigine de lhomme dans La Filiation de lhomme et la slection
lie au sexe.
t BWSJM
Mort de Darwin
dans sa demeure de Down, dans
le Kent. Il sera enterr labbaye
de Westminster.
( Dates-cls de la vie de Charles
Darwin , Le Monde, 06.02.09.)

NOTION CL
Hominisation
Daprs Teilhard de Chardin,
lhominisation est lensemble des
processus volutifs par lesquels
les hommes ont acquis les caractres qui les distinguent des autres
primates . Lhominisation concerne
lacquisition dune bipdie de plus
en plus parfaite, dun encphale
de plus en plus volumineux, dun
langage articul, dune activit
culturelle, artistique et industrielle
et dun sens mtaphysique avec le
culte des morts notamment.

60

L'histoire de la vie (Term)

tude de document : Larbre

Des scientifiques remettent en cause les


origines de lhomme moderne

phylogntique de quelques primates


Lintitul complet du sujet
partir des seules informations recueillies par lexploitation du document :
placez sur larbre phylogntique, que vous aurez recopi, les innovations volutives lorigine des caractres
drivs du tableau ;
citez les caractristiques du plus rcent anctre
commun lhomme, au chimpanz et au gorille ;
placez lorang-outan sur larbre phylogntique
et prcisez le degr de parent entre lorang-outan
et chacune des autres espces de larbre.
Gibbon

Homme

Chimpanz

Gorille

Arbre phylogntique de quelques espces de primates actuels


complter.

Le document
Espces
Caractres drivs
Absence de queue
Fusion prnatale des os
du poignet
Prsence d'un sinus
frontal
Bipdie permanente

Gibbon Homme Chimpanz Gorille Orang-outan


+

Le signe + signifie que le caractre driv est prsent, le signe


signifie quil est absent.

Lanalyse du sujet
Dans ce sujet, vous devez tre capable de situer les caractres drivs proposs sur larbre phylogntique, de lire
ce dernier en citant les caractristiques du plus rcent
anctre commun lhomme, au chimpanz et au gorille
puis d'ajouter sur larbre, la branche de lorang-outan.

La problmatique
En quoi les caractres drivs permettent-ils de prciser
les liens de parents ? Quel est le degr de parent de
lorang-outan avec les quatre espces proposes ?

Proposition de corrig
Ltablissement des relations de parent repose sur le
principe du partage des tats drivs des caractres.
Labsence de queue est un caractre driv prsent chez
les quatre espces, donc prsent chez leur anctre. Linnovation volutive lorigine de ce caractre driv est donc

Ce quil ne faut pas faire


Utiliser seulement vos connaissances
pour rpondre aux questions sans faire
de raisonnement logique partir du document.

apparue avant. Elle est placer sur la branche de larbre,


juste avant le nud reprsentant lanctre commun
au gibbon, lhomme, au chimpanz et au gorille.
La fusion prnatale des os du poignet et la prsence
dun sinus frontal sont deux caractres drivs communs lhomme, au chimpanz et au gorille, donc
prsents chez leur anctre commun. Ils sont placer
sur la branche avant le nud reprsentant lanctre
commun de ces trois espces.
La bipdie est un caractre driv uniquement prsent
chez lhomme : ce caractre nexistait pas chez lanctre
commun lhomme et au chimpanz, il nest apparu quaprs, au cours de lvolution. En consquence,
lhomme, le chimpanz et le gorille possdent un
anctre commun exclusif quils ne partagent pas avec
le gibbon. Cet anctre commun prsentait les caractres
drivs communs aux trois espces : absence de queue,
prsence dun sinus frontal et fusion prnatale des os
du poignet.
Lorang-outan ne possde que deux caractres drivs :
labsence de queue et la prsence dun sinus frontal. Il
possde ces deux caractres drivs en commun avec
lhomme, le chimpanz et le gorille, alors quil nen
possde quun seul en commun avec le gibbon. Lorangoutan possde donc avec lhomme, le chimpanz et
le gorille un anctre commun quil ne partage pas
avec le gibbon. Il est donc plus proche de lhomme, du
chimpanz et du gorille que du gibbon.
Gibbon

Homme
OrangOutan
4

Chimpanz

3
2
1

Gorille

1- Absence de queue
2- Prsence d'un sinus frontal
3- Fusion prnatale des os
du poignet
4- Bipdie

Arbre phylogntique de quelques espces de primates actuels.

SUJET TOMB AU BAC SUR CE THME


tude de documents
La ligne humaine (Sujet national, juin 2005)

Une tude amricaine, parue lundi 2 avril, dmontre que la thorie de la dispersion de
lhomme moderne est plus complexe.

a thorie de la migration
de lHomo sapiens a peuttre vcu. Selon cette thse,
lhomme moderne venu dAfrique
aurait ensuite migr vers lEurope
et lAsie. Mais une tude amricaine,
parue lundi 2 avril, dmontre que
cette thorie serait rductrice.
Dans un article publi dans Les Annales de lAcadmie nationale amricaine des sciences, les chercheurs
concluent quil ny a pas eu quune
seule migration dHomo sapiens
venu dAfrique orientale vers lEurope et lAsie, pendant une priode de
25 000 65 000 annes, aboutissant
au remplacement des humains autochtones moins volus. Les scientifiques envisagent dsormais une
propagation gntique de lHomo
sapiens partir de plusieurs foyers,
en Afrique et en Asie.
La plupart des caractristiques
morphologiques correspondent

celles des humains modernes, alors


quune minorit de traits sapparente davantage des hommes plus
primitifs , prcise Hong Shang, un
des coauteurs de cette tude. Les
chercheurs font galement valoir
que des ossements lgrement plus
jeunes et ayant le mme mlange
de caractristiques morphologiques ont aussi t dcouverts en
Eurasie orientale.

La preuve par les os


Pour tayer leur thse, les paloanthropologues sappuient sur
lexamen du plus ancien squelette
humain dEurasie jamais dcouvert. Mis au jour prs de Pkin en
2003, dans la grotte de Tianyuan,
Zhoukoudian, il est compos de
trente-quatre fragments dossements. Daprs les estimations des
scientifiques, ce squelette aurait
entre 42 000 et 38 500 ans.

POURQUOI
CET ARTICLE ?
Cet article montre que de nouvelles dcouvertes peuvent
remettre en cause les thories
labores par les chercheurs.
Les thories sont bases sur les
lments connus mais il existe
encore beaucoup dinconnues,
les chercheurs doivent donc
tre trs prudents dans leurs
conclusions et dans leurs hypothses. Cette nouvelle dcou-

Outre la remise en cause de la thorie de la migration de lhomme moderne, ces os devraient offrir aux chercheurs de prcieuses informations
sur la biologie du spcimen. terme,
une telle tude devrait permettre de

verte va galement permettre


de complter les connaissances
entre humains primitifs et humains modernes.
Cet article concerne la question de lorigine gographique
et des migrations de la ligne
humaine.
Lors dun sujet de restitution
de connaissances, vous pouvez
tre amen envisager cette
problmatique et larticle vous
apporte des lments de rponses.

reconstituer la transition entre les


humains primitifs et les humains
modernes en Eurasie orientale.
lemonde.fr avec AFP
(3 avril 2007)

LAfrique australe livre deux nouveaux


australopithques
Les fossiles dune femelle et dun adolescent, vieux de prs de deux millions dannes, ont
t trouvs dans une grotte.

l y a tout juste deux semaines,


une nouvelle espce humaine,
vieille de 40 000 ans, tait suggre sur la foi danalyses gntiques.
La palontologie lancienne
dmontre aujourdhui brillamment
que lheure nest pas pour autant
venue de lenterrer : la revue Science
prsente, dans son dition du 9 avril,
deux nouveaux fossiles daustralopithques, trouvs dans une grotte en
Afrique du Sud et vieux de presque
deux millions dannes - bien trop
anciens pour tre accessibles aux
outils de la gntique.

Les fossiles partiels dcouverts


par lquipe de Lee Berger, de luniversit Witwatersrand en Afrique
du Sud, ont conduit la dfinition
dune nouvelle espce daustralopithques, baptise Australopithecus
sediba sediba signifie fontaine
ou source dans la langue sesotho
parle en Afrique du Sud. Cette
dnomination a t choisie parce
que les chercheurs font lhypothse
que les deux hominids ont t
noys par une brusque monte
des eaux dans une caverne o ils
seraient venus se dsaltrer.

Ltude des ossements rvle laptitude de ces prhumains, hauts d


peine 1,20 mtre, une bipdie plus humaine que celle des australopithques,
mais aussi leur caractre arboricole.
Elle suggre aussi que lindividu le plus
jeune (g dune dizaine dannes), aux
membres plus robustes, devait tre un
mle, tandis que ladulte plus gracile
tait probablement une femelle.

Forte diversit
Comment placer ces deux nouveaux venus dans larbre gnalogique des hominids ? Il nest pas

possible de dterminer leur position


phylogntique prcise, rpond Lee
Berger. Cette nouvelle espce partage plus de traits drivs avec les
premiers Homo quavec toute autre
espce connue daustralopithques.
Elle reprsente un candidat pour lanctre de ce genre ou un groupe frre
dun anctre proche qui a persist
un moment aprs lapparition des
premiers Homo.
Difficile den faire un anctre
de la branche humaine : les premiers Homo taient dj apparus
500 000 ans plus tt. La diversit

L'histoire de la vie (Term)

61

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

DATES CLS

LES ARTICLES DU

LES ARTICLES DU
ancien a pu conduire des attributions htives. Lheure pourrait venir de
reclasser certains fossiles dans le genre
Australopithecus. A. sediba pourrait
contribuer de telles rvisions ,
estime lui aussi Pascal Picq, du Collge
de France.
H. M.
(10 avril 2010)

POURQUOI
CET ARTICLE ?
Les caractristiques des squelettes humains dcouverts en
Afrique australe rvlent que
ces individus de petite taille

taient bipdes et arboricoles.


Cette nouvelle espce a t baptise Australopithecus sediba.
Cet article montre bien la difficult reconstituer larbre
phylogntique de la ligne
humaine.

Homme et chimpanz proches dans les gnes et le temps

e chimpanz et lhomme
partagent plus de 98 %
de leur gnome. Jusqu
prsent, la date de la sparation
entre les deux espces la spciation tait, selon les fossiles,
estime 6,5-7 millions dannes.
Une tude gntique ralise par
Nick Patterson et David Reich,
du Massachusetts Institute of
Technology (MIT), et publie
dans Nature du 18 mai, rajeunit
considrablement la date de la
spciation en la plaant entre 6,3
et 5,4 millions dannes.
Elle indique aussi que le processus
de sparation entre lhomme et le
chimpanz a t long 4 millions
dannes et complexe. Car, aprs
stre spares une premire
fois, les deux espces se seraient
retrouves et hybrides, avant de
se sparer dfinitivement. Autre
particularit de ltude amricaine :
le chromosome sexuel X est plus
jeune de 1,2 million dannes par
rapport lge moyen des 22 autres

chromosomes non sexuels


analyss.
Cette annonce rsulte dune
analyse gntique de grande ampleur mene sur 20 millions de
paires de bases appartenant au gnome de lhomme, du chimpanz,
du gorille, de lorang-outan et du
macaque. Ce qui est nouveau et
intressant, car jusqu prsent
les tudes taient effectues sur
de petites portions du gnome ,
prcise Vronique Barriel, spcialiste de la phylognie des primates
au Musum national dhistoire
naturelle. Mais je suis surprise
par la dure de la spciation, qui
me parat un peu longue. Ces
rsultats provoquent des remous
chez les paloanthropologues, car
la spciation entre humains et
chimpanzs est postrieure aux
trois proto-humains connus ce
jour : Touma (7 millions dannes), Orrorin (6 millions dannes) et Ardipithecus kadabba
(5,6 millions dannes), tous

trois dcouverts en Afrique. Ce


qui pourrait remettre en cause
lappartenance de ces bipdes au
groupe des hominids.
Patrick Vignaud, palontologue
et proche collaborateur de Michel
Brunet pre de Touma luniversit de Poitiers, ne smeut gure
de ces rsultats : Les caractres
de Touma, dit-il, sont clairement
typiques de la ligne humaine et
non de la ligne chimpanz. Le
palontologue note aussi que les
tudes gntiques rajeunissent systmatiquement lge des fossiles .
Jean-Jacques Jaeger, professeur
de palontologie luniversit de
Poitiers, reste pour sa part perplexe devant ltude amricaine,
notamment en ce qui concerne lhybridation constate. Lluis Quintana-Murcie, spcialiste de gntique
des populations (CNRS-Institut Pasteur), trouve quant lui la nouvelle
tude trs intressante. Mais il lui
parat prmatur de comparer
les datations, car aujourdhui on

POURQUOI
CET ARTICLE ?

Vous pouvez utiliser les


donnes de cette brve pour
illustrer un sujet sur les recherches de parents entre
lHomo sapiens, le chimpanz et lorang-outan.

62

L'histoire de la vie (Term)

sont 97 % identiques, contre 99 %


entre le chimpanz et Homo sapiens.
Elles montrent aussi que lADN de ce
grand singe roux est rest beaucoup
plus stable que le ntre depuis la sparation de notre anctre commun,
estime 15 millions dannes. Ltude
explique que les deux populations de
Sumatra et Borno ont diverg il y a
400 000 ans seulement, alors quon
estimait que cette sparation avait eu
lieu il y a un million dannes.

DES GNOMES (TERM)

POURQUOI
CET ARTICLE ?
Cet article montre que les
problmes de datation des
fossiles sont essentiels pour
tablir des phylognies entre
espces. Des variations sont
constates selon les techniques
dtude et les chercheurs doivent travailler pour mettre en
place des datations fiables.
Dans un sujet sur la ligne
humaine, vous pouvez signaler, dans votre conclusion, ces
difficults de datation.

en est encore au tout dbut des


datations fiables en gntique. Et il
reste encore beaucoup faire dans
ce domaine .
Christiane Galus
(19 mai 2006)

Lorang-outan, notre cousin 97 %


L
e gnome dune femelle orangoutan de Sumatra prnomm
Susie vient dtre squenc par
un consortium international, qui
la compar celui de lhomme et
dautres mammifres, mais aussi
des squences gntiques provenant
de dix autres orangs-outans, cinq appartenant la sous-espce de Sumatra
et les cinq autres celle de Borno. Ces
comparaisons rvlent que le gnome
de lhomme et celui de lorang-outan

STABILIT ET VARIABILIT

En raison de la dforestation, il
ne reste que 50 000 orangs-outans
Borno et 7 000 Sumatra. Les
gnticiens ont eu la surprise de
constater que cette population,
pourtant plus rduite et considre
comme plus menace, prsentait
une plus grande diversit gntique,
ce qui pourrait constituer un atout
pour sa conservation.
(29 janvier 2011)

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

des hominids anciens proches de


notre ligne est plus forte que certains
ne lavaient envisag , commente
Brigitte Senut du Musum national
dhistoire naturelle, rjouie de voir
lattention se focaliser sur lAfrique
australe, souvent marginalise dans
les scnarios palontologiques . Selon elle, une course l Homo le plus

ZOOM SUR...
LADN.
t-FTNPMDVMFTEADN contenues
dans les chromosomes constituent le support chimique de
linformation gntique.
Il est possible disoler lADN de
nimporte quelle cellule par des
oprations chimiques relativement simples. Aprs extraction,
lADN se prsente sous forme
dune mduse , ensemble de
filaments microscopiques enchevtrs.
t-ADN, ou Acide dsoxyribonuclique, est une macromolcule,
polymre form par une succession de motifs lmentaires
appels nuclotides.
Un nuclotide est form par la
liaison covalente dune base azote,
dun dsoxyribose et dun phosphate. Il existe quatre nuclotides
diffrents, identiques chez tous les
tres vivants. Chacun dentre eux
comporte lune des quatre bases
azotes : guanine, adnine, thymine et cytosine (G, A, T, C).
LADN est form de deux chanes de
nuclotides enroules en double hlice. Les nuclotides sassocient toujours par deux grce des liaisons
faibles hydrognes : ladnine avec la
thymine, la cytosine avec la guanine.
t6OHOFFTUVOGSBHNFOUEADN.
Il est constitu dun enchanement de nuclotides. Il gouverne
la synthse dune protine. On
dit quun gne code une protine.
t -FT BMMMFT TPOU MFT EJGGSFOUFT
versions dun mme gne. On
parle de polyalllisme lorsquun
gne a plusieurs allles, ce qui est
presque toujours le cas.
Le terme de polymorphisme
gnique est utilis lorsque le gne
prsente au moins deux allles
reprsents avec une frquence
dau moins 10 % dans lespce.
Chez les espces diplodes, possdant des paires de chromosomes,
chaque gne est reprsent deux
fois. Si les allles sont identiques
on parle dhomozygotie pour
le gne considr ; si les allles
sont diffrents, on parle dhtrozygotie pour le gne considr.
t 6O HOF PDDVQF UPVKPVST VO
mme emplacement, le locus, sur
un chromosome.

64

LESSENTIEL DU COURS

Gnomes et innovations
gntiques

numration
des nuclotides
allle normal
thalassmie 3
thalassmie 4
thalassmie 7

n sait que les gnes portent linformation


gntique dun organisme sous une forme
code par la succession des nuclotides
de lacide dsoxyribonuclique (ADN) et que
les caractres phnotypiques, leurs diffrents
niveaux dorganisation (molcules, cellules,
organismes), dpendent de lexpression de
ces gnes en interaction avec lenvironnement.
Ltude des gnomes, et en particulier leur
squenage complet, apporte des informations
sur la fonction actuelle de ces gnes, mais aussi sur leur histoire.
En effet, les gnomes se modifient au cours de lvolution,
notamment en accumulant des mutations qui peuvent conduire
la formation de nouveaux allles ou en donnant naissance de
nouveaux gnes, constituant des innovations gntiques dont le
rle est important dans lvolution.

Lorigine de la diversit
phnotypique
Une espce partage un ensemble de gnes
communs tous ses reprsentants, appel pool
gnique. La plupart des gnes existent sous diverses
formes, les allles, qui sont caractriss par des
diffrences plus ou moins importantes dans leur
squence (polyalllisme).
Dans de nombreux cas, les diffrentes squences
conduisent des modifications de lactivit de la
protine correspondante et peuvent tre lorigine
de diffrents phnotypes.
Il existe ainsi des milliers de maladies gntiques
dues des allles codant une protine dfectueuse
(hmoglobinopathies, mucoviscidose, phnylctonurie).
La figure ci-dessous montre la squence des 15 premiers acides amins de deux chanes bta de lhmoglobine, codes respectivement par un allle normal
(squence suprieure) et par un allle lorigine de
0

la drpanocytose, hmoglobinopathie hrditaire


(squence infrieure). Le reste des squences des
deux allles est identique.

Le polymorphisme gntique
Une espce peut compter diffrentes populations
gographiques qui ne se rencontrent pas ncessairement, mme si elles restent potentiellement
interfcondes. Dans une population donne, le pool
gnique est caractris par une frquence dtermine des diffrents allles. Par convention, un gne
est qualifi de polymorphe sil existe au minimum
deux allles prsents dans la population avec une
frquence dau moins 1 %. La varit des allles est
ainsi responsable du polymorphisme gntique
des populations.
En outre, la frquence des diffrents allles volue
au cours des gnrations en raison du hasard li
la reproduction sexue, mais aussi sous laction de
la slection naturelle.
9

12

15

MetValHisLeuThrProGluGluLysSerAlaValThrAlaLeuTrpG
0 MetValHisLeuThrProValGluLysSerAlaValThrAlaLeuTrpG

Dbut des squences protiques codes par deux allles de lhmoglobine bta.

Stabilit et variabilit des gnomes (Term)

10

20

30

40

50

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCA
A
GAGAGTCTGCGTACTGCTGTGCA
CTCTGCGTACTGCTGT GC
dltion

addition

substitution

Comparaison du dbut de la squence de quatre allles de la chane bta de lhmoglobine.

Lorigine du polymorphisme
Le polymorphisme rsulte de laccumulation de
mutations dans lADN au cours des gnrations, mutations qui se retrouvent dans les populations actuelles.
La comparaison des squences des allles permet
didentifier trois types de mutations ponctuelles :
les substitutions, qui proviennent du remplacement
dun nuclotide par un autre ;
les additions, engendres par linsertion dun ou de
plusieurs nuclotides ;
les dltions, provoques par la perte dun ou de
plusieurs nuclotides.
La figure ci-dessus prsente le dbut des squences de
lADN de la chane bta de lhmoglobine et de trois
allles responsables de thalassmies. Trois protines
diffrentes sont alors synthtises.

Les mcanismes gntiques


MPSJHJOFEFMBQQBSJUJPOEFHOFT
nouveaux
Le squenage des gnomes a rvl des familles de gnes
(globines, molcules immunitaires, etc.) caractrises par
des similitudes de squences entre des gnes diffrents,
cest--dire situs des locus diffrents dun mme
chromosome ou sur des chromosomes diffrents.
Ces familles multigniques sont interprtes comme
rsultant de la duplication et de la transposition dun
gne ancestral, souvent plusieurs reprises au cours
des temps, puis de laccumulation de mutations
ponctuelles indpendantes. Ces dernires sont dautant plus nombreuses que la duplication est ancienne.
Un gne dupliqu peut tre dupliqu son tour.

Les consquences des innovations


gntiques
La duplication dun gne enrichit le gnome car la
protine rsultant dun gne dupliqu peut acqurir

de nouvelles fonctions, sans que le gne et la protine dorigine ne soient affects. Lenrichissement
du gnome favorise lvolution en permettant
lapparition de nouveaux caractres phnotypiques,
ventuellement soumis la slection naturelle.
En outre, comme un gne accumule dautant plus de
copies et de mutations quil est ancien, ltude des
gnomes permet de reconstituer une phylognie
des espces. Elle confirme pour lessentiel les phylognies tablies sur dautres critres, notamment
biologiques et palontologiques.

La transmission des innovations


gntiques au cours des gnrations
Les mutations affectant les cellules germinales sont les
seules tre transmises dune gnration lautre au
cours de la reproduction sexue. Les mutations affectant
les autres cellules, dites somatiques, disparaissent avec
lindividu. En outre, les innovations gntiques sont des
vnements trs rares car les mcanismes de rparation
corrigent le plus souvent les erreurs de rplication de
lADN. Cest leur accumulation au cours de milliers
de gnrations qui est lorigine de limportant polymorphisme gntique actuel. Enfin, une modification
de squence est un vnement alatoire qui affecte au
hasard nimporte quelle partie du gnome.

