1

UNIVERSITE DE OUAGADOUGOU
---------------------------------
Unité de Formation et de Recherche
En Sciences de La Santé
U.F.R. – S.D.S.
COURS DE GENIE GENETIQUE
NOTES DU COURS:
Prof. Jacques K. SIMPORE,
…AATCGCCGTCCGATTCCGTCACGC…
….TTAGCGGCAGGCTAAGGCAGTGCG…
Noyau cellulaire
Double brin d’ADN
Chromosome
Cellule
…AATCTTGCCGGGTTCCCG…
…TTAGAACGGCCCAAGGGC…
2
Le Ser ment ét hi que pour l es cher cheur s en sci ences de l a
vi e, adapt é et i nspi r é du Ser ment d' Hi ppocr at e médi cal ,
(Science Vol. 286, 19 Nov. 1999, p.1475).
« Je jure d'être fidèle à l'éthique du respect des personnes et des vies humai-
nes et de contribuer au développement de la connaissance et à la plus large
diffusion du savoir.
Je respecterai toutes les espèces dans leur biodiversité : ce respect inspirera
mes actes et mes projets, notamment au cours de mes expérimentations sur
les animaux ou les tissus humains.
Je m'efforcerai de soulager les souffrances de tous les êtres vivants.
Admis(e) à avoir accès à l'intimité tissulaire ou génétique des personnes, je
tairai leur identité et m'astreindrai au secret médical.
Même sous la contrainte, je ne ferai pas usage de mes connaissances contre
les lois de l'humanité.
Je préserverai l'indépendance nécessaire à l'accomplissement de ma mission.
Je m'informerai et réfléchirai au sens de mes expérimentations et à leurs
conséquences.
Je veillerai à ce que mes travaux et recherches ne soient pas utilisés à des
fins de destruction ou de manipulation.
Je respecterai les savoirs des ethnies et des sociétés traditionnelles.
Je n'aurai garde d'oublier mes responsabilités à l'égard des générations pré-
sentes et futures.
Je n'accepterai pas que des considérations de nationalité, de culture, de poli-
tique ou d'avantages matériels me détournent de mes devoirs.
J'interviendrai pour défendre, s'il m'en est donné l'occasion, l'ensemble de ces
règles.
Que les hommes et mes confrères m'accordent leur estime si je suis fidèle à
mes promesses.
Que je sois déshonoré (e) et méprisé (e) si j’y manque ».
3
Pages
SERMENT POUR LES CHERCHEURS EN SCIENCES DE LA VIE 02
INTRODUCTION 05
PREMIERE PARTIE:
LES OUTILS DE LA BIOLOGIE MOLECULAIRE 07
CHAPITRE I : 08
TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE
ET DE QUANTIFICATION DES ACIDES NUCLEIQUES,
I. Extraction, précipitation de L’ADN des eucaryotes et des procaryotes 08
II. Contrôle de la pureté de l'ADN extrait 10
III: Quantification de l'ADN
10
CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES, 13
YAC, BAC, VIRUS
I- Les vecteurs en génie génétique : l'ADN plasmidique 13
II- L'ADN phagique 17
III. Cosmides, YAC et BAC 20
Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE, 24
CARTE DE RESTRICTION
I. Enzymes de restriction 24
II. L’électrophorèse sur gel 30
III. Les enzymes utiles en génie génétique: 31
CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. 36
I - Le clonage 36
II - Les banques génomiques 36
III - Les banques de cADN 38
IV - L’étude de l’ADN cloné 40
CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION DES GÈNES 51
EUCARYOTES DANS LES BACTÉRIES.
I - Les mutagenèses 51
II. Mise en évidence des effets de la modification 56
III. Transfert de l’ADN modifié 57
4
DEUXIEME PARTIE : APPLICTION DE LA BIOLOGIE MOLECULAIRE :
LE GENIE GENETIQUE 59
CHAPITRE VI: LES TECHNOLOGIE DU GENIE GENETIQUE APPLIQUEES
AUX MICRO-ORGANISMES 60
I. La technique de l'ADN recombinant (ADNr) 60
II – Synthèse du facteur VIII humain 63
III – Synthèse de l’insuline humaine 63
IV - Synthèse de l’hormone de croissance (GH) 64
V – Production de vaccins 64
VI - Production de nouvelles antibiotiques 65
VII – Production d’aliments fermentées 68
CHAPITRE VII:
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX VEGETAUX 71
I. – Le plasmide Ti 71
II – Le Terminator 73
III – Application des techniques du génie génétique à l’agriculture 77
CHAPITRE VIII :
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX ANIMAUX 82
I – Les insectes transgéniques 82
II – Les animaux transgéniques 83
CHAPITRE IX : CLONAGE DES MAMMIFERES, PARTHENOGENESE,
CELLULES SOUCHES EMBRYONNAIRES, THERAPIE GENIQUE 87
I – Clonage des organismes entiers 87
II – Les cellules souches embryonnaires 88
III - La parthénogenèse: 93
IV - La thérapie génique: 93
CHAPITRE X :
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES
DANS LA RECHERCHE SUR LE VIH/SIDA 98
I – Structure du VIH 98
II - Les nouvelles molécules antivirales en développement: 99
III. Vers l’espoir d’obtenir un jour un vaccin anti-VIH. 100
IV. Le génie génétique et la lutte contre le VIH. 101
PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE 107
I - Généralité : Pharmacogénétique et pharmacogénomie 107
II - Les désordres pharmacogénétiques 111
5
BIBLIOGRAPHIE 120
INTRODUCTION
Les méthodes et les techniques de biologie moléculaire développées durant
ces dernières décennies, pour séquencer, « recombiner », transférer et analyser les
produits de l’expression du matériel génétique des diverses espèces vivantes ont
donné lieu à une application sous le nom de « génie génétique ».
Le transfert transitoire ou stable d’un DNA étranger dans une cellule proca-
ryote ou eucaryote s’opère grâce à des vecteurs naturels et à de nouveaux vecteurs
issus des constructions: plasmides, bactériophages, virus, cosmides etc. Ces tech-
niques doivent permettre une meilleure compréhension génétique et fonctionnelle
des organismes vivants.
Le génie génétique permet :
• d’identifier et d’isoler,
• de modifier et de transférer,
• de cloner et d’amplifier,
• de contrôler l’expression d’un gène ou d’un transgène dans
le matériel biologique.
Il s’agit donc d’un outil, aux applications très variées qui permet d’intervenir
avec une grande précision sur le patrimoine génétique de tous les organisme vi-
vants.
Cette technique permet d’identifier un gène spécifique parmi les 30.000 gè-
nes environ que compte l’être humain, de l’amplifier afin qu’il soit plus facile d’accès,
de le découper et de l’isoler ensuite des autres molécules d’ADN. Le gène isolé
peut, à la fin, être réinséré dans une molécule d’ADN d’origine différente, ce qui
permet de transférer de l’information génétique d’une cellule vers une autre dans
laquelle il pourra diriger la production d’une protéine particulière, dont il code et dé-
termine la structure (Projet Séquençage génome humain février 2001).
Le résultat obtenu au cours de cette manipulation est la protéine originelle du
premier organisme. Cependant, le génie génétique permet également d’apporter des
modifications à des gènes par une mutagenèse dirigée qui par conséquent produi-
ront des protéines modifiées ou recombinantes.
Les applications directes de la biologie moléculaire:
• En biotechnologie: le génie génétique permet de faire produire par des
micro-organismes recombinants des protéines eucaryotes comme des hormones,
des vaccins, des anticorps monoclonaux et il offre des perspectives nouvelles dans
6
l’industrie agroalimentaire, dans l’amélioration génétique des espèces animales et
végétales.
• En médecine: le but du génie génétique est la prédiction, le diagnostic des
maladies héréditaires et leur soin à travers la thérapie génique et la pharmacogéné-
tique. La thérapie génique somatique qui est différente de la thérapie génique ger-
minale, consiste à transférer certains gènes dans les cellules du patient pour
prévenir l’apparition d’une maladie ou en ralentir l’évolution. Ce type de
génothérapie suscite de très grands espoirs.
• Protection sociale et législation: La médecine «légale» à travers la tech-
nique de l'ADN «finger printing» peut individualiser une personne humaine sans
équivoque car cette technique ne requiert que quelques cellules de la personne
concernée (cellules sanguines, cellules épithéliales, cellules osseuses ou simple-
ment quelques boucles de cheveux).
• Perspective pour demain: avec le projet du génome humain et la techni-
que du clonage positionnel, les génies généticiens cherchent à localiser et à sé-
quencer non seulement les gènes responsables des maladies héréditaires mais
aussi la totalité du génome humain pour créer la cartographie génique de l’homme,
des micro chips. Aujourd’hui, le génome humain a été entièrement séquencé ; mais
une nouvelle problématique se pose: comment déterminer les interactions existan-
tes entre les 20.000 à 30.000 gènes de l’organisme humain ?
Le génie génétique possède, sans doute, aujourd’hui un champ d’application
très large et nous ouvre des perspectives nouvelles. Il s'agit incontestablement
d’une technologie clé pour ce troisième millénaire. Cependant, comme toute techni-
que, le génie génétique a ses limites. Ainsi, dans un organisme vivant, la production
d’une protéine de nature et de fonction données peut nécessiter des informations
présentes à plusieurs endroits de l’ADN. Ces informations plus complexes et plus
complètes peuvent amener un gène à produire de façon différente une même pro-
téine selon l’état physiologique de la cellule, de son stade de développement ou de
différenciation. Plusieurs gènes doivent donc s’associer dans ce processus, afin de
fournir à l’organisme les quantités et les qualités précises de cette protéine en fonc-
tion de son rôle biologique.
Si la technologie génétique sait parfaitement identifier, isoler et modifier un
gène particulier, elle a beaucoup plus de difficultés à l’heure actuelle pour détermi-
ner les liens existant entre les différents gènes. Leur transfert et leur expression,
parfois ectopique, posent encore des problèmes qui restreignent, pour l’instant, le
champ d’application du génie génétique.
7
PREMIÈRE PARTIE :
LES OUTILS
DE LA BIOLOGIE
MOLECULAIRE
8
CHAPITRE I :
TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE
ET DE QUANTIFICATION DES ACIDES NUCLEIQUES,
I. EXTRACTION, PRÉCIPITATION DE L’ADN DES EUCARYOTES
ET DES PROCARYOTES
Toutes les méthodes biochimiques qui permettent d’extraire l’ADN dans les
différents tissus peuvent être utilisées en fonction des espèces, et en tenant compte
de la structure anatomique des cellules. Nous prendrons comme exemple, les cellu-
les eucaryotes humaines, en l’occurrence les cellules sanguines qui sont très ac-
cessibles compte tenu de la moralité et du bénéfice du doute.
Pour ce qui concerne le génome humain comme pour tous les mammifères,
les leucocytes sanguins constituent une source simple de DNA pour les études de
biologie moléculaire.
