Vous êtes sur la page 1sur 216

1.

0 Les acides aminés


Introduction

"(...)La substance organique qui est présente dans toutes les parties du corps animal
et, comme nous allons le voir, du royaume végétal, pourrait être appelée protéine,
de πρωτειοσ (au premier rang) (...)"
Gerardus Johannes Mulder
Journal für praktische Chemie 16, 129 (1839)

Voilà, c'est ainsi que le mot protéine entra dans notre vocabulaire. À cause de leur
capacité d'adopter une infinité de formes et de leur synthèse à même les cellules, les
protéines sont l'outil à tout faire du monde vivant, le canif suisse de l'évolution, les
blocs Lego avec lesquels tout ce qui vit est bâti.

Des protéines structurales maintiennent la forme des cellules et des organismes.


Des protéines enzymatiques contrôlent des milliers de réactions qui s'entrecroisent
en un élégant ballet chimique d'anabolisme et de catabolisme. Des protéines
reconnaissent et détruisent les substances étrangères et nocives. Des protéines
assurent que le plan a partir duquel elles sont toutes construites (l'ADN) soit
reproduit pour les générations futures.

Nous nous nourrissons de protéines provenant de tous les royaumes du monde


vivant; nous nous en vêtons depuis que nous avons appris a apprécier la chaleur de
la laine, la douceur de la soie ou la résistance du cuir; nous en faisons des
médicaments; nous cherchons même a reproduire industriellement des fibres
protéiques plus solides que l'acier et aussi légére que la soie comme en fabriquent
nos congénères invertébrés. Plus que jamais, l'utilisation des protéines est au coeur
même de notre vie a tous.

Le cours BCM-514, biochimie des protéines, présuppose que vous en savez déjà
beaucoup sur ces molécules. Vous y aurez l'occasion de revoir, d'approfondir et d'y
mettre en contexte des notions acquises au cours de vos études. Ne vous étonnez
pas de vous sentir parfois en terrain familier; nous commencerons en effet par une
révision des notions physico-chimiques qui nous permettent de comprendre la
structure et le fonctionnement des protéines, afin de bien saisir un peu plus tard
comment ces paramètres influencent notre stratégie de purification ou d'analyse...
car l'essentiel du cours se consacre à l'utilisation de ces connaissances
biochimiques, que ce soit pour mieux comprendre les mécanismes moléculaires de
la cellule ou pour produire et purifier les protéines à des fins analytiques ou
industrielles.

Nous parlerons donc de différentes techniques de purification et d'observation des


protéines, d'une part dans le contexte des travaux de recherche académique à petite

1
échelle et d'autre part dans le contexte de projets de plus grande envergure
auxquels on colle souvent l'étiquette de projets en protéomique.

Nous discuterons aussi des travaux de l'industrie privée sur différents aspects de la
biochimie des protéines, particulièrement dans le domaine pharmaceutique.

Mais tout d'abord, revenons-en aux sources et consacrons quelques pages aux
notions de base sur la biochimie protéique...

1.0 Les acides aminés

1.1 Les vingt acides aminés de base

2
Les protéines sont de longues chaînes composées d'une succession de maillons et
repliées dans l'espace. Les maillons de ces chaînes sont de petites molécules
appelés acides aminés. Comme leur nom l'indique, les acides aminés portent un
groupe acide (-COOH) et un groupe aminé (-NH2). Ils sont au nombre de vingt dans
les protéines (nous verrons quelques exceptions à cette règle un peu plus loin). On
retrouve plusieurs autres acides aminés dans l'organisme (l'ornithine, par exemple)
mais ils n'entrent pas dans la composition des protéines.

Les acides aminés retrouvés dans les protéines ont tous la même structure de base:
ils sont orientés autour d'un atome de carbone central, le carbone α, sur lequel
s'articulent le groupe carboxyl (-COOH), le groupe aminé (-NH2), un atome
d'hydrogène (-H) et un groupement latéral (noté -R). C'est la nature de ce
groupement latéral (on dit aussi chaîne latérale) qui différencie les acides aminés
entre eux.

Le carbone α central est donc asymétrique dans tous les cas mis à part celui de la
glycine (parce que la glycine a un hydrogène à la place d'une chaîne latérale). Cela
signifie qu'il est possible d'avoir deux conformations différentes d'un même acide
aminé, conformations qu'il est impossible d'interconvertir sans briser et réassembler
de liens covalents. On désigne ces conformations L et D. Bien que les deux puissent
être synthétisées dans une même réaction chimique, seule la forme L est utilisée
dans les protéines.

La façon de savoir si on a affaire à une forme L ou D dans la structure d'un acide


aminé est de le regarder le long de l'axe du lien qui lie son hydrogène au carbone α.
Dans la forme L, l'agencement des autres groupements sur le carbone central sera
le suivant dans le sens des aiguilles d'une montre: COOH, R, NH3 ou CORN.

On appelle ce truc la loi de CORN.

3
Les chaînes latérales des acides aminés permettent de classer ces derniers en
différents groupes partageant certaines caractéristiques. Certains sont polaires, et
donc hydrophiles, d'autres non-polaires et donc hydrophobes. Certains sont chargés,
d'autres non. Certains contiennent un cycle aromatique. Certains contiennent du
soufre, etc.

Deux acides aminés tranchent un peu parmi les autres: la glycine (G, Gly), le plus
petit acide aminé, n'a en guise de
chaîne latérale qu'un atome d'hydrogène. La proline (P, Pro), elle, a une chaîne
latérale en forme de boucle
(un anneau pyrrolidone) qui va contacter l'azote de son groupement aminé; le résultat
en est que la proline est techniquement un acide iminé (-NH-) plutôt qu'aminé.
L'impact de cette structure sur celle des protéines sera vu
plus loin.

Quatre acides aminés ont une chaîne latérale fortement ionisée et donc chargée à
pH neutre: il s'agit de l'acide aspartique (D, Asp) et de l'acide glutamique (E, Glu),
dont la chaîne latérale porte un groupement acide supplémentaire (COOH); et de la
lysine (K, Lys) et de l'arginine (R, Arg) dont la chaîne latérale porte un groupement
aminé (-NH3+ pour la lysine, =NH2+ pour l'arginine). Un cinquième acide aminé,
l'histidine (H, His), porte une charge positive plus faible à pH neutre.

4
Les deux acides aminés acides ont des dérivés dont le groupement acide (-COOH) est
changé pour un groupement
amide (-CONH2). Il s'agit de l'asparagine (N, Asn) pour l'acide aspartique et de la
glutamine (Q, Gln) pour l'acide glutamique. Ces deux acides aminés sont non-chargés à
pH neutre mais restent polaires et hydrophiles.

5
La sérine (S, Ser) et la thréonine (T, Thr) ont un groupement hydroxyl (-OH) dans leur
chaîne latérale.
Cela leur permet d'interagir avec l'eau et d'autres molécules en formant des ponts
hydrogènes, ou d'être la cible de modifications utilisant ce site réactionnel.

Les acides
aminés
contenant des
cycles comme
la phénylalanine
(F, Phe), le
tryptophane (W,
Trp) ou la
tyrosine (Y, Tyr)
sont très
hydrophobiques
; c'est le cas
aussi de leurs
congénères
dont la chaîne
latérale consiste
en une
succession de
groupements
éthyl- et méthyl-
. On dit de ceux-
ci qu'ils sont
aliphatiques.

6
L'alanine (A,
Ala), la la valine
(V, Val), la
leucine (L, Leu),
L'isoleucine (I,
Ile) sont tous
des acides
aminés
aliphatiques.

On inclut généralement dans cette famille la méthionine (M, Met), dont la chaîne latérale
plutôt aliphatique contient un soufre non réactif. Notons que la tyrosine, malgré son
caractère hydrophobique dû au cycle benzénique, a tout de même un groupement -OH
qui, à l'instar de la sérine et de la thréonine, lui permet d'interagir avec l'eau ou d'être la
cible de réaction utilisant les groupements hydroxylés.

7
La cystéine (C, Cys) est un peu dans une classe à part, car elle a à l'extrémité de sa
chaîne latérale un groupement sulfhydryl réactif..

Dans des conditions oxydantes, une cystéine forme fréquemment un pont disulfure avec une autre
cystéine pour donner un dimère qu'on appelle cystine. Les cystéines contribuent à maintenir la structure
tridimensionnelle de très nombreuses protéines grâce à cette faculté.

Certains acides aminés sont synthétisés à même nos cellules; d'autres doivent faire
partie de notre alimentation (d'où notre besoin de manger des protéines). Ces
derniers acides aminés sont dits essentiels; ce sont la thréonine, la lysine, l'histidine,
l'isoleucine, la leucine, la méthionine, la phénylalanine, le tryptophane et la valine:
TKHILMFWV (qu'une ritournelle mnémonique peut changer en "HoT MILK For VW"
Il faut juste se souvenir de ne pas prendre le r en considération. Le O, lui, ne code
pas pour un acide aminé impliqué dans la synthèse des protéines.).

8
1.1.1 Les vingt acides aminés de base: quelques spécifications

Code à Code Poids probabilité de


mutabilité
Acide aminé 3 à1 (en se trouver en
relative (a)
lettres lettre g/mol) surface (b)

alanine Ala A 89,1 100 62

arginine Arg R 174,2 65 99

asparagine Asn N 132,1 134 88

aspartate Asp D 133,1 106 85

cystéine Cys C 121,2 20 55

glutamate Glu E 147,1 102 82

glutamine Gln Q 146,2 93 93

glycine Gly G 75,1 49 64

histidine His H 155,2 66 83

isoleucine Ile I 131,2 96 40

leucine Leu L 131,2 40 55

lysine Lys K 146,2 56 97

méthionine Met M 149,2 94 60

phénylalanine Phe F 165,2 41 50

proline Pro P 115,1 56 82

sérine Ser S 105,1 120 78

thréonine Thr T 119,1 97 77

tryptophane Trp W 204,2 18 73

tyrosine Tyr Y 181,2 41 85

9
valine Val V 117,1 74 46

(a) Probabilité qu'un résidu particulier soit muté ponctuellement pendant l'évolution.
La valeur de l'alanine a été arbitrairement fixée à 100.

(b) Probabilité que 5% ou plus d'un résidu particulier se trouve à la surface d'une
protéine.

Une règle informelle suggère d'utiliser un poids de 110 Daltons par résidu pour
calculer à vue de nez le poids d'une protéine (même si le poids moyen d'un acide
aminé est plutôt 136). Cette règle fonctionne étonnament bien dans la plupart des
cas. Ainsi, le poids réel de la protéine de BARD-1, qui compte 777 acides aminés est
de 86,6 kDa (poids calculé à l'aide du calculateur ScanSite du MIT, trouvé sur le site
d'ExPASy) alors que le poids estimé "au pif" est de 777 acides aminés X 110 = 85,4
kDa, ce qui est très proche de la valeur réelle.

1.1.2 Autres acides aminés et autres abréviations

En parcourant la littérature scientifique, on tombe parfois sur des acides aminés dont
le nom abrégé (Iva, Abu) n'est pas familier. Il s'agit souvent de résidus modifiés, ou
parfois de noms alternatifs pour les acides aminés de base. Le tableau qui suit en
désigne quelques-uns.

10
1.2 Charge des acides aminés

Les acides aminés individuels portent au moins deux groupes ionisables: le groupe -
NH2 et le groupe -COOH, ionisables en -NH3+ et -COO-. Ils ont donc un caractère
amphotère car ils peuvent être à la fois donneur ou accepteur d'électrons. Ils
peuvent par conséquent servir d'agent tampon. On appelle zwitterion une molécule
qui porte à la fois une charge positive et négative (c'est de l'allemand pour "ion
hybride"). La nature dipolaire des acides aminés a d'abord été remarquée parce que
leurs cristaux étaient beaucoup
plus stables à la chaleur que ceux de molécules organiques de taille similaire: c'est
que les interactions ioniques entre les charges différentes fortifient le réseau
cristallin.

Le pKa des acides aminés tourne autour de 2, ce qui est normal pour un acide; leur
pKb tourne autour de 9-10, ce qui est attendu pour une base. Les chaînes latérales
qui ont un pK ont des valeurs variables: le pKR de D et E tourne autour de 4 (ces
chaînes sont acides); le pKR de H, R et K est de 6, 12,5 et 10,5 respectivement (ce
sont des chaînes basiques). Ce qui compte en bout du compte n'est de toute façon

11
pas tant le pK de chaque acide aminé, mais celui, global, de la protéine qui les
contient!

L'effet tampon des acides aminés est maximal quand le pH ambiant est près du pKa
ou du pKb de la molécule, ainsi qu'on le devine en regardant la formule

pH= pKa/b + log ( [accepteur]/[donneur] )

Un effet tampon est maximal quand la concentration d'accepteur et de donneur sont


similaires, ce qui donne dans la formule ci-haut un ratio proche de 1. Comme le log
de 1 est zéro, pH = pKa ou pKb.

Quand toutes les charges portées par une protéine s'équivalent, on dit qu'elle atteint
son point isoélectrique. C'est aussi le point où une protéine a le moins d'interactions
avec les molécules d'eau, et donc le point où elle est le moins soluble.

Pour vous rappeler l'ordre dans lequel les groupes s'ionisent en fonction du pH,
rappelez-vous seulement qu'à pH bas, vous ajoutez tous les hydrogènes possibles
et qu'à pH élevé vous enlevez tous ceux que vous pouvez. Ainsi, à pH 2 les groupes
hydroxyls seront sous forme COOH et les groupes aminés sous forme NH3+, alors
qu'à pH 11 les groupes hydroxyls seront sous forme -COO- et les groupes aminés
sous forme NH2.

12
Acide aminé pK1 pK2 pK3 pI

(COOH) (NH2) (latéral)

Glycine (G, Gly) 2,35 9,6 5,97

Alanine (A, Ala) 2,34 9,69 6,01

Valine (V, Val) 2,32 9,62 5,97

Leucine (L, Leu) 2,36 9,6 5,98

Isoleucine (I, Ile) 2,36 9,68 6,02

Proline (P, Pro) 1,99 10,96 6,48

Phenylalanine (F, Phe) 1,83 9,13 5,48

Tyrosine (Y, Tyr) 2,2 9,11 10,07 5,66

Tryptophane (W, Trp) 2,38 9,39 5,89

Sérine (S, Ser) 2,21 9,15 5,68

Thréonine (T, Thr) 2,11 9,62 5,87

Asparagine (N, Asn) 2,02 8,08 5,41

Glutamine (Q, Gln) 2,17 9,13 5,65

Cystéine (C, Cys) 1,96 8,18 10,28 5,07

Methionine (M, Met) 2,28 9,21 5,74

13
Acide aspartique (D, Asp) 2,19 9,6 3,65 2,77

Acide glutamique (E, Glu) 2,19 9,67 4,25 3,22

Histidine (H, His) 1,82 9,17 6 7,59

Lysine (K, Lys) 2,18 8,95 10,53 9,74

Arginine (R, Arg) 2,17 9,04 12,48 10,8

1.3 Hydrophobicité

La chaîne latérale des acides aminés peut être plus ou moins hydrophobe. Les
cycles et les chaînes aliphatiques sont bien entendu plus hydrophobes que les
chaînes chargées ioniquement. Ces différences joueront un rôle dans les structures
supérieures des protéines. La phénylalanine est le plus hydrophobe; l'acide
aspartique le plus hydrophile.

Voici une liste du degré d'hydrophobicité des acides aminés. Comme il existe
plusieurs façons d'évaluer l'hydrophobicité, on n'en présentera qu'une ici. Cette
échelle se nomme OMH (optimized matching hydrophobicity), et son origine remonte
à l'article suivant :

Sweet R.M., Eisenberg D. (1983) J. Mol. Biol. 171:479-488.

Plus le chiffre est élevé, plus l'acide aminé est hydrophobe.

Phenylalanine 1,92

Tyrosine 1,67

Isoleucine 1,25

Leucine 1,22

14
Methionine 1,02

Valine 0,91

Tryptophane 0,5

Cysteine 0,17

Threonine -0,28

Alanine -0,4

Proline -0,49

Serine -0,55

Arginine -0,59

Histidine -0,64

Glycine -0,67

Lysine -0,67

Glutamine -0,91

Asparagine -0,92

Acide glutamique -1,22

15
Acide aspartique -1,31

1.4 Acides aminés un peu plus exotiques

Certains acides aminés ne se retrouvent pas dans les protéines, et certains acides
aminés protéiques subissent des modifications post-traductionnelles.

1.4.1 Acides aminés modifiés de façon post-traductionnelle

(Veuillez vous référer au chapitre 3 pour une couverture plus large des modifications
post-traductionnelle des protéines).

En dégradant des protéines pour obtenir les acides aminés qui les composent, on en
retrouve souvent qui varient par rapport au modèle de base. Ces acides aminés
modifiés jouent différents rôles importants dans la structure et la fonction des
protéines. On ne les ajoute pas à la liste des vingt, cependant, parce qu'ils ne sont
que des modifications d'acides aminés standards: une hydroxyproline, par exemple,
est une proline à laquelle un enzyme a été greffer un groupement hydroxyl.

Certains de ces acides aminés modifiés peuvent avoir une allure complexe: ainsi,
suite à une succession de pontages covalents, quatre lysines peuvent être réunies
en une molécule de desmosine (on la retrouve dans une protéine appelée élastine,
qui se retrouve dans les ligaments et le tissu conjonctif des grandes artères). La
desmosine aide à conférer à cette protéine ses vertus élastiques.

16
Quelques acides aminés modifiés qu'on retrouve dans les protéines.

Le gamma-carboxyglutamate qu'on voit dans cette figure est produit par une
modification d'un résidu glutamate. Cette modification est catalysée par la vitamine
K, qui tient son nom du mot allemand Koagulation. En effet, le gamma-
carboxyglutamate se retrouve dans plusieurs protéines impliquées dans la
coagulation sanguine, comme la prothrombine. Il aide à fixer un ion Ca2+.

1.4.2 Quelques acides aminés qu'on ne retrouve pas dans les protéines.

Des acides aminés peuvent avoir des rôles cruciaux sans être impliqués dans la
synthèse protéique. En voici quelques examples.

17
Les hormones thyroïdiennes, qui sont
responsables du contrôle du métabolisme
de l'organisme, sont appelées T3 et T4
(thyroxine et triiodothyronine). Ce sont des
modifications de la tyrosine portant un
cycle supplémentaire et des atomes d'iode.
C'est pour synthétiser ces deux hormones
que la glande thyroïde a besoin d'iode.

Par ailleurs, un autre dérivé d'acide aminé joue un rôle de premier plan dans le
contrôle de la production d' oxyde nitrique NO. Il s'agit de la diméthylarginine
asymétrique ou ADMA. L'ADMA est un inhibiteur de la réaction par laquelle l'oxyde
nitrique est synthétisé à partir de l'arginine:

NO est une molécule aux mutliples fonctions dans l'organisme. C'est un


neurotransmetteur avec de nombreuses fonctions dans le système nerveux
central; il joue un rôle, par exemple, dans la mémoire et la modulation de la
douleur; il relaxe les muscles lisses des bronches; il stimule l'inflammation.
Il aide aussi à la régulation de la pression sanguine et ce dernier effet fait du
dosage de l'ADMA une information très utile pour aider à prévenir les
accidents cardio-vasculaires, la pré-éclampsie chez les femmes enceintes et
même le diabète de type II; en outre, un niveau plasmatique élevé d'ADMA
peut être un signe avant-coureur d'athérosclérose.

Un acide aminé du nom de coprine présente un intérêt particulier pour les gourmets
amateurs de champignons. On le retrouve dans le coprin noir d'encre, Coprinus
atramentarius. La coprine n'est pas toxique en elle-même, et c'est pourquoi ce
coprin est considéré comestible (encore que pas particulièrement savoureux). Le
problème avec la coprine, c'est que sa dégradation produit deux composés, le 1-
Aminocyclopropanol et l'hydrate de cyclopropanone, qui agissent comme inhibiteurs

18
de l'enzyme aldéhyde déhydrogénase. Cet enzyme, en convertissant l'acétaldéhyde
en acide acétique et en CO2 aide à détoxifier l'ethanol. Cette inhibition qui peut durer
trois jours cause donc notre intoxication, non pas par le champignon lui-même, mais
par l'acétaldéhyde venant du catabolisme de l'ethanol! Ainsi, si on mange des
coprins noir d'encre, on ne doit absolument pas boire d'alcool sous peine de soufrir
d'une intoxication à l'acétaldhyde. Bonjour la migraine, les rougeurs, les maux de
coeur et tout le tralala.

1.5 Le code génétique

Les acides aminés sont assemblés en chaîne selon un ordre déterminé par une
séquence d'ADN. Chaque acide aminé est représenté sur l'ADN par un triplet de
bases appelé codon.

Puisqu'il existe quatre nucléotides dans l'ADN, il existe aussi une possibilité
maximale de 43 codons, ou 64. Il n'y a cependant que 20 acides aminés, qui se
partagent ces possibilités entre eux (et avec trois signaux d'arrêt de la traduction). La
distribution des codons n'est pas égale: il n'y a par exemple qu'un seul codon codant
pour le tryptophane mais six pour l'arginine.

19
Le code génétique. Chaque codon
(ou triplet de nucléotides) se lit du
centre vers l'extérieur. En plus des
codons désignant les 20 acides
aminés, il existe trois codons
STOP, qui marquent la fin de la
séquence d'une protéine: les
codons amber (TAG), ochre (TAA)
et opal (TGA)

1.5.1 Universalité relative du code génétique

Le code génétique est extrêmement conservé dans la nature. Des plus humbles
procaryotes aux plus massifs séquoias, les acides aminés et les codons stop sont
presque toujours les mêmes. Il existe cependant quelques mutations qui se sont
accumulées au cours de l'évolution, principalement chez certaines mitochondries qui
ont leur propre génome, et dont le code peut varier un peu face à celui utilisé par
l'ADN nucléaire.

20
Variations sur un thème: certains codons ont changé de signification dans certaines
organelles ou certains organismes au cours du temps. Les flèches indiquent des
mutations cumulatives qui peuvent refléter soit une conservation évolutive, soit une
évolution parallèle. Ainsi, les mitochondries des planaires cumulent les mutations
Stop(TGA)W, R(AGA)S, R(AGG)S, K(AAA)N et Stop (TAA)Y. Notez que chez les
plantes, noyaux et mitochondries utilisent le même code et peuvent donc s'échanger
des gènes. (Adapté des travaux de Weberndorfer, Hofacker et Stadler)

1.5.2 Utilisation préférentielle des codons

Il est utile en biotechnologie de se rappeller que différents organismes n'utilisent pas


avec le même enthousiasme tous les codons disponibles pour un même acide
aminé. Certains codons sont clairement favorisés par rapport à d'autres, ce qui se
reflète souvent dans l'abondance des ARNt correspondants. Ce phénomène est
probablement lié à des considérations économiques pour les organismes.

En exprimant une séquence d'ADN dans un système hétérologue (H. sapiens dans
E. coli, par exemple), mieux vaut donc être sûr d'utiliser une séquence qui sera
facilement traduite par les ARNt de l'hôte, quitte à changer par génie génétique des
codons défavorisés par des codons favorisés. Sinon, on risque de s'exposer à des
tracas du genre

- traduction retardée entraînant une baisse de la stabilité de l'ARNm;


- terminaison prématurée, pouvant mener à des protéines trop courtes ou instables;
- changements de cadre de lecture ou mauvaise incorporation;
- inhibition de la synthèse protéique.

21
Dans la liste ci-dessous, on compare trois organismes et leur préférence en fait de
codons codant pour l'arginine. Si tout était égal par ailleurs, on s'attendrait à ce que
chacun des six codons Arg soit représenté avec une fréquence d'environ 16,5% et
en effet, chez l'être humain, il n'existe qu'un léger biais qui défavorise le codon CGT.
Par contre, chez S.cerevisiae, les codons CGG, CGC et CGA ne représentent
respectivement que 2%, 4% et 5% des codons Arg du génome et la levure ne
fabrique que très peu des ARNt portant les anticodons appropriés. Une séquence
humaine exprimée dans la levure aurait intérêt à voir tous ses codons Arg changés
pour AGA, qui est fortement favorisé par cet organisme.

codon H. sapiens S. cerevisiae E. coli

AGG 21,5 17,0 3,2

AGA 21,0 54,0 4,3

CGG 18,2 2,0 9,0

CGA 10,7 5,0 5,0

CGT 9,1 17,0 36,0

CGC 19,5 4,0 40,0

1.5.2.1 Utilisation des codons: comparaison entre différentes espèces


(source: http://www.kazusa.or.jp/codon/

Homo sapiens (codon, acide aminé, fréquence sur 1).

UUU F 0.46 UCU S 0.18 UAU Y 0.44 UGU C 0.45

UUC F 0.54 UCC S 0.22 UAC Y 0.56 UGC C 0.55

UUA L 0.07 UCA S 0.15 UAA stop 0.28 UGA stop 0.5

UUG L 0.13 UCG S 0.06 UAG stop 0.22 UGG W 1.0

CUU L 0.13 CCU P 0.28 CAU H 0.41 CGU R 0.08

CUC L 0.20 CCC P 0.33 CAC H 0.59 CGC R 0.19

CUA L 0.07 CCA P 0.27 CAA Q 0.26 CGA R 0.11

22
CUG L 0.40 CCG P 0.11 CAG Q 0.74 CGG R 0.21

AUU I 0.36 ACU T 0.24 AAU N 0.46 AGU S 0.15

AUC I 0.48 ACC T 0.36 AAC N 0.54 AGC S 0.24

AUA I 0.16 ACA T 0.28 AAA K 0.42 AGA R 0.21

AUG M 1.0 ACG T 0.12 AAG K 0.58 AGG R 0.20

GUU V 0.18 GCU A 0.26 GAU D 0.46 GGU G 0.16

GUC V 0.24 GCC A 0.40 GAC D 0.54 GGC G 0.34

GUA V 0.11 GCA A 0.23 GAA E 0.42 GGA G 0.25

GUG V 0.47 GCG A 0.11 GAG E 0.58 GGG G 0.25

Saccharomyces cerevisiae Triplet, acide aminé, fréquence (sur 1)

UUU F 0.59 UCU S 0.26 UAU Y 0.56 UGU C 0.63

UUC F 0.41 UCC S 0.16 UAC Y 0.44 UGC C 0.37

UUA L 0.28 UCA S 0.21 UAA stop 0.47 UGA stop 0.3

UUG L 0.29 UCG S 0.10 UAG stop 0.23 UGG W 1.0

CUU L 0.13 CCU P 0.31 CAU H 0.64 CGU R 0.15

CUC L 0.06 CCC P 0.15 CAC H 0.36 CGC R 0.06

CUA L 0.14 CCA P 0.42 CAA Q 0.69 CGA R 0.07

CUG L 0.11 CCG P 0.12 CAG Q 0.31 CGG R 0.04

AUU I 0.46 ACU T 0.35 AAU N 0.59 AGU S 0.16

AUC I 0.26 ACC T 0.21 AAC N 0.41 AGC S 0.11

23
AUA I 0.27 ACA T 0.30 AAA K 0.58 AGA R 0.48

AUG M 1.0 ACG T 0.14 AAG K 0.42 AGG R 0.21

GUU V 0.39 GCU A 0.38 GAU D 0.65 GGU G 0.47

GUC V 0.21 GCC A 0.22 GAC D 0.35 GGC G 0.19

GUA V 0.21 GCA A 0.29 GAA E 0.71 GGA G 0.22

GUG V 0.19 GCG A 0.11 GAG E 0.29 GGG G 0.12

Escherichia coliTriplet, acide aminé, fréquence (sur 1)

UUU F 0.57 UCU S 0.15 UAU Y 0.57 UGU C 0.44

UUC F 0.43 UCC S 0.15 UAC Y 0.43 UGC C 0.56

UUA L 0.13 UCA S 0.12 UAA stop 0.63 UGA stop 0.29

UUG L 0.13 UCG S 0.15 UAG stop 0.08 UGG W 1.0

CUU L 0.1 CCU P 0.16 CAU H 0.57 CGU R 0.38

CUC L 0.1 CCC P 0.12 CAC H 0.43 CGC R 0.40

CUA L 0.04 CCA P 0.19 CAA Q 0.35 CGA R 0.06

CUG L 0.5 CCG P 0.53 CAG Q 0.65 CGG R 0.10

AUU I 0.51 ACU T 0.17 AAU N 0.45 AGU S 0.15

AUC I 0.42 ACC T 0.43 AAC N 0.55 AGC S 0.28

AUA I 0.07 ACA T 0.13 AAA K 0.76 AGA R 0.04

AUG M 1.0 ACG T 0.27 AAG K 0.24 AGG R 0.02

GUU V 0.26 GCU A 0.16 GAU D 0.63 GGU G 0.34

GUC V 0.22 GCC A 0.27 GAC D 0.37 GGC G 0.40

GUA V 0.15 GCA A 0.21 GAA E 0.69 GGA G 0.11

24
GUG V 0.37 GCG A 0.36 GAG E 0.31 GGG G 0.15

Les six codons les moins utilisés chez E.coli, et leur fréquence chez d'autres
organismes (nombre par millier de codons):

AGG AGA CGA CUA AUA CCC

R R R L I P

E. coli 1,4 2,1 3,1 3,2 4,1 4,3

H. sapiens 11 11,3 6,1 6,5 6,9 20,3

D. melanogaster 4,7 5,7 7,6 7,2 6,9 18,6

C. elegans 3,8 15,6 11,5 7,9 9,8 4,3

S. cerevisiae 9,3 21,3 3 13,4 17,8 6,8

P. falciparum 4,1 20,2 0,5 15,2 33,2 1

C. pasteurianus 2,4 32,8 0,8 6 52,5 8,5

P. honkoshii 30,3 20,4 1 18 44,9 10,1

T. aquaticus 13,7 1,4 1,4 3,2 2 43

A. thaliana 10,9 18,4 6 9,8 12,6 5,2

(Strategies Newsletter (2000) vol. 3 (1) p.31)

Les huit codons les moins utilisés:

acide
E.coli Levure Drosophile Humain
aminé

AGG AGG R

AGA AGA R

AUA AUA I

CUA CUA L

CGA CGA CGA CGA R

25
CGG CGG CGG R

CCC CCG P

UCG S

CGC CGU R

CCG P

CUC CUU L

GCG GCG A

ACG ACG T

UUA UUA L

GGG G

AGU S

UGU C

GUA V

UUG L

Certaines souches bactériennes commerciales contiennent des transgènes


exprimant les ARNt normalement sous-exprimés. De telles souches nous permettent
de contourner le problème sans avoir à optimiser les codons des protéines que l'on
veut faire exprimer.

BL21 (DE3) CodonPlus-RIL R (AGG, AGA), I(AUA) et L (CUA)


BL21 (DE3) CodonPlus-RP R (AGG, AGA) et P (CCC)
Rosetta ou Rosetta (DE3) R (AGG/AGA), R (CGG), I (AUA), L (CUA), P (CCC) et G
(GGA)

(Les bactéries CodonPlus sont des produits de la compagnie Stratagene; Rosetta


est un produit de la compagnie Novagen).

26
1.5.3 Le 21e et le 22e acide aminé

Après des décennies de travail avec nos vingt acides aminés familiers, il fut
surprenant de découvrir qu'il en existait finalement d'autres qui ne relevaient pas
d'une modification post-traductionnelle des résidus classiques mais qui étaient
insérés dans les protéines en tant qu'acides aminés originaux à part entière, avec
leur propre ARN de transfert. Le 21e acide aminé découvert (en 1986) est la
selenocystéine (Sec), le 22e (en 2002) est la pyrrolysine. Ils ne sont quand même
pas très courants.

Ces deux acides aminés sont codés par des codons STOP qui sont "contournés" par
des systèmes spéciaux. L'ARNt de la selenocystéine reconnait le codon UGA; celui
de la pyrrolysine le codon UAG. L'ARNt de la selenocysteine ne peut être
synthétisés que si la cellule a accès à une source de selenium.

En outre, on sait que la séquence de l'ARN en aval de l'UGA (sur environ 40 bases)
joue en rôle dans l'identité du UGA en tant que codon Sec plutôt que codon stop. Ce
n'est donc pas n'importe quel codon UGA qui codera pour une selenocystéine.

On a isolé la selenocystéine chez différents organismes eucaryotes et procaryotes;


elle se retrouve dans des enzymes ayant besoin de selenium pour fonctioner,
comme la glutathione peroxydase et la formate déhydrogénase chez les eucaryotes.
La pyrrolysine, elle, a tout d'abord été découverte dans la monométhylamine
méthyltransférase de l'archéa Methanosarcina barkeri.

La pyrrolysine est chargée directement sur son ARNt par une ARNt synthétase, mais
dans le cas de la sélénocystéine la situation est un peu plus complexe. Chez E. coli,
27
quatre gènes sont requis pour produire une selenoprotéine: SelA, SelB, SelC et
SelD.

SelA code pour une selenocysteine synthase qui catalyse la conversion de seryl-
tRNA en selenocysteyl-tRNA. SelB code pour un facteur d'élongation analogue à
EF-Tu mais avec une spécificité pour l'insertion de selenocysteine au codon UGA. Il
nuit à la terminaison de la traduction au codon UGA, permettant à la selenocystéine
de s'intégrer et à la traduction de se poursuivre le long de l'ORF étendu. SelD code
pour une selenophosphate synthetase qui catalyse la réduction du selenium en
selenium monophosphate. Ce phosphate est la source de métal pour la
selenocystéine. SelC code pour l'ARNt de la selenocystéine, avec un anticodon
UCA. Cet ARNt est d'abord chargé d'une sérine par la séryl-tRNA synthétase. C'est
le plus long des ARNt connus jusqu'ici chez E. coli. Cette exception à la règle des
vingt acides aminés souligne d'abord que rien n'est jamais coulé dans le béton en
biologie, et ensuite que la nature a toujours une surprise ou deux en réserve pour
nous quand nous croyons avoir tout compris.

1.5.4 Mutations au cours des siècles (et des millions d'années)!

Il est bien connu que des mutations s'accumulent dans le matériel génétique au
cours des éons, et ces mutations génétiques dirigent la synthèse de protéines
également mutées (et encore heureux, car sinon nous serions tous encore des
petites morves qui nagent et rien de plus).

28
La mutation d'un codon dans une protéine passe par deux filtres: celui de l'occasion
et celui de la sélection. Tout d'abord, plus une mutation est simple et plus elle a de
chance de se produire (AGG muté en AGC est plus fréquent que AGG muté en TTT,
parce qu'un seul nucléotide a été affecté). Ensuite, pour que la mutation soit
maintenue, il faut qu'elle confère un avantage quelconque à son hôte, ou au moins
qu'elle ne lui nuise pas.

La plupart de nos protéines sont là depuis très longtemps (le cytochrome C, par
exemple, est un modèle qui dure et dure et dure). Comme ces protéines ancestrales
remplissent très bien leur office, on n'y observe pas beaucoup de mutations d'une
espèce à l'autre; les mutations ont tendance à être conservatrices (celles n'ont pas
beaucoup d'impact). Si un résidu lysine joue un rôle important dans une protéine à
cause de sa charge positive, sa mutation en arginine (même charge) sera plus
facilement tolérée qu'une mutation en acide aspartique (charge inverse).

On peut utiliser le taux de mutations entre des protéines partagées par de nombreux
représentants du monde vivant pour aider à déterminer leur lien de parenté. Dans la
figure ci-dessous, on peut suivre les mutations les plus fréquemment observées
dans des protéines aparentées. La direction des flèches indique celle des mutations;
les flèches pointillées sont des mutations plus rares. Notez que pour ces mutations,
il est toujours possible de passer d'un codon codant pour un premier acide aminé à
un codon codant pour un deuxième en ne changeant qu'un seul nucléotide.
Parallèlement à cette relation qui explique que ces mutations soient plus fréquentes
parce que plus faciles à effectuer, on remarque que les chaînes latérales des
résidus mutés ont une certaine parenté avec celles des résidus originaux (petit
groupe pour petit groupe, comnme G vers A, ou encore charge négative pour charge
négative comme D vers E et vice-versa, ou encore aromatique pour aromatique
comme F vers Y et vice-versa); cela signifie probablement que la mutation n'a pas
introduit d'élément néfaste au bon fonctionnement de la protéine, et n'a donc pas
subi de pression évolutive tendant à la faire disparaître.

29
Les mutations les plus fréquemment observées.

1.6 Assemblage des protéines

1.6.1 Traduction de l'ARN par les ribosomes

Les ribosomes sont des usines moléculaires formées de protéines et d'ARN


structuraux, les ARN ribosomiques.

1.6.2 Synthèse peptidique non-ribosomique

Des polypeptides assemblés sans que les ribosomes ne soient solicités??? Et oui,
ça existe. Les peptides issus de la NRPS (non-ribosomal peptide synthesis) sont

30
généralement assez courts, de deux à environ 50 acides aminés. Ces peptides ne
sont pas codés par un gène, et ils ne sont pas limités aux vingt acides aminés de
base. On y retrouve parfois des acides aminés de forme D, des variantes méthylées
des acides habituels, des résidus hydroxylés ou glycosylés, des résidus jamais
retrouvés dans les protéines, etc. Il arrive que la chaîne peptidique y soit cyclique,
ou même branchée.

Ces peptides sont synthétisés par des synthétases massives organisées en chaînes
de montage; certaines sont des complexes multimériques, d'autres de grandes
protéines. Ces enzymes sont modulaires et contiennent une série d'unités
fonctionnelles qui peuvent lier un acide aminé libre, l'activer sous forme de thioester,
et le coupler au polypeptide grandissant. Chaque module a une taille de 1000-1200
acides aminés, rendant certains de ces enzymes vraiment énormes: une unique
protéine de 15 281 résidus (pour une masse de 1,7 MDal!!!) est responsable de la
synthèse de la cyclosporine, un immunorépresseur qui ne contient que... 11 résidus!

Structure de la cyclosporine A.

MeLeu: méthylleucine

MeVal: méthylvaline

MeBmt: (4R)-4-[(E)-2-butenyl]-4-méthyl-L-
thréonine

Abu: acide 2-aminobutyrique

Sar: Sarcosine

Dans la NRPS linéaire, la séquence de ces modules détermine la séquence du


peptide final. Les modifications sont introduites pendant la synthèse même ou après
la synthèse.

Ce système de synthèse des peptides produit plusieurs composés


pharmacologiquement importants. En plus de la cyclosporine A, on peut citer les
antibiotiques pénicilline et vancomycine comme étant issus de la NRPS. Pour en
savoir plus, vous pouvez consulter Chemical Reviews vol. 97, no 7, 1997.

31
2.0 Structure des protéines
n distingue quatre niveaux stades structuraux chez les protéines, de la structure
primaire à la structure quaternaire.

(1) Structure primaire: ordre des acides aminés le long de la chaîne polypeptidique.

(2) Structure secondaire: repliement local des acides aminés en hélices, en feuillets, ou en
d'autres formes similaires.

(3) Structure tertiaire: agencement stable dans l'espace de ces hélices et feuillets.

(4) Structure quaternaire: agencement des sous-unités entre elles, quand la protéine est
constituée de plusieurs sous-unités indépendantes (comme l'est par exemple
l'hémoglobine).

2.1 Structure primaire

2.1 La plupart des protéines ont une structure primaire linéaire.

Chaque acide aminé est lié au suivant par un lien peptidique, qui se forme quand le
groupement carboxylique d'un premier acide aminé réagit avec le groupement aminé
d'un second, avec élimination d'eau. Quand les acides aminés sont incorporés dans
une chaîne (qu'on appelle chaîne polypeptidique), on les appelle des résidus. La
chaîne polypeptidique n'est pas branchée; elle forme un unique filament étiré. Par
convention, on désigne le premier acide aminé de la chaîne comme étant celui dont
le groupement aminé reste libre; on dit qu'il est en 5' ou encore qu'il constitue l'
extremité N-terminale ou le N-terminus. On désigne comme étant le dernier résidu
de la chaîne celui dont le groupement carboxylique reste libre; on le dit en 3', ou à
l'extrémité C-terminale.

32
La figure ci-haut présente la conformation préférée du lien entre les résidus, soit en
trans. Cette conformation est généralement plus stable car elle positionne les
chaînes latérales loin l'une de l'autre. Qui plus est, les ribosomes synthétisent tous
les liens peptidiques en trans.

Un effet de résonance cause le partage d'électrons entre les atomes du groupe


carboxylique d'un résidu et l'azote du groupe aminé du résidu suivant. Cet effet de
résonance coince le lien peptidique en une structure planaire, le plan amide.

Chaque lien peptidique est donc rigide, mais de part et d'autre les liens peuvent effectuer
une rotation. L'angle de rotation d'un plan amide par rapport au carbone alpha en 5' est
noté angle ψ; l'angle entre le plan amide précédent et ce même carbone alpha est noté
angle υ. (Voir ci-dessous).

33
C'est la succession de ce genre de structures régulières, hélices, feuillets ou tours
qu'on appelle la structure secondaire d'une protéine.

2.1.2 Il existe des protéines circulaires

En s'intéressant à l'agent actif d'un thé médicinal congolais qui facilite les
contractions utérines, on découvrit dans les années 90 qu'il s'agissait d'une petite
protéine de structure circulaire, assez stable pour résister à l'ébullition et à
l'ingestion. Cette protéine, la kalata B1, n'était que la première d'une série de
protéines circulaires que nous devions découvrir, et qui comptent maintenant plus
d'une centaine de membres parmi leurs rangs (on pense qu'il pourrait même y en
avoir plusieurs milliers). Leur structure leur confère une grande stabilité et plusieurs
d'entre elles ont des activités insecticide ou antimicrobienne. (D'autres peptides non-
protéiques circulaires existent, comme la cyclosporine dont nous avons parlé au
point 1.6.2). Certaines ont en outre une structure topologique en noeud (c'est le cas
de la kalata B1); on les appelle des cyclotides.

Les protéines circulaires semblent être produites à partir de grands précurseurs


linéaires, mais on connait mal encore les enzymes qui permettent leur maturation et
leur cyclisation. Dans le cas de la défensine RTD-1 des mammifères, deux
précurseurs indépendants sont coupés et ligués ensemble à leurs deux extrémités
pour former un cercle. Dans le cas du kalata B1, deux parties séparées d'un même
précurseur sont d'abord coupées, puis liguées à leurs deux bouts pour former un
cercle. Mais dans le cas de la bactériocine AS-48, un seul précurseur est coupé et
ses deux bouts réunis pour fermer le cercle.

L'avantage d'être circulaire, pour uine protéine, est entre autres de ne pas offrir
d'extrémité terminale aux exopeptidases. La stabilité en est donc accrue. Il est
également plus difficile de les dénaturer de façon permanente par la chaleur ou les
variations de pH.

34
2.2 Structure secondaire

La chaîne polypeptidique adopte plusieurs types de structures régulières, mais il


n'en existe qu'un petit nombre qu'on retrouve souvent (on pourrait dire que ce sont
des modèles éprouvés par la nature).

Le biologiste G.N. Ramachandran, qui


découvrit entre autres la structure en
triple hélice du collagène, se rendit
compte en travaillant avec des modèles
de polypeptides que certains angles ψ et
φ ne pouvaient pas être combinés parce
que certains groupements chimiques se
rentraient carrément dedans. Son
graphique (le graphique de
Ramachandran, ci-dessous), nous
permet de voir d'un seul coup d'oeil
quelles sont les combinaisons toujours
permises (en noir) et celles qui sont non-
favorisées mais possiblement tolérées
(en pointillés). Ces derniers angles
assument que les atomes du
polypeptide, qui ne sont pas réellement
des sphères solides, peuvent voir leurs
rayons de contact se superposer
légèrement. Les structures secondaires
les plus souvent retrouvées dans les
protéines sont l'hélice alpha et le feuillet
beta; on voit ci-bas quelles
combinaisons d'angles peuvent y
conduire.

Notez que le graphique de


Ramachandran prédit qu'on puisse
former une hélice alpha qui tourne à
gauche si elle n'est composée que de
glycines (angles ψ de 45o et φ de 60o,
par exemple). C'est une exception: les
hélices alpha tournent presque toujours
dans le sens de la main droite.

35
2.2.1 L'hélice alpha

Une hélice alpha résulte de la succession d'angles υ de -57o et d'angles ψ de -47o.


Cette hélice est droitière; c'est à dire que si vous la saisissiez dans votre main droite,
elle tournerait dans le sens de vos doigts en montant dans la direction du pouce
(comme la double hélice de l'ADN, soit dit en passant). Notez que ceci reste vrai
même si vous la tenez à l'envers, puisqu'une main droite ne devient pas une main
gauche juste parce qu'elle est tournée vers le bas.

L'hélice alpha s'élève de 0,15 nm par résidu et de 0,54nm à chaque tour. Elle
compte 3,6 résidus par tour.

Elle est stabilisée dans sa forme hélicale par des ponts hydrogènes établis entre
l'hydrogène d'un groupement aminé -NH et l'oxygène d'un groupement carboxylique
-C=O et situé quatre résidus plus loin.

Comme ces ponts hydrogènes vont dans la même direction que l'hélice, celle-ci est
élastique: les ponts hydrogènes brisés lors de l'étirement de l'hélice se reformeront
facilement quand la tension sera relâchée.

Les chaînes latérales des résidus dans une hélice alpha pointent à l'extérieur de la
structure.

Une telle hélice peut facilement avoir une nature amphipathique si les chaînes
36
latérales se trouvant toutes du même côté ont une nature hydrophile et que celle se
trouvant de l'autre côté ont une nature hydrophobe. Le domaine d'interaction
protéine-protéine riche en leucine de la structure bZip (aussi appelée "leucine
zipper") de plusieurs facteurs de transcription de type AP-1 est une telle hélice
amphipathique.

Vue plongeante d'une hélice alpha amphipathique.


Les résidus chargés ou polaires sont en noir, les
résidus hydrophobiques en gris et les petits résidus
en blanc. Même si la structure primaire ne
révèlerait pas de région particulièrement
hydrophile ou hydrophobe, cette vue de l'hélice
nous montre qu'une de ses faces est plus
hydrophile et l'autre face plus hydrophobe.