La modification artificielle de
la frquence des mutations
Si le taux de mutations spontanes est le plus souvent
trs faible, divers agents physiques ou chimiques, qualifis dagents mutagnes, augmentent la frquence des
mutations par des mcanismes varis.
Ainsi, les rayons X et les rayons UV interagissent avec les
molcules dADN en les modifiant. Cest pourquoi les tissus
sont dautant plus sensibles aux agents mutagnes que
leur renouvellement est rapide (rplication de lADN). Enfin,
les biotechnologies permettent aujourdhui de raliser
une mutagense dirige, cible sur tel ou tel gne.

DEUX ARTICLES DU MONDE CONSULTER


t-FCPPNEFTCBDUSJFTSTJTUBOUFTBVYBOUJCJPUJRVFTp. 68
(Angela Bolis, 30 aot 2011)

t-hWPMVUJWJUEFTCBDUSJFT DMEFTNDBOJTNFTEFSTJTUBODFp. 69
(lisabeth Bursaux, 1er avril 2001)

REPRE
La synthse des protines.
De lADN aux protines, il y a deux
tapes :
1) La transcription.
La molcule dADN est le support
de linformation gntique. Elle est
localise dans le noyau tandis que
la synthse des protines se ralise
dans le cytoplasme. La transcription est la synthse de la molcule
dARN messager (acide dsoxyribonuclique, ARNm) dans le noyau,
puis la molcule est exporte dans
le cytoplasme en passant par les
pores de lenveloppe nuclaire
chez les eucaryotes.
Cest lenzyme, lARN polymrase,
qui permet la synthse dARNm
partir dun des brins de la molcule dADN.
La squence dARN est donc complmentaire de lun des brins de
la molcule dADN constituant le
gne (brin transcrit).
LARN est une molcule, simple
chane constitue de 4 nuclotides : adnine, cytosine, uracile,
guanine. Luracile remplace la
thymine dans lARN ;
2) La traduction.
Une protine est constitue dun
enchanement ordonn dacides
amins, il en existe vingt diffrents.
Lassociation de trois nuclotides
conscutifs dans une molcule
dARNm constitue un codon.
chaque codon correspond un
acide amin de la protine synthtise. Le code gntique est
universel (commun presque tous
les tres vivants), univoque (un codon correspond un acide amin
et un seul) et redondant (plusieurs
codons peuvent correspondre
plusieurs acides amins) puisquil
existe 64 codons.
Il existe un codon de dmarrage
de la lecture et trois codons stop,
marquant la fin de la synthse de
la protine.
Dans le cytoplasme, lARNm est lu
par des ribosomes qui assurent,
en suivant le code gntique, la
liaison des acides amins les uns
avec les autres pour constituer la
protine. Le codon AUG (mthionine) dbute la traduction tandis
quun des codons stop la termine
(UAA, UAG ou UGA).

Stabilit et variabilit des gnomes (Term)

65

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

ZOOM SUR
Quelques particularits des gnes.
t 4FMPO MFT FTQDFT  MF OPNCSF EF
gnes va de quelques milliers
quelques dizaines de milliers. Chez
lhomme, il y en a environ 30000 (on
connat plus de 4000 maladies gntiques dues un gne dfectueux).
t$IF[MFTQSPDBSZPUFT MBUSBOTDSJQtion et la traduction sont simultanes
car ils ne possdent pas denveloppe
nuclaire. Au fur et mesure que la
molcule dARNm est synthtise,
elle est lue par les ribosomes qui
ralisent la synthse de la protine.

DATES CLS
Les dcouvertes en biologie
molculaire.
tMise en vidence de lADN
par Miescher.
tKossel, Fischer et Levene
trouvent la composition de lADN.
tWatson et Crick ralisent le
modle de la structure en double
hlice de lADN.
t   Griffith met en vidence
la transformation bactrienne.
Lien avec lADN en 1944 grce aux
travaux dAvery.
tBeadle et Tatum montre la
relation un gne = une protine .
tMise en vidence des ribosomes par Palade.
tMise en vidence que lADN
est le support de linformation
gntique grce aux travaux de
Herschey et Chase.
tTravaux de Meselson et Stahl
qui montrent une rplication de lADN
selon le mode semi-conservatif.
t   Preuve de la colinarit entre un gne et une protine
grce aux travaux de Yanofski.
t   Expriences de
Nirenberg, Matthei et Khorona
permettant le dchiffrage du code
gntique.
tDcouverte des enzymes de
restriction et de leur utilisation pour
le gnie gntique par Aber, Smith et
Nathans (prix Nobel 1978).
t   Ralisation de la technique Southern blot par les
chercheurs en complmentarit
avec lutilisation des enzymes de
restriction et de llectrophorse.
tClonage des gnes.

66

UN SUJET PAS PAS

Restitution de connaissances :
La complexit du gnome
Lintitul complet du sujet
La connaissance du gnome des espces montre une
grande complexit tant du point de vue du polymorphisme que de la multitude des gnes.
Prsentez les diffrents types dinnovations gntiques et montrez quelles permettent dexpliquer la
complexit du gnome.
La rponse sera structure et illustre dun schma
dinnovation gntique lchelle de lADN.

Ce quil ne faut pas faire


t5SBJUFSEFMBUSBOTDSJQUJPOFUEFMBUSBEVDUJPO
t/HMJHFSMFTDINB

Lanalyse du sujet

Comment les diffrents types dinnovations gntiques


permettent-ils dexpliquer la complexit du gnome ?

I. Les diffrents types dinnovations gntiques


a) Les mutations
Modifications de la succession des nuclotides dADN
constituant les chromosomes, elles sont accidentelles,
spontanes, alatoires, rares, et se produisent la plupart
du temps lors de la rplication des molcules dADN.
Une mutation ponctuelle affecte une seule paire de
nuclotides dADN :

Une famille multignique :


les globines chez lhomme.

position 4, dans des complexes Hox diffrents, ce qui


plaide en faveur de leur origine commune.
Ltude de la comparaison de la squence partielle des
gnes Hox a-4, Hox b-4, Hox c-4 et Hox d-4 seffectue
en prenant pour rfrence la squence partielle de
Hox a-4 qui comprend 63 nuclotides.
En comparant squence par squence, on peut noter
le nombre de nuclotides identiques entre les squences et dresser un tableau des rsultats :

Chez de nombreux tres vivants, le dveloppement


est contrl par des gnes comme les gnes Hox,
par exemple. Plusieurs gnes Hox sont runis sur
un chromosome et forment un ensemble appel
complexe Hox .
partir de ltude du document, montrez que les
gnes Hox a-4, Hox b-4, Hox c-4 et Hox d-4 de la souris
appartiennent une mme famille multignique.

Hox a-4
Hox b-4
Hox c-4

Hox b-4

Hox c-4

Hox d-4

51

49

51

56

55
52

Les similitudes entre les squences des gnes oscillent


HOX B
Chromosome 11
entre 56 et 49 nuclotides
c-4 c-5 c-6
c-8 c-9 c-10 c-11 c-12 c-13
sur 63 nuclotides considChromosome 15
HOX C
a-1
d-3 d-4
d-7 d-9 d-10 d-11 d-12 d-13
rs, soit de 88,8 % 77,7 % de
Chromosome
2
HOX D
similitudes, ce qui montre
une parent molculaire
significative, tmoin dune
CCTAAGCGCTCTCGAACCGCCTATACCGCCAGCGCAATCTTGGAACTGGAGAAGGAATTCCAC
HOX A-4
origine commune. Au cours
CGGCTCGCGTGT
HOX b-4
de lvolution, les copies
CGAGACGCTAAGTT
HOX c-4
de gnes (duplication) se
CCGGCAACAATT
HOX d-4
sont retrouves sur des
Les tirets correspondent aux nuclotides communs la squence de rfrence (Hox a-4).
chromosomes diffrents
(transposition) et ont subi
des mutations ponctuelles. Il s'agit d'une famille
multignique.
La problmatique
Quels mcanismes ont permis dobtenir quatre gnes
constituant une famille multignique ?
a-1 a-2 a-3 a-4 a-5 a-6 a-7

ADN.

II. La complexit du gnome


a) Un gne, par mutations, peut avoir plusieurs allles :
on parle de polyalllisme.
Un individu diplode ne peut avoir dans son gnome
que deux formes possibles dun mme gne.
Quand les mutations sexpriment dans le phnotype,
elles sont soit faux-sens, quand la squence dacides
amins est modifie par changement dun seul acide
amin, soit non-sens quand la traduction est arrte
par lapparition dun codon non-sens.
Quand les mutations ne sexpriment pas dans le
phnotype, elles sont dites silencieuses : le triplet
dADN modifi, en relation avec la redondance du
code gntique, ne change pas la squence dacides
amins de la protine. Les effets des mutations
peuvent varier selon le gne affect.
b) La duplication de gnes est lorigine de familles de
gnes que lon nomme familles multigniques.
Ces gnes multiples noccupent pas le mme locus,
ils sont le rsultat de lvolution dun gne ancestral
unique par une ou plusieurs duplications : ce sont
Seules les mutations affectant les cellules germinales des gnes homologues.
Au cours des gnrations, les copies vont diverger du
sont transmissibles la descendance.
fait de laccumulation des mutations.
b) La duplication gnique
Formation de deux copies dun mme gne qui sont Si la divergence est faible, les gnes homologues
transposes en un autre point du gnome. Lvolution codent des protines qui conservent une fonction
identique ou voisine de celle code par le gne
des copies des gnes est autonome.
ancestral.
Si la divergence est grande, les gnes
codent des protines ayant des foncSUJET TOMB AU BAC SUR CE THME
tions nouvelles.
Au cours du temps, les gnomes des
tude de documents
espces se sont enrichis de nouveaux
La famille multignique des globines humaines (Pondichry, avril 2009)
gnes.

Stabilit et variabilit des gnomes (Term)

Lintitul complet du sujet

Gnes des complexes Hox chez la souris et squences


partielles.
Chaque complexe Hox est nomm par une lettre
(Hox A, Hox B, Hox C et Hox D) et comprend plusieurs
gnes. Par exemple, le gne Hox a-4 est le quatrime
gne du complexe Hox A.

La problmatique

ZOOM SUR...

Les gnes de la souris

Le document

On entend, par innovations gntiques, des mcanismes de mutation et de duplication de gnes qui
conduisent lapparition de nouveaux allles dun
gne ou lapparition de nouveaux gnes.

Le plan dtaill du dveloppement

tude de document :

HOX A

a-9 a-10 a-11

b-1 b-2 b-3 b-4 b-5 b-6 b-7 b-8 b-9

a-13

Chromosome 6

Le corrig
Les gnes Hox participent au contrle du dveloppement chez de nombreux tres vivants.
Plusieurs gnes Hox sont runis sur un mme chromosome et forment un complexe Hox . On
observe chez la souris quatre complexes diffrents
de gnes Hox : les complexes Hox A, Hox B, Hox C et
Hox D, situs sur quatre chromosomes diffrents, les
chromosomes 6, 11, 15 et 2.
Le gne Hox a-4 est le quatrime gne du complexe
Hox A, constitu de 11 gnes.
Le gne Hox b-4 appartient au complexe de gnes
Hox B, constitu de 9 gnes.
Le gne Hox c-4 appartient au complexe de gnes
Hox C, comprenant 9 gnes.
Le gne Hox d-4 appartient au complexe de gnes
Hox D, comprenant 9 gnes.
Ces gnes Hox-4 se trouvent la mme place, en

Chane d'ADN.

Ce quil ne faut pas faire


Expliquer la thorie des mcanismes lorigine
dune famille multignique sans exploiter
le document.

t -INPHMPCJOF )C
 FTU VOF
protine constitue de lassociation de quatre chanes polypeptidiques, deux chanes alpha
et deux chanes bta.
Au cours de sa vie, lorganisme
humain fabrique plusieurs types
dhmoglobines, constitus de
chanes de globines diffrentes :
pendant la vie embryonnaire,
lHb est forme de deux chanes
zta et de deux chanes epsilon ;
pendant la vie ftale, lHb est
forme de deux chanes alpha et
de deux chanes gamma ;
aprs la naissance, 97 % de lHb
est forme de deux chanes alpha et
de deux chanes bta (Hb A1) et 3 %
dHb A2 constitue de deux chanes
alpha et deux chanes delta.
t -FT TJY HOFT DPEBOU QPVS MFT
globines sont situs sur des locus
diffrents. Ceux codant pour les
globines zta et alpha sont situs
sur le chromosome 16 et les quatre
autres, codant pour les globines
epsilon, gamma, delta et bta sont
situs sur le chromosome 11.
t-BDPNQBSBJTPOEFTTRVFODFT
dacides amins des diffrentes
globines deux deux a permis
dtablir une matrice des distances. Une ressemblance de plus
de 20 % nest pas le fait du hasard,
mais dune parent. Lexistence
des diffrentes globines sinterprte par le fait que tous les gnes
sont apparents et rsultent dun
gne ancestral. Les globines sont
des polypeptides homologues.
Elles constituent une famille multignique.
Cest le mcanisme de duplicationtransposition associ des mutations qui, en se reproduisant
plusieurs fois, permet dobtenir
les diffrents gnes dune famille
multignique.
Sur larbre de filiation, les nuds
correspondent aux duplications
et la longueur des branches exprime le nombre de mutations.
La datation de lapparition des
diffrentes globines au cours des
temps gologiques se fait grce
aux donnes de la palontologie
et de la biologie.

Stabilit et variabilit des gnomes (Term)

67

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

LES ARTICLES DU

LES ARTICLES DU

es cinq patients dcds en


juillet lhpital de Massy (Essonne) ne sont pas morts de la
bactrie tueuse , tel que lavanait Le Parisien ce mardi 30 aot,
mais de la pathologie dont ils
souffraient , a rectifi lINVS (Institut national de veille sanitaire).
Une chose, toutefois, reste vraie : la
bactrie Klebsiella pneumoniae, dsigne tort comme coupable, tait
bien prsente chez dix-huit patients
de cet hpital. Assez courante dans

POURQUOI
CET ARTICLE ?
Cet article expose linquitude
des chercheurs de lINVS, de
lInra et de lInstitut Pasteur
devant laugmentation de la
rsistance de nombreuses
bactries aux traitements
antibiotiques.
Ces derniers deviennent totalement inefficaces, ce qui
pose un vritable problme
de sant publique : aucun
autre traitement n'tant
disponible.
Daprs les chercheurs, le
problme vient dune surconsommation dantibiotiques par les malades, dun
dosage trop faible et dun
usage massif en agriculture
provoquant une volution
rapide des bactries qui acquirent des rsistances aux
antibiotiques.
Larticle montre que linnovation gntique, traduit dans cet exemple par
lacquisition de rsistances
par les bactries, peut tre
rapide et ne concerne pas
seulement lvolution des
tres vivants lchelle de
millions dannes.
C'est un exemple utile
pour illustrer un sujet sur
lvolution du gnome et
linnovation gntique.

68

nos tubes digestifs, la Klebsiella


nest pas forcment pathogne, et
rsidait dailleurs chez ces patients
sans leur causer de maladie. Mais
cette souche en question, importe
de Grce, avait une particularit
qui a pu inquiter les mdecins :
elle est rsistante la plupart des
antibiotiques disposition.
Ce phnomne de rsistance proccupe de plus en plus le monde
de la sant. Car la Klebsiella est loin
dtre la seule chapper aux traitements. Dbut aot, des scientifiques
de lInra (Institut national de la recherche agronomique), de lINVS et
de lInstitut Pasteur alertaient sur
lmergence soudaine et proccupante dune salmonelle bactrie
reprsentant une des premires
causes dinfections alimentaires chez
lhomme [] devenue rsistante
presque tous les antibiotiques .
Dans ce cas, le berceau de ces modifications gntiques pourrait tre
lgypte, probablement cause de
lusage massif dantibiotiques dans
laquaculture puis dans llevage de
volailles, grandes consommatrices
de fluoroquinolones . La bactrie,
dont certaines souches rsistent dj
toutes les classes dantibiotiques,
semble simplanter en Europe.
En juin dernier, cest la fameuse
E. Coli, qui a fait 76 morts en Europe. Elle avait comme particularit, outre sa virulence, dtre trs
rsistante aux mdicaments. Le
phnomne touche dautres colibacilles, des bactries trs communes
qui peuplent par millions les tubes
digestifs des hommes et des animaux. Certaines ont aujourdhui
la capacit de rsister quasiment
tout larsenal thrapeutique, laissant les mdecins dsarms.

Une utilisation
jECSJEFx
Les professionnels de la sant
ne cachent pas leur inquitude,
comme en tmoigne un manifeste
de lAlliance francophone contre le
dveloppement des bactries multirsistantes. Le groupe voque le

Stabilit et variabilit des gnomes (Term)

chiffre, sous-estim selon lui, de


25 000 dcs par an en Europe
causs par ces micro-organismes
tenaces. Aprs plusieurs dcennies dune utilisation souvent dbride des antibiotiques, nous entrons dans une priode de risque
et de pnurie, avec lapparition de
bactries extrmement rsistantes
ces mdicaments, voire tous
les antibiotiques, alors que trs
peu de nouveaux produits sont
attendus dans les dix prochaines
annes , constate ce document.
Le coordinateur de lAlliance, Jean
Carlet, met en cause un mauvais
usage des antibiotiques. Et en premier lieu, leur surconsommation.
Chez lhomme, peut-tre la moiti
des antibiotiques prescrits le sont
alors quil ne sagit pas de bactries,
mais de maladies virales ou autres,
pour lesquelles ces traitements nont
pas lieu dtre , dplore le mdecin.
Autre utilisation nuisible : un dosage
trop faible qui ne tue pas toute la
population bactrienne, laissant les
micro-organismes les plus rsistants
survivre et se multiplier. Cest de
cette faon, paralllement aux mutations, que les bactries dveloppent
des capacits de rsistance.

Trop dantibiotiques
tuent lantibiotique
En France, cette consommation
dantibiotiques a t pointe par
lAfssaps (Agence franaise de scurit sanitaire des produits de sant) en
juin : lHexagone est nettement audessus de la moyenne europenne
dans ce domaine . Et les Franais se
remettent consommer davantage
de ces mdicaments depuis 2005,
malgr une tendance globale la
baisse par rapport aux annes 1990.
Et il ny a pas que chez les humains que lon se gave dantibiotiques : Jean Carlet voque leur
usage massif dans llevage o ils
servaient mme, petite dose, de
stimulateurs de croissance jusqu
ce que cette pratique soit interdite
en France il y a quelques annes. Elle
reste en vigueur dans dautres pays

comme les tats-Unis, laissant libre


cours aux volutions des bactries
puis leurs ventuelles migrations.
Dans lagriculture enfin, les antibiotiques utiliss pour soigner les
plantes sinfiltrent dans la terre.
En cause galement, le manque
dinnovation dans ce domaine : si
les bactries sont de plus en plus rsistantes, cest quelles ont le temps
dvoluer face des produits qui,
eux, ne changent pas ou peu. Du
coup, les solutions de rechange sont
galement rduites pour remplacer
un produit devenu obsolte. En
pratique, les mdecins sont dj
confronts des infections susceptibles de menacer le pronostic vital
des patients par manque dantibiotiques efficaces , souligne lAfssaps.

Diversifier
les thrapeutiques
Pour Jean Carlet, il faut donc
crer de nouveaux antibiotiques,
dans limmdiat, pour sortir de cette
impasse. Dans la revue Nature,
Martin Blaser, prsident du dpartement de mdecine de luniversit de
New York, prconise quant lui de
rduire fortement leur usage pour
les enfants et les femmes enceintes.
En effet, rduire la consommation
de ces mdicaments et rationnaliser
leur usage freinerait la capacit de
rsistance des bactries.
Mais long terme, les antibiotiques
seront toujours rattraps par ladaptation, invitable, de ces organismes
vivants. Par consquent, pourquoi ne
pas sintresser dautres solutions ?
Jean Carlet voque, en premire ligne,
la vaccination. Mais pas seulement :
On peut aussi regarder du ct de
certaines plantes, qui ont des effets
antibactriens assez puissants, ou
encore de certains virus bactriophages. Bref, il sagit de diversifier
les thrapeutiques, face des antibiotiques qui ont reprsent, en France,
un chiffre daffaires de 852 millions
deuros en 2009, selon lAfssaps.
Angela Bolis
(30 aot 2011)

Lvolutivit des bactries, cl


des mcanismes de rsistance
L

a rsistance des bactries


aux antibiotiques est un
phnomne gntique reli
lextraordinaire capacit des
bactries de se reproduire et dvoluer. La stratgie premire de
la vie, lvolution, est le fruit de
deux mcanismes indpendants, la
mutagense qui produit les mutations sources de variabilit et la
slection naturelle des individus les
mieux adapts , explique Miroslav
Radman, qui dirige le laboratoire de
gntique molculaire volutive et
mdicale la facult de mdecine
Necker-Enfants-malades (qui dpend de lUniversit Paris-V).
Au dbut des annes 1970, il a
t montr, poursuit-il, que les bactries dcident de muter. Elles
dclenchent en effet un mcanisme
gntiquement contrl, lorsquelles
sont soumises un stress qui endommage leur ADN. Lenvironnement
ne dirige pas leurs mutations, mais
il peut en augmenter la frquence.
Et parmi les mutations survenues,

POURQUOI
CET ARTICLE ?
En complment du prcdent, cet article explique les
mcanismes qui permettent
aux bactries dvoluer rapidement et de devenir rsistantes
aux antibiotiques. Il prsente
ltat actuel des connaissances
concernant lvolutivit des
bactries qui rsulte de deux
mcanismes : la mutagense
et la slection naturelle.
Les antibiotiques empchent
la multiplication des bactries,
soit en empchant la transcription (synthse dARN partir
dADN), soit bloquant la traduction (synthse de protines
bactriennes). Or, les bactries
rsistantes sont capables soit
dinactiver lantibiotique, soit

celles confrant une meilleure


adaptation sont alors slectionnes.
Comment peuvent se dclencher ces mutations alors que les
bactries possdent un systme
de rparation des erreurs trs performant ? La nature ne recherche
pas la fiabilit maximale, constate
Miroslav Radman. Les bactries
favorises par la nature sont celles
dont les systmes de rparation
des mutations sont inactifs.
Divers mcanismes molculaires
assurent une augmentation du taux
de mutation. Certains fonctionnent
en permanence, dautres sont inductibles et se mettent en route dans certaines conditions particulirement
dltres pour ces organismes qui
ont alors besoin de ragir . Dautres
enfin mettent en jeu des zones du
gnome qui sont trs souvent le sige
derreurs de recopiage de lADN.