Un prélèvement de 5 à 10 ml de sang recueilli sur un anticoagulant comme
l'EDTA, permet d’obtenir quelques centaines de microgrammes de DNA sous la
forme de fragments de taille supérieure à 20 kbases. Cette quantité est suffisante
pour entreprendre une expérience d’application en génie génétique.
1. La lyse des cellules eucaryotes.
La lyse des cellules sanguines met en jeu l’intervention de détergents ioni-
ques qui désorganisent la double couche de phospholipides des membranes cellu-
laires.
Le sang fraîchement recueilli (avec un anticoagulant comme l’EDTA) ou dé-
congelé est vigoureusement mélangé à une solution hypotonique pour faire éclater
les hématies dépourvues de noyaux. Les leucocytes sont alors récupérés par centri-
fugation suivie d’un lavage avec la même solution hypotonique.
Ils sont ensuite traités par un mélange de détergent, comme le SDS (Sodium
DodécylSulfate) qui permet de désagréger les membranes cellulaires et de libérer
les contenus cytoplasmiques et nucléaires. En biochimie classique et pour d’autres
applications, il faut d’abord séparer les noyaux du contenu cytoplasmique et de ces
organites cellulaires. Un traitement par la protéinase K (une protéase) permet de
libérer le DNA nucléaire en digérant les histones qui lui sont associées dans les
chromosomes eucaryotes.
L'élimination des protéines non digérées et des lipides se réalise par des pré-
cipitions et des extractions sélectives. Le mélange phénol-chloroforme permet de
dénaturer les protéines car non miscible à l’eau et de densité supérieure à cette der-
nière. Les acides nucléiques n'y sont pas non plus solubles et restent dans le sur-
nageant aqueux.
9
Pour les tissus, il est conseiller de les désagréger par les techniques couran-
tes de biochimie comme le broyage ou les ultrasons. Une congélation préalable
permet de transformer les tissus en une masse solide qui se prête alors à un
concassage par les techniques courantes de broyage. L’extraction et la purification
suivent alors le même protocole.
2. L’ADN des procaryotes
Le schéma de la figure I.2 résume les différents étapes de l’extraction et de la
purification de l’ADN d’Escherischia coli, la bactérie la plus utilisée pour les analyses
en biologie moléculaire. La lyse cellulaire utilise ici une enzyme : le lysozyme qui
permet de dégrader la membrane cellulaire. La purification suit le même schéma que
pour celle de l’ADN des eucaryotes.
3. L’extraction de l’ADN par le mélange phénol / chloroforme.
Le mélange phénol-chloroforme non miscible à l’eau permet de transférer les
protéines dans la phase organique alors que les acides nucléiques restent dans la
phase aqueuse. La phase aqueuse résultante peut subir plusieurs extractions par un
mélange chloroforme-éther pour éliminer les peptides restants, les traces de phénol
et des composés organiques qui y sont solubles. Les acides nucléiques sont alors à
récupérer de la phase aqueuse par des précipitations à l’alcool éthylique ou à
l’isopropanol en fonction des besoins. On obtient alors les acides nucléiques sous la
forme de fibres solides que l’on récupère par centrifugation.
Pour des études biochimiques fines de structure, il convient de procéder à
d’autres purifications. Pour les analyses génétiques (application des diagnostics de
routine), le DNA obtenu est de qualité suffisante et peut être quantifié par simple
pesée.
L'élimination de l'ARN peut être effectuée à la fin ou avant l'étape phénoli-
que. Pour cela, on utilise une RNAase pure ou "DNAase free", c'est à dire, dépour-
vue d'activité DNAase.
L’ADN récupéré sous forme de fibres peut être conservé sous la forme solide
pendant des temps très longs. Il peut aussi être re-dissout dans un tampon stérile de
force ionique moyenne contenant de l'EDTA et dont le pH est compris entre 7 et 8
Figure I.1 : Méthode classique de l’extraction et de la purification de l’ADN
Figure I.2/I.3 : Organigrammes de l’extraction et de la purification de l‘ADN des pro-
caryotes
10
4. Extraction des ARN
Les ARN sont plus difficiles à étudier parce qu’ils sont très sensibles aux ri-
bonucléases (RNase A) qui sont très actives et présentes même sur les doigts du
manipulateur. Elles peuvent résister à un traitement à 90°C pendant une heure. Il
faut donc des conditions de stérilité parfaite pour travailler avec ces acides
nucléiques. Pour l’extraction, les tissus ou les cellules sont homogénéisés dans un tam-
pon acétate contenant :
- Un détergent puissant (SDS ou sarcosyl)
- Un agent dissociant (thiocyanate ou guanidine)
- Un agent réducteur (DTT ou 2-mercaptoéthanol)
Ce type de tampon permet d’inhiber les RNases endogènes, de dénaturer les
acides nucléiques et de dissocier les protéines. Après une centrifugation pour élimi-
ner les débris cellulaires, les RNA sont extraits suivant plusieurs techniques. La
technique par précipitation différentielle du RNA et du DNA en fonction du pH et de
la concentration en éthanol donne de très bons rendements. On peut également uti-
liser l’ultracentrifugation. Le culot est récupéré, lavé avec le tampon acétate et pré-
cipité à l’éthanol. Il peut se conserver congelé à –70°C pendant un an.
II. CONTRÔLE DE LA PURETÉ DE L'ADN EXTRAIT
Le maximum d'absorption des acides nucléiques se situe à 260 nm. Les pro-
téines, principaux contaminant des préparations absorbent aussi à 260 nm, mais
avec maximum d'absorption qui se situe vers 280 nm à cause des acides aminés
aromatiques. Le rapport R= A
260nm
/ A
280nm
constitue alors un bon moyen pour appré-
cier une éventuelle contamination de la préparation d'ADN par les protéines ou par
les RNA.
Une contamination par les ARN se traduit par une augmentation du rapport R.
Les ARN étant en simple brin, le coefficient moyen d’absorption d’un nucléotide est
supérieur à celui du même nucléotide dans la double hélice à cause de
l’hypochromisme.
*R = A
260nm
/A
280nm
* ADN pur: 1,8 < R < 2
* ADN contaminé par les protéines: R < 1,7
* ADN contaminé par les ARN: R > 2
Le spectre d'absorption U.V. permet également d’estimer les contaminations
éventuelles et permet aussi de quantifier l’ADN de la préparation. L’apparition
d’épaulements donne une idée des différents contaminant.
-Un épaulement à 280 nm indique une contamination protéique.
-Un épaulement à 270 nm indique une contamination par phénol.
11
-Un épaulement à 230 nm indique une contamination par les glucides.
-En absence d'impuretés l'absorbance de la solution d’ADN à 320 nm doit
être autour de zéro.
Figure I.4 : Spectre d’absorption de l’ADN
III: QUANTIFICATION DE L'ADN
a. - Dosage colorimétrique de l'ADN
Il est basé sur la réaction spécifique des 2-désoxypentoses avec la diphény-
lamine. En milieu acide à chaud, le 2-désoxyribose des nucléotides puriques peut
être libérés et former un composé bleu dont le maximum d'absorption se situe à 595
nm. C’est la méthode classique pour mesurer des quantités importantes de DNA (de
l’ordre de quelques milligrammes).
b: Dosage par absorption U.V. de la concentration en ADN
A 260 avec un trajet optique de 1 cm, une unité d'absorbance correspond à
une concentration d’ADN double brin de 50 µg / ml. La concentration de l’ADN d’une
préparation peut être alors calculée par la relation :
A= ε.C.l =
Une unité d’absorbance correspond à 25 µg/ml de RNA ou d’ADN simple brin.
Malheureusement, cette méthode est peu sensible pour manipuler des concentra-
tions d'ADN inférieures à 250 ηg/ml
c. Dosage de l'ADN par fluorescence en présence de BET
Le Bromure d'Ethidium (BET) interagit avec l'ADN en s’y intercalant et une
fois intercalé, le rendement de fluorescence du colorant devient cent fois plus impor-
tant. Le principe de la quantification consiste à comparer à l’oil nu (estimation), ou
mieux après photographie, l'intensité de la fluorescence émise par l'ADN sur un gel
d’électrophorèse. La quantification exacte consiste alors à établir une courbe
d’étalonnage donnant l’intensité de fluorescence d’une solution de BET à laquelle on
ajoute des quantités croissantes de DNA de concentration connue. (Gamme d'éta-
lonnage). Par cette méthode on peut déceler des quantités de DNA de l’ordre de 50
ηg/ml.
d. Dosage fluorimétrique classique de l'ADN.
On utilise un spectrofluorimètre pour mesurer l'intensité de la fluorescence
d'une solution d'ADN en présence d'un excès de BET. On compare ensuite les va-
leurs de ces intensités avec celle d'une solution d'ADN standard (courbe standard).
Le BET peut être remplacé par un autre colorant pour augmenter la sensibilité de la
mesure. Cette méthode permet de mesurer des quantités d’ADN de l’ordre de quel-
ques picogrammes.
12
CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES,
YAC, BAC, VIRUS
I - LES VECTEURS EN GÉNIE GÉNÉTIQUE : L'ADN PLASMIDIQUE
1. Les plasmides.
a : Définition :
Les plasmides sont de petites molécules d'ADN bicaténaires, circulaires,
extra-chromosomiques, susceptibles de se répliquer de façon autonome (réplicons).
Ils sont présents dans le cytoplasme de nombreuses espèces bactériennes. Leur
ADN comprend au minimum les gènes intervenant dans la réplication et la ségréga-
tion de leur matériel génétique dans les cellules filles à chaque cycle de division cel-
lulaire de la cellule hôte Figure II.1.
La plupart des plasmides naturels contiennent des gènes qui confèrent à
l'hôte des propriétés supplémentaires comme la résistance aux antibiotiques. Une
bactérie peut posséder en même temps plusieurs plasmides différents sauf si leur
co-habitation est incompatible avec la survie de la bactérie.
Une bactérie peut posséder un très grand nombre de copies plasmidiques. el-
les sont transférables d’une bactérie à une autre au cours de la conjugaison bacté-
rienne. Leurs utilisations majeures comme vecteurs en génie génétique sont :
> Le clonage et l'amplification d'une séquence d'ADN exogène.
> L'étude des mécanismes de l'expression d'une séquence d'ADN exogène.
> L'introduction des gènes dans les cellules bactériennes (transformation) ou
animales (transfections) ou dans des organismes entiers (animaux transgéniques).
> A l'échelle industrielle, la production des protéines codées par les gènes
contenus dans l’ADN inséré.
b : Caractéristiques des plasmides utilisés en génie génétique
La cellule hôte la plus utilisée est Escherichia coli. Les plasmides naturels dits
de première génération ont été utilisés dans le passé comme vecteur de clonage,
mais les plasmides utilisés actuellement sont modifiés et sont donc des chimères
obtenues par des recombinaisons de différents plasmides naturels et de DNA viral.