Les domaines transmembranaires sont souvent constitués d'une ou de plusieurs


hélices alpha d'une vingtaine de résidus pour la plupart hydrophobes. La
bactériorhodopsine, par exemple, compte sept hélices alpha qui traversent la
membrane cellulaire. Ces hélices forment un pore (à la manière d'un beigne qui
serait inséré dans la membrane) par lequel les protons peuvent passer. La
bactériorhodopsine est une pompe à protons activée par la lumière.

La proline n'ayant pas d'hydrogène sur son goupe aminé, elle ne peut pas contribuer
au pontage hydrogène. La proline déstabilise donc l'hélice alpha, et il est rare qu'on
retrouve un résidu proline dans une telle hélice. (La proline se retrouve cependant
dans un autre type d'hélice, l'hélice de collagène, dont nous parlerons plus tard).

2.2.1.1 L'hélice 310

L'hélice 310 ressemble à une hélice alpha tricotée serré. Elle compte 3 résidus par
tour (au lieu de 3,6) et s'élève de 0,6nm pour faire un tour complet au lieu de
0,54nm. Chaque pont hydrogène ferme une boucle de dix atomes, d'où le nom de
310 (3 résidus par tour, 10 atomes dans la boucle).

37
Dans une hélice 310, les ponts hydrogènes se font entre le groupement -NH en
position x et le groupement -C=O en position x+3. (Des ponts hydrogènes entre -NH
en x et -C=O en x+5 sont parfois, bien que rarement, observés, dans une structure
appelée hélice p).

2.2.2 Le feuillet β

Les feuillets beta (β-sheet en anglais) se forment quand des parties de la longue
chaîne polypeptidique se replient et se longent l'une l'autre, côte à côte, en formant
des pont hydrogènes avec la voisine. On parle de feuillets beta parallèles quand les
chaînes vont dans le même sens et d'antiparallèles quand elles vont dans des
directions opposées. La direction des angles Φ et Ψ alterne dans un feuillet beta (un
positif, l'autre négatif), donnant à la chaîne une allure en zigzag.

On peut se représenter un feuillet beta comme une grosse croustille Ruffle, avec des
chaînes latérales pointant en alternance en haut et en bas. La distance entre deux
résidus est de 0,335nm; chaque chaîne est séparée de sa voisine de 0,465nm. Un
feuillet beta est représenté, dans les modèles structuraux, par une grosse flèche
plate qui indique sa direction.

Puisque les ponts hydrogènes des feuillets beta pointent perpendiculairement à l'axe
de la chaîne polypeptidique, ils ne donnent pas d'élasticité à la structure.

On retrouve beaucoup de feuillets beta dans la soie de ver (Bombyx mori) et la toile
d'araignée.
Les feuillets beta sont représentés par des flèches, l'hélice alpha est représentée par
une spirale.

38
2.2.3 Hélice vs feuillet

fréquence dans une fréquence dans un


hélice α feuillet β
résidu résidu
(1=distribution (1=distribution
aléatoire) aléatoire)

E 1,59 V 1,87

A 1,41 I 1,67

L 1,34 Y 1,45

M 1,3 C 1,40

Q 1,27 W 1,35

K 1,23 F 1,33

R 1,21 L 1,22

F 1,16 T 1,17

I 1,09 M 1,14

H 1,05 Q 0,98

W 1,02 S 0,96

D 0,99 R 0,84

V 0,90 H 0,80

T 0,76 A 0,72

N 0,76 K 0,69

Y 0,74 G 0,58

C 0,66 E 0,52

S 0,57 N 0,48

G 0,43 D 0,39

39
P 0,34 P 0,31

Certains acides aminés ont une préférence marquée pour certaines structures:
expérimentalement, on remarque qu'ils se retrouvent plus souvent dans une
structure que dans une autre. Mais même si les hélices alpha et les feuillets beta
sont les structures secondaires les plus courantes, il ne faut pas croire qu'un acide
aminé soit nécessairement plus porté vers une hélice quand il n'est pas fréquent
dans un feuillet, ou vice-versa (ce n'est pas comme si on parlait d'hydrophobicité).

En fait, si certains résidus comme l'acide glutamique préfèrent clairement les hélices
alpha aux feuillets beta, et que la cystéine préfère clairement les feuillets beta aux
hélices alpha, il y a des résidus comme la leucine qui se retrouve fréquemment dans
les deux structures. Il y en a également d'autres (la proline par exemple) qui se
retrouvent rarement et dans l'une et dans l'autre.

Le tableau ci-haut vous indique la fréquence des acides aminés dans différentes
structures. Une valeur de 1 indique une distribution aléatoire (ou ce à quoi on
s'attendrait si les acides aminés étaient distribués au hasard); une valeur supérieure
indique qu'on retrouve l'acide aminé plus souvent que ce que le hasard prédit; une
valeur inférieure à 1 indique le contraire.

2.2.4 Autres structures secondaires

Il serait inconvenant de négliger les nombreuses autres structures protéiques qu'on


retrouve dans la nature. Il en existe plusieurs autres que les feuillets beta et les
hélices alpha, mais elles ne sont pas toutes aussi clairement définies ou aussi bien
étudiées. De plus, certaines structures moins universellement connues peuvent se
retrouver dans la littérature sous différents noms. Ne vous sentez donc pas embêtés
si vous ne pouvez pas nommer toutes les structures possibles et imaginables; si
jamais vous avez besoin de vous familiariser avec une structure ésotérique
particulière, il existe plusieurs resources sur le web qui pourront vous y aider. Pour le
moment, il suffit de réaliser qu'il existe un grand nombre de structures secondaires.

Voici quand même les paramètres structuraux de certaines autres structures


secondaires, d'après Lesk, A.M. Introduction to protein architecture, Oxford University
Press, New York (2001), p.67 et d'après
http://www.cryst.bbk.ac.uk/pps97/assignments/projects/szabo/pphelix.htm

Différentes sources ne s'entendent pas toujours à l'unité près sur certaines valeurs,
mais elles restent très similaires.

n (résidus par d (élévation en Å entre deux p (élévation en Å pour un


structure φ ψ
tour) résidus successifs tour complet)

40
hélice α (à droite) -57 -47 3,6 1,5 5,5

hélice 310 (à droite) -49 -26 3 2 6

hélice β (à droite ou à
-57 -70 4,4 1,1 5
gauche)

héline de polyproline PPI


-75 +160 3,3 1,7 5,6
(à droite)

hélice de polyproline PPII -79 (- +149


-3 3,1 9,4
(à gauche) 75) (+145)

feuillet β parallèle -119 +113 3,2

feuillet β antiparallèle -139 +135 3,4

2.2.4.1 L'hélice beta

L'hélice β ressemble à un ressort qui aurait une section triangulaire plutôt que
circulaire. Elle est composée de feuillets beta qui, au lieu d'être plus ou moins
parallèles les uns par rapport aux autres, tournent en rond au lieu d'un axe.

C'est une structure retrouvée, par exemple, dans plusieurs protéines antigel. La
figure ci-contre, représentant une hélice β de la protéine antigel de Choristoneura
fumiferana, est tirée de GRAETHER SP, KUIPER MJ, GAGNÉ SM, WALKER VK, JIA ZC,
SYKES BD & DAVIES PL: b-Helix structure and ice-binding properties of a hyperactive antifreeze
protein from an insect Nature 406, 325 - 328 (2000) © Macmillan Publishers Ltd.

41
2.2.4.2 Bourrelet β, tour β, et épingle à cheveux β

Ces termes traduisent les noms plus usuels de β-bulge, β-turn et β-hairpin. Le
bourrelet β est une discontinuité locale dans la structure d'un feuillet β. Le tour β, lui,
est comme un U-turn subit de la chaîne principale de la protéine; on en retrouve
souvent à la jonction de deux segments de la chaîne formant un feuillet β
antiparallèle. L'épingle à cheveux consiste également en un repli sur elle-même de
la chaîne mais est plus étendue.

2.2.4.3 Hélices de proline

La proline étant un acide iminé dont


l'azote alpha fait partie d'un cycle
pyrrolidone. À cause de cela, la
chaîne latérale de la proline, au lieu de
s'étirer perpendiculairement à la
chaîne principale du polypeptide,
revient se coller dessus comme une
anse de tasse:

Cette structure restreint beaucoup la


rotation du lien N-Cα de la proline;
l'angle Φ est limité à environ -63 +/-
15 degrés. Cette restriction ne se prête
pas à une structure en hélice alpha ou

42
à un feuillet beta, chez qui elle peut
causer une distortion (un coude dans
une hélice alpha, par exemple), mais
permet par contre d'autres types de
structures: les hélices de proline.

La proline est pratiquement le seul


acide aminé qui peut adopter une
structure en cis de façon stable à
cause de la faible différence en
énergie entre ses formes cis et trans
(elle a deux carbones liés au N).

Les conformations préférées de la proline sont ψ= 160° et υ= -75° pour la


configuration cis; une répétition de prolines en cis donne une hélice de polyproline
de type I ou PPI. L'hélice PPI tourne a droite.

La configuration trans a des angles de ψ= 145° et υ= -75°; une répétition de cette


configuration donne une hélice de proline dite de type II (ou PPII); cette hélice tourne
à gauche. Une hélice PPII peut tolérer d'autres acides aminés, le plus souvent Q, S,
R ou A.

On n'a pas encore rencontré d'hélice PPI dans les protéines. Par contre, les hélices
PPII ont une importance biologique indéniable: le domaine SH3 (src-homology 3) de
plusieurs récepteurs lie des ligands de conformation PPII.

2.2.4.4 L'hélice de collagène.

Cette hélice qui tourne à gauche s'apparente à l'hélice PPII. Elle a une structure fort
particulière: chaque troisième résidu y est une glycine, et près de la moitié des
autres est une proline. Elle est aussi très riche en résidus modifiés comme
l'hydroxylysine et l'hydroxyproline.

43
L'hélice de collagène est vue plus en détails à la section 3.7, car elle contient aussi
plusieurs acides aminés modifiés et servira de modèle pour résumer les trois
premiers chapitres.

2.3 Structure tertiaire

La structure tertiaire d'une protéine fait référence à l'organisation dans l'espace de


ses structures secondaires. La structure en 3D adoptée par tous ces feuillets et
toutes ces hélices est la structure tertiaire de la protéine.

Le NCBI (National Center for Biotechnology Information), l'une des meilleures


utilisations de l'argent des taxes de nos voisins américains, offre de nombreuses
bases de données dont une collection de structures en 3D.
Vous pouvez aussi essayer celle-ci, la base de données PDBsum.

2.3.1 Maintien de la structure

Plusieurs interactions entre différents résidus de la chaîne polypeptidique repliée


dans l'espace maintiennent la structure de la protéine.

Interactions électrostatiques: on les distingue en...

(a) interactions charge-charge entre résidus de charge inverse comme K et R d'une part et
-
D et E d'autre part ( -NH3+ vs COO ). Quand une telle interaction est enfouie dans une
protéine globulaire, à l'abri de l'eau, on dit qu'il s'agit d'un pont de sel (salt bridge).

(b) Interactions charge-dipôle quand une chaîne latérale ionisée interagit avec le dipôle
d'une molécule d'eau. Cette interaction aide aussi à l'hydratation et à la solubilisation de la
protéine.

(c) Pont hydrogène entre H d'une part et O ou N d'autre part (il n'y a pas de Fluor dans la
composition des acides aminés). Les protéines peuvent bien sûr former des ponts
hydrogènes avec des molécules de solvant comme l'eau, et de telles interactions peuvent
aussi contribuer à la stabilité de la structure globale.

Interactions hydrophobes : entre groupes hydrophobiques comme les


groupements cycliques de la phénylalanine et de la tyrosine. De telles interactions
excluent les molécules d'eau.

Forces de Van der Waals : il s'agit de dipôle temporaires de faible force.. Ceux-ci
peuvent se former parce que les nuages électroniques des atomes individuels
peuvent fluctuer, donnant naissance à des dipôles temporaires.

Ponts disulfures : Nous l'avons vu dans le chapitre un: une cystéine oxydée peut
former un lien covalent avec une autre cystéine. Ces ponts ne peuvent se produire
spontanément que dans des conditions oxydantes (ce qui n'est pas le cas dans le
cytoplasme, qui est légèrement réducteur). Les ponts disulfures se forment donc
44
dans la lumière du réticulum endoplasmique chez les cellules eucaryotes, et dans
l'espace périplasmique chez les bactéries. Le réticulum endoplasmique est
également riche en une protéine facilitant la formation de ces ponts: il s'agit de la
PDI, ou protein disulfide isomerase. Celle-ci peut oxyder des cystéines réduites et
les forcer à former un pont disulfure. La PDI, sous sa forme réduite, peut également
briser un pont disulfure déjà établi en formant un pont temporaire avec une des deux
cystéines impliquées, ce qui permet à la deuxième cystéine d'établir un pont ailleurs.
Ce processus permet de briser les ponts disulfures établis par accident entre deux
cystéines qui n'auraient pas dû être pontées, et permet ainsi à la protéine de
retrouver une structure tertiaire plus stable.

Type d'interaction Changement dans l'énergie libre (en kJ/mol)

lien covalent (carbone-carbone) -350 (très solide!)

interaction hydrophobique -10

interaction ionique (pont de sel) -4

pont hydrogène (entre H et F,O ou N) -3

forces de Van der Waals -1

2.3.2 Fibres et globules

On sépare souvent les protéines globulaires des protéines fibreuses.

2.3.2.1 Protéines globulaires

Les protéines globulaires ont une forme compacte, où on peut distinguer une surface
en contact avec le solvant et un coeur qui en est isolé. Les résidus hydrophiles se
retrouvent souvent à la surface; les résidus hydrophobes le plus souvent à l'intérieur.

Les ponts disulfures peuvent se former plus facilement à l'intérieur des protéines
globulaires, parce qu'ils nécessitent des conditions oxydantes et que le cytoplasme
est généralement réducteur à cause de la présence de glutathione. À l'abri des
molécules d'eau qui les hydrateraient, les acides aminés chargés enfouis dans les
protéines globulaires peuvent former des ponts de sel entre eux. Les acides aminés
hydrophobes peuvent aussi plus facilement s'y empiler pour former des régions
dépourvues d'eau.

2.3.2.2 Protéines fibreuses

Puisque toutes les protéines sont à la base une longue chaîne polypeptidique, on
peut se les représenter comme des spaghettis. Alors qu'une protéine globulaire est
45
une boule de spaghettis refroidis et figée, une protéine fibreuse s'étire en longueur.

Voici quelques protéines fibreuses typiques:

(a) la tropocollagène, la composante de base du collagène, qui est la protéine la plus


abondante du corps humain. La structure secondaire la plus présente dans le
tropocollagène est l'hélice de collagène, de type PPII et qui est gauchère. Cette
hélice n'est pas stabilisée par des ponts hydrogènes internes.

(b) la kératine et la tropomyosine, retrouvées dans la peau et les muscles,


respectivement. Les deux consistent d'hélices alpha, qui sont droitières, et sont
stabilisées par des ponts hydrogènes internes orientés dans le même sens que la
fibre, ce qui leur permet d'être étirées. Les ponts hydrogènes des hélices peuvent se
briser sous la traction sans qu'il y ait de bris de liens covalents; quand la tension se
relâche les ponts hydrogènes se reforment. Suffisamment étirée, la kératine peut
aussi adopter une structure en feuillet beta.

Une protofibrille de kératine est formée par l'enroulement de deux ou trois hélices
alpha les unes autour des autres, en tournant de façon gauchère. 11 protofibrilles
forment une microfibrille de kératine; un grand nombre de telles microfibrilles forment
une fibre de kératine.

(c) la fribroïne de la soie est composée de régions très rigides et riches en feuillets
antiparallèles. Ces régions sont séparées par des régions moins structurées
conférant une certaine élasticité à la soie.

On peut retrouver dans la fibroïne une répétition du genre Gly-Ala-Gly-Ala-Gly-Ser


avec la chaîne latérale de Gly un atome d'hydrogène) occupant entièrement l'une
surface du feuillet:

Les régions rigides riches en feuillets de la fibroïne sont peu élastiques parce que
leurs nombreux ponts hydrogènes sont perpendiculaires à la direction de la chaîne
polypeptidique. L’élasticité de la soie est conférée par les domaines amorphes
séparant les feuillets beta.

46
2.3.3 Domaines

Il existe des structures tertiaires qui ont connu un tel succès que la nature les a
utilisés comme domaines modulaires. Ces domaines peuvent se retrouver sur des
protéines différentes pour y jouer le même rôle. Plusieurs types de domaines
d'attache à l'ADN sont communs à de grandes familles de facteurs de transcription
qui pourtant n'ont pas du tout les mêmes fonctions: les doigts de zinc, les domaines
bZIP, les homéodomaines, les hélice-boucle-hélice, etc).

La plupart des domaines ont une structure stable qu'on peut transférer dans un autre
contexte protéique. On peut ainsi fabriquer des protéines chimériques consistant de
domaines de différentes origines. Un facteur de transcription très utilisé en
laboratoire pour l'étude de l'activation de la transcription est une fusion du domaine
d'attache à l'ADN de la protéine de levure Gal4 et du domaine d'activation de la
transcription de la protéine virale VP-16.

2.3.3.1 bZIP, ou leucine zipper

Cette structure consiste en une hélice amphipathique contenant des leucines


répétées régulièrement. Deux hélices de ce type peuvent interagir entre elles de
façon à permettre la dimérisation de protéines, particulièrement celle de facteurs de
transcription comme les membres de la famille AP-1 ou (comme dans la figure ci-
contre) GCN4. Un domaine basique à la base des hélices permet l'interaction avec
l'ADN (chargé négativement).

2.3.3.2 bHLH (hélice-boucle-hélice)

47
Ce domaine d'attache à l'ADN présente deux hélices reliées par une boucle non
structurée. La structure permet la dimérisation de facteurs de transcription et
l'attachement à l'ADN sur une séquence de type E box, CANNTG.

Les facteurs de transcription Myc et MyoD contiennent des domaines bHLH.

2.3.3.3 Helix turn helix (ou hélice tourne hélice)

Voici le domaine hélice-tour-hélice du répresseur lambda.

Il s'agit de deux hélices alpha antiparallèles reliées entre elle par une simple boucle
non structurée. Plusieurs protéines (et même plusieurs domaines) contiennent une
telle structure. Le répresseur lac ou l'homéodomaine, par exemple, contiennent des
domaines hélice-tourne-hélice.

2.3.3.4 Winged helix

Structure hélicale permettant la liaison à l'ADN pour certains facteurs de


transcription, comme par exemple le facteur HNF-3.

2.3.3.5 Zinc finger

Domaine d'attache à l'ADN caractérisé


par une boucle à la base de laquelle se
trouve des histidines ou des cystéines
qui coordonnent un atome de zinc. La
présence de zinc stabilise la structure.
Les doigts de zinc sont des domaines
d'interaction avec l'ADN ou entre
protéines.

On retrouve des doigts de zinc dans


de très nombreux facteurs de
transcription (SP1, Récepteurs
nucléaires...)

48
2.3.3.6 Homeobox

Ce domaine consiste en une séquence très conservée (chez les levures, les plantes
aussi bien que chez les animaux) de 60 acides aminés formant trois hélices (voyez
la partie homeobox du domaine POU, ci-dessous). Ce motif se retrouve dans un
grand nombre de facteurs de transcription impliqués dans le développement
embryonnaire. Il s'agit d'un domaine d'interaction avec l'ADN.

2.3.3.7 Domaine POU

POU est un acronyme de Pit-1, Oct-2 et Unc-86, trois


facteurs de transcription chez qui le domaine a
d'abord été identifié. Le domaine POU est lui-même
constitué de deux sous-domaines: un domaine
spécifique à la famille POU (le domaine POU-S), et
un homéodomaine (ou homeobox).

L'homéodomaine se retrouve chez un grand


nombre de facteurs de transcription impliqués
dans le développement. (Il a reçu son nom à
cause de sa présence dans des facteurs de
transcription dont l’inactivation entraînait des
mutations homéotiques, du genre remplacement
une antenne par une patte).

2.3.3.8 Domaine NFkB

Le domaine d'attache à l'ADN assez complexe de la famille NFkB/rel évoque la


forme d'un papillon.

49
Contrairement à des domaines de petites taille comme le doigts de zinc, ces
domaines-ci requièrent un grand échafaudage protéique pour se maintenir.

On retrouve ce motif dans des facteurs de transcription tels p50, p65, rel, et NFAT.

2.3.3.9 La boîte MADS ou MADS box

La boîte MADS est un motif commun à certains facteurs de transcription. Son nom
vient des quatre premiers facteurs dans lesquels on l'a identifiée: MCM1, Agamous,
Deficiens et SRF. On compte au dessus de cent facteurs contenant des boîte
MADS, particulièrement parmi les facteurs de transcription qui dirigent la
morphogénèse des plantes.

2.3.3.10 domaine SANT

Domaine d'attache à l'ADN qui reconnaît la séquence YAAC(G/T)G. On retrouve des


domaines SANT dans les facteurs de transcription v-myb, TFIIB" ainsi que d'autres
protéines nucléaires comme Ada2, Swi3 et N-CoR.

2.3.3.11 PHD finger

Motif s'apparentant au doigt de zinc, le doigt PHD se retrouve dans des protéines
comme p300, CBP, TIF1, ash-1 (une protéine du groupe trithorax), l'histone
acétyltransférase Moz, etc.

2.3.3.12 RING finger

"Real Interesting New Gene": voilà


l'origine du nom "ring finger". Il s'agit
d'une forme particulière de doigt de zinc.

On retrouve un tel Ring finger, par


exemple, dans la protéine BRCA1
(dont la mutation est associée au
cancer du sein), dans la sous-unité
MAT1 du facteur de transcritpion
TFIIH, ou dans plusieurs membres
des ubiquitine-transférases de la
famille E3.

Le domaine est donc impliqué dans


certaines interactions entre protéines.

50
Une variété de RING finger est le motif RBCC, qui contient un RING finger, deux
domaines supplémentaires de liaison de Zinc (les B-box), une hélice de leucine
(Coiled Coil) et une région C-terminale variable). Ce domaine permet lui aussi une
interaction protéine-protéine.

2.3.3.13 Bromodomaine

Le bromodomaine compte 110 acides aminés et se retrouve dans plusieurs


protéines associées à la chromatine, des levures aux animaux; on le retrouve dans
les acétyltransférases Gcn5, P/CAF, CBP, p300, TAFII250, etc. Certaines protéines
contiennent des bromodomaines très modifiées, avec des parties manquantes ou
remplacées par d'autres séquences. On croit le bromodomaine impliqué dans
certaines interactions entre protéines et il pourrait jouer un rôle dans l'assemblage
des complexes menant à l'activation de la transcription.

2.3.3.14 Chromodomaine

Identifié à cause d'une région d'homologie entre les protéines d'hétérochromatine


HP1 et Polycomb, ce domaine a été ainsi nommé en raison de sa fonction présumée
(qui serait de jouer un rôle dans la restructuration de la chromatine). Le
chromodomaine consiste en une cinquantaine de résidus organisés sous forme de
trois feuillets beta pressés contre une hélice alpha. Le chromodomaine de la
protéine HP1 lui permet de se lier à une histone H3 méthylée sur la lysine 9. (Cette
méthylation est effectuée par une autre protéine à chromodomaine, SUV39H1). On
sait que dans certains cas, le chromodomaine peut interagir avec de l'ARN; on
soupçonne d'ailleurs qu'une telle interaction ARN-chromodomaine joue un rôle dans
l'établissement de régions hétérochromatiques par le système du RNAi (ou "RNA
interference").

2.3.3.15 Domaine riche en glutamine, domaine riche en proline, domaine acidique

Vous rencontrerez probablement ces termes si vous étudiez les domaines


d'activation des facteurs de transcription. Des facteurs comme SP1 ont en effet un
domaine d'activation riche en glutamine (domaine qui, d,ailleurs, ne fonctionne pas
chez un eucaryote primitif comme S. cerevisiae); des facteurs comme GAL4, VP16
ou GCN4 ont des domaines riches en acides aminés acides; des facteurs comme
CTF1 ont des domaines d'activation riches en proline. On doit donc se souvenir de
ces particularités quand on analyse une séquence en acides aminés et qu'on y
cherche une région fonctionnelle.

51
2.3.3.16 Répétitions WD40

Les répétitions WD40 sont caractérisées par un motif Tryptophane-acide


aspartique qui se répète à tous les 40 résidus environ. Ce dom aine semble
permettre l'interaction entre certaines protéines. On le retrouve dans de nombreux
types de protéines, incluant des facteurs de transcription (Taf72 chez S. pombe),
des répresseurs (Hir1p de S. cerevisiae) ou même des cyclines (Cdc20 chez
l'humain). C'est un motif assez courant.

2.3.3.17 T-box

La boîte T ou T-box a été caractérisée en raison de sa présence dans le facteur de


transcription Brachyury (T). On la retrouve dans plusieurs facteurs de transcription
impliqués dans le développement, les décisions précoces quant à l'identité cellulaire,
l'établissement du plan corporel et l'organogénèse. La T-box est un domaine assez
grand (17-26kDa), très riche en feuillets beta, et qui représente souvent une
proportion considérable de la protéine totale. Les facteurs possédant une T-box lient
la séquence TCACACCT. La structure de la T-box peut être visualisée sur ce site.

2.3.4 Les chaperones

Les protéines adoptent spontanément leur structure tertiaire. Certaines sont si


stables que même après une dénaturation complète elles retrouvent spontanément
et rapidement leur structure normale (c'est le cas de la RNAse A, une nucléase
qu'on peut faire bouillir à volonté et qui retrouve toujours son activité par la suite).

52
Toutes les protéines ne sont pas dans ce cas, bien sûr: pour la plupart, un traitement
dénaturant aura résulté en leur précipitation pure et simple ou du moins en une
agrégation à cause d'interactions hydrophobiques entre résidus exposés par le
dépliement de la protéine.

Il existe cependant une classe de molécules qui aident les protéines à retrouver leur
structure tertiaire si elles viennent à la perdre. Ces molécules sont les chaperones,
qui protègent les protéines d'un repliement inadéquat ou de l'agrégation. Les
protéines HSP (heat shock proteins) par exemple, servent à protéger les protéines
des dégâts causés par un choc thermique. Elles peuvent aussi aider les protéines à
retrouver leur forme momentanément perdue: c'est par exemple le cas de Hsp60,
qui aide au transport de protéines dans la matrice mitochondriale. L'enzyme F1
ATPase est synthétisé sous forme d'un précurseur à partir d'un gène nucléaire. Ce
précurseur contient un peptide signal lui permettant d'être reconnu par un récepteur
membranaire des mitochondries afin de faciliter son importation. Cependant, la F1
ATPase sous sa forme repliée est trop grosse pour passer par le canal de transport
mitochondrial. Elle doit d'abord être dépliée par l'action d'enzymes idoines.
L'ATPase, maintenant dépliée, peut ensuite passer par le canal et se retrouver dans
la matrice mitochondriale. Là, une protéase coupe son peptide signal et la Hsp60
l'aide à retrouver sa forme initiale. Sans Hsp60, l'ATPase ne réussit pas à reprendre
sa structure tertiaire et à rejoindre le complexe où elle agit d'habitude.

Chez E. coli, on connait bien le système GroES-GroEL qui sert à replier


correctement les structures diformes.

GroES est un anneau de 10 KDa consistant en sept sous-unités; GroEL est aussi un
anneau de sept protéines mais pesant 58 KDa.
53
En l'absence de GroES, deux anneaux GroEL s'empilent l'un sur l'autre. Le substrat
mal plié entre dans la cavité centrale d'un des anneaux. GroES vient alors couvrir le
trou, et induit dans la cavité un profond changement de conformation: elle passe de
majoritairement hydrophobe à majoritairement hydrophile, ce qui facilite aussi un
changement de conformation dans le substrat. Ce changement donne la chance au
substrat de peut-être retrouver une conformation stable et appropriée. Après vingt
secondes, quoiqu'il advienne, le substrat est relâché -qu'il soit bien replié ou non; il
peut toujours, si ça n'a pas marché, recommencer le cycle.

Voici un fait intéressant ayant rapport aux chaperones: dans le cas de la fibrose
kystique, l'origine de la maladie est une (ou plusieurs) mutations dans le gène CFTR,
qui code pour une pompe à ions Cl-. En bousculant la circulation des ions de part et
d'autre de la membrane plasmique des cellules pulmonaires, la maladie entraîne un
problème d'hydratation dans les poumons et facilite l'accumulation de mucus dans
lequel poussent des bactéries opportunistes.

Ces mutations dans le gène CFTR sont accompagnées par le remplacement de


certains acides aminés par d'autres dans la protéine pendant sa traduction. Dans la
majeure partie des cas, les mutations ponctuelles n'interfèreraient pas avec le
fonctionnement de la pompe à ions, mais malheureusement les chaperones
reconnaissent la protéine comme étant mal formée et ne lui permettent pas de se
rendre jusqu'à la membrane. Les patients sont donc victimes de leur propre système
de contrôle de la qualité protéique.

2.3.5 Quand la structure tertiaire cafouille

La maladie de la vache folle, une encéphalite spongiforme transmissible à l'homme,


nous a sensibilisés à l'impact que peut avoir sur la santé la structure tertiaire d'une
protéine.

L'hypothèse du prion, qui valut le prix Nobel à son inventeur, le Dr Stanley Prusiner,
suggère que l'agent pathologique de cette maladie (comme celle d'autres
encéphalites spongiformes, dont le nom vient du fait qu'elles changent le cerveau
en véritable éponge pleine de trous, et qui incluent la maladie de Creutzfeld-Jakob,
le syndrome de Gerstmann-Strausler-Scheinker et l'insomnie familiale fatale) n'est
pas une bactérie, ni un virus, ni même quoique ce soit contenant un acide
nucléique. Ce serait une protéine à laquelle on a donné le nom de prion.

La structure primaire du prion est codée par le gène PRNP (pour "PRIon Protein").
Chez un individu sain, la protéine codée par ce gène n'a rien de dangereux et fait
partie de notre bagage habituel de protéines. On désigne cette protéine normale par
le nom de PrPC; il s'agit d'une protéine extra-cellulaire fixée à l'extérieur de la
membrane plasmique par une ancre de GLI (ou glycosyl-phosphatidylinositol.

Chez une victime de la maladie, la séquence primaire ne change pas: c'est la


structure tertiaire qui est profondément modifiée, passant d'une structure

54
principalement faites d'hélices alpha en une structure très riche en feuillets beta.
Cette nouvelle structure est extrêmement stable et résiste à presque toutes les
techniques de désinfection. La protéine ayant adoptée cette nouvelle structure est
appelée PrPSC, pour "scrapie", le nom anglais de la tremblante du mouton, le
pendant ovin de la maladie de la vache folle.

Comment la structure passe-t-elle de PrPC à celle de PrPSC? C'est là que l'histoire


devient vraiment bizarre: il semble que la conversion soit catalysée par PrP SC elle-
même. À la manière d'un vampire, PrPSC entre en contact avec un PrPC sain et le
convertit en PrPSC.

Le PrPC converti en PrPSC est indifférentiable du premier PrPSC et va à son tour


convertir d'autre PrPC. On assiste alors à une réaction en chaîne de conversion vers
PrPSC. PrPSC s'accumule dans les cellules, et il semble qu'il finisse par former de
gros agrégats. Il détruit en tout cas les cellules du cerveau, entraînant les sévères
troubles neurologiques que l'on connaît et éventuellement la mort. Il existe aussi une
forme d'origine génétique de la maladie. En effet, certaines mutations dans le gène
PRNP favorisent l'adoption de la conformation PrPSC plutôt que la conformation
habituelle PrPC. Chez les individus porteurs de ces mutations, la traduction de
l'ARNm de PRNP peut donner naissance à une particule PrPSC. Et dès que celle-ci
est synthétisée par le ribosome, elle peut se mettre à convertir PrPC en plus de
PrPSC.

Ce phénomène n'est pas limité aux mammifères: chez la levure, le produit du gène
URE2 semble lui aussi avoir une forme PrPC comme une forme PrPSC. Les prions
semblent donc être une forme extrêmement avancée de parasites moléculaires: non
contents de puis er dans nos cellules le matériel requis à leur reproduction, comme
le font les virus, ils ne se donnent même pas la peine d'emporter leur matériel
génétique avec eux.

2.3.6 Épissage protéique

Il existe chez les protéines un phénomène analogue à celui de l'épissage chez les
ARN messagers: une partie de la chaîne polypeptidique peut être enlevée quelque
part entre ses deux extrémités, et les deux bouts restant être raccordées ensemble.

55
Les intéines et les extéines sont à ces protéines épissées ce que les introns et les
exons sont à l'ARNm. (Mais ne nous mêlons pas: les exons ne codent pas pour des
extéines, ni les introns pour des intéines! Il ne s'agit que d'un parallèle de principe).

Ce sont les intéines elles-mêmes qui se chargent de leur excision à partir du


précurseur avec lequel elles ont été synthétisées. On en a recensé au-dessus de
150 à ce jour, chez différents procaryotes et chez la levure.

Voici le mécanisme d'excision d'une intéine. On peut souligner une parenté avec le domaine
autocatalytique de la protéine de signalisation Hedgehog, qui se coupe en deux pour greffer
à sa partie N-terminale une molécule de cholestérol lui permettant de se fixer à la membrane
cellulaire.

56
Les Dr Chilkoti et Filipe (le dernier de l'université McMaster en Ontario) ont mis au
point une technique de purification des protéines utilisant une intéine. Dans leur
approche, la séquence d'une intéine est introduite entre celle de l'ELP (Elastin-like
polypeptide) et celle de la protéine d'intérêt. La protéine de fusion finale, à cause de
la présence de l'ELP, précipite en présence de sel ou à une température inférieure à
30-40°C, menant à un très grand enrichissement (puisque les autres protéines, elles,
restent solubles). La protéine de fusion récupérée et resuspendue est ensuite
incubée de façon à ce que l'intéine se coupe elle-même, libérant la protéine d'intérêt.

À c e sujet, voir les références suivantes: Banki et al. (2005) Nat Methods 2: 659-62
et Ge et al. (2005) J Am Che Soc 127: 11228-9.

Une catégorie d'intéines a une particularité intéressante: une fois excisées du


précurseur, ces protéines constituent des endonucléases qui reconnaissent des
sites de restriction particulièrement longs. On les appelle des méganucléases.
Il existe une certaine similarité entre ces méganucléases et l'endonucléase HO
responsable de la recombinaison somatique entre les locus HML, HMR et MAT chez
la levure.

Un aspect encore plus intéressant de ces endonucléases est qu'elles jouent un rôle
dans la propagation de leur propre séquence codante. Voici comment, en utilisant
comme exemple la méganucléase PI-SceI, qui est une intéine retrouvée au beau
milieu du polypeptide d'une ATPase de levure, Vma1.

Il existe deux types d'allèle pour VMA1. L'une d'entre elles contient la séquence
codante pour PI-SceI. L'autre allèle ne contient pas cette séquence codante, mais à
la place contient le site de restriction reconnu par la méganucléase PI-Sce I:

5' ATCTATGTCGGGTGC GGAGAAAGAGGTAATGAAATGGCA 3'


3' TAGATACAGCC CACGCCTCTTTCTCCATTACTTTACCGT 5'

57
Quand la levure, dans sa forme diploïde, contient les deux allèles, l'une d'entre elles
conduit à la production de PI-Sce I. La nucléase une fois libérée de son précurseur,
Vma1, migre vers le noyau où elle va retrouver son site de restriction qui justement se
trouve dans l'allèle de VMA1 ne contenant pas l'insertion codant pour PI-Sce I. (Ce
voyage vers une cible précise explique le nom anglais de ce type de nucléases: homing
endonucleases).

La nucléase va couper ce site. Avec un chromosome coupé en deux, la levure va


essayer de réparer les dégâts en utilisant l'autre allèle par recombinaison
homologue. Cette réparation va dupliquer l'insertion codant pour PI-Sce I dans le
site ouvert par la nucléase, et après la réparation son gène aura été introduit
dans l'allèle qui auparavant n'en disposait pas. PI-Sce I agit donc comme une
sorte de parasite moléculaire, qui veille à la propagation de sa propre séquence
codante dans les génomes qui en sont dépourvus.

2.3.6.2 Épissage protéique par le protéasome

58
Nous verrons dans le chapitre 3 que le protéasome consiste en une usine
moléculaire de dégradation des protéines. Cette usine est elle-même formée de
plusieurs sous-unités protéiques formant un tunnel par lequel passent les protéines
destinées à la dégradation.

Structure générale d'un protéasome. Les unités


régulatrices contrôlent l'accès à un tunnel formé
par les sous-unités catalytiques a et b. Chacune
de ces sous-unités sont elles-mêmes formées de
sept protéines formant un anneau. L'empilage
des quatre anneaux forment un tunnel dans
lequel ont lieu les réactions enzymatiques
catalysées par le protéasome.

On a récemment découvert que le protéasome était non seulement responsable de la


dégradation, mais qu'il pouvait aussi être impliqué dans une forme d'épissage protéique.

59
Les lymphocytes T de type CD8+ reconnaissent des antigènes que génèrent les cellules
présentant l'antigène (APC). Ces antigènes consistent en peptides de 8 à 10 résidus, et
proviennent des produits de dégradation des protéines- cibles par le protéasome. Ces
résidus se retrouvemt donc normalement à la queue-leu-leu dans la protéine originale.

On a cependant découvert il y a peu que ces peptides peuvent consister en deux courtes
séquences de résidus normalement séparées par une séquence intercalaire, et
fusionnées par le protéasome. Le mécanisme de cette fusion est décrit ci-contre et
correspond bien à une forme d'épissage protéique.

2.4 Structure quaternaire

Il existe des protéines complexes formées de plusieurs chaînes polypeptidiques.


L'assemblage de ces sous-unités entre elles constituent la structure quaternaire de
la protéine.

2.4.1 Hémoglobine

L'hémoglobine est la molécule qui, présente dans les globules rouges, permet le
transport de l'oxygène vers les tissus. Elle contribue aussi, dans une moindre
mesure, à l'évacuation des ions H+ et du CO2.

Chez l'adulte, elle est constituée de deux sous-unités d' -globine et de deux sous-
unités de -globine. Ces sous-unités sont assemblées de telle façon qu'elles laissent
une cavité au centre du tétramère. (Cette cavité ne sert pas à lier l'oxygène, mais
elle a un rôle à jouer dans la régulation du rôle de l'hémoglobine, comme nous allons
le voir à l'instant).

Chaque unité globine est associée à un groupe hème, qui contient un atome de fer
capable, quand il est bien enligné avec ce groupe, de s'associer à l'oxygène.

60
Les structures tertiaire et quaternaire de l'hémoglobine jouent un rôle primordial dans
son rôle comme transporteur. La protéine existe sous deux formes, la forme T (pour
tendue) qui a une faible affinité pour l'oxygène et la forme R (pour relaxée) de haute
affinité. Ces deux formes existent en un équilibre rapide qui dépend du pH ambiant et
de la présence d'oxygène. À pH élevé et en présence d'oxygène, la forme R est
privilégiée (et l'hémoglobine cherche donc à capturer de l'oxygène); à pH bas et quand
l'oxygène est rare, la forme T est privilégiée et l'hémoglobine relâche l'oxygène.

Lors d'une transition de T vers R, les sous-unités α1-β1 se rapprochent des sous-
unités α2-β2, réduisant la taille de la cavité centrale entre les sous-unités. Ce changement de
structure quaternaire a d'abord été remarqué lors d'expériences de cristallisation de
déoxyhémoglobine: ces cristaux, mis en présence d'oxygène, se cassaient -indice que la
structure des composantes du cristal avaient changé et n'était plus compatible avec le réseau
cristallin initial.

En présence d'oxygène et à pH plus élevé, le mouvement de différentes hélices alpha de


l'hémoglobine fait que l'atome de fer se déplace par rapport au groupement hème et vient se
positionner sur le même plan (voir figure ci-bas). Cette configuration est propice à
l'association du fer à une molécule de O2. Quand le pH baisse, la réaction inverse se produit:
les hélices reprennent leur position typique de la forme T, la cavité centrale grandit, et l'atome
de fer est déplacé par rapport au groupe hème. Il relâche alors son oxygène.

61
La sensibilité de l'hémoglobine au
pH procède du fait que les
cellules contenant beaucoup de
CO2 ont un pH plus acide, parce
que CO2 + H2O -> H2CO3.
L'hémoglobine ayant déchargé sa
charge d'oxygène peut alors
contribuer à évacuer l'excédent
de CO2 et d'ions H+ des cellules.
Elle est responsable d'environ
20% de cette évacuation. Les
ions H+ ne se lient pas au groupe
hème: ils se lient à l'histidine 146
de la -globine et à deux autres
résidus dans l' -globine de la
forme T. Le CO2, lui, se lie à
l'extrémité N-terminale de
chacune des quatre chaînes de
globine pour former la
carbaminohémoglobine.

Contrairement au CO2, le
monoxyde de carbone CO
compétitionne directement
avec O2 pour le lien libre sur
l'atome de fer du groupe
hème. Il a en outre une affinité
240 fois plus élevée. C'est
pourquoi le CO est beaucoup
plus toxique que le CO2: alors
que le CO2 est libéré
facilement (par simple
compétition) quand le patient
intoxiqué est mis en présence
de O2, le CO, lui, reste fixé très
longtemps sur le groupe hème,
puisque l'équilibre entre le CO
et O2 sur le groupe hème
favorise grandement le
premier.

La globine est une structure fort utile pour la capture de l'oxygène et on en retrouve
une autre forme, la myoglobine, dans les cellules musculaires. La myoglobine n'est
cependant pas un tétramère mais un monomère. En outre, elle ferait un pauvre
transporteur d'oxygène parce que son affinité pour ce gaz est trop élevée (elle a
tendance à le garder. Imaginez un laitier qui ne laisserait aller son lait qu'avec

62
réticence: il ferait un bien mauvais distributeur). La myoglobine sert donc à stocker
l'oxygène dans les muscles.

Chez l'hémoglobine, la capture d'oxygène par une première sous-unité entraîne une
augmentation d'affinité pour les suivantes. Les sous-unités de l'hémoglobine
pratiquent donc des interactions coopératives quand il s'agit de lier l'oxygène. La
courbe de saturation en O2 en fonction de la pression partielle d'oxygène est
sigmoïde, reflétant cette coopération.

Un autre agent joue un rôle important dans la régulation de la capture d'oxygène par
l'hémoglobine: il s'agit du diphosphoglycérate.

Le diphosphoglycérate est présent à haute


concentration dans les globules rouges. Il se lie à la
cavité centrale de la déoxyhémoglobine (la forme T)
en interagissant avec des chaînes latérales chargées
positivement dans les sous-unités de beta-globine. La
transition en forme R l'expulse de la cavité. Le
diphosphoglycérate réduit l'affinité de l'hémoglobine
pour l'oxygène. Il est produit en plus grande quantité
chez les individus fréquentant les hautes altitudes, là
où la pression partielle d'O2 est plus faible, afin de
faciliter la libération d'oxygène par les globules
rouges.

63
2.4.2 Anémie falciforme

L'anémie falciforme est une


maladie sanguine causée
par une simple mutation:
celle de l'acide glutamique
en valine à la sixième
position de la structure
primaire de la beta-globine.
Cette mutation cause une
malformation de
l'hémoglobine (qu'on dit
"hémoglobine S"). À basse
concentration d'oxygène,
l'hémoglobine S précipite et
forme des fibres insolubles.

Ces fibres s'accumulent


dans les globules rouges
qui prennent une forme en
faucille, d'où le nom de la
maladie. De telles
hématies ne peuvent pas
transporter d,oxygène et
peuvent boucher les
capillaires.

Ceci dit, les porteurs d'une


seule allèle mutée ne
souffrent que d'une forme
atténuée de la maladie et
gagnent un avantage:
leurs globules rouges sont
moins sujets à être
affectés par Plasmodium,
le vecteur de la malaria.
pour cette raison, la
mutation n'a pas été
éliminée par l'évolution
mais se maintient dans les
régions du monde où sévit
la malaria.

64
Les effets pléiotropiques d'une seule mutation dans la séquence de la
beta-globine (Glu6Val) qui mène à l'anémie falciforme. (D'après Strickberger, MW,
Genetics (3e éd.) Prentice-Hall, Upple Saddle River, 1985).

2.4.3 Un peu plus sur le transport de l'oxygène...


2.4.3.1 Hemerythrine

L'hemerythrine est une protéine qui sert à véhiculer l'oxygène chez les
brachiopodes, les sipunculides, les priapulides et un annélide (le
Magelona). Elle est incolore dans son état désoxygéné et adopte une
couleur rose en absorbant l'oxygène. Contrairement à l'hémoglobine, elle
ne souffre pas d'empoisonnement au monoxyde de carbone.

Elle aussi utilise le fer pour fixer l'oxygène, mais pas sous forme de
groupement hème comme le fait l'hémoglobine. Deux atomes de fer y sont
liés aux anneaux imidazole de cinq histidines et au groupes carboxyliques
d'un acide aspartique et d'un acide glutamique. Un atome d'oxygène est
également positionné entre les deux atomes de fer. L'hemerythrine est le
plus souvent trouvée sous forme d'un octamère de 108 000 Da, mais il
65
existe des formes dimériques, trimériques ou tétramériques chez certains
organismes. La topologie de cette protéine est presque entièrement
composée d'hélices.

2.4.3.2 Chlorocruorine

Ce sont des pigments respiratoires extracellulaires de couleur verte. On les


retrouve dans le plasma de quatre familles de polychètes, parfois en même
temps que de l'hémoglobine (à laquelle les chlorocruorines ressemblent
énormément au point de vue moléculaire, différant seulement au niveau du
groupement hème). Elles ont moins d'affinité pour l'oxygène que
l'hémoglobine et la myoglobine.

2.4.3.4 Hémocyanine

Il n'y a pas que le fer qui puisse servir au transport de l'oxygène, il y a aussi
le cuivre. Les hémocyanines sont des transporteurs d'oxygène utilisant ce
métal. Il en existe deux types, associés à certains arthropodes (crustacés
et arachnides, entre autres, et donc crabes, araignées, scorpions et
limules) ou à certains mollusques (pieuvre, ormeau). La circulation chez
ces organismes est très différente de ce qu'elle est chez les vertébrés:
plutôt que d'être pompé à haute pression par le coeur dans des artères, le
sang est distribué à basse pression dans des espaces et des sinus autour
des organes internes.