Contrle de qualit
Dans la nature, un petit pourcentage des souches bactriennes

dempcher son entre dans la


cellule, soit dexpulser lextrieur de la cellule la molcule.
Ces capacits sont le rsultat
de mutations du gnome. Les
chercheurs ont dcouvert
que les mutations sont des
mcanismes gntiquement
contrls et provoqus la
suite dun stress. Les bactries
dites mutateurs constitutifs
ont la particularit de ne pas
possder de mcanisme de
contrle de la rplication de
lADN : elles changent donc en
permanence et prsentent un
avantage slectif. La rsistance
des bactries peut tre accentue (multi-rsistances) par des
changes de fragments dADN
entre souches bactriennes,
fragments qui seront transmis
aux cellules filles.

sont des mutateurs constitutifs . Dpourvues du mcanisme


de contrle de qualit qui corrige
les erreurs de recopiage de lADN,
elles changent en permanence,
ce qui augmente les mutations
dans lensemble du gnome.
Ainsi, lorsque deux populations
bactriennes de mme taille,
lune de type normal (sauvage) et
lautre de type mutateur sont en
comptition, ce sont les secondes
qui finissent par coloniser tout
le milieu.
Le phnomne nest pas dfinitif car, dans la nature, quelques
bactries peuvent acqurir nouveau un systme de rparation
de lADN fonctionnel par change
dADN avec des bactries dune
souche sauvage.
En effet, les barrires gntiques
entre les espces bactriennes apparentes disparaissent chez les
mutateurs. On constate mme
des changes de larges fractions de
gnomes entre microbes apparents, responsables de lapparition de
nouveaux gnomes mosaques,
sources potentielles de nouvelles
activits enzymatiques , poursuit
le chercheur. Pour les bactries
mutateurs inductibles, les gnes
mutateurs ne sont activs quen
raction une forte pression de
slection en prsence dantibiotiques par exemple et ne se manifestent plus lorsque cesse le stress.
Plus dune souche bactrienne sur
deux, isole dans la nature, serait
un mutateur inductible.
Il existe un autre outil de diversification des gnomes des bactries
et des parasites qui met en jeu des
vnements de mutation particulirement nombreux dans certaines
rgions du gnome responsables de
la synthse de protines de surface
de la bactrie. Celles-ci sont normalement reconnues par le systme
immunitaire de lhomme qui dtruit les bactries. Leurs mutations
les rendent invisibles.

Les antibiotiques arrtent la


prolifration des bactries, soit
en empchant la transcription
de lADN bactrien en ARN, premire tape de sa multiplication,
soit en empchant la fabrication
de protines bactriennes indispensables, notamment pour
constituer la paroi de la bactrie.
Toutefois les bactries ont acquis
divers moyens pour contrecarrer
ces actions. Certaines inactivent
lantibiotique ; dautres ferment
leurs propres canaux, empchant
lantibiotique dy pntrer ;
quelques-unes enfin fabriquent
des pompes qui refoulent lantibiotique lextrieur.

Bote outils
molculaire
Ces rsistances sont le fruit de
mutations quelles transmettent
leurs descendantes. Mais elles
peuvent aussi avoir acquis ces capacits par transfert dune partie
de gnome dune autre bactrie,
porte par un morceau dADN non
intgr leur gnome. Celui-ci se
recopie en mme temps que lADN
des bactries et se retrouve ainsi
dans les cellules filles. Ce morceau
dADN peut aussi se transmettre
directement une bactrie qui en
tait dpourvue, ce qui favorise
la dissmination de la rsistance.
Ce mcanisme est dautant plus
dangereux pour lhomme que ces
morceaux dADN mobiles contiennent souvent plusieurs gnes de
rsistance aux antibiotiques,
rendant les bactries multi-rsistantes. Ainsi des systmes de
mutations activs la demande
semblent tre la cl de ladaptabilit des bactries qui disposent
dune bote outils molculaire
leur permettant de se perfectionner sans cesse. Un dfi pour la
mdecine et la recherche.
lisabeth Bursaux
(1er avril 2001)

Stabilit et variabilit des gnomes (Term)

69

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Le boom des bactries rsistantes


aux antibiotiques

MOTS CLS
ASQUE
tui renfermant plusieurs spores
(huit chez Sordaria).

CHROMATIDE
Rsultant de la duplication dun
chromosome, une chromatide ne
contient quune molcule dADN.
ne pas confondre avec chromatine.

CHROMATINE
Ensemble form par la molcule
dADN et les protines nuclaires,
appeles histones, sur lesquelles
elles senroulent.

CHROMOSOMES
HOMOLOGUES
Chromosomes appartenant une
paire dans le caryotype.

DOMINANCE/
CODOMINANCE/
RCESSIVIT
Exemple des groupes sanguins :
si lun des deux chromosomes
homologues porte lallle A et
lautre lallle O, le groupe sanguin exprim sera A. Lallle A est
dominant par rapport lallle O,
qui est rcessif ;
si lun des deux chromosomes
porte lallle A et lautre lallle B,
le groupe sanguin exprim sera
AB. Les allles A et B sont codominants ;
pour quune personne soit du
groupe O, il faut que les deux
allles soient O.

MONOSOMIE
Prsence dun seul chromosome
au lieu dune paire dhomologues
dans le caryotype.

Miose et fcondation

a reproduction sexue est caractrise par lalternance de


la miose et de la fcondation, deux mcanismes qui, tout
en assurant la stabilit du gnome, sont responsables de la
formation dindividus uniques sur le plan gntique.

Les mcanismes qui permettent


le maintien du nombre des
chromosomes au cours des
gnrations
Chaque espce est caractrise par un nombre constant
de chromosomes. Chez les espces phase diplode
prdominante, les cellules possdent des paires de
chromosomes homologues (2n). linverse, chez les
espces phase haplode prdominante, les cellules
ne possdent quun exemplaire de chaque type chromosomique (n).
Chez les espces diplodes, les cellules de chaque
individu proviennent de la division par mitose dune
cellule-uf, cest--dire dun zygote rsultant de la
fusion dun gamte femelle et dun gamte mle lors
de la fcondation. Les gamtes possdent seulement
n chromosomes (haplodes), contrairement aux
cellules somatiques qui sont diplodes. La rduction
par deux du nombre de chromosomes dans les cellules de la ligne germinale ligne lorigine de la
formation des gamtes se produit lors de la miose.
Ainsi, lalternance de la fcondation et de la miose
permet de maintenir lquipement chromosomique
caractristique de lespce au cours des gnrations.
Chez les espces haplodes, comme certaines moisissures, la miose ne se produit pas lors de la
formation des gamtes mais peu de temps aprs
la formation du zygote. Les quatre cellules filles
haplodes rsultant de la miose donnent des spores
qui sont lorigine dun nouvel organisme haplode
par simples mitoses. Dans certaines circonstances,
deux cellules appartenant des mycliums de types
sexuels opposs peuvent fusionner pour donner un
zygote. Chez ces espces, la phase diplode est donc
rduite au zygote.

POLYPLODIE
Prsence de plus de deux chromosomes homologues.

TEST CROSS
Croisement dun individu dont on
veut connatre le gnotype avec un
homozygote rcessif cest--dire porteur des allles rcessifs des gnes
considrs. Le test cross permet de
mettre en lumire le gnotype des
gamtes en phnotype des individus. Il permet destimer le taux
de recombinaison et de calculer la
distance gntique entre deux gnes.

70

LESSENTIEL DU COURS

Cycle de reproduction dun animal (diplode).

Stabilit et variabilit des gnomes (Term)

entre chromatides homologues (crossing over). la


mtaphase I, les centromres des chromosomes
homologues se placent de part et dautre du plan
quatorial, puis se sparent lanaphase I, entranant leurs chromosomes respectifs chaque ple.
La tlophase I donne donc naissance deux cellules
haplodes dont les chromosomes sont toujours
forms de 2 chromatides.
La seconde division nest pas prcde dune synthse dADN. Lors de lanaphase II, les centromres
se clivent de telle sorte quils entranent chaque
ple un chromosome form dune seule chromatide.
Ainsi, la cellule diplode initiale donne naissance
quatre cellules haplodes.

En cas derreur de rpartition


des chromosomes la miose

Cycle de reproduction dun champignon haplode.


Exemple : Sordaria (champignon ascomycte).

Ainsi, quels que soient les organismes considrs, la


reproduction sexue comporte lalternance dune
phase haplode et dune phase diplode.

La particularit des divisions de


la miose
La miose est un ensemble de deux divisions prcdes dune seule synthse dADN. partir dune
cellule diplode, elle conduit la formation de
quatre cellules haplodes. La premire division est
appele division rductionnelle car elle aboutit la
formation de deux cellules n chromosomes, tandis
que la seconde division est dite quationnelle car
elle ne modifie pas le nombre de chromosomes.
La prophase I de la premire division est particulirement longue. ce stade, chaque chromosome
est form de deux chromatides puisque la synthse
de lADN a dj t ralise lors de la phase S de
linterphase. On observe alors lappariement des
chromosomes homologues sous forme de bivalents
(2 chromosomes), encore appels ttrades (4 chromatides), dont les chromatides sentremlent en
formant des chiasmas. Au moment de cet appariement peuvent se produire des changes de segments

Lorsque la rpartition des chromosomes homologues ne se produit pas correctement, les cellules
filles prsentent des anomalies du nombre de chromosomes (aneuplodie).
Par exemple, si deux chromatides homologues se
retrouvent dans la mme cellule fille, on trouvera
parmi les gamtes forms un gamte portant un
chromosome surnumraire et un autre auquel il
manquera un chromosome. Lors de la fcondation,
ces gamtes donneront respectivement un embryon
trisomique et un embryon monosomique. Les trisomies provoquent de graves anomalies congnitales
et beaucoup dentre elles sont ltales.
Dans lespce humaine, on connat la trisomie 21,
qui est compatible avec la vie mais lorigine dun
ensemble danomalies appel syndrome de Down.
La formule XXY est galement compatible avec la
vie mais est lorigine du syndrome de Klinefelter.
Labsence dun chromosome est rarement viable,
lexception de la monosomie X (XO), lorigine du
syndrome de Turner.

Le rsultat dun croisement


entre deux souches de Sordaria
RVJEJGGSFOUQBSVODPVQMF
EBMMMFT
Appelons arbitrairement M+ et M les deux allles
dun gne. Ils peuvent correspondre divers caractres, comme, par exemple, la capacit synthtiser
une substance ou la couleur des spores. Les cellules
de Sordaria tant haplodes, elles possdent soit
lallle M+ soit lallle M.
On part dune cellule M/M+, issue du croisement
entre une souche M et une souche M+. lissue de
la miose, les cellules filles subissent une mitose
qui conduit la formation de huit spores par asque.
Dans tous les asques, on constate que la moiti des
spores portent M+ et lautre moiti M. En outre, chez
Sordaria, les spores sont ordonnes dans lasque et
on constate que leur rpartition peut se faire de deux
manires : soit les spores sont ordonnes en deux
groupes de quatre M+ et quatre M, soit elles sont
ordonnes en quatre groupes de deux M+ et deux M.
Ceci traduit la gomtrie des divisions successives,
miose puis mitose.

La formation des diffrents


types dasques lors de
la miose
On obtient deux groupes de quatre spores lorsque
les deux allles se sparent ds la premire division
de la miose, en raison de la sgrgation indpendante des chromosomes.
On obtient quatre groupes de deux spores lorsque
les allles se sparent la deuxime division de la
miose, en raison dune recombinaison chromosomique (crossing over) lors de la prophase de la
premire division.

Le brassage gntique
Les organismes comportent plusieurs milliers de
gnes, dont la plupart prsentent diffrents allles.
Lors de la formation des gamtes chez les parents,
chaque gamte reoit un seul allle de chaque gne.
Mais comme les allles sont distribus au hasard,
les gamtes forms diffrent les uns des autres par
leur gnotype.
Au cours de la miose se produit la recombinaison
des allles qui nest possible que pour les gnes
prsents ltat htrozygote. La distribution au
hasard des chromosomes homologues de chaque
paire dans les cellules filles constitue le brassage
interchromosomique, tandis que lchange de segments chromosomiques ralis par les crossing over
constitue le brassage intrachromosomique. Comme
il existe de nombreux gnes htrozygotes chez
la plupart des organismes, ce brassage gntique
lors de la miose conduit la formation de gamtes
pouvant possder une quasi-infinit de gnotypes
diffrents.
La rencontre au hasard des gamtes lors de la
fcondation amplifie la diversit potentielle des
gnotypes. Ainsi, dans lespce humaine, la sgrgation indpendante des chromosomes permet
thoriquement la formation de 223 types de gamtes
diffrents et la rencontre au hasard avec un gamte
de lautre sexe conduit thoriquement, chaque
fcondation, 70 000 milliards de combinaisons
gnotypiques possible pour une cellule-uf.
Ce chiffre est trs sous-valu car il ne tient pas
compte du brassage intrachromosomique d aux
crossing over. Cest une quasi-infinit de combinaisons gntiques diffrentes qui sont thoriquement
possibles. Ainsi, en assurant le brassage des allles
au sein dune population, la miose et la fcondation
entretiennent le polymorphisme.

UN ARTICLE DU MONDE
CONSULTER
t3FO'SZENBOj-BGDPOEBUJPO
en prouvette est le symbole d'une grande
USBOTHSFTTJPOxp. 74
(Propos recueillis par C.V., 6 octobre 2010)

ZOOM SUR
Les aberrations chromosomiques.
t 1MVTJFVST BOPNBMJFT EF MB NJPTF
conduisent des aberrations chromosomiques :
trisomie 21 ou syndrome de
Down (traits caractristiques du visage, sant fragile, malformations
cardiaques, parfois retard mental) ;
trisomie 18 ou syndrome dEdwards (anomalies du crne, de la
face, des pieds et des mains, malformation des viscres, mortalit
avant lge de un an) ;
trisomie 13 ou syndrome de Patau (nombreuses anomalies qui
conduisent au dcs in utero pour
80 90 % des ftus. Dans le cas
dune naissance, lesprance de vie
des enfants est de trois mois pour
la moiti dentre eux) ;
trisomie XXY ou syndrome de
Klinefelter (homme strile, pilosit
peu dveloppe, dveloppement
intellectuel le plus souvent normal) ;
trisomie XYY (habituellement
asymptomatique, phnotype
masculin) ;
trisomie X (47, XXX habituellement asymptomatique, phnotype fminin) ;
monosomie X (45, XO) ou syndrome de Turner (femme de petite
taille, strile, absence de caractres
sexuels secondaires).
t$FTBOPNBMJFTTPOUMJFTVOFOPO
disjonction des chromosomes homologues lors de la premire division de
la miose ou une non-disjonction
de chromatides lors de la deuxime
division de la miose. Les gamtes
anormaux ainsi forms possdent
n + 1 ou n 1 chromosomes. La
fcondation de ces gamtes par
des gamtes normaux conduit
des cellules ufs possdant 2n + 1
chromosomes (trisomie) ou 2n 1
chromosomes (monosomie).
t-FTUZQFTEFHBNUFTGPSNTMPST
du brassage intrachromosomique :
les gamtes de type parental pour
des gamtes dont la combinaison
dallles existait dj avant la miose ;
les gamtes de type recombin sont
des gamtes possdant une nouvelle
combinaison dallles. Les types recombins sexpliquent par des crossing over ou changes de segments
de chromosomes lors de la prophase
de la premire division de la miose.

Stabilit et variabilit des gnomes (Term)

71

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

ZOOM SUR
Le chromosome du colibacille.
Chez tous les tres vivants, lADN
est contenu dans les chromosomes.
Chez les procaryotes, comme par
exemple les bactries, il nexiste
quun seul chromosome gnralement circulaire. Contrairement
aux cellules eucaryotes, ce chromosome nest pas contenu dans un
noyau.
Le cycle de vie des levures.
La levure est un champignon unicellulaire qui vit naturellement la
surface des grains de raisin.
Lorsque les conditions sont favorables, les levures se reproduisent
par bourgeonnement. Ce dernier
se produit toutes les 90 minutes
(il sagit de divisions conformes ou
mitoses) et chaque cellule issue du
bourgeonnement contient le mme
nombre de chromosomes que la
cellule-mre, soit 17 chromosomes.
Lorsque les conditions sont moins
favorables, deux cellules de levures
peuvent fusionner (fcondation)
pour former une cellule (forme
de 34 chromosomes) qui subit
les deux divisions successives de
la miose pour former 4 spores
(17 chromosomes) contenues dans
un asque.
Chaque spore libre de lasque
redonne une cellule de levure
capable de bourgeonnement.
La drosophile, organisme modle
en gntique.
Linformation gntique est duplique et transmise de gnration
en gnration selon des mcanismes identiques chez tous les
organismes.
La mouche drosophile est ainsi
devenue un organisme modle
en gntique depuis le dbut du
vingtime sicle car elle prsente
notamment lavantage de navoir
quun petit nombre de chromosomes. Les rsultats obtenus ont
pu tre extrapols aux autres
organismes. Ce sont notamment
les travaux sur la drosophile qui
ont permis de faire le lien entre
chromosomes et caractres hrditaires.

72

UN SUJET PAS PAS

Restitution de connaissances :
Fcondation et miose chez
une espce haplode
Lintitul complet du sujet
Une espce dtre vivant est caractrise notamment
par son caryotype, cest--dire par les particularits
(nombre, forme, taille) de ses chromosomes.
Exposez comment miose et fcondation permettent
le maintien du caryotype dans les gnrations successives. Votre expos sappuiera sur lexemple dune
espce haplode 3 chromosomes (n = 3).
On attend une introduction, un dveloppement structur
et illustr par des schmas, ainsi quune conclusion.

Lanalyse du sujet
Il sagit dexpliquer, avec des schmas clairs, la
fcondation et la miose pour un organisme haplode
3 chromosomes.

La problmatique

La deuxime division de miose se droule ensuite.


Cest au cours de lanaphase II de miose que les
chromosomes se scindent et que chaque chromatide
migre un ple de la cellule (schma 6).

Ce quil ne faut pas faire


Des schmas avec des cellules ayant
un autre nombre de chromosomes
que celui demand.

lADN par rplication dans la cellule-uf. La miose


intervient immdiatement aprs la fcondation,
elle est constitue par deux divisions successives.
La premire division de miose dbute dans la
cellule-uf diplode avec des chromosomes deux
chromatides rigoureusement identiques.
Lors de la prophase I, les chromosomes se condensent, les homologues sapparient et forment des
bivalents.

Comment la miose et la fcondation permettentelles le maintien du caryotype de lespce dans les


gnrations successives ?

sparation
des chromatiques
Schma 6 : anaphase II de 2e division de miose.
Chromosomes.

En fin de tlophase I, la cellule se divise en deux pour


former deux cellules un chromosome de chaque
type mais deux chromatides (schma 5).

En fin de tlophase II, les cellules se sparent en deux


et les quatre cellules formes ont un chromosome de
chaque type une chromatide (schma 7).

Rplication ADN

Cellule-uf
2n = 6 chromosomes
2 chromatides

Schma 2.

Stabilit et variabilit des gnomes (Term)

2 cellules
n = 3 chromosomes

Schma 3 : prophase I de 1re division de miose.

Schma 1.

Fcondation

appariement des chromosomes homologues


2n = 6 chromosomes 2 chromatides

Cellule haplode
n = 3 chromosomes

La fcondation correspond la rencontre de


deux cellules haplodes
afin de former une celluleuf diplode.
La cellule-uf possde ainsi, dans le cas
tudi, trois types de
chromosomes en deux
exemplaires, soit 2n =
6 chromosomes. Chez les
organismes haplodes,
la phase diplode est
rduite la cellule-uf
(schma 2).

2 chromatides

Au cours de la mtaphase I, les chromosomes homologues de chaque paire se disposent face face de
part et dautre du plan quatorial de la cellule. Lors
de lanaphase I chaque paire dhomologues se spare
et chaque chromosome migre un ple de la cellule
(schma 4).

migration des chromosomes


sparation des homologues

4 cellules n = 3 chromosomes 1 chromatide


Schma 7 : tlophase II de 2e division de miose.

Conclusion
Schma 5 : tlophase I de 1re division de miose.

Ici, chaque cellule possde trois chromosomes deux


chromatides chacun.

Chez les organismes phase haplode prdominante,


la fcondation aboutit la formation dune cellule-uf
diplode. La premire division de miose est rductionnelle et permet le retour lhaplodie. Les cellules
nont plus quun chromosome de chaque paire, soit n
chromosomes. Le caryotype de lespce est conserv.

SUJET TOMB AU BAC SUR CE THME


Restitution de connaissances

II. La miose
La miose est prcde
de la duplication de

Variation de la quantit dADN au


cours du cycle cellulaire.
La mitose permet une cellule de
transmettre la totalit de son information gntique, cest--dire
son ADN, ses deux cellules-filles.
Ce partage suppose, quavant de
se diviser, la cellule double sa
quantit dADN.
Cette duplication a lieu au cours de
la phase S (synthse) de linterphase.
Cette phase S suit une phase de
croissance de la cellule, nomme
phase G1, et prcde une seconde
phase de croissance, plus courte,
nomme phase G2. Lors de la mitose, la quantit dADN diminue de
moiti par cellule en raison du partage du matriel gntique entre les
deux cellules-filles. Ainsi, la quantit
dADN par cellule reste constante au
cours du cycle cellulaire.

ZOOM SUR...
Le cycle de dveloppement de deux
algues.

Le plan dtaill du dveloppement


I. La fcondation
Les organismes haplodes ont un caryotype n
chromosomes une chromatide (schma 1).

REPRE

Miose et fcondation chez un diplode et trisomie 21. (Sujet national, septembre 2004)
Schma 4 : anaphase I de 1re division de miose.

t -B TQJSPHZSF FTU VOF BMHVF WFSUF


deau douce dont les chloroplastes
ont une forme spirale. Elle est
constitue de filaments pluricellulaires non-ramifis de sexe mle ou
femelle. Les filaments de sexe opposs peuvent sapparier et former un
tube. Le contenu de la cellule mle se
dirige vers le contenu de la cellule
femelle. Cytoplasme et noyau fusionnent pour donner un uf qui
est libr par dgnrescence du
filament. Aprs un hiver en vie ralentie, luf subit une miose pour
donner quatre spores. Seule une
donnera naissance un nouveau
filament, les trois autres dgnrent.
t -F GVDVT FTU VOF BMHVF CSVOF
vivant en eau de mer. Il existe des
individus ou pieds mles et
des individus femelles. maturit
sexuelle, des gamtes sont forms
dans des renflements situs aux
extrmits de chaque pied. Les
spermatozodes et les ovules sont
librs dans leau de mer o a lieu
la fcondation. La cellule-uf
forme se fixe sur un support et
forme un pied mle ou femelle par
divisions successives.