Ils sont petits de taille pour permettre l'insertion d'une importante quantité d'ADN
exogène tout en maintenant une bonne efficacité de transformation. Ils possèdent :
> Une origine de réplication de type relâché : la séquence ori. Le nombre de
copies par cellule est très important (plusieurs centaines par cellule)
> Un gène de résistance à un antibiotique auquel la souche hôte est sensi-
ble, ce qui permet la sélection des cellules résistantes qui survivent sur un milieu
contenant l’antibiotique en question.
> Un second gène marqueur phénotypique (soit un deuxième gène de résis-
tance à un second antibiotique ou le gène Lac Z' ) qui permet de reconnaître parmi
les colonies transformées celles qui hébergent un plasmide recombinant.
> Un ou plusieurs sites de restriction (polylinker) qui permettent la linéarisa-
tion du plasmide préalable à l'insertion de l'ADN exogène.
13
c : Deux vecteurs plasmidiques : pBR 322 et pUC18
Le plasmide pBR322 est très simple dans sa structure. Il contient 2 gènes de
résistance aux antibiotiques, tet
R
et amp
R
. Chacun de ces gènes contient un site de
restriction qui est utilisé pour le clonage. L'ADN du donneur peut être, par exemple,
inséré dans le gène tet
R
. Une insertion réussie se traduira par l'inactivation de ce
gène qui ne sera plus capable de conférer la résistance à la tétracycline à la cellule
hôte. C'est pourquoi le protocole de clonage consistera à mélanger l’ADN du plas-
mide et l’ADN du donneur digérés par une même enzyme de restriction suivi d’une
ligaturation.
Cette préparation est alors utilisée pour transformer les bactéries et sélec-
tionner les colonies résistantes à l'ampicilline. Ces dernières doivent avoir été
transformés avec succès par une molécule de plasmide recombinante.
Parmi les colonies Amp
R
, seules celles qui s'avèrent sensibles à la tétracy-
cline contiennent une insertion, en d'autres termes, seules les colonies amp
R
tet
S
contiennent de l'ADN recombinant (ADN du plasmide et ADN inséré). L’insertion de
l’ADN étranger dans pBR322 est détectée par l’inactivation du gène de résistance
(tet
R
), indiqué par le phénotype tet
S
(sensible).
Figure II.2 : Le plasmide pBR322
d : Les plasmides pUC
Les plasmides de la famille pUC sont des vecteurs plus élaborés dont la
structure permet la sélection visuelle directe des colonies contenant l’ADN inséré.
L'élément clé est une petite portion du gène de la β-galactosidase d’Escherichia coli.
Un segment d'ADN synthétique appelé adaptateur (en anglais, polylinker ou clo-
ning site) contient de nombreux sites de restriction utiles pour l'insertion des frag-
ments de l'ADN du donneur. L'adaptateur est en phase avec la séquence codant la
β-galactosidase mais n'interfère pas avec son fonctionnement.
Figure II.3 : plasmides pUC
L’origine de réplication ori des plasmides pUC diffère légèrement par muta-
tions de celle de pBR322, ce qui explique le très grand nombre de copies des plas-
mides pUC dans une cellule bactérienne et par suite des vecteurs de troisième gé-
nération qui en dérivent.
L'insertion d’un vecteur dans pUC est détecté par l'inactivation de la fonction
galactosidase du gène Z', qui se traduit par l'incapacité de la cellule hôte à convertir
le substrat artificiel X-Galactoside en un colorant bleu (X= paranitrophénol).
X-Galactoside → X (colorant bleu) + Galactose
En résumé, les plasmides sont des fragments d'ADN extra-chromosomiques
circulaire présents dans les bactéries et susceptibles de se répliquer de façon auto-
nome. Ils peuvent porter des gènes de résistances aux antibiotiques. Expérimenta-
lement ils sont utilisés comme vecteur pour transporter de l’ADN exogène.
14
Vecteurs Taille en
bp
Nombres de
copies par cel-
lule
Marqueur phénoty-
pique
Quelques sites
uniques
de restriction
pBR322 4363 15 à 20 Tétracycline
Ampicilline
EcoR I, Hind III, Pvu
II,
Nde I, Afl III
pPUC18 686 ≈ 500 Ampicilline Lac Z' 13 sites de restric-
tion
sur un polylinker
Tableau I. 1 : Quelques caractéristiques des deux plasmides utilisés en génie
génétique.
Les plasmides de première génération: ce sont les plasmides rencontrés dans
la nature. Il s'agit des plasmides ColE1, RSF2124, pSC101. Ces types de plasmides
n'ont pas les propriétés requises pour les manipulations génétiques.
Les plasmides de seconde génération: ce sont les plasmides de la famille
pBR. (pBR312 à 328) obtenus par construction. Le plus utilisé est le plasmide
pBR322, constitué de 4 363 paires de bases. Il possède deux gènes de résistance
aux antibiotiques : l’un pour la tétracycline Tc
R
et l’autre pour l’ampicilline Amp
R
et
20 sites uniques pour les enzymes de restriction. Parmi les sites uniques, 11 sont
localisés dans les gènes de résistance aux antibiotiques.
EcoR V, BamH 1, Sph 1, Sal 1, Xma 1 et Nru 1 dans le gène Tc
R
Cla 1 et Hinh III dans le promoteur du gène Tc
R
Pst 1, Pvu 1, et Sca 1 dans le gène Amp
R
L'insertion d'ADN étranger dans un quelconque de ces sites se traduit par la
perte de la résistance à l'antibiotique.
Les plasmides de 3
ème
génération : Ces plasmides ont été construits pour facili-
ter le travail de sous clonage et pour une sélection des clones recombinants.
> la famille pUC: Ce plasmide de 2 600 paires de bases environ dont
pUC18 possèdent : un promoteur et un opérateur efficace de transcription, le gène
de résistance à l’ampicilline Amp
R
et une partie du gène lacZ. Un polylinker est insé-
ré dans le gène lacZ. La présence de ce polylinker n’interfère pas avec le fonction-
nement du gène de la 8-galatosidase. Le gène LacZ permet la sélection des recom-
binants par la couleur des colonies. Il faut donc pour cela utiliser les bactéries lac
-
.
Les différents plasmides de cette famille diffèrent les uns des autres par la taille de
leur polylinker. Leur petite taille permet l’insertion d’un ADN assez grand et une
croissance rapide des plasmides.
15
> La famille pSP . Ils sont plus petits que pBR322 (entre 2900 et 3000 bp).
Ces plasmides possèdent : un polylinker, le gène de résistance Amp
R
et le promo-
teur de la RNA polymérase du phage SP6 qui provient de Salmonella. typhimurium
immédiatement adjacent au polylinker. Ces types de plasmides offrent un avantage,
car ils permettent de transcrire en ARN la séquence d’ADN qui a été insérée dans le
polylinker.
> Les plasmides Gemini (1 à 4) dérivent des précédents. Ils possèdent en
plus sur le brin complémentaire, de l’autre côté du polylinker, un promoteur de la
RNA polymérase du phage T7. L’avantage de ces plasmides est de pouvoir trans-
crire l’ADN inséré en une grande quantité d’ARN sur les deux brins pour servir de
ribosondes ou pour la traduction en protéines.
> Les plasmides Blue-Script
®
. Ce sont les plasmides les plus complexes
car ils combinent tous les avantages des vecteurs précédents. Le plasmide Blue-
Script
®
est un petit plasmide de 2961 paires de bases à haut nombre de copies, plus
de 500 exemplaires par cellule. Il possède, outre le gène de résistance à
l’ampicilline, le gène lacZ’ (codant pour le peptide q de la 8-galactosidase et conte-
nant les séquences régulatrices de l’opéron lactose) qui permet la sélection des co-
lonies. De plus, l’ADN inséré est sous la dépendance du promoteur du gène lacZ’.
Chaque fois que ce gène est exprimé, l’ADN inséré est aussi exprimé d’ou la pro-
duction de la protéine correspondante. La haute efficacité de transformation, due à
sa petite taille, constitue un intérêt avantageux pour ce vecteur en biotechnologie.
Figure I.6 : Le plasmide pUC18.
Figure II.4 : Le plasmide Blue-Script II ;
2. Extraction et purification de l’ADN plasmidique
Il existe de nombreuses méthodes d'extraction et de purification des plasmi-
des . Toutes comportent cependant trois (3) étapes principales :
1-Croissance des bactéries hôtes avec éventuellement amplification du
plasmide en ajoutant par exemple du chloramphénicol qui bloque la croissance bac-
térienne sans affecter la réplication de l’ADN plasmidique.
2-Lyse des bactéries pour libérer le plasmide : La lyse des cellules est réali-
sée dans les conditions permettant d'obtenir l'ADN plasmidique purifié dans une so-
lution ne contenant que très peu d'ADN chromosomique et de protéines: Le traite-
ment des bactéries par le lysozyme suivi d’un traitement avec un détergent (Triton
100 ou SDS) ou d’un traitement basique fait passer les RNA et les plasmides en so-
lution tandis que l’ADN bactérien reste emprisonné dans les fantômes bactériens .
Cette solution est appelée lysat clair.
3-purification du plasmide à partir du lysat. Les principales techniques de
purification sont :
> Le lysat clair est soumis à une ultracentrifugation dans du chlorure de cé-
sium (CsCl ) en présence de bromure d’éthidium (BET) saturant.
16
> La précipitation différentielle de l'ADN plasmidique par le polyéthylène gly-
col (PEG ) permet aussi d'éliminer les petits fragments d'ADN et d'ARN non précipi-
tés et d’obtenir des plasmides de pureté appréciable.
> La chromatographie d'échange d'ions, dans les conditions appropriées de
force ionique et de pH, permet également à l'ADN plasmidique d’être absorbé sélec-
tivement.
II- L'ADN PHAGIQUE
Les bactériophages ou phages sont des particules virales qui infectent les
bactéries. Leur multiplication est rapide et le nombre de copies par cellule bacté-
rienne est très important. Figure II. 5.
Lorsque l’ADN du phage pénètre dans une bactérie, deux types de réponses
peuvent se produire :
Une réponse lytique : Dans ce cas, l’ADN du phage intégré dans le
chromosome bactérien prend immédiatement en charge le système de transcription
et de traduction de la cellule hôte qui commence la synthèse des constituants pro-
téiques du phage. Ces différents constituants s’assemblent et forment de nouvelles
particules phagiques dès que commence la réplication de l’ADN phagique. La bacté-
rie éclate et les nouvelles particules virales infestent les bactéries voisines. Il se
forme alors une plage de lyse sur une boite de Pétri. Figure II. 6
Réponse lysogénique : L’ADN du phage est intégré dans le chromosome
bactérien. Il reste à l’état de repos, c’est à dire qu’il se réplique en même temps que
le chromosome bactérien mais reste intégré à ce chromosome. Il ne se produit pas
de nouveaux virions. Le métabolisme et la viabilité des bactéries ne sont pas modi-
fiés tant que la bactérie reste dans cet état. Les bactéries à prophage intégré sont
appelées des bactéries lysogènes. La lysogénie peut être supprimée par des
agents inducteurs de la virulence des phages (rayons X, agents mutagènes…)
Deux types de phages qui infectent Escherichia coli sont d'usage fréquent en
génie génétique: le phage λ et le phage M13.
