Vous êtes sur la page 1sur 138

Site Web : www.microbes-edu.

com
Cours de Bactériologie Générale

Objectifs : Connaître les principes de classification des organismes vivants et la place


des procaryotes

DEFINITIONS, CLASSIFICATION ET NOMENCLATURE DES


BACTERIES

PLACE DES BACTERIES DANS LE MONDE VIVANT

En 1673, Antoni Van Leeuwenhoek (1632-1723) fut le premier à observer les


bactéries qu’il appela animalcules. En plus de la première description des globules rouges
et des spermatozoides, ce drapier hollandais observa pour la première fois les bactéries
et décrivit leur différentes formes.

Ce n’est que deux siècles plus tard que le rôle des bactéries dans les processus de
fermentation et dans la transmission des bactéries a été découvert et que leur étude a
commencé. Les scientifiques les plus illustres de cette époque furent Louis Pasteur et
Robert Koch.

Louis Pasteur Robert Koch

L’universalité du code génétique a montré que tous les organismes vivants, eucaryotes et
procaryotes, descendent d’un seul et même ancêtre. L’étude de gènes existants chez
tous les êtres vivants, du fait de fonctions métaboliques particulièrement importantes,
comme ceux codant pour les ARN ribosomiques, a montré que leurs séquences ont peu
varié au cours des âges et que la comparaison de ces séquences permet de trouver les
relations existant entre organismes.

Les procaryotes, présents à l’origine de la vie, ont donné naissance aux


Archaebactéries et aux Eubactéries donnant le classement suivant :
 la branche des Eucarya (ou eucaryotes avec 4 règnes : animal, végétal,
champignons, et protistes),
 la branche des Archaea (archaebactéries vivant dans les milieux hostiles :
méthanogènes, halophiles, Sulfolobus),
 la branche des Eubacteria (bactéries proprement dites).

Grâce aux études comparatives, il est proposé un autre classement, plus ou moins
arbitraire, des formes de vie en 5 règnes, tous issus directement d’un ancêtre commun :

 les Monères (ensemble des procaryotes, cellules sans noyau),


 les Protistes (ensemble des procaryotes unicellulaires avec noyau),
 les Mycètes (ou champignons, qui regroupent les organismes eucaryotes
hétérotrophes et possédant une paroi),
 les Végétaux (organismes autotrophes avec paroi),
 les Animaux (organismes eucaryotes hétérotrophes sans paroi).

La séparation entre les Monères et les autres règnes est facile. Les limites entre les
quatre autres règnes sont plus floues.

Dans aucune classification, les virus ne forment un règne en tant que tel. Ils ne sont pas
considérés comme des êtres vivants. Les virus sont classés en ordre, famille, genre, et
espèce.

De nombreuses théories existent sur la phylogénie des êtres vivants : l’arbre


phylogénique représenté ici exprime l’une des théories.

Organisation des cellules eucaryotes et procaryotes

Structure cellulaire eucaryote procaryote


Taille 2 - 20 mm 0,3 - 2,5 µm
Noyau présence absence
plusieurs chromosomes un seul chromosome
Nucléole présence absence
Membrane nucléaire présence absence
Mitochondrie présence absence
Lysosome présence absence
Appareil de Golgi présence absence
Réticulum endoplasmique présence absence
Ribosome présence présence
association au RE
rugueux

TAXONOMIE ET CLASSIFICATION DES BACTERIES

Chaque fois que l’homme attribue un nom à des objets, il fait un classement. La
taxonomie est l’ensemble des principes et théories qui permettent de classer et de
valider le classement des organismes.

Les microorganismes sont classés en taxons, ou groupes, sur la base de leurs relations
phénétiques et/ou phylogénétiques. La classification des bactéries est maintenant
établie de manière phylogénétique. Les méthodes moléculaires utilisées permettent de
connaître les relations entre les bactéries.
Les bactéries peuvent être divisées en 12 groupes qui ont été définis à partir de l’analyse
de l’ARN ribosomal 16S et 23S.

L’espèce est l’unité fondamentale de la classification. Elle regroupe les organismes qui
possèdent de nombreux caractères communs. Cependant à l’intérieur d’une même
espèce, il est possible de distinguer des souches et des clones.
Une souche est la sous-division d’une espèce.
Un clone est une population descendant d’une même souche.

Les noms attribués aux bactéries n’ont pas de sens taxonomique. Ils donnent cependant
un nom à une souche bactérienne isolée d’un produit pathologique sans aucune
ambiguïté.

La classification bactérienne n’est pas forcément bien adaptée à la pathologie. En


bactériologie médicale, on peut classer les bactéries selon une classification clinique : les
bactéries sont la cause de grands syndromes (méningites, endocardites…) ou selon une
classification pathogénique : maladies dues à une même bactérie (staphylocoques,
mycobactéries…) ou un même mécanisme pathogénique (toxi-infections…).

Les bactéries peuvent être classées selon leurs caractères :

 biochimiques (classification en biotypes ou biovars)


 antigéniques (classification en sérotypes ou sérovars)
 pathogéniques (classification en pathotypes ou pathovars)
 enzymatiques (classification en zymotypes ou zymovars)
 de sensibilité aux antibiotiques (classification en antibiotypes)
 de sensibilité aux bactériophages (classification en lysotypes ou lysovars)
 moléculaires : identification de l’ADN par ribotypie, hybridation ADN-ADN,
hybridation ADN-ARN,séquençage de l’ARN ribosomique, etc

Les bactéries peuvent aussi être classées selon :

 la coloration de Gram
 la morphologie
 la mobilité
 la capacité à sporuler
 la température de croissance
 les besoins nutritionnels
 le mode respiratoire
 la capacité de photosynthèse
 l’utilisation des différentes sources de carbone ou d’azote
 le G+C% du génome.

NOMENCLATURE DES BACTERIES

La nomenclature est l’ensemble des règles qui régissent l’attribution d’un nom à chaque
taxon distinct. Elle est universelle.

D’une manière générale, la classification des êtres vivants est hiérarchisée ainsi :

Les noms des bactéries sont désignés par deux noms latins : le nom de genre, écrit avec
une majuscule, est suivi du nom d’espèce, écrit en minuscule. L’ensemble du nom est
écrit en italiques (Ex. : Escherichia coli).
Espace Etudiant
Cours de Bactériologie Générale

ANATOMIE - STRUCTURE

Objectifs d'aujourd'hui

Qu'est-ce qu'une bactérie ?


Comment la voir ou la mettre en évidence ?
Quelles sont ses principales caractéristiques morphologiques et structurales ?
Intérêt médical de connaître la morphologie et la disposition des bactéries ?

A - DECOUVERTE DES BACTERIES

. Que penser d'un examen macroscopique d'urine ?

La première mise en évidence des bactéries a été


possible avec un miscroscope simple fabriqué par
Anthonie van Leeuwenhoeck, drapier hollandais
(1632-1723).
Pour en savoir plus.

Ainsi il décrit dans la salive de "Très nombreux


animalcules.....autant d'habitants que sur la
planète"

Un microscope de type Stiassine (début 1800)

B - METHODES D'ETUDE

Compte tenu de leur taille (de l'ordre du micron), elles seront visualisées par le
microscope.

. microscopie électronique (G x >10.000


fois)
. microscopie optique (G x 1000 -1500 fois)

La présence de bactéries est habituellement recherchée avec un


microscope optique sans coloration (état frais) ou après coloration
(cf travaux pratiques).

. état frais : voici un examen d'urine mettant en évidence des


polynucléaires neutrophiles (G x 400)

. après coloration : voici un examen de pus urétral après avoir


coloré la lame avec une solution de bleu de méthylène : il y a mise
en évidence de polynucléaires neutrophiles ayant phagocyté des
bactéries de type diplocoque (G x 1000)

. Diverses techniques de coloration existent, mettant en évidence des affinités


tinctoriales différentes telle la coloration de Gram, très utilisée en pratique courante ou
encore celle de l'imprégnation argentique pour révéler les spirochètes ou encore celle
révélant le caractère acido-alcoolo-résistant de certains bacilles (BAAR ou
mycobactéries).

C - DEFINITION D'UNE BACTÉRIE

Etre unicellulaire de petite taille (microorganisme, micron) de morphologie différente qui


présente des caractéristiques propres (Procaryote).
D - CARACTERISTIQUES DES PROCARYOTES

Tableau 1: Quelques caractères distinctifs des procaryotes et eucaryotes

Haut

E - LES PRINCIPAUX ELEMENTS

LES ENVELOPPES

1. La capsule

Ce constituant inconstant est le plus superficiel. Sa mise en évidence s'effectue par


coloration négative (le colorant, encre de Chine ou Nigrosine est repoussé par la capsule
et apparaît en clair sur fond noir).
Exemple:

Méningite à Cryptococcus chez un Autre exemple de mise en évidence (par


sidéen coloration) :
Constitué de polysaccharides acides (sucres sous forme d'acides uroniques tel l'acide
galacturonique, l'acide glucuronique, mais aussi sous forme de sucres phosphorés), ce
composant est lié à certains pouvoirs pathogènes, car il empêche la phagocytose.

Elle peut se trouver à l'état soluble dans les liquides de l'organisme (emploi dans le
diagnostic = recherche d'antigène soluble).

Elle intervient dans l'identification infra-spécifique. Ce typage est une des méthodes de
reconnaissance des épidémies.

Les polymères capsulaires purifiés sont la base de certains vaccins(Streptococcus


pneumoniae, Haemophilus influenzae).

2. Le glycocalyx

Ce sont des fibres polysaccharidiques


ou polymères extrêmement fréquents
entourant la bactérie et difficiles à
visualiser en microscope électronique. Le
feutrage des fibres de glycocalyx est
constant dans le cas de bactéries vivant en
biofilm dans les conditions naturelles.

Il est responsable de l'attachement des bactéries aux cellules (cellules buccales,


respiratoires......) ou à des supports inertes (plaque dentaire sur l'émail dentaire,
biofilms sur les cathéters, ou encore les prothèses dans le cas de bactéries d'intérêt
médical). Il protège les bactéries du biofilm de la dessiccation, sert à concentrer ou
modifier les éléments nutritifs exogènes et rend les bactéries résistantes: antiseptiques,
désinfectants, antibiotiques.

Certaines structures sont plus grosses,


protéiques, fibrillaires et rigides (fimbriae ou
pili) qui permettent l'attachement spécifique
des bactéries sur les cellules, phase
essentielle dans certains pouvoirs pathogènes
(Escherichia coli de certaines infections
urinaires).

Des virus bactériens ou bactériophages peuvent infecter la bactérie


après fixation sur certains pili, dits sexuels (cf génétique)

3. La paroi

Un exemple de mise en évidence après un traitement antibiotique de type ß-lactamine


. Définition : enveloppe rigide assurant l'intégrité de la bactérie, donc responsable de la
forme des cellules. Elle protège des variations de pression osmotique (mer). Elle est
absente chez les Mollicutes (Mycoplasma). En dehors de bactéries halophiles ou
thermophiles, la partie commune à toutes les parois bactériennes est le
peptidoglycane, enveloppe la plus interne.

Le peptidoglycane est un hétéropolymère composé de chaînes glucidiques reliées


les unes aux autres par des chaînons peptidiques (pentapeptide). La macromolécule
réticulée tridimensionnelle est ainsi constituée et sa solidité dépend de l'importance des
interconnexions. La paroi de la bactérie est ainsi une unique macromolécule.

. Composition : La chaîne
polysaccharidique est formée
de chaînons N-Acétyl
Glucosamine - Acide N-Acétyl
Muramique. Les chaînes
peptidiques formées au
minimum de quatre
aminoacides (par exemple L-
Alanine - D-Glycine - L-Lysine -
D-Alanine) sont toujours fixées
sur l'acide muramique.
L'enchaînement des
aminoacides des séries D et L
est une constante. Ces
tétrapeptides sont reliés
directement entre eux ou par
une courte chaîne peptidique
(chaîne « interpeptidique»).

La biosynthèse du peptidoglycane s'effectue par sous-unités dans le cytoplasme


jusqu'à l'assemblage du disaccharide-pentapeptid (N-Acétyl Glucosamine-Acide N-Acétyl
Muramique- L-Alanine-D-Glycine-L-Lysine-D-Alanine-D-Alanine) qui traverse la
membrane cytoplasmique fixé sur un transporteur phospholipidique puis est attaché à la
chaîne glucidique de la paroi pré-existante (réaction de transglycosylation). Les chaînes
peuvent être reliées pour former la molécule réticulée finale par liaison covalente entre
les peptides (réaction de transpeptidation). D'autres enzymes sont nécessaires:
hydrolases permettant de couper les chaînes glucidiques du peptidoglycane (rôle
essentiel lors de la division), D, D carboxypeptidases coupant le dipeptide D- Alanine-D-
Alanine et réduisant le nombre des interconnexions.
Certaines étapes peuvent être
entravées par certains
antibiotiques: ß-lactamines,
glycopeptides (cf antibiotiques)
ou encore enzyme (lysozyme).

La composition variant selon


l'espèce ou le groupe
bactérien, il a été possible de
distinguer des affinités
tinctoriales différentes par la
coloration: Gram + et Gram -.

- Paroi des bactéries à Gram positif : Le peptidoglycane est le constituant majeur.


La muréine représente jusqu'à 30 % du poids sec d'une cellule. Le peptidoglycane est
très solide, les liaisons croisées entre chaînes glucidiques sont nombreuses.

- Paroi des bactéries à Gram négatif : Beaucoup plus complexe

Le peptidoglycane est en couche mince peu dense (< 15 % du poids sec). L'autre
constituant essentiel est un lipide complexe (A) couplé à la glucosamine et à des
résidus phosphore qui est amphiphile, possédant une partie hydrophobe et une
hydrophile. Il y a analogie entre les appellations « endotoxine », « lipide A » et «
membrane externe » (cf pouvoir pathogène).

Sur les résidus glucosamine, des polysaccharides complexes sont fixés et forment la
partie la plus externe de la paroi. Ils sont essentiels pour la physiologie bactérienne dans
les processus de pénétration de nutriments ou de toxiques, ils sont spécifiques de
sous-espèces ou de types et comportent des sucres originaux : antigènes O.

On trouve à l'intérieur, des phospholipides. La membrane est successivement


hydrophile (polysaccharide complexe), hydrophobe (lipide A et lipides des
phospholipides), hydrophile (têtes hydrophiles des phospholipides).

Se trouvent enchâssées des protéines qui assurent la cohésion de la membrane, une


liaison avec le peptidoglycane et des fonctions diverses de perméabilité sélective ou
non. Ces porines, seules structures de transport des composés hydrophiles, sont
essentielles à la vie de la bactérie mais aussi à l'action de certains antibiotiques. Enfin
d'autres protéines servent à la captation d'ions (fer), ou de vitamines (facteurs de
croissance). Notons les antigènes protéiques M des streptocoques.

D'autres structures existent telle chez les mycobactéries

Haut

Autres propriétés de la paroi bactérienne

Coloration de Gram : fondée sur l'action successive d'un colorant, le cristal violet,
d'iode puis d'un mélange d'alcool et d'acétone (cf TP 1). Gram(1853-1938), a été
inventeur de la coloration en 1884. Son intérêt est de donner une information rapide
et médicalement importante, car le pouvoir pathogène et la sensibilité aux
antibiotiques sont radicalement différents.

Les morphologies bactériennes sont variées. Les cellules peuvent être courtes,
pratiquement sphériques (cocci ou coques) ou allongées (bacilles).
Les bacilles sont essentiellement des
cylindres à extrémités hémisphériques mais
on en connaît aussi à extrémités fines,
pointues (formes en fuseau) ou au
contraire planes (bacilles dits « à bouts
carrés»). Certains corps bacillaires sont
incurvés (Vibrio, Campylobacter) ou
spiralés (Leptospira, Treponema).

Dans un environnement adapté, les cellules


des bactéries peuvent être associées en
groupements qui sont caractéristiques de
l'espèce.

Quelques exemples à partir de produits pathologiques (cf Internet, QCM sur la


morphologie)

- L'absence de paroi est habituellement létale pour les bactéries (Mollicutes


exceptés). Les bactéries dépourvues d'enveloppes extérieures sont les « formes L » et
les protoplastes, suite à l'action des antibiotiques (ß-lactamines) ne semblent pas
avoir un intérêt médical.

4. La membrane plasmique

selon V. Jarlier

C'est une membrane trilamellaire formée de phospholipides dont les pôles


hydrophobes sont face à face, entourant des protéines. Elle est à l'interface entre
cytoplasme et structures externes. Certaines protéines, les perméases, ont un rôle
important dans les échanges. D'autres protéines sont des enzymes respiratoires ou
impliquées dans la production d'énergie (ATPase). La membrane a ainsi un rôle
métabolique majeur : on y trouve la plupart des activités associées aux mitochondries
dans la cellule supérieure. Les flagelles bactériens y sont fixés, c'est là que se génère leur
mouvement tournant. Est est détruite par des antibiotiques (polypeptides,
antiseptiques).
LES CONSTITUANTS DU CYTOPLASME

À côté de diverses structures de stockage (mais jamais organisées), appareil nucléaire


et ribosomes sont présents dans le cytoplasme bactérien.

. Appareil nucléaire (chromosome) et plasmides (cf génétique bactérienne I)

. Ribosomes

Constitués d'ARN et de protéines, les ribosomes bactériens comportent deux sous-


unités (30 S, 50 S). Fonctionnellement, il y a deux sites essentiels pour la synthèse des
protéines : le site aminoacyl qui accueille l'acyl-tARN et le site peptidyl qui accueille la
chaîne d'aminoacides en cours de constitution.

Ils sont particulièrement présents à proximité de la membrane cytoplasmique, site de


synthèse de la paroi et des protéines exportées. Ils n'ont pas la structure des
ribosomes de cellules supérieures expliquant la spécificité propre au monde bactérien.
Des antibiotiques perturbent la synthèse des protéines à leur niveau (Tétracyclines)

LA SPORE BACTÉRIENNE

Certaines bactéries, entre autres d'intérêt


médical (genre Clostridium et Bacillus), ont
la propriété de se différencier en formes
de survie appelées spores. Elles se
présentent sous une forme végétative
métaboliquement active et potentiellement
pathogène ou métaboliquement inactive
et non pathogène (forme sporulée).

La transformation de la forme végétative en spore est la sporulation :

. Temps : 6 à 8 heures à 37°C pour Bacillus subtilis.

. Conditions : déclenchée par des modifications de l'environnement tel épuisement en


matières nutritives.

. Etapes : déshydratation progressive du cytoplasme, par l'apparition de composés


(dipicolinate de calcium), une densification des structures nucléaires et enfin la synthèse
d'une paroi sporale épaisse et imperméable, donc hautement résistante
(chaleur).

La spore intra-bactérienne est libérée dans le milieu extérieur et y survit des


années.

Dans des conditions favorables (nutritives, thermiques et chimiques), elle redonne une
cellule végétative (germination).

Intérêt médical avec conserves familiales (Botulisme)(Clostridium botulinum)

Intérêt médical avec des plaies souillées par de la terre (Tétanos)(Clostridium tetani)

Chez l'animal : mange des chardons.........(Charbon)(Bacillus anthracis)

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)
Espace Etudiant
Cours de Bactériologie Générale

PHYSIOLOGIE - CROISSANCE

Objectifs : Connaître les principaux éléments de la physiologie bactérienne :


croissance bactérienne, mode respiratoire, et application à l'identification bactérienne.

A - DIVISION BACTERIENNE

La bactérie se multiplie par fission binaire : la bactérie grandit puis se divise en deux
cellules filles séparées par un septum de division formé par la paroi cellulaire. Durant la
division, l'ADN se duplique ainsi que les autres constituants. Divers systèmes
enzymatiques de synthèse et de dégradation participent à la division cellulaire.

B - DYNAMIQUE DE LA CROISSANCE

La croissance bactérienne est l'accroissement ordonné de tous les composants de la


bactérie. Elle aboutit à l'augmentation du nombre de bactéries.

Au cours de la croissance, il se produit, d'une part, un appauvrissement du milieu de


culture en nutriments et, d'autre part, un enrichissement en sous-produits du
métabolisme, éventuellement toxiques. La croissance peut être étudiée en milieu liquide
ou solide.

1 - Courbe de croissance : La croissance d'une bactérie s'étudie en milieu liquide. Il


existe 6 phases dont l'ensemble constitue la courbe de croissance.

. Phase de latence : le taux de croissance nul (µ = 0). La durée de cette phase dépend
de l'âge des bactéries et de la composition du milieu. C'est le temps nécessaire à la
bactérie pour synthétiser les enzymes adaptées au nouveau substrat (pas de phase de
latence si repiquage sur milieu identique au précédent).