Stabilit et variabilit des gnomes (Term)

73

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

UN SUJET PAS PAS

L' ARTICLE DU

Ren Frydman : La fcondation en prouvette


est le symbole dune grande transgression

omment accueillez-vous
ce Nobel ?
Avec une grande satisfaction. Bob Edwards a toujours t
quelquun de chaleureux, de jovial
mme, et il avait surtout un esprit
douverture assez sidrant. Penser
la possibilit des cellules souches
ds 1965, il fallait le faire ! Il tait trs
en avance sur le plan scientifique,
et il a toujours soutenu les jeunes
chercheurs. Quand je suis venu le
voir en 1977, il ma tout de suite
donn des conseils pour commencer travailler. Cest donc tout un
parcours qui est reconnu avec ce
prix Nobel. Un prix qui, je trouve,
arrive un peu tard.
Pourquoi si tard ?
Parce que la fcondation in
vitro, et toutes les techniques qui
en ont driv, a toujours suscit
beaucoup de rticences. Encore
aujourdhui, les dveloppements
de la procration mdicalement
assiste, dont certains ne sont
dailleurs pas toujours justifis,
continuent de sentir le soufre.
Ce qui tait invisible est devenu
visible, ce qui tait intouchable
est devenu touchable : en cela, la
fcondation en prouvette constitue le symbole dune grande
transgression humaine. Au fil des

74

dcennies, selon sa religion ou


sa philosophie, cette transgression est devenue plus ou moins
admise. Mais elle reste prsente.
Comment expliquez-vous la
pugnacit dont Robert Edwards
a fait preuve ?
Je crois quil tait anim dune
conviction profonde : aider les
couples infertiles, cela lui importait vraiment. De plus, il tait
fascin par les mcanismes quil
essayait de matriser. Lorsquil
tentait ses premires fcondations in vitro avec Patrick Steptoe, le gyncologue de la bande,
celui-ci faisait ses prlvements
dovules dans un hpital qui
tait 50 km du laboratoire. Or,
lpoque, les ovulations ntaient
pas stimules par traitement.
Elles pouvaient se produire jour
et nuit, et il fallait donc, jour et

nuit, courir lhpital prlever un


ovule, puis le rapporter durgence
Cambridge Ctait une vraie saga !
En 1978, vous tiez prsent au colloque o a t annonce la naissance imminente de Louise Brown,
premier bb au monde avoir t
conu en prouvette
Ctait un grand colloque de gynco-obsttrique, et lorsque Bob
Edwards a fait cette prsentation,
personne narrivait y croire ! Alors
que ctait le dbut dune fabuleuse
aventure ! Quatre ans plus tard,
je lai retrouv un congrs sur la
reproduction humaine, avec une
centaine de participants. Il a alors
lanc lide de crer une association
europenne de mdecins, qui aurait
son propre journal : cest devenu
Human Reproduction, et le dernier
congrs quivalent celui de 1982 a
runi peu prs 7 000 participants

Compte tenu des lgislations qui


encadrent la recherche sur les
embryons humains, les travaux
qui ont abouti la naissance de
Louise Brown et dAmandine seraient-ils possibles aujourdhui ?
Je ne le crois pas. lpoque,
il nous suffisait davoir laccord
de notre chef de service, mile
Papiernik ! Nous travaillions,
certes, contre vents et mares,
nous avions rpondre lopposition de lglise catholique et
celle de certains scientifiques,
mais il ny avait pas dinterdit.
Aujourdhui, je ne pense pas
que lesprit soit suffisamment
louverture et linnovation pour
quun tel progrs soit possible. La
philosophie de Bob Edwards nest
pas dactualit.
Propos recueillis par C. V.
(6 octobre 2010)

POURQUOI CET ARTICLE ?


Ren Frydman rend hommage son collgue, le professeur Edwards, qui a permis grce la FIV le
traitement de la strilit de nombreux couples.
Le professeur Frydman met en exergue les obstacles, philosophiques ou religieux, lis aux recherches
sur la fcondation. Lintervention humaine sur la fcondation et la manipulation dembryons
constituent des sujets dthiques toujours dactualit. Pour lui la fcondation in vitro est le symbole
dune grande transgression .

Stabilit et variabilit des gnomes (Term)

LE SYSTME
IMMUNITAIRE (TERM)

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Ren Frydman, chef du service de gyncologie-obsttrique de lhpital Antoine-Bclre


(AP- HP) est, avec le biologiste Jacques Testart, le pre scientifique dAmandine, premier bb-prouvette franais n en 1982.

CHIFFRES CLS
Le Sida en France.
tQFSTPOOFTPOUEWFMPQQ
un Sida depuis le dbut de lpidmie dans les annes 1980.
tNBMBEFTUBJFOUUPVKPVST
vivants fin 2009.
tDBTEFSida ont t diagnostiqus sur lanne 2009 ; 73 % de ces
nouveaux cas taient des hommes,
gs en moyenne de 43,2 ans.
t   BOT FTU MHF NPZFO EF MB
dcouverte de la sropositivit.

PERSONNAGE
IMPORTANT
Luc Montagnier
N en 1932, Luc Montagnier est un
biologiste virologue franais. Il est
colaurat du prix Nobel de mdecine avec Franoise Barr-Sinoussi
pour la dcouverte, en 1983, du VIH.
Ses travaux ont permis de mieux
connatre linfection par le virus et
de mettre en place des traitements
pour les malades.
Professeur mrite lInstitut
Pasteur, entre autres, il est actuellement directeur du nouvel Institut
de recherche en Chine Shanghai
o il poursuit ses recherches. Il
a publi plusieurs ouvrages dont
Le Virus et les hommes et Sida et
socit franaise, en 1994.

ZOOM SUR
La fixation et la pntration cellulaire du VIH.
Les virus sont des parasites se dveloppant dans les cellules. Dpourvus
de mtabolisme, donc incapables de
se multiplier de faon autonome,
ils dtournent la machinerie de
biosynthse des cellules infectes
de telle sorte quelles produisent
de nouvelles particules virales. Les
virus ont des tailles extrmement
rduites (de quelques nm quelques
centaines de nm). Le VIH infecte
les cellules-cibles, en particulier les
lymphocytes T4, en se liant des
protines de surface puis en pntrant dans la cellule par endocytose.

76

LESSENTIEL DU COURS

Le Sida, une maladie du systme


immunitaire

es organismes sont en permanence exposs aux agressions


de multiples agents infectieux virus, bactries, champignons et parasites animaux mais le systme immunitaire
permet en gnral de les liminer. En outre, les vaccins augmentent son efficacit en le stimulant artificiellement. Cependant,
lexemple du virus de limmunodficience humaine (VIH) montre
que le systme immunitaire nest pas infaillible puisque ce virus
est responsable du syndrome dimmunodficience acquise (ou
Sida), une maladie mortelle pour laquelle il nexiste encore aucun
vaccin efficace.

Un virus
Un virus est un parasite intracellulaire obligatoire. Il
est form dun acide nuclique (ADN ou ARN), entour
dune enveloppe protique et parfois dune membrane
plasmique provenant de la cellule-hte. Tous les
virus sont de trs petite taille, de quelques nm pour
les plus petits 200 nm environ pour les plus grands.
Dpourvus dorganites et de mtabolisme, les virus ne
sont pas considrs comme des tres vivants : ce sont
des acaryotes. Ils ne peuvent donc pas se multiplier par
eux-mmes et dtournent leur profit le fonctionnement de la cellule-hte. Leur information gntique
est transcrite puis traduite en protines virales par la
cellule infecte. En sassemblant, ces protines donnent
naissance des particules virales, les virions, qui
peuvent infecter de nouvelles cellules. De nombreux
virus sont lorigine de maladies humaines, souvent
pidmiques. Ainsi, la fin du vingtime sicle, plus de
33 millions dtres humains dans le monde, dont plus
de 95 % vivant dans des pays en voie de dveloppement,
taient porteurs du VIH, et plus de 16 millions de
personnes taient dcdes du Sida depuis le dbut de
lpidmie. En France, plus de 50 000 cas de Sida ont
t dclars dans la mme priode et entre 21 000 et
23 000 personnes vivent aujourdhui avec linfection.

ces protines aux cellules cibles, comme les lymphocytes T4, qui permet la pntration du virus.

Schma structurel du VIH.

La multiplication du VIH
Le VIH peut pntrer dans les cellules-cibles lorsquil se lie
par sa protine de surface gp120 au rcepteur CD4, une
protine membranaire notamment prsente la surface
des lymphocytes T4, des monocytes et des macrophages.
Cependant, laction dautres protines est requise pour
que lenveloppe virale puisse fusionner avec la membrane
plasmique de la cellule et que le virus puisse entrer.

Les caractristiques du VIH


Le VIH (virus de limmunodficience humaine) est un
rtrovirus, cest--dire un virus dont lacide nuclique
est un ARN. Les virions du VIH ont une forme sphrique
dont le diamtre mesure environ 100 nm. Chaque virion
possde deux molcules dARN identiques qui portent
linformation gntique du virus, des enzymes ncessaires lexpression de cette information (transcriptase
inverse, protase, intgrase) et diverses protines de
structure qui constituent la capside (contenant lARN
et la transcriptase inverse) et la matrice qui lentoure.
La matrice est enveloppe par une membrane plasmique provenant de la cellule-hte et dans laquelle
sont ancres des protines gp120. Cest ladhsion de

Le systme immunitaire (Term)

LARN du VIH, libr dans le cytoplasme, est rtrotranscrit en ADN par lenzyme virale nomme
transcriptase inverse. Le transcrit passe ensuite
dans le noyau o il sintgre lADN de la cellule-hte
sous laction de lenzyme virale appele intgrase. Il
peut ds lors rester intgr pendant plusieurs annes
dans lADN hte sous forme de provirus.
Lactivation de la transcription des gnes viraux est
souvent lie ltat dactivation de la cellule-hte.
Les ARN messagers viraux passent alors dans le cytoplasme o la traduction en protines virales se ralise
aux dpens de la machinerie de protosynthse de
la cellule-hte (ribosomes, ARNt, enzymes, etc.). La
protase du virus clive ensuite les protines noformes. Les protines sassemblent avec lARN viral
pour former de nouveaux virions qui bourgeonnent
et se dtachent de la cellule-hte. Cette dernire finit
par en mourir.

Le droulement de la primoinfection par le VIH


Le VIH se transmet uniquement par voies sexuelle
et sanguine, y compris de la mre son ftus. Les
principales cellules-cibles du VIH lymphocytes T4,
monocytes et macrophages appartiennent au systme immunitaire et se concentrent dans les ganglions
lymphatiques.
Lorsquun agent infectieux comme un virus pntre
dans lorganisme, le systme immunitaire produit
des cellules et des molcules destines le neutraliser.
Dans le cas du VIH, on observe une phase de latence de
quelques jours, suivie de lapparition et de la multiplication rapide des particules virales dans le sang.
Cette augmentation de la concentration virale (virmie)
rvle que la rplication du virus chappe au contrle
du systme immunitaire ; il sagit de la primo-infection.
Cette phase ne se manifeste souvent que par de discrets
symptmes cliniques voquant une infection bnigne.
Des anticorps apparaissent ensuite dans le sang avec
un dlai de deux trois mois (sroconversion) et
leur prsence (sropositivit) permet de dtecter la
contamination. Des lymphocytes spcialiss dans

TROIS ARTICLES DU MONDE


CONSULTER
t-FTOPVWFBVYDBTEFTSPQPTJUJWJU
en hausse en France p. 79
(Paul Benkimoun, 1er dcembre 2010)

t-FTFOGBOUTEFTQBZTMFTQMVTQBVWSFT
sont les grands oublis de la lutte
contre le Sida p. 79-80
(Paul Benkimoun, 19 aot 2011)

t6ODIFWBMEF5SPJFQPVSNJFVYBDIFWFS
le VIH p. 80
(Paul Benkimoun, 28 mai 2011)
Cycle rplicatif du VIH.

la destruction des cellules infectes (lymphocytes T


cytotoxiques) apparaissent galement. Lactivation du
systme immunitaire se traduit par un gonflement des
ganglions lymphatiques. La concentration des anticorps
anti-VIH augmente ensuite progressivement et se
maintient un taux lev.

Lvolution de l'infection au cours


du temps
Les rponses immunitaires dclenches lors de la
primo-infection font diminuer rapidement la virmie et conduisent une phase asymptomatique de
linfection qui peut durer plusieurs annes. Chez 5 %
des personnes infectes, cette phase dure mme plus
de 10 ans.
Toutefois, comme lactivation des cellules immunitaires dpend troitement des messagers chimiques
mis par les lymphocytes T4, la destruction de ces derniers par le virus entrane une dficience progressive
du systme immunitaire. Si aucun traitement antirtroviral nest entrepris, la concentration en lymphocytes T4 diminue tandis que la charge virale augmente.
concentration
lymphocytes CD4
anticorps
lymphocytes cytotoxiques

charge virale

semaines
primoinfection
dclenchement
des rponses
immunitaires

mois

annes
phase
asymptomatique

contrle de la
virmie par le
systme immunitaire

annes

temps

phase
asymptomatique
(Sida)
effondrement du
systme immunitaire

volution du systme immunitaire et de la charge virale la


suite dune infection par le VIH.

La phase symptomatique, ou Sida dclar, apparat


quand diverses maladies se dveloppent en raison
de la disparition des dfenses immunitaires. Il sagit
dinfections opportunistes et daffections cancreuses
qui conduisent la mort des patients. Ainsi, le caractre
essentiel des lymphocytes T4 dans les mcanismes immunitaires est rvl par les consquences mortelles de
linfection par le VIH. Il est possible dentraver la progression du virus par divers mdicaments antirtroviraux
(il en existe une vingtaine aujourdhui) agissant sur des
cibles varies du cycle viral. Actuellement, on utilise surtout des inhibiteurs des enzymes virales, notamment
des inhibiteurs nuclosidiques et non nuclosidiques
de la transcriptase inverse, et des inhibiteurs de la
protase, dont des combinaisons varies (trithrapies)
permettent le plus souvent de limiter considrablement
la rplication virale. De trs nombreuses autres molcules
sont galement en cours de dveloppement. Quant
aux maladies opportunistes, elles peuvent tre combattues par les mthodes thrapeutiques classiques.

ZOOM SUR
Les diffrents types de virus.
t *M FYJTUF EFVY HSBOET UZQFT EF
virus en fonction de la nature du
matriel gntique :
les virus ADN (hpatite A, herps, etc.) ;
les virus ARN rtrovirus (VIH,
hpatite B, etc.).
t -FT WJSVT EPJWFOU VUJMJTFS MJOGPSmation gntique de la cellule parasite pour raliser les synthses protiques ncessaires la production
des particules virales. Ainsi, les virus
ARN doivent transcrire leur ARN en
ADN lors dune rtrotranscription
afin dintgrer leur matriel gntique dans celui de la cellule-hte.
Deux types de tests.
t -F UFTU &MJTB Enzyme linked immuno sorbent assay).
Ce test consiste dtecter la prsence dans le sang danticorps
anti-VIH en utilisant dautres anticorps spcifiques, anti-anticorps
anti-VIH. Plusieurs tapes sont
ncessaires :
dpt de srum dans un support
alvol contenant des antignes
du VIH. Si le srum contient des
anticorps anti-VIH, ces derniers se
fixent sur les antignes ;
les plaques sont laves pour liminer les autres anticorps ;
on ajoute des anticorps anti-anticorps marqus par une enzyme qui
dclenche une raction colore en
prsence dun substrat prcis. Plus
la coloration est intense, plus le
taux danticorps est lev.
Ce test nest pas fiable 100 % et
les rsultats doivent tre complts
par dautres tests.
t-FUFTU8FTUFSO#MPU
Le srum dun autre prlvement est
mis incuber sur une bandelette sur
laquelle les antignes de diffrentes
protines du virus du Sida ont t
positionns et spars en fonction de
leur masse molculaire. La bandelette
test est compare une bande tmoin
ngatif et une bande tmoin positif.
Si des anticorps sont prsents dans le
srum, ils se fixent sur la bandelette.
Aprs lavage, des anticorps anti-anticorps anti-VIH marqus se fixent sur
les prcdents, provoquant une coloration permettant de les reprer.

Le systme immunitaire (Term)

77

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

La transmission du virus du Sida.


t-BUSBOTNJTTJPOEVSida a lieu :
lors de rapports sexuels (80 % des
cas). Prvention par utilisation de
prservatifs masculin ou fminin ;
lors dune contamination par le
sang (transfusion sanguine, seringue contamine). Prvention par
utilisation de matriel strile et
usage unique ;
de la femme enceinte lenfant, lors
de la grossesse, laccouchement ou
lors de lallaitement. Dans les pays
industrialiss, les traitements ont
permis de rduire le risque de la
transmission lenfant de 30 %
5 %. Prvention par prise en charge
mdicale pendant la grossesse, naissance par csarienne, utilisation
de lait artificiel exclusivement en
remplacement du lait maternel et
traitement post-natal de lenfant.
t%FGBVTTFTDSPZBODFTQFSTJTUFOU
sur la transmission du virus. Il
ne peut pas se transmettre par :
la salive, la sueur, les larmes, les
piqres dinsectes, le toucher
(contact avec la peau).

DATES CLS
La recherche sur le Sida.
tIdentification du virus
tExprimentation de lAZT,
premire molcule anti-VIH visant
ralentir la rplication du virus.
tMise sur le march de lAZT.
tDcouverte dune nouvelle
famille de mdicaments, les antiprotases.
tMise au point des trithrapies
incluant des antiprotases. Diminution de la mortalit de 25 % en France.
tPremiers essais en immunothrapie par interleukine 2 pour
stimuler le systme immunitaire.
tMise sur le march dune
nouvelle molcule T-20, inhibiteur
de fusion, visant empcher le
virus de rentrer dans la cellule.
tRalisation dun deuxime
inhibiteur de fusion, t-1243, de plus
grande efficacit et ncessitant
une seule injection par jour. Sa
production a t arrte.
Les essais vaccinaux se poursuivent
la fois pour des vaccins prventifs
et pour des vaccins thrapeutiques.

78

Restitution de connaissances :
Rponse de lorganisme une
infection par le VIH
Lintitul complet du sujet
Linfection par le VIH se manifeste par la prsence danticorps anti-VIH : lindividu est dit sropositif pour le VIH.
Aprs avoir expos la structure des anticorps circulants, expliquez leur production en rponse
linfection par le VIH.
Votre expos sera structur par une introduction, un
dveloppement et une conclusion, et comportera un
schma de la structure des anticorps.

Lanalyse du sujet
Il sagit dexpliquer que la sropositivit dun individu
est dtecte par la prsence danticorps sriques dont la
fabrication a t dclenche par linfection par le VIH.

La problmatique
Comment linfection par le VIH dclenche-t-elle la
fabrication danticorps par lorganisme ?

Le plan dtaill du dveloppement


I. La structure des anticorps circulants
Les anticorps ou immunoglobulines sont des protines
formes par lassemblage de quatre chanes polypeptidiques deux deux identiques : deux chanes lourdes
et deux chanes lgres , qui sont relies entre elles
par des ponts disulfures. Chaque chane possde une
rgion constante et une rgion variable dont la squence
dacides amins varie dun anticorps lautre.

Schma dun anticorps circulant.

Le systme immunitaire (Term)

Ce quil ne faut pas faire


Traiter de la destruction des cellules infectes.

Un anticorps possde deux sites de fixation un antigne


forms par lassociation des extrmits variables dune
chane lourde et dune chane lgre ayant une conformation spatiale complmentaire de celle dun antigne. Telle
est la spcificit de lanticorps. Du ct des extrmits
constantes des chanes, il existe un site de fixation des
rcepteurs membranaires des cellules phagocytaires.
II. La production des anticorps circulants (coopration
cellulaire)
a) Les lymphocytes B et le rpertoire immunologique
de lorganisme
Chaque lymphocyte B porte sa surface des rcepteurs membranaires ou anticorps membranaires
identiques.
Les lymphocytes qui portent les mmes anticorps
forment un clone. Les diffrents clones forment le
rpertoire immunologique de lorganisme. Chaque
clone est capable de reconnatre un antigne ds son
entre dans lorganisme.
b) La slection clonale
Un lment tranger porteur dantignes est dtect
par les lymphocytes B dont les anticorps membranaires peuvent se fixer ses antignes. Ceux-ci sont
slectionns et activs.
c) La ncessit des lymphocytes T4
Certains LT4, porteurs de rcepteurs T spcifiques
peuvent reconnatre les antignes viraux. Ils sont
slectionns et subissent une expansion clonale puis
scrtent les interleukines.
d) Les plasmocytes et la production danticorps
solubles
Les lymphocytes B activs acquirent des rcepteurs
interleukine et prolifrent (lexpansion clonale). Puis
les cellules se diffrencient en plasmocytes scrteurs
danticorps.

SUJETS TOMB AU BAC SUR CE THME


Restitution de connaissances
La sropositivit. (Sujet national, juin 2005)

tudes de documents
Diagnostic dune sropositivit au VIH chez des nouveau-ns.
(Nouvelle-Caldonie, septembre 2009)
Le dpistage du Sida. (Sujet national, juin 2009)
Mesure du risque de survenu dun Sida dclar. (Pondichry, avril 2010)

Conclusion
Les anticorps circulants produits
sont le rsultat dune coopration
cellulaire entre lymphocytes B
et lymphocytes T4. Ils vont former avec les antignes viraux des
complexes antignes-anticorps
appels complexes immuns. Ceux-ci
sont ensuite limins par phagocytose
selon des mcanismes propres limmunit non spcifique.