L'hémocyanine désoxygénée est presque incolore et elle devient bleue lors


de l'oxygénation. Elle forme différents complexes selon les organismes et
peut en former atteignant des tailles de 10 millions de Daltons. Elle n'est
pas aussi efficace que l'hémoglobine pour le transport de l'oxygène, ce qui
cause une fatigue assez rapide suite à un effort chez certains gros
mollusques (comme les pieuvres).

L'hémocyanine d'un mollusque (le keyhole limpet en anglais, un animal du


genre Diodora, ressemblant à une patelle) est utilisé en immunologie à
cause de son grand caractère immunogénique. Vous la rencontrerez peut-
être dans un labo sous le nom de KLH (keyhole limpet hemocyanin). On
couple souvent de petits antigènes à la KLH pour augmenter la réponse
immunitaire.

Vous savez maintenant qui sont les vrais sang bleu dans l’évolution!!!

66
3.0 Modifications post-traductionnelles
3.1 Généralités

Les protéines subissent d'abondantes modifications covalentes pendant et après


leur synthèse. Celles-ci vont de la simple protéolyse contrôlée à l'ajout covalent de
groupements énormes. Ces modifications peuvent servir...
(a) à la régulation de l'activité des protéines
(b) à leur étiquettage pour qu'elles soient reconnues par des partenaires
métaboliques ou par des systèmes de dégradation
(c) à les ancrer dans une membrane
(d) à les faire participer à des cascades de signalisation
(e) à leur adressage pour qu'elles se rendent au bon endroit dans la cellule
(f) à définir une identité immunologique (comme les groupes sanguins) etc, etc.

Voici une liste partielle des modifications post-traductionnelles qu'on peut rencontrer
dans une protéine.

Ajout ou retrait de groupements divers:


- acétylation (p.e. sur les histones; sur le N-terminus ou sur une lysine)
- amidation (plusieurs neuropeptides et hormones peptidiques; sur le C-terminus)
- biotinylation (pyruvate carboxylase; sur une lysine)
- carboxylation (prothrombine, sur un acide aspartique)
- hydroxylation (collagène; sur une lysine, une proline)
- méthylation (calmoduline, cytochrome C; sur une lysine)
- phosphorylation (AP-1; surtout Y, S, T, mais aussi sur H et D)
- sulfatage (gastrine; sur une tyrosine)

Acylation, ou ajout d'acides gras divers:


- glypiation: liaison entre une protéine destinée à la surface extracellulaire et une
ancre de glycophosphatidylinositol (ou GPI).
- isoprénylation: liaison entre un résidu cystéine C-terminal et l'un de deux composés
isoprènes, le farnésyl ou le géranylgéranyl.
- S-acylation: liaison entre une cystéine interne et un acide gras (acide palmitique ou
acide myristique). La liaison oxyester simple entre l'acide gras et une sérine interne
(O-acylation) est aussi observée
- Myristoylation N-terminale: Modification co-traductionnelle d'une glycine N-
terminale par formation d'un lien amide amide avec l'acide myristique sous forme de
myristoyl-CoA.
- Ancrage à la membrane par protéolyse contrôlée et ajout de cholestérol (comme
avec le récepteur membranaire hedgehog).

Ajouts de glucides, simples ou complexes:


- c-mannosylation
- poly-ADP-ribosylation
- acétylglucosamination

Ajout de polypeptides:
67
- ubiquitination (couplage à l'ubiquitine: histones, aussi toute protéine appelée à être
dégradée par le sentier métabolique du protéasome 26S; sur une lysine).
- sumoylation (couplage du small ubiquitin-like modifier, ou SUMO: se produit chez
p53, IκB, PML; sur une lysine).

Modification Site Exemple


Acétylation K Histones
Gamma-carboxylation carbone en position gamma de E prothrombine
Amidation G terminale gastrine
pyruvate
Biotinylation K
carboxylase
Carboxylation K, D, E Prothrombine
O-glycosylation sur S, T et Groupes sanguins
Glycosylation
hydroxylysine; N-glycosylation sur N Collagène
Hydroxylation P, K, D et Y Collagène
Prénylation (farnesylation,
C en C-terminal Ras
geranylgeranylation)
S-acylation C rhodopsine
NADH-cytochrome
Myristoylation G en N-terminal
b5
Méthylation K, H, R, D, E Actine
Phosphorylation Y, S, T MAP kinases
Sulfatage Y APP, thyroglobuline
Ubiquitination K Histones H2A, H2B

3.2 Ajout ou retrait de petits groupements divers:

Dans cette section, nous effectuerons un survol de plusieurs modifications qui


ajoutent ou enlèvent des molécules de petites tailles aux protéines. Plus tard, nous
verrons l'ajout d'acides gras et de glucides complexes.

3.2.1 acétylation

L'ajout d'un groupement acétyl- (CH3-CO- ) est une acétylation. Cette modification
post-traductionnelle des protéines est dirigée par des enzymes appelés
acétyltransférases. Cet ajout est réversible par un autre type d'enzyme: les
déacétylases. L'acétylation se produit sur un groupement aminé, qui peut se trouver
soit à l'extrémité N-terminale d'une protéine ou à l'extrémité de la chaîne latérale
d'une lysine.

68
L'acétylation de plusieurs lysines localisées dans la partie N-terminale des histones
H3 et H4 est impliquée dans la régulation de l'expression des gènes. Ces régions
sont à l'extérieur du domaine globulaire des histones, et comme leurs nombreuses
lysines chargées positivement (-NH3+ à pH neutre), elles peuvent se coller sur l'ADN
qui, lui, est chargé négativement. L'acétylation des lysines neutralise leur charge
positive, et les queues N-terminales n'interagissent plus avec l'ADN qui, par
conséquent, est empaqueté de façon moins serrée par les histones.

Les acétyltransférases chargés d'acétyler les lysines N-terminales des histones sont
recrutées par des facteurs de transcription au promoteur d'un gène -cible. Les
histone déacétylases, elles, sont recrutés au promoteur d'un gène-cible par des
répresseurs de la transcription. On retrouve des acétyltransférases dans le
cytoplasme (comme Hat1) ainsi que dans le noyau (comme Gcn5). L'acétylation des
histones dans le cytoplasme aide à l'assemblage de la chromatine (une fois qu'elles
ont rejoint le noyau) et l'acétylation qui fait suite à cet assemblage a un rôle de
régulation de l'expression des gènes.

Modifications covalentes des histones,


d'après Lee et Young (2000) Ann. Rev.
Genet. 34:77-137.
Certaines lysines peuvent être soit
acétylées,soit méthylées.
Ac=acétylation;
Met=Méthylation;
Ub= Ubiquitination;
P= Phosphorylation

Comme la combinaison de l'acétylation, de la méthylation et de la phosphorylation


de certains sites a des résultats qui varient et qui ne sont pas toujours associés soit
à une activation soit à une répression de la transcription, le Dr. David Allis a suggéré

69
que ces modifications reflétaient un nouveau système de signalisation, qu'il a appelé
le "code des histones". Ce code est bien entendu encore bien mystérieux, si tant est
qu'il existe réellement.

Exemple de "code des histones:"

Histone H3
Pas de modification répression
K14 acétylée transcription
S10 acétylée + S28 phosphorylée mitose
S10 phosphorylée + K14 acétylée transcription
K4 méthylée transcription
K9 méthylée répression de la transcription
Histone H4
K8 acétylée + K16 acétylée transcription
K5 acétylée + K12 acétylée dépôt des histones
K20 méthylée répression

Une hypothèse alternative à celle du code des histones permettrait d'expliquer le


rôle de l'acétylation. En faisant un recensement du statut de l'acétylation des
histones partout dans le génome de levure, le laboratoire du docteur Michael
Grunstein a relevé une association significative entre certains patrons précis
d'acétylation/déacétylation et la régulation commune de groupes de gènes. Ainsi,
des gènes appelés à répondre à des stimuli communs pourraient voir leurs histones
partager un même profil d'acétylation. Un tel profil spécifique servirait de site de
reconnaissance pour des facteurs de transcription particuliers.

3.2.2 amidation

Plus de la moitié des neuropeptides actifs sont amidés en C-terminal (chez les
insectes, ce chiffre atteindrait 90%). C'est le cas par exemple de l'hypocretin-1 et -
2, de la galanine, ou de la calcitonine de saumon; la gastrine et la cholŽcystokinine
sont Žgalement amidŽes. L'amidation est une réaction enzymatique qui a besoin de
vitamine C comme cofacteur. La source du groupement amide est une glycine
placée à l'extrémité C-terminale, et chez les vertébrés cette réaction est catalysée
par un enzyme bifonctionnel appelé PAM (peptidylglycine alpha-amidating
monooxygenase).

70
3.2.3 biotinylation

La biotine est une molécule qui peut être ajoutée à la chaîne latérale de certaines
lysines pour former la biocytine, le groupement actif d'enzymes telle la pyruvate
carboxylase, qui carboxyle le pyruvate pour donner de l'oxaloacétate. Dans ces
réactions, la biotine agit comme transporteur temporaire de groupements -COO-.

La biotine est une vitamine


et est par définition
essentielle dans la diète.
L'ingestion d'une trop
grande quantité de blanc
d'oeuf cru peut causer une
carence en biotine, car son
affinité pour l'avidine, une
protéine du blanc d'oeuf, est
si élevée que la biotine ne
peut plus être absorbée par
les intestins. (En fait,
l'afinité avidine-biotine a la
réputation d'être la plus
forte des liaisons non-
covalentes connues). Une
carence en biotine est
mortelle.

3.2.4 carboxylation

La carboxylation consiste à ajouter un groupement -COOH. Elle peut se produire sur


une lysine, comme dans le cas de la OXA-1 b-lactamase, sur un acide aspartique,
comme cela se produit dans le facteur IX (un facteur de coagulation) ou sur un acide
glutamique. Cette dernière réaction, qui donne de l'acide g-carboxyglutamique, se

71
produit dans de nombreuses protéines impliquées dans la coagulation sanguine
(Facteur II ou prothrombine, facteur VII, facteur IX, facteur X), de même que dans
d'autres protéines (protéines anticoagulantes C, S et Z; ostéocalcine; certaines
protéines ribosomiques).

La prothrombine, par exemple, a 10 résidus glutamates dans sa région N-terminale


qui sont carboxylés.
Cette modification du glutamate semble aider les protéines à coller aux surfaces
membranaires. Elle permet aussi de chélater du calcium, et celui-ci aide à former
des réseaux entre les groupes glutamates et les groupements phosphates des
phospholipides membranaires (pour aider à boucher les trous par où le sang
s'écoule). Un pont dépendant du Ca2+ peut aussi se former entre deux groupes
glutamates, une situation qui ressemble un peu à un pont disulfure.

Plusieurs carboxylases ont besoin de Vitamine K comme co-facteur pour permettre


la gamma-carboxylation du glutamate.

3.2.5 déimination

Certaines arginines ou méthylarginines des histones peuvent être la cible d'enzymes


appelés peptidylarginine deiminases. Ces enzymes vont changer le =NH2+ de la
chaîne latérale de l'arginine en =O.

Cette réaction joue probablement un rôle dans la régulation de l'expression génique


passant par les modifications covalentes des histones. La transformation d'une
méthylarginine, particulièrement, permettrait de jouer au niveau de la régulation
épigénétique de l'expression de certains gènes: en effet, alors que jusqu'ici on avait
identifié plusieurs histone méthyltransférases, on ne connaissait pas encore
d'activité enzymatiques capables de renverser la méthylation des histones.

72
3.2.6 hydroxylation

Cette modification consiste à ajouter un groupement hydroxyl (-OH) à une protéine.


On retrouve plusieurs résidus hydroxylés: les lysines et les prolines, l'acide
aspartique, la tyrosine...

L'hydroxylation de la lysine et de la proline est particulièrement importante parce que


ces résidus modifiés comptent pour une grande part dans la stabilité du collagène,
une protéine essentielle du tissu conjonctif. L'hydroxylation de la proline par la prolyl
hydroxylase, une réaction qui requiert de la vitamine C, est la réaction dont
l'inhibition cause le scorbut.

73
3.2.7 méthylation

La méthylation consiste à ajouter un groupement -CH3 sur une lysine, une


histidine, un acide aspartique ou glutamique, ou une arginine. Elle peut aussi se
produire aux NH2 ou COOH terminaux. La méthylation des lysines des queues N-
terminales des histones est associée à la répression de la transcription (voir le
tableau en section 1.1).

3.2.8 phosphorylation

La phosphorylation est la modification la plus étudiée des protéines et joue


un rôle majeur dans la signalisation cellulaire. Elle consiste en l'ajout d'un
groupement phosphate sur un groupement -OH d'une protéine.

Il existe un très grand nombre de Protéines kinases (les enzymes qui


ajoutent des groupements phosphates) qui appartiennent à différentes
voies de signalisation. La mutliplication de ces voies permet...

(a) Une amplification de signal

(b) Une activation simultanée de plusieurs sentiers, comme dans le cas du


contrôle de la dégradation du glycogène.

74
Les kinases ne doivent évidemment pas phosphoryler toutes les protéines
contenant au moins un tyrosine, une sérine ou une thréonine, car alors
aucune transmission de signal spécifique ne serait possible. Voici quelques
sites-cibles de protéines-kinases:

Kinase Séquence consensus Ref.

CaM II R-X-X- S/T -X 3,4

CK I Sp/Tp-X 2-3 -S/T -X 2

CK II X- S/T -X-X-D/E 1

GSK3 X- S/T -X-X-X-Sp 3

MLCK X-K-K-R-X-X-S-X 2,4

p34cdc2 X- S/T -P-X-R/K 3

p70s6k K/R-X-R-X-X- S/T -X 2

PKA R-X 1-2 -S/T -X 3

75
PKC X- S/T -X-R/K 1

PKG (R/K) 2-3 -X- S/T -X 3

References:
1- PROSITE pattern.
2- Pinna, L.A. and Ruzzene M. (1996) Biochim. Biophys. Acta 1314 :191-225.
3- Kennelly, P.J. and Krebs, E.G. (1991) J. Biol. Chem. 266 :15555-15558.
4- Kemp, B.E., and Pearson, R.B. (1990) Trends Biochem. Sci. 15 :342-346.

La phosphorylation est une modification réversible, ce qui permet d'activer ou


d'inactiver les voies de signalisation au besoin. La déphosphorylation est assurée
par des phosphatases.

La phosphorylation réversible des protéines peut aussi jouer un rôle dans


la modulation de l'activité de facteuyrs de transcription, soit en les activant
directement (comme c'est le cas pour le facteur AP-1) ou en jouant sur leur
localisation dans la cellule (comme c'est le cas pour les facteurs NFkB ou
NFAT).

NFAT: une famille de facteurs de transcription dont l'activité est contrôlée


par la déphosphorylation.

76
La phosphorylation du facteur NFAT le garde inactif dans le cytoplasme.
Un message membranaire permet l'influx de calcium dans la cellule, ce qui
stimule la phosphatase calcium-dépendante calcineurine. Celle-ci
déphosphoryle NFAT qui peut migrer dans le noyau et activer la
transcription de gènes cibles.

Ce système est intéressant au point de vue médical, car NFAT est impliqué
dans la différentiation de cellules du système immunitaire (les lymphocytes
T). Les drogues cyclosporine et FK506 sont des inhibiteurs de l'activité de
77
la calcineurine, et par effet indirect empêchent NFAT d'aller activer les
gènes requis par la réponse immune. C'est pourquoi la cyclosporine et
FK506 sont utilisés comme immunosuppresseurs chez les patients
porteurs d'une greffe hétérologue.

Pour en revenir au thème de la phosphorylation, notons qu'elle se produit


surtout sur une tyrosine, une sérine ou une thréonine. On a aussi
occasionnellement rapporté l'existence de phosphorylation d'autres résidus
comme l'acide aspartique ou l'histidine. Les procaryotes n'ont que peu de
gènes codant pour des sérine/thréonine kinases (entre 1 et 10). Il faut s'en
souvenir quand on veut faire exprimer des protéines dans un système
hétérologue: une sérine ou une thréonine se trouvant dans une protéine
eucaryote qu'on fait s'exprimer dans une bactérie a peu de chances d'être
phosphorylée.

3.2.9 sulfatage (ou sulfatation)

L'ajout d'un groupement sulfate à une tyrosine se fait par une


sulfotransférase. La gastrine et la cholecystokinine sont deux protéines
sulfatées. Cette modification sert apparement à activer ces enzymes.

3.3 Ajout d'acides gras ou de composés hydrophobiques.

Qu'il s'agisse d'une chaîne organique hydrophobique, d'un acide gras simple ou d'un
complexe glycophosphatidylinositol, on retrouve de nombreuses "ancres" qui
permettent à des protéines de rester attachées aux membranes biologiques. Cette
section décrit les principales:

(a) le GLI, ou glycosylphosphatidylinositol;


(b) les composés isoprénoïdes que sont le farnesol et le géranylgéranol;
(c) les acides palmitiques et myristoïques.

78
Nous parlerons aussi du cholestérol, même s'il ne s'agit pas d'un ajout fréquent.

3.3.1 Glypiation, ou ajout de GLI

Le nom de glypiation vient de GLYcosyl Phosphatidyl Inositol. Il s'agit d'une


modification rare en général, mais qui se retrouve dans plusieurs protéines ancrée
dans la membrane par un acide gras couplé à leur extrémité C-terminale. La
molécule entière pourrait avoir la structure suivante:

(N- PROTÉINE -C) -


phosphoethanolamine-
mannose- glucosamine-
phosphatidylinositol-
(phospholipides)

mais la nature de la
chaîne liant le PI à la
protéine peut varier et
compter de nombreux
sucres. De telles protéines
n'ont pas de domaine
transmembranaire et sont
exclusivement trouvées à
la surface des cellules.

Les protéines avec une


ancre GPI se divisent en
enzymes, marqueurs,
molécules d'attachement
et en protéines de
transport non-catalytiques.
La protéine PrPc, le
précurseur de la protéine
PrPsc associée à la
maladie de la vache folle,
possède une telle ancre
de GPI.

Vous voyez ici l'ancre de


GPI de la protéine
neuronale Thy-1.

L'ancre de GPI est préformée et est ancrée dans la membrane. Elle est ajoutée à
une protéine en remplaçant une des extrémités de la chaîne; c'est à dire qu'une
partie de la protéine est perdue quand l'ancre est ajoutée. La cible du GPI sur la
protéine est une séquence de 3-5 petits acides aminés suivis de 8-12 acides aminés
hydrophiles, puis de 8-20 acides aminés hydrophobes; l'ancre de GPI s'intercale
entre les petits acides aminés et les aa hydrophiles.

79
3.3.2 Isoprénylation ou prénylation

Liaison entre un résidu cystéine C-terminal et l'un de deux composés poly-isoprènes,

le farnésyl-diphosphate ou le géranylgéranyldiphosphate

L'isoprénylation permet à des protéines de se fixer dans une membrane. C'est le cas
des protéines G impliquées dans la transduction du signal. Les membres de la
famille Ras s'accrochent aussi à la membrane plasmique par une ancre farnésylée.
En plus, N-Ras, K-RASA sont palmitoylés une fois et H-Ras l'est deux fois.

L'ajout d'un groupement isoprénoïde à une


protéine se fait sur une séquence cible
CAAX, où C est une cystéine, A représente
un acide aminé aliphatique et X est Ser, Met,
Ala ou Glu. (On retrouve aussi parfois des
cibles Cys-Cys ou Cys-X-Cys, selon la
farnesyl transférase impliquée dans la
réaction).

L'ajout du groupement se fait sur le -SH de la


cystéine de la séquence cible; par la suite, la
protéine est coupée juste après cette
cystéine et un groupement méthyl y est
ajouté à l'extrémité C-terminale.

L'ajout du groupement se fait sur le -SH de la


cystéine de la séquence cible; par la suite, la
protéine est coupée juste après cette
cystéine et un groupement méthyl y est
ajouté à l'extrémité C-terminale.

On a dit que la farnésylation permet à la


protéine Ras de se positionner dans la
membrane; c'est pourquoi plusieurs drogues
anticancéreuses en voie de développement
sont des inhibiteurs de farnesyltransférase,
qui empêchent Ras de se retrouver à la

80
membrane et de véhiculer les signaux
extracellulaires pro-mitotiques.

3.3.3 Palmitoylation et myristoylation

Les deux acides gras les plus souvents ajoutés aux protéines sont l'acide palmitique
et l'acide myristique.

Ils servent eux aussi à ancrer les protéines dans une membrane, et parfois à les
diriger vers le bon compartiment cellulaire.

La liaison entre une cystéine


interne et un acide gras est
une S-acylation; ce lien peut
être renversé à cause de la
fragilité de la liaison thioester
(sensible à la réduction). Une
liaison ester simple entre un
acide gras et une sérine
interne (O-acylation) est aussi
parfois observée.

L'acide myristique peut aussi


se retrouver dans une position
particulière: sur une glycine
localisée à l'extrémité N-
terminale d'une protéine. C'est
une modification courante des
protéines membranaires
virales. La myristoylation N-
terminale n'est pas réversible.
La protéine gag de HIV est
ainsi myristoylée; sans cette
modification, le virus ne peut
pas produire de particules
infectieuses.

La protéine BID impliquée dans l'apoptose est un exemple de transit intracellulaire


régulé par la myristoylation: pour participer à la réponse apoptotique, BID doit être
localisé sur la membrane de la mitochondrie. Or, sa forme inactive reste bêtement
dans le cytoplasme. Lors du déclenchement de la réponse apoptotique, la caspase 8
vient couper BID en deux morceaux, p7 et p15, qui restent cependant associés par

81
une interaction hydrophobes. Cependant, même si les deux morceaux restent collés,
l'extrémité N-terminale fraîchement coupée de p15 est maintenant GSQSAR, et
cette glycine N-terminale est une cible pour les enzymes qui transfèrent l'acide
myristique. p15 se fait myristoyler, et cette nouvelle ancre d'acide myristique permet
de diriger le BID activé vers la membrane de la mitochondrie.

Même des protéines possédant des domaines transmembranaires peuvent utiliser


une ancre hydrophobique pour arrimer une partie hydrophilique de leur structure à la
membrane: c'est le cas de la rhodopsine, qui même si elle possède sept domaines
transmembranaires utilise quand même une ancre S-palmitoylée pour attacher son
extrémité C-terminale (cytoplasmique et hydrophile) à la membrane plasmique.

3.4 Ajouts de glucides, simples ou complexes

3.4.2 Structure pyranosique

3.4.3 Quelques sucres fréquemment retrouvés dans les modifications post-


traductionelles

82
3.4.4 Glycosylation en N et en O

Les glycoprotéines sont composées de protéines liées de façon covalente à des


sucres, qui peuvent contribuer à leur stabilité, leur adressage, leur solubilité ou
faciliter l'adoption d'une structure (ce qui est le cas du trimère d'hémagglutinine du
virus de l'influenza, permettant à ce pathogène de fusionner avec la membrane de
sa cellule-cible).

Le sucre situé le plus à l'extérieur d'une chaîne glucidique liée à une protéine est
souvent l'acide N-acétylneuraminique, chargé négativement, qui aide à tenir les
protéines éloignées les unes des autres (par répulsion de charges).

La glycosylation des protéines est présente dans toutes les cellules eucaryotes. Elle
se retrouve aussi chez les bactéries, une découverte assez récente d'ailleurs. La
majeure partie des glycoprotéines se trouve sur la face externe de la membrane
plasmique, avec la partie glycosylée pendouillant dans le milieu extracellulaire; il
existe cependant aussi des glycoprotéines intracellulaires, comme les facteurs de
trannscription SP1ou YY1 qui sont O-glycosylés par le N-acétylglucosamine.

Les chaînes glucidiques des glycoprotéines sont dites liées en N ou en O selon leur
site d'ancrage.

83
Liées en O: sucres ancrés sur l'oxygène du groupement hydroxyl de
la sérine,
la thréonine,
l'hydroxylysine (dans le collagène).

Le sucre accroché à la sérine ou la thréonine est GalNAc. Le sucre accroché à


l'hydroxylysine est le galactose.

Liées en N: sucres ancrés sur l'azote du groupement amide de l'asparagine. Le


sucre qui contacte l'asparagine est le N-acetylglucosamine (GlcNAc).

Les structures liées en N ou en O sont très différentes. Les chaînes liées en O sont
plus courtes et plus variables que celles en N, et ne contiennent la plupart du temps
84
qu'un, deux ou trois résidus glucidiques. Les chaînes en N peuvent former de
véritables arborisations.

Le site d'attachement des chaînes liées en N a un consensus N-X-S(T), où X peut


être n'importe quel acide aminé sauf la proline. Les chaînes liées en N contiennent
toutes une structure de base consistant en deux GlcNAc et trois mannoses; sur cette
structure viennent se greffer d'autres glucides.

Selon la nature de ces autres glucides, on divise les arborisations glucidiques liées
en N en trois familles:

- Type riche en mannose, qui ne contient que des résidus mannose en plus de la
structure de base;
- Type hybride, qui contient différents sucres et sucres aminés;
- Type complexe, qui ressemble au type hybride mais contient aussi du NANA.

La plupart des protéines sécrétées ou attachées à la membrane plasmique sont


glycosylées.

3.4.5 Mécanismes de glycosylation des protéines

la glycosylation en N commence en même temps que la traduction, dans le lumen


du réticulum endoplasmique, et se continue jusque dans le Golgi. L'attachement de
sucres en O se fait dans le Golgi, grâce à l'action de glycoprotéines
glycosyltransférases.

Liaison en N: ce type de glycosylation requiert un intermédiaire, le dolichol


phosphate. Ce polymère hydrophobe est inséré dans la membrane et est relié par
un groupe diphosphate au précurseur glucidique de l'arborisation liée en N. (Même
si la structure et la composition finale de cette chaîne glucidique change d'une
protéine à l'autre, le précurseur est toujours le même).

Lorsque le polypeptide portant un signal N-X-S(T) entre dans la lumière du réticulum


endoplasmique, une oligosaccharide protéine transférase décroche la chaîne
glucidique du dolichol et la greffe sur l'asparagine-cible.

85
La chaîne glucidique n'est pas au bout de ses peines, cependant: elle continue
d'être modifiée dans le réticulum et dans le Golgi.

On peut inhiber la glycosylation des protéines. La tunicamycine, par exemple, est un


agent inhibiteur de la N-glycosylation. Elle empêche la glycosylation du résidu Asn
initial. Elle arrête en plus le cycle cellulaire en G1.

Liaison en O: Ici, les résidus sont ajoutés un par un (s'il y en a plus d'un). Les
sucres ajoutés sont sous forme "activée", c'est à dire liés à un nucléotide, et les
glycoprotéines transférases les ajoutent directement sur les acides aminés cibles.

Les groupes sanguins ABO résultent d'une glycosylation effectuée avec les mêmes
enzymes que pour la O-glycosylation, même s'ils ne sont pas toujours associés à
des protéines. Ils viennent de ce que trois conformations possibles d'un
oligosaccharide greffé sur une protéine membranaire des globules rouges donnent
naissance à trois antigènes: l'antigène H (ou O), l'antigène A et l'antigène B.

Ces épitopes, A, B et O, sont entièrement glycosidiques: ils peuvent être portés par
une glycoprotéine (comme la bande 3, la bande 4.5 ou d'autres) ou même par un
lipide. La bande 3 contient aussi une unique chaîne glycosylée liée en N, pointant
vers l'extérieur de la cellule, et qui porte elle-même plus de la moitié des épitopes
antigéniques du système ABO.

86
Ces épitopes, A, B et O, sont entièrement glycosidiques: ils peuvent être portés par
une glycoprotéine (comme la bande 3, la bande 4.5 ou d'autres) ou même par un
lipide. La bande 3 contient aussi une unique chaîne glycosylée liée en N, pointant
vers l'extérieur de la cellule, et qui porte plus de la moitié des épitopes antigéniques
du système ABO.

L'épitope "de base" du système ABO consiste à la base d'un groupe de cinq sucres:
le glucose, le galactose, le N-acétylglucosamine, le galactose et le fucose. Ces
sucres constituent l'antigène O (ou H) qui est -théoriquement- partagé par tout le
monde.

Chez les individus de type A, on retrouve un enzyme (la Fucosylglycoprotein alpha-


n-acetylgalactosaminyltransferase EC 2.4.1.40 ) qui ajoute un N-
acétylgalactosamine à l'a ntigène O. Chez les individus de type B, on retrouve un
autre enzyme (la Fucosylglycoprotein 3-alpha-galactosyltransferase EC 2.4.1.37) qui
ajoute un galactose à la place. Les individus qui possèdent une allèle de chaque
type pour ces enzymes ont des cellules portant un antigène A et un antigène B, et ils
sont dits AB (puisque leur système immunitaire a appris à n'attaquer ni l'une ni
l'autre des deux formes A et B). Les individus dépourvus des deux enzymes sont de
type O, et leur système immunitaire attaque les antigènes A et B.

Il existe une mutation empêchant la synthèse de l'antigène O (le fucose manque);


les individus porteurs de cette mutation sont dits appartenir au groupe de Bombay.
Comme les tests pour déterminer les groupes sanguins sont basés sur une
reconnaissance immunitaire (le sang de type A réagit avec les anticorps anti-A, le
sang de type B réagit avec les anticorps anti-B, le sang de type AB réagit les deux
alors que le sang O ne réagit pas du tout), le sang du type de Bombay peut passer

87
pour du sang O (puisqu'il ne réagit ni avec A ni avec B). Ces individus sont donc
passibles de recevoir une transfusion qui peut leur être fatale.

Pour échapper à une réponse immunitaire trop sévère de son hôte (l'être humain,
par exemple), la bactérie entérique Shigella flexneri est équipée d'une structure
lipopolysaccharidique qui contient plusieurs répétitions de l'antigène O. Ce polymère
d'antigène O s'étend bien au-delà de la surface de la bactérie.

3.4.6 Adressage par le biais d'une glycosylation

Les protéines destinées à l'exportation où à certains compartiments dans la cellule


ne sont pas traduites dans le cytosol mais dans la lumière du réticulum
endoplasmique, à la surface duquel les ribosomes sont attachés et lui donnent un
aspect rugueux en microscopie électronique. Les protéines qui entrent dans le RE
doivent ensuite être acheminées vers leur destination correcte.

Les enzymes qui doivent se rendre dans les lysosomes y sont dirigés par une glycosylation spécifiq
portent un mannose-6-phosphate. Le phosphate est ajouté à la protéine (qui est déjà une glycoprot
bien entendu) selon le processus décrit dans la figure qui suit. Cette réaction se produit dans le Go

Deux récepteurs de mannose-6-phosphate sont présents sur la membrane interne


de l'appareil de Golgi et permettent de diriger les protéines vers les lysosomes.

88
3.4.7 Glycosylation et infection

Beaucoup de virus et d'autres agents pathogènes ont évolué de façon à reconnaître


les sucres présents à la surface des cellules et s'en servent comme points
d'arrimage.

- Le virus VIH entrent dans les cellules du système immunitaire en s'attachant à des
récepteurs tels CXCR4 et CXCR5, qui sont des glycoprotéines.

- La glycoprotéine membranaire Dystroglycan est une composante du complexe de


la dystrophine. Deux protéines sont issues du gène de dystroglycan (suite à une
maturation enzymatique): a-DG et b-DG. Le a-DG présent sur les cellules de
Schwann est le récepteur de Mycobacterium leprae, ainsi que des arénavirus
(causant des fièvres hémorrhagiques, telle la fièvre de Lhassa).

- Les rhinovirus (qui causent le rhume) utilisent la glycoprotéine ICAM-1 comme


point d'entrée.

- Le virus de la rage se lie à la glycoprotéine N-CAM.

- L'agent malarial Plasmodium vivax utilise le récepteur de l'interleukine 8 pour entrer


dans les érythrocytes.

- Plasmodium falciparum, lui, utilise les sucres portés par la glycophorine à la


surface des éryhtrocytes. G. La glycophorine sert aussi de point d'entrée pour le
virus de l'influenza. (Les sucres de la glycophorine contribuent à établir le système
de groupe sanguin dit MNS:ce sont des antigènes propres à l'être humain mais
attaqués par le système immunitaire d'autres animaux).

3.5 Ajout de polypeptides

3.5.1 ubiquitination

Voir les revues suivantes sur l'ubiquitination: Pickart CM. Mechanisms underlying
ubiquitination. Annu Rev Biochem. 2001;70:503-33 ainsi que Voges D, Zwickl P,
Baumeister W. The 26S proteasome: a molecular machine designed for controlled
proteolysis. Annu Rev Biochem. 1999;68:1015-68 et Hershko A, Ciechanover A. The
ubiquitin system. Annu Rev Biochem. 1998;67:425-79.

L'ubiquitine est une petite protéine de 76 acides aminés, extrêmement conservée


dans le monde vivant. Son rôle principal consiste à marquer une protéine pour la
dégradation par le protéasome 26S. Son importance a valu à ses découvreurs le prix
Nobel de chimie en 2004.

89
L'ubiquitine est ajoutée par
sa propre extrémité C-
terminale à des résidus
lysine des protéines-cibles
ou, parfois, à l'extrémité N-
terminale de certains
facteurs (MyoD ou LMP-1 de
EBV, p.e.). D'autres
molécules d'ubiquitine
peuvent ensuite être
ajoutées par leur C-terminal
à la lysine K48 de la
précédente pour former une
longue chaîne qui permet
l'accostage de la protéine sur
des sites de reconnaissance
localisés sur la particule
régulatrice du protéasome
26S.

Au protéasome 26S, la
protéine est déroulée par des
ATPases et est dégradée en
peptides de 8 acides aminés
environ.

Trois familles d'enzymes sont requises pour ubiquitiner les protéines (E1 à E3); un
nouvel enzyme, E4, semble faciliter l'allongement de la chaîne poly-ubiquitine. Au
moins quatre ubiquitines sont nécessaires pour signaliser la destruction de la
protéine. Les membres des familles E2 et E3 forment des complexes qui s'associent
avec la protéine-cible; E3 fournit l'association à la cible et E2 fournit l'ubiquitine.

90
Il existe un enzyme E1, une vingtaine d'enzymes E2, et encore plus d'enzymes E3.
Cette variété permet une multiplicité de spécificités. L'enzyme E1 est d'abord
conjugué à l'ubiquitine (sur un résidu cystéine), qu'il transfère à l'enzyme E2,
également sur un résidu cystéine. E3, le partenaire de E2, permet de recruter la
protéine-cible et permet le transfert de l'ubiquitine sur cette dernière. Beaucoup de
membres de la famille E3 contiennent un RING finger, une forme de doigt de zinc de
séquence CXXCX(n) CX(1-3) HX(2-3) C/HXXCX (n)CXXC.

Un "ring finger".

Le signal d'ubiquitination des protéines cibles n'est pas très bien défini, quoiqu'on ait
décrit une "destruction box" qui en fait office chez les cyclines. Sa séquence est très
dégénérée et ressemble à ceci: R (A/T) (A) L (G) X (I/V) (G/T) (N), où les résidus
entre parenthèses sont présents 50% du temps ou plus. En outre, certaines
modifications post-traductionnelles (comme la phosphorylation) peuvent changer
une séquence peptidique inactive en signal de reconnaissance pour le système de
dégradation; c'est ce qui se passe dans le système IkB-NFkB illustré plus bas.

3.5.2 La règle du N-terminal (ou "N-end rule") et le dégron.

La "règle du N-terminus" (ou "N-end rule"), spécifie que certains résidus, quand ils
occupent la place N-terminale d'un peptide, peuvent donner un signal de destruction.
Les acides aminés concernés, qu'on peut identifier dans la table ci-dessous, se
combinent avec une lysine située légèrement en aval pour former une cassette
appelée N-degron. Le N-degron est reconnu par un complexe protéique E2-E3 qui
ajoute des ubiquitines à la lysine. La protéine est ensuite détruite par le protéasome
comme nous venons de le voir.

Demi-vie d'une fusion Ubiquitine-Résidu-β-


Galactosidase (en minutes)

S.
Résidu E.coli
cerevisiae

Arginine, Arg, R 2 2

Lysine, Lys, K 2 3

Phenylalanine, Phe, F 2 2

91
Leucine, Leu, L 2 2

Tryptophane, Trp, W 2 2

Tyrosine, Tyr, Y 2 10

Histidine, His, H Plus de 600 3

Isoleucine, Ile, I Plus de 600 30

Acide aspartique, Asp, D Plus de 600 3

Acide glutamique, Glu, E Plus de 600 30

Asparagine, Asn, N Plus de 600 3

Glutamine, Gln, Q Plus de 600 10

Plus de
Cysteine, Cys, C Plus de 600
1200

Plus de
Alanine, Ala, A Plus de 600
1200

Plus de
Serine, Ser, S Plus de 600
1200

Plus de
Threonine, Thr, T Plus de 600
1200

Plus de
Glycine, Gly, G Plus de 600
1200

Plus de
Valine, Val, V Plus de 600
1200

On ne sait pas, puisque la proline ne


Proline, Pro, P
participe pas au dégron.

Plus de
Methionine, Met, M Plus de 600
1200

(D'après Varshavsky, PNAS 93: 12142-12149, 1996)

On a utilisé ce dernier phénomène pour développer un système d'auto-destruction


qui permet d'étudier le fonctionnement de certaines protéines en forçant leur
dégradation à des moments donnés. Ce système repose sur le clonage, en phase
avec le cadre de lecture de la protéine d'intérêt, d'une cassette (appelée dégron, un
petit nom très technologique) qui peut recruter le système d'ubiquitination en
réponse à un choc thermique.

92
Le dégron de levure représenté ci-bas contient
(a) la séquence de l'ubiquitine,
(b) une arginine, et
(c) la séquence d'une dihydrofolate réductase (DHFR) thermosensible.

L'ubiquitine située en N-terminus est enlevée pendant ou tout juste après la


traduction, un phénomène normal et attribuable à des Ubiquitines-protéases. Ces
protéases coupent juste après la séquence de l'ubiquitine, laissant exposé l' acide
aminé suivant (sauf s'il s'agit d'une proline). Dans le cas qui nous occupe ici, la
coupure de l'ubiquitine expose une arginine N-terminale. Cette arginine est reconnue
par un complexe E2-E3 (Ubc2-Ubr1, ce dernier produit s'appelant aussi N-recognin)
qui ne peut pas ubiquitiner les lysines de la DHFR voisine tant que la température
reste basse. Lors d'un choc thermique, la DHFR subit un changement
conformationnel et les lysines-cibles sont exposées, menant à leur ubiquitination
puis à la dégradation de la protéine entière.

L'ubiquitine ne sert pas qu'à marquer les protéines pour la dégradation. De courtes
chaînes d'ubiquitine jouent probablement un rôle différent (Les histones H2A, H2B et
H1 peuvent être ubiquitinées dans leur partie C-terminale sans être condamnées à
la destruction). Par exemple, on sait que la protéine de réparation de l'ADN Rad26
aide à ubiquitiner la lysine 123 de l'histone H2B. Cette ubiquitination semble être un
pré-requis à la méthylation de la lysine 4 de l'histone H3, et on soupçonne que cela
est dû au recrutement de la sous-unité 19S du protéasome (la sous-unité
régulatrice) par H2B-K123-Ubi. La méthylation de H3K4 permet le recrutement de
SAGA via sa sous-unité Chd1, et SAGA peut ensuite procéder à l'acétylation de

93
l'histone H3 via sa sous-unité Gcn5.

Le facteur de transcription NFkB est contrôlé par un système d'ubiquitination et de


phosphorylation. NFkB est normalement maintenu dans le cytoplasme par son
association avec un répresseur appelé IkB (inhibiteur de kappa B) riches en
répétitions ankyrines ou avec des formes immatures de NFkB contenant ces
répétitions. Suite à un signal pro-inflammatoire approprié , IkB est phosphorylé; cette
modification le rend apte à être ubiquitiné. Le protéasome dégrade alors le
répresseur et NFkB est libre de migrer vers le noyau et son site d'attache sur l'ADN.

3.5.2 Sumoylation

Il existe des protéines apparentées à l'ubiquitine, soit par leur séquence, soit par leur
capacité d'être greffée à des protéines déjà existentes. C'est le cas des protéines
SUMO ( small ubiquitin-like modifier).La sumoylation est une variante de
l'ubiquitination. Elle implique l'attachement de SUMO à une lysine présente dans
divereses cibles comme p53, IκBα, ou PML. Elle ne mène pas à l'assemblage de

94
longues chaînes de SUMO et ne mène pas non plus à la dégradation. La
sumoylation est réversible.

SUMO semble augmenter la stabilité de ses cibles et moduler leur


compartimentalisation cellulaire. Pour les facteurs inhibiteurs IκB et Mdm2, SUMO
semble faire compétition à l'ubiquitine et pourrait agir comme stabilisateur.

AOS1 et UBA2 agissent de concert comme enzyme E1 pour la sumoylation. Ces


deux protéines présentent une homologie avec les parties N-terminale et C-
terminale de UBA1, l'enzyme E1 impliquée dans l'ubiquitination.

3.6 Maturation protéolytique

La dégradation des protéines est une des étapes majeures de la régulation de leur
activité. La dégradation peut être partielle, comme quand un zymogène est
partiellement dégradé pour libérer un enzyme actif, ou totale pour complètement
éliminer la molécule.

Il existe deux principaux systèmes de dégradation protéique dans la cellule: le


protéasome 26S et les lysosomes.

Le protéasome est un gros complexe protéique ressemblant à l'empilement de


quatre anneaux, bouché à chaque extrémité par deux autres complexes protéiques.
Le tunnel au centre des anneaux contient le site actif de plusieurs protéases.

L'unité régulatrice qui coiffe l'empilement reconnaît les chaînes d'ubiquitine (et donc
les protéines marquées pour la destruction par ce système) et déroule la chaîne
polypeptidique qu'elle fait passer dans le canal des unités catalytiques, où la chaîne
est découpée en fragments d'environ huit résidus.

95
Les lysosomes, eux, sont des vésicules d'origine golgienne. Les enzymes
lysosomiques sont glycolsylés et portent un mannose-6-phosphate, qui est reconnu
à la surface interne du réticulum trans golgien par un récepteur qui dirige ces
enzymes vers les lysosomes en maturation.

Les lysosomes contiennent une soupe à pH 5 contenant une grande variété


d'enzyme de dégradation. Phosphatase, RNAse, DNAse, collagénase, cathepsine,
peptidase, glucosidase, polysaccharidase lysozyme, hyaluronidase... tout c'qui y a
de pas bon pour la santé, ce qui est normal puisque le lysosome est supposé
dégrader tout ce qui y est introduit. Ces enzymes fonctionnent préférablement à pH
acide, ce qui veut dire que si un lysosome vient à se briser dans la cellule ils n'iront
pas tout bouffer autour d'eux (le pH du cytoplasme étant plus élevé que le pH de
prédilection des enzymes lysosomaux). Il vaut quand même mieux, quand on purifie
les protéines, s'assurer d'avoir un bon système tampon.

Exemple de l'insuline, activée par dégradation protéolytique à partir d'un précurseur:

Préproinsuline avec peptide signal


|
Vésicules de sécrétion des cellules B des ilôts de Langherans
(coupure du peptide signal) (1)
|
proinsuline
|
Activation par un signal cellulaire
|
Coupure du peptide C (2)
|
Insuline active, maturation du peptide C.(3)

Les chaînes A et B sont reliées par des ponts disulfures dans l'insuline mature.

Le rôle métabolique du peptide C n'est pas encore clair, mais il est sécrété en
quantité équimolaire à l'insuline.(Il peut être utilisé pour quantifier la production
d'insuline).

96
3.7 Le collagène, protéine très modifiée

Consultation suggérée: Darnell, Lodish & Baltimore: Molecular Cell Biology (2nd ed).
Scientific American Books, New York, 1990, pp. 906-915.

Le collagène est une protéine fibreuse insoluble de la matrice extracellulaire et du


tissu conjonctif. C'est la protéine la plus abondante du règne animal. Sa famille
compte jusqu'à présent 23 types de collagènes, assemblés à partir de 38 chaînes a
génétiquement distinctes. (Voir le site suivant pour un exposé récent sur les
différents types de collagène).

Le collagène de type I, qui nous intéresse aujourd'hui, se retrouve dans la plupart


des tissus conjonctifs; il est abondant dans le derme, les os, les tendons, les
ligaments et la cornée.

3.7.1 Structure primaire du collagène

La structure primaire, ou séquence en acides aminés, du collagène est caractérisée


par une très grande abondance en glycine et en proline, des acides aminés qu'on ne
retrouve presque jamais dans les hélices a ou les feuillets b. Chaque 3e position
dans la séquence d'une chaîne de collagène est une glycine.

Séquence primaire de la chaîne a1(I) de


collagène, qu'on retrouve dans le collagène de
... Gly-Pro-Met-Gly-Pro-Ser-Gly-Pro-Arg-Gly- type I, du 13e au 66e acide aminé. Notez que la
Leu-Hyp-Gly-Pro-Hyp-Gly-Ala-Hyp-Gly-Pro-Gln-Gly- glycine se retrouve régulièrement tout le long de la
Phe-Gln-Gly-Pro-Hyp-Gly-Glu-Hyp-Gly-Glu-Hyp-Gly- séquence, séparée des ses voisines par deux
Ala-Ser-Gly-Pro-Met-Gly-Pro-Arg-Gly-Pro-Hyp-Gly- acides aminés. Notez aussi la très grande
Pro-Hyp-Gly-Lys-Asn-Gly-Asp-Asp... richesse en proline et la présence
d'hydroxyproline, une proline hydroxylée post-
traductionnellement.

97
La glycine est un petit acide aminé. Sa chaîne latérale ne consiste en effet que d'un atome d'hydrogène. La
proline est un cas spécial: sa chaîne latérale se replie et vient rejoindre son groupement aminé: la chaîne
latérale dépasse alors de l'axe principal de la chaîne polypeptidique comme une anse de tasse. Cette
conformation inhabituelle et rigide rend la proline incapable de participer à l'élaboration d'une hélice a.
L'hydroxyproline est produite après la traduction de l'ARNm du collagène en chaîne polypeptidique: elle résulte
d'une hydroxylation d'un résidu proline par l'enzyme prolyl hydroxylase, avec comme co-facteurs O2, Fe2+, l'α-
cétoglutarate et l'acide ascorbique.