. Phase d'accélération : il se produit une augmentation de la vitesse de croissance.

. Croissance exponentielle : le taux de croissance atteint un maximum (µ=max).


Cette phase dure tant que la vitesse de croissance est constante. Le temps de
doublement des bactéries est le plus court. La masse cellulaire est représentée par des
cellules viables (mortalité nulle).

. Phase de ralentissement : la vitesse de croissance régresse. Il y a un épuisement du


milieu de culture et une accumulation des déchets. Il existe un début d'autolyse des
bactéries.

. Phase maximale stationnaire : le taux de croissance devient nu (µ = 0). Les


bactéries qui se multiplient compensent celles qui meurent.

. Phase de déclin : le taux de croissance est négatif (µ < 0). Toutes les ressources
nutritives sont épuisées. Il y a accumulation de métabolites toxiques. Il se produit une
diminution d'organismes viables et une lyse cellulaire sous l'action des enzymes
protéolytiques endogènes. Cependant, il persiste une croissance par libération de
substances libérées lors de la lyse (croissance cryptique).

Exemple d'une courbe de croissance

1 : phase de latence,
2 : phase de croissance
exponentielle,
3 : phase de ralentissement,
4 : phase stationnaire,
5 : phase de déclin.

Courbe de croissance dans un automate d'hémoculture

Haut

2 - Croissance in vitro (milieux liquides et solides)

Les bactéries peuvent être cultivées en milieux liquide, solide et semi-liquide. Les
milieux liquides sont utilisés pour la culture de bactéries pures ou lors d'infection
monomicrobienne (hémoculture).
Exemples : culture d'une bactérie dans un bouillon nutritif ou encore à partir du sang
d'un malade (hémoculture en flacon)

Les milieux solides ou semi-solides, à base d'agar (gélose), sont utilisés pour
l'isolement de bactéries. Dans ces milieux, ont été ajoutés des nutriments favorisants la
croissance des bactéries étudiées.

Exemples : culture par isolement d'une bactérie à la surface d'un milieu gélosé
contenant du sang (mouton, cheval) montrant après 18 à 24 H à 37°C d'incubation des
colonies hémolytiques.

3 - Croissance in vivo

In vivo, la croissance bactérienne n'est pas similaire à celle observée in vitro. Elle est
beaucoup plus ralentie. La phase de latence est beaucoup plus longue. Les bactéries
n'ont pas toujours tous les nutriments à leur disposition pour leur croissance. In vivo, les
bactéries peuvent être phagocytées par les macrophages et les polynucléaires et être
inhibées par les produits antibactériens comme le lysozyme ou le complément.
4 - Croissance en culture continue

Il y a maintien d'une croissance exponentielle continue lorsque le milieu de culture est


renouvelé régulièrement et que les métabolites sont éliminés en même temps. La valeur
µ est maximale et constante.

5 - Croissance en culture synchrone

Les bactéries se multiplient toutes au même moment. La courbe de croissance montre


des paliers successifs. Ce type de culture permet d'étudier la division cellulaire
indépendamment de la croissance.

6 - Croissance en biofilm

Les bactéries peuvent s'attacher aux surfaces, s'associer entre elles et s'entourer d'un
polymère organique pour constituer un biofilm. Leur organisation et leur métabolisme
dépendent de la nature de la surface et de l'environnement physico-chimique. Les
biofilms intéressent tous les domaines de la microbiologie et de la médecine (matériels
d'exploration, matériels implantés, muqueuses lésées). Les biofilms sont caractérisés par
une hétérogénéité spatiale : il existe des variations métaboliques importantes à
l'intérieur du biofilm et à l'interface milieu liquide/milieu solide.

Schéma d'organisation d'un biofilm


7 - Effets de carence et de stress

En situation de carence ou de stress, la bactérie peut


adopter deux types de stratégie pour sa survie :

1 - la bactérie se différencie vers une forme de résistance


métaboliquement inactive C'est le cas des Bacillus qui
produisent une spore.

2 - la bactérie développe des systèmes de régulation pour


contrôler cette période de carence en adaptant son
métabolisme pour faire un maximum d'économie. C'est le
cas de Escherichia coli.

Dans ce type de situation, la bactérie présente les


adaptations suivantes :
. Dégradation de l'ARN cellulaire total, libérant des nucléotides utilisables pour la
synthèse de nouveaux ARN ou comme source d'énergie.

. Dégradation des protéines : libération d'acides aminés réutilisés ou dégradés pour la


production d'énergie

. Mise en œuvre de systèmes de transport et d'assimilation comme substituts aux


éléments manquants qui sont essentiellement les composés azotés, phosphorés,
carbonés et le fer.

. Synthèse de protéines de stress qui protègent la bactérie de la privation de nutriments


et d'autres stress (existence de gènes impliqués dans les phénomènes de carence ou de
stress).

Haut

C - CONDITIONS FAVORABLES A LA CROISSANCE

1 - Sources d'énergie

Les bactéries doivent trouver dans leur environnement les substances nécessaires à leur
énergie et à leurs synthèses cellulaires.

Les bactéries phototrophes utilisent l'énergie lumineuse pour la photosynthèse


(synthèse d'ATP à partir d'ADP et de phosphate inorganique).

Les bactéries chimiotrophes puisent leur énergie à partir de composés minéraux ou


organiques. Elles utilisent des donneurs et des accepteurs d'électrons (élément minéral :
bactérie chimiolithotrophe ; élément organique : bactérie chimioorganotrophe).

La grande majorité des bactéries d'intérêt médical sont chimioorganotrophes.

2 -Sources de carbone

Le carbone est l'un des éléments les plus abondants de la bactérie. Le plus simple des
composés est l'anhydride carbonique ou CO2. Celui-ci peut être utilisé par la bactérie
pour la synthèse de certains métabolites essentiels qui ferait intervenir une réaction de
carboxylation.
Le CO2 est la seule source de carbone pour les bactéries autotrophes. Les bactéries
hétérotrophes utilisent facultativement le CO2. Les bactéries hétérotrophes dégradent
une grande quantité de substances hydrocarbonées (alcool, acide acétique, acide
lactique, polysaccharides, sucres divers).

3 - Sources d'azote et besoins en soufre

Les bactéries ont besoin de substances azotées pour synthétiser leurs protéines. La
provenance de cet azote peut se faire par fixation directe de l'azote atmosphérique ou
par incorporation de composés azotés (réactions de désamination, de transamination)

Le soufre est incorporé par les bactéries sous forme de sulfate ou de composés soufrés
organiques.

4 - Besoins inorganiques

Le phosphore fait partie des acides nucléiques et de nombreuses réactions enzymatiques.


Il permet la récupération, l'accumulation et la distribution de l'énergie dans la bactérie. Il
est incorporé sous forme de phosphate inorganique.

5 - Autres éléments

D'autres éléments jouent un rôle dans le métabolisme bactérien (sodium, potassium,


magnésium, chlore) et dans les réactions enzymatiques (calcium, fer, magnésium,
manganèse, nickel, sélénium, cuivre, cobalt, vitamines)

Exemple d'un milieu solide minimum pour


étudier le transfert de marqueurs
d'auxotrophie (cf découverte de la
conjugaison)

composition: SO4(NH2)2 1 g, PO4K2H 7g,


PO4KH2 2g, citrate 0,5g, SO4Mg, 7H2O 1g,
eau 500 ml

Haut

D - CONDITIONS PHYSICO-CHIMIQUES DE LA CROISSANCE

1 - Effet de l'oxygène

Il existe plusieurs classes de bactéries en fonction de leurs rapports avec l'oxygène.


1 - Les bactéries aérobies strictes ne se
développent qu'en présence d'air. Leur source
principale d'énergie est la respiration.
L'oxygène moléculaire, ultime accepteur
d'électron, est réduit en eau (Pseudomonas,
Acinetobacter, Neisseria).

2 - Les bactéries microaérophiles se


développent mieux ou exclusivement lorsque
la pression partielle d'oxygène est inférieure à
celle de l'air (Campylobacter,
Mycobacteriaceae).

3 - Les bactéries aéro-anaérobies facultatives


se développent avec ou sans air. C'est le cas
de la majorité des bactéries rencontrées en
pathologie médicale : les entérobactéries
(Escherichia, Salmonella), les streptocoques,
les staphylocoques. L'énergie provient de
l'oxydation des substrats et de la voie
fermentaire.
4 - Les bactéries anaérobies
strictes ne se développent
qu'en absence totale ou
presque d'oxygène qui est le
plus souvent toxique. Ces
bactéries doivent se cultiver
sous atmosphère réductrice.
La totalité de l'énergie est
produite par fermentation.

C'est le cas des bactéries intestinales (Bacteroides, Fusobacterium, Clostridium) et de


nombreuses bactéries présentes dans les flores normales de l'organisme. La toxicité de
l'oxygène s'explique par la production de radicaux superoxydes que les bactéries
anaérobies ne peuvent pas détruire (absence de superoxyde dismutase) et/ou par
l'absence d'une activité enzymatique à type de catalases et de peroxydases.

Mode d'action de la superoxide dismutase, de la catalase et de la peroxydase

Exemple : Etuve avec culture de bactéries anaérobies stricts en jarre


Autre exemple : culture de bactéries anaérobies stricts en sachet plastique et en
atmosphère contrôlée

2 - Effet de la température

Les bactéries peuvent être classées selon leur température optimale de croissance.

- Bactéries mésophiles (Ex. : Escherichia coli) : température de croissance proche de


celle du corps humain (37°C)

- Bactéries thermophiles (Ex. : Thermus aquaticus) : températures de croissance


comprises entre 45°C et 70°C .

- Bactéries hyperthermophiles (Ex. : Archaea) : températures de croissance


supérieures à 80°C .

- Bactéries psychrophiles (Ex. : ) :Températures proches de 0°C (optimum à 10-15°C).

- Bactéries psychrotrophes (Ex. : Pseudomonas) : températures de croissance proches


de 0°C avec optimum de croissance proche des bactéries mésophiles.

Exemple : Dans un laboratoire d'analyse, étuve dont la température intérieure est


réglée à 37°C
Autre exemple : étuve dont la température intérieure est réglée à 37°C avec une
atmosphère de 5% de gaz carbonique (CO2)

Haut

3 - Effet du pH

Le pH (concentration en ion hydrogène [H+]) de l'environnement varie entre 0,5 (sols


acides) et 10,5 (eaux alcalines des lacs).

Les bactéries pathogènes ou liées à l'écosystème humain se développent le plus souvent


dans des milieux neutres ou légèrement alcalins.

On distingue les bactéries:

- neutrophiles qui se développent pour des pH sont compris entre 5,5 et 8,5 avec un
optimum voisin de 7. La plupart des bactéries médicalement importantes sont ainsi.

Exemple : isolement d'une souche de Escherichia coli sur un milieu usuel


- alcalophiles qui préfèrent les pH alcalins: cas de Pseudomonas et Vibrio, donc milieux
de culture particuliers

- acidophiles qui se multiplient mieux dans des milieux acides : cas des Lactobacillus.

4 - Effet de la pression osmotique

Les bactéries sont assez tolérantes aux variations des concentrations ioniques. Certaines
espèces sont osmotolérantes (staphylocoques, Vibrio cholerae).

5 - Effet de l'eau libre

La disponibilité de l'eau présente dans l'atmosphère ou dans une substance intervient


dans la croissance bactérienne. L'activité de l'eau (Aw) est inversement proportionnelle à
la pression osmotique d'un composé. Ainsi, elle est affectée par la présence plus ou
moins importante de sels ou de sucres dissous dans l'eau.

- Présence de sels : Les bactéries halophiles nécessitent du sel (NaCl) pour leur
croissance. Cette concentration peut varier de 1-6% pour les faiblement halophiles
jusque 15-30% pour les bactéries halophiles extrêmes (Halobacterium).

Les bactéries halotolérantes acceptent des concentrations modérées de sels mais non
obligatoires pour leur croissance (Ex. : Staphylococcus aureus).

- Présence de sucres : Les bactéries osmophiles nécessitent des sucres pour leur
croissance. Celles osmotolérantes acceptent des concentrations modérées de sucres
mais non obligatoires pour leur croissance. Enfin les bactéries xérophiles peuvent se
multiplier en l'absence d'eau dans leur environnement.

6 - Métabolisme énergétique

On peut opposer les bactéries ayant un métabolisme fermentatif et celles ayant un


métabolisme de type respiratoire.

Pour les bactéries à métabolisme fermentatif, la dégradation du glucose est incomplète et


aboutit à la formation de divers composés organiques (acides organiques).

Pour les bactéries ayant un métabolisme oxydatif , la dégradation se fait par le cycle de
Krebs. L'accepteur final d'électron est l'oxygène. Chez les bactéries, le système de
transport d'électrons est situé dans la membrane cytoplasmique.
Exemple : Mise en évidence du caractère fermentaire (A) ou oxydatif (B) avec un milieu
dit de MEVAG contenant du glucose. Le témoin (C) est le même milieu sans sucre
ensemencé de manière identique.

Haut

E - APPLICATIONS

1 - Milieux de culture

Un milieu de culture est composé d'un mélange de substrats nutritifs (acides aminés,
peptides, bases nucléiques, sucres, etc), d'un système tampon pour éviter les variations
importantes du pH, de sels minéraux et de vitamines. Il est possible d'ajouter d'autres
facteurs de croissance (sang, protéines, hémoglobine, vitamines). Ils sont de nature
solide, semi-solide ou liquide.

Parmi les milieux de culture, on distingue les milieux :

- d'isolement qui sont le plus souvent solides (gélosés) et de composition variable pour
permettre le développement de plusieurs espèces bactériennes: gélose au sang frais,
gélose dite au sang cuit…….

Exemple : isolement d'une aspiration bronchique sur milieu gélosé au sang frais (A), au
sang cuit (B) ou contenant des substrats chromogéniques (C)

- sélectifs qui favorisent artificiellement la croissance d'une espèce au détriment des


autres tels le Milieu de Chapman (hypersalé + mannitol + indicateur de pH), Drigalski
(sels biliaires + cristal violet + lactose + indicateur de pH)………

Exemple : culture d'une part sur le milieu de Chapman (gauche) de trois souches de
Staphylococcus aureus et d'autre part sur celui de Drigalski (droite) de Escherichia coli et
Proteus mirabilis

- identification permettent au cours de l'isolement ou non de mettre en évidence une


ou plusieurs propriétés biochimiques d'une bactérie pour commencer à l'identifier

Haut

2 - Apparences des colonies

L'aspect des colonies est le caractère primaire utilisé pour orienter le diagnostic
effectué par le bactériologiste. La forme des colonies dépend de :

A) facteurs intrinsèques à la bactérie :

mobilité,

morphologie : taille, forme, contour, relief, surface

production d'une capsule,

production de matériel extracellulaire,

pigmentation,

présence de fimbriae
B) facteurs extrinsèques :

gradients de solutés créés autour de la colonie

présence de colorants dans le milieu de culture.

Exemple : Aspects de colonies bactériennes sur le milieu sélectif dénommé Drigalski

Autre exemple : Aspects de colonies bactériennes sur le milieu enrichi au sang

3 - Recherche des caractères biochimiques

L'identification des bactéries est effectuée en utilisant des milieux de culture dont la
composition permet de mettre en évidence une enzymatique.

Exemples : activités variables (souches A et B) de type ß-galactosidase (ONPG), lysine


décarboxylase (LDC), ornithine décarboxylase (ODC), uréase (URE) .........
L'activité fermentaire est révélé avec un milieu type contenant un sucre, un indicateur
coloré des changements de pH. La fermentation du sucre entraîne un abaissement du pH
et donc un changement de couleur de l'indicateur coloré.

Exemples : activité fermentaire positive vis-à-vis de divers hydrates de carbone:

A l'heure actuelle, des systèmes automatisés plus sensibles effectuent des mesures
photométriques en continu et peuvent identifier les principales bactéries isolées en
pratique médicale en moins de 5 heures.

Exemples : automates d'identification et de sensibilité aux antibiotiques


Espace Etudiant
Cours de Bactériologie Générale

Relations Hôte-Pathogène

1. L'infection est une maladie provoquée par des agents pathogènes vivants. On
distingue deux types de bactéries responsables d'infections:

1.1 - Les bactéries pathogènes

- Les bactéries pathogènes sont des bactéries responsables d'une maladie même chez
le sujet " sain " (ex typhoïde, choléra, tuberculose, méningite...).

- Le pouvoir pathogène conditionne le type de maladie et va dépendre de l'espèce


bactérienne responsable de l'infection. Par exemple, le choléra dont l'agent est Vibrio
cholerae est une maladie complètement différente de la méningite à méningocoque.
Cette notion de pouvoir pathogène est à distinguer de celle de virulence.

- Ces bactéries pathogènes peuvent (pneumocoque, Haemophilus, méningocoque..) ou


non (Mycobacterium tuberculosis, Salmonella, Shigella, Vibrio cholerae..) appartenir à la
flore humaine commensale. Pour certaines bactéries, comme le méningocoque (agent de
la méningite cérébrospinale), le portage sain dans le nasopharynx est la situation de loin
la plus fréquente, la maladie est l'exception puisqu'elle ne touche qu'un porteur sain sur
10 000. Ce point souligne que pour ces bactéries qui en réalité appartiennent à la flore
commensale de l'homme bien que "pathogènes", il existe une susceptibilité individuelle
qui peut être l'âge (plus fréquentes chez les jeunes enfants) ou propre à certains
individus, de nature encore indéterminée.

- La virulence est une notion quantitative alors que le pouvoir pathogène est une
notion qualitative.

Ainsi pour un même pouvoir pathogène, il peut y avoir des souches plus ou moins
virulentes. Exemple : Shigella dysenteriae et Shigella flexneri sont toutes les deux
responsables d'une dysenterie bacillaire, mais pas avec les mêmes doses. Quelques
bactéries suffisent pour développer une infection avec S.dysenteriae alors que plusieurs
milliers sont nécessaires avec S. flexneri. Cette espèce est donc considérée comme moins
virulente que S.dysenteriae.

1.2 - Les bactéries opportunistes

- Les bactéries opportunistes ne donnent habituellement pas de maladie chez les sujets
sains. En revanche, elles peuvent devenir pathogènes chez les sujets aux défenses
immunitaires altérées.

- Ces bactéries sont souvent des bactéries commensales qui vivent à la surface de la
peau et des muqueuses de l'homme

Chez le sujet normal, elles ne donnent pas d'infections, mais à la faveur d'une
immunodépression ou d 'une antibiothérapie, elles vont être contre-sélectionnées et
proliférer leur donnant ainsi un avantage sélectif.

- Le type de maladie (et donc le pouvoir pathogène) dont ces bactéries sont
responsables est, en général, monomorphe : colonisation de la porte d'entrée avec
développement d'une inflammation non spécifique à ce niveau (pneumonie, infection
urinaire, infection sur cathéter,.. ), éventuellement suivie d'unegénéralisation, septicémie
avec des localisations secondaires possibles (endocardite, abcès profond, ostéites,
méningites...)

2. Facteurs de défense contre les bactéries

2. 1 Facteurs non spécifiques

2.1.1 Les barrières

A/ Les barrières qui s'opposent à l'implantation des bactéries correspondent :

- aux flores saprophytes/commensales: la composition de cette flore varie en fonction de


l'âge, de l'alimentation, de l'administration d'antibiotiques...

- aux substances microbicides des revêtements cutanéo-muqueux: défensines, NaCl,


acides gras, HCl, sels biliaires, mucus...

- aux facteurs mécaniques : desquamation, péristaltisme intestinal, cellules ciliées.

B/Les barrières qui s'opposent à la croissance bactérienne :

- La disponibilité en nutriment pourrait être le facteur limitant.


- Le seul réel nutriment qui fait défaut in vivo est le Fe3+ . Sa concentration dans les
tissus biologiques est de 10-18 M et ceci en raison de sa liaison à la transferrine et la
lactoferrine dans le secteur extra-cellulaire.

- Cette faible concentration en Fe3+ impose à tous les pathogènes de posséder des
systèmes de captation du Fe3+ afin de se procurer ce nutriment nécessaire à leur
métabolisme.