1- Le phage Lambda λ
Le phage λ est un bactériophage de 1
ère
génération. Il est constitué d'un ADN
double brin linéaire de 48.502 paires de bases. Les extrémités appelés COS sont
constituées par de l'ADN sous forme simple brin sur une longueur de 12 bases. Le
bactériophage λ est un vecteur de clonage efficace pour plusieurs raisons:
> Les extrémités cohésives permettent au phage de se concaténer et de se
circulariser. La circularisation est observée dans la bactérie immédiatement après
l’infection.
> La tête du phage λ peut encapsider spécifiquement un ADN chromosomi-
que d’environ 5 kb. Cette propriété permet de sélectionner les particules du phage λ
naturel des phages λ contenant des ADN étrangers. Figure II. 7
> La région centrale du génome du phage λ n'est pas nécessaire pour la ré-
plication ou l'encapsidation des molécules d’ADN de λ dans Escherichia coli et peut
donc être excisée par des enzymes de restriction et écartée.
17
> Les "deux bras" restants sont ensuite ligaturés avec l'ADN du donneur di-
géré par les mêmes enzymes de restriction.
> Les molécules d’ADN ainsi obtenues peuvent être introduites dans E. coli
par la transformation ou être encapsidées in vitro dans les têtes d’un bactériophage.
Figure II. 8
Le génome du phage λ :
Les gènes AWBCNu3DEF
I
F
II
codent pour les protéines de la tête
Les gènes ZUVGTHMLKIJ codent pour les protéines de la queue
Les gènes att int xis q 8 v permettent la recombinaison
Les gènes cIII N cl cro cII assurent la régulation
Les gènes O P assurent la réplication
Le gèneQ est également un gène de régulation
Les gènes R S permettent la lyse bactérienne
La partie centrale peut être délétée pour insérer un ADN exogène
2: Dérivés du phage λ utilisés comme vecteur de clonage
Le bactériophage λ sauvage ne peut pas être toujours utilisé pour le clonage
car son ADN comporte des sites multiples pour beaucoup d'endonucléases de res-
triction utilisées dans les différents processus de clonage. De plus, ces sites sont
souvent localisés dans les régions du génome indispensables pour le cycle lytique
du phage.
La longueur de l'ADN pouvant être encapsidé ne peut dépasser 5 kb, si bien
que la taille de l'ADN étranger qui pourrait être inséré est très limitée.
A partir des phages sauvages, on a construit des phages qui n'ont qu'un
(pour vecteur d’insertion) ou deux (pour vecteurs de substitution) sites de restric-
tions situées dans les parties non essentielles du génome de phage λ.
Le phage λgt 11 est utilisé dans la stratégie de l’insertion pour cloner les
cDNA dont la longueur varie de 6 à 8 kb. Il sert de vecteur d’expression car la sé-
quence insérée pourra être exprimée dans la bactérie sous forme de protéine, per-
mettant la recherche du recombinant désiré à l’aide d’un anticorps dirigé contre la
protéine synthétisée.
Le phage λ ZAP II est une forme améliorée du précédent qui permet de vi-
sualiser l’expression du DNA inséré. La sélection des recombinants se fait en analy-
sant la coloration bleue ou blanche, lorsque la culture est réalisée sur un milieu
contenant le substrat X-gal et l’IPTG.
3. : Les phages EMBL 3 et 4
18
Ces deux phages sont très proches du phage λ classique. Ils en diffèrent par
la présence d’un polylinker aux deux extrémités de la zone de DNA qui sera délété
pour être remplacé par le DNA à cloner. Les deux phages ne diffèrent que par
l’orientation du polylinker. On peut y introduire des fragments de 15 à 20 kb. Ils
constituent des phages de choix pour la constitution des banques génomiques.
4. : Les phages GEM
R
11 et 12
Ces deux phages sont destinés à la réalisation de banques génomiques et
sont des versions améliorées des phages EMBL. La taille de l’ADN à insérer varie
de 9 à 23 kb. Ils en diffèrent par deux types d’améliorations :
- Modification du polylinker. Le polylinker de ces phages comporte un plus
grand nombre de sites de coupures uniques pour deux enzymes de restriction : Sfi
dans la version 11, Not dans version 12 car les sites de coupure de ces enzymes
sont très rare. L’addition d’un site Xho I simplifie la réalisation des banques génomi-
ques.
- Addition de promoteurs pour des RNA polymérases spécifiques : Un
promoteur de la T7 RNA polymérase est ajouté à l’extrémité du bras gauche avant le
polylinker et le promoteur de la T3 RNA polymérase à l’extrémité droit. Ces deux
promoteurs permettent de synthétiser des ribosondes correspondant spécifiquement
à chacun des brins de l’ADN cloné. Les ribosondes sont utilisées pour cribler de
nouveau la banque et ainsi isoler les segments adjacents au DNA cloné. Ainsi, il est
certain de marcher sur le chromosome sans se tromper d’avancer dans le bon sens.
5. : Le phage M13 et ses dérivés
Figure II.9
Le bactériophage M13 qui infecte Escherichia coli (seules les bactéries mâles
peuvent être infectées) est un phage filamenteux dont la particularité et l'intérêt rési-
dent dans son matériel génétique. Le matériel génétique de ce phage est constitué
d’une molécule d'ADN circulaire monocaténaire de 6407 paires de bases notée brin
(+).
La multiplication intracellulaire du phage fait intervenir une forme réplicative
(RF) constituée par l'association du brin génomique (+) et d’un brin complémentaire
nouvellement synthétisé noté brin (-). Ce dernier devient la matrice pour la synthèse
de nouveaux brins (+) qui seront encapsidés et relâchés dans le milieu.
L'ADN phagique (+) peut être extrait à partir des virions de manière analogue à
l'ADN du phage λ.. La forme réplicative (RF) bicaténaire peut aussi être extraite de
la cellule de la même manière que l’ADN d’un plasmide.
Le phage M13 a été modifié de manière a pouvoir introduire un ADN étranger
dans la forme réplicative au niveau d'un site unique de restriction. La forme réplica-
tive recombinée peut ensuite être introduite dans une cellule hôte par transformation
comme un plasmide de manière a disposer sur le brin (+) d'une séquence connue au
voisinage de l'insertion. Sur cette séquence connue, on peut hybrider un oligonu-
cléotide de synthèse qui servira alors d'amorce pour la DNA polymérase. Les modi-
fications pour en faire un vecteur sont :
19
- L’addition d’un polylinker pour faciliter l’insertion des séquences de DNA
- L’addition d’un gène lacZ pour permettre la sélection des recombinants (sys-
tème des bactéries bleues et blanches en présence d’IPTG et de X-gal).
La possibilité de disposer d'une insertion dans un ADN monocaténaire circu-
laire fait des dérivés du phage M13 des vecteurs très utilisés en génie génétique
pour :
• La création de mutations ponctuelles
• La synthèse de sondes nucléiques.
• Le séquençage de l'ADN par la méthode de Sanger
• Dans certaines techniques de mutagenèse dirigée in vitro, on utilise alors
comme amorce (primer) un oligonucléotide complémentaire de l'insert mais possé-
dant la modification de séquence souhaitée.
6. : Infection
Avec l'ADN recombiné par insertion ou substitution, on forme des particules
virales par encapsidation in vitro en ajoutant les protéines de la capside et de la
queue. Les particules virales ainsi formés permettent une introduction très efficace
de l'ADN recombinant de la cellule hôte E. coli par infection phagique. Les virions se
reproduisent ensuite par le cycle lytique, ce qui permet une bonne amplification de
l'ADN recombinant. L'isolement des clones est obtenu en réalisant l'infection sur un
milieu semi-solide. Chaque particule virale donne alors naissance à un clone sous la
forme d'une plage de lyse sur le tapis bactérien.
III. COSMIDES, YAC ET BAC
1. Les cosmides
Les cosmides sont des vecteurs hybrides constitués d’un plasmide classique auquel
ont été ajoutées les séquences COS du phage λ. Leur ADN peut se répliquer au
niveau de la cellule hôte comme celui d'un plasmide ou être encapsidé comme celui
d'un phage pour faire une infection. Les cosmides peuvent contenir des insertions
d’ADN environ trois fois plus longs que ceux portés par les phages λ (45 kb). Ceci
est dû à ce que la majeure partie de la structure du phage a été déletée tandis que
les séquences signaux responsables de l'encapsidation subsistent (les sites COS).
Figure II.10
2. Les YAC
Le YAC ou chromosome artificiel de levure (Yeast Artificial Chromosome).
Les YAC permettent de cloner de 150 à 1 000 kb de fragments d’ADN. Le génome
de la levure Saccharomyces cerevisiae est constitué de 16 chromosomes de taille
comprise entre 250 et 2 000 kb. Chez la levure, trois régions chromosomiques sont
importantes pour sa réplication. Les séquences télomériques (Tel), centromériques
(CEN), et une séquence ARS (Autonomous Replicating Sequence).
20
On a donc construit des chromosomes artificiels contenant ces régions es-
sentielles et du DNA que l’on désire cloner. La taille du DNA cloné peut donc attein-
dre de 1 000 à 2 000 kb. Les YAC n'exigent que les cellules de levures comme hô-
tes. On peut cependant introduire dans l’ADN cloné des séquence bactérienne pour
la sélection.
Figure II.11
3 . les PAC
PAC : Chromosomes artificiels dérivés du phage P1
(PAC, P1-derived artificial chromosomes)
Mise au point dans les années 1990 un vecteur dérivé du bactériophage P1. Le vec-
teur pCYPAC1 permet de cloner des fragments qui ont une taille de 130 à 150 kb
avec une efficacité qui est intermédiaire entre celle des cosmides et celle des YACs
(1,5x10+5 colonies/µg insert). Figure II.12
4. Les BAC
Figure II.13
Les BAC (Bacterial Artificial Chromosome) ont pour base le facteur sexuel F de 7 kb
de Escherichia coli. Ce facteur peut contenir de grands fragments d'ADN d'E. coli
sous la forme de dérivés F'. De manière similaire, les BAC peuvent incorporer des
inserts d'ADN étranger pouvant atteindre 300 kb. Le plasmide F porte des gènes qui
sont essentiels pour réguler sa propre réplication et pour contrôler aussi le nombre
de copies du plasmide F. Le plasmide F a aussi la capacité de s'intégrer dans le
chromosome bactérien et de s'en exciser. Un plasmide qui a cette capacité est ap-
pelé un épisome.
Les gènes oriS et repE régissent la réplication unidirectionnelle du plasmide tandis
que les gènes parA et parB maintiennent le nombre de copies de celui-ci à 1 à 2
copies par cellule.
