Scribd Logo
Importer

Bienvenue sur Scribd !

  • Bioinformatics Assignment B014811-Ashish Beck Gene:: Pair 1

    Transféré par

    Ashish9XY
    14 vues2 pages
    1) The document describes a bioinformatics assignment to design primers for a gene sequence. 2) Five pairs of potential primers were tested, with issues found such as high/low melting temperatures, end self-complementarity, and high 3' stability. 3) The first pair of primers was found to be acceptable, with just high 3' stability in the right primer, which is manageable. The other pairs had more significant issues.

    Description originale:

    An assignment that required us to design primers for our respective gene.

    Titre original

    [Beck]BioinformaticsAssignment

    Copyright

    © © All Rights Reserved

    Formats disponibles

    PDF, TXT ou lisez en ligne sur Scribd

    Avez-vous trouvé ce document utile ?

    Ce contenu est-il inapproprié ?

    Signaler ce document
    1) The document describes a bioinformatics assignment to design primers for a gene sequence. 2) Five pairs of potential primers were tested, with issues found such as high/low melting temperatures, end self-complementarity, and high 3' stability. 3) The first pair of primers was found to be acceptable, with just high 3' stability in the right primer, which is manageable. The other pairs had more significant issues.

    Droits d'auteur :

    © All Rights Reserved
    Téléchargez comme PDF, TXT ou lisez en ligne sur Scribd
    Signaler comme contenu inapproprié
    14 vues2 pages

    Bioinformatics Assignment B014811-Ashish Beck Gene:: Pair 1

    Transféré par

    Ashish9XY
    1) The document describes a bioinformatics assignment to design primers for a gene sequence. 2) Five pairs of potential primers were tested, with issues found such as high/low melting temperatures, end self-complementarity, and high 3' stability. 3) The first pair of primers was found to be acceptable, with just high 3' stability in the right primer, which is manageable. The other pairs had more significant issues.

    Droits d'auteur :

    © All Rights Reserved
    Téléchargez comme PDF, TXT ou lisez en ligne sur Scribd
    Signaler comme contenu inapproprié
    sur 2

    Bioinformatics Assignment

    B014811- Ashish Beck

    Gene:
    >gi|159476665|ref|XM_001696380.1|Chlamydomonas reinhardtii heat shock protein70B
    (HSP70B)ORF
    atgccggttcagcagatgacttctatgcgcagccagtccctggctggcgctccagtggcacccgtcaaggcgggccgcgctggcgtttcgcgc
    cgtggcctggccgtcagcgtccgtgctgagaaggtcgtgggtatcgatctgggcacgaccaactcggctgtggctgccatggagggtggcaa
    gccgaccatcatcaccaacgctgagggcggccgcaccaccccctcggtggtggcattcaccaagaccggcgaccgtctggttggccagattg
    ccaagcgccaggctgtggtgaaccccgagaacactttcttctccgtaaagcgcttcatcggccgccgcatgtcggaggtcggctcggagtcca
    cccaagtgccttaccgggtgattgaggacggcggcaacgtgaagatcaagtgccccaacgccggtaaggacttcgctcccgaggagatcagc
    gcgcaggtgctgcgcaagctgacggaggacgccgccaagttcctgaacgacaaggtggagaaggcggtcatcaccgtgcccgcctacttca
    atgactcccagcgccaggccaccaaggacgcgggcaagattgccggtctggaggtgctgcgcatcatcaacgagcccaccgccgcctcgct
    ggcgtacggctttgacaagaaggccaacgagaccatcctggtgttcgacctgggcggcggcaccttcgatgtgtcggtgctggaggtgggcg
    acggcgtgttcgaggtgctgtccaccagcggcgacacccacctgggcggtgacgacttcgacaagcgcatcgtggacttcctggctgatgact
    tcaagaagagcgagggcattgacctgcgcaaggaccgccaggcactacagcgcctgaccgaggcggccgagaaggccaagattgagctgt
    cgggaatggcccagacctccatcaacctgcccttcattactgccaccgccgatggtcccaagcacatcgacacccagctgacccgcgccaagt
    tcgaggagatgtgcaacgacctgctggagcgctgcaaggtgccggtgcagcaggccctgcgcgatgccaagctgtccatcagcgacattcag
    gaggtcatcctggtgggcggctccacccgcatccccgcggtgcaggagattgtgcgcaagctgtcgggcggcaaggaccccaacgtgacgg
    tcaaccccgacgaggtggtggctctgggcgcggcggtgcaggccggtgtcctggccggcgaggtgtcggacatcgtcctgctggacgtgac
    cccgctgtcgctgggcctggagaccctgggcggcgtcatgaccaagctcatcccccgcaacaccaccctgcccacctccaagtctgaggtctt
    ctccaccgccgccgacggtcagacttcggtggagatcaacgtgctgcagggcgagcgcgagtttgcccgcgacaacaagtcgctgggcacc
    ttccgcctggacggcatcccgcccgcgccccgcggtgtgccccagattgaggtcaagttcgacattgacgcgaacggcatcctgtccgtgacc
    gccaccgacaagggcactagcaagaagcaggacatccgcatcaccggcgcctccaccctggacaagggcgacgtggagcgcatggtcaa
    ggaggcggagaagttcgccggcgaggacaagaagcgccgcgagagcgtggagaccaagaaccaggcggagaccatggtgtaccagacc
    gagaagcagctcaaggagtttgagggcaaggtgccggccgacatcaaggccaaggtcgaggccaagctgggcgagctcaaggcggcgct
    gccggccgacgatgctgaggccaccaaggccgccatgaacgcgctgcagcaggaggtgatggccatgggccaggccatgtacagccagg
    ctggcgctgcgccaggcggcgccccgggcgctgagcccggcgccggtgcgggcgcgggtggcgcccccggcggcaagaaggacgacg
    acgtcattgacgccgagttcactgacaagaagtaa