2.2 Immunité innée

L'immunité innée permet l'élimination du microorganisme lorsqu'il se trouve dans un


tissu habituellement stérile. Il est nécessaire d'envisager

2.2.1. Les acteurs de l'immunité innée

 Le complément (voir cours correspondant)

Les conséquences de l'activation du complément sont la bactériolyse,


l'opsonisation et le chimiotactisme (C3a, C5a)

. Les cellules phagocytaires: 2 types de cellules phagocytaires :

 les polynucléaires
 les macrophages
(voir cours immunologie correspondant à la phagocytose)

Le but de l'immunité innée est de recruter ces éléments au siège de l'effraction


bactérienne, et ceci afin d'éliminer l'agent pathogène. Une réaction inflammatoire va
alors se mettre en place. Elle associe diapédèse - margination des leucocytes et
extravasation des protéines plasmatiques (complément et anticorps).

2.2.2. Les composants bactériens qui activent l'immunité innée

- lipide A du lipopolysaccharide des bactéries à Gram-négatif

- peptidoglycane

- acide lipotéichoïque des bactéries à Gram-positif

- lipoarabinamananne des mycobactéries

- mannanes des levures


(cf anatomie bactérienne)

Haut

2.2.3. Les voies d'activation


- IL-1

produit par les macrophages et les cellules endothéliales

rôle dans la fièvre, stimule la production de prostaglandine,

rôle dans la margination et la diapédèse leucocytaire

- IL-6

produit par les macrophages, production induite par l'IL-1

- IL-8

produit par les macrophages et les cellules endothéliales

rôle capital dans la margination leucocytaire.

L'ensemble de ces cytokines a un effet bénéfique en permettant le développement d'une


réaction inflammatoire qui participe à l'élimination de l'agent bactérien.

Si exagération de cette immunité innée, il y a sepsis (choc septique).

3 - Facteurs de virulence des bactéries pathogènes

3.1. En dehors des intoxinations, la première étape du pouvoir pathogène est la


colonisation de l'hôte au niveau de la porte d'entrée.

En pratique, celà se traduit par :

 une adhésion aux cellules épithéliales des muqueuses à l'aide de pili ou


d'adhésines non fimbrillaires. L'adhésine des pili est située au sein de fimbriae.
Cette adhésine est la molécule qui va interagir avec un récepteur sur les cellules
de l'hôte. Dans le cas des adhésines non fimbrillaires, la protéine est située sur la
membrane externe des bactéries. Dans certains cas (Escherichia coli
entéropathogène), ce récepteur est sécrété par la bactérie à l'intérieur du
cytoplasme des cellules de l'hôte.
 une adhésion à du matériel étranger (cathéter, prothèse..).

3. 2. Une fois la porte d'entrée colonisée, plusieurs types de pouvoir pathogène


peuvent s'exprimer:

3.2.1. Le pouvoir pathogène est due à la diffusion d'une toxine à distance de la


porte d'entrée

Dans ce cas, la bactérie adhère, colonise et se multiplie au niveau de la muqueuse de la


porte d'entrée et peut éventuellement provoquer une inflammation à ce niveau. Mais
l'essentiel du pouvoir pathogène est du à la production d'une toxine dont les effets
peuvent s'exercer à distance de la porte d'entrée:

 Vibrio cholerae (choléra). Dans ce cas, il y a colonisation de l'intestin et


production de la toxine cholérique qui va être responsable de la perte hydro-
électrolytique (cf Bactériologie médicale - Vibrio)
 Escherichia coli entérotoxinogène (diarrhée des voyageurs), même mécanisme
que pour le choléra (cf Vibrio)

 Bordetella pertussis (coqueluche). La muqueuse colonisée est l'arbre trachéo-


bronchique. La production de la toxine va être responsable de la toux et des
signes généraux et éventuellement cardio-vasculaires

 Staphylococcus aureus producteur de TSST (syndrome de choc toxique). Le


staphylocoque colonise une muqueuse (vaginale par exemple) et la production de
toxine qui diffusera sera responsable du choc.

 Corynebacterium diphtheriae (agent de la diphtérie). Le pathogène est


responsable d'une angine, secondaire à la multiplication bactérienne, mais seules
les souches produisant la toxine diphtérique pourront donner le croup et les signes
généraux (cf Physiopathologie de la diphtérie ou Corynebacterium).

3.2.1.1. Les toxines bactériennes

Les bactéries pathogènes produisent de nombreuses substances qui sont toxiques pour
leur hôte. Lorsqu'il s'agit de protéines et qu'elles agissent à faibles concentrations, il
s'agit de toxines. Dans certains cas (tétanos et botulisme par exemple), seule la toxine
est pathogène et la multiplication du microorganisme ne participe en rien aux symptomes
observés.

On distingue plusieurs types de toxines :

A. Les toxines A-B


Ce type de toxines a deux composants, la sous-unité B qui est responsable de
l'interaction avec les cellules de l'hôte et la sous-unité A qui contient l'activité
enzymatique (toxique). Cette activité varie d'une toxine à l'autre et peut être une activité
ADP ribosylante (toxine cholérique, toxine pertussique et toxine diphtérique) ou une
activité protéolytique (toxine tétanique ou toxine botulinique). La sous-unité B varie
d'une toxine à l'autre et est responsable des spécificités tissulaires. Quant à la sous-unité
A, elle est conservée spécialement dans les régions responsables de l'activité
enzymatique.

B. Les toxines formant des pores

Une famille de toxines est responsable de la formation de pores conduisant à la lyse


cellulaire. A titre d'exemple, il s'agit de l'hémolysine d'Escherichia coli, de la listériolysine
(hémolysine) de Listeria monocytogenes.

C. Les enzymes hydrolytiques

Beaucoup de bactéries pathogènes produisent des protéases, DNAses, collagénases qui


vont participer à la formation des lésions au siège de la multiplication bactérienne.
Exemple: Infection à staphylocoque doré (S.aureus)

Haut

3.2.2. Le pouvoir pathogène résulte d 'une inflammation au niveau de la porte d


'entrée secondaire à la multiplication bactérienne.

 Shigella responsable d'une dysenterie

 Neisseria gonorrhoeae responsable de la blennorhagie (cf Neisseria)

 Salmonella typhimurium (diarrhée)

 Abcès cutanés / furoncles dus à une multiplication localisée de Staphylococcus


aureus

 Angines, sinusites, otites, bronchites le plus souvent dues à des bactéries de la


flore commensale du nasopharynx qui deviennent pathogènes (streptocoques,
pneumocoques, Haemophilus, anaérobies..).

 Infections urinaires, basses le plus souvent, ou encore atteinte du rein dues à


Escherichia coli
Les bactéries en cause sont, en général, des pathogènes à multiplication extra-cellulaire
dont la diffusion à distance de la porte d'entrée peut être une complication à redouter
(surtout vrai pour les infections urinaires et les abcès sous-cutanés). Pour certains de ces
pathogènes qui doivent franchir une muqueuse pour atteindre le secteur extra-cellulaire
(Shigella, Salmonella, et Neisseria gonorrhoeae), cet envahissement nécessite une étape
de multiplication à l'intérieur des cellules épithéliales.

Autre exemple : Shigella

3.2.3. Le pouvoir pathogène résulte d'une dissémination du microorganisme à


partir de la porte d'entrée:

On distingue deux types de pathogènes selon que la multiplication bactérienne ait lieu à
l'intérieur ou à l'extérieur d 'un compartiment cellulaire

A/ Les bactéries à multiplication intra-cellulaire

Le plus souvent le compartiment dans lequel la multiplication prend place sont les
macrophages

 Mycobacterium tuberculosis (tuberculose)

 Salmonella typhi (typhoïde)

 Listeria monocytogenes (listériose)

 Brucella (brucellose)

 Legionella (Maladie des légionnaires)

 Coxiella burnetti (Fièvre Q)

Pour certaines bactéries, le type cellulaire dans lequel la multiplication a lieu sont les
cellules endothéliales

 Rickettsia (fièvre boutonneuse)

Pour les bactéries à multiplication intra-cellulaires, le plus important est d'éviter d'être
dégradées par les macrophages:

 soit elles inhibent la fusion phagolysosomale et se répliquent dans la vacuole


(Salmonella),

 soit elles sortent de la vacuole de phagocytose et se répliquent dans le


cytosol,(Listeria, Rickettsia)

 soit elles ne sont pas dégradées dans le phagolysosome.

B/Les bactéries à multiplication extra-cellulaire

Il s 'agit du pouvoir pathogène le plus fréquent. Les bactéries se multiplient dans le


secteur extra-cellulaire et sont équipées pour résister à l'activité bactéricide du
complément et à la phagocytose par les polynucléaires

 Septicémies (Escherichia coli, Staphylococcus aureus…)


 Pneumonies (Streptococcus pneumoniae, Klebsiella pneumoniae...)

 Pyélonéphrites (Escherichia coli, Proteus mirabilis..)

 Méningites (Neisseria meningitidis, Streptococcus pneumoniae)

 Endocardites (Streptococcus, Enterococcus...)

Ces bactéries à multiplication extra-cellulaires ont un tronc commun de facteurs de


virulence qui sont :

 la capsule polysaccharidique qui est essentielle dans la résistance à la bactéricidie


sérique et/ou la phagocytose

 la chaine latérale du lipopolysaccharide ou la sialyaltion du core

 les systèmes de captation du fer afin de se procurer le fer ferrique

 la production, inconstante, de certaines toxines

Ce cours a été préparé par les Professeurs X. Nassif (Faculté de Médecine Necker-Enfants-Malades, Paris V) et A.
Philippon (Faculté de Médecine Cochin-Port-Royal, Paris V).
Espace Etudiant
Cours de Bactériologie Générale

GENETIQUE BACTERIENNE I

Une histoire récente survenue à New-York en octobre a montré la psychose liée aux
manipulations génétiques chez les microorganismes et montrer les potentialités
de la génétique.

Heureusement, il ne s'agissait de moustiques infectés par le virus de la West Nile

Fever.

Objectifs d'aujourd'hui :

Définition de la génétique
Pourquoi les bactéries constituent un matériel génétique de choix ?
Quel est le mode de reproduction habituel des bactéries ?
Quelles sont les principales caractéristiques du chromosome bactérien ?
Quelles sont les applications actuelles quotidiennes ?
Quelles sont les principales caractéristiques de la variation génotypique ?

A - DEFINITION DE LA GENETIQUE

Science de la variation et de l'hérédité, née de l'étude chez les organismes doués de


reproduction sexuée, du croisement ou hybridation entre races ou variétés de la même
espèce.

B - HISTORIQUE

Premières lois fondamentales de la génétique formelle (transmission des caractères


héréditaires) ont été dégagées vers 1865 par G. Mendel, lors l'étude de la transmission
des caractères anatomiques, cytologiques et fonctionnels de certaines plantes, le pois par
exemple. Ces lois ont été redécouvertes vers 1900 chez la mouche.
Pour en savoir plus :
http://www.netspace.org/MendelWeb/home.html
http://www.mendelu.cz/index.eng.html

1 ère phase :

Bactéries peu favorables à l'analyse


génétique. Pourquoi ? Il y avait une
absence visible de différences
morphologiques à cause de la taille (µ) ou
encore de l'absence de spécialisation de la
cellule (germe, soma).

2 ème phase :

Les bactéries sont devenues,


par la suite, un matériel de
choix à cause de leur division
rapide : Escherichia coli (20
min) ou encore de leur
encombrement "limité" (dans
un tube de 22 mm),
contrairement aux
mammifères comme
l'éléphant.

Résultat : Dernière question ????


Conclusions : Apport de la génétique bactérienne considérable en biologie
moléculaire.Elle a participé à la naissance de cette nouvelle et importante discipline.

Pour en savoir plus : http://www.genethon.fr/projets/HistoireBM/HistoireBM.html

La génétique bactériennne est devenue d'application banale par son usage


quotidien :

 tests de mutagénése induite (agro-alimentaire)


 mutagénèse par insertion
 techniques de clonage de gènes
 transfert de gènes
 séquençage.......

C - REPRODUCTION ASEXUEE

Lors de la croissance bactérienne, il y a


donc reproduction asexuée par scission
binaire ou de scissiparité en l'absence de
toute recombinaison génétique (pas de
zygote). La bactérie est généralement
haploïde (1 chromosome).

Haut

D - PROPRIETES DU CHROMOSOME : ADN


BACTERIEN

Le chromosome bactérien est constitué d'acide


désoxyribonucléique (ADN) dont les
caractéristiques structurales sont bien connues.

Pour en savoir plus : http://www.asmusa.org/mbrsrc/

Parmi les autres caractéristiques, il convient de connaitre les suivantes :


- Formes topologiques : L'ADN bactérien qui est circulaire peut exister sous trois
formes topologiques (superenroulée, relachée, linéaire) objectivées par plusieurs
techniques telle l'ultracentrifugation, la microscopie électronique ou tout simplement
l'électrophorèse en gel d'agarose (technique d'usage courant).

La forme linéaire est obtenue par coupure, par exemple enzymatique (enzymes de
restriction).

- Séparation ou dénaturation : Les deux


chaines ou alpha hélices sont maintenues
entre elles (A-T, C-G) par les deux ou trois
liaisons "hydrogène". Le chauffage permet
leur séparation en brins monocaténaires =
fusion ou dénaturation. Cette séparation est
réversible (renaturation ou hybridation)
selon le principe de la complémentarité des
bases (A-T, C-G).

Pour en savoir plus :

http://www.ac-versailles.fr/

Lors de la séparation, il y a augmentation


de la DO à 260 m (effet hyperchromique),
et celle-ci est fonction du nombre de paires
GC. Il est possible de calculer un paramètre
quantitatif (Tm). Ainsi la détermination du
GC% est un critère taxonomique ou de
classification des bactéries qui peut être
calculé selon l'espèce bactérienne. Il peut
varier largement selon les groupes
bactériens.
- Hydrolyse ou restriction : L'ADN double brin peut être coupé par des enzymes de
restriction, dénommées endonucléases.

On a pu réduire de manière
reproductible, le génome
bactérien à une série de
fragments caractéristiques
isolables et mesurables
(kb=kilobases), par exemple par
une électrophorèse en gel
d'agarose.

Le mode d'action très spécifique


des endonucléases permet
d'établir des profils de restriction,
d'où leur intérêt en épidémiologie
pour tracer dans un service ou
plusieurs services d'un hôpital,
une épidémie hospitalière.

L'intérêt de telles enzymes est


essentiel dans l'obtention d'ADN
hybride ou programme (cf génie
génétique)

E - CONCLUSIONS

La bactérie possède, généralement, un seul chromosome circulaire de taille très variable.


Plusieurs espèces bactériennes ont leur génome séquencé, même Mycobacterium leprae.
Il est possible de chercher de nouveaux gènes de virulence, de nouvelles cibles pour les
antibiotiques : Naissance de la génomique
Pour en savoir plus :

http://www.ncbi.nlm.nih.gov/Entrez/

Nouvelles méthodes de diagnostic telles FISH comme la recherche d'espèces telles E.


coli dans les aliments ou sur des cellules (cystites).......

clichés P.Grimont

LES VARIATIONS BACTERIENNES

Les progrès de l'analyse bactériologique et biochimique démontrèrent dans les années


1920-1950, l'existence de variations chez les bactéries:
 aspect de la colonie
 dépigmentation de la culture
 perte de la capsule (virulence) chez
le pneumocoque
 caractère de fermentation (lactose)
 croissance sur milieu minimum :
mutant réverse his+
 acquisition de la résistance à un
antibiotique..........

clichés P.Grimont

L'analyse des caractères des


variations bactériennes a permis
leur individualisation en deux
types:
génotypique et phénotypique

Haut
DEFINITION DE LA VARIATION GENOTYPIQUE

Il s'agit d'une modification spontanée ou induite, discontinue, stable, rare, spécifique et


enfin liée à une modification du génome bactérien (ADN).

Ceci définit, en fait la mutation bactérienne dont les caractères spécifiques sont
identiques à ceux observés dans le règne animal ou végétal. C'est à tort que l'opinion fut
longtemps répandue de l'existence d'une différence de nature entre les bactéries
(procaryote) et les autres organismes (eucaryote).

CARACTERES

* Spontanée : l'antibiotique, par exemple, sélectionne les rares formes variantes pré-
existantes dans une population bactérienne comme dans une tuberculose pulmonaire.

* Induite : le caractère induit de la mutation bactérienne est bien connu lors de


l'utilisation de rayonnements de type UV ou de substances chimiques comme des
analogues de la guanine. Ces produits mutagènes sont dits génotoxiques.

* Discontinue ou brusque : elle apparait selon la loi du tout ou rien comme l'illustrent
les exemples de variation ci-dessus illustrés.

* Stable : le caractère acquis est alors transmissible à la descendance, donc héréditaire.


* Rare : elle est mesurable par le taux de mutation qui est la probabilité pour une
bactérie de muter pendant une unité de temps définie (souvent le temps de génération).

Il est caractéristique d'un caractère donné, de l'ordre de 10-5 à 10-10, le taux moyen étant
de l'ordre de 10-6. Il convient de savoir qu'il y a une corrélation avec la fréquence de
mutants ou proportion de mutants qui existe à un moment donné dans une culture.
Celle-ci est de détermination aisée.

* Spécificité - Indépendance : la probabilité pour une bactérie de subir


simultanément deux mutations distinctes est le produit des probabilités individuelles
de ces mutations. Cette notion est d'importance, afin d'éviter la sélection d'un mutant
résistant, dans l'antibiothérapie, antituberculeuse par exemple.

L'instauration d'une
monothérapie est suivie de la
sélection d'une souche
résistante. En effet, une
caverne évolutive de 2 cm de
diamètre peut contenir une
population bacillaire de
l'ordre de 108 bacilles
tuberculeux. Si le taux
mutation est de 10-5 pour
l'isoniazide (INH) et de 10-7
pour la rifampicine (RIF), la
probabilité d'isoler un double
mutant résistant à INH-RIF
est de 10-12.

Une telle émergence sera évitée par une antibiothérapie associant, au-moins deux
antituberculeux.

* modification de la structure du gène : unité de transmission héréditaire, entrainant


quelquefois une modification de la structure primaire de la chaine polypeptidique
correspondante. La mutation est une modification de l'ADN, donc de la séquence
désoxyribonucléotidique. Divers types de mutation sont connues telles la modification
d'une paire de nucléotides ou plus. Leurs effets sont variables: silencieux ou léthal.
Certains aspects modernes de la modification de l'ADN sont liés à des insertions de
séquence de type IS ou transposon (cf applications).

CONCLUSIONS

Il s'agit d'un mécanisme mineur d'évolution bactérienne, car la probabilité d'obtention


de mutants spontanés est faible souvent sans avantage sélectif pour la forme variante, à
l'exception de la résistance aux antibiotiques, par exemple.

La mutation peut être associée à un autre mécanisme (transformation) pour expliquer


l'évolution vers la résistance du pneumocoque ou du méningocoque (cf transformation).

En fait cette stabilité apparente des espèces ne résulte nullement d'une


invulnérabilité du chromosome aux lésions mais de l'existence de dispositifs
enzymatiques de maintenance par excision - réparation (système SOS dont divers gènes
dont recA et lexA.......).
VARIATION PHENOTYPIQUE

Elle se définit comme l'adaptation rapide de


l'ensemble de la population bactérienne
ayant le même génotype à diverses conditions
extérieures, induite, réversible, non
transmissible à la descendance mais spécifique.
Le mécanisme est en relation avec l'activité ou
l'expression des gènes et la découverte de
systèmes de régulation :

. négative avec les opérons inductibles (opéron


lactose).

. positive avec les opérons répressibles (opéron


tryptophane).

Pour en savoir plus :

http://www.blc.arizona.edu/courses/181gh/

Son intérêt historique est considérable avec l'individualisation de divers gènes:


régulateur, promoteur, de structure, en particulier suite aux travaux de J. Monod.

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)(Janvier 2000)
Espace Etudiant
Cours de Bactériologie Générale

GENETIQUE BACTERIENNE II

Donc les bactéries varient comme sur l'aspect des colonies, l'aptitude à utiliser un
substrat..........

La génétique bactérienne est ainsi la science de la variation.

Est-elle aussi celle de l'hérédité, née de croisement ou hybridation entre variétés ou


espèces différentes ?

Or les bactéries sont haploïdes............Néanmoins des possibilités existent

TRANSFERTS DE MATERIEL GENETIQUE

Objectifs d'aujourd'hui :

Combien de types de transfert d'ADN existe-t-il chez les bactéries ?


Donner la définition de la transformation
Donner la définition de la conjugaison
Donner la définition de la transduction
Pouvez-vous préciser leurs principales caractéristiques ?
Quelles ont été les conséquences scientifiques de ces transferts ?
Quelles sont les conséquences médicales de ces transferts ?