Les nouveaux cas de sropositivit en


hausse en France
Environ 6 700 personnes se sont dcouvertes contamines par le virus du Sida en 2009.

n France, en 2009, le nombre


de nouveaux cas de sropositivit est estim environ
6 700, selon le dernier Bulletin pidmiologique hebdomadaire, publi
mardi 30 novembre par lInstitut de
veille sanitaire (InVS). Un chiffre en
lgre augmentation par rapport
2008, quand 6 400 nouveaux cas
avaient t identifis. Cette ten-

POURQUOI
CET ARTICLE ?
Ce bilan de lvolution
de lpidmie du VIH en
France, en 2009, montre
une augmentation des
cas de sropositivit, par
rapport 2008. Environ
50 000 personnes seraient
infectes mais ne le sauraient pas.
Le VIH, malgr les progrs
mdicaux raliss, reste une
menace srieuse.

dance se retrouve surtout chez les


hommes homosexuels.
Selon les donnes prsentes
par lInVS, environ 4 000 sropositivits ont t dcouvertes chez
des personnes ayant des rapports
htrosexuels, dont 1 600 femmes
et 1 100 hommes ns ltranger
et 750 hommes et 500 femmes ns
en France. De plus, 85 usagers de
drogues injectables ont dcouvert
leur sropositivit en 2009.
Dans 30 % des cas, linfection tait
rcente ; 28 % des personnes ayant
dcouvert leur sropositivit en 2009
prsentaient des signes datteinte importante des dfenses immunitaires.
Chez les hommes contamins
par des rapports homosexuels, la
proportion des moins de 25 ans sest
accrue entre 2003 et 2009, passant
de 8 % 11 %. Alors quen 2007 et
2008, le nombre de dcouvertes
de sropositivit chez les hommes
contamins par des rapports homosexuels stait stabilis autour de
2 300, le passage 2 500 en 2009 est
statistiquement significatif.

Le nombre de nouveaux diagnostics de Sida, stade le plus


avanc de linfection par le VIH,
continue de dcrotre, avec environ 1 450 cas, soit 10 % de baisse
par rapport 2008. Les rsultats
les plus proccupants concernent
la contamination lors de rapports
homosexuels, groupe dans lequel
le nombre de nouveaux cas de
Sida augmente de 6 % entre 2008
et 2009.

Rpartition ingale
Sur le plan national, le nombre
de dcouvertes de sropositivit
est de 103 cas par million dhabitants. La rpartition gographique
est trs ingale, avec une prdominance de lle-de-France (263 cas
par million) et des dpartements
franais dAmrique : 183 pour la
Martinique, 418 pour la Guadeloupe et 1 378 pour la Guyane.
Dans lditorial du Bulletin pidmiologique hebdomadaire, France
Lert et Gilles Pialoux, auteurs dun
rcent rapport sur les nouvelles

mthodes de prvention , rappellent que le nombre de personnes


en France qui ne se savent pas infectes par le VIH est estim environ 50 000. Les deux chercheurs
trouvent dans ces derniers chiffres
des justifications supplmentaires
aux innovations du nouveau plan
de lutte contre le VIH, prsent
en novembre par le ministre de
la Sant : incitation au dpistage
linitiative des mdecins gnralistes, incitation un dpistage
rgulier, annuel, dans les groupes
de forte prvalence de linfection.
Dans ce plan, il est galement
propos un dpistage communautaire lintention des
hommes ayant des rapports
sexuels avec dautres hommes .
Des recherches sont en cours sous
lgide de lAgence nationale de recherches sur le Sida et les hpatites
(ANRS) pour valuer limpact dun
tel dpistage.
Paul Benkimoun
(1er dcembre 2010)

Les enfants des pays les plus pauvres sont


les grands oublis de la lutte contre le Sida
Plus de mille enfants sont infects chaque jour dans le monde, des experts dnoncent
la passivit des laboratoires et linadquation des traitements

e Sida chez les enfants peut


tre considr comme une
maladie nglige. Dans
les pays riches, lutilisation des
mdicaments antirtroviraux
au moment de laccouchement a
virtuellement fait disparatre les
cas de naissance denfants porteurs du VIH. En revanche, dans
le reste du monde, en particulier
lAfrique subsaharienne et lAsie,
plus de mille enfants sont nou-

vellement infects chaque jour


et 700 meurent de complications
lies au Sida.
Et plus des deux tiers de ceux
qui auraient besoin dun traitement ne reoivent pas les mdicaments ncessaires. Cest un
dsastre, mais les pays du Sud
ne constituent pas un march
solvable : cest le constat que
dressent quatre responsables
de la fondation DNDi (Initiative

mdicaments pour les maladies


ngliges) dans ldition du New
England Journal of Medicine du
jeudi 18 aot. La prvention de
lacquisition du VIH par les antirtroviraux est indispensable, mais
elle nest pas mise en uvre
lchelle ncessaire. La population
infantile touche ne va cesser de
saccrotre , sinquite le directeur excutif de DNDi, Bernard
Pcoul, un des auteurs de larticle.

Un bilan dress fin 2010 par


lOrganisation mondiale de la
sant (OMS) montre que, dans les
pays pauvres, un quart seulement
des femmes enceintes ont subi
un test de dpistage du VIH et
que seulement la moiti de celles
dont on dcouvre la sropositivit
reoivent une prophylaxie par
les antirtroviraux. Quant au
dpistage chez les enfants, il est
trop tardif.

Le systme immunitaire (Term)

79

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

REPRES

LES ARTICLES DU

Rsistance
la molcule
LOMS recommande pourtant de
traiter les enfants de moins de 2 ans
ds la dcouverte de leur sropositivit. Mais la scurit et le dosage
adquats de beaucoup des agents
antirtroviraux-cls employs chez
ladulte nont pas encore t tablis
chez lenfant, en particulier au sein
des groupes dges les plus jeunes, et
les formulations appropries nexistent tout simplement pas pour eux ,
crivent les responsables de DNDi.
De plus, la mise en uvre des traitements pdiatriques, lorsquils sont
disponibles, est complexe : rsistance
la molcule massivement utilise
pour prvenir la transmission du VIH
lenfant, utilisation pour des formes
buvables dun solvant compos
40 % dalcool, got dsagrable
Sollicits par Mdecins sans
frontires comme par le dispositif
international Unitaid le principal
acheteur de mdicaments anti-VIH
pdiatriques , rappelle Bernard
Pcoul , les responsables de DNDi

POURQUOI
CET ARTICLE ?
Cet article soulve le problme
du traitement des enfants infects par le virus du Sida lors
de la grossesse.
En Afrique subsaharienne et
en Asie, les mres sropositives
ne reoivent pas de traitement
comme dans les pays dvelopps, et on estime que 1 000 enfants sont infects chaque
jour.

se sont attels mettre au point


un traitement simple, si possible
prendre une seule fois par jour,
sous des formes faciles utiliser
et conserver. Il ne faut pas tout
rinventer, mais tudier les mdicaments existants et revoir les
formulations , souligne M. Pcoul.
Outre les contacts avec lOMS,
lOnusida et l'Unitaid, DNDi a
identifi des partenaires pour

LES ARTICLES DU

LOMS a montr que dans les


pays pauvres, seulement :
un quart des femmes enceintes sont dpistes ;
la moiti des femmes
sropositives sont traites par
des rtroviraux pendant leur
grossesse ;
un tiers des enfants infects
sont traits.
Le problme concernant le soin
des nourrissons est labsence de
traitements pdiatriques.
Plusieurs organismes travaillent

travailler sur ce projet : lAgence


nationale de recherches sur le Sida
et les hpatites (ANRS) en France,
les Instituts nationaux amricains de la sant, le Conseil de la
recherche mdicale britannique
Nous avons galement approch plusieurs industriels, mais
nous navons pas encore daccord
sign avec eux. La Communaut
de brevet, rcemment cre par

dans ce sens mais la lutte contre


la contamination par le VIH doit
tre mondiale et lon ne peut
faire lconomie de traitements
pour une grande partie des populations.
Dans certains sujets de restitution des connaissances ou dans
des questions o lon fait appel
votre rflexion, vous serez amens aborder les traitements
des sropositifs. Les donnes
proposes ici vous permettent
dtoffer vos devoirs.

Unitaid et laquelle participe dj le


laboratoire amricain Gilead, devrait
faciliter les choses , espre Bernard
Pcoul. Celui-ci pointe cependant
une dimension souvent oublie : si
la prvention et le traitement des enfants sont impratifs, celui des mres
sropositives ne lest pas moins.
Paul Benkimoun
(19 aot 2011)

Un cheval de Troie pour


mieux achever le VIH

POURQUOI
CET ARTICLE ?
Cet article explique les dernires
dcouvertes des chercheurs
concernant linfection par le VIH
qui pourraient permettre la mise
au point de traitements pour bloquer la rplication du virus. Il est
intressant pour les lves qui
souhaitent aller plus loin dans
leurs connaissances puisquil
aborde des aspects non-traits
par le programme.
Les chercheurs ont dcouvert une
protine, la SAMHD1, vritable
facteur de restriction intracellulaire du VIH.

la voie linfection des cellules


dendritiques et donc une rponse
immunitaire renforce, ce qui
ne se produit pas avec le VIH1 ,
prcise M. Benkirane.
Ces travaux, soutenus par
lAgence nationale de recherches
sur le Sida et les hpatites (ANRS),
le Sidaction, la Fondation pour la
recherche mdicale et le Conseil

Les cellules dendritiques ont un


rle cl dans le dclenchement
de la rponse immunitaire spcifique en prsentant les antignes
viraux aux lymphocytes T. Or, il
apparat que le VIH1 ninfecte pas
les cellules dendritiques contrairement au VIH2, donc la rponse
immunitaire ne peut pas tre
totale avec le VIH1. Le VIH2 exprime une protine virale (et non
le VIH1) qui induit la dgradation
de la protine SAMHD1. Cette dgradation permet linfection des
cellules dendritiques donc une
rponse immunitaire renforce.
Certains individus dits contrleurs dlite sont infects par

europen de la recherche, fournissent une hypothse expliquant


le phnomne des contrleurs
dlite , des individus chez qui la
rplication du VIH reste bride,
avec un virus indtectable dans
le sang, comme si linfection ne
se dclenchait pas. Ces personnes
pourraient porter une mutation
gntique leur faisant exprimer

le virus mais celui-ci nest pas


dtectable dans le sang et la rplication du virus est empche.
Il semblerait quune mutation
gntique est responsable de
lexpression dun facteur de restriction intracellulaire du virus.
Les chercheurs esprent agir
sur lexpression de la protine
SAMHD1 par les cellules cibles du
VIH1 afin de stimuler les dfenses
immunitaires.
Ce texte montre que les travaux
sur le virus du sida sont complexes en raison de nombreuses
interfrences de molcules pour
le fonctionnement du systme
immunitaire.

le facteur de restriction intracellulaire.


Surtout, ces recherches font
entrevoir des stratgies pour
empcher la rplication du VIH.
Monsef Benkirane et ses collgues
ont mis en place des collaborations
avec plusieurs autres quipes afin
dexplorer in vitro et sur des modles animaux (souris humanises,

primates) les possibilits dexpression de la protine SAMHD1 par


les cellules cibles par le VIH1.
La protine SAMHD1 apparat
comme un antiviral naturel efficace,
commente le professeur Yves Lvy,
chef du service dimmunologie
clinique lhpital Henri-Mondor
(Crteil). On peut imaginer de favoriser la diffrenciation de cellules
souches dun individu infect en
cellules sanguines exprimant cette
protine, afin de bloquer la rplication du VIH1 et de reconstituer le
systme immunitaire.
Yves Lvy estime galement que
ces travaux ouvrent la perspective
de pouvoir agir sur les rservoirs
dans lesquels le VIH persiste au sein
de lorganisme mme lorsquil est
devenu indtectable dans le sang.
Lquipe du professeur Lvy et celle
de la prix Nobel Franoise Barr-Sinoussi lInstitut Pasteur participent
aux programmes de recherche sur
des modles animaux en collaboration avec Monsef Benkirane et ses
collgues.
Paul Benkimoun
(28 mai 2011)

Des chercheurs franais dcrivent un mcanisme exprimental pour bloquer trs tt la


rplication du virus du Sida.

est une perce importante


dans la connaissance du
droulement de linfection
par le VIH, mais aussi louverture
dune piste pour empcher la rplication du virus. Elle sappuie
sur un paradoxe apparent : rendre
plus vulnrables les cellules en premire ligne lors de linfection pour
amliorer dans un second temps
la rponse immunitaire. Plusieurs
quipes du CNRS ont mis en vidence lexistence dune protine,
SAMHD1, qui limite linfection
par le VIH1 des toutes premires
cellules du systme immunitaire
quil rencontre, mais qui, de ce fait,

80

ne dclenche pas une raction de


dfense optimale. Leur article a
t publi jeudi 25 mai par la revue
Nature.
Monsef Benkirane (Institut de
gntique humaine, Montpellier)
et ses collgues se sont intresss
aux cellules dendritiques. Elles sont
charges de dclencher les dfenses
immunitaires, avec la fois une
rponse inne, non spcifique de
lintrus, et une rponse adaptative
ciblant le virus. Pour cette dernire,
les cellules dendritiques prsentent des lments distinctifs
de lagent tranger ses antignes
dautres cellules du systme

Le systme immunitaire (Term)

immunitaire, les lymphocytes T.


Lors de linfection par le VIH1, le
type le plus prsent dans le monde,
ce virus du Sida ninfecte pas les cellules dendritiques, ce qui empche
une rponse immunitaire spcifique
optimale. linverse, dans le cas du
VIH2, surtout prsent en Afrique de
lOuest et moins contagieux, comme
dans lquivalent du VIH chez les
singes (SIV), linfection des cellules
dendritiques est complte.
Cela rsulte de lexpression par
le VIH2 dune protine virale que
nexprime pas le VIH1. Nous avons
donc voulu savoir si, en exposant
des cellules dendritiques cette

protine, nous les rendrions permissives linfection par le VIH1.


Lide serait damliorer la rponse
immunitaire spcifique en agissant
trs tt lors de la primo-infection.
Les cellules ainsi modifies seraient
rinjectes au patient comme lors
dune greffe autologue , rsume
Monsef Benkirane.
Les chercheurs du CNRS sont
parvenus identifi une protine
cellulaire, le SAMHD1 , dont la
protine virale induit la dgradation.
SAMHD1 fait partie des facteurs
de restriction intracellulaire du
VIH, permettant de contrler
linfection. Sa dgradation ouvre

Le systme immunitaire (Term)

81

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LES ARTICLES DU

MOTS CLS
IMMUNODFICIENCE
Dfaut de lorganisme dans sa
capacit produire une rponse
immunitaire effective. Elle peut
tre due une destruction des
lymphocytes T4 par le virus du
Sida ou des anomalies gntiques qui empchent la production des lymphocytes.

IMMUNOSUPPRESSION
Perte de la capacit produire
une rponse immunitaire, due
des drogues qui dtruisent spcifiquement les lymphocytes ou
laction de radiations.
Les traitements immuno-suppresseurs sont utiliss dans le
cas des greffes pour limiter les
ractions de rejet.

MALADIE AUTO-IMMUNE
Maladie due lattaque et la destruction des cellules de lindividu
par son propre systme immunitaire. Par exemple, le diabte
juvnile est d lattaque des cellules du pancras responsable de
la synthse dinsuline ; la sclrose
en plaques correspond lattaque
de la gaine de myline entourant
les cellules nerveuses.

MALADIE OPPORTUNISTE
Maladie qui se dveloppe quand
lindividu prsente une immunodficience, lagent responsable de
linfection tant, dans une situation normale, facilement limin.

ZOOM SUR
Les cinq classes dimmunoglobulines.
La structure des diffrentes
chanes lourdes :
les Ig A luttent contre les bactries
et les virus dans les muqueuses
respiratoires et digestives ;
les Ig D interviennent dans la
maturation des lymphocytes ;
les Ig E dfendent contre les
parasites et les mcanismes de
lallergie et entranent la libration dhistamine ;
les Ig G sont produites lors dun
contact prolong avec lantigne
ou lors dun deuxime contact ;
les Ig M sont scrtes lors du
premier contact avec lantigne.

82

LESSENTIEL DU COURS

Les mcanismes immunitaires

exemple de linfection par le VIH montre que lorganisme est


capable de dtecter un lment tranger comme un virus et
de dclencher des mcanismes de dfense dans le but de
lliminer. Le systme immunitaire est en effet capable de faire
la distinction entre les cellules et les molcules qui lui appartiennent ( soi ) et celles qui proviennent dautres organismes
( non-soi ). Il est galement capable de dtecter et de dtruire
ses propres cellules quand elles sont transformes par un virus
ou un processus cancreux ( soi modifi ). Quels sont les processus immunitaires mis en jeu dans ces diffrentes situations ?

Les principales caractristiques


de limmunit inne et
de limmunit acquise
Limmunit inne met principalement en jeu des
cellules qui circulent en permanence dans le sang et la
lymphe, par exemple : les granulocytes neutrophiles,
les monocytes et les macrophages, quivalents tissulaires des monocytes. Ces cellules sont mobilises
et attires ds quun lment tranger est dtect
dans le milieu intrieur et sont capables de le faire
disparatre par phagocytose, quels que soient les
antignes quil porte.
Limmunit acquise, quant elle, fait intervenir des
molcules solubles, comme les anticorps, et des
cellules, comme les lymphocytes T cytotoxiques. Les
effecteurs de limmunit acquise sont mobiliss plus
progressivement parce quil nexiste au dpart quun
petit nombre de cellules immunocomptentes pour
un antigne donn et que leur multiplication ne se
produit qu la suite de la reconnaissance de lantigne. Les anticorps maintiennent lintgrit du milieu
extracellulaire en neutralisant des toxines, des particules virales ou des bactries extracellulaires, tandis
que les lymphocytes cytotoxiques maintiennent
lintgrit des populations cellulaires en dtruisant
les cellules infectes ou modifies par une mutation.
En outre, des cellules mmoire permettent aux
ractions acquises de se dvelopper plus rapidement
et plus intensment lors dune seconde rencontre
avec un antigne, assurant ainsi une protection
durable de lorganisme par limmunit acquise. Cette
caractristique est lorigine des vaccins.

Les anticorps sont des molcules polyfonctionnelles


comportant une partie constante et une partie
variable. La partie constante comprend notamment
le site de fixation la membrane des rcepteurs B et
la rgion reconnue par les phagocytes lors de llimination des complexes immuns. La partie variable est
responsable de la spcificit de lanticorps et constitue
le site de reconnaissance de lantigne.
Dans lespce humaine, on estime 1 017 le nombre
dantignes lmentaires diffrents susceptibles
dtre reconnus par les anticorps, alors quil nexiste
que quelque 30 000 gnes. un instant donn, on
estime 100 millions le nombre de types danticorps
diffrents prsents dans lorganisme. Lampleur de
la diversit des lymphocytes T est du mme ordre.

Le dclenchement de
la production danticorps
La production danticorps dpend de lactivation des
lymphocytes B. Celle-ci se produit quand les anticorps
membranaires dun lymphocyte B (rcepteurs B)
reconnaissent un antigne par leur partie variable
(phase de reconnaissance). La stimulation dun lymphocyte B a pour consquence sa multiplication
(phase dexpansion clonale) et la diffrenciation des
cellules filles en un clone de plasmocytes scrteurs
danticorps et en lymphocytes B mmoire, susceptibles de ragir rapidement en cas de nouveau contact
avec le mme antigne (phase de diffrenciation).
La spcificit des anticorps scrts par les plasmocytes est identique celle des rcepteurs B du lymphocyte stimul au dbut de la raction immunitaire.
On parle de slection clonale car les lymphocytes B ne
peuvent reconnatre quun seul antigne et que seul
le clone de lymphocytes B slectionn se multiplie.
Dans la plupart des ractions immunitaires, la prolifration des lymphocytes B et la production danticorps
dpendent galement de messagers chimiques, les
interleukines, produits notamment par des lymphocytes T auxiliaires ou T4. Lactivation de ces derniers
dpend le plus souvent de la prsentation dun antigne par une cellule prsentatrice dantigne (CPA)
comme un macrophage.
Les lymphocytes B sont les seules cellules capables de
reconnatre un antigne circulant dans le milieu intrieur et assurent ainsi une surveillance permanente
du milieu extracellulaire. Il y en a environ 1011 dans
lorganisme et on estime 100 millions le nombre
de types danticorps diffrents un moment donn.

Les caractristiques
des anticorps
Les anticorps, galement appels immunoglobulines,
sont des protines synthtises par les plasmocytes
drivant des lymphocytes B. Il existe des anticorps
membranaires, qui constituent les rcepteurs immunitaires des lymphocytes B (environ 100 000 rcepteurs par lymphocyte B), et des anticorps circulants,
scrts par les plasmocytes, qui constituent des
effecteurs de limmunit acquise.

Le systme immunitaire (Term)

Stimulation antignique et production danticorps.

-hMJNJOBUJPOEFTBOUJHOFT
Grce leur partie variable, les anticorps spcifiques
reconnaissent les antignes circulants.
Le double site de reconnaissance permet aux anticorps de se lier deux antignes identiques et de
complexer ainsi les agents trangers comportant
cet antigne.
Il en rsulte la formation de complexes insolubles
appels complexes immuns.
Des phagocytes (macrophages, granulocytes neutrophiles) font disparatre les complexes immuns par
endocytose puis digestion intracellulaire.
Dautres mcanismes de destruction des antignes
dpendant des anticorps existent galement. Dans
tous les cas, llimination des antignes ncessite
la coopration entre cellules de limmunit inne
(macrophages notamment) et cellules de limmunit acquise (lymphocytes).
Toutefois, si les anticorps produits contre un virus
circulant peuvent le neutraliser et lempcher dinfecter de nouvelles cellules, ils nont pas daction
sur les cellules infectes. Ce sont les lymphocytes T
cytotoxiques qui liminent ces dernires.

Le dclenchement de la
production de lymphocytes
cytotoxiques
Les principes de la production de lymphocytes
cytotoxiques (lymphocytes T CD8) sont comparables
ceux de la production de plasmocytes. Les lymphocytes T8 sont activs lorsquils reconnaissent par
leur rcepteur T des antignes ports par les cellules
infectes ou modifies.
Une fois activs, les LT8 se multiplient et se diffrencient en lymphocytes cytotoxiques, susceptibles
dliminer les cellules cibles en produisant des
substances cytolytiques leur contact.
Les lymphocytes T8 pr-cytotoxiques se multiplient
lorsquils sont stimuls par des interleukines produites par des lymphocytes T auxiliaires (T4) de
mme spcificit.
Ainsi, limmunit humorale, avec la production danticorps, et limmunit cellulaire, avec la production
de lymphocytes T cytotoxiques, sont contrles lune
et lautre par les lymphocytes T4.
Lors dune infection par le VIH, le systme immunitaire limite la rplication virale, souvent pendant
plusieurs annes, mais la destruction des lymphocytes T4 finit par rendre impossible la production
danticorps et de lymphocytes cytotoxiques.
En temps ordinaire, lorganisme produit environ
un milliard de lymphocytes par jour et ces derniers
reprsentent 20 % des globules blancs circulants.