Le vecteur pBeloBAC11 porte ces gènes essentiels ainsi qu'un gène de résistance
au chloramphénicol et la portion lacZa du gène b-galactosidase avec 2 sites de
restriction HindIII et BamHI qui permettent le clonage de fragments d'ADN étranger
Le facteur de fertilité F est utilisé lors de la conjugaison bactérienne.
- Les bactéries qui le possèdent dans leur cytoplasme sont dites F(
+
)
- celles qui ne l'ont pas dans leur cytoplasme sont dites F(
-
)
- Celles qui l'ont intégré dans leur chromosome sont dites Hfr
- Celles qui l'ont perdue, après l'avoir intégré dans leur chromosome sont F'.
Conclusion
Les plasmides sont très utilisés pour le génie génétique. Ils acceptent des fragments
de taille moyenne (jusqu'à 10 kb), par exemple des sous-fragments de l'insert d'un
phage ou d'un cosmide recombinant. La taille des fragments d'ADN étranger qui
peuvent être acceptés par le bactériophage lambda (10 à 20 kb), les cosmides (35 à
45 kb), les PAC (130 à 150 kb), les BAC (160 à 200 kb) et les YAC (250 à 1.500 kb)
en font les vecteurs de choix pour construire et amplifier des banques d'ADN géno-
mique. Les BAC et les PAC sont devenus les vecteurs principaux pour le séquen-
çage du génome humain. Les ADNc (voir plus loin) sont clonés dans des plasmides
ou des phages d'insertion.
21
Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE,
CARTE DE RESTRICTION
I. ENZYMES DE RESTRICTION
1. Définition et origine
Les enzymes de restriction sont des endonucléases qui coupent d’une ma-
nière définie et reproductible l’ADN double-brin quelle que soit son origine. Elles ont
permis de caractériser un génome entier en une série de fragments reproductibles.
Les gènes ou fragments de gènes deviennent ainsi des entités physiques isolables
et non plus de l’information noyée dans la masse du contenu génomique. Ces en-
zymes ont été mis en évidence par le phénomène de la lysogénie.
Les cellules bactériennes contiennent beaucoup d'endonucléases spécifiques
capables de reconnaître l'ADN des autres espèces et l’ADN des virus qui les infec-
tent. Ces enzymes constituent un système de défense de la bactérie surtout contre
l'ADN des virus au cours de leur infection. Ces enzymes de restriction reconnaissent
des sites particuliers sur l'ADN et coupent la molécule double brins soit au niveau du
site de reconnaissance soit quelques nucléotides plus loin. La souche d'Escherichia
coli B possède une endonucléase appelée EcoR1 qui reconnaît spécifiquement la
séquence bicaténaire suivante:
CH3
↓ ↓ |
5’G AATT C3’ 5’G *AATT C3’
3’C TTAA G5’ 3’C TTAA* G5’
↑ | ↑
CH3
Coupure Pas de coupure
L'enzyme catalyse l'hydrolyse d'une liaison phosphodiester dans le site re-
connu au niveau des deux flèches. Cependant, la coupure ne peut avoir lieu que si
les adénines (A) figurées en gras ne sont pas méthylées. Le phénomène de restric-
tion résulte de l’existence dans la bactérie de deux types d’activité enzymatique :
Une activité de restriction qui coupe le DNA lorsqu’il est reconnu comme
étranger à la cellule hôte.
Une activité méthylase qui méthyle une base donnée (A ou C) au niveau
du site de restriction du génome de la cellule bactérienne pour empêcher sa propre
dégradation par l’activité restrictive.
Les souches d’Escherichia coli R possèdent en plus de l’enzyme qui coupe la
séquence reconnue par (EcoR1) une autre qui assure la méthylation (EcoR1 méthy-
lase ou MEcoR1) qui reconnaît la même séquence mais méthyle les deux adénines.
Le système de restriction formé par le couple EcoR1 / MEcoR1 permet aux cellules
bactériennes d'hydrolyser un éventuel ADN étranger, phagique en particulier, tout
en conservant l'intégrité de leur propre génome. Les enzymes de restriction consti-
tuent donc un système de défense de la bactérie.
22
Il existe 3 types d'enzymes de restriction qui diffèrent les unes des autres, par
la localisation de leur activité catalytique.
Enzyme de type I: Ayant reconnu la séquence cible, l'enzyme se déplace
sur l'DNA et coupe de manière aléatoire mille à quatre mille bases plus loin (Sys-
tème de boucles d’ADN ?).
Enzyme de type II: L'enzyme coupe l'ADN au niveau de la séquence re-
connue.
Enzyme de type III : L'enzyme reconnaît la séquence cible et coupe la mo-
lécule de DNA 20 à 25 bases plus loin.
Seules les enzymes de type II qui coupent au niveau du site de reconnais-
sance sont utilisés en génie génétique parce qu’on peut contrôler parfaitement le
site de coupure et donc les extrémités engendrées.
En 1990, on avait recensé plus de mille endonucléases isolées à partir de
867 espèces bactériennes différentes.
2. Nomenclature des enzymes de restriction.
En 1973, Smith et Nathan ont proposé une nomenclature qui est définitive-
ment adoptée. Chaque endonucléase a un nom de code déterminé selon les princi-
pes suivants :
• La première lettre en majuscule est l'initiale du genre de la bactérie.
• Les deux lettres suivantes, en minuscule désignent l'espèces de la bacté-
rie.
• La 4ème lettre en majuscule, (pas toujours présente) désigne la souche
bactérienne.
• Un chiffre romain distingue les enzymes d'une même souche dans l'ordre
de leur découverte.
Exemple : EcoR 1:
E = Escherichia
Co = espèce Coli
R = Souche RY13
I = 1
ère
endonucléase isolée
3. Mécanisme d'action des endonucléases de restriction
a: Caractéristique de l'hydrolyse.
Une endonucléase de restriction se lie à une séquence spécifique qu'elle re-
connaît sur l'ADN: c’est le site de restriction. Elle catalyse ensuite un clivage double
brin au niveau des liaisons phosphodiester spécifiques à l'organisation de la sé-
quence de reconnaissance. L'hydrolyse d'une liaison phosphodiester, entre le
groupe 3' OH et le phosphate génère une extrémité 5' phosphate d'un côté de la
coupure et un groupe 3' OH de l'autre. Figure III.1
23
b: Sites de restriction
La plupart des sites de restriction comporte de 4 à 6 paires de bases. Un
nombre assez restreint d’enzymes de restriction reconnaît des séquences plus com-
plexes. Les séquences de restriction présentent toujours une double symétrique par
rapport à un centre ou à un plan de symétrie. De telle séquence sont dites palin-
dromiques. On observe sur les 2 brins la même séquence (5’→3’) mais en sens
inverse.

Exemple : EcoR 1 : 5’G AATTC3’
3’CTTAA G5’

c: Différents types de coupure
Les enzymes de restriction de type II peuvent donner deux types de coupu-
res :
Les coupures à bouts francs (blunt ends ou flush ends). L’enzyme coupe
exactement au même niveau sur les deux brins de la séquence reconnue soit au
niveau de l’axe ou du centre de symétrie.
↓Hae III
5'  GGCC  3' → 5'GG + CC 3'
3'  CCGG  5' → 3'CC + GG 5'

Ces types de coupes sont utilisées lorsqu’on désire faire un tailing (allonge-
ment de l’extrémité 3’OH) ou un marquage pour un séquençage.
les coupures décalées donnent des extrémités cohésives. Les extrémités
débordantes résultent d'une coupure décalée et les extrémités obtenues sont auto
complémentaires entre elles. Elles peuvent donc se réapparier spontanément si les
conditions sont favorables. On parle alors d'extrémités cohésives ou de bouts col-
lants "Sticky ends". Ces enzymes sont très utilisées pour fabriquer des ADN recom-
binants, car les fragments de différents ADN coupés par la même enzyme donnent
les mêmes bouts qui peuvent s'associer par leur extrémités cohésives. L'association
est ensuite rendue covalente par l’action d'une ADN ligase.
Coupure décalée du coté 5’ : Ce type de coupure génère des extrémités 5’P
débordantes ou sortantes. Exemple, les coupures de EcoR 1 :
5’ G/AATTC → 5’ G 3’ + 5’AATTC 3’
3’ CTTAA/G 5’ → 3’ CTTAA 5’ + 3’G 5’
Coupure décalée du coté 3’: Ce type de coupure génère des extrémités 3’OH
débordantes ou sortantes. Exemple : les coupures par Pst I :
24
5’ CTGCA/G 3’ → 5’ CTGCA 3’ + 5’ G 3’
3’ G/ACGTC 5’ → 3’ G + 3’ ACGTC 5’
Les coupures franches ; L’enzyme coupe les deux brins de l’ADN au niveau
du centre ou de l’axe de symétrie. On obtient des extrémités franches (blund ends)
qui n’ont pas un grand intérêt en génie génétique sauf pour réaliser des « taillings à
l’extrémité 3’OH). Exemple : Hae III :
5’ GG/CC 3’ → 5’ GG + 5’CC 3’
3’ CC/GG 5’ → 3’ CC + 3’GG 5’
Le tableau II.1 ci-dessous donne la liste de quelques enzymes de restriction
et leur sites de coupure.
Micro-organisme Sigle de l’enzyme Séquence
Thermus aquaticus TaqI 5’...T/CGA...3’
3’...AGC/T...5’
Haemophilus haemolyticus HhaI 5’...GCG/C...3’
3’...C/GCG...5’
Desulfovibrio desulfuricans DdeI 5’...C/TNAG...3’
3’...GANT/C...5’
Escherichia coli EcoRV
EcoRI
5’...GAT/ATC...3’
3’...CTA/TAG...5’
5’...G/AATTC...3’
3’...CTTAA/G...5’
Providencia stuarti PstI 5’...CTGCA/G...3’
3’...GA/CGTC...5’
Microcoleus MstII 5’...CC/TNAGG...3’
3’...GGANT/CC...5’
Nocardia otitidis-caviarum NotI 5’...GC/GGCCGC...3’
3’...CGCCG/GCG...5’
Tableau II.1 : Quelques enzymes de restriction de type II et leur site de coupure
N = Toute base (purine ou pyrimidine)
e: Isoschizomères et enzymes compatibles:
On appelle isoschizomères 2 enzymes différentes qui reconnaissent le
même site de restriction. Exemple :
Msp I: NNC/CGGNN et Hpa II NNC/CGGNN
NNGGC/CNN NNGGC/CNN
Deux enzymes compatibles ont des sites de restriction différents mais don-
nent naissance aux mêmes extrémités cohésives. C'est le cas de BamH I et Sau3AI
qui donnent les même extrémités cohésives car le site de reconnaissance de
Sau3A1 est contenu dans celui de BamH 1.
BamH I NNNG/GATCCNN et Sau 3A I NNN/GATCNNN
25
NNNCCTAG/G NNNCTAG/NNN
Ainsi, BamH I donne les mêmes extrémités cohésives que Sau3A I avec qui
elle est compatible.