    Primers:
    Pair 1:
    Left Primer 1:
    Sequence: atgccggttcagcagatg
    Start: 1
    Length: 18 bp Tm: 60.8 C GC: 55.6 % ANY: 4.0 SELF: 3.0
    Right Primer 1:
    Sequence: ttacttcttgtcagtgaactcgg
    Start: 2040 Length: 23 bp Tm: 58.6 C GC: 43.5 % ANY: 5.0 SELF: 1.0
    Right Primer is unacceptable: High 3' stability
    Pair 2:
    Left Primer 2:
    Sequence: atgccggttcagcagatga
    Start: 1
    Length: 19 bp Tm: 62.8 C GC: 52.6 % ANY: 5.0 SELF: 5.0
    Left Primer is unacceptable: High end self complementarity
    Right Primer 2:
    Sequence: ttacttcttgtcagtgaactcggc
    Start: 2040 Length: 24 bp Tm: 62.0 C GC: 45.8 % ANY: 5.0 SELF: 2.0
    Right Primer is unacceptable: High 3' stability

    Pair 3:
    Left Primer 3:
    Sequence: atgccggttcagcagat
    Start: 1
    Length: 17 bp Tm: 57.6 C GC: 52.9 % ANY: 4.0 SELF: 2.0
    Primer smaller than PRIMER_MIN_SIZE of 18
    Right Primer 3:
    Sequence: ttacttcttgtcagtgaactcg
    Start: 2040 Length: 22 bp Tm: 54.9 C GC: 40.9 % ANY: 5.0 SELF: 2.0
    Right Primer is unacceptable: Tm too low

    Pair 4:
    Left Primer 4:
    Sequence: atgccggttcagcaga
    Start: 1
    Length: 16 bp Tm: 57.1 C GC: 56.2 % ANY: 4.0 SELF: 4.0
    Left Primer is unacceptable: High end self complementarity
    Primer smaller than PRIMER_MIN_SIZE of 18
    Right Primer 4:
    Sequence: ttacttcttgtcagtgaactcggcg
    Start: 2040 Length: 25 bp Tm: 65.9 C GC: 48.0 % ANY: 5.0 SELF: 3.0
    Right Primer is unacceptable: Tm too high/High 3' stability

    Pair 5:
    Left Primer 5:
    Sequence: atgccggttcagcagatgac
    Start: 1
    Length: 20 bp Tm: 63.5 C GC: 55.0 % ANY: 5.0 SELF: 3.0
    Left Primer is unacceptable: Tm too high
    Right Primer 5:
    Sequence: ttacttcttgtcagtgaactc
    Start: 2040 Length: 21 bp Tm: 49.5 C GC: 38.1 % ANY: 5.0 SELF: 2.0
    Right Primer is unacceptable: Tm too low
    The first pair of primers is acceptable among these five because the left primer doesn't have any
    issues and right primer just has only high 3' stability which is managable. Other pair of primers also
    have high/low melting points and high end self-complementarities.

    Vous aimerez peut-être aussi