UN ARTICLE DU MONDE CONSULTER


t.PEVMFSMBSQPOTFJNNVOJUBJSFEFTPSHBOJTNFTp. 85
Reprsentation schmatique dune immunoglobuline.

(Nicolas Poirier, 18 novembre 2010)

ZOOM SUR
La transplantation dorganes.
t2VFMRVFTDIJGGSFT
En 2007, 274 000 Europens
vivaient avec un organe transplant et des milliers de personnes taient en attente dune
transplantation.
En France, en 2007, 12 800 patients avaient besoin dune transplantation et 232 sont dcds en
raison dun manque de greffon.
Depuis lan 2000, il y a eu une
augmentation de 45 % des transplantations dorganes en France.
Environ 13 000 greffes sont ralises chaque anne.
t .BMHS EWFOUVFMT QSPCMNFT
immunologiques, la transplantation dorganes est, pour un certain nombre de pathologies, la
seule issue thrapeutique lorsque
les organes vitaux sont atteints de
manire irrversible.
Lutilisation de lorgane transplant, le greffon, en provenance
de donneurs vivants se dveloppe
et prsente plusieurs avantages :
la survie du greffon est meilleure
que lorsque le greffon provient
dun donneur dcd.
De plus, la compatibilit HLA
(Human leucocyte antigen) ninfluence pas de manire importante
le rsultat de la transplantation.
t-FHSFGGPOFTUUSBOHFSMPSHBnisme. Ce dernier dveloppe donc
une raction immunitaire de rejet.
Le rejet peut-tre aigu, avec un
risque allant de 5 % pour le rein
jusqu 50 % pour le poumon. Il
peut aussi tre chronique, entranant, terme, la destruction du
greffon ou une perte de sa fonctionnalit.
Les traitements immunosuppresseurs ont progress ces dernires
annes, mais ils provoquent toujours une immunodpression qui
induit un risque accru dinfections
et de tumeurs chez le patient.
Les recherches se poursuivent afin
de permettre un tat de tolrance immunitaire oprationnel , c'est--dire faire en sorte
que le systme immunitaire du
patient soit tolrant lgard du
greffon sans altrer la rponse
immunitaire oriente vers les
autres antignes.

Le systme immunitaire (Term)

83

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LESSENTIEL DU COURS

UN SUJET PAS PAS

La lymphe interstitielle.
Il s'agit d'un liquide incolore dans
lequel baignent toutes les cellules
de notre corps et qui a la mme
composition que le plasma.
La lymphe interstitielle traverse
la paroi trs mince des capillaires
sanguins et permet aux nutriments
dentrer en contact avec les cellules.
La lymphe circulante est charge
dvacuer les dchets cellulaires par
un rseau de vaisseaux lymphatiques. Aux points de convergence
des vaisseaux se trouvent les ganglions lymphatiques qui jouent
un rle important dans le systme
immunitaire. La lymphe permet le
dplacement des cellules immunitaires vers tous les organes du corps
et rejoint le systme sanguin.
Les diffrentes cellules sanguines.
tLes hmaties, ou globules rouges,
sont des cellules anucles, biconcaves et aplaties au centre. Elles
transportent le dioxygne et le
dioxyde de carbone.
t -FT MFVDPDZUFT  PV HMPCVMFT
blancs, interviennent dans la dfense immunitaire de lorganisme :
les polynuclaires (neutrophiles,
basophiles, osinophiles) ont une
activit antibactrienne (diapdse,
chimiotactisme et phagocytose) ;
les monocytes se diffrencient en
macrophages ralisant la phagocytose et la prsentation de lantigne
aux autres cellules immunitaires ;
les lymphocytes interviennent
dans la rponse immunitaire spcifique. Les LT (LT4 et LT8), produits
par la mlle osseuse, ont leur maturation dans le thymus, tandis que
les LB naissent et mrissent dans la
moelle osseuse.
tMFTQMBRVFUUFTJOUFSWJFOOFOUEBOT
le processus de coagulation.

84

La syphilis
Lintitul complet du sujet
La syphilis est une maladie sexuellement transmissible due une bactrie pathogne, le trponme
ple. Un test immunologique fond sur la recherche
danticorps permet de dtecter si un individu a t en
contact avec la souche infectieuse.
Trouvez dans le document les arguments ayant permis de
dire que lindividu 2 est sropositif pour le trponme ple.

Le document

Solution avec microbilles Srum d'un individu 1


(n'ayant pas contract la
de latex et antignes
syphilis) mis en contact
trponmiques
avec des microbilles de
latex portant des
antignes de trponme.

Immunothrapie en allotransplantation chez le primate : inhibition du complment et


de la costimulation

Le trponme ple.

On est capable disoler les antignes trponmiques


et de les fixer sur des microbilles de latex. Ces microbilles sont places dans diffrents srums.
On peut observer au microscope, avec un grossissement 600, le rsultat de cette mise en contact.
Srum d'un individu 2
mis en contact
avec des microbilles de
latex portant des
antignes de trponme.

ny a pas de reconnaissance anticorps-antigne, il ny a


pas de ractions immunitaires. Le srum de lindividu 1
ne contient pas danticorps anti-syphilis.
Dans le cas du srum de lindividu 2, la photographie
de lobservation microscopique de la prparation
rvle des amas granuleux de microbilles. Laide
linterprtation indique que les microbilles portant
les antignes trponmiques sont relies entre elles
par des molcules danticorps qui sont diffrentes de
celles observes dans le srum de lindividu 1. Ces anticorps possdent deux parties terminales identiques
complmentaires de lantigne trponmique. Il y a
formation dun complexe antigne-anticorps, une
raction immunitaire a eu lieu.
Le srum de lindividu 2 contient des anticorps antisyphilis qui se lient aux antignes trponmiques.

Conclusion

Antignes trponmiques

Microbille de latex
Anticorps

Lindividu 2 est sropositif pour le trponme ple,


ce qui permet daffirmer qu'il a t au contact avec la
souche infectieuse de la syphilis.

Ce quil ne faut pas faire


Ne pas commenter les photographies
et utiliser uniquement le texte accompagnant
le document.

Le corrig
La solution avec microbilles de latex et antignes
trponmiques est la solution tmoin.
Lorsquil ny a que les microbilles ayant fix les
antignes trponmiques dans le srum, la photographie de lobservation microscopique de la
prparation montre un milieu homogne avec des
microbilles disperses. Aucune raction immunitaire ne sest produite.
Lorsque les microbilles de latex portant les antignes
trponmiques sont en contact avec le srum de lindividu 1, nayant pas contract la syphilis, la photographie de lobservation microscopique de la prparation
est semblable au tmoin. Le milieu est homogne.
Laide l'interprtation indique que les microbilles
sont disperses ainsi que des molcules danticorps. Il

Le systme immunitaire (Term)

Moduler la rponse
immunitaire des organismes

SUJETS TOMBS AU BAC


SUR CE THME
Restitution des connaissances
La production danticorps. (Amrique du Sud,
novembre 2004)
Mcanismes de productions des cellules immunitaires contre un virus. (Nouvelle-Caldonie, juin 2010)

tudes de documents
Production danticorps et coopration cellulaire.
(Sujet national, septembre 2004)
Proprits des anticorps. (La Runion, juin 2008)

ans la nature, tout est


quilibre, rgulation et
contrle. De nombreuses
maladies apparaissent lorsque cet
tat est rompu. Ainsi, en mdecine, de nombreux mcanismes
cellulaires sont soumis cette harmonie ; par exemple, sans contrle
ou autorgulation du systme immunitaire, nos lymphocytes, livrs
eux-mmes, peuvent sattaquer
nos propres organes ou tissus et
engendrer des maladies auto-immunes. Celles-ci ne sont en ce sens
quun systme en crise, drgul,
qui sen prend lui-mme.
Aprs une transplantation, la
crise est attendue et normale : lintroduction dun organe tranger
est logiquement reconnue comme
une agression et cet organe est
rejet par lorganisme ; il sagit
alors de rendre la crise acceptable.
La transplantation dorgane na
connu son essor quaprs la dcouverte, au dbut des annes
1980, de puissantes molcules
immunosuppressives, imposant
un gel plus ou moins complet
de bon nombre dactions normalement entreprises par le systme
immunitaire. Cependant, ce gel
prive les patients de leurs dfenses
naturelles et les expose certains
types de cancers et infections opportunistes normalement sous
contrle. De plus, les puissants
cocktails immunosuppresseurs ne
sont pas dnus de toxicit propre.
Mon travail de doctorat sest
droul au sein de lInserm U643,
qui sintresse depuis plusieurs
annes la dcouverte et au dveloppement de nouvelles stratgies
thrapeutiques innovantes afin
de contrler les rponses du systme immunitaire. Cette quipe
fait partie de lInstitut de transplantation-urologie-nephrologie

(ITUN), lun des premiers centres


europens de greffe de rein cre
par le Pr. Jean-Paul Soulillou.
Lide la base de ce travail de
thse tait de moduler de manire
slective et plus fine la rponse immunitaire, dans le sens de restaurer
une balance immune en faveur des
cellules de contrle (rgulation)
vis--vis de celles qui induisent le
rejet, afin de prvenir ce dernier,
voire, par extension, les maladies
auto-immunes. Pour ce faire, nous
avons identifi un moyen de prvenir laction des cellules effectrices
tout en favorisant celle des cellules
rgulatrices, par le blocage de rcepteurs activateurs de la rponse des
lymphocytes T sans bloquer ceux
qui promeuvent le fonctionnement
des lymphocytes rgulateurs antiinflammatoires qui agissent sur le
versant rgulation de la balance
immune. En effet, les lymphocytes T
jouent un rle dcisif dans le rejet
des greffes et dans plusieurs maladies auto-immunes. Lactivation
des lymphocytes T, induite par la
reconnaissance dantignes spci-

POURQUOI
CET ARTICLE ?
Cet article expose les travaux
de recherche concernant de
nouveaux mdicaments pour la
prvention des rejets de greffes
et le traitement des maladies
auto-immunes.
Les chercheurs travaillent sur de
nouvelles stratgies thrapeutiques qui permettraient de moduler la rponse immunitaire,
notamment des mdicaments
appels immunomodulateurs . Il sagit de rduire le rejet
de la greffe tout en maintenant

fiques, est aussi renforce par des


molcules costimulatrices venant
se lier un rcepteur activateur, appel CD28, ou un autre rcepteur
inhibiteur, CTLA-4.
Nous avons gnr un fragment
danticorps monoclonal dirig uniquement contre le rcepteur activateur CD28, sans interfrer avec
linhibiteur CTLA-4. Nous avons
dmontr que, contrairement aux
traitements actuels, ces fragments
danticorps favorisent la fonction
suppressive des cellules rgulatrices tout en bloquant celles des
cellules agressives.
Nous avons valu cette nouvelle
stratgie thrapeutique innovante
dans deux modles de transplantation (rnale ou cardiaque) chez
le primate en association avec un
immunosuppresseur classique. Les
rejets aigu et chronique dallogreffe
ont t rduits et le traitement a
induit une absence de rejet mme
aprs larrt de tout traitement. Ce
phnomne se rapproche dune tolrance immunologique en transplantation. Nous nous sommes

chez le patient un bon niveau de


protection immunitaire.
Les chercheurs ont russi bloquer les rcepteurs activateurs
de la rponse des lymphocytes T
qui interviennent dans le rejet
de greffe, sans intervenir sur les
lymphocytes rgulateurs de la
rponse immunitaire. Ils ont
fabriqu un anticorps monoclonal contre le rcepteur activateur
CD28 uniquement. Ils ont constat chez les personnes traites
une diminution des rejets aigus
et chroniques puis une absence
de rejet aprs traitement. Tout
se passe comme si lorganisme

alors intresss aux mcanismes


rgulateurs et avons observ une
accumulation de cellules rgulatrices dans le sang et le greffon des
receveurs ainsi que de molcules
immunorgulatrices impliques
dans la tolrance. Enfin, cette nouvelle molcule anti-CD28 sest rvle non toxique chez le primate et,
in vitro, sur des cellules humaines.
La valorisation de ces travaux
de recherches est effectue par la
socit de biotechnologie nantaise
TCL Pharma, inspire et anime
par les chercheurs de lITUN. TCL
Pharma est spcialise dans la
dcouverte et le dveloppement
de nouveaux mdicaments : des
immunomodulateurs et, plus
spcifiquement, des rgulateurs
de la costimulation lymphocytaire
permettant de rpondre des besoins insatisfaits et damliorer
lefficacit des traitements dans les
maladies auto-immunes et dans la
prvention des rejets de greffes.
Nicolas Poirier
(18 novembre 2010)

acceptait le greffon comme


cellule de lorganisme : on
parle ce propos de tolrance
immunologique.
Ces nouveaux traitements
offrent des perspectives trs intressantes pour le traitement
des malades.
Cet article permet dtablir un
lien entre vos connaissances
scientifiques sur le fonctionnement du systme immunitaire
et les problmatiques des traitements mdicaux. La recherche
fondamentale est indispensable
pour permettre des avances
dans le domaine mdical.

Le systme immunitaire (Term)

85

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

ZOOM SUR

Restitution de connaissance :

Photographies

Systme HLA
(Human leucocytes antigen).
Ensemble de six gnes principaux (A,
B, C, DR, DQ, DP) situs, chez lhomme,
sur la paire de chromo-somes 6, codant des glycoprotines de surface qui
interviennent dans le rejet de greffes
et la reconnaissance du soi modifi.

Aide l'interprtation

NOTION CL

L'ARTICLE DU

LESSENTIEL DU COURS

Limmunologie.
t   Jenner dcouvre quune
souche bovine protge de la
variole.
t   Pasteur met au point une
technique pour attnuer les microorganismes pathognes et permettre la vaccination.
t   Premires expriences
dagglutination par Metchnikoff.
t   Isolement des anticorps
par von Behring et Kitasato.
t   Concept de soi et de
non soi propos par Ehrlich.
tLes gnes codants pour les
rcepteurs des lymphocytes T et B
sont identifis.
tIdentification du virus du
Sida par lquipe de Montagnier.

ZOOM SUR
Cancers et immunothrapie.
Limmunothrapie complte le
traitement classique des cancers
(chirurgie, radiothrapie et chimiothrapie). Elle regroupe deux stratgies thrapeutiques diffrentes,
limmunothrapie passive et active :
les immunothrapies passives
consistent administrer au malade
des anticorps artificiels appels
monoclonaux ayant une cible
molculaire prcise la surface des
cellules cancreuses. Lobjectif tant
de dtruire ces dernires. On utilise
galement des anticorps contre des
facteurs qui interviennent dans la
multiplication des cellules, bloquant
ainsi leur prolifration ;
limmunothrapie active vise mobiliser ou renforcer les ressources
du systme immunitaire du malade
afin damliorer llimination des cellules cancreuses. Limmunothrapie
non-spcifique consiste stimuler
lactivit globale du systme immunitaire sans cibler la tumeur du
malade. On utilise des cytokines, par
exemple linterfron alpha. Dans le
cas de limmunothrapie spcifique,
on met en culture et on manipule des
cellules tumorales que lon rinjecte
au patient afin de les rendre plus
immunognes. On peut galement
travailler sur les cellules immunitaires pour les rendre plus efficaces
contre les cellules tumorales.

86

Les vaccins et la mmoire


immunitaire

haque anne, dans les pays en dveloppement, 3 millions


denfants meurent de la tuberculose, 3,5 millions dinfections
intestinales, 3 millions dinfections respiratoires, 1,5 million
de la rougeole et 1 million du paludisme. Par ailleurs, sur les 16 000
nouvelles personnes infectes chaque jour par le VIH dans le monde,
90 % vivent en Afrique subsaharienne. Pourtant, certaines de ces
maladies peuvent tre combattues efficacement. Dans les pays
o les vaccinations sont pratiques systmatiquement, la variole
a pu ainsi tre radique et les maladies correspondantes (diphtrie, coqueluche, rougeole, poliomylite, etc.) naffectent quun trs
petit nombre de personnes. Cest notamment la connaissance des
mcanismes immunitaires qui permet damliorer lefficacit des
vaccins et des traitements et qui conditionnera la mise au point
ventuelle dun vaccin contre le VIH.
La rponse primaire

Louis Pasteur.

La dcouverte des principes


de la vaccination
la fin du XVIIIe sicle, le mdecin anglais Edward Jenner
montra, sans pouvoir lexpliquer, quil tait possible de
fournir un individu une protection prventive contre
la variole maladie pidmique souvent mortelle , en
lui inoculant du pus prlev sur une vache atteinte de la
vaccine, une maladie bovine bnigne chez lhomme. Plus
tard, les travaux de Pasteur montrrent que la virulence
des microbes pouvait tre attnue et que leur inoculation des animaux empchait le dveloppement de la
maladie en cas de contamination par le microbe virulent.
Lapplication de ces principes lhomme a permis de
prouver lefficacit de la vaccination contre de nombreuses maladies, y compris contre des maladies dorigine
inconnue comme la rage, dont on ne pouvait pas,
lpoque, identifier le virus au microscope optique en
raison de sa taille (125 nm).

Le systme immunitaire (Term)

Lors du premier contact avec un agent infectieux,


limmunit inne, non spcifique dun antigne
donn, est mobilise en premier lieu. Son efficacit
se renforce ensuite avec lactivation de limmunit
acquise, qui stimule la phagocytose et facilite ainsi
la destruction des complexes immuns forms par
la raction antigne-anticorps.
Lors de ce premier contact, seuls les lymphocytes
munis de rcepteurs spcifiques de lantigne en
question sont stimuls et conduisent la production danticorps capables de le neutraliser. Les
lymphocytes capables de reconnatre un antigne
dtermin sont trs peu nombreux et la production
danticorps de faible intensit et de dure limite
nest dtectable quaprs une priode de latence de
plusieurs jours. Cest ce que lon appelle la rponse
primaire. La spcificit de la sropositivit qui en
rsulte permet cependant de dtecter une contamination (sroconversion).
Au cours de la rponse primaire, des anticorps
circulants sont scrts par les plasmocytes issus
des lymphocytes B activs.

La rponse secondaire
Lors dun nouveau contact avec un antigne ayant
dj dclench une rponse primaire, on constate
que la production danticorps spcifiques augmente
rapidement, aprs une courte priode de latence.
La scrtion danticorps circulants atteint alors des
niveaux bien suprieurs ceux observs au cours
de la rponse primaire. Cette rponse prcoce et
intense, appele rponse secondaire, aboutit le plus
souvent la destruction des agents infectieux avant
tout signe clinique.

On avait dailleurs remarqu, bien des sicles avant


la dcouverte des microbes, que les personnes ayant
dvelopp une maladie contagieuse sans en mourir
taient ensuite immunises spcifiquement contre
cette maladie, sans tre protges contre les autres.
La capacit de ragir de faon adapte un stimulus
dj reu suppose lexistence dune mmoire. La
mmoire immunitaire repose sur lexistence des
lymphocytes B et T mmoire, issus de lexpansion
clonale due au premier contact avec lantigne.
Leur dure de vie est nettement suprieure celle
des autres lymphocytes et leur haute ractivit
donne son caractre rapide et intense la rponse
secondaire.
taux
d'anticorps

conserver son pouvoir immunogne. On utilise


des micro-organismes tus ou bien vivants, mais
attnus, des substances microbiennes purifies,
voire des molcules produites par gnie gntique.
Il existe ainsi des vaccins contre les principaux
agents infectieux.
Dans le cas du VIH, lincapacit du systme immunitaire contrler le virus long terme et
les mutations incessantes du virus, conduisant
des modifications de ses proprits antigniques,
rendent difficile la mise au point dun vaccin.

103

rponse
secondaire

IgM

Le systme du complment.

Le phnotype immunitaire

IgG

latence

rponse
primaire

Les organes lymphodes.


On distingue les organes lymphodes primaires et secondaires.
Les organes lymphodes primaires
ou centraux (la moelle rouge des os
et le thymus) sont le lieu de multiplication et de maturation des cellules immunitaires.
Les organes lymphodes secondaires
sont les ganglions lymphatiques,
situs sur le trajet des vaisseaux
lymphatiques, la rate, les plaques de
Peyer tapissant la muqueuse intestinale, les vgtations et les amygdales.
Les cellules immunitaires migrent des
organes lymphodes primaires vers
les organes lymphodes secondaires.

105
104

ZOOM SUR

102
10
1
0
0

premire
stimulation
antignique

6
7
temps (semaines)

stimulation
antignique
identique

Production danticorps lors des rponses primaire et


secondaire.

La ralisation des vaccins


Limmunit acquise, qui confre une protection
long terme contre une maladie infectieuse, suppose
que lon ait t en contact avec lagent responsable. Ainsi, au cours des pidmies historiques,
les survivants dune pidmie prcdente taient
protgs. Pasteur a mis au point empiriquement
des mthodes pour attnuer la virulence des agents
infectieux, agents quil a ensuite utiliss pour
dclencher une rponse immunitaire sans pour
autant provoquer de maladie.
Aujourdhui, on prpare de mme une forme inoffensive de lagent infectieux tout en sefforant de

Schma-bilan des ractions immunitaires.

Le phnotype immunitaire dun individu correspond son rpertoire immunitaire, cest--dire aux
diffrents clones de cellules immunocomptentes
prsents un instant donn et qui diffrent par la
partie variable de leurs rcepteurs immunitaires.
La slection dun clone dtermin
dpend des antignes prsents un
instant donn. Aprs disparition de
QUATRE ARTICLES DU MONDE CONSULTER
lantigne, seuls les lymphocytes
mmoire persistent. Ainsi, le phnot-FCOmDFEVWBDDJOFOUFSNFTEFTBOUQVCMJRVF
type immunitaire volue en fonction
est remis en question p. 89
de lenvironnement antignique.
(Emeline Cazi, 12 juillet 2011)
Lors dune vaccination, le systme
immunitaire se prpare une vent.FOBDFTVSMBWJFEFNJMMJPOTEhFOGBOUTp. 90
tuelle contamination ultrieure en
(Modou Diagne Fada, 1er juin 2011)
modifiant son rpertoire par slection des clones appropris. Le phnot1BMVEJTNFQSPHSTWFSTVOWBDDJOp.90-91
type immunitaire volue ainsi tout
(Sandrine Cabut, 17 septembre 2011)
au long de la vie. La figure ci-dessus
rcapitule les principaux processus
t-FjEPVUFVSxFTUMFWSBJTBWBOUp. 91-92
immunitaires examins dans les
(Anne Fagot-Largeault, 27 octobre 2010)
trois chapitres dimmunologie.