4. Carte et fragments de restriction
L'hydrolyse d'un ADN par une endonucléase de restriction conduit à une série
de fragments dits de restriction dont le nombre est fonction du nombre de sites de
restriction présent sur cet ADN. La longueur des fragments est déterminée par la
distance séparant les séquences de restrictions reconnues par cette endonucléase.
On obtient pour un ADN donné, toujours le même nombre de fragments qui donne
ce que l’on appelle RFLP (pour longueur des fragments de restriction polymorphi-
ques ou Restriction Fragments Lengh Polymorphism en Anglais). Une molécule
d'ADN déterminée, donne toujours les mêmes fragments et cette série de fragment
constitue une empreinte caractéristique de l'ADN hydrolysé. On parle alors de carte
d'identité moléculaire.
Exemple : CARACTERISATION DE L’HAPLOTYPE DREPANOCYTAIRE
Des variations de la séquence nucléotidique, sans conséquence pathologique di-
recte, sont fréquentes.
Elles sont désignées sous le terme de polymorphisme.
Lorsque ces modifications portent sur des sites reconnus très spécifiquement par
certaines endonucleases (enzymes de restriction) elles sont faciles à mettre en évi-
dence par les méthodes de cartographie génique (polymorphisme de taille des frag-
ments de restriction) RFLP. L'association de plusieurs de ces polymorphismes défi-
nit un haplotype. L'un des résultats les plus intéressants des études des polymor-
phismes de l'environnement du gène drépanocytaire a été l'observation d'un désé-
quilibre de liaison : les polymorphismes ne sont pas distribués au hasard mais for-
ment un petit nombre d'haplotypes bien définis. Il a été ainsi observé que la mutation
drépanocytaire a été trouvée associée à 5 haplotypes désignées d'après leur épi-
centre. Figure III.2
Figure III.1 : Les haplotypes
E Gγ Αγ ψβ δ β
Haplotype HbS
Bénin - - - - - + - + - - + + - +
Bantou - - + + - + - - - + + + + +
Sénégal - + + + - + + + + - + + + +
Arabo Ind. + + + + - + + + - + + - + -
Cameroun - - + + + + - + + - + - + -
H inc I I XmnI Hi nd I II TaqI Hi ndI I I PvuI I Hi nc I I Hi nf I Rsa I AvaI I Hi nf I Hpa I BamH I
26
Une carte de restriction est une séquence de sites de restriction séparés par
des distances précises sur l'ADN et mesurée en paire de bases (bp). Diverses tech-
niques permettent d'obtenir de telles cartes. Elles passent toutes par une digestion
de l'ADN à analyser par une enzyme de restriction suivie d’une électrophorèse pour
la séparation des fragments et la détermination de leurs tailles.
L'analyse par double digestion est obtenue quand l'ADN est digérée sépa-
rément par 2 enzymes différentes A et B. On obtient un certain nombre de fragments
pour chaque enzyme. Ces fragments sont ensuite analysés par électrophorèse sur
gel d’agarose. Chaque fragment produit par l’enzyme A est d’abord élué du gel et
digéré ensuite par l’enzyme B et inversement. La confrontation des différents résul-
tats permet de situer les sites de coupure les uns par rapports aux autres sur la sé-
quence nucléotidique.
Figure III.3 Exercice et corrigé: Détermination des sites de coupure de deux enzy-
mes de restriction A et B sur un fragment d’ADN .
- L’enzyme A coupe et donne deux fragments : 2 Kb et 8 Kb
- L’enzyme B coupe et donne deux fragments : 3 Kb et 7 Kb
- Les enzymes A et B coupent et donnent trois fragments 2 Kb, 3Kb et 5 Kb
Déterminez les sites de coupures :
2 Kb A 8 Kb
7 Kb
B
2 Kb 5 Kb 3 Kb
A B
10 Kb dADN
3 Kb
27
II. L’ÉLECTROPHORÈSE SUR GEL
Figure III.4.
Les différents types d'électrophorèse utilisés dans les laboratoires de biologie
moléculaire, permettent de séparer les acides nucléiques en fonction de leur taille:
» L'électrophorèse horizontale sur gel d'agarose permet de séparer les
fragments d'ADN de 300 à 10 000 paires de bases en fonction de la concentration
du gel en agarose
» L'électrophorèse verticale sur gel de polyacrilamide permet de séparer les
fragments d'ADN dont les longueurs vont de 1 à 1 000 nucléotides en fonction de la
longueur du gel et de la tension appliquée (de 1 000 à 2000 volts / cm).
» L’électrophorèse sur gel d'agarose en champ pulsé (PFGE) permet de
séparer des fragments d'ADN double brin dont la taille peut varier de 220 000 à 2
500 000 paires de bases. Cette technique est aussi mise à profit pour la séparation
des chromosomes interphasiques. (PFGE pour Pulsed Field Gel Electrophoresis).
1 - Suivi de la migration .
Les échantillons d'ADN, avant d'être déposés dans les puits, sont mélangés
avec une solution de charge qui contient :
» un alourdisseur (glycérol ou saccharose ) pour entraïner l'ADN au fond du
puits
» des marqueurs de mobilité (colorants visibles : bleu de bromophénol et xy-
lène cyanol)
» Des marqueurs de taille pour l’identification (dans le puits de référence)
» un agent dénaturant comme le SDS ou l’urée pour arrêter les réactions en-
zymatiques suivant la nature du gel.
Les deux marqueurs (colorants) migrent à des vitesses différentes. Le bleu de
bromophénol (violet ) migre avec les fragments de petites tailles (donc plus vite )
alors que le xylène cyanol (bleu turquoise ) migre avec les fragments de grande
taille. On peut ainsi suivre indirectement la migration de l'ADN sur le gel.
2 - Etalonnage d'un gel
On étalonne les gels avec des marqueurs de taille. Un marqueur de taille est
un mélange de fragments d'ADN linéaire bicaténaires dont les tailles sont connues.
il existe deux type de marqueurs de tailles :
» Des marqueurs fabriqués à partir d'une molécule d'ADN naturelle digérée
par des enzymes de restriction,
» Des marqueurs composés d'une série de fragments, chacun constitué d'une
à plusieurs répétition d'un même fragment d'ADN de taille connue. Un exemple est
28
l'échelle d'ADN de 1 Kb de GIBCO BRL. Les différents fragments sont formés
de 1 à 12 répétitions d'un même segment de 1018 bp.
3. Révélation :
Les bandes d'ADN sur un gel de polyacrylamide ou d'agarose ne sont pas vi-
sibles si l'ADN n'est pas marqué ou coloré.
» Une méthode sensible de coloration de l'ADN consiste à plonger le gel
après électrophorèse dans du bromure d'éthidium (BET) qui devient cent fois plus
fluorescent sous illumination ultra-violette lorsqu'il est lié à l'ADN. Le BET est une
produit hautement mutagène, donc il doit être manipulé avec beaucoup de soins.
» Une détection encore plus sensible implique l'incorporation d'un radio iso-
tope dans les molécules d'ADN avant électrophorèse. Le
32
P est actuellement utilisé
puisqu'il peut être incorporé dans les phosphates 5' de l'ADN et émet des particules
8 très énergétiques facilement détectées par autoradiographie.
Figure III.5
III. LES ENZYMES UTILES EN GÉNIE GÉNÉTIQUE:
1. La DNA polymérase I.
Cette enzyme extraite d’Escherichia Coli intervient dans les activités de répa-
ration du chromosome bactérien par le phénomène de nick translation. Elle est uti-
lisée sous sa forme de «fragment de Klenow» qui est dépourvu de l’activité exonu-
cléasique (5’→3’) par suite d’un traitement protéasique pour:
> Déterminer les séquences nucléotidiques d’un ADN par la méthode de
Sanger.
> Pour convertir les bouts cohésifs en bouts francs
> Pour le marquage des DNA
> Pour la construction de sondes ou de vecteurs à partir d’un ADN simple ou
double brin.
2. La T4 DNA polymérase.
L’enzyme est produite par les bactéries E. Coli infestées par le bactériophage
T4. Elle possède les mêmes propriétés que le fragment de Klenow et possède les
mêmes utilisation en biologie moléculaire.
3. La Taq polymérase
C’est une enzyme extraite de la bactérie Thermus aquaticus, espèce bacté-
rienne vivant dans les eaux chaudes et qui présente une grande résistance à la dé-
naturation thermique. Elle peut toujours travailler entre 80 et 94°C, d’où son utilisa-
tion en PCR. Il en est de même des polymérases extraites des archéobactéries
comme des bactéries du genre Thermus comme la polymérase de Bacillus steato-
thermophilus. Ces enzymes ne possèdent pas une activité de correction des épreu-
29
ves (proof reading = activité exonucléasique 3’→5’) et de ce fait introduisent
beaucoup d’erreurs au cours de la réplication.
4. La transcriptase inverse.
La transcriptase inverse est un enzyme produite par les rétros virus qui per-
met de recopier un ARN en un DNA. Elle possède aussi une activité RNAase H qui
permet de dégrader le RNA dans un hybride ADN-ARN. Elle est utilisée chaque fois
qu’il est nécessaire de transformer un ARN en un ADN.
> Pour la construction des banques de cDNA
> Pour détermination des séquences nucléotidiques par la méthode
de Sanger
> Pour la PCR sur les RNA messagers (R-PCR).
5. La terminal transférase
C’est une enzyme couramment extraite du thymus de veau qui permet
l’addition de désoxyribonucléotides, sans besoin d’amorce à l’extrémité 3’OH libre
d’un DNA simple ou double brin. Elle permet donc:
> de rajouter une queue (tailing) à l’extrémité 3’ en vue de créer des extrémi-
tés cohésives pour l’insertion d’un ADN
> de marquer l’extrémité 3’OH pour le séquençage des acides nucléiques
par la méthode de Maxam-Gilbert.
6. La polynucléotide phosphorylase
Cette enzyme d’origine bactérienne (E. coli ou M. luteus) catalyse la polymé-
risation de ribonucléotides diphosphates pour donner un ARN. La séquence de
l’ARN résultant dépend de la concentration relative des différents nucléotides pré-
sents dans la solution.
n XDP → (XMP)n + n Pi
Elle a été utilisée pour déchiffrer le code génétique.
Actuellement, elle permet:
> La synthèse de polyribonucléotides froids ou radio-actfs
> La dégradation de la queue polyrA des mARN eucaryotes à cause
de son activité nucléolytique
> Un marquage intensif des extrémité 3’OH des ribonucléotides
> Le marquage sur le phosphore des ribonucléotides diphosphates
à cause de son activité d’échange de phosphate.
7. La poly A polymérase
30
Enzyme eucaryote, elle catalyse l’addition d’une queue polyrA à l’extrémité
3’OH des ARN messagers eucaryotes. Son substrat est spécifiquement l’ATP. Elle
possède donc les mêmes utilisations que la polynucléotide phosphorylase et la ter-
minal transférase.