3.7.2- Structure secondaire du collagène

Hélice de collagène. Cette hélice est de pas gauche (elle tourne


en montant dans le sens des aiguilles d'une montre). À chaque
trois acides aminés on tombe sur une glycine; l'hélice est aussi
très riche en proline et en hydroxyproline. Notez qu'au contraire
de ce qui se passe dans une hélice α, on ne retrouve pas de
ponts hydrogènes stabilisants entre les résidus d'une même
hélice de collagène. L'hélice de collagène s'élève de 0,29nm par
résidu et elle compte un peu moins de trois résidus par tour
alors que l'hélice α ne s'élève que de 0,15nm par résidu et
compte 3,6 résidus par tour.

98
3.7.3 Structure quaternaire du collagène

La molécule de collagène est une microfibrille consistant de trois sous-unités: trois


hélices comptant chacune 1050 acides aminés et tournant l'une autour de l'autre en
une super-hélice orientée dans le sens de la main droite. (L'hélice de collagène
individuelle tourne dans le sens de la main gauche, mais les trois hélices tournent
l'une autour de l'autre dans l'autre sens). La forme mature de cette triple hélice
longue de 300nm s'appelle tropocollagène.

La structure en triple hélice du tropocollagène est stabilisée par des ponts


hydrogènes entre les hélices. Elle est très dépendante de la présence
d'hydroxyproline. En l'absence d'hydroxyproline, la triple hélice est très instable à
température de la pièce et ne se forme pratiquement pas à la température du corps.
Puisque l'hydroxylation de la proline, qui a lieu dans le réticulum endoplasmique
pendant la maturation du collagène, dépend de l'acide ascorbique (un cofacteur de
l'enzyme prolyl hydroxylase), une carence en cette vitamine (il s'agit bien sûr de la
vitamine C) conduit à une très mauvaise synthèse de collagène, ce qui conduit à la
fragilité des vaisseaux sanguins, des tendons, et de la peau -les symptômes
caractéristiques du scorbut.

En plus de l'hydroxylation des prolines, on note une hydroxylation de certaines


lysines (donnant des résidus d'hydroxylysine) qui serviront à stabiliser les structures
supermoléculaires des microfibrilles de collagène (voir ci-dessous). Certaines de
ces hydroxylysines sont O-glycosylées alors que le propetide de la partie C-
terminale du procollagène est N-glycosylé. Chacune des trois chaînes, de façon
concomitante à sa traduction, est transférée dans le lumen du réticulum
endoplasmique. À cette étape précoce, elle consiste La région contenant la triple
hélice est flanquée d'un peptide signal et d'un propeptide N-terminal, ainsi que d'un
propeptide C-terminal; ces deux dernières parties aideront la maturation de la
protéine.

99
Une fois dans le réticulum
endoplasmique, le peptide signal est
coupé (étape 1 de la figure ci-dessous).
Ensuite, plusieurs prolines et lysines du
polypeptide sont hydroxylés. Le
propeptide C-terminal est modifié par N-
glycosylation. Certaines hydroxylysines
sont O-glycosylées (étape 2). Les
différentes modifications et la formation
de ponts disulfure entre les propeptides
C-terminaux de trois chaînes permettent
ensuite leur alignement (étape 3). Une
fois sa base bien alignée, la triple hélice
s'enroule alors comme une fermeture
éclair, en direction du N-terminus. (étape
4). Dans l'appareil de Golgi, étape qui suit
le voyage dans le réticulum
endoplasmique, la triple hélice est
flanquée de part et d'autre de régions
non-hélicales qui ont aidé à sa maturation
(étape 5). Le propeptide est alors éjecté
par exocytose dans l'espace
extracellulaire, où des procollagène
peptidases coupent les propeptides N- et
C-terminaux et libèrent une triple hélice
mature de tropocollagène de 1050 a.a. ou
300 nm de longueur (étape 6).

100
Les molécules de tropocollagène s'assemblent côte à côte
mais avec un décallage de 67 nm. Des lysines de la partie N-
terminale d'une molécule sont pontées de façon covalente à
d'autres lysines de la partrie C-terminale d'une voisine par
l'action de la Lysyl oxydase.

Cela permet aux molécules de tropocollagène de s'assembler en une fibrille de 50


nm de diamètre. Ces fibrilles s'aggrègent en une fibrille d'ordre supérieur de 500nm,
qui peuvent à leur tour former une fibre de collagène de 1 à 10 um de diamètre.

101
Tannage:

Le tannage est le processus qui permet de transformer une peau de bête en


matériau imperméable et résistant à la putréfaction. Ce qui est utile dans une telle
peau au point de vue structurel, c'est sa haute teneur en collagène qui la rend très
solide. Pour la rendre utilisable, évidemment, il faut en tout premier lieu la
débarasser de sa graisse à cause de l'odeur déplaisante qu'elle dégagerait en se
dégradant; il faut aussi empêcher aussi vite que possible l'action des bactéries qui
auraient tôt fait de changer la peau en vulgaire charogne.

Le dégraissage est exécuté mécaniquement, par grattage des couches adipeuses


situées sous la peau. La peau est aussi salée dans un premier temps. Elle est
ensuite incubée dans une substance caustique pour l'épiler. La peau est par la suite
neutralisée par trempage dans un acide (des conditions basiques, en ionisant les
groupements hydroxyls, empêcheraient la suite du procédé) et est rendue
imperméable et résistante à la putréfaction par une incubation subséquente dans
une substance appelée tannin. (De nos jours, plutôt qu'un tannin, on utilise plutôt un
sel comme le sulfate de chrome).

Traditionnellement, les tannins sont des polyphénols extraits de source végétale


(l'écorce du chêne, de l'acacia, du bouleau, du saule, sont toutes des sources de
tannins). La figure ci-bas montre la structure d'un tel tannin. Vous voyez que le nom
de polyphénol n'est pas une exagération. Pendant le trempage, en s'intercalant entre
les fibres de collagène, les très nombreux cycles aromatiques en chassent les
molécules d'eau. Des interactions hydrophobiques entre les cycles aromatiques et
les chaînes de collagène, de même que les ponts hydrogènes formés entre les très
nombreux groupements hydroxyls du polyphénol avec les prolines, permettent de
former un réseau très dense de fibres de collagène qui est à toutes fins utiles
imperméable à l'eau. Puisque ce réseau protéique est pratiquement dépourvu d'eau,
la putréfaction bactérienne ne peut y avoir lieu. Le tannage doit se faire avec une
concentration pas trop élevée de tannin pour éviter que les surfaces externes du cuir
ne se "ferment" trop vite, empêchant le traitement d'atteindre les couches plus
profondes du cuir -qui ne serait alors pas tanné et risquerait, lui, de se dégrader
avec le temps.

102
4.0 Les enzymes
Les enzymes sont des catalystes biologiques qui permettent d'augmenter la vitesse d'une
réaction chimique jusqu'à plusieurs milliards de fois. Ce sont principalement des protéines,
quoique les travaux des Drs Thomas Cech et Sydney Altman, justement récompensés par le
prix Nobel de chimie en 1989, nous ait permis de découvrir que certains ARNs ont aussi une
activité catalytique.

Les enzymes sont généralement beaucoup plus grosses que les molécules sur lesquelles elles
agissent et qu'on appelle "substrat". Leur activité peut être modulée, et c'est principalement
sur la compréhension de la façon dont l'activité enzymatique est régulée dans la cellule que
repose l'essentiel de la recherche en biologie cellulaire et moléculaire.

Il existe plusieurs ressources sur les enzymes. Voici quelques lectures recommandées sur le
sujet:

(1) Lehninger, A.L. Principles of Biochemistry, Worth Publishers Inc., New York, 1982
(chapitre 9).

(2) Le site du Dr Michael King, très bien fait, très recherché, et surtout assez concis
pour être informatif sans nous perdre en cours de route.

(3) Deux pages du site du Dr John Kimball, sur les enzymes en général et sur la
cinétique en particulier. Le Dr Kimball a la réputation d'être l'un des professeurs de
biologie les plus appréciés de ses étudiants aux États-unis. Son site est très
informatif.

Quand à nous, nous pouvons parcourir les pages suivantes (elles s'ouvriront
chacune dans une nouvelle fenêtre):

4.2 Nomenclature

Étant déjà familiers avec plusieurs enzymes, vous aurez remarqué que le nom de la
plupart d'entre eux se termine par le suffixe "-ase" et que le reste du nom nous
donne une idée générale de ce que fait cete enzyme -et c'est très bien ainsi. De
cette manière, nous avons une assez bonne idée de ce que va faire une DNA
polymérase même si nous n'avons jamais travaillé avec ou même lu quoi que ce soit
à son sujet.

Des noms comme polymérase, phosphatase, kinase etc. sont cependant des noms
familiers, ou usuels, et non des noms systématiques. La nomenclature officielle des
enzymes, elle, a été établie par la Commission des Enzymes (EC), un organisme
tributaire de l'union Internationale de Biochimie et de Biochimie Moléculaire
(IUBMB). Cette nomenclature officielle nous permet d'avoir une référence unique à
l'échelle mondiale pour la désignation des enzymes. L'histoire du développement de
cette nomenclature est en elle-même une épopée que vous pouvez lire sur le site de
l'IUBMB.

103
Là où la nomenclature officielle diffère sensiblement de la nomenclature usuelle,
c'est qu'elle désigne les enzymes en fonction des réactions qu'ils catalysent et non
en fonction de la molécule qui possède l'activité enzymatique. Ainsi, les ARN
polymérases I, II et III, que nous distinguons en biologie parce que ce sont trois
complexes moléculaires différents qui sont responsables, respectivement, de la
transcription de l'ADN en ARN ribosomique (I), en ARN messager (II) ou en ARN de
transfert, ARN ribosomique 5S et autres petits ARNs (III). Pour la Commission des
Enzymes, ces trois entités ne sont qu'une seule et même activité enzymatique,
responsable du transfert de nucléotides triphosphates sur une chaîne de
nucléotides:

EC 2.7.7.6

Common name: DNA-directed RNA polymerase

Reaction: nucleoside triphosphate + RNAn = diphosphate + RNAn+1

Other name(s): RNA polymerase; RNA nucleotidyltransferase (DNA-directed); RNA


polymerase I; RNA polymerase II; RNA polymerase III; RNA nucleotidyltransferase
(DNA-directed); C RNA formation factors; deoxyribonucleic acid-dependent
ribonucleic acid polymerase; DNA-dependent ribonucleate nucleotidyltransferase;
DNA-dependent RNA nucleotidyltransferase; DNA-dependent RNA polymerase;
ribonucleate nucleotidyltransferase; ribonucleate polymerase; C ribonucleic acid
formation factors;ribonucleic acid nucleotidyltransferase; ribonucleic acid
polymerase; ribonucleic acid transcriptase; ribonucleic polymerase; ribonucleic
transcriptase; C RNA formation factors; RNA nucleotidyltransferase; RNA
transcriptase; transcriptase

Systematic name: nucleoside-triphosphate:RNA nucleotidyltransferase (DNA-


directed)

Comments: Catalyses DNA-template-directed extension of the 3'- end of an RNA


strand by one nucleotide at a time. Can initiate a chain de novo. In eukaryotes, three
forms of the enzyme have been distinguished on the basis of sensitivity to a-
amanitin, and the type of RNA synthesized. See also EC 2.7.7.19 (polynucleotide
adenyltransferase) and EC 2.7.7.48 (RNA-directed RNA polymerase).

Le code qui permet de désigner un enzyme de façon systématique a la forme

EC (chiffre de 1 à 6) . (chiffre). (chiffre). (chiffre)

"EC" désigne la commission des enzymes. Le premier chiffre classe l'enzyme dans
l'une des six classes d'enzymes:

1: Les oxydoréductases, qui catalysent des transferts d'électrons;

2: Les transférases, qui catalysent les transferts de groupements;

3: Les hydrolases, qui catalysent des réactions d'hydrolyse;

104
4: Les lyases, qui catalysent l'addition de groupes à des liens doubles ou l'inverse;

5: Les isomérases, qui catalysent le transfert de groupes dans une même molécule
pour produire des formes isomères (la conversion d'un acide aminé L en acide
aminé D' par exemple);

6: Les ligases, qui forment des liens C-C, C-S, C-O et C-N lors de réactions de
condensation couplées à l'utilisation d'ATP.

Les autres chiffres désignent des sous-classes pour chaque enzyme; ils permettent
de savoir que telle transférase ajoute un groupement hydroxyl à une molécule de
glucose, par exemple.

En toute honnëteté, on n'utilise pas très souvent le noms systématique d'un enzyme
en biologie. Il est quand même bon de savoir que cette référence existe.

4.3 Utilisation des enzymes à travers l'histoire

Nous avons utilisé le pouvoir de catalyse des enzymes pour favoriser notre mieux-
être depuis les temps les plus reculés, même si c'était parfois à notre insu. Dans
l'industrie alimentaire, par exemple, il n'est probablement pas possible de savoir
quand exactement nous avons commencé à utiliser les enzymes glycolytiques des
levures de type Saccharomyces pour faire fermenter la bière et faire lever le pain.
Les Sumériens brassaient déjà de la bière et comme ils ont inventé l'écriture, il est
difficile de chercher plus avant.

Quelques organismes parmi les très nombreux dont les enzymes nous facilitent la
vie:

Organisme Enzymes utiles Utilisation


Hordeum sp. (orge) α-amylase Dégradation de l'amidon

β-amylase permettant aux levures de

endo-1,3-β-D-glucanase faire fermenter la bière.

Saccharomyces cerevisiae oligosaccharidases diverses Fermentation (bière, pain)

enzymes glycolytiques

Saccharomyces oligosaccharidases diverses Fermentation à basse température


(bière)
carlsbergensis enzymes glycolytiques

Streptococcus lactis enzymes lipolytiques Dégradation partielle des lipides (yaourt,


fromage)
Streptococcus cremoris

Penicillium roqueforti

105
Même si les enzymes étaient utilisés depuis l'âge de bronze au moins, leur étude n'a
commencé à se faire qu'assez récemment.

Une réjouissante description des querelles sévissant au XIXe siècle au sujet des
enzymes se trouve sur ce site: http://bip.cnrs-mrs.fr/bip10/buchner4.htm ; nous nous
limiterons ici à quelques considérations historiques.

Le mot "enzyme" a été inventé n 1876 par le professeur Willy Kühne de l'université
de Heidelberg (à qui nous devons aussi les noms de la myosine et de la trypsine).
Le mot vient vient du grec "en zume", et signifie, de façon assez appropriée, "dans la
levure". Et si vous avez la chance de goûter à la bière de Heidelberg, vous trouverez
pertinent l'intérêt de ce chercheur pour la fermentation alcoolique!

Le mot enzyme cherchait à donner à ces mystérieux catalystes biologiques qu'on savait se
trouver dans les microorganismes une connotation chimique. En effet, suite aux travaux de
Louis Pasteur sur la fermentation alcoolique, l'opinion généralement partagée était que cette
fermentation est un processus inséparable des organismes vivants. Des chercheurs comme
Berthelot et Kühne suspectaient bien que ce que Pasteur appelait "ferments" devaient être un
genre de composé qu'on pouvait extraire des microorganismes -seulement, à cette époque, les
techniques d'extraction cellulaire étaient encore à découvrir et les tentatives faites jusque là
n'avaient livré aucun ferment actif.

C'est finalement le scientifique allemand Eduard Buchner qui put produire un extrait
cellulaire aux propriétés enzymatiques indéniables. Sa zymase, un enzyme qui permettait
la fermentation du sucre en alcool en l'absence de levures vivantes, lui valut le prix Nobel
de chimie en 1907.

La première activité enzymatique à être suffisamment purifiée pour être cristallisée


fut celle de l'uréase, par James Sumner en 1926. Sumner ayant établi que ses
cristaux d'uréase consistaient de protéines, il en conclut que les enzymes étaient des
protéines -une opinion contestée pendant quelques années par d'autres éminents
chercheurs, jusqu'à la démonstration de la nature également protéique de la trypsine
et de la chymotrypsine.

4.4 Apoenzyme, coenzyme, holoenzyme, etc.

Les enzymes protéiques ne sont pas toujours homogènement composés d'acides


aminés. Certains (en fait, beaucoup!) recquièrent aussi des composantes chimiques
supplémentaires appelées cofacteurs.

Un cofacteur peut être inorganique, tels que le sont les ions Fe 2+, Mn2+, Zn2+ ou
Mg2+, des cofacteurs fréquents. Il peut aussi être de nature organique, comme la
biotine ou le coenzyme A. La plupart des vitamines sont des cofacteurs
enzymatiques. Quand un cofacteur est une molécule organique complexe, il porte le
nom de coenzyme. La partie protéique de l'enzyme, elle, s'appelle apoenzyme et
l'union de l'apoenzyme et de son coenzyme (ou de son cofacteur) est un
holoenzyme.
106
Le cofacteur, qu'il soit petit comme un ion ou complexe comme un coenzyme, peut
être attaché de façon transitoire à l'apoenzyme ou encore y être fixé de façon
covalente; c'est alors un groupement prosthétique.

Finalement, un enzyme qui est synthétisé sous une forme inactive qui demande à
être activée par protéolyse partielle est un zymogène.

4.4 Réactions chimiques et catalyseurs

L'énergie individuelle des molécules dans une population varie beaucoup de part et
d'autre d'une valeur moyenne. L'énergie d'une molécule particulière pourrait être
suffisamment élevée pour lui faire passer le niveau d'une barrière d'énergie
d'activation qui sépare cette molécule d'un autre état plus stable:

Le niveau d'énergie final est plus bas que le niveau


initial; la réaction a donc fort peu de chances de se
faire en sens inverse. Cependant, elle ne sera pas
non plus systématiquement spontanée parce
qu'entre le niveau d'énergie initial et le niveau
d'énergie final (plus bas) il y a un niveau d'énergie
de transition (l'énergie d'activation) qui est plus
haut que les deux.

L'état dans lequel une molécule se trouve quand elle est au sommet de la colline
(c'est à dire avec assez d'énergie pour changer d'état) et dit "état de transition",
parce que la molécule pourrait soit franchir la barrière, soit revenir à son état
antérieur. une fois la barrière franchie, le retour est extrêmement défavorisé.

Voici un exemple: un ballon au sommet d'une pente va rouler vers le bas sans
nécéssiter d'aide, parce que son niveau d'énergie potentielle en haut de la pente est
plus élevée qu'en bas. À moins qu'on lui fournisse activement de l'énergie, une
réaction va toujours du niveau d'énergie le plus élevé au niveau le plus bas.
L'énergie d'activation dans cet exemple pourrait être représentée par un caillou qui
tiendrait le ballon en place: ce dernier a besoin d'un léger coup de pied pour franchir
cette barrière. Après la réaction se déroule spontanément.

Dans le graphique ci-haut, le niveau d'énergie initial pourrait être celui de


l'hydsrogène et de l'oxygène gazeux (H2 et O2). Ces deux gaz coexistent sans
problème à cause de la barrière d'énergie d'activation qui les empêche de se
convertir spontanément en une molécule d'eau. il suffit cependant de l'énergie d'une
étincelle pour atteindre et franchir cette barrière, et la formation de l'eau est alors si
rapide et exothermique qu'elle est utilisée pour mettre la navette spatiale en orbite.

107
Il existe deux façons
de permettre une
réaction qui fait face à
une barrière
énergétique
d'activation: fournir de
l'énergie (en
chauffant, par
exemple) ou en
utilisant un facilitateur
chimique, un
catalyseur. Avec un
catalyseur, le niveau
d'énergie d'activation
d'une réaction est
abaissé: celle-ci a
donc moins besoin
d'un apport externe
d'énergie pour se
dérouler.

Un catalyseur peut ainsi accélérer une réaction d'un facteur de plusieurs millions de
fois.

Les enzymes sont des catalystes biologiques. Ils augmentent la vitesse de réactions
chimiques en en abaissant le niveau d'énergie d'activation; eux-mêmes ne sont pas
affectés par la réaction proprement dite.

Enzyme + Substrat -------> Enzyme + Produit

4.6 Structure et fonction

Un enzyme est beaucoup plus volumineux que son substrat. Il semble qu'on ait
besoin d'une architecture fort complexe pour permettre à quelques acides aminés de
se trouver juste dans la position qu'il faut pour servir de catalyseur à une réaction. La
structure de l'enzyme sera donc déterminante pour sa fonction.

Plusieurs facteurs entreront en ligne de compte pour le bon fonctionnement d'un


enzyme. Comme la rencontre entre l'enzyme et son substrat dépend du mouvement
moléculaire, l'activité d'un enzyme croîtra avec la température (puisque la
température est le reflet du mouvement moléculaire). Cependant, cela ne sera plus
vrai quand la température sera assez haute pour affecter la structure tertiaire de
l'enzyme: il pourrait alors perdre rapidement son activité. Un enzyme dénaturé (c'est
à dire qui a perdu sa structure tertaire) ne peut pas fonctionner.

Le pH aura le même effet. L'état d'ionisation des différents acides aminés d'une
protéine aura une grande influence sur sa structure, et indépendamment de la
structure on doit aussi considérer l'état d'ionisation des acides aminés du site actif.

108
Les enzymes auront par conséquent des pH optimaux différents, selon leur structure
et la nature de leur site actif. La pepsine a un pH optimal de 1,5, approprié pour un
enzyme gastrique; la trypsine intestinale a plutôt un pH optimal de 7,7).

La forme du site actif de l'enzyme va lui permettre de reconnaître un substrat


particulier: le substrat est la clef dont le site actif est la serrure. Certains enzymes
sont extrêmement spécifiques et ne fonctionneront que sur un seul et unique
substrat; d'autres ont un large spectre et fonctionnent sur une structure partagée par
de nombreuses molécules qui peuvent toutes lui servir de substrat. Le site actif
consiste d'au moins deux parties fonctionnelles, qui peuvent ou non être voisines sur
la chaînes polypeptidique (si non, la structure tertiare les amène près l'une de
l'autre). Ce sont le site de reconnaissance du substrat et le site catalytique. Le
premier permet à l'enzyme de reconnaître son substrat; le second de lui faire subir
son traitement catalytique. La liaison du substrat implique souvent de nombreuses
liaisons non-covalentes de type hydrophobique, des ponts hydrogènes, ou des
interactions de van der Waals.

On retrouvera souvent une activité enzymatique associée à un domaine d'une


protéine, et ce domaine peut parfois être transporté par ingénierie génétique sur une
autre protéine. La nature a probablement favorisé la conservation de tels domaines
au cours des nombreuses recombinaisons de gènes qui ont accompagné notre
évolution.

De même, il n'est pas rare qu'une même protéine ait plusieurs activités enzymatique.
Le facteur de transcription basal TFIID contient une polypeptide, TAFII250, qui
combine des activités kinase, acétylase et ubiquitinyl-transférase.

4.6.1 Un exemple: la chymotrypsine.

La chymotrypsine, comme sa comparse la trypsine, est synthétisée dans le


pancréas et sécrété dans l'intestin grêle sous forme d'un zymogène, la
chymotrypsinogène. Sa forme active est une protéase à très large spectre: elle
coupe le lien peptidique qui suit les acides aminés dotés d'une grosse chaîne
latérale hydrophobique comme Trp, Tyr, ou Phe; elle peut aussi, plus faiblement,
faire de même après Leu, Ile et la méthionine (avec une affinité décroissante dans
l'ordre cité) et peut aussi agir avec une très faible affinité après une Histidine.

Le délai dans l'activation de la chymotrypsinogène protège le pancréas de la


protéolyse par la chymotrypsine. L'activation se produit quand deux dipeptides sont
retirés au chymotrypsinogène: Ser14-Arg15 et Thr147-Asn148.

109
Le mécanisme réactionnel de la chymotrypsine a été partiellement déduit à partir de
sa structure. L'enzyme compte trois chaînes polypeptidiques (A, B et, sans surprise,
C) reliées entre elles par des ponts disulfures ainsi que vu dans la figure ci-haut. Le
site d'attache du substrat dans la chymotrypsine consiste en une région ressemblant
à une crevasse bordée d'acides aminés hydrophobiques. La conformation de cette
crevasse permet à ces acides aminés hydrophobes d'interagir avec les chaînes
latérales hydrophobiques de W, F et Y présentes dans les substrats. Les petites
chaînes latérales hydrophobiques (comme celle de la valine ou de l'alanine), de
même que les chaînes latérales hydrophiles (toutes celles qui sont polaires) ne
permettent pas les liaisons non-covalentes nécessaires à la liaison au site actif de
l'enzyme.

Les protéines globulaires protègent la plupart de leurs résidus hydrophobiques à


l'intérieur de leur structure; la chymotrypsine aurait donc du mal à aider à la digestion
des aliments si ceux-ci ne transitaient pas d'abord dans l'estomac. Là, le pH très
acide (entre 1 et 2) dénature la plus grande part des protéines, exposant leurs
"entrailles", si l'on peut dire... entrailles qui sont partiellement dégradées par la
pepsine et les autres enzymes gastriques. Ce sont donc des protéines déjà
partiellement dégradées qui arrivent dans l'intestin pour être la cible de la
chymotrypsine.

110
Mécanisme du site actif de la chymotrypsine. Le substrat, une chaîne polypeptidique
avec une chaîne latérale hydrophobique comme W, F ou Y, est logé dans le site de
reconnaissance de telle façon que le lien à être hydrolysé se retrouve près de la
sérine 195. La chymotrypsine est une sérine protéase en raison du rôle que joue cet
acide aminé dans son activité; le terme sérine protéase ne désigne pas une
protéase coupant les sérines! Un transfert d'électrons initié sur l'aspartate 102,
induisant l'histidine 57 à voler un hydrogène à la sérine active.

Le O - qui reste à la sérine attaque le carbone du substrat, formant un lien covalent


temporaire. L'hydrogène volé à la sérine, maintenant sur l'histidine, est attiré par le
doublet électronique libre de l'azote du substrat (deuxième figure).

Cet azote vole à son tour l'hydrogène (en italique), ce qui brise le lien C-N du
substrat et libère une moitié de la chaîne en train d'être digérée. Une molécule d'eau
entre alors en jeu; un pont hydrogène avec l'histidine la met en présence du reste du
substrat (troisième figure). La molécule d'eau réagit avec le substrat après que
l'histidine lui eut elle aussi volé un hydrogène (figure quatre); le lien entre la sérine et
le substrat est conséquemment hydrolysé et l'enzyme retrouve sa forme initiale. Le
reste du substrat est libéré (figure cinq).
111
4.7 Cinétique enzymatique

En présence d'une certaine quantité de substrat, un enzyme va donc catalyser une


réaction chimique pour donner un produit. La mesure de son efficacité est donnée
par sa vitesse de réaction dans les conditions initiales de la réaction. Cette vitesse
de réaction est dite "vitesse initiale" et est notée Vo.

Plus il y a de substrat, et plus


l'enzyme pourra travailler vite:
avec suffisamment de substrat, il
devrait éventuellement atteindre
une vitesse maximale (le point où
son site actif est totalement saturé
en substrat). Une telle vitesse est
cependant une vue de l'esprit: un
enzyme tend vers sa vitesse
maximale en proportion directe à
la quantité de substrat mais il ne
l'atteind jamais. Le graphique ci-
dessous montre qu'alors que
l'enzyme travaille de plus en plus
vite avec de faibles augmentations
initiales de substrat, il parvient
rapidement à un point où son
rendement est tel qu'il faut
énormément plus de substrat pour
lui faire gagner juste un peu de
vitesse supplémentaire.

Il y a donc une relation entre la concentration de substrat et la vitesse de réaction


d'un enzyme. Cette relation est exprimée sous forme mathématique par l'équation
de Michaelis-Menten:

Vo = VMax [S] / ( KM + [S] )

où Vo est la vitesse initiale, VMax la vitesse maximale, [S] la concentration en


substrat et KM une constante propre à une réaction dans des conditions données, et
qui est la concentration de substrat nécessaire pour que l'enzyme atteigne (1/2) V Max
(voir graphique ci-haut).

La réciproque de la réaction de Michaelis-Menten est également très utile:

1 / Vo = ( KM + [S] ) / ( VMax [S] )

qu'on peut aussi écrire

1 / Vo = Km / (VMax [S]) + [S] / (VMax [S])

et qui se simplifie en

112
1 / Vo = Km / (VMax[S]) + (1 / VMax)

qu'on appelle aussi équation de Lineweaver-Burke.

L'avantage de cette
transformation
mathématique est qu'elle
permet de tracer un
graphique 1/Vo vs 1/[S]
dont la courbe est en fait
une droite pour les
enzymes obéissant à la
relation michaélienne
entre vitesse de réaction et
concentration du substrat.

À une concentration de
substrat infinie, à laquelle
la vitesse de notre enzyme
serait vraiment maximale,
la valeur de 1 / [S] sera de
0. Ce graphique nous
permet donc de trouver
facilement la valeur de 1 /
Vmax, qui correspond à 1
/ Vo quand l'axe des x est
à zéro.

Plusieurs enzymes catalysent des réactions à plus d'un substrat. L'hexokinase, par
exemple, a l'ATP et le glucose comme substrats et l'ADP et le glucose-6-phosphate
comme produits. Pour un tel enzyme à deux substrats, on observera un
comportement dit de déplacement simple ou de déplacement double.

113
Le cas de l'hexokinase serait un déplacement double, car seul un groupement
phosphate a changé de place.

4.8 Changements de conformation

Le modèle clef et serrure du substrat et de l'enzyme doit être pris avec un peu de
souplesse: en effet, certaines de ces clefs ont la capacité de changer la forme de la
serrure. L'hexokinas est un tel cas. Une fois que son site de reconnaissance a
permis au glucose de se fixer au site actif, l'enzyme subit une profonde modification
de conformation qui permet aux différentes composantes du site actif de trouver leur
position appropriée dans l'espace pour catalyser le transfert d'un groupement
phosphate sur le glucose. D'autre molécules peuvent entrer dans le site de
reconnaissance (le ribose, le glycérol, par exemple) mais comme ils n'induisent pas
un tel changement de conformation, ils ne sont pas de vrai substrats pour
l'hexokinase.

Des changements de conformation peuvent être à l'origine d'une forme de régulation


pour les enzymes. Prenons un enzyme possédant deux sites actifs, l'un ayant une
plus forte affinité que le second pour le substrat. Après la capture d'une première
molécule de substrat, le changement de conformation de l'enzyme pourrait faire en
sorte que l'affinité du second site soit augmentée: il y aurait alors coopération entre
les deux sites actifs. À l'inverse, il peut arriver que le second site ait une faible
activité enzymatique et cause un changement de conformation nuisant au premier
site; dans le cas où le substrat serait assez abondant pour que le site de faible
affinité et de faible activité soit bien fourni en matériel, on assisterait à une baisse de
l'activité globale de l'enzyme (c'est ce qu'on appelle une inhibition par le substrat).

Nous verrons plus loin comment les enzymes allostériques sont régulés par un
changement de conformation.

4.9 Régulation de l'activité enzymatique

Pratiquement toutes les réactions chimiques dignes de mention dans la cellule sont
catalysées par des enzymes. La cellule a donc besoin d'un système fiable de
régulation pour gérer toute cette activité bourdonnante. Imaginez seulement une
cellule dont tous les enzymes seraient en action en même temps. Ce serait comme
une grande ville dont tous les feux de circulation seraient au vert.

Le systèmes de régulation sont nombreux; on pourrait les classer de différentes


façons selon leur rôle, leur importance ou leur pertinence en biologie moléculaire.
Nous allons faire un survol des aspects qui suivent, certains pouvant se recouper:
(1) inhibition ou activation par des macromolécules; (2) disponibilité de cofacteurs;
(3) rétroaction et allostérie; (4) inhibitioncompétitive, non-compétitive, et par le
substrat; (5) modifications covalentes.

4.9.1 Régulation par des macromolécules

Il existe de nombreuses protéines dont le rôle est d'inhiber l'action de certains


enzymes. Ces inhibiteurs peuvent agir sur l'activité enzymatique proprement dite, ou
114
dissimuler son site actif, ou séquestrer l'enzyme dans une partie de la cellule où il ne
peut pas tenir son rôle,. À l'inverse, certaines interactions avec d'autres protéines
vont permettre aux enzymes de se trouver là où leur activité peut avoir un rôle à
jouer dans la régulation du métabolisme; qu'on pense seulement aux nombreux co-
activateurs de la transcription qui possèdent une fonction acétyltransférase; ils n'ont
pas beaucoup d'utilité tant qu'ils n'ont pas été recrutés au niveau de promoteurs de
gènes particuliers.

4.9.2 Disponibilité de cofacteurs

Qu'il s'agisse de coenzymes, de groupements prosthétiques ou de simples ions, les


cofacteurs sont nécessaires à tous les apoenzymes. La cellule a beaucoup recours
à l'échange de cofacteurs, permettant d'activer ou d'inactiver rapidement un enzyme
selon le cofacteur auquel il se lie.

La présence d' ions métalliques comme le Zn2+, le Fe2+, le Mn2+, le Mg2+ est aussi
très souvent primordiale pour la fonction enzymatique. C'est pourquoi les cellules ont
des sytèmes permettant à ces métaux de pénétrer le cytoplasme, malgré le risque
qu'il peuvent aussi lui faire courir (la plupart des métaux lourds sont rapidement
mortels pour une cellule),

En purification protéique, l'une des plus élémentaires mesures de précaution pour


protéger nos protéines des protéases est d'ajouter une certaine quantité de
comnposé chélateur (EDTA, EGTA) aux tampons pour priver les protéases de leurs
cofacteurs métalliques.

4.9.3 Rétroaction et allostérie

La rétroaction est l'action qu'a le produit d'une réaction sur cette dernière.

S'il s'agit d'une inhibition, nous parlons d'une rétroaction négative. Par exemple, la
conversion de la thréonine en isoleucine est le fruit de l'activité de cinq enzymes en
séquence, le premier étant la thréonine déhydratase. Le produit de cette conversion,
l'isoleucine, est un inhibiteur de cet enzyme; ainsi, quand la réaction a donné le
résultat attendu, la production d'isoleucine est arrêtée (n'utilisant pas plus de
thréonine que nécessaire).

Le cas de la thréonine déhydratse est un bel exemple de régulation allostérique. Un


enzyme allostérique contient plus d'un site: en plus de son site actif, il a un site
régulateur (le nom allostérique vient d'ailleurs du grec allos (autre) et stereos
(espace ou site). La molécule qui vient se fixer au site régulateur est appelé
effecteur ou modulateur. Tout comme le site catalytique de l'enzyme est spécifique
pour son substrat, le site allostérique est spécifique pour son modulateur.

On peut bien entendu observer un effet allostérique positif. Le modulateur dans un


tel cas va favoriser l'activité de l'enzyme au lieu de lui nuire. C'est ce qu'on
observerait dans une boucle de rétroaction positive dans laquelle le produit d'une
cascade enzymatique irait stimuler un ou plusieurs enzymes y étant impliqués.

115
Un enzyme allostérique qui est modulé par son propre substrat est dit
homotrophique; s'il est modulé par une autre substance il est dit hétérotrophique.

Les enzymes allostériques dévient de la règle michaélienne de comportement face


au substrat. Un enzyme allostérique homotrophique stimulé par la présence de son
propre substrat, au lieu d'avoir une relation hyperbolique comme celle de la figure ci-
dessous,

donnera plutôt une courbe de type sigmoïde.

Cela s'explique par le fait qu'une très faible augmentation du substrat, dans la partie
à pic de la courbe, résulte en une grande stimulation de l'enzyme.

116
Parce que cette courbe n'obéit pas à la cinétique michaélienne, on ne peut pas
définir de KM en fonction de 1/2 Vmax. On note quand même une concentration de
substrat équivalent à 1/2Vmax, valeur qu'on désigne par K0,5.

Une telle courbe est aussi typique de la dynamique de capture de l'oxygène par
l'hémoglobine: le premier oxygène est le plus difficile à attraper, parce que sa liaison
induit un changement conformationnel qui facilite la capture des trois suivants. Ainsi
qu'on pourrait s'y attendre, la myoglobine (qui comme l'hémoglobine capture de
l'oxygène, mais n'a qu'une seule sous-unité globine au lieu de quatre) donne, elle,
une courbe hyperbolique plutôt que sigmoïde.

4.9.4 inhibition comnpétitive, non-compétitive, et par le substrat

La forme la plus extrême de l'inhibition de l'activité d'un enzyme par une autre
substance (à part, peut-être, la destruction de l'enzyme!) est l'inhibition irréversible.
Cette inhibition, le plus souvent causée par la formation d'un lien covalent entre
l'enzyme et l'inhibiteur, cause la perte définitive de l'activité enzymatique de
l'enzyme.

L'insecticide malathion, par exemple, est un inhibiteur irréversible de


l'acétylcholinestérase des insectes. Il se lie de façon covalente au groupement
hydroxyl de la sérine du site actif de l'enzyme, l'inactivant pour de bon. Le PMSF, un
agent fréquemment utilisé dans la préparation des protéines, inhibe les sérine et
cystéine protéase en sulfonylant leur site actif. Lui aussi est irréversible.

Un inhibiteur réversible, comme vous le devinez, permet à l'enzyme de retrouver son


état normal quand l'inhibiteur est retiré. Un tel inhibiteur peut être compétitif, c'est à
dire qu'il compétitionne avec le substrat pour le site actif, qu'il occupe de façon à
perturber la réaction, ou non-compétitif, c'est àa dire qu'il agit à un autre niveau. Un
inhibiteur non-compétitif pourrait se lier à l'enzyme sur un autre site et interférer
d'une manière ou d'une autre avec son activité, ou il pourrait avoir une action
secondaire telle que la chélation d'un cofacteur essentiel à l'enzyme (ce que fait
l'EDTA, un inhibiteur de protéase également fréquent).

Pour un enzyme de type michaélien, la différence entre une inhibition compétitive et


non-compétitive se voit bien avec le graphique de Lineweaver-Burke:

117
Dans le cas d'une inhibition compétitive, le problème est que le site de l'enzyme est
souvent occupé par un obstacle. La vitesse maximale de l'enzyme n'est cependant
pas affectée, puisque l'enzyme, lui, fonctionne très bien: c'est l'accessibilité du
substrat qui est mise en cause. À une concentration suffisemment élevée de
substrat, la concentration de compétiteur deviendrait négligeable et la vitesse
maximale serait atteinte. Cependant, plus il y a d'inhibiteur, plus il faut de substrat
pour compenser; par conséquent, la concentration de substrat pour atteindre la
moitié de la vitesse maximale est aussi plus élevée et le KM augmente avec la
concentration d'inhibiteur.

Dans le cas d'une inhibition non-compétitive, quelque chose empêche l'enzyme de


fonctionner correctement, indépendamment du substrat. La concentration de
substrat requise pour atteindre 1/2 Vmax reste inchangée; c'est juste que le Vmax
de l'enzyme baisse proportionnellement à la concentration d'inhibiteur non-
compétitif.

L'inhibition par le substrat se présente quand il existe deux sites dans un enzyme
pour le même substrat, mais quand l'un des deux sites a une faible activité
catalytique et une faible affinité. La vitesse de l'enzyme devrait croître quand on
augmente la quantité de substrat. Dans le cas qui nous occupe, cependant, il arrive
un moment où la concentration de substrat est telle que même le site de faible
affinité finit par avoir accès au substrat. Comme ce second site n'est pas très
efficace, cependant, il peut nuire à l'action du premier sans lui-même compenser par
sa propre activité. Quoiqu'un modèle intéressant, ce n'est pas un cas très courant.

4.9.5 modifications covalentes

Nous avons vu comment un précurseur inactif peut être activé quand on lui fait subir
une protéolyse limitée (exemple de la chymotrypsine).

D'autres modifications incluent le transfert de groupements chimiques. Il existe des


systèmes de phosphorylation / déphosphorylation, méthylation / déméthylation,
acétylation / déacétylation qui justement activent ou inactivent plusieurs enzymes.

118
5.0 La purification des protéines
Peu importe le type de projet biochimique que nous poursuivons, il est fort probable
qu’à un moment ou à un autre nous aurons besoin d’une protéine sous une forme
raisonnablement pure. (Je dis "raisonnablement", parce qu’une protéine absolument
et totalement pure est probablement une vue de l’esprit. On peut s’estimer déjà très
heureux d’obtenir une protéine assez enrichie pour que tout contaminant puisse y
être tenu comme valeur négligeable).

La purification d’une protéine consiste en sa séparation des autres constituants de la


cellule, ni plus ni moins. Il y a gros à parier que votre protéine de prédilection sera
une entité noyée dans la masse de toutes les composantes cellulaires, un peu
comme dans le jeu "où est Charlie?"

La purification se fera en plusieurs étapes, chaque étape visant à éliminer telle ou


telle classe de contaminant. À chacune de ces étapes, votre protéine sera enrichie
par rapport aux autres substances (même si, en termes absolus, la quantité totale de
votre protéine va probablement baisser à chaque étape).

En bout de course, cependant, vous aurez entre vos mains une protéine
extrêmement enrichie (allez, ne soyons pas modestes et disons-la purifiée) qui vous
permettra de vous livrer à vos expériences, qu’il s’agisse de cinétiques
enzymatiques si c’est l’activité de la protéine qui vous intéresse, ou qu’il s’agisse
d’études structurales si l’architecture moléculaire est votre passion.

Pour être d'une quelconque utilité, notre protéine purifiée devra avoir conservé une
certaine intégrité; il faut donc lui éviter autant que possible les différents
traumatismes qui pourraient l’endommager pendant la purification. Pour une activité
enzymatique, nous voulons surtout préserver la fonction de la protéine, même si sa
structure a un peu pâti; à l’inverse, pour des études structurelles, nous voulons une
structure intacte même si l’activité n’y est plus. L’idéal reste évidemment de tout
préserver! Heureusement, plusieurs précautions peuvent nous aider à atteindre ce
but. Les sections suivantes vous permettrons d'en savoir un peu plus sur les
méthodes utilisées pour purifier les protéines.

5.1 Les différentes étapes d'une purification


5.1.1 Paramètres

Ce sont ses caractéristiques intrinsèques, celles qui rendent une protéine unique, qui vous
permettront de la séparer de ses congénères cellulaires. Une protéine a une masse, une forme,
des structures primaire, secondaire, tertiaire et peut-être quaternaire; elle a une certaine
charge à un pH donné, elle présente une certaine densité; elle possède un certain degré
d’hydrophilicité ou d'hydrophobicité. Elle a peut-être des isoformes suite à un épissage
alternatif. Elle se retrouve peut-être dans une certaine région de la cellule ou dans une
organelle donnée. Elle a peut-être été nantie, par génie génétique, d’un quelconque marqueur
facilitant son identification. Tous ces critères peuvent être utilisés dans votre démarche: votre
stratégie de purification n’est réellement régie que par l’augmentation de vos chances de
succès.

119
L’équipement disponible dans votre laboratoire sera un des facteurs les plus importants dans
le choix de cette stratégie. Supposez que vous ayez à retrouver Carlos Sanchez dans une
foule. Carlos est un Paraguayen de petite taille, avec une moustache et des cheveux noirs; il
porte une cicatrice au genou gauche, il boit son café noir et fume des Gitanes. Votre
instrument de travail est un téléphone et vous devez travailler dans l'obscurité. Il y a gros à
parier que votre stratégie d’identification reposera davantage sur l’accent paraguayen de
Carlos que sur son goût en fait de café. C’est la même chose avec les protéines : si vous
disposez des appareils vous permettant d’utiliser la charge comme moyen de séparation,
allez-y; c’est la même chose avec la taille ou la densité. Ne vous croyez pas obligé d'utiliser
tous les paramètres en même temps.

Paramètre Technique
Taille Filtration sur gel
Solubilité Précipitation séquentielle au
sulfate d'ammonium
Charge Chromatographie d'échange
d'ions
Densité Centrifugation sur gradient;
ultracentrifugation
Hydrophobicité Chromatographie en phase
inverse
Marqueur ajouté Chromatographie d'affinité

5.1.2 Exemple simulé d’une purification protéique

Etape Quantité de votre Proportion de


protéine (unités votre protéine
arbitraires)
matériel brut 4000 1 : 2 000 000
1 1000 1: 500 000
2 500 1: 100 000
3 200 1: 1 000
4 10 1: 100
5 5 1: 2

Le tableau ci-haut simule une purification protéique. Dans le matériel brut (un extrait
cellulaire, par exemple) disons que nous avons 4000 unités arbitraires de notre protéine. Pour
chaque unité de cette protéine, on compte 2 millions d’unités d’autres protéines (en plus de
120
beaucoup de matériel non-protéique). Comme vous le voyez, nous avons affaire à une
aiguille dans une botte de foin (ou dans une très grande boîte d’aiguilles). Une première étape
de purification, qui d’habitude vise à éliminer le matériel non-protéique présent dans l’extrait,
nous fait perdre les trois quarts de notre matériel (oups!) tout en en augmentant la pureté par
un facteur de 4, puisque maintenant pour chaque unité de notre protéine on ne retrouve plus
que 500 000 unités d’autre chose.

La deuxième étape décrite ci-haut nous coûte moins cher en matériel, puisque nous ne
perdons que la moitié du matériel qui nous reste. En plus, elle permet d’augmenter le facteur
de pureté de cinq fois.

Pourquoi ne pas avoir adopté cette seconde étape en premier lieu, demanderez-vous,
puisqu’elle a clairement un meilleur rendement? Les réponses peuvent être multiples. Il se
peut que l’étape 2 ne puisse pas être réalisée avant l’étape 1 à cause de la sensibilité de
l’étape 2 aux contaminants éliminés par l’étape 1; il se peut que l’étape 1 livre l’ échantillon à
une concentration de sels qui permet de pratiquer l’étape 2 tout de suite, alors que
l’échantillon livré par l’étape 2 a besoin d’être dialysé avant d’être propre à passer par l’étape
1... L’expérimentateur doit considérer toutes ces options et faire un choix en conséquence. Un
des critères à respecter pendant une purification est que plus on fait vite, meilleures sont nos
chances d’avoir du bon matériel à la fin. Mieux vaut donc autant que possible limiter les
étapes en nombre et en durée.