Il comprend un vingtaine de protines dont 9 principales et reprsente 10 % des globulines du plasma


sanguin mme en absence de toute
infection. Il est indispensable pour
la destruction des cellules trangres lors de la phase effectrice de
la rponse immunitaire mdiation
humorale. Lorsque lanticorps est
fix sur lantigne pour former le
complexe immun, la partie constante
de lanticorps dclenche une activit
catalytique envers un substrat qui est
la premire protine du complment.
Cette dernire dclenche son tour
une activit catalytique envers une
seconde protine du complment. Il y
a une activation en cascade dont le rsultat est la formation dun complexe
dattaque membranaire perforant la
membrane de la cellule qui meurt
rapidement suite cette lyse.

REPRE
Le calendrier vaccinal.
t5VCFSDVMPTFETMFQSFNJFSNPJT
et avant six ans, rappel si ngatif.
t %JQIUSJF  UUBOPT  DPRVFMVDIF 
poliomylite : 3 injections 2, 3 et
4 mois, puis 4 rappels.
t)QBUJUF#JOKFDUJPOT FU
4 mois.
t 3PVHFPMF  PSFJMMPOT  SVCPMF 
1 injection 12 mois, puis 2 rappels.
t(SJQQFQBSUJSEFBOT QVJT
tous les ans suivant ltat de sant.

Le systme immunitaire (Term)

87

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

DATES CLS

LESSENTIEL DU COURS

UN SUJET PAS PAS

VIH, les avances de la recherche.


t7FSTVOWBDDJODPOUSFMFVIH ?
Linstitut Pasteur a dvelopp un
projet pour laborer un vaccin
anti-Sida partir du vaccin de la
rougeole. Ce dernier renferme
un virus vivant attnu et procure une immunit vie aprs
une seule injection. Lobjectif des
chercheurs est de faire un vaccin
dit recombinant cest--dire
dintroduire 2 3 gnes du VIH
dans le gnome du virus attnu
de la rougeole. Ce vaccin concernerait essentiellement les enfants.
Des essais cliniques sur lanimal
sont encourageants, les essais sur
lhomme doivent tre raliss.
t3FDIFSDIFFUTMFDUJPOEFWBDDJOT
potentiels.
Un des problmes majeur pour
la mise au point dun vaccin antiVIH rside dans lextrme variabilit du virus et lun des objectifs
des chercheurs est dlaborer un
vaccin qui puisse protger contre
la majorit des virus circulants
dans le monde.
Les chercheurs travaillent sur
des banques de donnes informatises qui contiennent les squences de tous les VIH connus
ce jour.
t*OEJWJEVTjDPOUSMFVSTEVVIH .
Il existe quelques rares individus
(moins de 1 % des personnes sropositives) infectes par le virus
du Sida qui ne dveloppent pas
la maladie malgr plus de 10 ans
de sropositivit et en absence
de traitement. On les appelle les
contrleurs du VIH .
Les chercheurs ont montr que
ces individus possdent des
lymphocytes cytotoxiques ayant
des proprits particulires. Leur
mise en prsence avec les LT4
infects provoque in vitro larrt de la production virale et la
destruction rapide des cellules
infectes.
La connaissance des marqueurs
dactivation pourrait permettre
dorienter la recherche vaccinale
et limmunothrapie avec lide
de stimuler le systme immunitaire pour obtenir des lymphocytes similaires ceux des
individus contrleurs du VIH .

88

tude de document :
La mmoire immunitaire
Lanalyse du sujet
Il sagit de dmontrer, partir de lexploitation
du graphique obtenu suite aux deux injections dantignes, quil existe une mmoire
immunitaire.

Le corrig

Ce quil ne faut pas faire


Rciter son cours sur le mmoire immunitaire
sans utiliser le document.

Lintitul complet du sujet


Les salmonelloses sont des intoxications alimentaires
provoques par des bactries flagelles (pourvues dun
filament rle locomoteur), les salmonelles, qui induisent
dans lorganisme la production danticorps anti-flagelles.
Le document prsente lvolution de la concentration
des anticorps dans le srum dun rat ayant subi deux
injections de flagelles de salmonelles intervalle de
six semaines.
En exploitant le rsultat de cette exprience, vous
justifierez le fait que, lors de la pntration rpte
dantignes, lorganisme met en jeu une mmoire
immunitaire.

Suite une premire injection de flagelles, cest-dire suite un premier contact avec lantigne,
on observe une production danticorps anti-flagelles dont la quantit augmente pour atteindre
une valeur comprise entre 100 et 1 000 UA la
fin de la 1re semaine ; puis le taux danticorps
stagne aux environs de 10 000 UA jusqu la 6e semaine.
Suite au premier contact, il y a une production progressive en 6 semaines danticorps anti-flagelles.
La deuxime injection de flagelles survient alors que le
taux danticorps est encore lev, elle correspond un
deuxime contact avec le mme antigne.
Dans les 3 jours qui suivent linjection, la production
danticorps anti-flagelles passe de 1 000 10 000 UA.
Au bout de la premire semaine qui suit ce 2e contact, le
taux danticorps est largement suprieur 10 000 UA et
il reste trs lev au cours des semaines suivantes.
Suite au 2e contact avec le mme antigne, il y a une
production trs rapide danticorps.
Le taux danticorps au bout dune semaine aprs ce 2e
contact est nettement suprieur celui qui apparat dans
la semaine qui suit le 1er contact avec lantigne (au moins
10 fois plus) et ce taux reste trs lev.

Conclusion
La comparaison des deux rponses met en vidence
que lorganisme ragit beaucoup plus rapidement et
plus intensment lors du 2e contact avec lantigne.
Tout se passe comme si lorganisme avait mmoris
lantigne lors du 1er contact.
Cette exprience met donc en vidence lexistence
dune mmoire immunitaire qui rend lorganisme
beaucoup plus efficace pour lutter contre les salmonelles en permettant une production rapide et massive
danticorps.

Le document
Anticorps
anti-flagelle (U. A.)

10 000

1000

Le systme immunitaire (Term)

SUJETS TOMBS AU BAC


SUR CE THME

100

Seconde injection

Restitution de connaissances

10
1
0

La vaccination. (Sujet national, septembre 2006)


1

Premire injection

Semaines aprs
la premire injection

tudes de documents
La mmoire immunitaire. (Polynsie, juin 2008)
Origine de la maladie de Burton. (mirats Arabes
Unis, juin 2009)

Le bnfice du vaccin en termes


de sant publique est
remis en question
L
POURQUOI
CET ARTICLE ?

e vaccin contre le cancer du


col de lutrus a t prsent
comme une avance mdicale majeure pour les femmes.
Il fait aussi les beaux jours de
lindustrie pharmaceutique. Deux
vaccins sont disponibles : le Cervarix, de langlo-saxon GSK, et le Gardasil, produit par Merck et vendu
en Europe par Sanofi Pasteur MSD,
la co-entreprise des laboratoires
Sanofi Pasteur et Merck.
En France, le Gardasil, recommand pour les jeunes filles ds
14 ans, se taille la part du lion. Il obtient une autorisation de mise sur
le march en septembre 2006 de
lagence europenne des mdicaments (EMEA), qui sest applique
de fait tous les pays membres.
Depuis le dbut de la commercialisation, en novembre 2006, Sanofi
Pasteur MSD, grce une vaste
campagne de sensibilisation des
mres de famille la protection
de leur fille , et un lobbying insistant auprs des leaders dopinion,
a coul plus de quatre millions de
doses dans lHexagone. On estime
1,5 million, le nombre de jeunes
filles vaccines. La coentreprise
refuse de communiquer ses rsultats, mais Merck, dans son dernier
rapport annuel, affiche un chiffre
daffaires de 988 millions de dollars (698 millions deuros) pour les
ventes de Gardasil, hors Europe,
pour la seule anne 2010.

Empressement
Derrire ces chiffres et la grande
campagne de sensibilisation de
lopinion qui a accompagn le
premier vaccin contre un cancer , des questions souleves par
des mdecins, des gyncologues,
restent toujours sans rponse.
Lempressement qua eu le ministre de la Sant de lpoque, Xa-

vier Bertrand, annoncer le remboursement du vaccin, ds fvrier


2007, alors que le comit technique des vaccinations navait
pas rendu son avis et que la commission de la transparence na
donn le sien que deux mois plus
tard, a jet les premiers doutes.
Mais le ministre se dfend de
tout emballement et assure que
linscription au remboursement
de Gardasil sest droule conformment la procdure .
Dans une lettre adresse le
2 juillet M. Bertrand, un collectif de
mdecins de lle de la Runion, emmen par Philippe de Chazournes,
se montre par ailleurs trs proccups par les campagnes de vaccination contre le cancer du col de
lutrus, essentiellement bases sur
une peur injustifie .
Le cancer du col est-il vraiment un problme de sant
publique en France au sens o
lentendent les pidmiologistes ?
La question mrite dtre pose,
car en ralit, on assiste depuis
1980 une baisse rgulire du
nombre de nouveaux cas et de
la mortalit lie cette affection.
Or, la seule et unique mesure de
prvention associe cette baisse
rgulire est le dpistage rgulier
par un frottis cervico-utrin ,
fait-il remarquer. Le ministre
assure, lui, quil ny a pas de
polmique. Le cancer du col de
lutrus est le quinzime cancer
fminin par le nombre de dcs,
cest donc un sujet sur lequel on
doit tre attentif .
Les mmes doutes sur lintrt
dun vaccin par rapport au frottis
avaient t soulevs par Antoine
Spire, directeur du dpartement
de recherche des sciences humaines de lInstitut national du
cancer (INCa) au moment o le

laboratoire est venu prsenter


son produit. Le Gardasil nagit que
sur deux types de cancer du col, le
HPV (papillomavirus humains)
16 et 18, certes parmi les plus
virulents, et deux autres types, les
6 et 11, responsables du dveloppement des verrues gnitales. Les
spcialistes dnombrent au total
40 types diffrents de HPV.
Vaccination ou pas, il est donc
indispensable de continuer se
faire dpister rgulirement.
M. Spire, qui doute de la capacit du
laboratoire toucher les femmes
qui ne sont dj pas suivies rgulirement , plaide donc pour une
gnralisation du frottis avant tout.
Philippe de Chazournes a galement demand, le 10 juin, au
professeur Jean-Luc Harousseau,
le prsident de la Haute Autorit
de sant (HAS), de bien vouloir retirer la dernire recommandation
pour le dpistage du cancer du col
de lutrus et de constituer un
nouveau groupe de travail sans
conflits dintrts majeurs avec lindustrie afin de promouvoir le dpistage du cancer du col de lutrus
par le frottis cervico-vaginal . Sil
est bien et rgulirement fait,
lui seul, il permettrait dentraner
la disparition de la mortalit par
ce cancer , plaide-t-il.
Interrog, le laboratoire renvoie
la confrence de presse organise
mi-juin au cours de laquelle il rpondait aux doutes sur lefficacit
du produit, rappelait lurgence
de vacciner toutes nos filles avec
les trois doses avant 15 ans , et
jugeait vident, que si lon souhaitait une vraie politique de sant
publique , il faudrait tendre la
vaccination aux garons .
meline Cazi
(12 juillet 2011)

Ce texte illustre la polmique qui entoure la vaccination contre le cancer du


col de lutrus prconis pour
les jeunes filles ds quatorze
ans. Un certains nombre de
mdecins considre que cette
vaccination ne se justifie pas,
que le cancer du col de lutrus nest pas un problme
de sant publique en France
puisque lon constate une
baisse des nouveaux cas
et que les mesures de prvention sont essentielles et
consistent tout simplement
en un frottis cervico-vaginal
effectu chaque anne. Le
ministre de la Sant avait
lanc un vaste programme de
promotion de la vaccination
considrant que le cancer
de lutrus est le quinzime
cancer fminin. En arrire
plan, se profilent les intrts
conomiques des grands
groupes pharmaceutiques
avec des chiffres daffaires
de plusieurs millions deuros et lon sinterroge sur les
priorits choisies. Les chercheurs signalent, par ailleurs,
que le vaccin nest efficace
que contre quatre types de
papillomavirus alors quil
en existe quarante et considrent que la protection nest
pas trs satisfaisante.
Cet article rvle que, dans
certains cas, il est ncessaire
de mener une rflexion afin
de dterminer si une vaccination systmatique est
indispensable aux regards
des risques lis linfection,
des cots en termes de sant
publique, indpendamment
des intrts conomiques
de certaines grandes firmes
pharmaceutiques.

Le systme immunitaire (Term)

89

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

REPRES

LES ARTICLES DU

LES ARTICLES DU

Menace sur la vie de 4 millions denfants

outes les vingt secondes, un


enfant meurt dune maladie
vitable par la vaccination
avant davoir souffl sa cinquime
bougie. Cela reprsente 2 millions
de dcs denfants vitables chaque
anne. Les origines de ce drame sont
bien connues des spcialistes de la
sant comme de mes concitoyens.
Les complications dues la diarrhe
et la pneumonie sont les deux
premires causes de la morbidit et
mortalit infantiles dans les pays les
plus pauvres, dits faibles revenus.
Ces dcs ne relvent pas de la
simple fatalit. Ils peuvent tre vits !
Une solution rapide, efficace, peu
coteuse existe : ladministration
dans les plus brefs dlais de deux
nouveaux vaccins luttant prcisment contre la pneumonie et la
diarrhe dont les germes les plus
incrimins sont respectivement le
pneumocoque et le rotavirus.
Ces vaccins sont bien disponibles
dans les pays dvelopps tels que la
France, mais nont pas t introduits
large chelle dans les programmes
nationaux de vaccination des pays
qui en ont pourtant le plus besoin.
Avec le recul du paludisme, la pneumonie et les diarrhes constituent,
aujourdhui, au Sngal, les deux
premires causes de mortalit chez
les enfants de moins de cinq ans. Les
complications lies aux insuffisances
respiratoires aigus restent aussi
meurtrires que celles des diarrhes.
Pourtant, administrer gratuitement ces deux nouveaux vaccins
nos enfants relve de nos comp-

tences : entre 2000 et 2009, mes


services ont su relever la couverture
vaccinale du Sngal de 50 % 89 %
en prodiguant le vaccin pentavalent qui combat cinq maladies en
une seule injection.
Ainsi, les solutions techniques
existent, les ressources humaines
en sant sont mobilisables tout
instant : nos mdecins, infirmiers,
ONG, sont sur le qui-vive.
Seule une inconnue persiste pour
rsoudre lquation fatale de la sant
de nos enfants : la mobilisation de
financements prennes pour relever
le dfi de lObjectif du millnaire
visant rduire des deux tiers la
mortalit des enfants de moins de
5 ans entre 1990 et 2015.
Tel est prcisment lenjeu de la
prochaine confrence des donateurs
de lAlliance pour la vaccination et
limmunisation, GAVI, qui se tiendra Londres le 13 juin prochain.
Mobiliser 2,6 milliards deuros pour
les cinq annes venir permettrait
dimmuniser 250 millions denfants
et sauver la vie de 4 millions dentre
eux dans les pays les plus pauvres
de la plante.
Cet enjeu ne saurait se rsumer
un froid calcul financier. Vacciner un
enfant, cest investir dans lavenir,
cest garantir son droit la vie, cest
galement faciliter laccs des mres
aux centres de sant en favorisant
lchange sur les mthodes contraceptives et en les conseillant sur les
soins qui les concernent, elles et
leurs enfants. Du point de vue du
dveloppement conomique, cest

galement bnficier dune population en mesure de travailler et


spanouir en loignant le fardeau
dune peur quotidienne.
En un mot, offrir sa population
les moyens de prvenir les causes de
son mal-tre et de son mal-dveloppement relve de la responsabilit
politique. Cette responsabilit, mon
pays, le Sngal, mais galement plusieurs dizaines dautres pays qui ont
adress une demande GAVI pour
introduire de nouveaux vaccins, nous
la prenons devant nos administrs
en nous engageant ds aujourdhui
cofinancer lachat de ces vaccins.
quelques jours de cette confrence trop oublie o se joue la vie
ou la mort de 4 millions dinnocents,
une variable demeure inconnue.
quelle hauteur slvera le niveau
de contribution de la communaut
internationale ? Et notamment celui
des pays membres du G8 qui se sont
runis dernirement Deauville, en
prsence de leaders africains, dont
notre prsident, M. Abdoulaye Wade.

POURQUOI
CET ARTICLE ?
Cet article est un vritable plaidoyer en faveur de la vaccination des enfants quexprime
Modou Diagne Fada afin de sauver plusieurs millions denfants
au Sngal. Alors que larticle
prcdent illustrait lexemple
dune vaccination non indis-

cette occasion, les chefs dtat ont


fait le point sur leurs engagements
passs, notamment ceux de lan
dernier, visant mobiliser 5 milliards de dollars supplmentaires
pour la sant des femmes et des
enfants. Une fois nest pas coutume,
il savre que ces promesses seront
largement dpasses, alors pourquoi ne pas dbloquer ces fonds
immdiatement pour prvenir les
morts prvisibles plutt que gurir
a posteriori ? Quelques jours avant
la Confrence des donateurs de GAVI,
alors quaucun donateur na encore
rendu public le niveau de son engagement, je me dois, au nom des
millions de sans-voix qui nont pas
mme connaissance de ces enjeux
lointains, de sonner lalarme.
Ne dit-on pas que gouverner cest
prvoir ?
Modou Diagne Fada,
ministre de la Sant et de la Prvention
de la Rpublique du Sngal
(1er juin 2011)

pensable, mais engendrant des


dpenses consquentes dans les
pays dvelopps, il y a, au Sngal, une urgence humanitaire
pour laquelle la vaccination
est la solution adquate.
Ce texte montre bien en quoi la
sant est un enjeu primordial
pour un pays permettant le
bien-tre et lpanouissement
des populations.

Paludisme : progrs vers un vaccin


Test sur 45 enfants africains, un vaccin de lInstitut Pasteur les a protgs 70 %. Par
ailleurs, lefficacit long terme de moustiquaires imprgnes dinsecticide est dbattue.

est la semaine des bonnes


nouvelles dans la lutte
contre le paludisme. Alors
quun rapport rendu public lundi 12 confirme le recul de cette
maladie en Afrique (Le Monde du
14 septembre), une quipe inter-

90

nationale conduite par le Pr Pierre


Druilhe (Institut Pasteur, fondateur de linitiative vac-4-all )
annonce dans le New England
Journal of Medicine des rsultats
trs encourageants dun candidat
vaccin appel MSP3.

Le systme immunitaire (Term)

Dans une tude prliminaire


incluant 45 jeunes enfants au
Burkina Faso, cette approche a
induit une protection de 64 77 %.
Jusquici, la plupart des essais vaccinaux ont chou, du fait de la
complexit et de lextrme variabi-

lit du Plasmodium falciparum, le


parasite responsable. La protine
MSP3 prsente lavantage dtre
identique dun parasite un autre,
laissant esprer une protection
plus universelle. Si son efficacit se
confirme lors de plus vastes tudes

(dj en cours), le vaccin pastorien


pourrait bien concurrencer, et
bien moindre cot, le vaccin RTS,
S (dvelopp par GSK et soutenu
par la Fondation Gates), en phase
finale dessai.
Autre bonne nouvelle sur le front
de la prvention, la mortalit des
enfants de moins de 5 ans a chut
de 23 % dans les foyers quips
de moustiquaires imprgnes
dinsecticide, selon des donnes
provenant de 22 pays, publies le
6 septembre dans PLoS Medicine
par Stephen Lim (Universit de
Washington). Un taux rapporter
aux 800 000 dcs annuels par
paludisme en Afrique, continent
de loin le plus touch. Quelques
tudes menes dans des pays
africains engags dans des programmes de prvention avaient
dj conclu que les moustiquaires
imprgnes rduisent significativement le nombre daccs palustres et
la mortalit infantile. Mais ces statistiques, parcellaires et obtenues
dans des conditions contrles ,
ne permettaient gure de conclure
sur lampleur des bnfices en utilisation de routine.
Les chercheurs ont pass au
crible 29 enqutes menes dans
22 pays africains depuis 2000.
Dans la majorit dentre eux,
lquipement du foyer familial en
moustiquaires de lit imprgnes
dinsecticide a t suivi dun recul
de la mortalit infantile : - 76 % au
Congo, - 68 % au Kenya, de lordre
de - 10 % au Mali, au Nigeria et

au Rwanda. Aprs pondration,


la diminution moyenne est de
23 %. Paralllement, la proportion
denfants porteurs du parasite
du paludisme dans le sang tait
abaisse de 20 % dans les familles
possdant une moustiquaire.

Taux de rsistance
Les auteurs de cette tude finance par la Fondation Gates voient
l un argument de poids en faveur
de la poursuite des programmes
de prvention. Ces donnes
confirment notre impression dun
recul du paludisme en Afrique,
mais elles restent assez globales,
commente le Pr Martin Danis, du
Centre national de rfrence du
paludisme (Paris). Ainsi, on ne
sait pas vraiment si les moustiquaires distribues sont rellement utilises chaque nuit, la
saison des pluies en particulier,
et dans quelles conditions.
Surtout, les spcialistes franais
restent dubitatifs quant au succs
long terme de cette stratgie, au
vu des rsultats dune tude de
Jean-Franois Trape (chercheur
lInstitut de recherche pour le
dveloppement, IRD de Dakar)
rcemment publis dans The
Lancet Infectious Diseases. Chez
les habitants dun petit village
du Sngal, la distribution de
moustiquaires imprgnes a fait
sensiblement reculer les cas de
paludisme en quelques semaines.
Mais, moins de trois ans plus tard,
une recrudescence des crises tait

POURQUOI
CET ARTICLE ?
Cet article traite de la lutte
contre le paludisme avec la
fabrication dun candidat vaccin, le MSP3. Le paludisme cause
environ 800 000 dcs par an
en Afrique, il y a donc une urgence humanitaire trouver les
meilleurs traitements.
Ce nouveau vaccin ralis
partir de la protine MSP3
prsente sur tous les parasites
permettrait une bonne protection des individus.
Autre moyen daction, les
moustiquaires insecticides ont
permis de rduire de 23 % la

dj constate dans la population, particulirement chez les


enfants de plus de 10 ans et les
adultes. Et le taux de rsistance
des moustiques aux pyrthrodes,
insecticides de rfrence, avait
grimp en flche.
Le succs des moustiquaires
imprgnes est fragile pour trois
raisons, synthtise Jean-Franois Trape. Dabord, cause du
dveloppement de rsistances
des anophles aux insecticides.
Ce phnomne, qui est en train
dexploser dans toute lAfrique,
parat davantage proccupant que
celui des rsistances des parasites aux antipaludens. Autre
cueil : en prvenant les piqres

mortalit infantile en Afrique


due au paludisme. Toutefois,
leur efficacit est controverse. En effet, lapparition
dune rsistance de lanophle
linsecticide, un moins bon
dveloppement des dfenses
immunitaires chez les jeunes
enfants en l'absence de piqres
dinsectes et lapparition de
parasites plus infectants ont
t constats.
Ce texte, ainsi que les prcdents, vous permettent
dillustrer des sujets relatifs
aux vaccinations. Ce sont
des exemples et chaque cas
soulve des problmatiques
diffrentes.

de moustique, les moustiquaires


freinent lacquisition de dfenses
immunitaires contre le paludisme
chez les jeunes enfants. Ceux-ci
restent donc vulnrables, notamment aux formes graves, poursuit
le chercheur. Enfin, la proportion
dindividus porteurs de Plasmodium a chut, mais ces parasites
sont dsormais beaucoup plus
infectants. Il y a quelques annes,
il fallait plusieurs centaines de
piqres de moustiques infects
pour induire un accs palustre ;
aujourdhui, quelques-unes suffisent.
Sandrine Cabut
(17 septembre 2011)

Le douteur est le vrai savant


Doute et recherche scientifique.