8. Les ARN polymérases
Les ARN polymérases de tous les organismes transcrivent l’un des deux brins
de la double hélice de l’ADN en un ARN simple brin. La synthèse s’effectue sans
amorce à partir du promoteur (site de fixation et d’initiation de l’enzyme) et nécessite
toujours les ribonucléotides triphosphates et du Mg
2+
comme cofacteur, dans le sens
5’→3’.
Ce sont les polymérases des procaryotes qui sont le plus souvent utilisées en
biologie moléculaire car elle possèdent des promoteurs très spécifiques qui permet-
tent de conditionner et de révéler l’expression des gènes recombinés dans une cel-
lule transfectée.
Les plus utilisées sont: la polymérase de SP6 extraite de Salmonella typhimu-
rium LT2, la T7 RNA polymérase extraite d’E. coli infesté par le phage T7 et la T3
RNA polymérase extraite aussi de E. coli infesté par le phage T3. Ces polymérases
permettent:
> la synthèse de sondes hautement marqués soit par un nucléotide radioactif
soit par un nucléotide biotinylé (marquage froid);
> la détermination de la séquence d’un ADN cloné dans un vecteur possé-
dant, devant le DNA cloné, l’un quelconque des promoteurs SP6, T7 ou T3;
> les études sur les différents RNA résultant de la transcription d’un DNA
cloné.
Ces polymérases permettent aussi de produire, à partir d’un gène cloné, les
quantités de RNA suffisantes pour les études de structure, de régulations et des in-
teractions RNA-DNA, RNA-protéines.
9. Les Ligases
La DNA ligase d’E. Coli. Les ligases assurent la formation d’une liaison
phosphodiester entre une extrémité 3’OH et une extrémité 5’phosphate de deux nu-
cléotides déjà incorporés dans un acide nucléique. L’enzyme d’E. coli n’agit que si
les deux DNA sont associés par des extrémités cohésives ou dans le cas d’une cas-
sure sur un seul brin. Cette enzyme utilise le NAD
+
comme cofacteur. Elle est donc
utilisée pour la soudure des extrémités cohésives lors de la construction des vec-
teurs.
La T4 ligase. Extraite d’E. coli infestée par le phage T4, elle joue le même
rôle que la ligase de E. coli. Cependant, elle présente un avantage sur cette der-
nière car elle utilise l’ATP au lieu du NAD+ comme source d’énergie, ce qui lui per-
met de relier les extrémités cohésives, mais aussi les extrémités à bouts francs en
présence d’éthylène glycol.
La RNA ligase. Extraite d’E. Coli infesté par le phage T4, elle réalise la liga-
tion entre deux RNA en créant entre eux une liaison phosphodiester entre l’extrémité
3’OH libre et l’extrémité 5’phosphate libre de l’autre molécule. Elle utilise aussi l’ATP
31
qui est hydrolysé et AMP et en pyrophosphate. Elle permet donc soit un marquage
des ARN, soit la construction de liaisons inter ou intra - RNA (RNA mixtes).
10. Les nucléases.
La DNase I Cette enzyme extraite du pancréas est une endonucléase qui
coupe le DNA après un base pyrimidique, libérant une extrémité 3’OH et une extré-
mité 5’phosphate. Elle coupe aussi bien les acides nucléiques en simple ou en dou-
ble brins. Elle est utilisée pour analyser les gènes actifs de la chromatine, éliminer le
DNA d’une préparation protéique ou de RNA, pour la création de cassures (nicks)
pour le marquage de l’ADN par nick translation.
La nucléase S1. L’enzyme dégrade spécifiquement les acides nucléiques en
simple brin. Les DNA bicaténaires et les hybrides DNA-RNA ne sont pas attaquées.
Elle permet :
> Une étude des hybrides DNA-RNA
> L’élimination des extrémités simple brin d’un DNA double brin
> Le suppression des boucles dans la synthèse de cDNA
> La détermination des origines de la transcription
L’exonucléase III. Elle catalyse l’hydrolyse séquentielle des nucléotides d’un
ADN dans le sens 3’ ÷ 5 à partir d’une extrémité 3’OH libre. De plus elle possède
une activité 3’ phosphatase. Elle permet donc d’obtenir des ADN simple brin.
11. Les RNases
La RNase A. Cette enzyme très résistante (se maintient après 1 heure à
90°c) hydrolyse spécifiquement les RNA simple brin après une pyrimidine. Elle est
utilisée pour éliminer le RNA dans une préparation protéique ou de DNA. Elle per-
met également de détecter les mismatches dans les hybrides DNA-RNA.
La RNase H : Elle détruit le RNA dans les hybrides DNA-RNA. Elle permet
donc la détection des hybrides DNA-RNA et la destruction de l’ARN dans un hybride
après une transcription inverse pour la synthèse du second brin de cDNA.
32
CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ.
I - LE CLONAGE
Le clonage des micro-organismes est différent de celle des organismes supé-
rieurs comme les mammifères.
1. Le clonage des animaux supérieurs: les mammifères.
Le principe du clonage n'est pas très compliqué en soit. Dans le cas de Dolly
(la première brebis clonée), on a prélevé une cellule dans le pis d'une brebis de race
Finn Set à face blanche. On a prélevé également un ovule sur une autre brebis. Sur
cet ovule, on a enlevé le noyau qui contient le matériel génétique. Pourquoi un
ovule? Pour qu'il devienne éventuellement un embryon.
À l'aide d'un choc électrique, on a fusionné in vitro la cellule du pis qui
contient tous ses gènes et l'ovule vidé de tout son matériel héréditaire. C'est la rai-
son pour laquelle Dolly n'a eu pour tout bagage génétique que celui que contenait la
cellule du pis. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche.
Après s'être divisé un nombre suffisant de fois, l’embryon au stade blastocyte a été
placé dans l'utérus d'une brebis porteuse. Dolly est née de cette technique, identi-
que en tous points à la brebis qui a fourni la cellule du pis.
2. Clonage de l’ADN dans les micro-organismes:
Le but du clonage est d’obtenir un grand nombre de copies absolument pures
d’une séquence donnée d’ADN. Stricto sensu, le clonage est la sélection d’un clone
parmi un ensemble de clones bactériens recombinants qui porte le nom de banque
(library). Il existe 2 types de banques d’ADN : les banques génomiques et les ban-
ques d’ADNc.
33
II - LES BANQUES GÉNOMIQUES
1 - La fragmentation de l’ADN tout entier d’une cellule et son introduction dans
des vecteurs
Construire une banque génomique consiste à fragmenter l’ADN tout entier
d’une cellule (la méthode du shotgun) et à introduire chaque fragment dans un vec-
teur, puis dans un hôte approprié. Si la banque est correctement établie, elle
contiendra, sous une forme morcelée, l’ensemble de l’information d’un individu telle
qu’elle existe dans son génome, d’où le terme de banque génomique.
Une banque génomique ne sera représentative que si elle contient, au moins
une fois, l’ensemble des séquences du génome. Il est donc évident que plus les in-
serts seront longs, plus faible sera le nombre des clones nécessaires. Clarke et Car-
bon ont établi une formule statistique permettant de déterminer le nombre de clones
nécessaires, compte tenu de la longueur des inserts. Cette formule, qui dérive de la
loi de Poisson est :
log ( 1-P )
N =- --------------
log ( 1-1 / n)
P = Probabilité de présence dune séquence donnée
n = ( longueur du génome ) / ( longueur moyenne des fragments insérés ).
Probabilité de présence
d’une séquence donnée
Longueur de l’insert en
(kb)
15 20 30 35 40
0,99 860 640 430 370 320
0,95 560 415 280 240 210
0,90 430 320 215 185 160
0,80 300 225 150 130 115
Tableau IV.1 : Nombre de clones (en milliers) que doit contenir une banque gé-
nomique pour être représentative d’un génome.
2 – Etablissement d’une banque génomique.
Les différentes étapes principales sont les suivantes :
• Extraction de l’ADN nucléaire
• Digestion du génome avec des enzymes de restriction
• Insertion des fragments d’ADN dans des vecteurs (plasmide ou phage ou
YAC). Le vecteur doit être choisi en fonction de la taille des fragments d’ADN à insé-
rer.
• Ligature avec l’ADN ligase
• Transformation (avec des plasmides) ou infection (avec phages) des bacté-
ries
• Culture des bactéries sur des milieux entiers
34
• Toutes les bactéries qui portent une chimère se multiplieront et donneront
des clones.
Figure IV.1: Schéma pour la réalisation pratique d’une banque génomique à partir
de phages.
3. Amplification de la banque
Lorsque la banque n’est pas d’usage unique, mais doit servir à plusieurs clo-
nages successifs, il convient de l’amplifier, c’est à dire, d’augmenter le nombre de
copies de chaque fragment inséré. L’amplification n’est réalisable que lorsqu’on tra-
vaille avec des phages. Avec les cosmides et les YAC, ou les BAC, les pertes de
séquences sont très rapides et on est alors obligé de refaire la banque chaque fois.
4 - Les avantages des banques génomiques:
Les banques génomiques permettent de connaître:
- Les régions non transcrites des exons
- Les séquences de régulation
- Les gènes silencieux
- Les introns
Malheureusement l’ADN génomique est fragmenté au hasard, donc, dans la
plupart des cas, on obtient des gènes fragmentés incapables de coder pour des pro-
téines biologiquement actives.
Pour pallier à cet inconvénient, il faut utiliser les chromosomes artificiels de
levure (YAC) comme vecteur de clonage. Les YAC.peuvent recevoir des fragments
d’ADN de 150kb à 1 000 kb. Ces vecteurs permettent de marcher sur le chromo-
some.
III - LES BANQUES DE CADN
L’ADN complémentaire (ADNc) est la copie sous forme d’ADN d’un ARN mes-
sager (ARNm). Un banque de cDNA doit contenir au moins une copie de tous les
ARNm présents dans la cellule. Ces banques sont essentiellement tissulaires puis-
qu’une cellule d’un tissu donné ne possède pas tous les ARN messagers de
l’individu, mais ceux dont l’état de différentiation cellulaire permet la transcription. Le
processus de formation de l’ADNc comprend deux étapes:
1 - L’isolement de l’ARN poly A
+
(poly adénine):
Dans la cellule eucaryote, il existe plusieurs types d’ARN : l’ARN messager,
l’ARN de transfert et l’ARN ribosomal. La majeure partie des ARN messagers des
eucaryotes possède une queue poly(A) rajoutée après le transcription et avant le
transfert vers le cytoplasme.
ARNm (eucaryote)
35
5’ GGGAUCACUUGCGCAGCGCAUGCU(AAAAAAAAAA)n 3’ queue poly(A)
On utilise les queues poly rA pour purifier l’ARNm en écartant les autres types
d’ARN. Sur une colonne chromatographique, les oligo-désoxythymidine (dT) sont
liés à la cellulose ou à l’agarose par des liaisons covalentes. On fait alors passer
l’ARN cellulaire dans la colonne. Seuls les ARNm qui possèdent les queues poly rA
seront retenus sur la colonne par hybridation par les oligo-thymidilates. Les autres
ARN sont éliminés par un lavage avec le tampon. Les ARNm sont ensuite « élués »
par un agent dissociant. La figure III.3 résume les principales étapes de la purifica-
tion des ARN messagers eucaryotes ayant une queue poly-rA.