A - INTRODUCTION

La reproduction par scissiparité est bien monotome, même pour une bactérie. Pourquoi
ne pas envisager que les bactéries aient leurs transports (cf dictionnaire Robert par
exemple) !!!!!!

Ceux-ci ont été initialement impliqués dans le processus d'adaptation des bactéries à leur
environnement, en faisant intervenir des transferts d'ADN bactérien (1920-1965).

Combien et quels sont-ils ?


* la transformation * la conjugaison * la transduction
Ces transferts d'acide désoxyribonucléique
(ADN) bactérien doivent être suivis de
recombinaison génétique dite légitime
(s'il provient d'une même espèce ou d'une
espèce voisine). Dans d'autres
circonstances, l'ADN peut ne pas se
recombiner (cf plasmide). Ces transferts
sont unidirectionnels, le plus souvent
partiels (1 à 2 % du génome transféré) et
d'efficacité faible (fréquence de
recombinaison de l'ordre de 10-6).

Pour en savoir plus :


http://penguin.d.umn.edu/lectures/Hawley/genetrans/Gene.htm

B - LA TRANSFORMATION BACTERIENNE

Définition

La transformation "naturelle" ou physiologique est le premier modèle connu de transfert


de matériel génétique lui-même (ADN), qui est fixé et absorbé par des bactéries
réceptrices, dites en état de compétence. Ce modèle a permis de démontrer que l'ADN
était le support chimique de l'hérédité en 1944.
Historique

Pour en savoir plus :


http://www.scisoc.org/opae/forty.htm
Pour en savoir plus :
http://tidepool.st.usm.edu/crswr/transformation.html

Les essais de transformation des


pneumocoques R (colonie rough) en
S (colonie Smooth) ont été
finalement possibles en 1944 avec
l'équipe d'Avery du Rockefeller
Institute à New York.

Pour en savoir plus :


http://www.ultranet.com/~jkimball/BiologyPages/A/Avery.html

http://www.genethon.fr/projets/HistoireBM/HistoireBM.html#griffith.

Caractéristiques

D'une part, il doit y avoir de l'ADN libéré


d'une bactérie (exogénote). D'autre part
celui-ci doit être fixé sur une bactérie
réceptrice en phase de compétence
Cette absorption d'ADN polymérisé est suivie
d'une recombinaison génétique légitime avec
acquisition de nouveaux caractères génétiques
stables, donc transmissibles à la descendance
dénommés recombinants ou transformants.

Voulez-vous voir une animation:


http://www.fda.gov/cvm/antiresistvideo.htm
Ce transfert naturel d'ADN bactérien est limité à quelques espèces telles
Streptococcus dont S. pneumoniae, Neisseria, Haemophilus..... Il est partiel : une partie
de l'exogénote (1-2% du génome) pénètre et se recombine (si homologie suffisante).

Applications scientifiques

* Ce mode de transfert a un grand intérêt historique : L'ADN est bien le support


chimique de l'héridité, et non les protéines.

* Il a permis l'établissement des premières cartes génétiques partielles chez les


bactéries, et donc des études plus précises sur la virulence, la résistance aux
antibiotiques........

* C'est une technique de base du génie génétique, utilisée quotidiennement dans les
laboratoires lors de clonage.

* Le concept de transférer de l'ADN par simple contact a été développé avec des ADN
viraux dans les années 65, d'où le terme de transfection.

* La découverte ultérieure de la transformation "artificielle" a permis alors de


transférer divers ADN sous forme de chimère ou hydride comme un plasmide sur lequel
sont clonés des gènes bactériens, animaux ou humains à des bactéries non
transformables naturellement comme E. coli.

* Pour les espèces non transformables, la technique d'électroporation liée à la


"création de pores" dans la paroi bactérienne lorsque des impulsions électriques à haute
tension sont appliquées lors de la culture a été proposée par la suite. La durée et
l'intensité de l'impulsion sont à définir pour chaque espèce.

En bactériologie médicale, son intérêt est lié à l'émergence d'espèces résistantes


aux antibiotiques comme le pneumocoque ou récemment, le méningocoque.

Cette émergence de la
résistance, à la
pénicilline G par
exemple, a été lente
depuis l'introduction
des antibiotiques. En
fait ce phénonème n'a
été possible qu'après
sélection de mutants
résistants
(streptocoques
buccaux) lors
d'antibiothérapie puis
de transfert du ou des
gènes de cette
résistance par
transformation
naturelle à l'espèce
pathogène potentielle
en situation de portage.

Haut

C - CONJUGAISON OU SEXUALITE BACTERIENNE

Définition

Processus sexuel strict qui nécessite un contact préalable et un appariemment entre


bactéries de sexe différent (hétérothalliques) avec la formation d'un pont cytoplasmique
permettant les échanges bactériens dont celui du chromosome. Le facteur de sexualité
ou de fertilité (F) permet la synthèse de pilis sexuels chez la bactérie donatrice ou
mâle et donne la polarité au chomosome. Le transfert d'ADN chromosomique est à sens
unique, orienté, progressif et quelquefois total (2 h).

Historique

Pour en savoir plus :


http://www.profiles.nlm.nih.gov/BB/Views/Exhibit/
J. LEDERBERG et E. TATUM en 1946
mélangèrent dans un milieu liquide, 2
mutants polyauxotrophes d'E. coli
K12: 108 T-L-M+B+ et 108 T+L+M-B-
(exigence en thréonine, T- ; leucine,
L- ; méthionine, M- et biotine B-).
Après plusieurs heures de contact,
l'étalement de 108 bactéries sur un
milieu synthétique sans T, L, M et B
est suivi, après incubation, de la
croissance d'une centaine de colonies
à la surface du milieu. Ces clônes
ainsi que leur descendance sont T+
L+ M+ B+. Il ne pouvait s'agir de
mutants doublement réverses
(probabilité de l'ordre de 10-14) mais
de recombinants.

Caractéristiques

- Spécificité - Fréquence : Le transfert d'ADN chromosomique suivi de recombinaison


est spécifique (intra espèces), mais limité, en particulier aux espèces à Gram négatif
telles E. coli, Salmonella, Pseudomonas aeruginosa et aussi chez les Streptococcus. Par
contre, ce mode de transfert d'information génétique est très largement rencontré dans
le monde bactérien lorsqu'il s'agit de transfert de plasmides conjugatifs (Tra+) porteurs
ou non de transposons. La spécificité est, dans ce cas, variable selon le type de
plasmides, certains ayant un large spectre (Inc P-1, par exemple).

- Différenciation sexuelle : Le transfert d'ADN qui est à sens unique ou orienté


(croisements fertiles (F) que dans un sens), met en évidence la différenciation sexuelle
entre le donneur et le receveur. Elle porte sur la présence du facteur sexuel, appelé
encore facteur de fertilité (F), donnant la polarité à la bactérie donatrice ou mâle (F+). Il
s'agit du premier plasmide connu. Son potentiel d'information génétique (de l'ordre de 2
% de celui du chromosome bactérien) code pour la biosynthèse d'appendices ou pili
sexuels, pour son insertion possible au chromosome bactérien, pour la mobilisation ou le
transfert partiel ou non de ce dernier dans la bactérie réceptrice (F-). La conjugaison est
ainsi dénommée sexualité des bactéries.

- Contact ou appariement : Cette phase individualise ce mode de transfert. En effet, le


transfert de gènes du donneur au receveur n'est possible qu'après la formation de paires
ou couples de bactéries donatrice-réceptrice. Le rôle des pilis sexuels, flexibles ou non (2
à 3 par donneur) est essentiel, bien qu'incomplètement élucidé. Leurs extrémités
spécifiques, repérées par des bactériophages, reconnaissent des zones de contact à la
surface cellulaire des bactéries réceptrices, s'y fixent et se rétractent. Cette rétraction
des pilis sexuels a pour effet de rapprocher les deux bactéries de sexe différent
permettant un contact cellulaire étroit (pont cytoplasmique de 100 à 300 mµ).
-Transfert de l'ADN
chromosomique : La
mobilisation du chromosome de
la bactérie donatrice peut alors
débuter à travers le pont
cytoplasmique sous la forme
monocaténaire (un des deux
brins transmis). Ce transfert
est à sens unique, orienté et
progressif, quelquefois total,
durant alors une centaine de
minutes à 37° C. Son
interruption artificielle par
agitation mécanique a permis
l'analyse cinétique.

Un processus de réplication asymétrique restaure le brin monocaténaire non transféré du


donneur au niveau d'un site réplicateur spécifique proche du pont cytoplasmique ou du
pilus. Le processus ultérieur de recombinaison entre certaines régions du brin
monocaténaire exogène et celles de l'ADN receveur est mal connu.
Voulez-vous voir une animation: http://www.fda.gov/cvm/antiresistvideo.htm

- Caractères transférés - fréquence : N'importe quel gène bactérien peut être


transféré comme l'aptitude à biosynthétiser un acide aminé (thréonine, leucine,
sérine)............ La fréquence de recombinaison est faible, de l'ordre de 10-6. La sélection
de certains clones (HfrC, par exemple) montra la possibilité d'augmenter notoirement la
fréquence de recombinaison de certaines marqueurs jusqu'à 10 -1.

Conclusions :

* Seul le mode de transfert


d'ADN bactérien d'une cellule à
l'autre après contact
(conjugaison) a permis :

 l'établissement de
cartes génétiques du
chromosome
bactérien (E. coli, P.
aeruginosa)
 la circularité du
chromosome
bactérien

 la caractérisation des propriétés remarquables du facteur F (plasmide =


insertion au chromosome en des sîtes limités ou autonome). Le passage de l'état
intégré à l'autre par excision peut entrainer la formation d'un plasmide F' (unité
autonome de réplication et porteuse de gènes bactériens).

* La Sex-duction ou F-duction se
définit par le transfert de F' à une
nouvelle cellule réceptrice (F-), suivi ou
non de recombinaison légitime
(chromosomique). En l'absence de
recombinaison, l'obtention de
mérozygotes stables (diploïdes partiels)
aboutit à la notion du gène, unité de
fonction (gène régulateur, promoteur,
opérateur et structure) (JACOB et
MONOD, 1961).

* Ce mode de transfert d'information génétique est rencontré lors d'échange d'ADN


non chromosomique comme l'ADN plasmidique (plasmides conjugatifs). Il s'agit du
principal facteur d'évolution des bactéries, en particulier pour l'acquisition de la
résistance aux antibiotiques.

D - TRANSDUCTION

Définition

Il s'agit d'un transfert d'ADN bactérien partiel, par l'intermédiaire de


bactériophages dont le rôle est passif (vecteur). Il est dans ce cas, virulent donc se
multiplier dans la bactérie. Lors de la phase d'encapsidation, il incorpore de l'ADN
bactérien fragmenté.

Historique

Pour en savoir plus :


http://www.asmusa.org/mbrsrc/archive/SIGNIFICANT.htm#1956

En 1952, N. ZINDER et J. LEDERBERG tentent d'obtenir des recombinants après


croisement de mutants auxotrophes de souches de Salmonella typhimurium (LA22, LA2)
responsables de toxi-infections d'origine alimentaire. La fréquence des recombinants
histidine+ tryptophane+, de l'ordre de 10-6, n'est pas modifiée lorsque les souches
parentales, séparées par un filtre en verre fritté, ne sont plus en contact (cf expérience
de Davis). L'existence d'un agent filtrable, vecteur de l'information génétique est
démontrée (bactériophage tempéré produit par la souche parentale lysogène, LA 22).
Pour en savoir plus :
http://www.zo.utexas.edu/faculty/sjasper/images/so23_02a.gif
http://www.phage.org/tphage2.gif

Caractéristiques

. INCIDENCE : Ce phénomène est en relation avec l'existence de nombreuses souches


lysogènes. Il est décrit aussi bien chez les espèces bactériennes à Gram positif
(Staphylocoques, Bacillus) qu'à Gram négatif (Entérobactéries, Pseudomonas).

. TYPES : Trois variantes conditionnent les autres caractères tels spécificité du ou des
caractères transduits, fréquence de transduction, recombinaison génétique ou non.

Ce transfert partiel de gènes bactériens peut s'accompagner d'une recombinaison


légitime (transduction généralisée) ou non (tr. abortive et quelquefois tr. spécialisée).
Pour en savoir plus :
http://www.uark.edu/campus-resources/mivey/m4233/lyso.html

Voulez-vous voir une animation: http://www.fda.gov/cvm/antiresistvideo.htm

Conclusions:

* mode de transfert ayant un intérêt historique (phage lambda et E. coli dans la


transduction restreinte ou spécifique)

* transfert en ADN bactérien ou plasmidique limité (taille du phage)(<50 kb)


* En bactériologie médicale, on évoquera le terme de conversion lysogénique qui
pourrait être une autre modalité de transduction ? Plusieurs exemples ont un intérêt
médical.

Haut

E- CONVERSION LYSOGENIQUE

Définition

C'est l'acquisition par une bactérie d'un caractère somatique particulier


déterminé par le génome d'un prophage spécifique. Son expression dans toutes
les bactéries est lié à l'état lysogène. Il disparait avec la perte de celui-ci.

Exemples :

* toxine du bacille diphtérique

Pour en savoir plus :


http://www.gsbs.utmb.edu/microbook/ch032.htm

* toxine érythrogène par le streptocoque A

* certaines cytotoxines (vérotoxines) chez E.coli


ECEP

* certains facteurs antigéniques de Salmonella: Voici un exemple de conversion


relatif à un antigène somatique (O15) qui est rapidement révélé par
immunofluorescence.
Conclusion :

La notion de transfert du support chimique de


l'hérédité d'une cellule bactérienne à l'autre allait
amener à extrapoler ce concept aux cellules
eucaryotes.

Pour en savoir plus :


http://www.madsci.org/posts/archives/may97/864507142.Ge.r.html

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)(Janvier 2000)
Espace Etudiant
Cours de Bactériologie Générale

GENETIQUE BACTERIENNE III

La résistance acquise des bactéries aux antibiotiques est devenue un réel problème
de limitation des thérapeutiques actuelles et amène à sensibiliser le grand public à un
usage beaucoup raisonné de ces médicaments.

Ce phénomène d'émergence de bactéries résistantes peu de temps après la


commercialisation d'un antibiotique a "traumatisé" le monde scientifique dans les années
50-55 et a même conduit les scientifiques a pensé que les antibiotiques allaient être
obsolètes à cause d'une extraordinaire aptitude génétique des bactéries à échanger du
matériel génétique (R facteurs).

Objectifs d'aujourd'hui :

Pouvez-vous définir un plasmide ?


Pouvez-vous préciser les propriétés biologiques codées par les plasmides ?
Quelles ont été les conséquences médicales de ce type de transfert ?
Etes-vous capable de définir brièvement la transposition et le transposon ?

A - PLASMIDE: HISTORIQUE
* Au Japon dans les années 55-60,
isolement d'entérobactéries
multirésistantes (Shigella ) responsables
de diarrhées.

* Par ailleurs, il y avait existence


simultanée dans les selles de malades
de souches d'Escherichia coli et de
Shigella multirésistantes.

* Selon le principe de la spécificité, la


probabilité d'obtenir un mutant eut
été de l'ordre de 10- 24. Or dans une
selle, la population d'entérobactéries
n'excéde pas 10 10.
* Evénement capital : La multirésistance a été transférée avec des fréquences
variables (10- 5 à 10- 7) et l'on évoqua le terme de RTF = resistance transfert factor.

Un nouveau chapitre de la génétique bactérienne était ouvert avec la


découverte de ces ADN cytoplasmiques, dénommés, par la suite, plasmides.

B - DEFINITION

ADN à double brin, circulaire, cytoplasmique douées de réplication autonome et de taille


variable. Ils sont médiateurs de nombreuses propriétés permettant une meilleure
adaptation des bactéries, bien que non indispensables au métabolisme normal de la
cellule-hôte (endosymbiotes). Leur transmission naturelle d'une cellule à l'autre
s'effectue habituellement par conjugaison, quoique les autres modes de transfert soient
possibles.

C - PRINCIPALES CARACTÉRISTIQUES

On notera l'addition de ces propriétés par une même souche :


L'acquisition d'un ou plusieurs caractères
métaboliques dont la production de SH2 (E.
coli), de lysine décarboxylase (Proteus) ou
encore l'utilisation de plusieurs
hydrocarbures (camphre, toluène,
xylène.....) peut amener à des erreurs de
diagnostic au laboratoire ou à contruire
certains "bugs" utiles pour dépolluer.

Les plasmides sans fonction connue sont


dits cryptiques.

Autres propriétés :

Ils sont doués de réplication autonome, assurant sa survie ou son existence. Leur
transmission d'une cellule à l'autre s'effectue habituellement par conjugaison (codent
pour des pilis sexuels), ou encore transduction ou transformation, mais souvent sans
spécificité d'hôte, d'où une diffusion entre espèces bactériennes différentes.
Voulez-vous voir une animation: http://www.fda.gov/cvm/antiresistvideo.htm
Nature - Structure :

ADN à double brin, circulaire,


cytoplasmique de taille variable (0,5
kb à 500 kb).

Peuvent être visualisés par


microscopie électronique ou plus
simplement par électrophorèse en gel
d'agarose et révêlation au bromydrate
d'éthidium (substance flurorescente).

Haut

Voici le contenu plasmidique de plusieurs Peuvent être coupés par diverses


souches d'une entérobactérie dénommée endonucléases, d'où une caractérisation possible
Klebsiella pneumoniae par leur profil de restriction.

Nomenclature :

p pour plasmide puis 2 ou 3 lettres selon les combinaisons et un chiffre : pIP15 pour
Institut Pasteur, pSC102 pour Stanley Cohen, pUD12 pour Université Descartes..............

Classification :

A cause du grand nombre de combinaisons de caractères et du risque d' "épidémie


planétaire", un classement a été proposé dans les années 70 en groupes ou classe
d'incompatibilités (Inc).

Deux chefs dans le même bureau, que se passent-ils ? Il y a exclusion de l'un. Cette
régle est applicable aux plasmides.

Ainsi ils appartiennent au même groupe s'il y a exclusion. Cette approche fastidieuse
de classement au cours des années 70 a amené la découverte des gènes sauteurs
ou mobiles.

D - CONCLUSION

Elèments de l'hérédité extrachromosomique, ils donnent aux nombreuses


espèces qui les hébergent de nouveaux caractères. Il s'agit du principal processus
d'évolution rapide des bactéries

TRANSPOSON

E - HISTORIQUE

Première évocation de gènes mobiles venue d'expériences de génétique chez le maïs.


Lors de caractérisation de plasmide, il a été observé d'étranges recombinaisons de
gènes de résistance aux antibiotiques tel le gène amp, s'accompagnant du même
accroissement de taille du plasmide receveur. On avait la preuve directe d'une
addition de matériel génétique (10 kb)(1974).

F - DEFINITION

transposons : séquences d'ADN capables de changer de localisation dans le génome


sans jamais apparaitre à l'état libre. Ils ne peuvent se répliquer mais codent pour les
déterminants de la transposition et ceux d'autres fonctions telle la résistance aux
antibiotiques (cf propriétés biologiques des plasmides).

transposition : mécanisme d'évolution rapide consistant dans l'addition pure et simple


de gènes (ADN) de taille définie au sein d'un génome (chromosome bactérien ou
plasmide) et enl'absence d'homologie de séquence nucléotidique (recombinaison
illégitime).

G - RÔLE - INTÉRÊT

Les transposons constituent un génome collectif ou un patrimoine génétique commun,


dans lequel puissent les bactéries en fonction de leur nécessité d'adaptation ou de la
pression de sélection. Ces élèments sont la preuve du "génie génétique in vivo". Il sont
très utilisés en mutagénèse in vitro, ou encore par les bactéries elles-mêmes pour
moduler l'expression d'un gène.

CONCLUSIONS

Il est assez curieux que le principal mécanisme d'apparition de nouvelles propriétès chez
les bactéries soit en relation avec l'acquisition d'ADN soit de type plasmidique soit de
type transposon. Cependant d'autres solutions génétiques ont été récemment
découvertes avec la mise en évidence d'intégrons, par exemple. Cette extraordinaire
aptitude du monde bactérien à s'adapter aux conditions environnantes montre leur
supériorité et notre nécessaire adaptation telle l'usage de plus en plus ciblé des
antibiotiques.

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V))(Octobre 2000)
Espace Etudiant
Cours de Bactériologie Générale

GENETIQUE BACTERIENNE IV : LES INTEGRONS

A - INTRODUCTION

Après plusieurs décennies d'euphorie consécutives à la découverte des premiers


antibiotiques tels la pénicilline ou les sulfamides, nous connaissons aujourdhui une
période plus critique avec l'augmentation de la résistance des bactéries à de nombreux
antibiotiques (cf antibiotiques III).