L’étape 3 qui suit l’étape 2 a un très bon rendement : pour une perte d’un peu plus de la
moitié du matériel, notre pureté augmente d’un facteur 100!!! À l’inverse, l’étape 4 présente
un rendement pitoyable puisque nous perdons 95% de notre matériel pour un gain de pureté
de 10 fois seulement. Une telle étape serait certainement à reconsidérer dans un exercice réel!

Finalement, l’étape 5, qui nous coûte encore la moitié de notre matériel, nous donne une
protéine presque pure puisqu’elle constitue la moitié du matériel qui nous reste.

5.2 Planification

Chaque heure de planification vous sauvera dix heures d’effort. Avant d’entreprendre quoi
que ce soit, assurez-vous d’abord que tous les appareils soient disponibles, en état de marche,
et pas réservés par quelqu’un d’autre (réservez-les vous-même tout de suite). Soyez sûr que
toutes vos solutions soient préparées et refroidies à 4°C; que votre matériel soit prêt et que
vous ayez mis assez de temps de côté pour vous concentrer à la tâche. Ce sont là des
considérations terre-à-terre à l'extrême, mais vous seriez surpris de constater à quel point
elles peuvent être négligées même par des scientifiques chevronnés. (Un bon truc en passant:
gardez toujours une grande quantité d'eau stérile à 4°C. On ne sait jamais quand on aura à
préparer une solution en catastrophe... et si dissoudre une poudre se fait en un tournemain,
refroidir un litre de solution peut prendre des heures)!

Votre planification doit inclure les étapes suivantes , que nous allons explorer une à une.

1- Essai. Comment allez-vous suivre votre protéine pendant sa purification? Rappelez-vous,


dans la vraie vie une protéine en solution ressemble pas mal à un peu d’eau malodorante dans
un tube. Vous devrez disposer de moyens pour savoir si votre protéine est là ou non à chaque
étape de sa purification.

121
2- Choix de la source de matériel. Source native vs source recombinante; source dispendieuse
mais idéale vs source moins idéale mais peu chère; impératifs scientifiques vs impératifs
pratiques... vous aurez parfois à faire des choix déchirants.

3- Choix d’une technique d’extraction. Elles sont nombreuses, et présentent toutes des
avantages et des inconvénients.

4- Séparation et enrichissement. D’une masse de protéines et de cochonneries cellulaires,


vous devrez extraire la pépite d’or. Les techniques de séparation utilisent différents aspects
physico-chimiques des protéines, telles que leur charge (chromatographie d'échange d'ions),
leur masse (filtration sur gel, gradients de densité) et leur solubilité (précipitation
différentielle au sulfate d'ammonium).

5.3 Essai

Vous aurez compris à la lecture de ce qui précède que la purification est un processus
étapiste. Une purification peut prendre plusieurs jours et nous voulons savoir à chaque étape
où en est notre protéine.

Il est possible de vérifier la présence aussi bien que l'activité d'une protéine, le choix se
faisant selon la nature de la protéine recherchée, la faisabilité du test et l'étape à laquelle nous
en sommes dans la purification. Les premières étapes se contentent généralement de vérifier
la présence de protéines (n'importe lesquelles) par spectroscopie; c'est plus tard pendant la
manoeuvre qu'on commencera à se soucier de vérifier la présence d'une protéine particulière
ou de son activité.

Quoiqu'il en soit, il est impératif de toujours, toujours garder des aliquots de matériel à
chaque étape! De cette manière, on peut retracer après coup le déroulement de la purification,
comprendre quelles en sont les étapes les plus utiles ou les plus dommageables, et améliorer
notre protocole pour l'avenir.

5.3.1 Critères

Sensibilité Parce que la protéine risque d'être très diluée à certaines


étapes, particulièrement les premières.
Spécificité Nous cherchons une aiguille dans une grosse boîte d'aiguilles,
et comme rien ne ressemble plus à l'une d'entre elles que sa
voisine, il vaut mieux que nous sachions vraiment reconnaître
la nôtre.
Disponibilité des réactifs Si votre protéine n'est qu'un des facteurs impliqués dans une
réaction in vitro requérant huit autres protéines purifiées,
mieux vaut déjà avoir ces derniers si vous comptez utiliser un
essai réactionnel. Sinon, optez pour un essai que vous pouvez
vraiment effectuer.
Coût Ce facteur se présente souvent.
Temps requis Plus votre purification est rapide et mieux ce sera. Votre essai

122
devrait donc vous permettre d'obtenir rapidement une idée de
ce qui se passe avec votre purification; si vous pouvez
l'effectuer à chaque étape PENDANT la purification, encore
mieux.

5.3.2 Exemples d'essais

5.3.2.1 Présence de protéines (en général)

(A) Par mesure de l'absorption aux UV.

Ce type d'analyse est très pratique pour suivre la course de protéines sur une série de
colonnes de chromatographie. Tous les systèmes de chromatographie sont équipés d'une
cellule spectrophotométrique pour mesurer l'absorption des rayons UV par le matériel qui
sort des colonnes. C'est cependant une méthode simple dont le type de réponse est "oui, il y a
des protéines" ou "non, il y a eu un os quelque part". On ne peut pas sérieusement s'attendre à
pouvoir faire une relation exacte entre la densité optique d'un mélange protéique en cours de
purification et sa concentration réelle. (On utilise parfois un coefficient d'extinction très
approximatif pour dire qu'une densité optique à 280nm, dans une cuvette de 1 cm, correspond
à 1 mg/mL de protéines...Mais c'est comme de dire que la population de la Terre s'élève à
quelques milliards. C'est une idée générale, rien de plus).

En outre, n'oublions pas que l'ADN et l'ARN absorbent dans le coin de 250-260nm, ce qui
risque de nous causer des soucis de précision! (D'habitude, on a plutôt le problème inverse,
celui des protéines qui contaminent notre ADN. Mais tout finit par nous arriver si on vit assez
longtemps).

On peut utiliser le spectro pour détecter la présence de protéines parce que le tryptophane
(Trp, W) absorbe la lumière UV avec un pic à 280 nm. La tyrosine (Tyr, Y) le peut aussi,
quoiqu'à un degré moindre, et un troisième acide aminé cyclique, la phénylalanine, le peut
aussi très faiblement. Tous les peptides pourraient absorber l'UV aux environs de 190-200nm,
mais la plupart des tampons absorbent aussi massivement dans cette région qui n'est donc pas
très commode pour nous.

Notez que le coefficient d'extinction de chaque protéine variera selon sa richesse en W et Y.


Une protéine dépourvue de ces acides aminés passerait devant la cellule optique comme un
fantôme, à peine percue.

(B) Par Méthodes colorimétriques.

Ces techniques demandent un traitement de l'échantillon à mesurer par une substance


chimique qui, au contact des protéines, produira un changement de couleur que l'on peut
quantifier par spectrophotométrie si on dispose d'une courbe standard fiable.

Comme dans le cas de l'absorbance à 280nm, les méthodes colorimétriques réagissent de


façon inégales aux différentes protéines. pour une analyse brute, une courbe standard faite
avec des quantités connues de BSA convient tout à fait, mais pour des protéines plus pures il

123
vaut mieux s'assurer de disposer d'une courbe standard dont le comportement représente bien
celui de notre protéine.

Exemple de courbe standard: la mesure de


optique (DO) de plusieurs échantillons ave
concentration croissante en protéines donne
fois une DO plus élevée. On peut ainsi trac
droite qui nous permet de déterminer la con
en protéines d'un échantillon inconnu grâce
propre DO.

Toujours avoir plusieurs points sur notre courbe standard: on limite ainsi l'effet de ceux qui
auraient eu une mauvaise réaction. C'est comme avec des fonds mutuels, vraiment.

Voici trois méthodes colorimétriques; la méthode de Bradford est probablement la meilleure


et la plus utilisée aujourd'hui, mais il en existe plusieurs autres.

Méthode du Basée sur la réduction du cuivre Cu2+ en Cu+.


biuret
Cu+ réagit avec le tryptophane (Trp, W), la tyrosine (Tyr, Y) et la cystéine
(Cys, C). Il leur donne une couleur bleue. Le pic d'absorption pour un test
du biuret est à 550nm.

Ce test est peu sensible.

Il résiste assez bien aux différents composés présents dans les tampons
mais est sensible aux sels d'ammonium, ce qui en fait un mauvais choix
pour doser les protéines venant d'être précipitées par ce sel.
Méthode de Basée sur la réaction du biuret, elle utilise aussi la réduction du Cu2+ en
Lowry Cu+. Depuis 1951, la méthode de Lowry est la plus citée de toutes dans la
littérature scientifique.

Dans la méthode de lowry, le Cu+ est utilisé pour réduire le réactif de


Folin (une solutiuon phénolique contenant des composés de tungstène et
de molybdène) qui change sa couleur du jaune au bleu. On lit la réaction à
750 nm.

Plus sensible que la réaction du biuret, la méthode de Lowry est utilisée

124
pour des quantités de 2 — 100 ug.

Elle est sensible à plusieurs agents, dont l'EDTA, le DTT, le -mercapto,


l'Hepes, le Tris, le triton X-100, le NP-40, etc.
Méthode de Le bleu de Coomassie se
Bradford lie à l'arginine (Arg, R),
la tyrosine (Tyr, Y), le
tryptophane (Trp, W),
l'histidine (His, H) et la
phénylalanine (Phe, F)
(surtout à R; huit fois plus
qu'aux autres en fait).

Il est assez insensible aux


agents des tampons, mais
est sensible aux
détergents.

En solution, il a une
forme cationique rouge
qui absorbe à 470nm. Lié
aux protéines, il a une
forme anionique bleue
qui absorbe à 595nm.

Parce que les deux


spectres d'absorption se
chevauchent un peu, une
courbe standard de
Bradford n'est pas
parfaitement linéaire sur
toute sa distance
(quoiqu'en disent les
commerçants!), un point
souligné par Brafdord lui-
même dans son papier
original. Elle l'est quand
même suffisament pour
nos besoins.

La méthode de Bradford
est encore plus sensible
que celle de Lowry (0,2
— 20 ug de protéines).

5.3.2.2 Présence de protéines particulières

125
L'absorption aux UV et les méthodes colorimétriques c'est bien, surtout si on veut juste savoir
par où passent les protéines durant la purification. Il vient cependant un temps où, confiants
de ne pas avoir flushé nos protéines aux égoûts, on veut savoir si parmi elles se trouvent la
protéine qui nous intéresse.

Un critère utile de notre protéine pour la reconnaître parmi les autres est sa taille; un autre tel
critère est sa charge.

5.3.2.2.1 Gel de SDS

Le système le plus utilisé pour l'analyse de la taille des protéines d'un mélange est le gel de
SDS (ou SDS-PAGE, pour sodium docecyl sulfate -polyacrylamide gel electrophoresis).

La séparation électrophorétique d'une protéine, tout comme celle de n'importe quelle


molécule chargée d'ailleurs, est l'effet de son mouvement sur ou dans une matrice appropriée
soumise à un courant électrique. Plus une molécule est massive ou biscornue, plus elle se
déplacera lentement; plus elle sera petite, plus elle ira vite.

Il serait avantageux, comme ce l'est pour l'ADN, de pouvoir séparer les protéines les unes des
autres par une simple séparation électrophorétique ne dépendant que de la taille des
molécules. Mais alors que l'ADN est uniformément chargé et que sa structure est
essentiellement la même quand il est sous forme linéaire, les protéines, elles, varient
énormément non seulement en poids mais aussi en charge et en forme. Pour les séparer selon
leur masse uniquement, il faut contrecarrer l'effet de leur charge et de leur forme.

Ce tour de passe-passe est accompli en mettant 1% de SDS dans le gel d'électrophorèse et


dans le tampon de migration. On utilise aussi 0,1M β-mercaptoethanol (HO-CH2-CH2-SH)
dans le tampon de largage des échantillons, et ceux-ci sont bouillis de surcroît avant la
migration sur gel.

Le sodium dodecyl sulfate (SDS) est un détergent anionique qui dénature les protéines en
enveloppant la chaîne polypeptidique selon un ratio de masse de 1,4 pour 1. Le SDS confère
aux protéines une charge négative proportionnelle à leur longueur; plus elles sont longues,
plus il y a de SDS. Les polypeptides deviennent donc des chapelets de charges négatives
partageant une même densité de charge par unité de longueur.

Le β-mercaptoethanol, lui, (un agent réducteur qui ne sent pas bon), en combinaison avec la
chaleur, brise les ponts disulfures internes des protéines que la chaleur ont dénaturées. Il brise
aussi les éventuels ponts disulfures inter-protéiques.

Les protéines ainsi dépliées et uniformément chargées en fonction de leur masse peuvent dès
lors être séparées par électrophorèse, de la cathode (-) à l'anode (+). Puisqu'elles sont
uniformément chargées par le SDS, leur vitesse de migration sur gel sera proportionnelle à
leur seule masse, les petites protéines étant les plus rapides.

On utilise d'ordinaire un gel discontinu: c'est à dire qu'en haut du gel de séparation
proprement dit, (le "running gel;" en bon franglais) se trouve une bande plus petite
d'acrylamide de composition différente, le gel de concentration ou stacking gel.

126
Alors que le gel de séparation a des pores petits et un pH de
9, le stacking gel a des pores plus grands et un pH de 6,8. La
taille des pores dans un gel de polyacrylamide est fonction
du degré de pontage entre les chaînes d'acrylamide, pontage
qui est proportionnel à la quantité de N,N,N',N',-méthylène
bisacrylamide dans le gel; plus il y en a, plus les chaînes sont
pontées et plus petits sont les pores.

De plus, les ions des deux gels au moment du dépôt des protéines sont des ions chlorure alors
que ceux du tampon sont des ions glycine. Les ions glycine qui entrent dans le gel de
concentration à pH 6,8 sont près de leur point isolélectrique et ont une très faible mobilité.
Les ions chlorure, eux, conservent une grande mobilité. Les protéines chargées par le SDS
sont plus lentes que le chlorure mais plus rapides que la glycine.

127
Quand le courant est
appliqué, les ions chlorures
filent vers l'anode, laissant
derrière elles un vide ionique
temporaire qui n'a qu'une
faible conductivité.

Manquant d'électrolytes dans


leur entourage immédiat, les
protéines dans le gel de
concentration ne peuvent pas
migrer vers l'anode. En fait,
elles ne peuvent bouger que
quand le front d'ions glycine
finit par les rattraper, parce
que ces ions remplacent alors
les ions chlorure comme
électrolytes. Même alors,
parce que les grands pores du
gel de concentration
permettent aux protéines
d'être aussi rapides que les
ions glycine, elles ne se
séparent pas les unes des
autres mais sont toutes
ramassées au passage par le
front d'ions.

(Imaginez que les protéines


sont des barques échouées
sur la grève, nez pointé vers
la terre ferme, et qu'elles sont
soudain poussées par une
vague (le front d'ions). Vous
aurez une idée assez correcte
de ce qui se passe dans cette
partie du gel. Même les
barques les plus rapides ne
peuvent pas aller plus vite
que la vague, parce qu'elles
manqueraient tout
simplement d'eau pour les
porter).

Ce front d'ions qui pousse et


empile les protéines devant
lui induit la concentration de
toutes les protéines en une
mince bande qui migre avec

128
le front jusqu'au bout du gel
de concentration.

Quand le front d'ions atteint


la discontinuité de pH et de
porosité entre le gel de
concentration et le gel de
séparation, le pH soudain
plus élevé permet aux ions
glycine de prendre leur envol.
Ils deviennent beaucoup plus
chargés et rapides et
dépassent les protéines.

Maintenant qu'il y a assez d'électrolytes en avant d'elles, les protéines peuvent migrer
librement en fonction de leur masse. (La porosité du gel, qui est plus faible dans le gel de
séparation que dans le gel de concentration, assure que les ions glycine seront plus rapides
que les protéines).

Soyons honnêtes avant de continuer: il nous faut avouer que la mobilité des protéines dans un
gel de SDS n'est pas absolument proportionnelle à leur masse. En effet, on peut observe une
variation de vitesse de migration par rapport à la masse dans une majorité de protéines, allant
de très petites variations jusqu'à des résultats franchement désarçonnants. La cause peut en
être variable: par exemple, certaines protéines ont naturellement une faible affinité pour le
SDS et le ratio masse/charge s'y trouve modifié. Certaines modifications post-
traductionnelles peuvent aussi jouer un rôle: la glycosylation interfère avec la liaison au SDS.
Il convient donc de ne pas se désespérer si nos protéines purifiées ont sur gel de SDS une
taille apparente différente de ce à quoi on s'attendait!

Les très petites protéines (moins de 15 kDa), en outre, courent de façon très aléatoires dans
les gels de glycine. C'est qu'elles peuvent être capturées dans des micelles de SDS qui se
tiennent près du front de migration. On peut les en libérer en utilisant la tricine à la place de
la glycine dans le tampon de migration. La tricine aide à la libération de ces petites protéines.
On offre commercialement des gels de SDS Tris-tricine pour l'étude des protéines de plus
petit poids moléculaire.

Une fois les protéines dûment séparées selon leur taille, il reste à révéler leur présence. Les
deux approches les plus courantes sont de les colorer, ou d'utiliser un anticorps spécifique qui
permette de localiser une réaction chimique quelconque (mais donnant un résultat visible) là
où se trouve une protéine particulière (voir à ce sujet la technique de l'immunobuvardage de
type western, un peu plus loin).

On peut colorer les protéines directement sur le gel, ou les colorer après les avoir transféré
sur une membrane (quoique dans ce dernier cas, il ne s'agisse d'ordinaire que d'un rapide
contrôle pour vérifier la qualité du transfert; on colore presque toujours les protéines
directement dans le gel).

Les techniques les plus courantes sont la coloration au bleu de Coomassie et au nitrate
d'argent. Le bleu de Coomassie servait jadis à colorer les chandails de laine en bleu; son nom

129
commémore la prise de la ville Ashantie de Kumasie, au Ghana, pendant l'époque coloniale.
Le bleu de Coomassie colore les protéines de façon à peu près égale mais est de dix à cent
fois moins sensible que la technique de coloration au nitrate d'argent.

Cette dernière repose sur la réduction, facilitée par la présence des protéines, de sels d'argent
en argent métallique (qui précipite). Il existe plusieurs protocoles de coloration au nitrate
d'argent (choisissez la vôtre en fonction de sa facilité d'exécution et du temps qu'elle
requiert)! Cette technique est cependant sensible à plusieurs facteurs et ne colore pas toutes
les protéines de façon égale.

5.3.2.2.2 Gel non-dénaturant "Blue native".

Une variante du gel SDS permet de greffer une charge aux protéines ou aux complexes
protéiques sans les dénaturer. À la place du SDS, un détergent, on utilise le bleu de
Coomassie qui donnera une charge négative aux protéines en se collant (principalement) sur
ses résidus arginine. La distrubution des charges ne permet pas de définir un ratio
charge/masse aussi constant qu'avec le SDS, mais au moins les protéines natives migrent
dans le même sens. Cette technique est appelée "blue native electrophoresis". (Schagger H,
von Jagow G. Blue native electrophoresis for isolation of membrane protein complexes in
enzymatically active form. Anal Biochem. 1991 Dec;199(2):223-31).

5.3 Essai (suite)

5.3.2.2.3 Electrofocalisation et gel 2D

L'électrofocalisation ou focalisation isoélectrique utilise avantageusement la charge que


possède chaque protéine à un pH donné.

Elle consiste en une migration, induite par un courant électrique, des protéines dans un
gradient de pH jusqu'à ce qu'elles atteignent un pH équivalent à leur pI -moment auquel elles
cessent de migrer, puisque leur charge nette est nulle.

Cette technique, qui sépare les polypeptides en fonction de leur charge plutôt que de leur
masse, est très sensible: elle peut distinguer des protéines dont la différence de pI est aussi
faible que 0,01 unité de pH.

On génère le gradient en soumettant un mélange d'ampholytes à un courant électrique. Des


tampons d'électrophorèse contenant de grandes quantités d'ampholytes sont disponibles
commercialement, précisément pour utilisation en électrofocalisation.

Les ampholytes sont de petites molécules à caractère amphotère; le mélange utilisé en


focalisation isoélectrique contient un très grand nombre de molécules ayant des pI différents,
ce qui leur permet de se distribuer entre l'anode et la cathode et de maintenir entre elles un
gradient de pH.

130
Focalisation isoélectrique.

Dans cet exemple, l'échantillon protéique est


déposé dans un large puits au centre du gel.
Évidemment, peu importe où l'échantillon est
déposé puisque les protéines migreront dans une
direction ou dans l'autre jusqu'à ce qu'elles
rencontrent leur point isoélectrique, point où elles
cessent de migrer.

On peut combiner la séparation isoélectrique avec la séparation selon le poids moléculaire


que permet le gel de SDS. Cette combinaison est appelé "gel 2D", pour deux dimensions.

Après l'électrofocalisation, une bande


longitudinale contenant toutes les protéines
séparées est coupée du gel. Cette bande ne doit
pas être trop large pour que les résultats de
l'étape suivante ne soient pas trop flous. Elle va
servir de "puits", si l'on peut dire, pour un gel
SDS, ainsi que décrit dans la figure ci-dessous.

Observez que chaque bande du gel


d'électrofocalisation peut contenir plusieurs
protéines de poids moléculaire différent. Si on
effectuait le processus à l'envers, c'est à dire si
on faisait courir un gel de SDS avant de
soumettre une de ses pistes à la focalisation
isoélectrique, on verrait que plusieurs protéines
de même poids moléculaire ont des pI très
différents.

Le gel 2D est très utilisé dans les analyses


protéomiques parce qu'il sépare les protéines
selon deux paramètres distincts et permet l'étude
d'un plus grand nombre d'entre elles en même
temps.

131
5.3.2.2.3 Western blot et Dot blot

Il existe un outil extrêmement précieux peut nous renseigner sur la présence ou l'absence de
notre protéine: un anticorps.

Les anticorps sont des protéines complexes fabriquées par les plasmocytes, des lymphocytes
B stimulés pendant une réponse immunitaire. Les anticorps circulent dans le sang comme des
missiles à tête chercheuse; ils sont sélectionnés pour reconnaître avec une grande spécificité
une structure chimique particulière qu'on appelle antigène, qui se retrouve sur les corps
étrangers. (Toute partie d'un corps étranger qui sert de base à la sélection d'un anticorps par le
système immunitaire est par définition un antigène).

On peut immuniser différents animaux pour les induire à fabriquer des anticorps contre les
protéines qui nous intéressent. Le sérum de ces animaux fournit alors le matériel dont nous
avons besoin pour identifier, au milieu d'une soupe de protéines, celle que nous voulons en
particulier.

Alternativement, si notre protéine est le fruit du génie génétique, nous lui aurons peut-être
greffé un petit bout de séquence antigénique qui sera reconnu par un anticorps commercial.
C'est ainsi que l'étiquette FLAG de Sigma (DYKDDDDK) ou la série d'histidines
(HHHHHH) parfois utilisée pour faciliter la purification par chromatographie d'affinité pour
un métal immobilisé (IMAC, pour immobilized metal affinity chromatography) sont
reconnues par des anticorps commerciaux; toute protéine qui les porte sera identifiée par les
anticorps respectifs.

Un anticorps spécifique à notre protéine, ou spécifique à une étiquette que nous lui avons
greffée, peut être utilisé pour révéler la présence de la protéine sur une membrane après un
transfert à partir d'un gel (SDS ou de focalisation isoélectrique) ou, plus rapidement, une
membrane sur laquelle on a directement déposé un certain volume de solution contenant la
protéine. Dans le premier cas on parle de western blot (un jeu de mots sur la technique du
Southern blot, développée par le Dr Southern, et qui est basée sur le transfert d'ADN sur une
membrane). Dans le second cas, on parle de dot blot ou de slot blot parce que le dépôt de la
protéine sur la membrane se fait souvent avec l'aide d'un masque n'exposant que de petites
parties de la membrane, avec des trous de forme ronde (dot blot) ou en forme de fentes (slot
blot).

Dans la figure ci-dessous, on représente le transfert des protéines d'un gel SDS à une
membrane pouvant être ensuite traitée avec un anticorps. L'anticorps va coller sur sa
protéine-cible. Un deuxième anticorps, qui reconnaît la partie Fc du premier, est alors
appliqué pour révéler la présence de ce dernier. Ce second anticorps est d'ordinaire couplé à
un enzyme quelconque dont l'activité est facilement décelable: il s'agit le plus souvent d'une
phosphatase alcaline dont l'action sur des substrats adéquats causera la production de photons
(lumière!) ou l'apparition locale d'une coloration foncée.

De tels anticorps secondaires de même que les systèmes pour révéler leur présence sont
disponibles chez de très nombreux fournisseurs de réactifs biologiques.

132
Il est très utile de faire un double
de notre gel de SDS, en faisant
courir les mêmes échantillons, dans
le même ordre, sur un autre gel
qu'on fait courir en parallèle. Alors
que le premier gel sert au western
blot, le deuxième est coloré au bleu
de Coomassie ou au nitrate
d'argent (beaucoup plus sensible)
afin de juger du degré
d'enrichissement de la protéine
révélée par l'anticorps.

5.3.2.3 Essai d'activité enzymatique: méthode continue.

Nous pouvons avoir plusieurs raisons de nous intéresser à l'activité de ce que nous purifions.

D'une part, il est possible que nous soyons sur la piste de quelque chose qui a une activité
particulière, et que nous supposons être une protéine, mais sans en être sûrs. D'autre part, il
est possible que ce soit l'activité de notre protéine qui nous intéresse et que nous n'ayons
absolument pas besoin d'elle si elle a perdu cette activité. Dans les deux cas, nous devrons
faire un test d'activité.

Le choix de notre essai repose une fois de plus sur la nature de notre protéine: si c'est une
kinase, nous testerons sa capacité à phosphoryler un substrat; si c'est une polymérase, à
synthétiser des polymères.

On distingue des méthodes dites continue, discontinue et couplée pour les essais
enzymatiques, selon que la détection de l'activité enzymatique nécessite ou non des
manipulations supplémentaires.

Dans la méthode continue, le produit de l'enzyme est différent du substrat. Il n'est donc pas
besoin de les séparer avant de quantifier l'activité de l'enzyme. La méthode continue peut
s'effectuer directement dans la solution où se retrouve l'enzyme purifié. Un exemple en est la
quantification de l'activité de la luciférase, un enzyme qui hydrolyse la luciférine (son
substrat) en provoquant la libération d'un photon. C'est le système enzymatique qui permet

133
aux lucioles de s'envoyer des messages lumineux. Ici, le substrat est la luciférine alors que le
produit à quantifier est un photon. Rien ne saurait être plus différent! On peut donc ajouter de
la luciférine directement à une solution contenant la luciférase purifiée et compter les
photons. Le substrat qui n'a pas été utilisé par l'enzyme n'interfère en rien avec la mesure.

C'est le cas aussi de différentes phosphomonoestérases. On les teste en les incubant avec le 4-
nitrophényl phosphate, un composé incolore. L'action de ces enzymes convertit ce substrat en
nitro phénol de couleur jaune. Comme la couleur finale est distincte de la couleur initiale, on
peut l'évaluer directement.

5.3.2.4 Essai d'activité enzymatique: méthode discontinue

Il peut arriver que notre substrat ne puisse se distinguer du produit par la méthode de
quantification utilisée. Le cas le plus flagrant est celui des méthodes utilisant des isotopes
radioactifs.

Un test de kinase, par exemple, peut recquérir l'utilisation d'ATP radioactif; la kinase, en
utilisant cet ATP, transfère un groupement phosphate isotopique sur son substrat. Il est
cependant impossible de distinguer, dans le mélange réactionnel, le substrat nouvellement
phosphorylé de l'ATP se trouvant dans la solution, puisque tous les deux sont radioactifs. Il
faut donc d'abord les séparer.

5.3.2.5 Essai d'activité enzymatique: méthode couplée


Qu'advient-il quand le produit d'une réaction particulière n'a pas de résultat facilement
observable?

On a recourt à une deuxième réaction qui utilise le produit de la première comme carburant!

La figure ci-dessous nous résume une telle méthode, telle qu'utilisée pour doser l'activité de
l'aspartate aminostransférase. Cet enzyme convertit le 2-oxoglutarate et l'aspartate en
glutamate et en oxaloacétate.

L'oxaloacétate ne se distingue pas particulièrement dans un tube: il ne dégage pas de photons,


il ne change pas de couleur et il ne danse pas à claquettes. il faut donc une deuxième réaction
pour révéler sa présence.

Le NADH absorbe la lumière de longueur d'onde 340nm, ce que ne fait pas le NAD+. On
utilise donc l'action de l'enzyme malate déhydrogénase, qui convertit l'oxaloacétate et le
NADH en malate et en NAD+. Cette réaction est accompagnée par une chute d'absorbance à
340nm, et n'aurait pas pu se produire si l'oxaloacétate n'avait pas été formé lors de la
première réaction.

134
Bien que la mesure que nous prenons ne soit pas reliée à l'activité directe de l'aspartate
aminotransférase, c'est tout de même cette dernière qui est responsable de la baisse
d'absorbance observée. Une telle méthode couplée nous permet donc de mesurer
indirectement l'activité d'un enzyme dont le produit immédiat ne se prêterait pas à une mesure
plus directe.

5.3.2.6 Purification d'un enzyme: définir l'unité.

En assumant que ce soit l'activité d'un enzyme qui vous intéresse, il ne sera pas suffisant de le
quantifier uniquement en termes de masse. L'activité devra être définie en termes d'unités.

Par exemple, on pourra définir une unité de nucléase EcoR I comme étant la quantité
d'enzyme requise pour digérer complètement 1 ug d'ADN de phage lambda en une heure à
37°C dans un volume de 50 uL. La notion d'unité permet de comparer les activités de
différentes préparations d'enzymes (on peut comparer l'activité spécifique de plusieurs
préparations indépendantes).

Voici un exemple de calcul de l'activité d'une préparation d'ARN polymérase II. Cet enzyme
catalyse la polymérisation de ribonucléosides phosphates en utilisant un brin d'ADN comme
gabarit. Une unité utile serait définie par la quantité de ribonucléosides phosphates qui sont
incorporés dans un polymère par unité de temps.

Nous définierons pratiquement notre unité en utilisant

135
(a) une quantité connue de polymérase II purifiée, et

(b) une concentration connue de nucléotides triphosphates radioactifs, avec une activité
spécifique déterminée.

Test d'incorporation de GTP radioactif dans l'ARN par la polymérase II: un exercice à
vous faire dresser les cheveux sur la tête!!!

Stock de mélange réactionnel (mélange 2X):

140 mM TrisHCl pH8

6 mM MnCl2

80 mM (NH4)2SO4

10 mM DTT

1 mM GTP

0,1 mg/mL poly riboC

32
6 uL de GTP- P 10 uCi/uL (3000 Ci/mmol)

dans 3 mL de volume total.

Les sels divers sont là pour assurer des bonnes conditions de pH et de salinité à la polymérase
II. Le poly riboC est un polymère de cytosine phosphate; il servira de gabarit à la réaction (la
polymérase II est particulièrement efficace pour initier la transcription sur un simple brin de
C répétés).

Réaction:

- Faire la réaction dans 100 uL. Mélanger 50uL de mélange réactionnel 2X, 30 uL H 20, et 20 uL de polymérase
purifiée.

- (pour distinguer la réaction spécifique de la Polymérase II de celles des Polymérases I et III, on peut répéter
l'expérience en y ajoutant 10ug/mL d' -amanitine, qui inhibe l'activité de la pol II beaucoup plus rapidement
que celle des deux autres polymérases).

- Incuber 20 minutes à T/P, derrière un écran de plexiglas. Le 32P est un émetteur de particules beta, des
électrons de haute énergie, qui doivent être bloqués par une couche épaisse d'une matière molle plutôt que par
une masse solide comme du plomb. 1 cm de plexiglas fait très bien l'affaire.

- Prendre 45 uL de réaction et spotter sur un filtre rond de papier chargé DE81 (qui lie l'ARN et l'ADN). Faire
de même sur un deuxième filtre pour avoir un duplicat. (On utilise 45 uL plutôt que 50 uL pour compenser pour
les pertes inévitables pendant le pipettage).

- Laver les filtres 3 fois avec un tampon phosphate (250 mL de Na2HPO4 5% à chaque fois). Il est pratique de le
faire dans une unité de filtration Nalgene de 500mL; on peut ainsi aspirer le liquide chaque fois sans avoir à le

136
manipuler (contenant le GTP radioactif non-incorporé, il est lui aussi très radioactif)!

- Après trois lavages, les filtres devraient être débarassés du GTP non incorporé. Rincer à l'éthanol et laisser
sécher à l'air. Compter par scintillation.

Activité de l'isotope:

On vient d'obtenir des comptes en CPM. Mais attention! Pour pouvoir comparer ces comptes
avec ceux obtenus lors d'autres préparations, il faut s'assurer de comparer les pommes avec
les pommes!

Pour ce faire, il faut d'abord établir l'activité spécifique exacte de l'isotope utilisé dans la
réaction. Le tube nous dit GTP- 32P, 10uCi/uL, 3000 Ci/mmol avec une date de référence.
L'activité d'un isotope s'éteint avec le temps; il faut en tenir compte dans nos calculs. Pour le
32
P, qui a une demi-vie assez courte de 14 jours, la baisse d'activité est la suivante:

Jours
0 1 2 3 4
0 1.000 0.953 0.906 0.865 0.824
5 0.785 0.748 0.712 0.678 0.646
Jours
10 0.616 0.587 0.559 0.532 0.507
15 0.483 0.460 0.436 0.418 0.396
20 0.379 0.361 0.344 0.328 0.312

Il est préférable de ne pas utiliser un isotope trop vieux. En fait, la plupart des fournisseurs
nous les livrent avant la date de référence (qui correspond au jour 0 sur le tableau ci-haut). À
la date de référence, l'activité spécifique par volume est réellement de 10 uCi/uL.

Si on utilise l'isotope avant la date de référence, 3 jours plus tôt par exemple, on aura une
activité spécifique réelle supérieure à 10 uCi/uL. En fait, si on utilise le tableau ci-haut, on
établira que l'activité spécifique dans trois jours d'ici, à la date de référence, équivaudra à
0.865 de l'activité réelle d'aujourd'hui. Une simple règle de trois nous apprendra alors que
l'activité de notre isotope est aujourd'hui de

10 uCi/uL divisé par 0,865 = 11.56 uCi/uL.

Nous avons mis 6 uL de ce pastis dans notre mélange réactionnel; cela correspond à 69,36
uCi.

137
Activité spécifique du GTP dans notre mélange réactionnel:

Nous venons d'établir de façon précise l'activité spécifique de notre isotope; cependant, il ne
faut pas oublier que la majeure partie du GTP dans notre réaction n'est pas radioactive
(regardez la liste des sels dans le mélange réactionnel: nous y avons mis 1 mM de GTP). Le
GTP radioactif sera donc dilué par le GTP froid, et l'activité spécifique du GTP total dans
notre réaction sera donc moindre que celle trouvée dans notre pot de GTP radioactif (et
heureusement, sinon nous brillerions dans le noir).

L'activité spécifique du GTP dans le mélange réactionnel correspond à l'activité totale du


GTP divisé par la quantité totale de GTP.

L'activité totale, nous l'avons calculée à l'étape précédente, est de 69,36 uCi. La concentration
de GTP dans notre tampon 2X (dont nous avons préparé 3 mL ci-haut) est de 1 mM; cela
signifie 3 micromoles dans 3 mililitres. Il y a donc 3 micromoles de GTP dans notre mélange
réactionnel 2X.

L'activité spécifique du GTP dans le mélange réactionnel est de 69,36 uCi divisé par 3
micromoles, ou 23,12 Ci/mol.

À ce point, il faut préciser deux choses. D'abord, nous parlons ici de l'activité spécifique du
GTP, pas de celle du mélange réactionnel. Il n'est donc pas important que le mélange soit un
stock 2X, puisque le GTP froid sera dilué en même temps que le chaud; il y aura donc
toujours autant de froid que de chaud, proportionnellement, et l'activité spécifique du GTP ne
changera pas.

Ensuite, vous noterez que je n'ai pas considéré l'apport de l'isotope radioactif à la quantité
totale de GTP: c'est que la quantité de GTP froid est si grande par rapport à celle du GTP
chaud que cette dernière devient négligeable. (Mais si vous tenez vraiment à le savoir, petits
curieux, en ajoutant la quantité de GTP chaud à celle du froid on obtient 3,00000002
micromoles au lieu de 3 micromoles).

Tous les CPMs ne sont pas nés égaux.

Mais nous ne sommes pas encore sortis de l'auberge! Les comptes que nous ont donnés le
compteur à scintillation sont des cpm, ou comptes par minute. Chaque compte est
l'enregistrement, par le compteur, d'un évènement de désintégration d'une particule
radioactive. Cependant, un compteur ne peut pas enregistrer toutes les désintégrations. En
plus, il peut arriver que son efficacité baisse avec le temps. Et puis tous les compteurs ne sont
pas aussi bons les uns que les autres. À cause de tout cela, le cpm n'est pas une valeur très
utile pour définir l'unité, car cette dernière ne serait alors utilisable qu'en utilisant toujours le
même compteur. On cherchera plutôt à établir à combien de désintégrations par minute
(dpm) nos cpm correspondent. Et c'est justement pour cela qu'un compteur est d'ordinaire
accompagné de ses fioles à calibration.

Ces fioles ont été remplies à une date précise (marquée sur la fiole) d'une quantité donnée
d'un isotope radioactif de longue demi-vie. L'étiquette de la fiole vous indique exactement le

138
nombre de dpm qu'on pouvait y enregistrer à la date de référence.

En utilisant un tableau comme celui du 32P ci-haut et la date de référence, on mettre la fiole
dans notre compteur et déterminer quelle est son efficacité aujourd'hui. De façon générale, un
bon compteur enregistre environ 1 cpm par 2 dpm.

Supposons que ce soit le cas chez nous. Mettons que notre expérience ait donné 10 000 cpm.
10 000 cpm équivaudra à 20 000 dpm. On transforme ensuite les dpm en Ci selon le rapport

2,22 x 1012 dpm = 1 Ci

et 20 000 dpm= 9 x 10-9 Ci

Comme notre activité spécifique pour le GTP est de 23,12 Ci/mol, notre polymérase a donc
incorporé

9 x 10-9Ci / 23,12 Ci/mol = 3,9 x 10-10mol ou 0,39 nmol.

Définition de l'unité:

Nous savons combien de polymérase purifiée nous avons mis dans chaque réaction, et grâce à
notre gymnastique arithmétique nous savons aussi quelle est l'activité spécifique du GTP
présent dans la réaction. Nous pouvons maintenant définir avec précision notre unité
d'enzyme comme étant "la quantité de polymérase requise pour incorporer 1 nanomole de
GTP en ARN pendant une réaction de 20 minutes à T/P".

Nous avions 20 uL de polymérase dans notre mélange réactionnel. Nous n'avons compté que
45 uL sur 100, ce qui correspond à 9 uL d'enzyme. Ces 9uL d'enzyme ont incorporé 0,39
nmol de GTP dans les conditions décrites. Pour incorporer 1 nmol de GTP, on aurait eu
besoin de 23 uL d'enzyme. Notre enzyme a donc une concentration de 1 unité / 23 uL, ou de
0,043u/uL. (Comme ce chiffre est bas, on peut aussi l'écrire 43 unités/mL, ça paraît mieux)!

Cette unité a l'avantage de permettre de comparer une préparation de polymérase à une autre,
peu importe où et quand celle-ci a été préparée, ni sur quel compteur à scintillation on l'a
évaluée.

5.3.2.7 Essais d'activité non-enzymatique

Il peut arriver (et même il arrive fréquemment) que l'activité que nous cherchions ne soit pas
enzymatique. C'est le cas, par exemple, de la recherche de protéines se liant à l'ADN. De
telles protéines peuvent être des enzymes, mais ce n'est pas un pré-requis; de plus, leur liaison
à l'ADN n'est pas un processus enzymatique.

Nous verrons dans un chapitre subséquent différentes techniques d'interaction ADN-


protéines; pour le moment, mentionnons qu'il est possible d'utiliser de telles techniques pour
suivre la présence et la spécificité d'une protéine pendant sa purification.

139
Les essais les plus simples pour une protéine liant l'ADN sont la migration retardée EMSA,
pour electromobility shift assay) et l'empreinte à la DNAse (ou footprinting).

5.4 Source de matériel

5.4.1 Généralités

La source de notre matériel peut ne pas être sujette à discussion. Si nous étudions des
protéines dans leur contexte naturel, nous n'avons d'autre choix que d'aller les y chercher.

Cependant, si nous pouvons sans conséquences fâcheuses utiliser une source alternative, nous
devrions sérieusement le considérer si cette alternative se révèle plus disponible, moins
onéreuse ou plus commode à utiliser.

Autant que faire se peut, pour obtenir de grandes quantités de protéines, nous devrions opter
pour une méthode quelconque de surexpression. Alors qu'une protéine dans son contexte
naturel ne représente qu'une fraction infime du pourcentage de la masse totale des protéines,
une protéine surexprimée peut en représenter une fraction impressionante.

La surexpression passe souvent par la construction d'un vecteur d'expression qui contiendra la
séquence codant pour notre protéine: la construction d'un tel vecteur est une occasion en or
pour introduire dans la séquence une étiquette favorisant la purification ou l'identification de
la protéine.

Le tableau qui suit présente les caractéristiques de différentes sources de protéines exprimées
à partir d'un vecteur d'expression.

Bactérie Levure Insecte Mammifère in vitro

+/- complexe, complexe,


Facilité du procédé +/- complexe, lent complexe, lent simple, rapide
lent lent

Expression rapide rapide assez lente assez lente très rapide

Production élevée élevée moyenne moyenne faible

milieu pas cher pas cher coûteux couteux couteux

souvent, avec aussi corps ne s'applique


protéine sécrétée? souvent parfois rarement
d'inclusion pas

purification simple simple assez simple assez simple simple

co-expression difficile difficile assez facile difficile facile

140
Interférence avec
rarement rarement rarement rarement non
l'hôte

Repliement correct pas toujours pas toujours oui oui pas toujours

oui, riche en simple, pas d'acide


N-glycosylation non complexe non
mannose sialique

O-glycosylation non oui oui oui non

sur Tyr; très rare sur Ser


phosphorylation oui oui oui non
et Thr

acétylation non oui oui oui non

acylation du N-
non oui oui oui non
terminus

gamma-
non non non oui non
carboxylation

5.4.2 Tissu

Travailler avec du tissu comme source de matériel peut être indispensable, mais ce n'est
certes pas commode. Le tissu devra souvent être brisé (à la moulinette ou au blender!) et/ou
traité à la collagénase pour en briser les fibres insolubles et très solides. Un avantage est que
la protéine vient de son milieu naturel; un autre est que le tissu en question est peut être
vendu à prix très avantageux (un boucher vous vendra du thymus, sous le nom de ris de veau,
à coups de kilogrammes).

5.4.3 Cellules en culture

Probablement la source la plus courante de protéines non-exprimées dans un système


recombinant procaryote. Les cellules en culture sont très proches, physiologiquement parlant,
de ce qui se passe dans un être vivant. Elles sont aussi généralement très faciles à traiter pour
faire un extrait cellulaire. Malheureusement, la plupart demandent des conditions de culture
exigeant l'utilisation de réactifs et de nutrients très onéreux; en outre, plusieurs types de
cellules poussent lentement et ne donnent pas beaucoup de matériel.

5.4.4 Les levures

Si nous étudions une protéine qui se retrouve aussi bien chez ces eucaryotes plus primitifs
que dans notre modèle habituel, alors les levures constituent une excellente source de
matériel. Les conditions de culture pour les levures sont élémentaires, elles peuvent donner
énormément de matériel, et elles ont l'avantage (par rapport aux procaryotes) d'être plus près,

141
évolutivement parlant, des eucaryotes supérieurs. On y retrouvera donc des enzymes, comme
les sérine-thréonine kinases, que ne possèdent pas les vecteurs d'expression procaryotes.

Certaines levures, comme Picchia pastoris, peuvent permettre l'expression d'énormes


quantités de matériel.

La levure Saccharomyces cerevisiae, compactée et vivante, peut être achetée chez un


boulanger grossiste en paquets de un kilo ou plus... quand on songe à ce que ça coûte pour
obtenir 100g de cellules en culture, il y a de quoi pleurer.

5.4.5 Les bactéries

Elles restent ce qui se fait de moins cher et de plus puissant en fait de manufactures
moléculaires. Les bactéries peuvent être utilisées pour exprimer des quantités astronomiques
de matériel. Elles ont aussi été le sujet de plusieurs manipulations visant à en faire des
vecteurs d'expression de plus en plus performants (consultez un catalogue Stratagene, par
exemple, pour vous familiariser avec de nombreuses souches bactériennes qu'on a rendues
déficientes en protéases, ou permettant l'expression de protéines toxiques, ou que sais-je
encore).

L'utilisation d'un plasmide bactérien à partir duquel exprimer une protéine a de nombreux
avantages, dont le principal est certes la facilité. Il suffit de cloner la séquence codant pour
notre protéine dans un tel plasmide, en aval d'un promoteur qui fonctionnera dans la bactérie-
hôte choisie, et de transformer la bactérie avec le plasmide ainsi fabriqué. Si le plasmide
porte un gène de sélection (un gène de résistance à un antibiotique, par exemple) en plus
d'une origine de réplication, on n'a pas à se soucier d'intégration ou de quoi que ce soit de ce
genre.

De très nombreux vecteurs de clonage, prévu pour l'expression dans Escherishia coli, sont
disponibles commercialement. Nombre d'entre eux contiennent des sites de clonage sous le
contrôle de polymérases virales et non bactérienne (comme la T7 RNA polymerase), et sont
destinés à être utilisés en conjonction avec des souches modifiées pour exprimer une telle
polymérase -souvent sous le contrôle d'un système activable, comme celui de l'opéron gal.
L'avantage d'une telle approche est que, par exemple, tant que le répresseur gal n'est pas
inactivé par du galactose ou de l'IPTG, la polymérase T7 n'est pas synthétisée... et la protéine
recombinante que nous voulons faire exprimée ne l'est pas non plus. En outre, on peut traiter
nos cultures avec un inhibiteur d'ARN polymérase qui n'agit pas sur la polymérase virale:
ainsi, on sait que suite à l'activation, seule notre protéine est exprimée. Cela réduit le bruit de
fond causé par la présence des protéines endogènes de la bactérie.

