Test Preparation 1

Topic : DNA Structure And Protein Synthesis

Que: (A) DNA Scientists: Answer the following questions about the following
scientists.
1) Hershey & Chase
A. Which 2 molecules was the possible genetic material?
B. From their experiments, what conclusion was made?
C. What 2 organisms did they use to determine DNA was the genetic material?
2) Watson & Crick
A. What did Watson & Crick discover?
B. What is the shape of DNA?
3) Erwin Chargaff
A. What is Chargaffs Rule?
4) Frederick Griffiths Experiment
A. What type of bacteria did Griffith work with?
B. What strain was virulent?
C. What strain was harmless?
D. What term did he phrase that means bacteria takes in outside DNA and
genetically changes?
E. Why did the mouse with dead S and live R die?
Que: (B) Short Answers.
1. What does DNA stand for?
2. What type of sugar is found in DNA?
3. What type of bond holds the bases in DNA together?
4.A. What is the term for a double ringed base?
B. Give 2 examples of this type of base.
5. A. What is the term for a single ringed base?
B. Give 2 examples of this type of base.

6. How many nucleotides are shown is the diagram above?

7. What is the shape of a DNA molecule?
8. What are the rungs of the DNA molecule?
9. What is the backbone of the DNA molecule?
10. What is the monomer of DNA?
11. What Guanine ONLY bond with?
12. What does Thymine ONLY bond with?

Que: (C) DNA Replication: Answer the following questions about DNA Replication
using the pictures below.

1. What is the first step to DNA Replication?

2. What type of enzyme matches up free floating nucleotides to the parent
strand?
3. What is the term for the DNA strand that acts as a pattern to the newly
synthesized DNA?
4. What is the end product of DNA replication?
5. Which strands in Picture 2 are the template?

6. Which strands in Picture 2 are the newly synthesized DNA?

7. In picture 2, what is the next nucleotide to be added to strand B?
8. In picture 2, what is the next nucleotide to be added to strand C?
9. What nucleotide complements cytosine?
10. What nucleotide complements adenine?
11. Give the complementary DNA strand to the DNA below.
12. ATCGGCGTAGCGTAAGCTACGTAGCTTTAGC
13. Where does DNA replication occur in the cell?
14. During which phase of the cell cycle does DNA replicate itself?

Que: (D) RNA vs DNA: Identify the following characteristics as DNA or RNA
1. ------------ contains deoxyribose
2. ------------- contains A, T, C and G
3. ------------- single stranded molecule
4.--------------- double helix
5. -------------- contains ribose
6. ------------- contains A, U, C and G
7. -------------- found ONLY in the nucleus
8. ------------- found in the nucleus and cytoplasm
9. -------------- 3 different types: m, t and r
10. -------------- shape discovered by Watson & Crick
11. --------------AUGCCUAGUC
12. -------------- ATCGTTAGCT

Que: (E) Types of RNA: Drag and drop the names of the types of RNA in the
appropriate locations.

1. What process makes mRNA?

2. What type of RNA makes up ribosomes?
3. What type of RNA carries amino acids to the ribosome?
4. What does the m in mRNA stand for?
5. Where in the cell is mRNA made?
6. Where does mRNA go after it leaves the nucleus?
7. What does the t in tRNA stand for?
8. What process occurs at the ribosome?
9. What would be the mRNA for the following DNA strand?
DNA: TACGGCATCGTAGCTA

Que: (F) Protein Synthesis: Label the parts of protein synthesis by dragging and
dropping the labels into the appropriate locations

1. What is the term for the 3 bases ion the tRNA that matches with the 3 bases on the
mRNA?
2. What is the ANTICODON to the following codons?
A. AUG
B. UGC
C. GGC
D. CUA
3. What occurs during translation?
4. What occurs during transcription?
5. How are transcription and translation different?
6. What does the tRNA carry to the ribosome?
7. What is the final product of protein synthesis?
8. What molecule in protein synthesis is ONLY found in the nucleus?
9. What is the name of the enzyme that makes mRNA?
10. What organelle is involved in translation?

Que: (G) Mutations: Look at the sequences of DNA below and answer the questions
that follow.
regular DNA: T A C G T A A G T C C G T A C G T C A G T T G C A T G C
mutation 1: T A C T C G A G T C C G T A C G T C A G T T G C A T G C
mutation 2: T T C G T A A G T C C G T A C G T C A G T T G C A T G C
mutation 3: T A C G T A A G T C C G T T C A G T T G C A T G C
mutation 4: T A C G T A A G T C C G T A T G C G C A C G T C A G T T G C A T G C
1. What type of mutation is shown in mutation #1?
2. What type of mutation is shown in mutation #2?
3. What type of mutation is shown in mutation #3?
4. What type of mutation is shown in mutation #4?
5. What type of mutation (substitution, deletion or addition) causes sickle cell anemia?
6. What type of mutation (substitution, deletion or addition) causes cystic fibrosis?
7. What is the name for a mutation in which ONLY one base pair is substituted?
8. What is the term for when all of the base pair
positions are shifted from their original position?