Divers mécanismes de résistance génétique ont été rapportés tels la mutation, les
transferts de gènes (cf génétique I, II, résistance III). Les bactéries possèdent différents
supports génétiques très élaborés permettant le transfert horizontal de gènes de
résistance aux antibiotiques entre bactéries d'espèces ou de genres différents
favorisant ainsi la dissémination de la résistance aux antibiotiques.
La résistance acquise des bactéries est ainsi une fatalité en raison de la diversité des
mécanismes développés par les bactéries. Parmi les éléments génétiques mobiles, les
plasmides et les transposons ont déjà été étudiés (cf résistance III).

Ce n'est qu'au cours des années 1980, que des éléments génétiques susceptibles
d'acquérir ou de perdre des gènes de résistance aux antibiotiques ont été décrits et
désignés sous le nom d'intégrons.

B - DÉFINITION

Les intégrons constituent un système de capture et d'expression de gènes sous forme de


cassettes. Les cassettes sont des éléments mobiles capables d'être intégrés ou excisés
par un mécanisme de recombinaison spécifique de site médié par une intégrase.

C - STRUCTURE DES INTÉGRONS


Incapables d'autoréplication, les intégrons sont obligatoirement portés par un réplicon
(plasmide ou chromosome). Ils peuvent aussi être véhiculés par un élément
transposable. Les intégrons sont constitués d'une région 5' comprenant un gène intI qui
code pour une intégrase, d'un site d'attachement attI et d'un promoteur.

Il existe plusieurs classes d'intégrons définies en fonction de la nature des gènes


codant pour l'intégrase. Trois d'entre elles (classes 1, 2 et 3) ont été bien caractérisées
et sont impliquées à ce jour dans la dissémination de la résistance aux antibiotiques.
Les sites attI des différentes classes d'intégrons n'ont pas de séquence commune,
exceptée le motif GTTRRRY (R, purine ; Y, pyrymidine).

Chez la majorité des intégrons de classe 1, la région 3' contient trois cadres de lecture
ouverts. Le premier, qacED1, est un dérivé tronqué du gène qacE codant pour la
résistance aux ammoniums quaternaires. Le second cadre de lecture est le gène sulI qui
code pour la résistance aux sulfamides. Le troisième cadre de lecture désigné ORF5 ne
code pour aucune fonction connue.

Les intégrons diffèrent des transposons par plusieurs caractéristiques :

 les cassettes ne contiennent aucun gène codant pour une protéine catalysant leur
mouvement, la recombinase étant présente sur la partie immobile de lêintégron

 les cassettes ne sont pas flanquées à leurs extrémités de séquences inversées


répétées.

D - STRUCTURE DES CASSETTES

Les cassettes ont des tailles et des fonctions très variables mais possèdent une
organisation commune. Une cassette est constituée d'un gène adjacent à un site
spécifique de recombinaison attC reconnu par l'intégrase. Le site attC est constitué de
séquences, relativement conservées, inversées répétées imparfaites dont la taille varie
de 57 à 141 paires de bases. Deux séquences inversées répétées de 7 paires de bases
sont constamment retrouvées aux deux extrémités de chaque site attC et désignées core
et core inverse.

Le core de séquence consensus GTTRRRY est localisé à l'extrêmité droite du site attC et
le core inverse de séquence complémentaire RYYYAAC à l'extrêmité gauche. Les premiers
sites attC décrits avaient une taille de 59 pb, ce qui explique leur désignation dans
différentes publications par élément 59-pb, terminologie désormais obsolète.
Il existe une grande variété de sites attC. Certains, dont la séquence est très conservée,
sont associés à des gènes de résistance très différents, alors que certains gènes
apparentés sont associés à des sites attC hétérologues.

E - MOUVEMENT DES CASSETTES

Certaines cassettes ont été retrouvées dans différentes classes d'intégrons. Toutes les
cassettes peuvent apparemment être intégrées dans les trois classes d'intégrons.
Cependant, les études sur le mouvement des cassettes ont principalement porté sur les
intégrons de classe 1. Il a été démontré que les cassettes intégrées sous forme linéaire
peuvent après excision, générer une forme libre circulaire. Le mouvement des cassettes
se fait donc essentiellement par insertion-excision sous forme circulaire par un
mécanisme de recombinaison entre deux sites spécifiques catalysé par l'intégrase.
L'évènement de "crossing-over" se produit entre le G d'un site core GTTRRRY et le
premier T d'un deuxième site core. Les intégrations de cassettes se font
préférentiellement au site attI.

Exceptionnellement, l'évènement de recombinaison peut impliquer un site spécifique et


un site non spécifique, appelé site secondaire. Ces évènements se produisent à des
fréquences très faibles mais sont probablement responsables de la dissémination de
cassettes en dehors des localisations spécifiques. L'intégration de la cassette est alors
stabilisée, car dépourvue d'un site de recombinaison spécifique. Les sites secondaires ont
généralement la séquence GWTMW (W : T/A ; M:A/C) qui présente des similitudes avec
le core GTTRRRY.

F - EXPRESSION DES CASSETTES

Les cassettes sont toutes orientées dans la même direction et sont généralement
dépourvues de promoteur. Les gènes sont co-transcrits comme au sein d'un opéron sous
la dépendance d'une région promotrice localisée dans la région 5' conservée de
l'intégron. L'expression des cassettes est tributaire de la position par rapport au
promoteur, les gènes localisés dans des cassettes éloignées étant faiblement exprimés.
La pression de sélection antibiotique peut favoriser des réarrangements de cassettes afin
de permettre le positionnement d'une cassette faiblement exprimée à une localisation
plus proche du promoteur.
De rares cassettes possèdent leur propre promoteur telles que cmlA et cmlA2
responsables de la résistance au chloramphénicol par un mécanisme non enzymatique.
Chez les intégrons de classe 1, deux promoteurs P1 et P2 ont été caractérisés. P2 n'est
présent que chez quelques intégrons pour lesquels une insertion de 3 résidus guanine a
entrainé un espacement de 17 paires de bases entre les séquences -35 et -10. P2 est
situé 90 paires de bases en aval de P1. Il a été montré expérimentalement que ces deux
promoteurs P1 et P2 étaient fonctionnels. P1 peut se présenter sous 3 versions
différentes, une forte, une moyenne et une faible, selon les combinaisons de séquences -
35 et -10. Quand une cassette est intégrée à un site secondaire, l'expression du gène
n'est possible que si l'intégration s'est opérée en aval d'un promoteur potentiel.

G - NATURE DES CASSETTES

Plus de 60 cassettes impliquées dans la résistance aux antibiotiques ou aux antiseptiques


ont été décrites.

H - ÉPIDÉMIOLOGIE DES INTÉGRONS

Les études épidémiologiques ont surtout porté sur les intégrons de classe 1 très
répandus chez différentes bactéries à Gram-négatif : Entérobactéries, Pseudomonas,
Vibrio, Acinetobacter et Campylobacter.
Exemples d'intégrons chez les entérobactéries (http://www.cdc.org)

Des intégrons ont été retrouvés chez des bactéries d'origine humaine, animale et celles
de l'environnement.
Peu d'études ont été réalisées chez les bactéries à Gram-positif. Des intégrons de classe
1 ont été décrits récemment chez Corynebacterium glutamicum, Corynebacterium
striatum et Enterococcus faecalis. Chez Mycobacterium fortuitum, seul un vestige
d'intégron a été retrouvé.

I - ORIGINES DES INTÉGRONS

Il semblerait que les intégrons proviendraient de super-intégrons récemment décrits sur


le chromosome de différentes espèces ou genres (Pseudomonas, Xanthomonas,
Shewanella, Vibrio) et contenant plus de 100 cassettes. Les cassettes contiennent des
gènes codant pour des toxines ou encore des fonctions métaboliques mais le plus
souvent, il s'agit de cadres ouverts de lecture n'ayant pas de fonction connue.
L'hypothèse émise est que les intégrons de résistance aux antibiotiques auraient évolué à
partir de super-intégrons par le biais de la capture d'un gène intI et d'un site attI dans
des structures mobiles type transposon et qu'ensuite, sous l'effet de la pression de
sélection antibiotique, il y aurait eu capture de gènes de résistance provenant des
différents pools de cassettes contenus dans différents super-intégrons. Les super-
intégrons représentent un phénoménal réservoir de gènes permettant aux
bactéries d'avoir une capacité d'adaptation rapide aux pressions environnementales par
capture de gènes impliqués dans des fonctions métaboliques ou la virulence.

J - CONCLUSION

Les intégrons constituent un système de capture et d'expression de gènes jouant un rôle


important dans l'acquisition et la dissémination des gènes de résistance aux antibiotiques
chez les bactéries. Le mouvement des cassettes permet une mosaïque de combinaisons.
La découverte récente des super-intégrons indique que ce système de génie génétique
au naturel a de plus amples implications dans l'évolution du génome bactérien que la
simple dissémination des gènes de résistance aux antibiotiques.
Ce dernier mécanisme génétique connu de la résistance acquise des antibiotiques
montre l'étonnante aptitude des bactéries à s'adpter, donc survivre. Une attitude plus
volontariste dans l'usage raisonné des antibiotiques est devenue une exigence
actuelle d'autant que la consommation de ce type de médicament est plus élevé en
France que dans d'autres pays européens.

Ce cours a été préparé par le Dr. M-C PLOY et le Professeur F. DENIS (Faculté de Médecine de Limoges))(Octobre
2002)
Espace Etudiant
Cours de Bactériologie Générale

GENETIQUE BACTERIENNE V

A -IN VIVO

Les bactéries ont constamment besoin, comme nous d'ailleurs, de s'adapter à leur
environnement

- Ainsi la modification du génome ou encore la


modulation de l'expression de gènes, jusque-là
silencieux ou d'expression limitée peut être
observée par l'insertion/transposition d'un ADN
(éléments transposables) suivie d'une
recombinaison illégitime ou par mutation
ponctuelle au niveau du promoteur. La mutation
est souvent léthale et difficilement réverse.

- L'acquisition de gènes est fréquente, en


particulier ceux de résistance aux antibiotiques
ou antiseptiques mais aussi ceux facteurs de la
virulence. Le mode de transfert de l'ADN est le
plus souvent la conjugaison avec des plasmides
ou des transposons.

Les bactéries faisaient du génie génétique comme


Monsieur Jourdain............

Le cumul .... ne peut malheureusement être proscrit dans ce petit monde..........

Ainsi la sélection de mutants résistants chez certaines espèces commensales


(streptocoques ou Neisseria de la flore oropharyngée) et le transfert par
transformation des gènes correspondants à d'autres espèces virulentes
(pneumocoque, méningocoques) est bien démontré.

Nous ignorons encore le ou les mécanismes intimes relatifs à certains flux de gènes.

B - IN VITRO
Ils évitent pour partie, la détection de
l'effet cancérigène chez l'animal
nécessitant une expérimentation longue (2-
3 ans) et dispendieuse.

Le test imaginé par B. Ames dans les


années 71-75 fait appel à des souches de
Salmonella typhimurium auxotrophes
pour histidine (his -) avec d'autres
mutations: meilleure perméabilité et
modification du processus de réparation
par excision. Une autre amélioration a été
de traiter les bactéries tests en présence
d'extraits hépatiques, la substance
génotoxique étant quelquefois un
dérivé de biotransformation.
Les bactéries sont quotidiennement exploitées.

Quelques exemples

- Dans l'industrie alimentaire, pharmaceutique... on recherche au moindre coût,


l'effet mutagène (génotoxique), car cancérigène potentiel de nombre de molécules:
additifs alimentaires, colorants....... Divers tests commerciaux de mutagénèse
bactérienne sont disponibles: test d'Ames, inductest, mutatest lambda, SOS
Chromotest.......

Haut

- Le clonage de gènes est une approche fréquente de divers types de recherche.

- La Mutagénèse par insertion :


Cette technique évite l'emploi de
substances cancérigènes pour obtenir plus
aisément (fréquence augmentée 10 -3 au
lieu de 10 -6) des mutants intéressants. À
titre d'exemple, cette approche a été
testée avec succés, il y a une dizaine
d'années pour l'analyse de la virulence
chez Listeria monocytogenes pour
l'obtention de mutants non producteurs
d'hémolysine par insertion du transposon
Tn :1545 (J.L. Gaillard et coll. 1988).

- Le transfert de plasmide : La maitrise de la diffusion des bactéries multirésistantes


(BMR) résistantes chromosomiques à la rifampicine (RIF) passe par des enquêtes
d'épidémiologie moléculaire avec individualisation de plasmides conjugatifs par transfert
de la résistance (céfotaxime ou CTX) à une souche réceptrice auxotrophe (exigence en
thréonine ou TH). Voici un transfert positif après 2 h de contact en milieu liquide entre
une souche donatrice de P. aeruginosa hautement résistante à CTX et RIF R et une
souche réceptrice de E. coli CTX S RIF R avec étalement sur un milieu minimum
contenant TH+CTX+RIF.

- L'individualisation de plasmide : après électrophorèse en gel d'agarose de 1,5 à 3 H,


il est possible de visualiser un plasmide transférable ou conjugatif Tra+ de la souche
donatrice B à deux souches réceptrices différentes (C, D) après contact avec le
bromhydrate d'éthidium et excitation à la table UV. Les deux souches réceptrices A et E
avant transfert sont en A et E.
- Le profil de restriction : L'usage d'enzymes
de restriction ou la recherche de marqueurs
moléculaires est devenu courant et permet de
préciser des profils de restriction d'ADN
chromosomique ou plasmidique.

- En Taxonomie, l'individualisation de nouvelles espèces fait référence au GC% (cf


génétique I) et à la détermination d'homologies génétiques (ADN/ADN, ADN/ARN) ainsi
qu'au séquencage de certains gènes comme celui codant pour l'ARNr - 16S ou encore
celui de ARN-polymérase, ADN gyrase........

La technique de séquencage de l'ARNr - 16S est très utilisée en pratique hospitalière


pour diagnostiquer une espèce bactérienne (cf Internet et Bactériologie).

Voici un exemple récent


d'isolement d'un coccobacille
à Gram-négatif de croissance
difficile dans 3 hémocultures.
Après PCR, la séquence de
l'ordre de 700 nucléotides a
été obtenue puis comparée à
celles déposées dans
certaines banques de
données (Genebank par
exemple).

Pour en savoir plus :


http://www.ncbi.nlm.nih.gov/

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V))(Octobre 2000)

Pour en savoir plus :


Espace Etudiant
Cours de Bactériologie Générale

ANTIBIOTIQUES I

DEFINITIONS - CLASSIFICATION

Objectifs d'aujourd'hui :

En 2001, qu'est-ce qu'un antibiotique ?


Pourquoi classer les antibiotiques ?
Comment classer les antibiotiqu>es ?
Pourriez-vous décrire les critères de classement des antibiotiques ?
Quelles sont les définitions des termes suivants: bactériostase, bactéricidie, CMI, CMB ?

A - GENERALITES

* Découverte de l'antibiose = antagonisme


bactérien avec la bactéridie charbonneuse
(Pasteur et Joubert, 1877).

Voici un exemple d'antibiose entre E. coli et


Brucella à partir de lysier liquide (INRA,
1966)

* Le terme d'antibiote a été proposé par Vuillemin (1889): "principe actif d'un
organisme vivant qui détruit la vie des autres pour protéger sa propre vie".

* Thèse de Médecine de E. Duchesne (1897): "Concurrence vitale" entre Penicillium


et bactéries.
* Erlich P. suggéra l'intérêt possible des colorants de teinturerie dès 1885. Le prontosil
ou rubiazol® premier futur sulfamide, fut découvert par G. Domagk en 1935.

* Découverte de la pénicilline G par A. Fleming en


1928: Transformation vitreuse de colonies de
staphylocoques.

* Découverte des sulfamides en 1935

* Purification et usage en clinique de la pénicilline G en 1938-1942 (H. Florey, E.


Chain).

* Le terme d'antibiotique a été proposé par R. Dubos (1940).

Cette grande étape du progrès médical entrainant la découverte ultérieure de


centaines de molécules a engendré rapidement l'émergence de souches
multirésistantes, d'où un usage des antibiotiques qui devra être de plus en plus
raisonné.

Haut

B - DEFINITIONS D'UN ANTIBIOTIQUE

- WAKSMAN (1943) : " toutes les substances chimiques produites par des micro-
organismes capables d'inhiber le développement et de détruire les bactéries et
d'autres micro-organismes"

- TURPIN ET VELU (1957): " Tout composé chimique, élaboré par un organisme
vivant ou produit par synthèse, à coefficient chimiothérapeutique élevé dont
l'activité thérapeutique se manisfeste à très faible dose d'une manière
spécifique, par l'inhibition de certains processus vitaux, à l'égard des virus, des
microorganismes ou même de certaines êtres pluricellulaires".

C - CLASSIFICATION DES ANTIBIOTIQUES

Pourquoi ?

* Nombre de molécules élevé, donc faciliter le choix thérapeutique.


* A une parenté structurale s'associera un mode d'action semblable ainsi qu'une
modalité d'action et un spectre d'action, donc classification en famille au sein desquels
peuvent exister des groupes ou sous-groupes. Néanmoins, il existe des antibiotiques
"orphelins": acide fusidique, fosfomycine, triméthoprime.

Critères de classification ?

C - 1 . Origine : " élaboré par un organisme vivant ou produit par synthèse".

Intérêt historique. A l'heure actuelle, il s'agira souvent de molécules, le plus souvent


obtenues par hémisynthèse.

C - 2 . Nature chimique :

Très variable, souvent une structure de base comme le cycle


ß-lactame (famille des ß-lactamines) sur laquelle il y a
hémisynthèse.
Donne souvent, le nom à la famille: Exemples

Aminosides Macrolides Phénicolés Tétracyclines

C - 3 . Modes d'action : Principaux modes d'action :

"l'activité thérapeutique se manifeste à très


faible dose d'une manière spécifique, par
l'inhibition de certains processus vitaux, à
l'égard des virus, des microorganismes ou
même de certaines êtres pluricellulaires".

Leur mode d'action bien que parfois imparfaitement


connu, est d'une grande variabilité, voire complexité.
Sa connaissance peut permettre de comprendre la
synergie et les méchanismes de résistance naturelle
et acquise.
Haut
C - 4 . Modalités d'action :

Etudions les interactions dans le temps


entre des concentrations variables d'un
antibiotique et d'une bactérie:

Bactériostase : Le nombre de
bactéries viables après un temps
d'incubation et de contact donné avec
un antibiotique est inférieur à celui
observé, en l'absence d'antibiotique
(témoin), pour une culture incubée
dans les mêmes conditions. Donc
ralentissement ou arrêt de la
croissance quantifiable en termes de
CMI (concentration minima inhibitrice
en mg/l)

Bactéricidie: Le nombre de bactéries


tuées après un temps d'incubation et
de contact donné avec un antibiotique
est inférieur à celui déterminé au
temps 0. Donc arrêt de la croissance et
mortalité quantifiable en termes de
CMB (concentration minima inhibitrice
en mg/l)

CMI = Plus faible concentration d'antibiotique pour laquelle il n'y a pas de croissance
visible de la souche bactérienne étudiée, les conditions de culture étant standardisées.
CMB = Plus faible concentration d'antibiotique
pour laquelle l'effet bactéricide souhaité est de
99,99 %, les conditions de culture étant
standardisées.

C - 5 . Spectre d'activité : Liste des espèces


sur lesquelles les antibiotiques sont actifs
(spectre étroit ou large).

Le spectre sera évoqué lors de l'étude des


classes thérapeutiques.

Spectre d'activité des antibiotiques selon la nature de la paroi bactérienne

D - CONCLUSION

La diversité des dénominations communes internationales (DCI) comme celles


commerciales justifie une connaissance de la classification des antibiotiques, évitant par
exemple une seconde prescription sans effet bénéfique.
L'abus de prescription des antibiotiques a amené dans certains pays comme le nôtre, à
l'émergence de souches bactériennes nombreuses (prévalence importante) ou encore
multirésistantes, nous ramenant dans une situation d'avant leur découverte.

Avant la découverte de la pénicilline G Après la découverte de la pénicilline G

Dessin de Konk, Le Monde, 20-21 avril 1975

Il conviendra de suivre des règles beaucoup plus précises de prescription.