142
Voici deux inhibiteurs d'ARN polymérase:

5.4.6 Les virus

Une approche intéressante pour la production de protéines par des cellules eucaryotes est d'en
introduire la séquence codante dans le génome d'un virus, puis d'utiliser celui-ci pour infecter
des cellules.

On utilise beaucoup le baculovirus pour infecter des cellules d'insectes. Ce système est très
efficace. On doit cependant se souvenir de ce que la glycosylation protéique chez les insectes
n'est pas exactement la même que chez les mammifères. Si cet aspect est important pour
nous, il convient de ne pas l'oublier.

Le virus de la vaccine offre un autre système d'expression. Il peut fonctionner dans des
cellules humaines. En plus, l'infection par la vaccine cause l'arrêt de la transcription et de la
traduction des protéines de l'hôte (seules les protéines venant du virus sont exprimées), ce qui
enrichit notre protéine recombinante par rapport au bruit de fond. Le problème ici est que la
vaccine est un virus vivant qui peut se transmettre à l'utilisateur (et la vaccination contre la
petite vérole a été interrompue il y a déjà quelques lustres).

5.4.7 Le homard

À ce que je sache, personne n'utilise encore le homard de façon régulière pour l'expression
des protéines.

5.5.1 Généralités

Quelque soit le type de cellule que nous ayons choisi pour produire la protéine qui
nous intéresse, nous devrons persuader cette dernière d’en sortir. À moins que notre
candidate ne soit une protéine sécrétée et donc disponible dans le milieu, nous
devrons sélectionner une méthode pour briser les cellules et en extraire le contenu.

Plusieurs choix s’offrent à nous, choix qui seront faits en fonction du type de cellule
utilisé, des conditions de purification de notre protéine, de l’équipement disponible,
et même de nos goûts personnels. Soyons conscients de ce que certaines

143
méthodes d’extraction seront clairement préférables à d’autres même si elles sont
plus compliquées; il nous faut donc être souples quant à notre décision finale.

Les principales approches de lyse des cellules sont les suivantes. Un choc
osmotique peut suffire à briser la membrane cellulaire de cellules fragiles. Ce choc
peut être assisté par un léger traitement avec un détergent (ce qui permet aussi
d’aider à maintenir les protéines en solution). Une certaine action mécanique peut
aussi être ajoutée au processus: un homogénéisateur à piston permet de briser la
plupart des cellules de mammifères.

Pour les cellules de plantes, de levures ou les bactéries, toute approche "douce"
devra tenir compte de la présence d’une paroi cellulaire très résistante; les
protoplastes de telles cellules seront préparés en traitant ces dernières avec des
enzymes (telle la lyticase) qui détruiront la paroi sans briser la membrane plasmique.

Finalement, dans tous les cas, une méthode brutale peut aussi être utilisée. Le
traitement aux ultrasons, une lyse mécanique utilisant des billes de verre ou une
presse Aminco-French, comme les cycles de congélation/décongélation, sont tous
des moyens envisageables.

5.5.2 Tampon

L’extraction s’effectuera dans une solution tampon, dans laquelle les cellules seront
resuspendues après une centrifugation visant à les concentrer. À cette étape, notre
protéine est fort probablement en concentration infime par rapport à toutes les autres
protéines cellulaires; nous mettrons les chances de notre côté en limitant toute
dilution supplémentaire. On cherchera autant que possible à maintenir une
concentration élevée dès les premières étapes.

Le tampon de lyse répondra à certaines exigences expérimentales. Il devrait avoir


un fort pouvoir tampon, car le contenu des cellules peut être à un pH inapproprié. On
ne veut pas, par exemple, que les enzymes lysosomiques puissent se retrouver tout
d’un coup libérés de leur enveloppe et dans un milieu à pH acide, conditions dans
lesquelles ils auraient tout loisir de détruire les autres protéines cellulaires.

Rappelons-nous que le pouvoir tampon d’une substance est plus élevée dans une
région de pH proche de son pKa; voici les pKa de certains tampons populaires.

Bis-TRIS 6,46
PIPES 6,76
MOPS 7,20
TES 7,40
HEPES 7,48
Tris 8,06
Glycine 9,78

144
Le HEPES (pour la chromatographie d’échange de cations) et le Tris (pour l’échange
d’anions) sont ceux que vous rencontrerez le plus souvent en purification de
protéines. Méfiez-vous des solutions "tampon" qui ont un pH très éloigné du pKa; à
plus de deux ordres de grandeur en plus ou en moins que le pKa, ce ne sont
sûrement pas de très bons tampons.

Alors que l’intérieur des cellules est un environnement réducteur (à cause entre
autres de toute cette glutathione), l’atmosphère dans laquelle nous vivons est au
contraire oxydante (elle est riche en oxygène). Il y a gros à parier que notre protéine
devra être protégée d’une oxydation excessive : c’est pourquoi un agent réducteur
comme la glutathione, l’acide ascorbique, le beta-mercaptoethanol ou le dithiothreitol
(DTT) pourra être ajouté au tampon. Ne vous en faites pas trop pour les ponts
disulfures retrouvés à l'intérieur des protéines globulaires: ils devraient être bien à
l'abri des conditions externes.

On retrouve souvent du glycérol dans la composition des tampons. Il stabilise les


interactions protéine-protéine.

Faisons face à cette dure réalité : notre protéine a beaucoup d’ennemis. La cellule
même d’où elle provient est remplie de protéases qui ne demandent pas mieux que
d’en faire une bouchée. En brisant les lysosomes (particulèrement si nos cellules de
départ ont une forte activité catabolique, comme les cellules du foie; ou si ce sont
des cellules de plantes avec des vacuoles riches en protéases) nous avons libéré
une horde de protéases féroces dans le même tampon de lyse que notre protéine.
La solution? Tenir le pH élevé (entre 7 et 8), garder la soupe au frais (4°C) et ajouter
des inhibiteurs de protéases à la solution.

Voici quelques-uns de ces inhibiteurs :

Inhibiteurs Cible
PMSF Toutes les sérine protéases (trypsine, thrombine,
chymotrypsine, papaine, etc).
AEBSF Toutes les sérine protéases (trypsine, thrombine,
chymotrypsine, papaine, etc). Plus soluble et moins
toxique que son prédécesseur, le PMSF.
EDTA et EGTA métalloprotéases (métal comme cofacteur)
Benzamidine sérine protéases
Pepstatin A protéases aspartiques comme la cathepsine D, la
rénine, la pepsine et les protéases d'HIV.
Leupeptin sérine- (trypsine, plasmine, kallikréine porcine) et
cystéine- protéases (papaine, cathepsine B). N'inhibe
pas la thrombine ni la chymotrypsine.
Aprotinin sérine protéases, mais pas la thrombine ou le facteur
X.

145
Chymostatin sérine protéases avec une spécificité de type
chymotrypsine (chymotrypsine, chymases, cathepsine
G et des cystéine protéases comme les cathepsines B,
H et L.
Antipain Inhibe la papaine, la trypsine et la plasmine jusqu'à un
certain point. Plus spécifique pour la trypsine et la
papaine que ne l'est la leupeptine.

Notez que l’acétylcholine estérase est une sérine protéase; la bungarotoxine du


cobra pourrait donc être utilisée comme agent protecteur de votre protéine. Si vous
cherchez un animal familier dans le labo, optez donc pour un cobra. Il s’occupera
aussi des souris qui s’échappent de leur cage.

Plusieurs compagnies offrent un catalogue très complet d’inhibiteurs de protéases,


de même que des cocktails déjà mélangés.

5.5.4 Techniques d’extraction

Si du tissu entier est choisi comme matériel, surtout s’il est riche en tissu conjonctif, il
faudra d’abord libérer un maximum de cellules. Un blender de cuisine sera un outil
fort utile pour ce faire, malgré son origine infâme pour les compagnies d’outillage de
laboratoire. On utilisera aussi un enzyme comme la collagénase pour briser les
fibres de collagène empêtrant les cellules.

5.5.4.1 Choc osmotique

Le choc osmotique permet de briser certaines cellules fragiles avec un minimum de


dommages. Les cellules sont incubées dans une solution hypo-osmotique.
Cherchant à rétablir l’équilibre osmotique, l’eau pénètre dans la cellule et finit par
causer une rupture de la membrane plasmique. On peut donner un coup de pouce à
la technique avec un peu de détergent (NP-40, LDAO, triton X-100) et avec un
soutien mécanique (quelques coups de piston dans un homogénéisateur de type
Dounce). Une telle approche permet de récupérer des noyaux presque intacts une
fois séparés des débris de la membrane plasmique.

Il est possible de lyser les membranes plasmiques sans briser les noyaux. La lyse
cellulaire doit être suivie par de fréquentes visites aux microscope. La lyse des
noyaux, si elle arrive accidentellement, se traduira par une soudaine augmentation
de la viscosité de la solution: c'est la chromatine qui est libérée qui en la
responsable.

Soyons francs : ce genre de technique relève de l’art autant que de la science et il


n’y a rien de tel que la pratique répétée pour que l’expérimentateur en découvre
toutes les nuances.

146
5.5.4.2 Homogénéisateur de type Dounce

Cet appareil ressemble à une éprouvette (aux parois épaisses) dans laquelle s’enfonce un piston
serré. Le passage des cellules dans l’espace extrêmement exigu entre le piston et la paroi interne du
tube cause leur bris, un peu comme ce qui nous arriverait si nous étions accroché à une porte de
métro quand il s’engouffre dans un tunnel. Sproutch.

5.5.4.3 Homogénéisateur de type Potter-Elvehjem

Le "potter" ressemble à un Dounce motorisé; son piston a souvent une tête de teflon et
tourne dans le cylindre contenant les cellules resuspendues.

5.5.4.4 La presse Aminco- French

Ne vous laissez pas abuser par son sobriquet anglais de


French press : cet appareil n’est pas français, il a été mis au
point par un certain Dr. French (un nom d’inventeur plus facile à
porter, avouons-le, que Poubelle ou Crapper). L’appareil vise lui
aussi à forcer les cellules à passer dans un espace plus petit
qu’elles, ce qui déchire leur membrane (et réduit la plupart de
leurs structures en marmelade). Il consiste en un cyclindre
creux en métal, cylindre dans lequel s’enfonce un piston de
métal nanti de plusieurs o-rings d’un caoutchouc très solide. À
la base du cyclindre, une petite valve est installée; celle-ci peut
être obstruée par une petite bille en teflon.

La suspension de cellules est versée dans le cyclindre. Le piston est installé, obstruant le trou,
et une puissante vis sans fin commence à l’enfoncer dans le cylindre (avec un bruit assez
inquiétant il faut bien l’admettre). Comme il n’y a que peu d’air dans le cyclindre et qu’un
liquide est à toute fin pratique incompressible, l’enfoncement du piston fait très rapidement
grimper la pression sur les parois du cylindre. Quand on ouvre légèrement la valve, la

147
suspension de cellules est éjectée comme de l’eau qu’on fait passer entre ses dents et les
cellules sont déchiquetées. Plus la pression est haute dans le cylindre, plus totale est la lyse.

5.5.4.5 La bombe à disruption

Elle consiste en une chambre pressurisée dans laquelle les cellules sont traitées
avec de l'azote à haute pression. La pression force l'azote à se solubiliser dans les
liquides. On libère alors la pression tout d'un coup; l'azote en solution reprend son
état gazeux, forme des bulles à l'intérieur des cellules et les fait éclater.

C'est un problème similaire qui attend les plongeurs sous-marins qui remontent sans
avoir respecté leurs paliers de décompression.

5.5.4.6 Les billes de verre

L’appareil utilisé pour cette technique ressemble à un blender (et un coup parti dans
les anglicismes, pourquoi ne pas aller jusqu'au bout... on appelle ça un bead beater),
à ceci près qu’il est beaucoup plus petit et ne contient pas de lames. Son contenant
amovible est rempli de petites billes de verre sur lesquelles on verse la suspension
de cellules. La suspension se répartit entre les billes. Il est important de remplir
complètement le contenant et de ne pas y laisser d’air pour éviter de faire de la
mousse et d’oxyder les protéines. Le tout est alors scellé et on lance la machine, qui
fait furieusement tourbilloner les billes de verre dont l’action abrasive a tôt fait de
réduire les cellules en charpie.

Séparer les billes du lysat est très facile parce que les billes coulent au fond dès que
l'agitation cesse.

On doit prendre soin de garder le tout au frais; en fait le contenant est souvent nanti
d’une chambre où on installe de la glace. Le mouvement des billes génère en effet
beaucoup de chaleur.

148
5.5.4.7 La sonication

Elle consiste en la destruction des cellules par les ultrasons, exactement comme le
faisait l’invention du professeur dans "L’affaire Tournesol" de Hergé. Ici, une tige de
métal (le "sonicateur") à l’extrémité très fine est introduite dans la suspension de
cellules et induite à vibrer violemment, émettant un bruit fort déplaisant même pour
l’utilisateur portant ses cache-oreilles obligatoires.

Les vibrations sont des ondes de pression ultrasoniques qui causent la croissance
de bulles par un phénomène appelé "cavitation". Ces bulles sont soumises à un
grand stress par les ondes ultrasoniques et peuvent subitement grandir, se
contracter ou même imploser. Une telle implosion est accompagnée d'une très haute
augmentation locale de la pression et de la température. Quel genre
d'augmentation? Et bien une microbulle qui implose ainsi peut voir sa température
grimper à 5000°C et sa pression atteindre plusieurs centaines d'atmosphère.

Comment les microbulles se forment-elles? Une analogie possible est celle d'un
attache-trombone qu'on tortille. Il est fait de métal, mais en le pliant et le dépliant
rapidement vous pouvez faire augmenter sa chaleur, "fatiguer" les liens moléculaires
qui assurent sa cohésion locale et le briser. C'est la même chose qui arrive aux
molécules d'eau quand un sonicateur les fait vibrer. Les vibrations ultrasoniques
réussissent à briser les ponts hydrogènes qui assurent l'état liquide de l'eau, ce qui
les convertit en gaz. Il s'agit en quelques sorte d'une ébullition à froid, effectuée en
agitant les molécules d'eau. Mais comment maintenir de l'eau à l'état gazeux dans
un liquide froid? Assurément cela ne peut pas durer bien longtemps et le gaz se
condense. Or voilà: le gas qui se condense perd du volume et laisse derrière lui un
espace vide (une cavité, d'où le nom de "cavitation"). L'eau liquide se précipite dans
l'espace vide pour le remplir, et les molécules d'eau liquides entrent en collision au
coeur de la cavité. L'onde de choc de cette collision s'étend alors dans le voisinage
comme les cercles concentriques générés par un caillou lancé dans une mare. Et
l'addition de toutes ces ondes de choc peut pulvériser les cellules, comme le ferait
un très puissant ouragan qui tomberait sur notre maison à l'improviste.

Le hic avec le sonicateur est qu'il génère beaucoup de chaleur dans le matériel
biologique. L'utilisateur a tout intérêt à garder le tube dans lequel a lieu la sonication
dans un bac à glace.

149
5.5.4.8 Enzymes lytiques

Avec les levures, les plantes, les bactéries, il faut tenir compte de la paroi cellulaire
qui protège la membrane plasmique. Si on n’opte pas pour une méthode mécanique
et violente d’extraction, il faudra d’abord détruire cette paroi avant de s’en prendre
au reste de la cellule.

Différents enzymes comme le lysozyme (du blanc d'oeuf de poule, par exemple) ou
la lyticase de S.aureus sont disponibles pour s’occuper de cette tâche; il suffit de
choisir le plus approprié.

5.5.4.9 Élimination précoce de ce qui n'est pas utile

La cellule contient une très grande quantité de protéines, parmi lesquelles celle qui
nous intéresse est fort probablement très minoritaire. Si possible, il sera donc tout à
notre avantage de nous débarasser le plus vite possible de la majorité des protéines
qui ne nous intéressent pas.

De nombreuses protéines sont concentrées dans une région limitée de la cellule :


facteurs de transcription et histones dans le noyau, par exemple; protéines
mitochondriales dans les mitochondries, etc. Plusieurs protocoles existent pour
isoler ces organelles les unes des autres par centrifugation. Une extraction douce
des organelles suivie de leur isolation nous donnera une très grande longueur
d’avance pour la suite de la purification.

Un exemple de séparation des


composantes cellulaires par
centrifugation différentielle.
Certaines organelles de la cellule
sont plus denses que d'autres et plus
à même de sédimenter à basse
vitesse de centrifugation.

Si notre protéine est contenue dans


une organelle particulière, nous
pouvons gagner beaucoup de temps
et d'effort en séparant d,abord celle-
ci du reste des composantes
cellulaires; c'est particulièrement le
cas des noyaux.

Les protéines nucléaires sont presque toujours préparées à partir de noyaux et pas
de cellules entières. Une bonne façon de séparer les noyaux du reste est de

150
déposer le lysat cellulaire (avec les noyaux intacts) sur un coussin de sucrose. La
densité du sucrose ne laisse passer que les particules denses comme les noyaux,
les débarassant de la majeure partie du reste du matériel cellulaire.

La compagnie Caprion, de Montréal, s’est fait une spécialité de purifier les


organelles. Une visite sur son site web www.caprion.com est fort instructive.

5.5.4.10 La chromatine

Selon la technique utilisée, nous nous retrouverons avec un extrait protéique brut
contenant de l’ADN plus ou moins intact et associé à un grand nombre d’histones.
Plus cette chromatine est intacte, et plus notre soupe est visqueuse. Une extraction
à la presse Aminco-French ou au sonicateur va pulvériser la chromatine et n'en
laisser que des débris; une extraction de protéines ne lysant pas les noyaux laissera
la majeure partie de la chromatine derrière nous.

On peut séparer la plupart des protéines de la chromatine en changeant la force


ionique de la solution (ce qui se passe lors d'une précipitation au sulfate
d’ammonium, par exemple). L'histone H1 va décrocher à partir de 100 mM
d'ammonium, ce qui aide la solubilisation de l'ADN; les histones de l'octamère
décrochent entre 400mM et 700mM d'ammonium). On peut même utiliser une simple
ultracentrifugation après la lyse nucléaire pour se débarasser de la chromatine (la
chromatine intacte est un énorme réseau très visqueux qui s'écrasera dans le culot,
alors que la plus grande partie des protéines solubles resteront dans le surnageant).

Mieux vaut se débarasser de l’ADN dès que possible.

On peut opter pour un traitement aux nucléases (si on ne craint pas de traîner des
nucléases derrière nous) ou encore choisir comme première étape de purification
chromatographique un passage sur une résine de DEAE, chargée positivement, qui
retiendra fortement l’ADN chargé négativement. Ce serait en tout cas mon choix.

5.5.4.11 Protéines membranaires

Ces protéines ne se promènent pas librement en milieu aqueux puisqu’elles


comptent au moins un domaine transmembranaire hydrophobe. Elles sont donc
assez insolubles et difficiles à préparer. Leur purification requiert l’utilisation de
détergents.

5.5.4.12 Corps d’inclusion

La même chose est vraie de protéines exprimés chez E.coli, surexprimées ou non,
et qui se retrouvent dans des agrégats insolubles appelés corps d’inclusion. Notons
au passage que la solubilité d’une protéine surexprimée chez E. coli peut varier
selon les étiquettes qu’on y ajoute par ingénierie génétique; ainsi, il est possible
qu’une même protéine soit insoluble avec une étiquette 6-histidines et soluble avec
une étiquette GST.

Les corps d’inclusion peuvent être récupérés par centrifugatrion. Si nous ne


craignons pas de travailler avec du matériel qui a précipité et a été resuspendu,

151
nous pouvons alors entreprendre de resolubiliser les protéines qu’ils contiennent.
Des agents vigoureux comme la guanidine-HCl, le SDS ou l’urée 8M sont utilisés
pour resuspendre les agrégats; ils doivent ensuite être éliminés pour permettre la
renaturation.

Le problème au point de vue expérimental est de jongler entre des conditions assez
dénaturantes pour prévenir l'aggrégation et la précipitation, mais aussi assez douces
pour ne pas systématiquement dénaturer toutes nos protéines. Chaque protéine
demandera un protocole optimisé.

Voici le protocole du Protein Purification and Expression Facility de l'EMBL, à


Heidelberg en Allemagne:

Tampon de lavage

50 mM Tris-HCl pH 7.5
50 à 200 mM NaCl

Tampon d'extraction

50 mM Tris-HCl pH 7.5
8 M urea
1 mM DTT
1 mM PMSF* * Le PMSF est instable en solution aqueuse et est ajouté au
tampon au moment décrit dans le protocole.

Procédure

1. Centrifuger le lysat cellulaire à 4°C pour 20 min. à 30 000 g (16 000 rpm dans un rotor SS34 de
Sorvall ou JA-20 de Beckman).
2. Resuspendre le culot dans 10 mL de tampon de lavage contenant 1% triton X-100 et 1M urée par
gramme de culot de cellules. Incuber à T/P pour 5 minutes.
3. Centrifuger le lysat cellulaire comme à l'étape (1).
4. Répéter 3 fois.
5. Resuspendre le culot dans 10 mL de tampon de lavage et centrifuger la suspension à 4°C pour 30
min. à 45 000 rpm dans un rotor 45Ti de Beckman.
6. Resuspendre les corps d'inclusion dans le tampon d'extraction. Utiliser assez de tampon pour
obtenir une concentration finale en protéine de 1 mg/mL. Ajouter 10 uL PMSF (100 mM) par mL de
solution. Incuber une heure à T/P.
7. Diluer la solution dix fois avec le tampon d'extraction et dialyser toute la nuit contre 100
volumess de solution de lavage.
8. Centrifuger le dialysat à 4°C pour 30 min. à 45 000 rpm dans un 45Ti.

152
En voici un autre, de Laurent Vuillard et Alasdair Freeman de l'université de St
Andrews (Royaume Uni).

Solubilisation des protéines des corps d'inclusions

- Resuspendre le culot d'un litre de culture batérienne dans 20 mL de

50mM HEPES-NaOH pH7.5


0.5M NaCl
1mM PMSF
5mM DTT
avec 0,35mg/mL de lysozyme

Incuber 30 min. à 20°C.

- Ajouter du triton X-100 à une concentration de 1% (vol./vol.)


- Soniquer par coups de 30 secondes jusqu,à ce que la solution s'éclaircisse.
- Traiter l'extrait à la DNAse I (20 mg/L) pour 60 min. à 37°C
- Sédimenter les corps d'inclusion par centrifugation à 30 000g, 30 min., 4°C.
- Laver le culot (les corps d'inclusion) deux fois au TBS ou au PBS contenant 1% Triton X-100, et
centrifuger à 30 000g, 30 min., 4°C
- Solubiliser le culot dans 2 mL de
50mM HEPES-NaOH pH7.5,
6M guanidine HCl,
25mM DTT

et laisser 1h at 4C.

- Le matériel insoluble est retiré par centrifugation à 100 000g pour 10 minutes. Cette étape est
particulièrement importante pour enlever les aggrégats qui pourraient servir de noyaux de précipitation
pendant le relpiement des protéines resolubilisées.

- Évaluer la concentration en protéines et ajuster à 1mg/mL en utilisant

50mM HEPES-NaOH pH7.5,


6M guanidine HCl,
25mM DTT

Repliement

Les protéines resolubilisées sont diluées aussi vite que possible 1 : 10 dans le tampon de repliement à 4°C:

50mM HEPES pH7.5,


0.2M NaCl,
1mM DTT,
1M NDSB256 (Phorbol 12,13 diacetate).

La concentration finale en protéines ne devrait pas excéder 0,05 à 0,1 mg/ml. Le mélange doit être fait
rapidement. Pour de très petits volumes, on peut directement déposer la suspension protéique dans la
solution de repliement en vortexant. Pour des volumes plus grands, plutôt qu'un vortex, utiliser un
agitateur magnétique vigoureux. Agiter 2 minutes après l'addition. Incuber 1 heure à 4°C. Le reste du
NDSB et de la guanidine peuvent être retirés par dialyse.

Notes

153
- Les paramètres-clés de ce protocole sont la concentration protéique, celle du guanidium résiduel et la
température. Optimiser au besoin.

- Les NDSB (Non-detergent sulfobetaines) sont des agents aidant le repliement des protéines. Ce sont des
zwitterions qui contiennent un groupement sulfobetaine hydrophilique et une courte chaîne
hydrophobique; ils ne peuvent cependant pas former de micelles. Ils aident à réduire l'aggrégation et
facilitent le repliement des protéines dénaturées (on présume que c'est en interagissant avec les
groupements hydrophobes des protéines et en masquant ceux-ci à des groupes similaires sur d'autres
protéines).

Le NDSB 256 est d'habitude un peu plus efficace que le NDSB 201 mais ce dernier est beaucoup moins
cher.

5.6 Séparation et enrichissement

Après avoir choisi une source de matériel et sélectionné une technique d'extraction, vous
voici arrivé à l'étape de la séparation des protéines et de l'enrichissement de celle que vous
voulez purifier.

De façon générale, les premières étapes d'une séparation protéique sont des techniques peu
coûteuses et à capacité élevée. Les techniques demandant des réactifs plus onéreux (des
anticorps, par exemple) sont d'habitude gardées pour plus tard, quand il y a moins de matériel
total et une plus grande proportion relative du matériel qui nous intéresse.

5.6.1 Précipitation différentielle au sulfate d'ammonium

Cette technique utilise la solubilité différentielle des protéines. Comme chaque protéine est
plus ou moins soluble en solution selon sa composition, on peut en séparer plusieurs en
fonction de leur tendance à précipiter plus ou moins vite quand on change la force ionique de
la solution qui les contient.

Une force ionique élevée peut avoir deux effets sur la solubilité: neutraliser certaines charges
ioniques requises en surface pour le maintien de la solubilité, et compétitionner avec les
protéines pour les molécules d'eau disponibles en solution. Quand la concentration en sel est
assez élevée pour priver une protéine des molécules d'eau qui l'hydratent, celle-ci sort de
solution et précipite. C'est ce qu'on appelle le phénomène de salting-out.

Les protéines seront éventuellement toutes précipitées par une teneur en sel assez élevée,
mais certaines d'entre elles seront remarquablement résistantes alors que d'autres
précipiteront très facilement. C'est cette différence de solubilité qui permet de les séparer.

La série de Hofmeister ci-dessous décrit les effets relatifs de différents ions sur la
précipitation des protéines ou la promotion de leurs interactions hydrophobiques. (L'anion
phosphate et le cation ammonium sont est les plus efficaces pour précipiter les protéines;
l'anion chlorate et le cation Ca2+ sont au contraire les plus efficaces pour les remettre en
solution. Notez que ce ne sont pas toutes les combinaisons de ces ions qui donnent un sel
soluble).

154
précipitation PO43- > SO42- > COO- > Cl- > Br- > NO3- > ClO4- chaotropique

(salting out) NH4+ > Rb+ > K+ > Na+ > Cs+ > Li+ > Mg2+ > Ca2+ (salting in)

Le sel le plus utilisé en laboratoire pour précipiter les protéines est le sulfate d'ammonium
(NH4)2SO4. Sa solubilisation n'affecte pas la température de la solution (au contraire du NaCl,
dont la solubilisation exothermique aide à faire fondre la glace dans les rues l'hiver), il ne
dénature pas les protéines et ne coûte pas cher.

Le tableau ci-dessous donne les quantités de (NH4)2SO4 requises pour atteindre le niveau de
saturation à 0°C. (Le tableau indique aussi combien de sel ajouter à une solution qui en
contient déjà).

La procédure suivie d'habitude quand on travaille en aveugle est de préparer quelques


précipitats avec des concentrations croissantes de sulfate (qu'on peut ajouter directement à la
solution protéique):

(1) Ajustement à 20% sulfate Centrifugation et récupération du culot

(fraction C20)

155
(2) Ajustement du surnageant Centrifugation et récupération du culot

à 40% sulfate (fraction C40)

(3) Ajustement du surnageant Centrifugation et récupération du culot

à 60% sulfate (fraction C60)

(4) Ajustement du surnageant Centrifugation et récupération du culot

à 80% sulfate (fraction C80)

(5) Ajustement du surnageant Centrifugation et récupération du culot

à 100% sulfate (fraction C100)

Notre protéine se trouvera dans une des fractions C20, C40, C60, C80 ou C100.

Bien sûr, si on sait à l'avance comment notre protéine réagit au salting-out, on peut viser avec
plus de précision. Si elle précipite à environ 35% sulfate, on fera une première coupure avec
30% sulfate, une deuxième à 40% sulfate, et une dernière (juste au cas) à une teneur en sel
plus élevée. Mais nous saurons déjà que notre protéine se trouve dans la fraction C40, et
qu'elle est débarassée de tout ce qui précipite en-deçà de 30% sulfate et au-delà de 40%.

Les culots de protéines peuvent alors être resuspendus. Ils contiendront cependant encore une
grande quantité de sulfate dont il faut se débarasser.

5.6.2 Dialyse

La méthode la plus utilisée pour changer la concentration en sels d'une solution protéique est
la dialyse. Dans une dialyse, les protéines dans une concentration de sels donnée sont
séparées d'une solution à la concentration en sels différente par une membrane poreuse. Les
pores de cette membrane peuvent avoir différentes tailles; certaines membranes ne laisseront
passer que des ions alors que d'autres laisseront même passer de petites protéines (jusqu'à des
poids moléculaires de 50 000 Da).

Les sels auront tendance à équilibrer leur concentration de part et d'autre de la membrane. En
utilisant un volume de tampon de dialyse beaucoup plus grand que celui de la solution
protéique, on changera rapidement la teneur en sels de celle-ci en la même que celle du
tampon de dialyse.

Afin d'accélérer le processus, il vaut mieux changer souvent le tampon de dialyse pour du
tampon neuf plutôt que d'utiliser une seule quantité (même grande) de tampon. Voyez plutôt:
puisque C1V1=C2V2, la dialyse de 10mL de solution protéique à 500mM dans 1000mL de
tampon de dialyse à 100mM donnera une concentration de 104 mM à l'équilibre.

(500mM x 10 mL) + (100mM x 1000mL) = 1010 mL x 104mM

156
On aurait pu atteindre la même concentration en dialysant dans un plus petit volume et en
changeant le tampon une fois:

dialysat protéique tampon dialyse équilibre

1) (500mM x 10mL) + (100mM x 100mL) = 110mL x 136 mM

2) (136mM x 10mL) + (100mM x 100mL) = 110mL x 103 mM

La vitesse de dialyse dépend beaucoup de la quantité de matériel à dialyser et de la viscosité


des solutions.

Notez que l'eau sera la première à diffuser: il n'est pas rare de voir un tube de dialyse gonfler
progressivement alors que l'eau y pénètre pour en réduire la concentration en solutés.
Attention aux éclatements.

À l'inverse, on peut utiliser des agents hygroscopiques pour concentrer les protéines dans un
sac à dialyse sans en changer la concentration en sels: il faut alors utiliser un tampon de
dialyse de même composition que le tampon se trouvant dans le tube, mais contenant un
agent comme le polyethylèneglycol (ou PEG, un gros polymère hygroscopique) de taille
supérieure à la porosité de la membrane. Le PEG ne pourra pas entrer dans le tube mais il
attirera l'eau qui s'y trouve hors du tube, concentrant du même coup les protéines.

5.6.3 Filtration sur membrane

Je la mentionne ici parce qu'elle peut être utilisée pour changer la salinité d'une solution de
protéines, mais en fait la filtration sur membrane se prête beaucoup mieux à une étape tardive
de la purification qu'au début des opérations.

On y utilise des membranes avec une porosité permettant à certaines substances de passer
(sels, petites molécules, petites protéines). Ces membranes sont le plus souvent vendues sous
forme d'unités de filtration (vous en avez peut-être déjà rencontrées sous le nom de colonne
Centricon),

qui consistent en un tube dont la partie inférieure est séparée de la partie supérieure par la
membrane. Les protéines sont déposées dans la partie supérieure du tube, et reposent sur la
membrane; le tube est alors centrifugé à basse vitesse pour forcer le liquide et les petites
molécules à traverser cette dernière sous le coup de la gravité. Les protéines, trop grosses, ne
peuvent pas passer et restent dans la partie supérieure; on peut ensuite soit les diluer avec un
nouveau tampon et recentrifuger (c'est une bonne technique de lavage) ou récupérer les
protéines concentrées.

Il faut bien sûr ne pas centrifuger si longtemps que tout le liquide ait traversé la membrane.

157
5.6.4 Sédimentation

Vous trouverez beaucoup d'informations sur les principes de la sédimentation à cette adresse:

http://ntri.tamuk.edu/centrifuge/centrifugation.html

Les protéines ont un coefficient de sédimentation défini par leur taille, leur forme et leur
densité. On peut donc les séparer par ultracentrifugation sur des coussins ou des gradients de
sucrose ou d'autres substances.

Dans une centrifugation zonale, l'échantillon est déposé en une mince bande au sommet d'un
tube contenant un tampon présentant un gradient de densité. Les protéines s'enfonceront et se
sépareront dans le gradient en fonction de leur coefficient de sédimentation (les plus lourdes
et denses coulent plus vite). Comme toutes les protéines finiront par arriver au fond du tube,
il faut arrêter la centrifugation avant, puis séparer chaque "étage" du tube (en fait, on
fractionne le contenu du tube en en retirant des volumes égaux à partir du sommet).

Dans ce type de centrifugation, la densité du matériel à séparer excède celle du matériel du


gradient. C'est ce qui permet aux particules de s'y enfoncer sans s'arrêter en cours de route.

Ce genre de séparation est particulièrement approprié pour la préparation de gros complexes


protéiques qui sédimenteront beaucoup plus vite que leurs composantes individuelles. C'est
une des excellenetes façons d'exploiter à notre profit la taille de telles complexes sans
nécessairement avoir recours à une technique de filtration. Les ARN polymérases eucaryotes
ou les facteurs de transcription complexes comme TFIIH se prêtent particulièrement bien à la
purification par fractionnement sur gradient.

Dans une centrifugation isopycnique, maintenant, le gradient de densité couvre un spectre qui
inclue la densité de toutes les particules à séparer. Le matériel "flottera" alors dans le gradient
à un niveau où sa densité est égale à celle du milieu ambiant.

L'ADN a longtemps été préparé sur des gradients isopycniques de chlorure de césium. On
peut aussi séparer les protéines sur CsCl. (Le CsCl forme spontanément un gradient dans un
tube quand il est centrifugé à haute vitesse pendant 24-48hrs parce que les atomes lourds Cs+
ont tendance à decendre au fond). Comme ce gradient se forme spontanément, les particules à
158
séparer peuvent être mélangées directment au CsCl avant la mise en tube: l'établissement du
gradient de CsCl et la séparation isopycnique des particules se feront en même temps pendant
la centrifugation.

Le Percoll, une substance développée par Amersham Biocsciences, est une suspension de
billes de silice couvertes de polyvynipyrrolidone. Comme les billes ont une taille hétérogène,
le Percoll peut lui aussi spontanément former un gradient quand il est centrifugé assez
longtemps, On s'en sert pour la séparation isopycnique d'organelles cellulaires ou de virus.

Il est possible de préparer une centrifugation isopycnique avec un gradient préparé à l'avance:
il faut alors s'assurer de ce que la partie la plus dense du gradient excède la densité du
matériel que l'on veut voir se stabiliser dans sa migration en fonction de sa densité propre.

On a souvent recours à un type de gradient isopycnique utilisant un gradient discontinu de


sucrose: un coussin à haute teneur en sucrose (mettons 80%) se trouvera dans le fond du tube,
avec un coussin de 50% par dessus, puis un coussin de 25%, puis un coussin de 10%. Les
particules qui traversent un coussin pourraient être arrêtées à la surface du suivant.

Différents types de gradients permettant la séparation de particules en fonction de leur


densité. Une centrifugation isopycnique utilise un tampon avec gradient de densité incluant
les densités de toutes les particules à séparer. Les particules vont donc se stabiliser à un
point du gradient égal èà leur propre densité. En (A), on utilise dans le tampon un agent
comme le CsCl qui forme spontanément un gradient pendant la centrifugation; le matériel à
séparer peut lui être directement mélangé. En (B), on utilise dans le tampon un gradient
préformé (par exemple de sucrose) et le matériel est déposé au sommet. Les particules à
séparer s'enfoncent jusqu'à leur point isopycnique (ou de même densité). En (C), on voit que
le résultat est le même en bout de course. En (D), on prépare un gradient discontinu en
supreposant des coussins de densité différente. Le matériel est déposé en haut et centrifugé.
En (E), on voit que les particules s'enfoncent jusqu'à la frontière d'un coussin dont la densité
excède la leur. La centrifugation zonale utilise un coussin ou un gradient dans lequel les
particules s'enfoncent plus ou moins vite en fonction de leur coefficient de sédimentation.

159
Comme la densité maximale du gradient ne dépasse pas celles des particules, celles-ci
s,enfonceraient toutes jusqu'au fond si on ne les arrêtait pas avant.

5.6.5 Filtration sur gel

Il s'agit ici d'une séparation des protéines selon leur taille utilisant un tamis moléculaire. Une
colonne de chromatographie pour filtration sur gel est remplie d'une résine consistant en
billes creuses et poreuses. La taille des pores de ces billes est telle que certaines protéines
(petites) peuvent entrer et sortir à leur guise; que certaines (plus ou moins grosses) peuvent
essayer d'entrer mais avec plus ou moins de succès, alors que d'autres (trop grosses) ne
peuvent pas entrer du tout et passent tout droit.

Les plus grosses protéines, celles qui passent carrément entre les billes, sortent en premier de
la colonne. Les autres sont retardées par leurs interactions avec les billes; les plus petites
protéines, qui peuvent entrer et sortir à leur guise, sont les dernières à quitter la colonne.

Nom de la résine Capacité de fractionnement (en


Da)
type dextran

Sephadex G-10 700


Sephadex G-25 1 000- 5 000
Sephadex G-75 3 000- 70 000
Sephadex G-200 5 000- 800 000

160
type polyacrylamide

Bio-gel P2 200- 2 000


Bio-gel P6 1 000- 6 000
Bio-gel P-150 15 000- 150 000
Bio-gel P-300 60 000- 400 000
type agarose

Sepharose 2B 2 000 000- 25 000 000


Sepharose 4B 300 000- 3 000 000
Bio-gel A-0,5M 30 000- 500 000
Bio-gel A-15M 30 000- 15 000 000
Bio-gel A-150M 5 000 000- 150 000 000

Cette technique est très efficace mais nécessite une haute concentration et un faible volume
de matériel de départ parce que les protéines ont tendance à s'étaler le long de la colonne, ce
qui réduit la qualité de leur séparation si elle n'y entrent pas relativement toutes en même
temps.

Cette colonne peut aussi être utilisée pour dessaler un échantillon.

La forme d'une colonne de filtration devrait être étroite et longue pour une meilleure
séparation.

La filtration sur gel se fait avec un tampon dont la nature ne change pas pendant la séparation,
à l'inverse de ce qui se passe dans une chromatographie d'échange d'ions. Les protéines
assemblées en complexes macromoléculaires (comme par exemple les ARN polymérases, qui
comptent un grand nombre de sous-unités) ont donc plus de chances de rester assemblées,
puisqu'on n'interfère pas avec les interactions entre les différentes sous-unités.

161
5.6.6 Échange d'ions

Dans une colonne à échange d'ions, les protéines collent par affinité électrostatique à des
groupements chargés de la résine. Une résine portant des groupements positifs est dite
"échangeuse d'anions", parce que des ions négatifs ou les groupements acides d'une protéine
peuvent interagir avec. Une résine portant des groupements négatifs est dite "échangeuse de
cations" parce que ce sont des cations ou les groupements basiques d'une protéine qui
interagissent avec elle.

On fera décoller les protéines d'une telle résine en augmentant progressivement la force
ionique du tampon d'élution, ou en changeant le pH de telle façon que la protéine soit moins
chargée. Un gradient salin permet de séparer les protéines selon leur degré de charge positive
ou négative à un certain pH et est une étape de choix dans une purification.

On peut même effectuer les deux types de chromatographie d'échange d'ions, car une même
protéine aura souvent des charges positives et des charges négatives distribuées de façon
inégale. À l'inverse de ce qui se passe en électrophorèse, ici, ce n'est pas la charge nette de la
protéine qui compte mais la capacité de ses résidus chargés d'interagir avec la résine.

Comme on veut favoriser l'interaction de la protéine avec la résine choisie, on aura avantage
à jouer avec le pH de la solution tampon qui circule dans la colonne. Pour une résine
échangeuse de cations (monoS ou phosphocellulose, par exemple), on voudra optimiser la
charge positive de la protéine et donc travailler à un pH plus bas, histoire de bien former des
groupements -NH3+ et -COOH plutôt que -NH2 et -COO-. Un tampon HEPES à pH 7,5 serait
approprié. À l'inverse, pour une résine échangeuse d'anions (monoQ ou DEAE), on utilisera
plutôt un tampon basique comme le Tris à pH 8,2, histoire de favoriser la formation de
groupements -COO- et de réduire la présence de groupements NH3+.

La résine n'a pas à être utilisée en colonne. On peut la mettre au fond d'un bécher et y ajouter
la solution de protéine (ce qui est pratique dans les premières étapes d'une purification si on a
de très grands volumes de matériel). On peut aussi ménager la chèvre et le chou et mettre les
protéines en contact avec la résine dans un bécher ou un tube, effectuer des lavages à faible
force ionique dans le même récipient, puis déposer la résine dans une colonne vide pour
procéder à une élution plus contôlée.

162
Il existe une très grande variété de résines échangeuses d'ions, variant les groupes chargés
comme la nature des supports solides. Des colonnes pré-empaquetées sont aussi disponibles
et sauvent un temps précieux. Le catalogue Amersham Biosciences www.amersham.com
présente un grand inventaire de telles résines et colonnes.

5.6.7 Interactions hydrophobes

En solution, les protéines à caractère hydrophobe cherchent davantage à s'associer entre elles
qu'à s'hydrater avec les molécules d'eau.

Des résines portant des groupements hydrophobiques (cycliques ou aliphatiques) permettent


de retenir de telles protéines sur une colonne. À l'inverse de ce qui se passe sur une colonne
de chromatographie par échange d'ions, une colonne de chromatographie d'interaction
hydrophobe est chargée à haute force ionique (qui favorise les interactions hydrophobes) et
est éluée avec un gradient de sel à la baisse. Grâce à cela, on peut faire passer un échantillon

163
frais élué (avec une haute concentration en sel) d'une colonne d'échange d'ions directement
sur une colonne d'interaction hydrophobe, sans avoir à dialyser ou diluer.

Les résines les plus utilisées pour ce type de chromatographie sont l'octyl- et le phényl-
sépharose.

5.6.8 Hydroxyapatite

L'hydroxyapatite est du phosphate de calcium cristallisé comme nos dents en contiennent.


Cette substance retient les protéines de deux façons: son calcium interagit avec les
groupements acides des protéines alors que son phosphate interagit avec leurs groupements
aminés. L'élution n'est pas ici faite avec un gradient de sel mais plutôt avec un gradient de
phosphate ou de potassium pour compétitionner ces interactions.

5.6.9 Chromatographie d'affinité

Dans une telle technique, on a recours à l'affinité de certaines molécules pour d'autres. On
pourra ainsi fixer des anticorps sur une matrice solide dans une colonne (Protéine A-
sépharose, par exemple) et faire passer notre échantillon sur la colonne pour y attraper les
protéines reconnues par l'anticorps.

On a souvent recours à des colonnes dont la matrice porte des fragments spécifiques d'ADN
pour aller pêcher les protéines liant l'ADN. Le bromure de cyanogène (CNBr) est l'un des
réactifs utilisés pour coupler ainsi une cible à la matrice d'une colonne.

Plusieurs protéines de fusion ont des étiquettes permettant de reconnaître et de fixer des
résines spécialement adaptées. Une telle étiquette est la glutathione-S-transférase, qui permet
164
à la protéine à laquelle elle est fusionnée de se fixer sur une résine de glutathione-sépharose.
La chitin-binding-protein (CBP) fait la même chose pour une résine couplée à de la chitine,
un polymère de N-acétylglucosamine.

Les lectines comme l'agglutinine de germe de blé (WGA, pour wheat germ agglutinin) ont la
très utile capacité de permettre l'adsorption de protéines glycosylées. Le WGA lie le N-
acétylglucosamine; la concanavalin A (Con A) lie le mannose et le glucose

Puisque la chromatographie d'affinité repose sur l'interaction entre deux ou plusieurs


molécules, on devine que seule l'imagination limite ses possibilités de combinaison. Il suffit
de disposer de deux substances qui ont de l'affinité l'une pour l'autre et d'en fixer une sur un
support solide.

Résine Affinité pour...

Calmodulin sepharose 4B ATPases


5' AMP sepharose 4B kinases dépendantes de l'ATP
DNA-agarose ADN polymérases, protéines liant l'ADN
Colonnes d'héparine Lipases, protéines liant l'ADN
Poly(U) sepharose Transcriptase réverse, ARNm
Arginine sepharose 4B Sérine protéases
Lysine sepharose 4B ARNr

165
Cibacron blue F3G-A enzymes nécéssitant des nucléotides
ConA Sepharose 4B glycoprotéines contenant du -D-mannose, du -
D-glucose et des sucres similaires
Wheat germ Lectin Sepharose glycoprotéines contenant du N-acetyl- -D-
glucosmine

On retrouve dans le commerce des résines d'affinité déjà faites. En voici quelques unes
vendues par la compagnie Amersham.

On en retrouve d'autres sur le site de la compagnie.

Des résines "pré-activées" et prêtes à recevoir un ligand pour former une nouvelle résine
d'affinité existent aussi.

Résine Groupe à coupler

CNBr-activated Sepharose 4B -NH2


EAH Sepharose 4B -COOH
Activated thiol sepharose 4B -SH
rProtein A sepharose Partie Fab des anticorps

5.6.10 IMAC (immobilized metal affinity chromatography)

166
Ce type de chromatographie d'affinité fait appel à l'immobilisation, sur une résine, d'un atome
métallique comme le nickel ou le cobalt. Cet atome immobilisé peut établir des liens de
coordination avec certains polypeptides, comme par exemple une chaîne d'histidines.
L'étiquette 6-His est justement ajoutée aux protéines pour que ces dernières soient plus
aisément purifiées par chromatographie d'affinité pour le métal.