Il faut douter
mais ne point
USFTDFQUJRVFx

La philosophie inhrente la
recherche scientifique nest pas
une philosophie sceptique au sens
radical du terme. Elle repose sur
la confiance dans la possibilit
de connatre toujours mieux le
monde dans lequel nous vivons.
Le connatre non seulement pour
le plaisir de lmerveillement,

mais pour agir mieux, en fonction


de connaissances qui samliorent. Le sceptique ne croit pas
la science , disait Claude Bernard,
il croit lui-mme ; il juge que
tout est opinion, et que toutes les
opinions se valent. Le douteur,
continue C. Bernard, est le vrai
savant ; il doute de lui-mme et
de ses interprtations, mais il
croit la science . C. Bernard se
rfre explicitement Descartes,

qui part dun doute universel


pour arriver des connaissances
indubitables , et qui soient
utiles la vie , comme il le
dit dans le Discours de la mthode. Descartes sen explique
fort bien quand il conte quil a pris
conscience davoir dans la tte
un fatras dopinions, et davoir
essay de draciner de son esprit
toutes les erreurs qui sy taient
pu glisser : Non que jimitasse

pour cela les sceptiques, qui ne


doutent que pour douter et affectent d tre toujours irrsolus, car,
au contraire, tout mon dessein ne
tendait qu massurer et rejeter
la terre mouvante et le sable pour
trouver le roc ou largile . Le
doute de Descartes est un doute
mthodologique, cest--dire un
moyen de dgager des vrits qui
rsistent au doute, des vrits
certaines. C. Bernard, ayant salu

Le systme immunitaire (Term)

91

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LES ARTICLES DU

LES ARTICLES DU

Sortir du doute
Majorer lincertitude, cest paralyser laction. valuer un risque
incite agir pour le matriser,
et agir, cest sortir du doute. Les
mdecins sont depuis longtemps
familiariss avec cette ralit. Par
exemple, les cardiologues se sont
intresss au risque coronarien :
quels sont les facteurs qui influencent ce risque ? Plusieurs ont
t identifis : hypertension, tabagisme, temprament colrique...
Sur le rle du cholestrol il y avait
hsitation : tait-ce un rel facteur
de risque, ou seulement un marqueur du risque ? La recherche
sest poursuivie, jusqu ce quen
1984 un groupe de travail qui
faisait le bilan des connaissances
conclue quon avait maintenant
assez dindices concordants
(cliniques, pidmiologiques,
exprimentaux, gntiques)
pour pouvoir affirmer quil cesse
dtre raisonnable de douter que
lhypercholestrolmie pse sur
le risque coronarien. Il sensuivait, aux yeux des mdecins, quil
fallait prendre pour objectif la
rduction du taux sanguin de cholestrol chez les personnes menaces par la maladie coronarienne.
Des mdicaments anti-cholestrol
ont t dvelopps. La rduction
du taux de cholestrol sanguin a

92

t inscrite dans les programmes


de sant publique. Des millions
de gens prennent maintenant
tous les jours leur mdicament
hypolipmiant (type : statines).
Cela ne signifie ni que lhypercholestrolmie est une maladie,
ni que le cholestrol en soi est
toxique. Il reste un doute sur le
rle exact du cholestrol dans la
maladie des coronaires. Ce qui
est intressant est que des chercheurs ont discern un moment
o lon franchit un seuil beyond
reasonable doubt, un moment
o, donn ce quon sait, continuer
douter (et donc ne rien faire)
devient draisonnable. Ce qui apparat alors comme raisonnable,
puisquil reste un doute, est de
prendre ce quon appelle une
prcaution (ici, un mdicament).
Les mdecins sont la fois chercheurs et prescripteurs. Habituellement ce nest pas le rle du
chercheur de prescrire les actions
engager. Les chercheurs ont une
obligation dvaluer les risques,
de dire quelle part du risque est
ventuellement matrisable et
par quels moyens, et dinformer
leurs concitoyens quand ils jugent
quon a pass le seuil au-del duquel douter de la ralit du risque
devient moins raisonnable que
de le prendre au srieux (cest
ce qua fait le Giec : Groupe dexperts intergouvernemental sur
lvolution du climat). Il revient
ensuite aux dcideurs de prendre

Le systme immunitaire (Term)

leurs responsabilits. Des considrations extrieures la dmarche


scientifique interviennent alors,
touchant le bien-tre collectif, le
respect de certaines valeurs, et tout
ce qui entre dans un projet de socit. Le rapport de Nicholas Stern
montre comment la dmarche du
dcideur chappe lemprise du
scientifique. Le dcideur retient
quil y a une marge dincertitude
sur le rchauffement, mais quon
estime du ct des climatologues
quil devient draisonnable de rester dans le doute, cest--dire, de ne
rien faire. Que faire, donc ? Dune
part, rflchir aux prcautions
prendre dans lhypothse o les
scientifiques ont raison, et les valuer. Ensuite, raisonner. De deux
choses lune, ou bien on prend
ces prcautions, ou bien on ne les
prend pas. Si on ne les prend pas et

POURQUOI
CET ARTICLE ?
Cet article conclut les lectures
prcdentes et propose une
rflexion philosophique sur le
doute et la recherche scientifique. Quelles sont les motivations des chercheurs ?
Doute, incertitude, mesures
prventives quel moment
certaines actions sont-elles
dclenches, notamment en
lien avec une estimation des

que les scientifiques se trompent,


tout va bien. Si on ne les prend pas
et que les scientifiques ont raison,
lavenir apparat dsastreux. Si on
les prend et que les scientifiques se
trompent, cest beaucoup defforts
coteux pour rien. Si on les prend
et que les scientifiques ont raison,
on aura fait le maximum pour prparer lavenir. Il sagit donc de peser
leffort faire, en face des dgts si
on ne le fait pas. Construire lavenir
conduit au-del du doute.

LE GUIDE PRATIQUE

Pr Anne Fagot-Largeault,
chaire de Philosophie
des sciences biologiques
et mdicales (2000-2009),
membre de lInstitut,
dlgue de lAcadmie des sciences,
Sance solennelle de rentre
des cinq Acadmies
(27 octobre 2010)

risques, par exemple, en matire de sant ou denvironnement ?


Il est intressant que vous
puissiez faire le lien entre la
recherche scientifique et la
rflexion philosophique et
permettre le dcloisonnement
des matires.
Ces rflexions peuvent vous
tre utiles lors dun examen
oral et vous donnent loccasion
de montrer vos connaissances
gnrales.

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

Descartes, conclut par une sorte


de devise du savant : il faut douter mais ne point tre sceptique .

PREUVE
CRITE DE TermS
t Coefficient : 6 ou 8 pour les candidats ayant choisi la SVT comme
enseignement de spcialit.
t La partie crite est sur 16 points ;
la partie pratique compte pour
4 points.
t Dure : 3 h 30.
Partie 1
t Cette premire partie est une
question sans document (sur 8
points) qui permet de valider
les connaissances acquises par
le candidat dans l'une des sept
parties valuables du programme
de lenseignement obligatoire.
Partie 2
t Cette seconde partie de
lpreuve valide la pratique du
raisonnement scientifique et
porte sur une ou deux partie(s)
valuable(s) du programme,
diffrente(s) de celle de la partie 1 :
le premier exercice permet dvaluer la capacit extraire dans un
document des informations utiles
la rsolution du problme scientifique pos (sur 3 points) ;
le second exercice permet dvaluer, partir de lexploitation de
deux ou trois documents, la capacit
rsoudre le problme scientifique
pos, en relation avec les connaissances du candidat (sur 5 points).
t Pour les candidats qui nont suivi
que lenseignement obligatoire, le
deuxime exercice peut porter, ou
non, sur la mme partie du programme que le premier exercice.
Pour les candidats ayant choisi la
spcialit SVT, le second exercice
porte sur lun des trois thmes du
programme de spcialit.
t Dure : 15 minutes ; prparation :

PREUVE ORALE
DE CONTRLE
TermS
15 minutes.

t Lexaminateur propose au choix

du candidat deux sujets se rapportant deux parties diffrentes :


le programme commun ou le
programme de spcialit pour un
des sujets, pour les candidats ayant
choisi cet enseignement.

94

Le guide pratique

LE GUIDE PRATIQUE

Mthodologie et conseils

Pour les Terminales S


I. Partie 1
Dans la partie 1 de lpreuve, on vous demande un
expos organis de connaissances portant sur un
point bien dlimit du programme. Attention ne
pas faire une rcitation de cours mais un vritable
expos scientifique, construit et argument.
Il est impratif de construire un plan comportant
une introduction, des paragraphes identifis par des
titres et une conclusion.
Pour tablir le plan, notez au brouillon les diffrentes notions auxquelles le sujet fait rfrence,
puis affectez-leur un numro dordre.
Lintroduction doit prsenter le sujet et la faon
dont on va le traiter, tandis que la conclusion fait la
synthse de lexpos.
Si on vous demande des schmas, faites-en une premire bauche au brouillon. Noubliez pas de les titrer
et de les lgender soigneusement.
II. Partie 2 Exercice 1
Lobjectif de cette partie 2 est dvaluer vos comptences
dans la pratique dun raisonnement scientifique par
deux types dexercices diffrents.
Il sagit de vrifier votre capacit extraire des informations dun document pour rpondre un problme
scientifique donn.
Selon le cas, les informations rcoltes peuvent servir
formuler une hypothse, expliquer un phnomne,
soutenir une thorie, etc.
Vous devez donc la fois fournir une analyse du
document, que vous avez trs probablement tudi

pendant lanne, et noncer les conclusions que vous


pouvez en tirer.
Vos arguments doivent tre correctement ordonns
et tays ; attention ne pas tomber dans le travers
frquent du catalogue dides.
Notez que, si vos connaissances sont utiles pour
comprendre le document, elles ne sont pas restituer
dans la rdaction de la rponse.
Dans cet exercice, cest la qualit du raisonnement qui est principalement value (mme si
des connaissances sont bien sr ncessaires pour
raisonner correctement).
III. Partie 2 Exercice 2
Cette partie de lpreuve est la seule qui diffre selon
les candidats. Si vous avez choisi lenseignement
de spcialit, lexercice porte sur un programme
spcifique en SVT. Si vous avez choisi une autre
spcialit, elle porte sur le programme commun.
Il sagit ici dvaluer votre capacit rsoudre un
problme scientifique clairement indiqu dans le
sujet, par une analyse de deux ou trois documents
qui nont pas t ncessairement tudis en classe
et qui mobilisent vos connaissances.
Attention, lordre de prsentation des documents ne correspond pas forcment lordre logique de leur analyse.
Il faut donc mettre en relation les informations tires
des documents avec vos connaissances pour construire
une argumentation logique et laborer une synthse
cohrente permettant de rpondre au problme pos.
Sil vous est demand de construire un schma-bilan,
noubliez pas de le lgender et de lannoter avec soin.

Pour les PSFNJSFT&4FUI. Commentaire argument


Il est important dnoncer clairement la problmatique
ds le dbut de votre texte. Elle peut tre exprime sous
la forme dune question.
Votre argumentation doit sappuyer sur les donnes
scientifiques fournies par les documents des questions prcdentes, mais aussi sur vos connaissances
scientifiques acquises. De plus, votre rflexion peut
apporter tous les lments dactualit, et/ ou de
diffrents champs disciplinaires en lien avec la problmatique, qui permettent un clairage intressant
et qui appuient votre raisonnement.
La rdaction de votre texte doit respecter les consignes
concernant la forme dexpression : mail, article de
presse, article scientifique et tenir compte de lmetteur du texte et du rcepteur. Nhsitez pas utiliser
des connecteurs logiques (donc, parce que, etc.) permettant de mettre en relief votre argumentaire.
II. tude de documents
Il sagit dutiliser au maximum les informations
apportes par les documents. Bien reprer pour chaque
question le ou les documents concerns. Pour cela, il faut
lire lensemble du sujet et toutes les questions avant de
commencer rpondre.
Soyez prcis dans vos rponses et lorsquil sagit dun
graphique, citez des valeurs chiffres.
Certaines rponses font galement appel vos connaissances pour la comprhension du document : ainsi,
aprs avoir comment ou dcrit le document, utilisez
vos connaissances pour expliquer les rsultats observs.
Mettre en lien les diffrents documents se rvle
souvent indispensable pour une rponse complte et
montre votre raisonnement et votre comprhension
globale des phnomnes ou des mcanismes tudis.
Si on vous propose un QCM, il est important de bien lire
la question pour ne pas faire derreur et reprer sil faut
cocher les phrases justes ou bien les fausses, ou encore
celles qui justifient une exprience ou une conclusion.
Soignez la rdaction, rdigez clairement les rponses.

Conseils pour les rvisions


Au cours de lanne, au fur et mesure des chapitres,
ralisez des fiches o figurent lessentiel du cours,
ainsi que les schmas importants connatre. Ce
travail vous permet de trier les points importants et
les points secondaires, de mmoriser le cours et de
vrifier votre comprhension des notions. Ces fiches
vous seront dune grande utilit pour une rvision
avant les preuves.
Ralisez un rpertoire de dfinitions des termes cls.
En biologie, il y a beaucoup de termes spcifiques et
leur utilisation bon escient montre au correcteur
que vous avez une bonne matrise de votre cours.
Travaillez le plus possible sur les annales afin de
bien comprendre ce que lon attend de vous. Un
certain nombre de sujets reviennent rgulirement
sous une forme un peu diffrente et une premire
approche peut vous tre utile.
Rviser en groupe permet de sinterroger mutuellement et de saider si ncessaire. Cela permet de

travailler de faon efficace, motivante et sympathique


lorsque le groupe est dans une logique de russite et
de coopration.

Dvelopper votre culture gnrale


Tout particulirement en premire ES et L, mais
galement en Terminale, les sujets font de plus en
plus appel votre culture gnrale. Celle-ci vous sera
galement utile pour la suite de vos tudes, pour des
concours ou des entretiens.
Suivez les grandes lignes de lactualit rgulirement (radio, tlvision, presse crite : journaux,
Internet) et approfondissez, par des lectures, les
sujets qui peuvent se rfrer au programme.
Les articles du Monde proposs ici visent vous faciliter cette ouverture sur lactualit et la mise en lien
avec les recherches scientifiques et le cours enseign.

Gestion du temps pendant


lpreuve
Il important de vous fixer une dure de travail
pour chacune des parties du sujet et de vous y
contraindre dans une certaine mesure. Ne pas traiter
une partie entrane une baisse consquente de la
note. Mme si vous ne matrisez pas bien une partie
du sujet, il faut absolument traiter tout le sujet.
Placez votre montre bien en vidence et contrlez
lheure rgulirement.
Consacrez un quart dheure en dbut dpreuve pour
lire tranquillement lensemble du sujet et vous
concentrer.
Prvoyez 5 10 minutes avant la fin du sujet pour
une relecture avec une correction des fautes
dorthographe.

Gestion du stress pendant


les examens
Grer ses motions est important pour tous et essentiel pour ceux qui ont un vritable trac au moment des preuves. Celui-ci peut venir dun manque
de confiance en soi ou de la peur de lchec. Si vous
avez travaill rgulirement pendant lanne, vous
pouvez tre confiant. Il y a suffisamment de matires
pour vous donner toutes les chances de russir.
Il faut galement relativiser les consquences de
lchec dans une preuve puisquil peut y avoir
compensation avec les autres matires. Se dtendre
entre les preuves et faire du sport est un bon moyen
pour limiter le stress. Des rvisions intensives les
veilles dpreuves sont souvent inefficaces.
Apprenez vous concentrer au moment de
lpreuve. Si vous tes trs motif, la lecture calme
du sujet en dbut dpreuve et le travail au brouillon
vous permettront de vous apaiser.
loral, respiration profonde, calme et concentration
sont indispensables avant lexamen.

PREUVES
ANTICIPES
1re ES ET L
Partie 1
t6OEFTEFVYUINFTDPNNVOT
aux SVT et aux SPC : Reprsentation visuelle ou Nourrir
lhumanit (8 points)
t Llve doit prsenter une argumentation scientifique sur des questions de socit, sur les avantages et
limites des avances scientifiques
ou sur des problmatiques de sant
ou de dveloppement durable. Il fait
preuve desprit critique. Il est amen
mobiliser ses connaissances.
Entre un et trois documents prsentent des donnes scientifiques et/
ou relatives des faits dactualit.
Partie 2
t Un des deux thmes suivants
(6 points) :
le thme spcifique aux SPC,
Le dfi nergtique ;
le thme commun aux SVT et
aux SPC qui na pas fait lobjet de
la question de la premire partie.
t-WBMVBUJPOQPSUFTVSMFTBDRVJT
de SPC.
Partie 3
t Un des deux thmes suivants
(6 points) :
le thme spcifique des SVT,
Fminin-masculin ;
le thme commun aux SVT et
aux SPC qui na pas fait lobjet de
la question des deux prcdentes
parties.

PREUVE
ORALE DE
CONTRLE
1re ES ET L
t Dure : 15 minutes ; prparation :
15 minutes.
t Llve est amen mobiliser
des connaissances et mettre en
uvre un raisonnement au cours
dune interrogation dialogue.
t Le candidat choisit un des deux
sujets proposs par les examinateurs. Lun porte sur lun des deux
thmes communs du programme,
lautre porte sur lun des thmes
spcifiques en SPC ou en SVT.
Le guide pratique

95

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LE GUIDE PRATIQUE

Crdits
NOURRIR LHUMANIT
Vers une agriculture durable
p. 6 iStockphoto.
p. 8 Tracteur Istockphoto/ Thinkstock ; Graphique RDE.

Qualit des sols et de leau


p. 13 RDE.
p. 14 Schma RDE ; Graphiques RDE. p. 15 Fond papier DR

Les aliments dans notre assiette, qualit et conservation


p. 18 Comstock/ Thinkstock. p. 19 Schma RDE.
p. 20 Salmonelle Hemera/ Thinkstock ; Schma RDE.

FMININ-MASCULIN ET PROCRATION
Devenir homme ou femme : du sexe gntique au sexe phnotypique
p. 27 Schma RDE.
p. 28 Schma RDE. p. 29 : Farinelli DR.

La rgulation de la fonction reproductrice


p. 32 Schma RDE. p. 33 Schmas RDE.
p. 34 Spermatozodes Joshua Resnick/ Fotolia. p. 35 Schma RDE ; Vue de spermatozodes au
microscope Duncan Smith/ Photodisc/ Thinkstock.

Fcondation, grossesse et techniques de procration mdicalement assiste


p. 38 Schmas RDE. p. 39 RDE.
p. 40 Comstock/ Thinkstock.

Prendre en charge sa vie sexuelle (contraception, contragestion, prvention des IST)


p. 44 Photodisc/ Thinkstock. p. 45 Istockphoto/ Thinkstock.
p. 46 Graphique RDE. p.47 Wavebreak Media/ Thinkstock.

p. 53 RDE.
p. 54 RDE.

La ligne humaine
p. 58 Caryotypes RDE ; Pierre polie et pierre taille iStockphoto/ Thinkstock. p. 59 RDE.
p. 60 Schmas RDE.

STABILIT ET VARIABILIT DES GNOMES


Gnomes et innovation gntiques
p. 64 Recherche Comstock/ Thinkstock ; Squences protiques RDE. p. 65 RDE.
p. 66 Mutation ADN RDE ; ADN Stockbyte/ Thinkstock. p. 67 Gne Hox RDE ; Chane dADN
iStockphoto/ Thinkstock.

Miose et fcondation
p. 70 Schmas RDE.
p. 72 Schmas RDE. p. 73 Chromosomes Hemera/ Thinkstock ; Schmas RDE.

LE SYSTME IMMUNITAIRE
Le Sida, une maladie du systme immunitaire
p. 76 Schmas RDE. p. 77 Graphique RDE.
p. 78 RDE.

Les mcanismes immunitaires


p. 82 RDE. p. 83 RDE.
p. 84 Schma RDE ; Trponme ple Hemera/ Thinkstock.

Les vaccins et la mmoire immunitaire


p. 86 Photos.com/ Thinkstock. p. 87 Schma et graphique RDE.
p. 88 Seringues Hemera/ Thinkstock ; Graphique RDE.

PRATIQUE : CONSEIL ET MTHODE


p. 93 iStockphoto.
p. 94 iStockphoto. p. 95 DR.

rue des coles, 2011-2012. Reproduction, diffusion et communication interdites sans accord pralable de rue des coles.

LHISTOIRE DE LA VIE
La recherche de parent chez les vertbrs

HORS-SRIE

Rviser son bac


avec

SCIENCES CO.
e
mm
a
r
g
Pro minale
er
de T

SRIE ES
LESSENTIEL DU COURS
tDes fiches synthtiques
tLes points cls
du programme
tLes dfinitions cls
tLes repres importants
DES SUJETS DE BAC
t 22 sujets comments
t Lanalyse des sujets
t Les problmatiques
t Les plans dtaills
t Les piges viter

3:HIKPNJ=]U\^UV:?a@k@k@b@f;

M 05398 - 1 H - F: 7,90 E - RD

Hors-srie Le Monde, avril 2012

DES ARTICLES DU DFE;<


t Des articles du Monde
en texte intgral
t Un accompagnement
pdagogique de chaque
article
UN GUIDE PRATIQUE
t La mthodologie
des preuves
t Astuces et conseils
En partenariat avec