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)
Espace Etudiant
Cours de Bactériologie Générale

ANTIBIOTIQUES II

CATEGORIES CLINIQUES

CLASSES THERAPEUTIQUES

A - INTRODUCTION

Quelle est la nécessité pour un clinicien de


demander un antibiogramme de la souche
pathogène ?

En fait selon l'agent bactérien impliqué et la


probabilité élevée de résistance acquise (cf
classe thérapeutique), il pourra être nécesaire
d'isoler l'agent infectieux (examen cyto-
bactériologique) et d'effectuer un
antibiogramme.

Objectifs d'aujourd'hui

Quelle définition de l'antibiogramme pourriez-vous donner ?

Etes-vous capable de définir les trois catégories cliniques : S, I ou R ?

Comment définir le spectre clinique d'un antibiotique (SCA) ?

Combien de classes thérapeutiques existent-ils ?

Pouvez-vous les définir ?

B - L'ANTIBIOGRAMME

. Définition: détermination de la sensibilité d'une bactérie aux antibiotiques.


Terme contracté par analogie avec l'hémogramme. Examen quotidien de laboratoire, en
particulier hospitalier pas toujours nécessaire (cf classes thérapeutiques)

. Méthodologies:

- détermination directe de la CMI en milieu liquide ou solide (cf antibiotique IV)

- méthode des disques ou diffusion (pratique)

- E- test

- antibiogramme automatisé ou automates


Choix des antibiotiques: malgrè la grande diversité des antibiotiques disponibles, ils
seront choisis selon leur spectre, donc un antibiotique d'un groupe peut répondre pour un
autre appartenant au même groupe.

En pratique quotidienne: Choix de 10 (en ville) à 30 antibiotiques (en milieu hospitalier)


selon la prise en compte de l'examen morphologique: coques, coccobacilles, bacilles
disposition (en amas, en chainette) coloration (Gram + ou +). Celà suppose la
connaissance du spectre des antibiotiques.

Réponses de l'antibiogramme : un exemple de rendu d'antibiogramme

Interprétation :

BUT = classement en catégorie clinique au


nombre de trois

1/ SENSIBLE

2/ INTERMEDIAIRE

3/ RESISTANT

1/ SENSIBLE: Les souches S sont celles pour lesquelles la probabilité de succès


thérapeutique est acceptable. On doit s'attendre à un effet thérapeutique dans le cas
d'un traitement à dose habituelle par voie génèrale.

2/ RESISTANT: Les souches R sont celles pour lesquelles il existe une forte probabilité
d'échec thérapeutique. On ne peut s'attendre à un effet thérapeutique quel que soit le
traitement.

3/ INTERMEDIAIRE: Les souches I sont celles pour lesquelles le succès thérapeutique


est imprévisible. Elles forment un ensemble hétérogène pour lequel la seule valeur de la
CMI n'est pas prédictive:

il peut s'agir d'un caractère de résistance avec expression très faible (S ???). In vivo, une
partie de ces souches apparaîtront résistantes à la thérapeutique, observations cliniques
partielles ou inexistantes, risque d'échec thérapeutique. On peut espérer un effet
thérapeutique dans certaines conditions (fortes concentrations locales ou accrues). En
fait, il existe une zone tampon entre incertitudes techniques et biologiques.

Catégories définies par le Comité de l'Antibiogramme de la Société Française de


Microbiologie (CA-SFM) délimitées par deux concentrations critiques (c, C) et à deux
diamètres critiques (D, d) et choisies par un compromis : données bactériologiques,
cinétique; résultats cliniques.
Vision banalisée par deux bornes (c, C ou D, d) schématique avec l'évolution de nos
connaissances sur l'activité intrinsèque des antibiotiques en termes de CMI (moyennes,
modales, CMI 50%) vis-à-vis des espèces bactériennes.

C - SPECTRE CLINIQUE DES ANTIBIOTIQUES (SCA)

L'antibiogramme n'est pas nécessaire si'il y a prise en


compte du spectre clinique des antibiotiques (SCA), Pour
deux classes thérapeutique (habituellement sensibles et
modérément sensibles) le recours à l'antibiogramme n'est
pas nécessaire, celà implique qu'il n'y aura pas d'examen
cytobactériologique.

Le SCA est revu régulièrement (cf Vidal). La prescription d'un antibiotique sans
antibiogramme prend alors en compte la faible probabilité de la présence d'un
mécanisme de résistance.

Le SCA se définit selon les éléments suivants: c, C, données pharmacocinétiques,


spectre naturel de l'antibiotique (CMI modales, CMI 50%, CMI 90%) et enfin résultats
cliniques.

Ainsi 4 classes sont proposées au clinicien par espèce bactérienne:

- HABITUELLEMENT SENSIBLE

- MODEREMENT SENSIBLE
- INCONSTAMMENT SENSIBLE

- RESISTANTE

- Les espèces habituellement sensibles appartiennent au spectre naturel de


l'antibiotique et le pourcentage de souches résistantes ne dépasse pas 10%. Le médecin
peut choisir cet antibiotique pour une infection peu sévère et l'antibiogramme n'est pas
nécessaire.

- Les espèces modérément sensibles sont naturellement peu sensibles à l'antibiotique


mais ne possèdent pas de résistance acquise (CMI 50% comprises entre c et C). Le
traitement impose de fortes doses ou il s'agit d'une infection de localisation particulière
avec des concentrations très élevées de l'antibiotique.

- Les espèces insconstamment sensibles sont dans le spectre naturel de


l'antibiotique mais la fréquence de résistance acquise dépasse 10%.

Sensibilité imprévisible, donc l'antibiogramme est nécessaire.


Risque d'échec clinique inacceptable

- Les espèces résistantes : fréquence de résistance > 90%, catégorie hétéroclite dont
les espèces naturellement résistantes ou espèces habituellement sensibles maisle
pourcentage de résistance est supérieur à 90% ou encore l'espèce est sensible in vitro
mais résistante cliniquement.
Haut

Voici un exemple de SCA : érythromycine, antibiotique de la famille des


macrolides

. espèce habituellement sensible : S. pyogenes : CMI modale de 0,03 mg/l

. espèce modérément sensibles : H. influenzae : CMI modale de 4 mg/l)

. espèce insconstamment sensible : S. pneumoniae : CMI modale de 0,03 mg/l mais


30-40% de souches résistantes en 2000

. espèce résistante : E. coli : CMI modale de 32 à 64 mg/l : résistance naturelle


incompatible avec un traitement

D - CONCLUSIONS

Demander un examen cyto-bactériologique avec antibiogramme est un acte


quotidien, banalisé, donc la prescription n'est pas toujours nécessaire, compte tenu
de la quasi-certitude d'avoir une souche sensible aux antibiotiques.

La corrélation clinique n'est pas toujours facile à établir entre les résultats d'activité in
vitro (CMI) et ceux obtenus in vivo (chez le patient).

Malheureusement l'antibiogramme n'explore que partiellement l'activité in vitro d'un


antibiotique (effet bactériostatique mesuré par la CMI).

Les autres caractéristiques d'un antibiotique sont l'effet bactéricide, l'effet post-
antibiotique (PAE) ou encore le phénomène de tolérance (cf polycopié).

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)
Espace Etudiant
Cours de Bactériologie Générale

ANTIBIOTIQUES III : RESISTANCE BACTERIENNE

A - INTRODUCTION

http://www.frm.org/informez/info_ressources_dossiers_article_sommaire.php?id=7&type=10

La résistance, en particulier acquise aux antibiotiques, bien qu'observée dès la


découverte de la pénicilline G avec le staphylocoque doré est devenue un sujet de
préoccupation entrainant depuis trop peu de temps, une réelle prise de conscience au
plan national ou international. La mise en place de réseaux de surveillance comme en
France l'ONERBA (http://www.onerba.org/) ou encore le réseau européen EARSS
(http://www.earss.rivm.nl/) atteste de cette préoccupation d'autant que la mise sur le marché
(AMM) de nouveaux antibiotiques est devenue parcimonieuse depuis plusieurs années.

D'un point de vue clinique, seule est réellement essentielle, la résistance clinique qui
signifie échec du traitement. Si le terme de souche "résistante" a déjà été évoqué dans
les définitions de catégorie clinique et classe thérapeutique d'autres types de résistance peuvent
évoqués comme ci-dessous : naturelle (spectre étroit des antibiotiques), acquise
(mutation), chromosomique, plasmidique, croisée, associée.............

Objectifs d'aujourd'hui

Quelles sont les principales caractéristiques de la résistance bactérienne ?

Quelles définitions de la résistance bactérienne pourriez-vous donner ?

Quels sont les principaux mécanismes biochimiques que vous connaissez ?

Quels sont les principaux mécanismes génétiques connus ?

Pouvez-vous en donner des exemples ?

B - PRINCIPALES CARACTÉRISTIQUES DE LA RÉSISTANCE BACTÉRIENNE :

La résistance bactérienne aux antibiotiques a souvent été rapportée dès l'usage d'un
nouvel antibiotique en clinique comme indiqué ci-dessous pour les ß-lactamines,
principale famille. La résistance bactérienne est donc une fatalité mais d'importance
variable selon le pays, l'espèce bactérienne et l'antibiotique, victime de son succès.

La résistance bactérienne dite acquise présente certaines caractéristiques ci-dessous


évoquées:

- Emergence rapide de quelques souches résistantes après l'introduction d'un


antibiotique

- Fréquence de ce nouveau mécanisme rapidement en augmentation mais


variable selon l'antibiotique. L'émergence de la résistance des pneumocoques à la
pénicilline G constitue une exception, puisqu'elle est apparue en France en 1984, alors
que la pénicilline G a été utilisée dès les années 45. Ce décalage, peu habituel, est en
relation avec un déterminisme génétique plus complexe qu'à l'accoutumée (cf déterminisme
génétique).
- Résistance transférable, car liée à la présence de gènes transférables comme ceux
intégrés dans un plasmide, un intégron ou plus récemment avec l'individualisation de
gènes cassettes (cf génétique IV).

- Ces génes transférables peuvent avoir une diffusion épidémique au sein du


monde bactérien comme celui-ci codant la ß-lactamase TEM identifiée dans des souches
de E. coli et de P. mirabilis, deux ans après l'introduction de la première pénicilline à
large spectre, l'ampicilline.

- L'addition de mécanismes de résistance est devenue monnaie courante dans le


monde bactérien, aussi les bactéries deviennent de plus en plus résistantes, d'où
l'appellation de BMR pour Bactérie MultiRésistante.

- Enfin diverses observations illustrent le potentiel évolutif d'un gène de résistance


bactérien avec, comme exemple, la découverte dans les années 85, des ß-lactamases à
spectre élargi ou étendu (BLSE) et, quelques années après, celles TRI/IRT, résultats de
mutations dans des positions différentes du gène codant pour l'enzyme précédemment
citée TEM-1 ou TEM-2
La résistance acquise peut être donc, modulable permettant au monde bactérien,
une adaptation possible aux thérapeutiques, mêmes les plus récentes.

C - DEFINITIONS DE LA RESISTANCE

* naturelle : Existence d'un ou plusieurs mécanismes de résistance innés, donc propres


à l'espèce. Elle permet de définir le spectre clinique d'un antibiotique.

Exemple: résistance en cocarde à la colistine de Serratia marcescens

* acquise : acquisition d'un mécanisme de résistance pour une souche d'une espèce
habituellement sensible
Exemple: résistance acquise aux pénicillines (amoxicilline ou AMX) et ticarcilline ou TIC)
chez E. coli (à droite souche sauvage)

* clinique : expression de la résistance in vivo par l'échec thérapeutique

Exemple: résistance clinique à la pipéracilline (PIP) lors de pneumopathie à Klebsiella


pneumoniae de phénotype "pénicillinase de bas niveau", résistante à l'amoxicilline (AMX)
et à la ticarcilline (TIC)

* croisée : fait référence au spectre d'inactivation lié à un même mécanisme de


résistance vis-à-vis de divers antibiotiques appartenant à la même famille ou sous-
groupe. Cette notion est utilisée lors de lecture interprétative de l'antibiograme.

Exemple: consulter le communiqué du CA-SFM


(http://www.sfm.asso.fr/nouv/general.php?pa=2)
* chromosomique : résistance liée au chromosome. Il s'agit aussi d'expliquer le
déterminisme génétique d'une résistance naturelle ou acquise dont le ou les gènes est ou
sont liés au chromosome (mutation)

* génétique : modification du patrimoine génétique entraînant des augmentations


limitées de CMI (X 3-5), souvent peu apparente
De légères modifications du patrimoine génétique d'une bactérie peuvent entraîner une
moindre sensibilité à un antibiotique ou plusieurs de la même famille ou de plusieurs
selon le mécanisme. Celles-ci sont révélées lors de la détermination de CMI ou par une
diminution des diamètres d'inhibition dans un antibiogramme par diffusion (méthode des
disques)(cf antibiotique IV). L'échec clinique n'est pas rapporté pour de telles souches de
sensibilité diminuée.

Exemple: E. coli et imperméabilité par rapport aux quinolones (NA, acide nalidixique)

* extrachromosomique : La résistance est liée à la présence d'un fragment d'ADN, le


plus souvent en position cytoplasmique tel un ADN plasmidique révêlé après une
électrophorère sur gel (cf plasmide ci-dessous):

* associée : résistance médiée par un plasmide à des antibiotiques de familles


différentes (cf résistance plasmidique transposable)(cf génétique IV)

Exemple : Chez P. aeruginosa, le plasmide (montré ci-dessous) est responsable de


plusieurs marqueurs de résistance aux antibiotiques mais aussi aux antiseptiques
(mercure) ou encore au tellurite.
* plasmidique: support génétique de la résistance (cf extrachromosomique ci-dessus et
cours Génétique III).

Exemple: Contenu plasmidique d 'une souche de P. aeruginosa (à gauche) et de E. coli


réceptrice avant (à droite) et après transfert (au milieu) par conjugaison. Le plasmide de
plus de 150 kD confère la résistance à plusieurs familles d'antibiotiques ou encore aux
antiseptiques..........

* transposable : localisée sur des transposons (Tn) ou éléments génétiques


mobiles, situés soit dans le chromosome, soit sur un plasmide.

Exemple: Mobilisation d'un transposon (Tn) d'une bactérie donatrice à gauche à une
réceptrice par conjugaison (schéma selon Poyart C.) .
D - MECHANISMES BIOCHIMIQUES :

Préciser le déterminisme biochimique de la résistance amène à comprendre la résistance


croisée entre antibiotiques de la même famille ou encore à imaginer de nouvelles
molécules plus actives, car plus hydrophiles, donc ayant une meilleure diffusion à travers
les porines chez une bactérie à Gram-négatif ou une meilleure affinité sur ses cibles
telles certaines protéines du ribosome (macrolides).

A l'inverse, le mode d'action des antibiotiques peut permettre une meilleure


compréhension des mécanismes de résistance possibles. Depuis quelques années, cinq
mécanismes peuvent être envisagés pour expliquer la résistance naturelle ou surtout
acquise des bactéries aux antibiotiques.

Prenons l'exemple des ß-lactamines chez un


bacille à Gram-négatif, qui pour agir, doivent
traverser la membrane externe ou la paroi au
niveau des porines (motif en bleu), puis
traverser l'espace cytoplasmique et enfin se
fixer sur des cibles ou protéines liant la
pénicilline (PLP ou PBPs en marron) qui sont
situées principalement au niveau de la membrane
cytoplasmique. Cette fixation amène à une
inhibition de celles-ci (transpeptidase,
transglycosylase....) entraînant des modifications
morphologiques de type filaments (cf ci-dessous)
ou au contraire formes sphéroïdes. Le résultat
final est une inhibition de la synthèse du
peptidoglycane (couche interne de la paroi en
rose ici) avec quelquefois, une lyse finale.
Exemple: modification morphologique (à droite) d'une souche de E. coli urinaire lors d'un
traitement par une pénicillline à large spectre.

Les mécanismes de résistance individualisés à l'heure actuelle, en prenant comme


exemple les ß-lactamines, sont donc, les suivants:

* Interférence avec le mécanisme de transport de type imperméabilité

Les porines (Omp ou Opr) sont des canaux aqueux ou


hydrophiles constitués de trois molécules de protéines
qui laissent diffuser diverses molécules de faible masse
moléculaire comme des substrats ou encore des
antibiotiques. Le dysfonctionnement ou la perte de l'une
d'entre elles peut entrainer une augmentation de CMI
d'un facteur 4 à 8 de divers antibiotiques comme ß-
lactamines, acide nalidixique (NA), triméthoprime (TMP),
fosfomycine, tétracycline (TE) ou encore chloramphénicol
(C) (Exemple ci-dessous).

Chez d'autres entérobactéries telle Enterobacter cloacae


ou E. aerogenes, la perte d'une porine (38 kD) associée
à une hyperproduction de la ß-lactamase
chromosomique de type céphalosporinase permet
l'acquisition de la résistance aux carbapénèmes tel
imipénème.

Exemple d'une souche de E. coli imperméable


* Interférence avec le mécanisme de transport de type efflux

Les mécanismes d'efflux observés chez les bactéries à Gram-


positif ou à Gram-négatif, en particulier P. aeruginosa sont
de nature différente ( famille MFS, SNR, RDN....), en
particulier à l'origine chez cette dernière espèce où ont été
individualisés les systèmes ayant des répercutions variables
en termes de CMI vis-à-vis de divers antibiotiques dont les
ß-lactamines avec les protéines MexA-B/OprM, MexC-
D/OprJ, MexE-F/OprN..................

Voulez-vous voir une animation:


http://www.fda.gov/cvm/antiresistvideo.htm

Exemple d'activation du système d'efflux MexA-B/OprM chez P.aeruginosa avec la


sensibilité diminuée à la ticarcilline (TIC) associée ou non à l'acide clavulanique (TCC)
comparée à celle de la pipéracilline (PIP)
* Inactivation ou détoxification enzymatique

Le mécanisme de résistance naturelle ou acquise


par inactivation ou détoxification enzymatique
est important et très varié ainsi qu'en
témoignent tout particulièrement, les ß-
lactamases, au moins 350 enzymes maintenant
identifiées. La résistance par ce type de
mécanisme à d'autres familles d'antibiotiques
est bien connue comme pour les
aminoglycosides avec les enzymes de AAC, ANT
et APH (cf tableau ci-dessous).

Voulez-vous voir une animation:


http://www.fda.gov/cvm/antiresistvideo.htm
Exemple de phénotype" céphalosporinase inductible" chez une souche d'entérobactérie
Le caractère "inductible" est répérable par un antagonisme ou perte d'activité liée à
l'hyperproduction de la ß-lactamase entre CF (céfalotine) et FOX (céfoxitine) mais surtout
entre IPM (imipénème) et CTX (céfotaxime) ou ATM (aztréonam).

* Modification d'affinité de la cible

Ce mécanisme est en relation avec une


modification d'affinité d'une ou plusieurs cibles
de type PLP ou PBP (Penicillin Binding Protein)
comme chez Streptococcus pneumoniae
définissant une résistance de niveau variable :
BNR (bas niveau de résistance) et HNR (haut
niveau de résistance). La résistance des
entérocoques aux pénicillines telle l'ampicilline
peut être en relation avec une hyperproduction
de PLP d'affinité médiocre telle PLP5. La
résistance à d'autres familles d'antibiotiques est
indiquée dans un tableau de synthèse rapporté
ci-dessous.

Exemple de diminution de CMI de la pénicilline G (PG) et du céfotaxime (TX) mesurées


par le E-test chez une souche de S. pneumoniae BNR

* Substitution de cible
Ce mécanisme est de moindre importance dans
le monde bactérien. Cependant, l'exemple
majeur est la résistance intrinsèque ou
méticillino-résistance de Staphylococcus aureus
qui est liée d'une part, à la présence d'une
nouvelle PLP de faible affinité, dénommée PLP2a
et d'autre part à son hyperproduction. La
conséquence clinique est importante, car il y
aura résistance croisée entre ß-lactamines.