Dans la figure ci-dessous, une résine IMAC populaire (nickel- nitriloacetic acid ou nickel-
NTA) utilise un ion de nickel comme site actif. L'ion Ni2+ possède six liens de coordination.
Quatre sont sollicités par le NTA pour l'immobiliser sur la résine; il en reste donc deux pour
interagir avec les atomes d'azote du cycle de la chaîne latérale de deux résidus histidines.

À pH <6, les résidus histidines commenceront à être réduits et ne pourront plus lier le nickel.
On peut donc utiliser une variation de pH pour faire décoller les protéines. Cependant, la
technique d'élution la plus usuelle (plus douce) se fera à l'aide d'un composé qui
compétitionnera avec l'histidine pour le nickel: l'imidazole.

Imidazole, un composé compétitionnant avec l'histidine pour


permettre l'élution de protéines d'une colonne d'affinité pour le
métal immobilisé.

Le nickel peut être chélaté par l'EDTA et l'EGTA, aussi ces composés doivent être utilisés
avec parcimonie (et selon les instructions du fournisseur en résine). Les agents réducteurs
peuvent aussi avoir un effet néfaste et doivent aussi être utilisées selon les instructions du
manufacturier (qui a généralement amplement testé sa résine)!

Comme une étiquette multi-histidines est très petite, facilement clonable à l'extrémité N' ou
C' d'une protéine, qu'elle permet la purification par affinité et peut être reconnue par des
anticorps spécifiques disponibles commercialement, elle est un excellent choix de
modification mineure facilitant la purification d'une protéine recombinante. Son aléa majeur

167
est qu'il existe des protéines contenant naturellement des séquences répétées d'histidines; il
faut donc se débarasser de celles-ci par une autre étape. (une recherche BLAST sur le
protéome de S. cereviasiae révèle 15 protéines avec au moins six histidines d'affilée). Pour de
telles protéines, une colonne IMAC peut servir de colonne d'affinité même sans l'ajout d'une
étiquette.

5.6.11 Système de chromatographie

La figure ci-dessous décrit un système de base de chromatographie (il est inspiré du système
FPLC d'Amersham Biosciences).

Le coeur de ce système est évidemment la colonne. Elle est reliée au reste du système de
façon à ce que le tampon la traverse de haut en bas. Ce tampon provient de réservoirs situés
tout au bout en amont du système. On a ici représenté deux tampons différents (A et B) reliés
chacun à une pompe (A et B), même si bien entendu il est possible de faire fonctionner ce
système avec un seul tampon et une seule pompe. L'avantage d'en avoir deux est qu'on peut
programmer le système pour pomper progressivement plus d'un tampon que de l'autre,
générant ainsi un gradient. (D'ordinaire, les deux tampons ont la même composition sauf pour
la concentration en sel; faire varier la proportion de l'un par rapport à l'autre pendant la
chromatographie génère un gradient de force ionique dans la colonne).

Chaque pompe est reliée au mélangeur, une chambre où s'effectue le mélange des deux
tampons. Le tampon de chromatographie passe ensuite dans le distributeur, qui l'enverra soit
vers la colonne, soit vers une autre destination. C'est aussi dans le distributeur qu'on déposera
l'échantillon à chromatographier; le distributeur le dirige vers la colonne.

En aval de la colonne, on installe d'habitude un conductimètre, qui enregistre la conductivité


du tampon (et donc sa concentration en sel) et une cellule spectrophotométrique qui
enregistre l'absorbance aux UV pour détecter le passage des protéines. L'éluat de la colonne
est ensuite recueilli en petites fractions par un collecteur.

168
La figure ci-dessous nous montre ce à quoi ressemble l'enregistrement de la densité optique
de l'éluat en fonction du temps pendant une chromatographie d'échange d'ions avec un
gradient de sel.

Le conductimètre a enregistré le passage d'une concentrations en ions de plus en plus élevée


avec le temps. Les protéines, elles, décrochent de la colonne en fonction de l'effet qu'a ce
gradient de sel sur leur interaction avec les groupements chargés de la colonne. Les protéines
du pic 1 décrochent avant les protéines du pic 8; c'est donc que leur interaction avec la
colonne était plus faible.

Remarquez que les pics ont des formes différentes. La plupart d'entre eux reflètent sûrement
la présence de plusieurs protéines différentes, surtout si cette chromatographie a été pratiquée
en début de purification. On remarquera aussi que certains pics sont fusionnés: ainsi, le pic 2
court presque à la même place que le pic 3 et lui donne une épaule. On trouve une autre
épaule, beaucoup plus importante, dans le pic 8; cependant, dans ce cas, l'épaule peut
simplement être due à la très grande taille du pic.

5.6.12 HPLC

High performance liquid chromatography: il s'agit d'une technique permettant de séparer les
protéines (entre autres) avec une très grande résolution.

En gros, un système HPLC ressemble au système vu ci-haut: les différences majeures seront
que la colonne est généralement en acier et que le tampon de chromatographie (le solvant) est
sous haute pression pendant la séparation.

Plusieurs types de séparation sont possibles en HPLC. La chromatographie d'échange d'ions


et la filtration sur gel s'y pratiquent selon les mêmes principes qu'avec une chromatographie
"low pressure" (même si à strictement parler, ce n'est pas un "gel" qu'on trouve ici dans la
colonne pour effectuer la filtration).

On distingue souvent en HPLC la chromatographie en phase normale de la chromatographie


en phase inverse. En phase normale, la matrice de la colonne est très polaire (de style silice,
par exemple) et la phase mobile (le solvant) est non-polaire (n-hexane, par exemple). En
phase inverse, vous l'avez deviné, c'est le contraire: la matrice de la colonne est non-polaire

169
ou hydrophobique et le solvant est polaire (eau, méthanol, acétonitrile). C'est le pendant à
haute pression de la chromatographie à interaction hydrophobe.

Le HPLC se distingue par le très petit diamètre de ses colonnes (moins de 5 mm); un flot à
haute pression de solvant; la capacité de séparer et détecter de très petites quantités; et
finalement une très haute résolution.

Sur le sujet du HPLC, je vous recommande le livre en ligne des Drs Yuri Kazakevich et
Harold McNair.

5.6.13 Techniques de précipitation

On a souvent recours à une précipitation d'un aliquot de notre préparation pour des fins
analytiques (pour mettre les protéines sur gel, par exemple). Il existe plusieurs techniques
rapides et fiables pour précipiter les protéines. Je recommanderais de se tenir loin de toutes
celles qui utilisent le triethanolamine, cependant, à cause de son odeur de latrines de métro.

Voici deux protocoles rapides et efficaces ne demandant que très peu de manipulations.
Attention à vos doigts: ils sont couverts de kératine qui va promptement contaminer vos
échantillons si vous n'y prenez garde! Le port de gants de laboratoire est de rigueur.

Précipitation des protéines à l'acide trichloroacétique

1- ajuster les protéines à 25% TCA (trichloroacetic acid)

2- Laisser précipiter 30 minutes sur glace

3- Centrifuger 10 minutes (microfuge, 14 000 rpm)

4- Laver avec 300 uL de 5mM HCl dans l'acétone (au vortex)

5- Centrifuger 5 minutes

6- Laver à l'acétone pure (vortex)

7- Centrifuger 5 minutes

8- Les protéines sont dans le petit culot.

Précipitation des protéines au méthanol

1- À 100 uL de protéines, ajouter 400uL de méthanol (vortex).

2- Ajouter 100 uL de chloroforme (vortex)

3- Ajouter 300 uL H2O (vortex)

4- Centrifuger 2 minutes (microfuge, 14 000 rpm)

170
5- Les protéines sont à l'interface. Retirer la phase supérieure et jeter.

6- Ajouter 300 uL de méthanol au reste du mélange.

7- Centrifuger 2 minutes (microfuge, 14 000 rpm)

8- Les protéines sont dans le petit culot.

5.6.14 Pontage

Les protéines s'associent souvent à d'autres molécules. Il est indispensable parfois de pouvoir
préserver ces associations pendant une purification. Bien qu'il soit parfois possible d'utiliser
certaines méthodes douces préservant les associations en questions, très souvent on doit
s'assurer qu'elles tiennent bon en les aidant un peu à l'aide d'un traitement chimique.

Un exemple de pontage entre les sous-unités d'une protéine est donné ci-dessous. Dans ce cas
on a eu recours au DMS, ou diméthylsuberimidate. (Ne pas confondre avec un autre DMS, le
diméthylsulfate ou encore avec le DMSO, le diméthylsulfoxide). Il est possible que toutes les
sous-unités ne soient pas pontées en même temps, mais à l'analyse on peut déduire la nature
de leurs interactions.

Ici, comme on découvre sur gel SDS des bandes correspondant à des complexes des sous-
unités 1-2-3, des sous-unités 1-2 et 1-3 mais pas des sous-unités 2-3, on pourrait conclure que
la sous-unité 1 contacte les deux autres dans l'holoenzyme, mais que les sous-unités 2 et 3
n'ont pas de contact direct.

171
6.0 Étude des protéines modifiées
6.1 Généralités

Que faire de nos protéines maintenant qu'elles sont purifiées? Ce que nous voulons! Mais
certaines méthodes d'analyse se retrouvant plus souvent que d'autres dans la littérature
scientifque, c'est à elles que nous prêterons maintenant attention.

Vous noterez que nous ne nous attardons pas trop aux principes physiques sur lesquels
reposent les techniques de spectrométrie. Ces sujets dépasseraient le propos de ce cours, aussi
nous nous limiterons à expliquer la base de chaque méthode et à comprendre comment les
utiliser dans le cadre d'un projet de biologie moléculaire.

6.2 Spectrométrie de masse


Voici une adresse fort utile pour être initié aux principes de la spectrométrie de
masse par le Dr Alison Ashcroft de l'université de Leeds

Vous ne pouvez pas vous tromper non plus en visitant le site de l'université de
l'Arizona.

En un mot, un spectromètre de masse c'est une balance. Il ne fonctionne pas du tout


comme une balance, mais c'est tout de même ce qu'il est. Vous lui donnez un
échantillon, et il va vous donner un poids -mais d'une manière vraiment précise...
Pour une protéine de 40 000 Da, le spectromètre de masse peut vous indiquer un
poids qui n'aura une marge d'erreur que de 4 Da!!! C'est amplement suffisant pour
détecter le changement d'un acide aminé en un autre, ou encore la présence d'un
groupement hydroxyl supplémentaire.

Mieux encore, si vous avez accès à une information génomique complète (comme
c'est le cas pour de plus en plus d'organismes dont les génomes ont été séquencés)
vous pouvez utiliser le spectromètre de masse pour identifier des protéines. Ainsi, si
vous digérez la protéine XYZ (encore inconnue) à la trypsine et que vous en
analysez les fragments par spectrométrie de masse, vous recevrez une liste de
poids moléculaires. Un ordinateur peut facilement comparer les poids de cette liste
avec les poids de toutes les séquences polypeptidiques codées par les cadres de
lecture du génome qui nous intéresse, et identifier celles qui coïncident. Quand vous
entendez un biochimiste dire qu'il a découpé une bande d'un gel SDS et l'a envoyé
en mass spec, c'est tout juste ce qu'il a fait.

Il existe plusieurs types de spectromètres de masse. Ils portent des noms


comprenant des sigles ésotériques comme TOF (time of flight), MALDI (matrix
assisted laser desorption), ESI (electrospray ionisation), APCI (atmospheric pressure
chemical ionisation), EI (electron impact), CI (chemical ionisation), FAB (fast atom
bombardment), FD/FI (field desoprtion/ field ionisation), TSP (thermospray
ionisation), Q (quadrupole), FT-ICR (Fourier transform-ion cyclotron resonance) etc.;
ces sigles sont souvent combinés entre eux pour refléter la nature de l'appareil ou ce
à quoi ils sont connectés (LC-MS = liquid chromatography -mass spectrometer, etc).

172
Le principe général de la spectrométrie de masse repose sur une ionisation du
matériel et au voyage du matériel chargé vers un détecteur. On distingue plusieurs
systèmes de spectrométrie de masse selon la technique d'ionisation et la technique
de détection.

6.2.1 Ionisation

6.2.1.1 EI (electron ionization, jadis electron impact)

Ici, on utilise la chaleur pour faire perdre des électrons à un filament de tungstène ou
de rhénium dans lequel passe un courant électrique. Ces électrons sont emportés
par un champ magnétique induit par un aimant, ce qui cause la formation d'un
faisceau d'électrons avec lequel les particules gazéifiées de notre échantillon vont
entrer en contact. L'impact va briser les protéines en plus petits peptides et les
ioniser.

À basse énergie (environ 20 eV), les électrons ne résussissent pas à provoquer une
ionisation. À environ 70 eV, le transfert d'énergie entre les électrons et les molécules
organiques analysées est maximisé, ce qui favorise l'ionisation des peptides.

6.2.1.2 FAB (Fast atom bombardment)

Ici, c'est un faisceau d'atomes de gaz (argon ou xénon) de haute énergie (4-10 KeV)
qui bombarde la substance à analyser. Cette énergie est transmise à nos peptides
qui sont ejectés sous forme ionique (positive et négative). Si la source d'accélération
(les deux éclairs dans la figure ci-haut) induit un courant positif, ce sont les ions
négatifs qui seront accélérés vers le détecteur; si le courant induit est négatif, ce
seront les ions positifs.

6.2.1.3 ESI (electrospray)

Ici, l'échantillon est d'abord soumis à un fort champ magnétique pour en ioniser les
molécules. Celles-ci sont pulvérisées dans la chambre d'ionisation sous la forme de
microgouttes pleines d'ions (comme si elles sortaient d'un pouiche-pouiche pour
arroser les plantes), gouttes qui sont rapidement déshydratées par un courant de
gaz chauffé (il s'agit le plus souvent d'azote). Le solvant disparaissant, les ions de

173
même charge dans les gouttes finissent par ne plus pouvoir se supporter, la faisant
exploser en plusieurs gouttelettes plus petites. Le processus se répète jusqu'à ce
qu'il n'y ait plus de solvant du tout, laissant des ions "nus" dans les airs.

Les charges sont distribuées sur les peptides de façon statistique; un même peptide
peut en porter plusieurs. Un séchage plus rapide des gouttelettes favorise la multi-
ionisation.

Une sectrométrie de masse utilisant l'ESI présente souvent ses résultats sous forme
de m/z (ou masse / charge) pour présenter la proportion des différentes formes
chargées d'un même peptide.

Le graphique ci-haut présente la distribution des ions détectés par un spectromètre


de masse et distribués selon leur ration m/z. Comme la valeur de z (la charge) ne
peut être qu'un nombre entier, il devient assez facile de déterminer quelle était la
masse du peptide initial qui a fourni tous les ions. Dans ce cas-ci, on devine que ce
peptide avait une masse de 1200 (car 1200/2=600; 1200/3=400; 1200/4=300;
1200/5=240; 1200/6=200 et 1200/7=171 et des poussières). Si l'ionisation avait été

174
particulièrement efficace et qu'on n'avait pas eu d'ions monovalents, le pic m/z de
1200 n'aurait pas été là. Malgré cela, on aurait quand même pu déterminer que le
peptide initial avait une masse de 1200 en identifiant le ppcm (le plus petit commun
multiple, comme on disait à la petite école!) de 171, 200, 240, 300, 400 et 600.

Le site suivant explique l'interprétation d'un spectre d'ESI.

6.2.1.4 MALDI (matrix-assisted laser desorption ionisation)

Ici, l'échantillon est d'abord associé à une matrice de telle façon que chaque molécule de
peptide soit séparée de ses voisines. Les peptides et la matrice doivent former une "solution
solide" (un mélange qu'on a laissé sécher jusqu'à ce qu'il forme un biscuit, en quelque
sorte!) dont tout le liquide a été retiré. L e s composés les plus populaires pour la
composition de la matrice sont l'acide sinapinique, l'acide alpha-cyano-4-hydroxycinnamique
et l'acide 2,5-dihydroxybenzoïque. Ces molécules ont un poids moléculaire assez faible pour
permettre leur vaporisation quand on les excite avec assez d'énergie, mais aussi assez
élevé pour prévenir leur évaporation spontanée pendant ou après la préparation de
l'échantillon. Elles sont en outre acides, ce qui facilite la protonation des peptides, et
absorbent la lumière UV (ce qui joue un rôle crucial dans l'étape suivante).

L'échantillon est ensuite zappé avec un laser UV. L'énergie du laser est absorbée en
quelques nanosecondes par la matrice qui chauffe très rapidement. Comme les
peptides de l'échantillon sont associés à un nombre bien plus grand de molécules de
la matrice, ce sont ces dernières qui absorbent le gros de l'énergie; les molécules
peptidiques ne sont donc pas endommagés par le laser. Cette excitation énergétique
a plusieurs effets. Elle cause d'abord la désoprtion de certains peptides qui sont
expulsés. De plus, le transfert subit d'énergie de la matrice aux peptides peut les
ioniser. (On peut observer des transferts de protons de la matrice vers les peptides;
on peut aussi voir les peptides perdre des électrons ou en gagner. Le choix de la
matrice joue un rôle important sur l'état ionique final de l'échantillon).

Comme toute cette opération se déroule entre une anode et une cathode, les ions
sont ensuite propulsés en direction de l'électrode portant une charge inverse à la
leur -et vers un détecteur. (Les peptides peuvent, mentionnons-le, porter de
multiples charges; quoique dans le cas du MALDI, les peptides n'en portent
d'habitude qu'une seule).

175
6.2.2 Détection

6.2.2.1 TOF (time of flight)

Cette technique prend en considération le temps que met un ion pour parcourir le
chemin de la chambre d'ionisation au détecteur. Les ions plus gros mettent plus de
temps que les plus petits.

Elle ne semble pas limitée par la taille des ions et est extrêmement précise. Elle est
souvent combinée avec une méthode d'ionisation rapide comme le MALDI, qui
permet de savoir exactement quand les particules ont pris leur envol à cause de la
vitesse du processus MALDI (un rayon laser voyage en effet à la vitesse de...ah,
vous le saviez déjà).

6.2.2.2 Analyse par double focus

Cette technique (aussi appelée sector analysis) permet de focuser les ions de même
charge et de même masse mais ayant un niveau d'énergie différent, ce qui
augmente la résolution de la détection des ions de même nature.

6.2.2.3 Q (quadrupole)

un spectromètre Q utilise des champs


électriques pour séparer les ions selon leur
masse et leur charge. Le quadrupole consiste
en quatre fils parallèles formant les arètes d'un
quadrilatère: deux sont positifs, deux négatifs.

Dépendant des champs électriques produits avec le courant passant dans les fils,
seuls les ions avec un ratio m/z particulier se rendront jusqu'au détecteur au bout du
quadripole. Les autres seront déviés sur les fils. En variant la force et la fréquence
des champs, différents ions seront détectés, nous donnant ainsi leur spectre de
masse. Ne vous fiez pas à la grosse flèche droite de la figure, qui ne vous indique
que la direction générale. La course d'un ion dans un quadripole ressemble plus à
celle d'une abeille saoûle.

176
6.2.2.4 FT-ICR (Fourier transfrom ion cyclotron resonance).

Ici, un piège à ions dans un champ magnétique statique et uniforme dans l'espace
force les ions à adopter une orbite circulaire dans ledit champ; la fréquence de cette
orbite dépend de la masse, de la vitesse et de la charge de l'ion. Des détecteurs
suivent la course des ions et permettent d'en déterminer ces paramètres.

6.2.2.5 Piège à ions (ion trap)

Dans ce piège à ions, un autre type de quadrupole est capable de capturer les
particules ionisées selon leur masse et leur charge, ainsi que selon le courant qu'on
fait passer dans le quadrupole. C'est la trajectoire des ions capturés dans des
conditions données de potentiel au niveau du quadrupole qui donne les informations
sur m et z.

6.2.3 Autres techniques de spectrométrie de masse

6.2.3.1 MS/MS ou MSn

Cette technique commence par séparer les ions en les faisant passer à travers une
série de trois quadrupoles qui sont réglés pour ne laisser passer que certains ions
vers le détecteur (par exemple, un certain peptide tryptique). Un MS laisserait
normalement passer tous les peptides issus d'une digestion protéique, et nous
donnerait le poids de chacun. Dans le MS/MS, on commence par n'en laisser passer
qu'un.

Le peptide qui réussit à passer entre dans une chambre où il est frappé par des
molécules de gaz chargées qui brisent sa chaîne peptidique en un ou plusieurs
endroits. Ces bris font en sorte que ce sont des morceaux du peptide tryptique qui
finissent par arriver au détecteur. En sachant le poids théorique du peptide tryptique
au départ et en comparant les poids des différents petits peptides qui en sont issus,
on peut établir l'ordre des résidus contenu dans le fragment initial. Cette technique
de MS/MS permet donc de séquencer un petit peptide.

177
6.3 Dichroïsme circulaire

La spectroscopie par dichroïsme circulaire nous permet d'étudier la structure


secondaire (hélices, feuillets, etc.) de polypeptides et de protéines en solution. Cette
technique utilise peu de matériel et ne le détruit pas. Les changements dus aux
conditions ambiantes de pH, d'agents dénaturants et de température peuvent y être
facilement monitorés.

La technique repose sur la capacité qu'on les structures optiquement actives


d'absorber de façon inégale la lumière polarisée circulairement à droite de la lumière
polarisée circulairement à gauche.

Une minute... "lumière circulairement polarisée?" vous demandez-vous. Qu'est-ce


que c'est encore que cette diablerie?

Vous êtes probablement


familiers avec la théorie
ondulatoire de la lumière. Une
onde lumineuse d'une certaine
amplitude voyage dans une
direction donnée avec une
forme sinusoïdale. L'angle des
pics de l'onde par rapport à
l'axe de sa propagation peut
avoir n'importe quelle valeur,
mais il est possible de
sélectionner un angle
particulier grâce à un filtre
polarisant (polaroïd).
Consistant en de longues
molécules alignées dans une
direction précise, un tel filtre
ne laisse passer que les
oscillations d'une onde
électromagnétique orientées
de même façon (dans son axe
de transmission).

Maintenant, si nous combinons deux rayons lumineux polarisés à 90° l'un de l'autre
mais se propageant dans la même direction. On obtiendra les ondes suivantes:

178
La résultante des deux ondes est une autre onde sinusoïdale située entre les deux
premières. Chaque pic de l'une correspond au pic de l'autre, et chaque noeud de
l'une arrive au même point que pour l'autre. Mais si notre filtre (un modulateur
photoélastique), en plus de laisser passer ces deux ondes, les déphase en plus
d'une valeur de π/ 2, le résultat sera tout autre. La résultante sera une spirale.

Dans L'exemple ci-dessus, on a retardé l'onde verticale bleue d'un quart de longueur
d'onde (λ / 4, ou encore π / 2 radiants) pour une résultante en hélice de pas droit. Si
on avait plutôt avancé l'onde bleue de π / 2 par rapport à la rouge, on aurait obtenu
une hélice de pas gauche. Pour une démonstration animée, veuillez vous référer à
l'excellent site suivant.

Les structures secondaires n'absorbent pas de façon égale la lumière polarisée


circulairement vers la droite et la lumière polarisée circulairement vers la gauche. On
raisonnera que l'absorption préférentielle de l'une de ces deux polarisations résultera
en une déviation de la résultante (au lieu d'un cercle, le tracé de la résultante entre
la spirale tournant à droite et la spirale tournant à gauche donnera une ellipse).

179
Cette déviation est appelée dichroïsme circulaire. Elle permet d'établir un spectre
(appelé CD spectra en anglais) de forme caractéristique pour trois structures
secondaires retrouvées dans les protéines: l'hélice, le feuillet et la forme aléatoire
(ou random coil), qui chacune présentent des asymétries structurales.

Le spectre CD est particulièrement approprié pour juger rapidement de l'état de


repliement d'une protéine (ses hélices sont-elles bien hélicales comme prévu?); pour
comparer la structure de protéines obtenues de sources différentes; pour analyser
l'impact de mutations ponctuelles surt la structure d'une protéine; pour juger de la
stabilité de la structure face à des changements environnementaux (pH, salinité);
pour déterminer l'impact sur la structure de la présence d'un cofacteur comme un le
zinc ou la magnésium.

On peut aussi suivre au fur et à mesure qu'il se déroule le déploiement d'une


protéine au fur et à mesure qu'on la soumet à un traitement dénaturant.

La forme du spectre obtenu pour une protéine


peut être décomposée en ses trois
composantes:

(a) hélicale,

(b) en feuillet,

(c) aléatoire.

Chaque composante donne une courbe


spectrale caractéristique.

(Voir le site suivant pour plus d'information.

180
La stabilité thermique d'une protéine peut être évaluée en suvant le comportement
de sa structure à différentes températures; cette opération peut aussi se faire de
façon continue avec un spectre de températures à une longueur d'onde fixe.

La dénaturation d'une protéine risque d'être irréversible. Le CD nous permet de la


suivre "en direct", et de juger si elle est encore réversible. Trouver les conditions
dans laquelle une protéine peut plus facilement retrouver son état premier après une
dénaturation partielle peut nous être d'un grand secours pour la conserver
longtemps.

6.4 Spectroscopie par Résonance Magnétique Nucléaire (RMN)

On utilise la RMN pour étudier la structure de petites protéines (jusqu'à 30 KDa


environ) en solution sans avoir besoin à les cristalliser. La RMN utilise le spin des
particules subatomique pour nous renseigner sur la structure des protéines.

Les électrons, les protons et les neutrons peuvent être imaginés comme des
sphères tournant sur leur axe. Dans plusieurs atomes comme le carbone 12, de
telles révolutions (le spin) sont appariées de telle façon que le spin global du noyau
est égal à zéro. Dans d'autres atomes, cependant, comme le 1H ou le 13C, le noyau
possède un spin.

(a) Si le nombre de protons et le nombre de neutrons sont tous les deux pairs, le
noyau n'a pas de spin.

(b) Si le nombre de protons plus le nombre de neutrons est impair, le spin a une
valeur qui finit en 1/2 (comme 1/2, 3/2, 5/2...)

(c) Si le nombre de protons et de neutrons sont tous les deux impairs, le spin a une
valeur entière (1,2,3...)

Le spin global du noyau est noté I (i majuscule) et un noyau a 2I + 1 orientations


possibles. Ainsi, un noyau de spin 1/2 possède (2 x 1/2) + 1 orientations, ou plus
simplement 2 orientations. En l'absence de champ magnétique, ces deux
orientations ont le même niveau d'énergie. Dans un champ magnétique, par contre,
ces deux énergies vont diverger: le spin va soit être enligné dans le sens du champ
magnétique (choix de basse énergie), ou lui être opposé (choix de haute énergie).

On peut faire transiter un noyau de l'état d'énergie faible à l'état d'énergie élevé en
l'irradiant avec une fréquence donnée (dont la valeur exacte a à voir avec la
précession du spin, mais là nous entrons dans des considérations de physique
quantique qui, pour toutes intéressantes qu'elles puissent être, nous éloignent un
peu de notre propos). Le retour subséquent du noyau à son état d'énergie antérieur
est enregistrée par un détecteur. Ce phénomène de transition d'un niveau d'énergie
à un autre est la résonance qui donne le R de RMN.

L'environnement des noyaux influencera la façon dont ils se comportent quand on


les irradie à la longueur d'onde appropriée; la RMN permet donc de déterminer la
nature des liens entourant un atome.

181
Pour en savoir plus long, n'hésitez pas à vous référer à ce site.

6.5 Diffraction aux rayons X

6.5.1 Principe

Dans un cristal parfait, toutes les sous-unités ont la même conformation et la même
orientation. Quand des rayons X sont focusés à travers un cristal de protéines
purifiées, ils sont déviés selon un patron particulier qu'on appelle le patron de
diffraction.

Le nombre d'électrons dans les atomes de la protéine détermine le degré de


diffraction des rayons, et c'est pourquoi les atomes lourds seront plus efficaces pour
faire dévier les rayons X.

Chaque atome peut induire la diffraction de rayons X incidents.


Les rayons déviés se répartissent dans l'espace. Si plus d'un
atome est présent, les rayons déviés par l'un et l'autre se feront
de l'interférence; cette interérence peut être constructrice quand
deux pics, ou encore deux creux, se superposent. Elle peut
aussi être destructrice quand ce sont un pic et un creux qui se
superposent.

La succession d'interférence constructrices et destructrices


donne le graphique du milieu; vue en 2D elle donne la figure du
bas, ci-contre.

En combinant le patron de diffraction d'un cristal obtenu à partir


de différents angles, on obtient assez d'information pour nous
aider à déterminer l'agencement des atomes de la protéine dans
l'espace.

La cristallisation demande une grande quantité de protéine pure.

182
6.5.2 Cristallisation

On cristallise une substance en la laissant devenir sursaturée dans un solvant; en


permettant au solvant de s'évaporer, par exemple, ou en abaissant la température
d'une solution saturée. Pour une protéine, on peut aussi faire varier le pH ou la force
ionique de la solution.

Si un noyau de cristallisation est présent, il peut permettre la croissance d'un gros


cristal, qui consiste en la répétion ordonnée dans l'espace d'une structure
particulière.

Dans la figure ci-dessous, l'agencement régulier des sous-unité de la première


structure lui donne une apparence cristalline. Dans le second cas, l'empilement des
sous-unités est désordonné et non-répétitif; ce n'est pas un cristal. Dans le dessin de
Moritz Escher, à droite, on voit un personnage dévaler un escalier jusqu'à ce que la
répétition ordonnée de son image donne au bas de l'oeuvre une allure très
cristalline. Le personnage au bas des marches a en quelque sorte servi de noyau de
cristallisation.

Un cristal de protéines, qui contient environ 50% de solvant réparti dans les
interstices entre les molécules, tient ensemble par le biais de forces hydrophobes,
de ponts hydrogènes et de ponts de sel (contrairement à un cristal minéral qui utilise
surtout les liens ioniques). En fait de solidité, un cristal de protéine est donc plus
proche d'un cube de jello sec que d'un diamant.

6.6 Microscopie de force atomique (AFM)

Cette technique non-destructrice permet de relever des détails topographiques à très


petite échelle. Elle détecte les formes des molécules un peu comme vous le faites
en tâtant une surface avec un doigt. Dans ce cas-ci, le doigt est remplacé par un
levier extrêmement ténu (la sonde). La position de cette sonde est suivie par la
déviation du tracé d'un rayon laser qui rebondit en permanence sur sa surface
réfléchissante et se rend jusqu'à un photodétecteur. Tout mouvement de la sonde
183
quand elle grimpe par dessus un obstacle ou descend dans une cavité se traduit par
une déviation du rayon, déviation qui est notée par le photodétecteur.

Une boucle de rétroaction permet de modifier la force appliquée au levier (lui


permettant, par exemple, de relâcher la pression quand il monte sur une bosse), ou
encore de maintenir sa hauteur constante.

L'université de Guelph a un site instructif sur le sujet.

On distingue trois types d'AFM, dépendant du mouvement de la sonde. En mode


Contact ou répulsif, la sonde est en contact avec l'échantillon. La force appliquée sur
le levier est fonction de la forme de l'échantillon: elle est relâchée légèrement quand
on monte et renforcée légèrement qand on descend.

En mode Sans Contact, la sonde ne touche pas l'échantillon mais est maintenu au-
dessus de celui-ci, à 50-150 Angstroms. Les forces de Van der Waals entre la sonde
et l'échantillon créent une tension entre les deux, et la mesure de cette tension
permet d'établir la forme de l'échantillon. Le mode sans contact est utile pour les
échantillons fragiles que la sonde pourrait endommager en les touchant.

En mode "poule qui picore" (tapping mode), la sonde monte et descend très
rapidement (50 000 - 500 000 Hz). Quand la sonde est au dessus d'une bosse, elle
a moins d'espace pour osciller; quand elle est au dessus d'un creux, elle en a
davantage. Ces variations permettent d'établir le profil de l'échantillon. Ce mode a
l'avantage de ne pas "traîner" le long de l'échantillon, ce qui évite les problèmes
causés par les interactions électrostatiques, par l'adhésion, par la friction, et la
plupart des problèmes rencontrés d'habitude par les deux autres modes.

La microscopie de force atomique a permis de visualiser la structure de la


chromatine, la position de polymérases sur l'ADN, et de nombreuses autres
structures ne relevant pas toujours de la biologie.

184
Ce lien mène à de très belles images obtenues par AFM. On peut y suivre la
condensation croissante d'un fragment de chromatine en fonction de la
concentration en sel dans le milieu ambiant.

Les avantages de l'AFM sont nombreux. Elle ne requiert pas la destruction de


l'échantillon, ne demande pas de coloration et donne une excellente idée de la forme
de l'échantillon.

6.7 Séquençage des protéines

1953 fut l'année où les travaux de Crick, Watson et Rosalind Franklin nous permirent
de visualiser la molécule d'ADN sous la forme hélicale qui nous est maintentant
familière. Cette date devrait aussi être remémorée comme celle où où Frederick
Sanger décrivit la séquence des résidus dans une molécule d'insuline.

Le séquençage protéique est un procédé classiquement décrit en six étapes.

1- Détermination de la composition en acides aminés.

2- Identification des bouts.

3- Fragmentation de la chaîne polypeptidique.

4- Séquençage des fragments.

5- Seconde coupure de la chaîne polypeptidique avec un nouvel agent.

6- Agencement des fragments obtenus et séquencés.

1- Détermination de la composition en acides aminés. Cette étape a pour but


d'évaluer la quantité de chaque acide aminé présent dans un peptide ou une
protéine. On y parvient en brisant chaque lien peptidique de la protéine et en
analysant ensuite le mélange obtenu par séparation chromatographique sur HPLC.
Bien sûr, une fois qu'on a une idée de la nature et de la quantité des acides aminés
contenus dans la protéine, il reste à en déterminer l'ordre.

2- Identification des bouts. Il existe des réactifs comme le 1-fluoro-2,4-


dinitrobenzene

ou le chlorure de dansyl qui réagissent avec la partie N-terminale des protéines et


leur greffent un groupement supplémentaire. Alors que les liens peptidiques sont
coupés par un traitement à l'acide, ces groupements supplémentaires restent greffés
à au résidu situé le plus en 5' de la protéine; on peut alors identifier quel est l'acide
aminé qui porte un appendice surnuméraire.

185
Pour l'extrémité C-terminale, on a recours à une protéolyse contrôlée avec la
carboxypeptidase Y, C ou P (elles coupent le résidu situé le plus en 3 prime). Il fait
alors faire attention à ne pas digérer plus d'un acide aminé à l'extrémité C-terminale.

3- Fragmentation de la chaîne polypeptidique. Un traitement avec des agents


chimiques ou des enzymes capables de couper la chaîne polypeptidique à des sites
précis (la trypsine, par exemple, coupe après une lysine ou une arginine; la
chymotrypsine après un résidu aromatique) permettra de réduire une grosse
protéine en plus petits peptides. Ceux-ci pourront être séquencés séparément après
séparation chromatographique.

4- Séquençage des fragments. La dégradation d'Edman permet d'enlever un par un


les résidus en commençant par l'extrémité N-terminale. On arrive ainsi à déterminer
la séquence de fragments d'environ 20 résidus.

186
5- Seconde coupure de la chaîne polypeptidique avec un nouvel agent. Nous avons,
en (3), coupé la chaîne avec un réactif ou un enzyme afin de pouvoir séquencer les
fragments obtenus. Pour pouvoir enligner ces fragments, il nous faut maintenant
recommencer (3) et (4) avec un nouvel échantillon de la protéine intacte et un agent
différent. (Par exemple, si on a utilisé la trypsine en (3), on pourra maintenant utiliser
la chymotrypsine).

6- Agencement des fragments obtenus et séquencés. Chaque fragment peptidique


que nous avons séquencé se situe quelque part dans la séquence globale de la
protéine. En comparant les fragments de la première digestion (en 3) à celle de la
seconde digestion (en 5) et en ayant identifié le résidu de l'extrémité N-terminale, on
peut enligner toutes nos séquences par leur bout se chevauchant.

Pour découvrir où se situent les ponts disulfures, on peut faire comme Sanger sur
l'insuline: il a utilisé de l'acide prformique, qui non seulement coupait les ponts
disulfures mais en plus convertissait les chaînes latérales résultantes en

-CH2-SO3H plltôt qu'en -CH2-SH. Lors de la séparation pendant la séquence, on peut


noter que ces cystéines modifiées ont une migration anormale.

187
6.8 Synthèse de peptides

Ce n'est pas vraiment une technique d'analyse, mais puisqu'elle est pratiquement le
contraire conceptuel de la dégradation d'Edman nous allons rappeler ici les bases de
la synthèse chimique de peptides.

On y utilise une phase solide sur laquelle la chaîne est alongée, un résidu à la fois,
par l'addition en séquence des réactifs appropriés.

La synthèse se fait à l'envers de ce qui se passe dans la nature: c'est à dire que le
premier acide aminé de la chaîne est le plus C-terminal (c'est lui qui est attaché au
support solide). Le groupe N-terminal de ce résidu est protégé par un groupement
Fmoc (9-fluorenylmethoxycarbonyl-), qui est stable dans les acides mais pas les
bases.

Le groupe Fmoc est enlevé par traitement à la piperidine 20% dans le


dimethylformamide. Les réactifs sont retirés par lavage.

Pendant ce temps, le deuxième acide aminé se prépare. Sa chaîne latérale est


protégée par un groupement chimique, mais son extrémité carboxy-terminale est
activée par conversion en un ester avec le HOBt ou N-hydroxybenzotriazole. Ce
deuxième acide aminé est mis en présence du premier toujours fixé sur le support
solide, et l'extrémité C-terminale du second vient former un lien peptidique avec
l'extrémité N-terminale (déprotégée) du premier.

Ce cycle est répété autant de fois que nécessaire et la chaîne s'allonge d'un résidu à
chaque fois.

Quand le polypeptide est complété, il est libéré du support solide par traitement à
l'acide trifluoroacétique, en présence de scavengers qui servent à neutraliser les
cations formés pendant le retrait des groupes protecteurs des chaînes latérales.

188
7.0 Interactions protéiques
Les protéines interagissent avec leur environnement, et ce sont les règles qui
régissent leur incessante partie de chassé-croisé qui nous permettent de mieux
comprendre comment elles contrôlent notre métabolisme.

Notre tentative de dresser une carte de toutes les interactions protéiques d'un
organisme a donné naissance à un nouveau terme, la protéomique. (En fait, le
suffixe "-omique" est de nos jours appliqué à toutes les sauces pour désigner l'étude
de systèmes à grande échelle. Ainsi, l'étude du génome entier est connu depuis un
certain temps sous le nom de génomique, celles d'un grand nombre de protéines est
de venu la protéomique, et on trouve déjà des références à l'interactomique (étude
des interactions), ou à la transcriptomique (étude de l'ARNm). L'étude du sens de
l'humour à grande échelle s'appellera peut-être un jour la comicomique.

Pour l'instant, nous allons étudier certaines techniques permettant de suivre


l'interaction de protéines entre elles ou entre les protéines et d'autres molécules

.1 Interactions protéines-protéines
7.1.2 FRET (fluorescence resonance energy transfer)

Le FRET est une technique qui permet de détecter


la proximité de deux molécules fluorescentes. La
première, (dite le "donneur"), est excitée par une
longueur d'onde λ1 (dans l'UV, par exemple). Le
donneur va libérer des photons de longueur d'onde
λ2 (dans le bleu, par exemple), qu'on peut détecter.
Il peut aussi transférer par résonance une partie de
son énergie d'excitation à la seconde molécule
fluorescente (le "receveur") qui libérera aussi des
photons, mais à une longueur d'onde qui lui est
propre, λ3 (dans le jaune, par exemple). Puisqu'il y
a transfert d'énergie entre le donneur et le receveur
(et que rien ne se perd, rien ne se crée), plus le
transfert d'énergie est efficace et plus le receveur
émet de photons par rapport au donneur.

Le transfert d'énergie du donneur au receveur, souligné par la détection de


l'émission de lumière λ3, indique que le donneur et le receveur ont été très proches
l'un de l'autre car l'efficacité du FRET est proportionnelle à l'inverse de la puissance
6 de la distance entre les deux molécules.

Les deux molécules doivent être séparées par 10-100 Angstroms; le spectre
d'absorption de l'accepteur doit chevaucher le spectre d'émission du donneur; et les
orientations des dipôles du donneur et de l'accepteur doivent être à peu près
parallèles.

189
La distance à laquelle le transfert est efficace à 50% est appelé distance de Förster
et varie selon les agents fluorescents utilisés.

Donneur Accepteur Distance de Förster (R0)


(Angstroms)
Fluorescein Tetramethylrhodamine 55 Å
IAEDANS Fluorescein 46 Å
EDANS Dabcyl 33 Å
Fluorescein QSY7 et QSY9 61 Å
ECFP EYFP 50 Å

Certains accepteurs ne fluorescent pas, mais en absorbant l'énergie du donneur ils


causent une baisse de sa fluorescence qui peut être quantifiée. (Un tel accepteur
non-fluorescent, dit "quencher" (ou "éteignoir"), est utilisé dans le système TaqMan
de PCR quantitatif).

Une forme de FRET utilise des protéines fluorescentes comme donneur et


accepteur; cette approche permet d'utiliser le FRET dans un contexte in vivo. On lui
donne parfois le nom de BRET pour Bioluminescent Resonance Energy Transfer.
On s'en sert dans les cellules vivantes en incitant celles-ci à produire des protéines
de fusion avec des domaines naturellement fluorescents, comme les variantes de la
GFP (green fluorescent protein) que sont la ECFP (enhanced cyan fluorescent
protein) ou la EYFP (enhanced yellow fluorescent protein). Le rayon de Förster entre
la ECFP et la EYFP est de 50Å.

7.1.3 Co-précipitation

Si nous avons le moyen de faire sédimenter une protéine en particulier, par


immunoprécicpitation par exemple, on peut espérer que nous puissions aussi faire

190
en mnême temps sédimenter un complexe dont elle ferait partie.

Une co-immunoprécipitation utilise un anticorps contre une protéine X, sur laquelle


une protéine Y vient d'habitude se coller. L'anticorps qui a reconnu X est immobilisé
par une bille de protéine A sepharose, permettant la sédimentation du complexe
bille-anticorps-X-Y.

Comme chaque anticorps a ses caprices, on a recours la plupart du temps à une


variante de ce concept: on introduit à une des extrémités de la séquence codante de
X une étiquette qui peut être reconnue par un anticorps commercial (ou par tout
autre agent faisant notre bonheur). Ainsi, si on utilise une étiquette portant l'épitope
FLAG de Sigma, on utilisera un anticorps anti-FLAG pour récupérer le complexe X-
Y; si on utilise une étiquette GST (gluthatione-S-transférase) on se servira de
glutathione-sepharose, sans anticorps, puisque la GST se lie spontanément à la
glutathione. Si on utilise une étiquette de six histidines, on pourra utiliser des billes
de sepharose Ni-NTA. On a même recours a des étiquettes complexes, comme
l'étiquette TAP (pour tandem affinity purification) qui combine un site de liaison à la
calmoduline à un site d'affinité pour les IgG tiré de la protéine A. Ce type d'étiquette
permet une double purification.

7.1.4 Combinaisons de buvardages

Dans la technique du Southwestern blot, on combine un buvardage de type western


à un transfert de type Southern. Les protéines sont d’abord transférées sur une
membrane, puis incubées dans des conditions qu’on espère suffisament douces
pour que les protéines se renaturent partiellement. On ajoute ensuite une sonde
d’ADN radioactive. S’il y a une interaction spécifique entre certaines protéines et
l’ADN, celui-ci sera localisé sur une ou plusieurs bandes particulières sur la
membrane. (Vous devinez que ce genre de technique donne un bruit de fond très
important).

On peut aussi s’y prendre à l’envers, et transférer d’abord l’ADN sur une membrane
de nylon; on l’incube ensuite avec un extrait protéique. Si une protéine se lie à
l’ADN, on pourra la révéler grâce à un anticorps spécifique. Bien entendu, pour que
le système fonctionne, l’interaction ADN-protéine doit être assez stable pour se
maintenir tout au long du traitement par les anticorps primaire et secondaire.

On a parfois aussi parlé de “far western blot”. Cette technique au nom


géographiquement pittoresque immobilise d'abord une protéine X sur une membrane
qui est ensuite mise en présence de protéine Y. S'il y a interaction entre les deux, un
anticorps anti-Y devrait signaler sa présence dans le voisinage de X plus qu'ailleurs
sur la membrane.

7.1.5 Réaction à même le gel, ou zymogramme

Cette technique est très simple, mais aussi très élégante et a permis de démontrer
que la protéine GCN5 avait une activité histone acétyltransférase. On prépare
d'abord un gel SDS normal, à ceci près que sa matrice contient aussi une cible
quelconque (dans le cas de l'expérience mentionnée, cette cible consistait

191
d’histones). La cible est aussi retrouvée dans le tampon. Bref, tout le système est
saturé en cible.

On dépose un extrait protéique dans les puits et on fait migrer le gel pour bien en
séparer les protéines. Aprèes la migration, on lave le gel pour le débarasser du SDS
pour permettre aux protéines de se renaturer, dans un tampon au pH et à la salinité
appropriée.

On fournit ensuite le substrat qui permet de suivre la réaction qui nous intéresse.
Dans le cas des histones acétyltransférases, il s'agissait d'acétyl-CoA radioactif. Une
histone acétyltransférase devrait transférer le groupe acétyl radioactif de l’acétyl-
CoA sur les histones qui sont à sa portée.

La réaction, si elle a lieu, se produira dans le gel à la hauteur de l'enzyme qui


possède l'activité, puisqu'il y a de la cible partout mais que l'enzyme ne se trouve
qu'à un seul endroit. il est alors facile de récupérer la bande contenant l'activité et de
la faire analyser par spectrométrie de masse.

7.1.6 Double hybride

Cette technique utilise à son profit la nature modulaire de certains domaines


protéiques, comme le domaine d’attache à l’ADN du facteur de transcription de
levure Gal4 et le domaine d’activation de la transcription viral VP-16.

Pour évaluer l’interaction entre une protéine 1 et une protéine 2, on commence par
en faire des hybrides par génie génétique: un premier hybride entre la protéine 1 et
un domaine d’attache à l’ADN, et un second entre la protéine 2 et un domaine
d’activation de la transcription.