Le tableau ci-dessous résume divers exemples de résistance naturelle ou acquise à


diverses familles d'antibiotiques :

Mécanismes Famille d'antibiotique Protéines impliquées


Imperméabilité B-lactamines, macrolides,
tétracy-clines, quinolones,
Omp, Opr telle OprD2
fosfomycine,
chloramphénicol.........
Efflux ß-Lactamines Mex, Mar, AcrAB-TolC
Macrolides MFS (MefA), MsrA, ABC
Lincosamides LsA
Tétracyclines TET(A)-(L)
Inactivation ß-Lactamases (> 350)
ß-Lactamines Phosphotransférases (APH)
Aminoglycosides Nucléotidyltransférases (ANT)
Aminoglycosides Acétyltransférases (AAC)
Aminoglycosides Phosphotransférases (mphA-C)
Macrolides Nucléotidyltransférases (linA, lnuA,
Lincosamides linB....)
Streptogramines Acétyltransférases (vatA-E), lyases
Chloramphénicol (vgbA)
Acétyltransférases (CAT)
Affinité Aminoglycosides Protéines L22...........
Macrolides Méthylases (Erm)
Quinolones- Topoisomérases: ADNgyraseA/B,
Fluoroquinolones ParC/E
Tétracyclines TET(M)-(T)
Substitution ß-Lactamines PLP2a
Glycopeptides Van
Sulfamides DHFR (dihydrofolate réductase)
Triméthoprime DHPS (dihydroptéroate synthétase)

E - MECANISMES GENETIQUES (cf Génétique I et III) :


Le déterminisme génétique de la résistance naturelle et acquise est de mieux en mieux
connu mais il présente de nombreux aspects comme déjà évoqué par les définitions de la
résistance : chromosomique, extra-chromosomique ou plasmidique mais aussi
transposable..... Pour plus de détails, consulter les cours de Génétique I, II, III, IV et V.

- Si la mutation (cours de Génétique I) peut affecter n'importe quel ADN (chromosomique


ou plasmidique), elle peut être individualisée soit au niveau du gène de régulation ou un
équivalent (promoteur) soit au niveau du gène de structure par exemple codant pour une
ß-lactamase (voir ci-dessous les enzymes de type BLSE et TRI/IRT).La modification de
l'ADN peut être soit un simple changement de base (mutation ponctuelle) soit de
plusieurs (déletion, insertion comme d'une courte séquence ou IS).

Voulez-vous voir une animation: http://www.fda.gov/cvm/antiresistvideo.htm

- L'acquisition d'ADN donc d'éventuels gènes de résistance s'effectue, le plus souvent


par conjugaison ou sexualité bactérienne (cours de Génétique II). Ces gènes sont portés
sur diverses structures de type plasmide, intégron et gène cassette (cours de
Génétique III et IV). Les analyses de séquences actuelles conduisent à la découverte de
nouveaux aspects génétiques sur la résistance avec les CR et leurs probables
recombinases.

Le tableau ci-dessous illustre par quelques exemples :

- Il est classique de dire que la résistance chromosomique est d'incidence faible, de


l'ordre de 10 à 20% alors que la résistance plasmidique est beaucoup plus importante, de
l'ordre de incidence de 80%

F - CONCLUSIONS

A partir des années 1945, les antibiotiques ont révolutionné nos pratiques médicales,
mais ils sont aujourd'hui en danger suite à une utilisation excessive et trop fréquente,
même en dehors du domaine purement médical. Les bactéries échangent divers gènes
dont ceux de la résistance et échappent à l'action des antibiotiques. Comme la
découverte de nouveaux antibiotiques est devenue très hypothétique, il convient de
mettre en oeuvre au plan planétaire, diverses stratégies comme la surveillance de la
résistance avec en France, l'ONERBA et au plan européen, l'EARSS.

Il conviendra de resteindre l'usage des antibiotiques à leur strict nécessaire. Des


campagnes de sensibilisation auprès des patients seront entreprises comme maintenant
en France ou dans d'autres pays.
Parmi les autres mesures, il conviendra au niveau de
l'hôpital, de surveiller l'émergence de souches
multirésistances (BMR)(création des CLIN, comité de lutte
contre l'infection nosocomiale), mesures d'isolement des
malades.........

Il conviendra aussi de respecter rigoureusement les règles d'hygiène comme


l'application de protocoles concernant la pose de cathéter ou la désinfection des
endoscopes............

Resteindre leur usage comme activateurs de la croissance dans l'alimentation


animale.
Espace Etudiant
Cours de Bactériologie Générale

ANTIBIOTIQUES IV : ETUDES IN VITRO, L'ANTIBIOGRAMME

A - INTRODUCTION

Il n'est pas toujours nécessaire de rechercher la


sensibilité d'une bactérie à un antibiotique. Car ce
type de traitement est bien standardisé dans
certaines infections et les espèces bactériennes
impliquées sont restées toujours sensibles à cet ou
ces antibiotiques: classe thérapeutique
"habituellement sensible" et "modérément
sensible".
Malheureusement certaines espèces bactériennes peuvent s'adapter plus rapidement aux
antibiotiques (résistance acquise) et donc, être classées en "inconstamment sensible"
à tel ou tel antibiotique, ce qui nécessitera d'effectuer au laboratoire, un antibiogramme.

La résistance acquise des bactéries a toujours été préoccupante et a justifié de préciser


des règles de prescription.

Objectifs d'aujourd'hui

Est-il toujours nécessaire de demander un antibiogramme ?


Quelle définition de l'antibiogramme pourriez-vous donner ?
Etes-vous capable de définir la CMI ?
Pouvez-vous décrire succintement les diverses méthodes de détermination de la CMI ?
Comment partant d'un diamètre d'inhibition autour d'un disque d'antibiotique, peut-on
obtenir la CMI ?
Comment à partir de la CMI, peut-on catégoriser en S, I, ou R ?

B - DÉFINITION DE L'ANTIBIOGRAMME :

C'est la détermination de la sensibilité d'une bactérie aux antibiotiques. Terme


contracté par analogie avec l'hémogramme. Examen quotidien de laboratoire, en
particulier hospitalier pas toujours nécessaire (cf classes thérapeutiques)

C - INTÉRÊT DE L'ANTIBIOGRAMME

Cet examen de routine va permettre de comparer la valeur de la CMI d'un antibiotique


par rapport à celle de deux concentrations critiques c et C (mg/l). Il permet de
catégoriser la souche à étudier en confrontant la CMI d'un antibiotique donné à celle de
la concentration c ou C, proposée par le Comoté d'experts, en France CA-SFM, Comité
de l'Antibiogramme de la Société Française de Microbiologie).

Définition des catégories cliniques

Haut
D - MÉTHODES DE DÉTERMINATION DE LA CMI

La mise en évidence de l'effet d'un antibiotique vis-à-vis d'une


souche bactérienne est simple et macroscopique: Effet sur la
croissance ou un exemple d'antibiose. La définition de la CMI fait
référence à l'inhibition mascroscopique.

- La méthode de dilution en milieu liquide


consiste à préparer une série de vue à
hémolyseavec le même milieu de culture liquide
(deux ml) puis constituer une gamme de
concentrations de l'antibiotique à tester, par
exemple 0,5 mg/l 1, 2, 4, 8, 16 (raison
géométrique de base 2).
Il reste un tube (contrôle) ou témoin de croissance de la souche à tester. Enfin on ajoute
la même quantité de germes dans chacun tube (inoculum). La galerie ainsi préparée sera
incubée à 37°C pendant 18 heures. Enfin elle sera examinée à l'oeil nu et dans l'exemple
ci-dessous, la CMI de l'antibiotique à tester est de 2 mg/l.

Le principal inconvénient de cette méthode est la quantité de tubes à manipuler, soit 100
tubes pour une dizaine d'antibiotiques à examiner.

- Une variante de cette méthode consiste à utliiser des microcupules en plaque au lieu
de tubes. Il s'agit d'une microméthode en milieu liquide.

Voici un exemple avec indicateur de pH

- Certains dispositifs commerciaux utilisent ce type de variante, par exemple pour la


détermination de la CMI d'une ß-lactamine chez une souche de Streptococcus
pneumoniae.

- La méthode de dilution en milieu solide consiste à


incorporer l'antibiotique à une concentration donnée dans
la gélose, maintenue liquide à 42°C. Une série de boites de
Pétri est préparée avec des concentrations d'antibiotique
variant selon une progression géométrique de base de 2,
comme précédemment.
Puis sont préparées les suspensions des différentes bactéries à examiner qui sont alors
distribuées dans les microcupules métalliques (exemple d'un système à 20 cupules).
Des tiges métalliques stériles plongent dans chaque cupule.
Puis par un mouvement de translation sont déposées les
différentes bactéries sous le même volume (de l'ordre du
microlitre) à la surface du milieu gélosé ou solide.

Après avoir ensemencer la série de boîtes, celles-ci


sont incubées dans une étuve jusqu'au lendemain. La
lecture est alors effectuée: il est facile de repérer
l'emplacement de chaque souche et de noter
croissance ou absence de croissance.

Cette méthode semi-automatique permet d'examiner des séries de 20 souches à 98


souches selon le type de plaque.Cette méthode de détermination de la CMI par une
approche directe est , en fait, peu pratique.Car tester la sensibilité à 10 antibiotiques
nécessite de préparer une centaine de boîtes contenant les diverses concentrations
d'antibiotique.

- La méthode de diffusion ou des disques en milieu solide est la plus simple. Elle
consiste à ensemencer en surface d'un milieu solide par inondation de la souche à tester.
Puis à déposer des disques de papier buvard comprenant un antibiotique à une certaine
concentration.

Après solubilisation de l'antibiotique par l'humidité du milieu gélosé,


il s'établit un gradient de concentration qui varie avec le temps.

La boite ainsi préparée est mise à incuber pendant une nuit à 37°C. Il
est possible de voir la croissance bactérienne (au milieu de la boite)
ainsi que des zones d'inhibition de la croissance circulaires, à proximité
de chaque disque.

Plus la zone d'inhibition est grande, plus grande est la sensibilité de la souche
bactérienne testée vis-à-vis de l'antibiotique étudié. Chaque zone peut être mesurée
selon divers moyens: règle, compas, pied à coulisse.....
Lecture automatique avec une
caméra

La zone d'inhibition circulaire est mesurée par le diamètre en mm, puis il sera possible
de calculer la CMI de l'antibiotique pour la souche examinée en reportant ce diamètre sur
une courbe de concordance, pré-établie à l'avance avec une centaine de souches
(échantillonnage) de sensibilités différentes.

Connaissant le diamètre d'inhibition pour un antibiotique donné, je puis déterminer la CMi


(mg/l) d'un antibiotique pour une souche bactérienne.
Néanmoins la détermination
par cette méthode est
insatisfaisante, d'où la
nécessité de recourir à la
méthode directe par
dilution ou encore à d'autres
méthodes comme celle du E-test.

- D'autres méthodes dont certaines semi-


automatiques ont été proposées depuis une vingatine
d'années.

 E-test : Un gradient de concentrations


d'antibiotIque est obtenu dans une bandelette
plastifiée. Il suffit de déposer l'une de celle-ci
(une bandelette par antibiotique) à la surface
d'une boite de Pétri ensemencée par la
suspension de la bactérie à tester puis après un
nuit d'incubation à 37°C dans une étuve, de lire
directemnt la valeur de la CMI au niveau de la
zone à lire.

 Semi-automates :
- méthode rapide en 4 heures

- Nouvelle génération d'automates mais méthode un peu plus lente en 6 -10 heures
:
E - CONCLUSION

Prescrire un examen cyto-bactériologique et un antibiogramme est un acte quotidien et


banal qui va rechercher à confirmer la sensibilité d'une bactérie à un antibiotique donné.
Néanmoins cet examen routinier n'explore pas les intereactions entre deux, voire trois
antibiotiques sauf circonstances particulières comme montré ci-dessous.

D'autres méthodes permettent de préciser d'autres paramètres d'une antibiothérapie


adaptée comme de calculer les effets synergiques de deux antibiotiques tel l'effet
bactériostatique et bactéricide d'une assocation de deux antibiotiques ou encore le
pouvoir bactéricide du sérum (cf travaux pratiques).

Ce cours a été préparé par le Professeur A. PHILIPPON (Faculté de Médecine COCHIN-PORT-ROYAL, Université PARIS
V)
Espace Etudiant
Cours de Bactériologie Générale

ANTIBIOTIQUES V : LISTE EN 2002

A - ANTIBIOTIQUES INHIBITEURS DE LA SYNTHÈSE DU PEPTIDOGLYCANE

 ß-lactamines I : Pénames, carbapénèmes et oxapénames (ou clavames)


 ß-lactamines II : Céphèmes et oxacéphèmes
 Autres antibiotiques : Fosfomycine, Glycopeptides, Bacitracine

B - ANTIBIOTIQUES ACTIFS SUR LES ENVELOPPES MEMBRANAIRES

 Polymyxines
 Gramicidines et tyrocidine

C - ANTIBIOTIQUES INHIBITEURS DES SYNTHÈSES PROTÉIQUES

 Aminosides ou aminoglycosides (aminosides-aminocyclitols)


 Macrolides, Kétolides, Lincosamides, Streptogramines (MLS)
 Tétracyclines
 Chloramphénicol
 Acide fusidique
 Oxazolidinones

D - ANTIBIOTIQUES INHIBITEURS DES ACIDES NUCLÉIQUES

 Rifamycines
 Quinolones
 Novobiocine
 5-Nitroimidazoles
 Nitrofuranes

E - ANTIBIOTIQUES INHIBITEURS DE LA SYNTHÈSE DES FOLATES

 Sulfamides
 2-4-Diaminopyrimidines
 8-Hydroxyquinoléines
Cours de Bactériologie Générale

ANTIBIOTIQUES V : LISTE EN 2002

A - ANTIBIOTIQUES INHIBITEURS DE LA SYNTHÈSE DU PEPTIDOGLYCANE

ß-lactamines I : Pénames, carbapénèmes et oxapénames (ou clavames)

Les pénames
Groupe de la Pénicilline G
Spectre: bactéries à Gram positif, coques à Gram négatif. Ces produits sont inactivés par
les pénicillinases, notamment celle du staphylocoque.

Pénicillines anti-staphylococciques
Spectre : celui de la pénicilline G ; ces produits sont moins actifs que cette dernière, mais
ils ne sont pas inactivés par la pénicillinase du staphylocoque. D’où leur unique indication
: infections à staphylocoques producteurs de pénicillinase.

Pénicillines à large spectre


Actives aussi sur certains bacilles à Gram-négatif ; inactivées par les pénicillinases, y
compris celle du staphylocoque.

Inactives sur Pseudomonas aeruginosa : aminopénicillines


Pénicillines à large spectre actives sur P. aeruginosa

Amidino-pénicillines
Spectre: bacilles à Gram-négatif (entérobactéries)

Pénicillines-sulfones
Activité antibactérienne faible, inhibiteurs de ß-lactamases, en association avec une autre
ß-lactamine
Sulbactam
Tazobactam

Les Carbapénémes
Spectre large : stabilité vis-à-vis de diverses ß-lactamases

Les Oxapénames ou Clavames


Acide clavulanique
Activité antibactérienne faible, inhibiteur de ß-lactamases, en association avec une autre
ß-lactamine

Haut

ß-lactamines II : Céphèmes et oxacéphèmes


Les céphèmes correspondent aux céphalosporines au sens strict. Certains, les 7-alpha-
méthoxy-céphalosporines, sont individualisés sous le nom de céphamycines.
Les oxacéphèmes sont les 1-oxa-7 alpha méthoxy céphalosporines.
En dépit de ces différences de structure, ces divers produits sont souvent désignés
globalement sous le terme de céphalosporines. Ce sont tous des produits à large spectre,
mais dont l’intérêt réside surtout dans leur activité sur les bacilles à Gram- négatif.
Les céphalosporines injectables sont classées, selon leurs propriétés antibactériennes, en
trois " générations ".
Les céphalosporines orales peuvent aussi être classées en trois catégories, globalement
superposables, du point de vue de l’activité antibactérienne, à cellesdes céphalosporines
injectables.

Céphalosporines injectables de 1ère génération


Relativement résistantes aux pénicillinases et pouvant être ainsi actives sur des souches
résistantes aux pénicillines à large spectre ; détruites par les céphalosporines de
nombreux bacilles à Gram-négatif. Inactives sur P. aeruginosa.

Céphalosporines injectables de 2éme génération


Se distinguent des précédentes par une relative résistance à certaines céphalosporinases
et un léger gain d’activité sur les souches sensibles. Inactives sur P. aeruginosa.

Céphalosporines injectables de 3éme génération


Accentuent les avantages des précédentes : meilleure activité sur les souches sensibles
et résistance accrue à l’inactivation par les céphalosporinases. Quelques-unes ont aussi
une certaine activité contre P. aeruginosa.

Autres céphalosporines injectables


Quelques molécules proches des céphalosporines de troisième génération sont moins
actives sur les entérobactéries; elles présentent toutefois des avantages particuliers
relatifs à leurs propriétés antibactériennes ou pharmacocinétiques.

Céphalosporines orales
Monobactames
Spectre : bacilles à Gram négatif aérobies, y compris P. aeruginosa.
Aztréonam, Azactam® IM.IV.

Haut

Autres antibiotiques

Fosfomycine
Spectre large

Glycopeptides
Spectre étroit : bactéries à Gram positif (surtout staphylocoque et entérocoque).

Bacitracine
Spectre étroit : bactéries à Gram-positif

C - ANTIBIOTIQUES INHIBITEURS DES SYNTHÈSES PROTÉIQUES

Aminosides ou aminoglycosides (aminosides-aminocyclitols = AMAC)

Spectre large ; les streptocoques et les Listeria sont peu sensibles et les bactéries
anaérobies résistantes.

Macrolides, Kétolides, Lincosamides, Streptogramines (MLS)


Spectre limité : bactéries à Gram-positif, coques à Gram-négatif.
Tétracyclines
Spectre large

Groupe du chloramphénicol
Spectre large - Antibiotiques électifs des fièvres typho-paratyphoïdiques.

Acide fusidique Fucidine per os, IV.


Spectre étroit : bactéries à Gram-positif, surtout le staphylocoque (les streptocoques
sont peu sensibles) et coques à Gram-négatif.

Oxazolidinones
Spectre limité : bactéries à Gram-positif, Pasteurella.
Linézolide, Zyvoxid® per os, IV.

D - ANTIBIOTIQUES INHIBITEURS DES ACIDES NUCLÉIQUES


Rifamycines

Quinolones

Produits classiques
Spectre étroit : bactéries à Gram négatif
Indication : infections urinaires essentiellement

Nouveaux dérivés = 6-fluoroquinolones


Spectre large

Novobiocine Cathomycine per os, IV.


Spectre étroit: bactéries à Gram positif, surtout le staphylocoque; coques à Gram-
négatif; Haemophilus et Pasteurella

5-Nitroimidazoles
Spectre particulier: bactéries anaérobies, sauf bacilles à Gram-positif non sporulés
Nitrofuranes
Spectre large, sauf Proteus, Serratia, P. aeruginosa et Acinetobacter

ANTIBIOTIQUES V : LISTE EN 2002

E - ANTIBIOTIQUES INHIBITEURS DE LA SYNTHÈSE DES FOLATES

Sulfamides
Spectre large sauf Enterococcus faecalis et lactobacilles; P. aeruginosa est peu sensible.

2-4-Diaminopyrimidines
Spectre large, sauf Pseudomonas, Acinetobacter, Neisseria, Moraxella, Brucella,
Campylobacter, Nocardia, Actinomyces, Bacteroides, Clostridium, Enterococcus faecalis.

" Antiseptiques " urinaires et intestinaux

8-Hydroxyquinoléines
Spectre large
Espace Etudiant
Cours de Bactériologie Générale

DIAGNOSTIC D'UNE INFECTION BACTERIENNE I

Objectifs: Connaitre les méthodes et leurs principales étapes du diagnostic biologique


d'une infection bactérienne

A - GÉNÉRALITÉS

Le diagnostic bactériologique est un ensemble de moyens permettant de confirmer telle


ou telle étiologie infectieuse d'origine bactérienne. Ces moyens diagnostiques sont variés
et caractérisent soit le diagnostic direct soit celui indirect :

DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle-même, donc finalement de


sa culture ou isolement qui permettra l'identification ultérieure ainsi que de préciser sa
sensibilité aux antibiotiques (antibiogramme).

DIAGNOSTIC INDIRECT : mis en évidence de la réponse de l'organisme à l'infection


par la présence d'anticorps spécifiques, le plus souvent sériques ou plus rarement par
une réponse dhypersensibilité, dite allergique.

B - DIAGNOSTIC DIRECT

La prescription s'intitulera "examen cyto-bactériologique" d'une urine (ECBU), d'une


expectoration (ECBC), d'un liquide pleural... ayant pour objectif de rechercher la mise en
évidence de la bactérie responsable de l'infection.

1 - Demande : Il sera important de bien identifier le patient par son nom, son prénom,
sa date de naissance... Il existe une procédure standard de recherche de cellules et de
germes, d'où l'appellation suivante : "Examen cytobactériologique des urines ou ECBU".
Celle-ci exclut toute recherche systématique de germes particuliers telle la
recherche de BAAR (Bacilles Acido-Alcoolo-Résistants), de leptopsires...
Le clinicien ne devra jamais oublier d'indiquer toute demande ou recherche
particulière, en raison de l'utilisation de milieux spéciaux.

Exemple : La culture du bacille tuberculeux (BAAR) se fera sur le milieu de Lowenstein-


Jensen après, au minimum 3 semaines d'incubation à 37°C, le milieu étant protégé de la
dessication par un bouchon en caoutchouc.

2 - Examen macroscopique :

Toute infection bactérienne s'accompagne, outre la présence


de bactéries, de signes biologiques liés à l'inflammation avec
l'éventuelle présence de leucocytes, notamment de
polynucléaires. Ces éléments peuvent entrainer au delà d'un
seuil, une modification visuelle, clairement perceptible à l'oeil
nu, qui signe une anomalie patente. Divers éléments sont
alors obtenus comme le montrent les exemples suivants:

 Trouble : urine, LCR, liquide pleural ou articulaire


Hématurique : urine, LCR, liquide pleural Autre coloration anormale
ou articulaire

Odeur : on notera celle caractéristique lors Consistance : Exemple d'une selle


d'infections à germes anaérobies stricts diarrhéique.
dans un liquide pleural

Haut

3 - Examen microscopique
L'examen microscopique a un intérêt diagnostique au delà d'un certain
seuil... Donc souvent, on notera aucune anomalie macroscopique ou
visible, d'où la nécessité de rechercher des bactéries et des éléments
cellulaires de type polynucléaire au microscope optique.

3 - 1 Etat frais (Grossissement de 400, en général):

Une préparation est obtenue avec le dépôt d'une goutte entre lame et lamelle, puis on
observe au microscope d'une part, la présence éventuelle de bactéries (coque,
diplocoque, chainette, coccobacille, bacille...), le type de mobilité comme celle du
"rameur" ou celle en "en vol de moucheron".

Par ailleurs, lors de cette observation, seront évaluées les cellules avec une appréciation
semi-quantitative (rares, peu nombreux, nombreux, très nombreux...) ou mieux
quantitative, exprimée par nombre d'éléments / mm3 ou ml ou par champ.
Exemple d'une cellule de Malassez pour LCR, liquides de ponction, urines

3 - 2 Examen après coloration (Grossissement de 1000, en général) :


Un frottis fin est obtenu à partir du produit pathologique, puis coloré permettant une
meilleure visualisation des bactéries et/ou des éléments cellulaires

Coloration simple: Le frottis fin est traité Coloration différentielle : Compte tenu
par un seul colorant basique (bleu de des différences structurales (cf anatomie)
méthylène). Cette technique est simple et de la paroi des bactéries, la coloration de
rapide, peu courante, à l'exception de Gram découverte par Hans GRAM en 1884
l'examen de pus urétral pour la recherche permet de distinguer les bactéries
de gonocoque: diplocoques en grain de colorées en violet (G+) de celles en rose
café intracellulaires. (G-).

Il est alors possible de suspecter en


tenant compte de la réponse Gram+ ou -
et des morphologies observées d'évoquer
un probable diagnostic

Exemples de probables diagnostics bactériologiques en fonction des


commémoratifs :
suspicion de pneumonie (A), de bronchopneumonie (B), de méningite (C), de
pyélonéphrite (D)
3 - 3 Examen après coloration spéciale (Ziehl-Neelsen) : Les bacilles acido-alcoolo-
résistants (BAAR) compte tenu de la composition de leur paroi sont détectés
spécifiquement. Il s'agit du groupe des mycobactéries dont le bacille tuberculeux (Bacille
de KOCH/BK) colorées en rouge sur un fonds bleu. Ce contraste de coloration permet une
recherche plus facile sur un frottis. D'ailleurs, l'usage actuel d'un colorant fluorescent
(auramine) confirme l'intérêt d'une visualisation plus facile (cf GBEA).

3 - 3 Examen après coloration spéciale (MGG): La coloration de May-Grunewald-


Giemsa (MGG) est principalement à visée cytologique pour une meilleure individualisation
des éléments cellulaires tels polynucléaires, macrophages, lymphocytes... Les bactéries
peuvent être néanmoins observées avec leur capsule comme le pneumocoque (A).
D'autres peuvent être spécialement recherchées telle Borrelia burgdorferi dans la maladie
de Lyme (B).

Haut

3 - 4 : Autres types de microscopie

Microscopie à fluorescence (source particulière ; lampe UV) :

 coloration spécifique des BAAR (mycobactéries) par fluorescence (auramine)(cf


GBEA). Cette technique est d'usage courant en laboratoire.
 coloration par anticorps marqués par un conjugué fluorescent. Ce type de
technique est maintenant d'usage plus limité (sensibilité insuffisante)comme celle
de la recherche de Legionella pneumophila dans un prélèvement pulmonaire. La
recherche de l'antigène urinaire est très supérieure en sensibilité.

Microscopie au fond noir (condenseur spécial) : Il s'agit de rechercher des bactéries


sur lequelles la lumière s'est réfléchie. Cette recherche est inhabituelle: diagnostic
bactérioscopique de la syphilis (Treponema pallidum) sur un prélèvement de chancre (A).

La recherche d'un microorganisme rare de type levure (Cryptococcus neoformans) est


constante dans une suspicion de méningite chez le sidéen (B).
Microscopie électronique : rarement utilisée en pratique, plus souvent dans le cadre
de l'identification d'une nouvelle étiologie bactérienne (Bartonella, Helicobacter...).

Exemple: individualisation d'un corps d'inclusion à Chlamydia trachomatis

3 - 5 : Autres types de coloration : Il existe en bactériologie, diverses autres


techniques de coloration qui ne présentent qu'un intérêt anecdotique. Cependant il
convient de ne pas les méconnaitre dans le cadre d'une nouvelle étiologie bactérienne
comme la techniqued'imprégnation argentique (intérêt historique) dans l'angiomatose
bacillaire ou la maladie des griffes du chat. Les autres comme celle de visualisation de la
capsule (coloration de Moeller) ou encore celle des cils ou flagelles (coloration de
Leifson) sont quelquefois mises en oeuvre dans le cadre de diagnostic d'une espèce...

Exemple d'imprégnation Exemple de coloration de la Exemple de coloration


argentique pour la recherche spore (Moeller) d'une flagellaire (Leifson) d'une
de Treponema pallidum souche de Clostridium souche de Vibrio
(spirochète)
4 - Premières conclusions:

Les éléments récoltés de l'examen macroscopique et surtout microscopique


fournissent souvent des arguments diagnostiques de très forte présomption qui vont
permettre la mise en route d'une thérapeutique adaptée. La culture ou l'isolement de
l'agent causal sera, cependant, essentielle. Elle permettra l'identification ultérieure mais
aussi de préciser sa sensibilité aux antibiotiques (Antibiogramme). Le diagnostic
indirect sera quelquefois le seul recours diagnostique possible dans quelques rares
maladies comme la syphilis (cf diagnostic bactériologique II).

Ce cours a été préparé par le Professeur A. PHILIPPON etle Dr. L. PROTS (Faculté de Médecine COCHIN-PORT-ROYAL,
PARIS V)
Espace Etudiant
Cours de Bactériologie Générale

DIAGNOSTIC D'UNE INFECTION BACTERIENNE II

Objectifs : Connaitre les méthodes et leurs principales étapes du diagnostic biologique


d'une infection bactérienne

A - GÉNÉRALITÉS

Le diagnostic bactériologique est un ensemble de moyens permettant de confirmer telle


ou telle étiologie infectieuse d'orIgine bactérienne. Ces moyens diagnostiques sont variés
et caractérisent soit le diagnostic direct soit celui indirect :

Le diagnostic direct est le seul diagnostic de certitude, car il permet la mise en


évidence de la bactérie elle-même, donc finalement sa culture ou isolement qui
permettra l'identification ultérieure mais aussi de préciser sa sensibilité aux antibiotiques
(antibiogramme).

L'examen cyto-bactériologique d'un produit pathologique débute par l'examen


macroscopique, puis l'examen microscopique (cf diagnostic I). Simultanément cet
examen microscopique, est ensemencé le produit pathologique pour l'éventuel isolement
d'un ou plusieurs germes.

Culture - Isolement :

Divers milieux sont utilisés qui doivent satisfaire les besoins nutritifs et énergétiques
des bactéries à cultiver (cf Physiologie-Croissance). En pratique, sont utilisés plusieurs
milieux solides (gélosés) avec une technique particulière d'ensemencement (isolement
orthogonal ou en cadran) permettant l'isolement de clones bactériens sous la forme de
colonies (de l'ordre de 106 bactéries).
Exemples de milieux solides coulés en boite de Pétri selon le produit pathologique
et la demande :

 Pus, liquides de ponction : milieux enrichis au sang (frais, cuit=chocolat),


milieu sélectif (Chapman, ou sur demande: Loewenstein-Jensen)

 Expectoration : milieux enrichis au sang (frais, cuit), milieu sélectif (Chapman;


Drigalski ou sur demande: Lowenstein-Jensen)

 Urines : milieu sélectif (Drigalski), milieu polyvalent pour bactéries G+ et G-


(CPS, Uricult®, Chromagar®...).

 Selles (coproculture): milieux sélectifs (Drigalski et SS pour entérobactéries


telles Salmonella et Shigella, milieux spéciaux pour Campylobacter (non montré),
quelquefois Chapman pour staphylocoque)

Exemples de milieux liquides (cf glossaire) :

L'usage de milieux liquides est limité en raison de l'absence possible d'isolement.

 Sang, pus, liquides de ponction : milieux enrichis (flacons pour hémoculture,


coeur-cervelle, trypticase.....

 Selles (coproculture): milieu sélectif (Muller-Kauffman)


Conclusion : après ensemencement, les divers milieux sont habituellement incubés dans
une étuve ou une chambre chaude à 37°C, en atmosphère ambiante (culture aérobie) ou
en l'absence d'oxygène (culture anaérobie en jarre plastique, par exemple).

Délai d'incubation : De très nombreuses espèces bactériennes cultivent après 18 à 24


H d'incubation à 37°C. Cependant d'autres espèces ont des délais d'incubation plus longs
telles Mycobacterium tuberculosis (temps moyen d'isolement de l'ordre de 21 jours)

Outre le délai d'obtention, les cultures sont examinées en notant la quantité de


colonies obtenues de manière :

 semi-quantitative (rares, peu nombreuses, nombreuses, très nombreuses) pour


les liquides de ponction, par exemple

 quantitative (104, 105, 106 ..../ml) pour les prélèvements urinaires et


pulmonaires.

Les autres éléments pris en compte sont :

 la culture en aérobiose et/ou en anérobiose


 l'aspect des colonies: la taille, la bordure (lisse, rugueuse), la coloration
(pigment jaune pour Staphylococcus aureus, pigment violet pour Serratia
marcescens)

 la présence d'une hémolyse (alpha, béta).

Exemples d'isolement:

Pus sur une gélose au sang frais Urine sur le milieu CPS

Quelques autres exemples de cultures

A B

Prélèvement de gorge avec de Expectoration avec de nombreuses


nombreuses colonies ß-hémolytiques colonies soit alpha-hémolytiques et
(gélose au sang frais) muqueuses évoquant un pneumocoque, soit
petites et brillantes évoquant une souche de
Haemophilus influenzae (gélose au sang cuit
ou gélose chocolat)

C D

Urine avec de nombreuses colonies de deux Urine avec de nombreuses colonies de trois
types d'entérobactéries lactose + (milieu de types différents (milieu UTI)
Drigalski): colonies muqueuses et colonies
irrégulières
Haut

Identification - Antibiogramme : L'identification et l'antibiogramme de la majorité des


bactéries habituelles est alors précisé dans un délai de 18-24 h.

 A l'aide de tests d'orientation rapide : oxydase, catalase, coagulase...

 Par ensemencement d'une galerie biochimique adaptée :


Identification de Escherichia coli et Proteus mirabilis par un ensemble de réactions
du métabolisme intermédiaire avec la galerie commerciale API20E (cf Physiologie-
Croissance)

Exemple d'un antibiogramme (méthode de diffusion ou des disques) d'une souche de


Escherichia coli productrice d'une pénicillinase (cf cours sur les Antibiotiques).

Recherches complémentaires : il peut être nécessaire de déterminer la structure


antigénique par des réactions d'agglutination sur lame à l'aide d'immunsérums (cf
streptocoques, entérobactéries, Salmonella).
Conclusion : L'étape de l'identification et de l'antibiogramme requiert souvent un délai
supplémentaire d'incubation de 24 h. A l'heure actuelle, existent des automates qui
effectuent dans un délai de quelques heures, l'identification et l'antibiogramme.

Quelquefois cette procédure est insuffisante pour l'identification d'une bactérie.


Il convient de faire appel :

 soit à des modalités classiques de recherche d'autres caractères bactériens


tels la croissance sur certains milieux pour l'identification des sources de carbone
permettant la croissance (galerie API biotype 100), le type respiratoire, le type
fermentaire, le type antigénique, le lysotype......... (cf glossaire)

 soit à des modalités modernes telles l'amplification génique (voir ci-dessous)


de certains gènes ou encore le séquencage d'autres(ARNr 16S, sodA, gyrB...)(cf
séquencage).

Autres moyens diagnostiques (produits bactériens) :

 Recherche d'antigène soluble : Exemple d'une pneumopathie à Legionella


pneumophila de sérogroupe L1 ( cf Legionella).

Ce test immunochromatographique sur membrane aide au diagnostic présomptif


des infections à Legionella en parallèle avec la culture ou d'autres tests. Les
avantages de ce test sont : précocité (dès le début des signes), simplicité (sur
urine), rapidité (en + 15 minutes), diagnostic tardif (> 2 mois après les signes
cliniques), même après untraitement antibiotique adapté, Donc Bonne valeur
prédictive mais ce test ne détecte pas les autres sérogroupes de L. pneumophila,
(cf Legionella)
 Méthodes moléculaires : Il existe depuis quelques années, des méthodes pour
identifier une bactérie dans un produit pathologique ou d'une culture. Le principe
en est simple puisqu'il consiste à amplifier un gène entier ou non avec des
amorces spécifiques (cf PCR) qui peut être ultérieurement révêlé par
électrophorèse sur gel, ou par hybridation (cf hybridation) ou encore séquencé et
comparé avec ceux déposés dans des banques (EMBL, NCBI par exemple)(cf
séquencage).

L'intérêt de ces diverses méthodes se résume

d'une part par un bénéfice clinique lié :

 gain de sensibilité (X 2 par rapport aux méthodes classiques) pour la recherche


notamment des Chlamydia génitaux.

 gain de temps important (divisé par 2) pour l'identification des mycobactéries à


partir de la culture.

 gain de spécificité pour l'identification des germes inhabituels à partir des


cultures.

d'une part à la simplicité et la rapidité d'exécution de la plupart de ces techniques


ainsi que par leur coût modéré justifiant une utilisation de plus en plus routinière dans les
laboratoires de biologie.
Exemples de techniques de Biologie moléculaire:

- PCR : "Polymerase chain reaction" ou l'amplification génique dont le principe est bien
connu (cf PCR) est couramment utilisée pour le diagnostic à partir du produit
pathologique de germes de culture difficile, voire impossible, tel Chlamydia trachomatis
(1 er jet d'urine)

Haut

Un appareil de PCR et la révêlation UV d'un produit amplifié après électrophorèse sur gel
- Hybridation : le produit ou ADN amplifié par PCR peut être hybridé avec une sonde
spécifique déposée sur un support de type nitrate de cellulose, puis révélé.
Exemple de l'identification d'une espèce de mycobactérie avec le réactif Inno-Lipa®

- Séquencage : Certains gènes tels celui codant pour l'ARNr 16S ou 23S peuvent être
maintenant amplifiés, séquencés et analysés par comparaison avec ceux déposés dans
les banques de données (http://www.infobiogen.......):

Le produit d'amplification (de 400 à 750 bp/brin) a été purifié ou non puis adressé au
centre de séquencage. La séquence est alors en quelques jours par courriel (E-mail) puis
analysée :
GGGGACGTATTCACCGTGCACATTCTGATTCACGATTACTAGCGATTCCGACTTCACGCAGTCGA
GTT
De nouveaux serveurs permettent maintenant des analyses phylogénétiques, devenues
nécessaires (Université Lyon 1, BIBI).

Pour quelques groupes bactériens tels les streptocoques, il est impossible d'établir une
différence suffisante dans la séquence de l'ARNr 16S. Aussi sera -t-il fait appel à celle d
'un autre gène comme SodA (Poyart C. et al. Faculté de Médecine Necker-Enfants
Malades).

Haut
C - DIAGNOSTIC INDIRECT OU SÉROLOGIQUE

Principe : Il se base sur les conséquences induites chez l'hôte (réaction


immunologique), à savoir la production d'anticorps (cf cours d'immunologie). La réaction
immunitaire ne se développe qu'à partir d'un délai, de l'ordre de 8 à 10 jours. Par
ailleurs la spécificité est relative (réactions croisées). La sensibilité varie selon le type
de technique utilisée: agglutination et ELISA. De plus, en raison d'immunisation active au
cours de la vie, il conviendra de demander deux examens sérologiques à deux semaines
d'intervalle. Dans d'autres diagnostics, pourront être individualisés les anticorps anti-M et
anti-G.

Techniques : Les anticorps sont recherchés, le plus souvent, dans le sang circulant
après prise de sang, de l'ordre de 5 à 10 ml sur tube sec sans anti-coagulant. Il existe
diverses techniques pour déceler la présence d'anticorps.

 Réaction d'agglutination

en tubes (sérodiagnostic de Widal-Felix, Wright....) avec des dilutions du sérum


(Wright du 1/10 au 1/1280e)

sur lame
(Epreuve à
l'antigène
tamponné
ou rose
bengale
test dans
la
brucellose)
sur sérum
non dilué

 Réaction de déviation ou fixation du complément

 Recherche d'anticorps par ELISA


 Recherche d'anticorps par immunofluorescence

 Recherche d'anticorps par une technique sandwich (Coombs)

 Recherche d'anticorps par une technique de révêlation utilisant les


globules rouges

Dosage des anti-Streptolysines O ou ASLO (infections streptococciques)

Dosage des anti-Staphylolysines (infections profondes staphyloccocciques)

Quelques exemples de sérodiagnostic:

Brucellose : agglutination (Wright), Antigène tamponné ou Rose bengale, Fixation du


complément, Coombs, IFI, ELISA

Chlamydioses : IFI, Fixation du complément

Legionellose : IFI, ELISA

Lyme (maladie) : IFI, ELISA, Western-blot

Mycoplasmes : Fixation du complément, ELISA


Rickettsioses - Coxiella : IFI

Salmonelloses : anti-typhoparathyphoïdiques (Widal-Félix)

Infections profondes à Staphylocoques : anti-staphylolysines alpha

Infections à Streptocoques du groupe A : anti-streptolysines, anti-strepdornases, anti-


streptokinases

Syphilis : TPHA, FTA, TPI, ELISA

Yersiniose à Yersinia enterocolitica : agglutination

Tularémie : agglutination

D - CONCLUSIONS

La décennie écoulée a vu des modifications profondes sur la stratégie diagnostique


des infections bactériennes au profit du diagnostic direct ou bactériologique avec
un raccourcissement considérable des réponsesà destination des cliniciens. C'est ainsi
qu'avec l'avénement des automates d'hémoculture, le délai d'incubation a été raccourci à
5, voire 3 jours pour les germes habituels. A partir du moment où le germe est isolé, il
est possible d'obtenir son identification (biochimique) et sa sensibilité aux antibiotiques
en quelques heures avec certaines méthodes.

Un autre aspect encourageant des progrès accomplis est sans conteste, l'approche
moléculaire avec l'amplification génique (PCR) et le séquencage de certains gènes
(celui codant pour l'ARNr 16S, par exemple). D'autres progrès essentiels sont à attendre
dans ce domaine, en particulier pour les diagnostics directement sur produits
pathologiques. Enfin, on notera une régression des méthodes de diagnostics indirects
ou de la place du sérodiagnostic dans la démarche diagnostique en raison de la mauvaise
précosité liée au décalage de la réponse de l'organisme à l'infection, de la faible
spécificité de la réponse et enfin du caractère transitoire de cette réponse immunologique
de l'organisme à l'infection.

Ce cours a été préparé par le Professeur A. PHILIPPON et le Dr. L. PROTS (Faculté de Médecine COCHIN-PORT-ROYAL,
Université PARIS V)