On transfère ensuite les vecteurs d’expression de ces hybrides dans une levure
contenant un gène rapporteur (comme la beta-galactosidase) sous le contrôle d’un
promoteur reconnu par le domaine d’attache à l’ADN de l’hybride 1.

L’hybride 1 va se lier au promoteur. Si les protéines 1 et 2 ont réellement de l’affinité


l’une pour l’autre, l’hybride 2 va entrer en contact avec l’hybride 1 et se trouver
positionné au promoteur lui aussi, là où son domaine d’activation de la transcription
stimulera l’expression du gène rapporteur.

L’interaction entre les protéines 1 et 2 mènera donc à l’activation du gène


rapporteur, même si les protéines 1 et 2, dans leur contexte naturel, n’ont rien à voir
avec l’expression des gènes.

192
Expérience de double hybride

7.2 Interactions ADN-protéines


7.2.1 Sensibilité à la nucléase micrococcale

La nucléase micrococcale a beaucoup de difficulté à couper l'ADN complexé à un


nucléosome. On peut donc utiliser cet enzyme pour couper la chromatine entre les
nucléosomes, et juger ainsi de l'état de la chromatine.

L'ADN d'une cellule coupé à la nucléase micrococcale et séparé sur gel d'agarose
ressemble à une échelle de fragments dont la taille est un multiple d'environ 147pb.
Ils correspondent à des monomères, dimères, trimères, etc. de nucléosomes. Quand
on tranfère cette échelle sur une membrane et qu’on l’hybride avec une sonde
d’ADN, on observera une échelle si la région où s’hybride la sonde a des
nucléosomes en phase (régulièrement déposés) ou encore une traînée si les
nucléosomes sont déphasés (déposés irrégulièrement).

193
Pour juger d'un site spécifique de coupure par la nucléase micrococcale, on peut
effectuer un marquage indirect ("indirect end-labelling"). Pour ce faire, après
traitement à la nucléase micrococcale, l'ADN est coupé avec une endonucléase qui
a un site près de la région qui nous intéresse. On effectue ensuite un transfert de
Southern, et comme sonde on en choisit une, pas trop longue, qui hybride juste à
l'extrémité du fragment laissé par la digestion à l'endonucléase. Cette hybridation
revient au même que d'avoir effectué un marquage au site de restriction, et permet
de juger des distances entre ce bout et toute coupure causée par la nucléase
micrococcale. (Cette technique fonctionne aussi bien sûr avec toutes les nucléases).

7.2.2 Extension de monomères

Cette technique un peu plus compliquée donne des résultats plus difficiles à
analyser mais fournit énormément d'information sur la position des nucléosomes.

194
On commence par digérer de la chromatine par la nucléase micrococcale jusqu'à
l'obtention de nucléosomes monomériques (les conditions de digestion sont à
déterminer empiriquement et préalablement).

Les monomères sont ensuite purifiés pour en récupérer l'ADN.

On aura au préalable préparé un phagemide de même séquence que la région que


nous voulons étudier dans la chromatine. Ce phagemide servira à faire de l'ADN
simple brin (on doit préparer les deux brins indépendamment pour déterminer la
position de chacune des deux extrémités des monomères).

L'ADN récupéré des monomères de nucléosome est dénaturé et hybridé sur l'ADN
simple brin du phagemide; il est ensuite allongé par la polymérase de Klenow.
Chaque monomère donnera naissance à un fragment d'ADN dont la synthèse
commence à une position qui lui est propre.

L'ADN obtenu après l'extension par la Klenow est ensuite coupé avec une
endonucléase coupant une fois dans le plasmide, ce qui génère une échelle de
bandes: chaque bande de cette échelle a une taille correspondant à la distance
entre l'extrémité distale du monomère et le site de restriction. Cela nous donne la
positon d'une des extrémités de chaque nucléosome.

On répète l'opération avec l'autre brin pour obtenir la position de l'autre extrémité.

7.2.3 EMSA (ou electromobility shift assay) et REMSA (RNA electromobility shift
assay)

Cette technique, la plus simple qui soit pour étudier une interaction entre un acide
nucléique et des protéines, repose sur le fait qu’un complexe ADN- protéine ou
ARN-protéine migrera moins vite dans un gel non-dénaturant qu’un ADN ou un ARN
nu. Ce retard de migration permet de juger au premier coup d’oeil si une séquence
particulière d’ADN ou d’ARN a été reconnue et liée par une protéine. On l’appelle
aussi gel-shift ou gel à retardement, ce qui le fait sonner comme une bombe.

On peut vérifier la spécificité de l'interaction ADN-protéine par l'incubation préalable


du complexe avec un anticorps qui se fixe à la protéine. Le complexe ternaire ADN-
protéine-anticorps a une migration encore plus retardée, qu'on qualifie de supershift.
Notez qu'il arrive qu'un anticorps qui fonctionne très bien en western ne vale pas
grand chose en supershift. Peut-être que son épitope est moins accessible, ou que
195
son affinité n'est pas assez forte pour résister aux conditions présentes pendant la
migration. On peut aussi trouver des anticorps qui interfèrenet avec la liaison ADN-
protéine; ceux-là, au lieu de provoquer un supershift, vont même inhiber le gel-shift
ordinaire.

Certaines protéines font se courber l’ADN. Dépendant de l’endroit où elle se lie sur
une sonde d’ADN, une protéine qui fait courber l’ADN affectera de façon différente la
migration sur le gel d’EMSA. Plus la courbure est au centre de la sonde et plus la
migration est retardée. On peut utiliser une même sonde en y déplaçant le site de
reconnaissance de la protéine pour juger de l’habileté d’une protéine à courber
l’ADN.

7.2.4 SELEX (Systematic Evolution of Ligands by EXponential enrichment)

Le SELEX est une approche de sélection progressive des séquences d'ADN


interagissant avec une ou plusieurs protéines. Son algorithme de base ressemble à
ceci:

196
On part d'un ensemble d'oligonucléotides dont la séquence est aléatoire; cela veut
dire qu'on y trouve toutes les séquences possibles -incluant les séquences
reconnues par notre protéine, ainsi qu'une énorme majorité de séquences qu'elle ne
reconnaît pas. Ces oligonucléotides contiennent des séquences permettant leur
amplification par PCR: par exemple, ils pourraient avoir une séquence comme
ACGTCCGTGCNNNNNNNNNNNNNNNNNNCCGTCGTGCA. Une ronde
d'amplification par PCR avec des amorces ACGTCCGTGC et TGCACGACGG les
amplifierait tous, quelque soit la séquences de la région
NNNNNNNNNNNNNNNNNN.

Ce "pool" de séquence est ensuite soumis à une sélection. In vitro, le plus simple est
de faire un EMSA avec le pool en entier; les rares séquences qui sont reconnues par
la protéine sont retardée lors d'une migration sur gel et le reste est éliminé. Les
bandes retardées sont récupérées, et comme elles ne contiennent que peu de
matériel, elles sont à nouveau amplifiées par PCR. Comme il est possible que des
contaminants se soient glissées à travers les mailles du filet, un nouvel EMSA est
pratiqué sur ces séquences réamplifiées; les bandes retardées sont une fois de plus
purifiées. On peut exécuter ce cycle plusieurs fois. Les séquences sont à la fin
séquencées et on peut alors déterminer celles pour lesquelles la protéine a le plus
d'affinité.

Cette technique peut aussi se faire à partir de matériel cellulaire. On commence par
ponter les protéines et l'ADN avec du formaldéhyde à même la cellule. Ensuite, on
morcelle la chromatine (par sonication, par exemple). Les fragments récupérés sont
immunoprécipités avec un anticorps contre la protéine; le pontage est renversé par
traitement à la chaleur et l'ADN récupéré. Les fragments d'ADN sont alors rendus
francs par traitement à la Klenow et on leur ajoute des adapteurs par ligation pour
permettre une amplification par PCR. Aprèes amplification, on peut soit utiliser un
EMSA comme ci-haut ou recommencer une ronde d'immunoprécipitation, au choix
de l'expérimentateur.

7.2.5 Empreinte à l’exonucléase III

197
L’exonucléase III a une activité 3’-5’ exonucléase, mais ne s’attaque qu’aux
extrémités 5’ proéminentes ou franches. Elle ne coupe pas l’ADN simple-brin, ni à
partir d’extrémités 3’ proéminentes.

Cette activité de l’exo III est utile pour déterminer les limites d’une interaction entre
une protéine et un fragment d’ADN. Si on marque l’extrémité 5’ du fragment au 32P,
et que l’on traite celui-ci à l’exonucléase III pendant qu’une protéine en protège une
partie, l’exonucléase III ne pourra digérer l’ADN que jusqu’à ce qu’elle entre en
contact avec cette protéine, qui lui barre le chemin ni plus ni moins. La taille de
l’ADN protégé, qu’on détermine sur gel dénaturant, permet alors de déterminer
jusqu’où s’étendait l’interaction ADN-protéine.

Un des avantages de l’empreinte à l’exonucléase III est que l’ADN non-protégé par
une protéine est entièrement dégradé; une interaction partielle ne génère pas de
bruit de fond.

7.2.6 Empreinte à la DNAse I

Cette technique, une fois de plus, utilise le fait qu’une protéine déposée sur l’ADN
peut le protéger de l’activité de dégradation d’une nucléase. Dans ce cas précis, il
s’agit de la DNAse I, une nucléase qui sans couper absolument partout a quand
même une affinité générale pour l’ADN et coupe très fréquemment. La DNAse I ne
coupe qu’un seul brin à la fois, aussi on marque un seul des brins au 32P pour suivre
son comportement sur gel de séquence.

La dégradation partielle du fragment d’ADN protégé par la protéine générera une


échelle de fragments de tailles différentes. En comparant l’échelle donnée par un
ADN nu à celle donnée par un ADN protégé, on remarque que cette dernière
présente un trou, ou une empreinte, correspondant aux sites rendus inaccessibles à
l’enzyme par la protéine.

Afin de déterminer précisément la position de cette empreinte, on fait souvent courir


à côté des pistes de digestion à la DNAse une réaction de séquence. Quoiqu’on
puisse utiliser la technique de Maxam-Gilbert sur la sonde radioactive qui sert aussi
198
pour la réaction d’empreinte, il est plus commode de préparer une échelle de
séquence par la réaction de Sanger en utilisant comme amorce un oligonucléotide
dont l’extrémité correspond à celle de la sonde marquée (voir figure). Le choix de la
technique de Sanger produit beaucoup plus de matériel qui en plus dure plus
longtemps (il est marqué au 35S plutôt qu’au 32P, de demi-vie plus courte), utilise un
isotope moins dangereux, et permet d’éviter les réactifs très nocifs de la réaction de
Maxam-Gilbert (comme le DMS et la piperidine).

La DNAse I favorise les sites du sillon mineur de l’ADN. Quand l’ADN est en contact
avec une surface continue (comme une plaque de verre ou la surface d’un
nucléosome, par exemple), elle génère des coupures à toutes les 10 paires de
bases, reflétant la fréquence d’hélicité de la spirale d’ADN.

Les empreintes à la DNAse I ont tendance à être grandes et claires.

7.2.7 Empreinte avec d'autres agents

7.2.7.1 Empreinte aux radicaux libres

Le principe de l’empreinte se prête à différents réactifs outre les nucléases. On peut


par exemple générer dans le milieu d’incubation des radicaux hydroxyl libres qui
attaquent la chaîne de phosphate de l’ADN et cassent un des brins de l’ADN. La
réaction pour générer ces radicaux est la suivante:

Fe2+(EDTA4-) + H2O2 -> Fe3+ (EDTA4-) + HO·

C’est le radical HO· qui attaque l’ADN. Il n’a pas de préférence quant à la séquence
et tend à couper partout. Une telle empreinte peut donner plus de bruit de fond
qu’une empreinte à la DNAse parce que cette dernière, beaucoup plus massive,
peut difficilement atteindre des sites situés sous la protéine qui protège l’ADN, alors
qu’une petite molécule comme HO· y arrive plus facilement. Pour cette raison, une
empreinte générée par les radicaux libres est moins claire qu'une empreinte à la
DNAse I.

D’autres radicaux existent pour ce type de réaction, comme par exemple le cuivre-
phénanthroline. La décision quant à la technique adoptée revient au chercheur.
Votre kilométrage peut varier.

7.2.7.2 Empreinte au DMS

Le diméthylsufate, ou DMS, peut méthyler les guanines. Cette réaction de


méthylation est plus efficace sur l'ADN nu que sur l'ADN masqué par une protéine et
on peut donc l'utiliser pour générer une empreinte. Les méthylguanines sont la cible
de la pipéridine chaude, qui coupe un brin de l'ADN à leur niveau (c'est d'ailleurs la
réaction utilisée par la méthode de Maxam et Gilbert pour séquencer l'ADN). Bien
entendu, comme le DMS n'agit que sur les guanines, l'échelle de digestion que l'on
obtient ne contiendra elle aussi que des guanines; on ne pourra pas analyser une
région dépourvues de G.

Un avantage du DMS est qu'il peut pénétrer les cellules sans qu'on ait à solubiliser

199
celles-ci au préalable; il se prête donc facilement aux études in vivo. Il est
particulièrement actif sur les G se trouvant dans le sillon majeur de l'ADN.

7.2.7.3 Empreinte aux UV ou photofootprinting

Les UVB (280-320 nm) et les UVC (200-230 nm) peuvent induire la formation de
dimères de pyrimidines quand deux pyrimidines se voisinent: on obtient alors des
CPD, pour cyclobtuane pyrimidine dimers, ou des photoproduits pyrimidine-
pyrimidone (6-4PP) . Les 6-4PP se forment à un taux d'environ 15-30% des CPDs.
Les 6-4PP peuvent être coupés par la piperidine chaude; les CPD doivent être
traités à la T4 endonuclease V et re-traités aux UVA (320-400nm) et à la photolyase.

Cette technique vise plus particulièrement les régions riches en pyrimidines. Elle se
prête bien aux techniques in vivo, car aucune perméabilisation membranaire n'y est
requise; de plus, l'irradiation peut être très brève si l'intensité de l'irradiation est
élevée, permettant de prendre une "photo" de ce qui se passe dans la cellule à un
moment précis, avec un minimum de perturbations.

7.2.8 LMPCR et analyses in vivo

Presque toutes les techniques utilisées pour étudier les interactions ADN-protéines
in vitro peuvent être utilisées in vivo aussi. Il est juste un peu plus difficile de faire
pénétrer les réactifs dans la cellule et d’en récupérer l’ADN par la suite. La technique
la plus populaire depuis une dizaine d’années pour récupérer des fragments d’ADN
aprèes une réaction d’empreinte in vivo est celle du LMPCR, ou ligation-mediated
Polymerase chain reaction. Elle est décrite ci-dessous.

(1) Récupération de l'ADN génomique. Cet ADN contient des coupures simple-
brin, là où la DNAse I ou un autre agent comme le DMS a endommagé la chaîne
de groupements phosphates.

(2) Séparation des brins et annélisation de l'un d'eux avec une amorce 1 spécifique
à une région qui nous intéresse. L'autre brin pourra être étudié plus tard lors d'une
autre expérience. Notez que les fragments d'ADN dont nous disposons à cette
étape sont de tailles différentes, parce que la coupure à la DNAse I n'est que
partielle.

200
(3) Extension de l'amorce 1. Cette élongation se fait jusqu'au bout de l'ADN qui
sert de gabarit, rendant cette extrémité franche ("blunt", comme dirait Coleridge s'il
avait fait de la biologie au lieu de la poésie).

(4) Ligation d'un adapteur double-brin dont une des extrémités est franche et
l'autre cohésive. Ces extrémités différentes empêchent l'adapteur de se liguer
plusieurs fois.

(5) PCR entre une


deuxième amorce
spécifique (l'amorce 2,
à côté du site de
l'amorce 1) et une
amorce (l'amorce 3)
semblable à l'extrémité
prohéminente de
l'adapteur que nous
avons ajouté à l'étape
précédente. Le premier
cycle de ce PCR ne
fonctionne que dans un
sens, c'est à dire à
partir de l,amorce 2,
parce que l'amorce 3
n'a pas encore de
séquence
complémentaire. Cette
séquence sera
synthétisée lors de ce
premier cycle.

Imaginons qu’on vienne de réaliser une expérience d’empreinte à la DNAse in vivo


sur le promoteur du gène Gogosse-1. L’ADN génomique entier de chacune de nos

201
cellules a été coupé par la DNAse I et nous voulons maintenant voir si des sites ont
été protégés au niveau de ce promoteur.

Dans la case 1, l’ADN génomique en entier est récupéré. L’ADN qui correspond à
notre promoteur est en si petite quantité comparé à tout le reste de l’ADN de la
cellule qu’il doit être amplifié par PCR pour pouvoir être visualisé de façon utile.

Dans un premier temps, une amorce spécifique au promoteur qui nous intéresse est
utilisée. L’ADN génomique est dénaturé, et l’amorce 1 (ci-dessus) est utilisée pour
s’allonger sur tous les fragments correspondant au voisinage du gène d’intérêt.
Cette élongation s’arrête quand la polymérase manque d’ADN-gabarit, c’est à dire là
où la DNAse I a fait une brèche dans le brin du bas. L’ADN de promoteur ainsi
allongé est donc rendu franc à une de ses extrémités.

Dans un deuxième temps, un adapteur (linker) partiellement double-brin est ligué au


bout de cette extrémité franche.

Cet adapteur est franc à un bout et 5’ proéminent à l’autre; cela évite entre autres
d’avoir un concatémère d’adapteurs au bout de notre fragment: un seul réussit à s’y
liguer. Notez que l’extrémité du fragment d’ADN se trouvant en amont de l’amorce 1
n’a pas pu être allongée et a donc une extrémité proéminente; l’adapteur ne peut
pas s’y liguer non plus.

On commence alors la réaction de PCR en utilisant deux nouvelles amorces. La


première se trouve un peu en aval de l’amorce 1. (En fait, on pourrait carrément
utiliser l’amorce 1 à nouveau, mais des expériences ont démontré que changer
d’amorce à cette étape améliore la spécificité des résultats). La deuxième amorce,
amorce 3 ci-dessus, correspond à l’extrémité 5’ proéminente de l’adapteur. Comme
la séquence sur laquelle cette amorce 3 devrait s’hybrider n’est pas présente sur
l’adapteur, le premier cycle de PCR est linéaire: seule l’amorce 2 peut s’hybrider à
l’ADN et être allongée.

Comme elle se rend jusqu’au bout du fragment, cette première élongation complète
la séquence manquante de l’adapteur; lors du deuxième tour de PCR, l’amorce 3
sera capable de s’hybrider et la réaction sera vraiment exponentielle.

Parmi les traitements disponibles pour effectuer des empreintes in vivo,


mentionnons bien sûr...

(a) la DNAse I (il faut alors perméabiliser les cellules pour permettre l’entrée de
l’enzyme, et s’assurer de ce qu’il y ait assez de Mg2+ présent dans le milieu);

(b) le diméthylsulfate ou DMS, qui pénètre spontanément dans les cellules et va


causer une méthylation des guanines non-protégées, une activité particulièrement
efficace dans le sillon majeur de l’ADN; le guanines méthylées peuvent alors être
coupées par la piperidine;

(c) et le UV footprinting, ou formation de dimères de pyrimidines par irradiation aux


rayons ultraviolets UVB (280-320nm) ou UVC (200-280nm). Ces dimères de
pyrimidines peuvent être coupés par une photolyase et la piperidine. Cette

202
empreinte aux UV a l’avantage de ne pas toucher aux cellules du tout, et permet
donc d’étudier une cellule très près de son état naturel.

7.2.9 Pontages covalents

Pour s’assurer de la stabilité d’une interaction ADN-protéine, on peut s’aider un peu


en établissant un lien covalent entre les deux. Cela est possible grâce à l’utilisation
du fornaldéhyde, HCHO, lequel formera un lien covalent entre protéines ou entre
protéines et ADN.

Le gros avantage de ce pontage covalent est qu’il est réversible par la chaleur.

Les expériences d’immunoprécipitation de la chromatine, qui nous ont permis d’en


apprendre beaucoup sur les modifications post-traductionnelles des histones,
utilisent le pontage au formaldéhyde la plupart du temps.

On peut également ponter les protéines à l’ADN par d’autres techniques. Les rayons
UV pourront y parvenir, de même qu’un rayon laser. Dans de tels cas, l’énergie
transmise au système permet d’avoir une réaction plus ou moins rapide; un laser
assez puissant donnera une image presque instantanée de ce qui colle à l’ADN
alors qu’une lampe UV de basse énergie demandera plusieurs minutes, ne révélant
que les complexes très stables. (Un problème avec les sources UV de faible énergie
est que les rayons UV sont facilement absorbés par le milieu de culture).

7.2.10 SPR (ou surface plasmon resonance), plus communément appelée Biacore

On mesure ici l’interaction entre deux partenaires moléculaires grâce à une machine
mesurant l’intensité d’un rayon de lumière. Cette machine est fabriquée par la
compagnie Biacore, qui a donnée son nom à l,appareil comme frigidaire l’a fait au
réfrigérateur.

La SPR, ou résonance de plasmon, se produit quand un rayon lumineux est réfléchi


sous certaines conditions par un film conducteur à l’interface entre deux milieux
d’indices de réfraction différents.

Dans le système Biacore (tm) ces milieux sont (1) la solution dans laquelle se trouvent
les molécules à analyser et (2) le verre d’une lame qui sert de senseur. Le film
conducteur à l’interface des deux est un très fin film d’or à la surface de la lame de
verre.

La résonance de plasmon cause une réduction de l’intensité de la lumière réfléchie à


un angle spécifique de réflection. Cet angle varie avec l’indice de réfraction près de
la surface du côté opposé à la lumière réfléchie (c’est donc dire du côté de
l’échantillon).

Dans le système Biacore (www.biacore.com) , la molécule appât est attachée à la


feuille d'or, du côté solution. Les molécules avec lesquelles elle peut interagir sont
ajoutées en flot continu. Si l’une d’entre elles interagit avec l’appât, la concentration
locale en molcules augmentera dans la région immédiate de l’appât, ce qui fera
changer l’indice de réfraction local.

203
Le changement d’indice de réfraction aura pour effet de changer l’angle pour lequel
la lumière réfléchie perd un maximum d’énergie par résonance.

Le système détecte ce un changement et enregistre une interaction. La mesure du


niveau d’interaction en fonction du temps permet d’évaluer le taux d’association.

Une unité de résonance (RU) correspond à un changement de 0.0001° dans l’angle


donnant une intensité minimale de lumière réfléchie, ce qui pour la plupart des
protéines correspond à un changement de concentration de l’ordre de 1 pg/mm 2 de
surface sur la lame de verre. Le Biacore est donc extrêmement sensible.

7.3 Interactions protéines-ADN in vivo à grande Échelle


7.3.1 ChIP ou Immunoprécipitation de la chromatine

La technique du ChIP, en permettant l'analyse des interactions ADN-protéines à


l'échelle de génomes entiers, a profondément marqué la biologie moléculaire depuis
quelques années. Elle repose sur la combinaison de différentes techniques, parmi
lesquelles l'immunoprécipitation, le pontage covalent, et le PCR.

Dans sa forme la plus simple, le ChIP permet de vérifier la présence d'une protéine
donnée à un endroit donné dans le génome. Dans un tel cas, on commence par
traiter les cellules avec du formaldéhyde, qui provoque des pontages covalents entre
les protéines et l'ADN. Comme nous le verrons un peu plus loin, ces pontages sont
solides mais peuvent être renversés par la chaleur (67°C).

L'ADN génomique, maintenant ponté avec une grande quantité de protéines, est
ensuite brisé pour donner des fragments de petite taille (environ 500 paires de
bases). La technique la plus utilisée pour cette fragmentation est la sonication.

204
Pour récupérer les fragments d'ADN sur lesquels se trouve pontée la protéine qui
nous intéresse, on utilise un anticorps spécifique contre cette dernière. L'anticorps
sera idéalement biotinylé, ce qui permettra de le retenir contre une bille magnétique
couplée à la streptavidine. Le complexe bille magnétique- streptavidine- anticorps-
protéine pontée- ADN est retenu au fond d'un tube par un aimant pendant que tous
les autres complexes ADN-protéines sont éliminés par lavage.

Dans la figure qui suit, on utilise un anticorps qui reconnait une protéine représentée
en vert.

Après les lavages, la bille magnétique a permis de retenir tous les fragments d'ADN
avec lesquels la protéine d'intérêt a une interaction assez importante pour permettre
le pontage au formaldéhyde. Reste maintenant à identifier ces fragments..

On commence par chauffer le complexe à 67°C pour renverser le pontage au


formaldéhyde. Cela permet la libération des fragments d'ADN, qui sont récupérés et
purifiés. Bien sûr, ils sont en faible quantité et il faut ensuite les amplifier par PCR
pour pouvoir établir leur présence.

205
La façon la plus simple de procéder est d'utiliser une paire d'amorces spécifiques à
une région particulière (la région promotrice d'un gène qui nous intéresse, par
exemple) et de procéder soit à un PCR normal, soit à un Q-PCR (aussi appelé "real-
time PCR", qui permet d'effectuer des analyses plus quantitatives). Si la protéine
étudiée était associée à la région qui nous intéresse, des fragments d'ADN
contenant cette séquence auront été retenus lors des lavages et le PCR pourra en
amplifier la séquence.

7.3.2 ChIP on chip ou ChIP2

Plutôt que de se limiter à une seule région lors de la réaction de PCR, on a aussi
l'option (plus coûteuse!) d'analyser la présence de notre protéine partout dans le
génome.

Pour ce faire, on commence par une ligation d'adapteurs aux extrémités des
fragments d'ADN purifiés lors du ChIP. On utilise ces adapteurs pour pratiquer une
réaction de PCR amplifiant tous les fragments présents. Cette amplification se fait en
présence d'un nucléotide associé à une substance fluorescente, du genre Cy3 ou
Cy5.

Pour identifier et démêler tous les fragments obtenus, on les hybride ensuite sur une
micropuce d'ADN (aussi appelée "DNA chip", d'où le nom de "ChIP on chip"). Plus la
micropuce contient de séquences, et plus celles-ci sont courtes, plus la résolution
obtenue est élevée en termes de localisation des protéines dans le génome. (Bien
entendu, le résultat sera plus intéressant si la micropuce contient non seulement des
séquences codantes, comme c'est le cas pour les puces de cDNA, mais aussi des
séquences intergéniques qui contiennent des régions de contrôle. L'idéal serait une
puce portant des séquences couvrant le génome entier).

206
En utilisant une telle technique, si on dispose d'une micropuce adéquate, on peut
(par exemple) suivre l'association globale d'un facteur de transcription à l'ADN
pendant le cycle cellulaire, ou suite à un traitement quelconque, ou encore
déterminer d'un seul coup d'oeil la position de plusieurs composantes de la
chromatine dans différentes situations.

7.3.3 ChIPPET

Technique d'abord publiée dans Wei et al. (2006) Cell 124, 207-219.

Des données, des données, trop de données!!! C'est le drame des biologistes
moléculaires modernes. Toute technique capable de réduire la quantité de bruit par
rapport aux informations cherchées ne peut être que la bienvenue.

La technque du ChIPPET (Chromatin immunoprecipitation Paired End diTags)


s'utilise pour les analyses à grande échelle, du genre "où sur les chromosomes
trouve-t-on la protéine p53 quand on traite des cellules NIH3T3 avec de la caféine?"
Elle utilise d'abord une immunoprécipitation comme on l'a vu ci-dessus, mais va
ensuite remplacer l'étape d'hybridation sur une micropuce par une technique de
séquençage. Oh, rassurez-vous, on ne va pas cloner chacun des fragments de
chromatine immunoprécipités dans un vecteur pour ensuite les séquencer un par un!
Ce serait bien entendu beaucoup trop long et finalement pas moins cher que
d'utiliser une hybridation sur puce d'ADN.

Le ChIPPET essaie de résoudre deux problèmes associés à l'immunprécipitation de


chromatine. Le premier est que la fragmentation de la chromatine par sonication
donne des fragments de taille inégale (on vise ~500 pb, mais il s'agit là d'une valeur
d'une moyenne). En outre, on immunoprécipitera toujours une certaine part de
fragments par erreur; ce seront de faux positifs.

Après l'étape de ChIP, le ChIPPET demandera qu'on clone les fragments


immunoprécipités dans des vecteurs entre deux sites Mme I. Cet enzyme coupe en
dehors de son site de reconnaissance : TCCRAC,20,18. Le clonage de tous ces
fragments donnera donc une banque de plasmides qu'on appellera une librairie de
ChIP.

On va ensuite couper notre librairie de ChIP avec l'enzyme Mme I avant de refermer
les plasmides avec de la ligase. Cette étape enlève la majeure partie des fragments
immunoprécipités et n'en laisse que deux bouts par plasmide, soit les 18 pb en 5' de
l'insert et les 18 pb en 3' de l'insert. Ces deux fragments de 18 pb recollés
ensembles forment une étiquette (le diTag) qui est caractéristique d'une position
dans le génome. La librairie de vecteurs ainsi coupés et religués est maintenant
affublée du très flatulent nom de librairie de PETs.

La librairie de PETs est ensuite coupée avec un autre enzyme présent dans le site
de clonage multiple, l'enzyme BseR I, qui lui aussi coupe en dehors de son site de
207
reconnaissance (GAGGAG, 10,8). En raison de sa position par rapport au site Mme I
du vecteur original, BseR I causera la formation de fragment d'environ 40 pb ayant
cette allure générale :

CGAC - DiTAG de 36 paires de bases - GTC


AGGCTG - DiTAG de 36 paires de bases - C

On comprendra que chacun de ces inserts correspond à un fragment


immunoprécipité, dont la position dans le génome peut être déterminée en cherchant
par homologie de séquence un endroit où les deux TAGs de 18 pb seraient à
environ 500pb l'un de l'autre.

Tous ces inserts sont ligués ensemble dans des vecteurs, formant une troisième
librairie, la librairie de ChIPPET dont chaque composante sera séquencée
séparément. Chaque réaction de séquence identifiera un grand nombre de fragment
grâce à ses diTAGs.

Là où on gagnera en confiance dans les résultats, c'est en comparant les séquences


obtenues. Des faux positifs seront rares alors que de vrais positifs seront plus
abondant (ce qui est vrai dans la plupart des techniques). En outre, les faux positifs
générés lors de l'amplification des différentes librairies se trahiront par leurs
séquences identiques; ils auront tous les mêmes bouts. Ce problème peut aussi se
manifester lors du ChIP utilisant le PCR; certaines séquences s'amplifient mieux que
d'autres, donnant l'impression qu'elles ont été plus souvent immunoprécipitées. Ici,
les vrais positifs donneront des diTags voisins mais pas identiques, puisque la
sonication ne brise pas la chromatine de manière précise.

208
7.3.4 ChIPSeq

Cette technique basée sur la technologie de la compagnie Illumina vise à


immunoprécipiter des fragments de chromatine et à en purifier l'ADN, puis à les
séquencer directement sur une puce. Comment séquence-t-on de l'ADN collé sur
une puce? C'est ce que nous allons voir.
Supposons qu'on veuille séquencer le génome du biturong, un mammifère asiatique.
À partir de cellules de l'animal, la technique demande qu'on en purifie l'ADN et qu'on
le fragmente ensuite en petits morceaux en laissant des bouts francs. L'ADN
passera par les étapes qui suivent :

1- Ligation d'adapteurs double-brin (A et B) aux deux bouts des fragments

2- Dénaturation de l'ADN et attachement des fragments simple-brin sur une surface


solide ressemblant à une lame de microscope (grâce aux adapteurs, qui portent une
modification à cet effet) . Les fragments s'attachent au hasard sur la surface de la
plaque. Une très grande quantité d'adapteurs simple-brin (qui sont donc des
amorces potentielles) se trouve aussi attachée sur le support solide, tout autour des
plus grands fragments d'ADN.

3- Les longs fragments se replient et leur extrémité libre (qui porte un des brins de
l'un des adapteurs) s'apparie aux courtes amorces complémentaires collées aur le
support solide.

4- L'ajout de nucléotides ordinaires et d'ADN polymérase permet l'élongation des


amorces qui auront réussit à s'annéliser sur les longs fragments, ce qui redonne un
fragment double-brin.

209
5- Dénaturation de ces fragments double-brin; chaque brin reste attaché par son
amorce fixée au support solide.

6- Nouveau repliement des fragments simple-brin (maintenant deux fois plus


nonbreux) et nouvel appariement aux amorces qui se trouvent en grande quantité
dans le voisinage. Nouvelle élongation. On répète ce cycle plusieurs fois, jusqu'à ce
que chaque fragment initialement collé au support donne naissance à un amas de
fragments semblables.

7- Ajout d'un nucléotide terminateur fluorescent, d'amorces et de polymérase. Un


seul nucléotide est ajouté à chaque fragment, au bout de l'amorce de séquençage.
L'appareil enregistre la position de chacun des points sur le support solide (ci-
dessous je n'en ai dessiné que deux, mais il peut y en avoit plusieurs millions). Il
identifie aussi le nucléotide qui a été ajouté à la position 1 pour chque point, en
raison de sa couleur spécifique.

210
8- Les réactifs sont lavés, le groupement qui bloque le bout 3' du premier nucléotide
est coupé chimiquement, le fluorophore du premier nucléotide est coupé
chimiquement, et un deuxième nucléotide est rajouté. Comme ci-dessus, l'appareil
enregistre quel nucléotide s'est ajouté à quel point. On répète ainsi les cycles base
par base, en enregistrant la séquence de chacun des points.

7.3.5 ChIC & ChEC

Ces deux méthodes procèdent de la même idée, et augmentent la résolution des


expriences de ChIP .

Le ChIC (Chromatin ImmunoCleavage) utilise une fusion entre la protéine A et la


nucléase micrococcale (on l'appelle pA-MN). On procède à une fixation des
protéines sur l'ADN comme dans un ChIP normal. On purifie ensuite les noyaux
grossièrement, juste pour les rendre accessibles aux anticorps. Un premier anticorps
est ajouté, visant la protéine dont nous voulons déterminer la position. Un deuxième
anticorps (anti-lapin, anti-souris) est ensuite utilisé pour augmenter le recrutement de
pA-MN au site occupé par le premier anticorps. La parite pA de pA-MN reconnaît et
se fixe à la partie Fc des anticorps, ce qui amène sa partie MN dans le voisinage de
l'ADN. L'ajout de Ca2+, un cofacteur essentiel de la nucléase micrococcale, permet
alors à cette dernière de couper l'ADN très près du site de laison de la protéine
étudiée. La résolution obtenue est de l'ordre de 100-200 pb, alors qu'un ChIP normal
est plutôt du genre 500 pb.

Dans le ChEC (Chromatin Endogenous Cleavage), pendant ce temps, on produit


directement une protéine de fusion entre la protéine d'intérêt et la nucléase
micrococcale. En présence de calcium, cette protéine de fusion va couper l'ADN
juste à côté de son site de liaison; la résolution en est augmentée encore plus.

Ces deux techniques ont été publiées par le laboratoire du Dr Laemmli (le même
que celui du tampon éponyme!) dans Schmid et al. (2004) Cell 16, 147-157.

211
8.0 Protéomique et découverte de drogues

La protéomique, ou étude à grande échelle des protéines, n'est pas strictement limitée au
domaine commercial. De nombreux laboratoires utilisent depuis longtemps des techniques de
gels 2D ou de spectrométrie de masse pour étudier en même temps de très nombreuses
protéines.

Cependant, comme l'industrie doit constamment chercher à accélérer le processus de


développement de nouveaux médicaments, il n'est pas étonnant qu'elle ait recours à toutes les
techniques qui lui permettent de gagner du temps et de se présenter devant les
consommateurs avec un nouveau produit avant la compétition.

Dans ce chapitre, nous parlerons du mécanisme de mise en marché de nouveaux médicaments


et nous mentionnerons, en guise d'exemple, trois compagnies de biotechnologie qui ont mis
sur pied d'ingénieux systèmes protéomiques.

8.1 Le développement d'une nouvelle drogue

8.1.1 D'hier à aujourd'hui

La grande force de notre système moderne de mise en marché des médicaments, c'est que ces
derniers sont supposés fonctionner. Ne riez pas! Pendant longtemps, les décisions médicales
ou pharmacologiques n'ont rien eu à voir avec l'observation ou avec ce duo étonnant que sont
Essai et Erreur.

À la place, nos ancêtres pleins de bonnes intentions essayaient de corriger les états de santé
défaillants en appliquant leurs connaissances limitées du monde qui les entourait. Vous avez
sûrement entendu parler de nombreuses théories qui nous paraissent fort étranges aujourd'hui,
théories souvent basées sur d'antiques systèmes philosophiques plutôt que sur l'observation
des malades.

Ainsi, au moyen-âge, le plus docte des médecins aurait pu vous expliquer sans rire que votre
état de santé dépendait de l'équilibre des quatres humeurs que vous contenez: le phlegme, la
bile jaune, la bile noire et le sang. (Son collègue le chimiste vous aurait expliqué que la
matière, elle, était composée de quatre éléments: le feu, l'air, la terre et l'eau). Sur quoi se
basait cette croyance? Pas sur l'étude des malades, en tout cas!!! Il y a gros à parier que si
vous attrapiez une phlébite, un chirurgien-barbier vous diagnostique en moins de deux un
excès de sang par rapport aux trois autres humeurs, et vous étiez bon pour un petit traitement
aux sangsues. (George Washington, le premier président des États-Unis, trouva la mort après
avoir pris froid un bel hiver... et avoir été abondamment SAIGNÉ par son médecin).

Cet état de choses plutôt dangereux pour les patients provenait en partie d'une croyance
(encore maintenue aujourd'hui par de nombreux vendeurs d'huile de castor) selon laquelle les
Sages de l'antiquité étaient vachement forts en tout, et que toute sagesse ne pouvait provenir
que de l'émulation de ces très grands esprits. Alors si Aristote déclarait que les abeilles ou les
écrevisses sont des animaux dépourvus de sang, il était inutile d'aller vérifier. Aristote l'a dit

212
il y a 2 000 ans, donc ça doit être vrai.

Heureusement, la curiosité naturelle de nos congénères leur permettait quand même de


découvrir des choses, et d'appliquer leurs découvertes à des problèmes concrets. Force est de
reconnaître que de boire une tisane de salicaire soulage les maux de têtes un peu mieux que
les amulettes du sorcier local, et que d'ingérer du jus de raisin fermenté fait oublier les soucis.
(Jusqu'à ce qu'il donne mal à la tête, auquel cas il est bon d'avoir de la tisane de salicaire pas
loin). Éventuellement, on a cherché à savoir ce qui, dans la salicaire, apportait un
soulagement... et nous savons maintenant qu'il s'agit de l'aspirine, un inhibiteur de la synthèse
des prostaglandines, et au diable les biles jaune et noire.

8.1.2 La méthode expérimentale

La méthode expérimentale est le concept le plus révolutionnaire de toute l'histoire de la


science. En termes simples, il s'agit de répondre à la question "oui, mais ça marche-tu?" et de
vérifier si notre succès est dû à autre chose qu'au hasard. (Par exemple, je suis sûr qu'un
horoscope peut prédire avec succès le résultat d'une partie quotidienne de pile ou face... avec
un taux de réussite de 50%. Le hasard fait tout aussi bien).

L'industrie moderne utilise deux approches complémentaires pour produire de nouveaux


médicaments:
(a) Partir avec un problème et lui trouver une solution;
(b) Développer un produit et essayer de trouver un problème qu'il peut résoudre.

Dans le premier cas, on étudiera des pathologies particulières, et on cherchera à les contrôler
en jouant sur différents paramètres qui lui sont propres. Par exemple, puisqu'on sait que de
nombreux cancers dépendent de la protéine de signalisation Ras qui est positionnée à la
membrane plasmique par une ancre de farnesol, on peut développer un inhibiteur de
farnesoylation et ainsi contrecarrer l'action de Ras.

Dans le second cas, on peut ramasser n'importe quel microorganisme dans un champ ou une
forêt, le cultiver en laboratoire, et tester les substances qu'il produit dans différents contextes
pour voir si cette bibitte ne serait pas en train de synthétiser un quelconque médicament
miracle. C'est ainsi qu'on a découvert la pénicilline ou la cyclosporine, après tout.

8.1.3 La recherche pré-clinique

La première étape du développement d'une nouvelle drogue est la recherche pré-clinique.


C'est l'étape de la bonne idée. Soit on a rencontré un shaman sibérien qui jure que sa liqueur
de lichen peut guérir les pieds plats, soit on a identifié un mécanisme moléculaire qui,
interrompu, pourrait empêcher le développement des verrues plantaires. Bref, c'est l'étape ou
une idée va être exposée et testée.

La première chose à l'ordre du jour lors de cette étape est d'avoir une cible, qui sera
d'ordinaire fournie par des travaux de recherche fondamentale. Par exemple, des chercheurs
peuvent déterminer que certains cancers du sein sont stimulés par les estrogènes. La stratégie
serait donc de découvrir un médicament qui inhibe l'activité du récepteur des estrogènes (le
facteur de transcription ER) pour attaquer ces cancers. ER serait considéré la cible d'une telle
stratégie.

213
Bien sûr, certaines entreprises pharmaceutiques chercheront à découvrir elles-mêmes leurs
propres cibles. Pourquoi? Parce que dans l'industrie, il n'y a rien de tel pour assurer les profits
que l'exclusivité d'un concept, d'une idée, d'un protocole ou d'une substance. Cette exclusivité
est assurée par l'obtention d'un brevet. Et au bureau des brevets, c'est premier arrivé, premier
servi. Si l'idée d'utiliser ER comme cible dans le traitement du cancer du sein avait été
pondue dans une entreprise plutôt qu'un labo académique, cette entreprise aurait pu la
breveter... et être la seule à avoir le droit de s'en servir.

8.1.4 Phase I

Les phases cliniques sont celles ou on teste chez l'être humain. Elles sont au nombre de
quatre.

La phase I dure entre deux et six mois. Elle vise principalement à déterminer si la drogue
candidate est sécuritaire chez l'être humain. Quelques dizaines de sujets sont utilisés comme
cobayes pour cette phase; certains sont malades, d'autres bien portant. Bien sûr, on a déjà
testé la drogue sur des animaux à cette étape et on sait qu'elle sera probablement sans danger;
cependant, on veut s'en assurer parce qu'on ne sait jamais. Les deux tiers des drogues
candidates passent cette étape.

8.1.5 Phase II

La phase II vient ensuite. Personne n'ayant subi de dommages spectaculaires pendant la phase
I, on peut maintenant tester la drogue sur un plus grand nombre de personnes (jusqu'à
plusieurs centaines). On va aussi commencer à tester la drogue pour voir si elle a l'effet qu'on
veut sur les patients. Cette phase peut durer deux ans et à la fin on aura éliminé les deux tiers
des drogues candidates qu'on avait au début.

8.1.6 Phase III

La phase III est encore plus poussée et onéreuse. Elle implique des milliers de patients et peut
durer quatre ou cinq ans. Il s'agit ici de tester différents aspects de la posologie et de
l'efficacité de la substance: effet placebo, dosage de la quantité optimale de drogue pour
qu'elle ait un effet supérieur à celui d'autres substances, assurance de l'absence de contre-
indication, etc. Seul le quart des candidats du début passeront cette étape et pourront recevoir
le satisfecit de la FDA (Food and Drugs Administration).

C'est cette approche en plusieurs étapes qui a permis au Dr Frances Kelsey, de la FDA,
d'empêcher que la thalidomide ne soit utilisée pour traiter la nausée du matin aux États-unis.
Nous n'avons pas eu cette chance ici...

8.1.7 Phase IV

La phase IV se déroule quand une drogue est sur le marché. Il peut arriver (malheureusement) que malgré tous les eff
pendant les trois premières phases, un médicament présente des effets dangereux imprévus à long terme.

La fenfluramine (Fen-Phen), par exemple, a été brièvement vendue comme drogue miracle
pour faire maigrir et vous imaginez quel succès elle a pu avoir chez les consommateurs.
214
Malheureusement, plusieurs utilisateurs devaient mourir de problèmes cardiaques peu après
le début de leur utilisation du produit, qui fut retiré du marché.

Le développement d'une
nouvelle drogue, depuis
les phases initiales
jusqu'aux quatre phases
cliniques.

8.1.8 Où la protéomique joue-t-elle un rôle?

215
C'est principalement au niveau de la recherche pré-clinique que la protéomique peut aider
l'industrie, et surtout au niveau de l'identification de nouvelles cibles. Par contre, ce n'est pas
là son unique application et on peut tester l'effet d'une drogue sur l'expression globale des
protéines, ou utiliser des techniques ingénieuses de synthèse pour mettre au point des
protéines artificielles qui auront un effet thérapeutique.

Le schéma ci-contre résume le processus qui conduit à la mise en marché d'une nouvelle
drogue. Qu'on parte avec une maladie à guérir ou un médicament à tester, on doit identifier
un cible qui puisse servir dans un test expérimental ET être utile dans le traitement d'une
maladie. Le test sert à vérifier si la substance candidate peut jouer un rôle; quand on découvre
qu'elle a du potentiel, on en modifie la structure chimique pour maximiser son efficacité.

8.2 Quelques compagnies intéressantes

Les compagnies suivantes (qui n’ont aucun lien avec ce site, je m’empresse de le préciser!!!)
utilisent des techniques de pointe pour étudier les interactions protéiques, découvrir de
nouvelles cibles thérapeutiques, ou encore développer de nouveaux médicaments. Une visite
sur leur propre site ne peut être qu’instructive.

La compagnie Caprion, de Montréal, utilise la spectrométrie de masse pour étudier les


nombreuses interactions protéiques présentes dans les différentes régions de la cellule. Cette
approche a permis la publication de plusieurs articles scientifiques d’une grande importance.

La compagnie Cellzome a utilisé la technique du TAP-tag pour définir une très grande
majorité des interactions protéiques chez la levure. La compagnie offre même ses résultats à
la communauté scientifique.

La compagnie Sangamo, au lieu d’utiliser des facteurs de transcription naturels pour contrôler
l’expression des gènes, synthétise ses propres facteurs en modifiant la structure de doigts de
zinc. Cela permet de créer de nouveaux facteurs de transcription capables de reconnaître de
nouvelles cibles.

216