Figure IV.2 : Les principales étapes de la purification des ARN messagers eucaryo-
tes ayant une queue poly-rA en utilisant la chromatographie d’affinité.
2 - Le passage de l’ARN à l’ADN
Cette étape est toujours réalisée grâce à la transcriptase reverse isolée d’un
rétrovirus. Plusieurs techniques sont utilisées pour la préparation de l’ADNc :
la transcriptase reverse :
La synthèse de l’ADNc commence en 3’ de l’ARNm. Cependant, la transcrip-
tion par la transcriptase reverse n’est pas parfaite, elle tend à baisser lorsqu’elle
rencontre des obstacles que sont les structures secondaires de l’ARN. Si la molé-
cule de l’ARNm est longue, la transcription peut ne pas aboutir à l’extrémité 5’ à
cause de la boucle formée à cette extrémité par la transcriptase reverse. La boucle
est détruite par l’action de la nucléase S1. Il y a cependant une perte d’information
au niveau de l’extrémité 5’.
Figure IV.3 : La technique de base de la synthèse du cDNA à partir du mRNA par la
reverse transcriptase.
La technique « copie entière » par addition de queues uniformes « tai-
ling »
Après la synthèse du premier brin de cDNA par la reverse transcriptase, une
queue poly dC est créée à l’extrémité 3’ par la terminal transférase en présence de
dCTP. Un poly dG synthétique est alors utilisé pour s’hybrider à la queue poly dC et
servir d’amorce pour la synthèse du brin complémentaire par le fragment de Klenow
de la DNA polymérase I.
La technique « copie entière » par cassure à la RNase H.
Le début de l’opération est identique aux techniques précédentes. Après la
synthèse du premier brin par la reverse transcriptase, le brin de RNA est coupé en
plusieurs endroits par la RNase H. Les courts fragment d’ARN servent alors
d’amorce pour la DNA polymérase I qui synthétise le brin d’ADN par son activité po-
lymérasique 5’ ? 3’ et détruit les restes d’ARN par son activité exonucléasique
36
3’ ? 5’. On peut alors utiliser la T4 DNA polymérase pour parfaire la synthèse au ni-
veau des extrémités. Figure IV.4
La technique du multi-amorçage au hasard : Cette méthode utilise la tech-
nique de synthèse de l’ADNc utilisant un multi-amorçage au hasard avec des oligo-
nucléotides de 6 à 10 nucléotides de long : « Random primer ». la suite est identi-
que à la méthode par la RNase H.
La PCR : Cette technique permet d’obtenir rapidement une grande quantité
de l’ADNc une fois l’ADNc disponible .(Polymerase Chain Reaction pour Réaction de
Polymérisation en Chaîne) Figure IV.5
IV - L’ÉTUDE DE L’ADN CLONÉ
Le criblage ou la recherche du bon clone au sein d’une banque génomique
est toujours un problème difficile à résoudre en fonction des vecteurs utilisés. Beau-
coup de techniques ont été utilisées pour le criblage des colonies, mais les techni-
ques les plus sensibles et les plus utilisées sont:
- Celles qui emploient les oligonucléotides de synthèse,
- Celles qui utilisent les anticorps.
Les autres techniques comme l’hybridation de sélection, l’hybridation différen-
tielle et la complémentation d’un défaut génétique de l’hôte qui ont eu gloire dans
les années 1975-1980 ne sont pratiquement plus utilisées à cause de leur lourdeur.
Le processus général utilisé pour le screening se pratique ainsi :
- Une réplique des clones est réalisée sur un filtre de nitrocellulose ou sur ny-
lon
- On utilise ensuite une sonde spécifique marquée par un radio-isotope (
32
P,
35
S) pour une hybridation. Dans ce cas, la révélation de la séquence insérée
est réalisée par une simple autoradiographie.
- On peut utiliser un anticorps dirigé contre le produit de l’expression de l’ADN
inséré dans le cas d’une banque d’expression.
1. Le criblage par des oligonucléotides de synthèse :
Le principe consiste à utiliser, dans un criblage classique, une sonde oligonu-
cléotidique marquée synthétisée à partir des données de séquençage d’une fraction
de la protéine. Le code génétique permet de déterminer les séquences possibles du
gène correspondant (dégénérescence du code). On utilise généralement un pool
d’oligonucléotides courts de 18 à 25 bases ou quelques oligonucléotides longs de
40 à 45 bases.
Les appareils automatiques permettent actuellement de séquencer une pro-
téine en 24 heures et de synthétiser des oligonucléotides dans le même laps de
temps. Les oligonucléotides purifiés sont marqués au
32
P et utilisés comme sonde
d’hybridation in situ d’une banque génomique.
2. Le criblage par des anticorps :
37
Cette technique ne peut se réaliser que sur une banque d’expression puis-
qu’elle vise à révéler le produit d’expression d’un gène cloné. Il faut pour cela dispo-
ser d’un anticorps, de préférence polyclonal dirigé contre le produit du gène. Le
complexe antigène-anticorps est révélé par un autre complexe protéique possédant
soit une activité enzymatique dont les produits sont colorés (8-galactosidase), soit
marqué à l’iode 125.
Figure IV.6: Criblage d’une bibliothèque d’expression avec une sonde
Figure IV.7 : Criblage d’une bibliothèque d’expression avec les anticorps
3. Electrophorèse (Cf. ci-dessus)
Elle permet de récupérer les fractions d’intérêt pour un séquençage de l’ADN
inséré. La révélation des différentes bandes est faite soit par :
- Une utilisation du bromure d’éthidium et une lecture sous une illumination
ultra-violette.
- Un marquage chimique ou enzymatique des produits obtenus pour le sé-
quençage (utilisation de radio-isotopes,
32
P,
35
S) suivi d’une autoradiographie.
4. Le séquençage :
Il a pour but la détermination de la séquence nucléotidique de l’ADN isolé
pour définir les introns, les exons et les zones de régulation de l’ADN inséré dans le
vecteur. Deux méthodes classiques sont alors utilisées.
a - La méthode de Maxam et Gilbert: la méthode chimique.
L’ADN double brin à séquencer est d’abord marqué au
32
P au niveau du
phosphate en 5’. Il doit ensuite être digéré par une endonucléase de restriction en
deux fragments différents de taille, qui sont séparés par électrophorèse. On obtient
ainsi un fragment dont une seule extrémité 5’ est marquée. Il est séparé en 4 lots et
dans chaque lot, au moyen de réactifs chimiques différents, on réalise une coupure
au niveau d’un type de base différent.
Après électrophorèse sur gel de polyacrylamide des 4 produits de réaction et
autoradiographie, les positions relatives des différentes bases sont déduites de la
comparaison des distances de migration des fragments marqués en 5’.
38
Séquence détectée sur le gel Lecture
3 →-5’
Ordre
des
taches
T C G A Lecture
3’→5’
32
PTGCACTTGAACGCATGCT 18 T
32
P- TGCACTTGAACGCATGC 18 17 C
32
P- TGCACTTGAACGCATG 17 16 G
32
P- TGCACTTGAACGCAT 16 15 T
32
P- TGCACTTGAACGCA 15 14 A
32
P- TGCACTTGAACGC 14 13 C
32
P- TGCACTTGAACG 13 12 G
32
P- TGCACTTGAAC 12 11 C
32
P- TGCACTTGAA 11 10 A
32
P- TGCACTTGA 10 9 A
32
P- TGCACTTG 9 8 G
32
P- TGCACTT 8 7 T
32
P- TGCACT 7 6 T
32
P- TGCAC 6 5 C
32
P- TGCA 5 4 A
32
P- TGC 4 3 C
32
P- TG 3 2 G
32
P- T 2 1 T
32
P- 1 0
Figure IV.8 : La méthode de séquençage des acides nucléiques de Maxam Gilbert :
Un traitement chimique permet de cliver spécifiquement au niveau de chaque base
qui produit alors des fragments radioactifs de tailles différentes.
La séquence de l’ADN, lue directement de bas en haut du gel, est alors :
5’-TGCACTTGAACGCATGCT-3’
b - La méthode de Sanger: la méthode enzymatique.
La méthode de séquençage enzymatique mise au point par Sanger par
l’incorporation de didésoxyribonucléotides terminateurs de chaîne a été universelle-
ment adoptée.
Cette méthode met à profit l’absence d’un hydroxyle en 3’ d’un ddXTP qui ne
permet pas la formation d’une liaison phosphodiester. la conséquence est un arrêt
de l’élongation lorsqu’un didésoxyribonucléotide est incorporé dans un brin d’ADN
en synthèse. Ce phénomène est à la base de la méthode de Sanger.
Figure IV.9 : Séquençage, méthode enzymatique
39
5. Analyse du génome et de ses modifications: Le Southern blot
C’est la méthode d’analyse de l’ADN imaginée par Southern en 1975 pour
visualiser les gènes ou toute séquence d’un ADN génomique, par une hybridation
avec une sonde, marquée et spécifique, avec des fragments de restriction d’ADN,
préalablement séparés par électrophorèse, dénaturés et transférés sur une mem-
brane. Le processus est le suivant:
• L’ADN génomique est d’abord fragmenté par une enzyme de restriction
appropriée
• Les fragments sont ensuite séparés par électrophorèse sur gel d’agarose,
• L’ADN est dénaturé in situ par une solution de soude,
• L’ADN dénaturé (simple brin) est transféré par capillarité sur un support so-
lide (filtre de nitrocellulose ou nylon). Les membranes de nylon sont les plus
utilisées car par un traitement au UV (254 nm), on forme des liaisons covalen-
tes entre le DNA et le nylon de sorte que le support peut être utilisé plusieurs
fois avec d’autres sondes.
• Le support solide est hybridé avec une sonde mono-brin marquée à faible
stringence puis lavé
• Le ou les fragments reconnus par la sonde sont révélés par la technique de
l’autoradiographie.
Figure IV.10 : Southern Blot
Cette technique permet :
• L’établissement des cartes de restriction : Les enzymes de restriction
coupent l’ADN au niveau de séquences bien définie. Il est donc facile d’établir une
carte de restriction par cette méthode.
• La mise en évidence de pseudo-gènes et de gènes apparentés : Une
sonde suffisamment longue peut s’hybrider avec des séquences non totalement
complémentaire : pseudogènes, gènes d’une même famille ou gènes homologues
d’une espèce différente. Ces gènes sont mis en évidence en fonction des conditions
d’hybridation (stringence).
• Les mutations par délétions : Cette technique permettant de visualiser un
gène, il est possible de mettre en évidence une délétion pourvue qu’elle ne soit pas
très grande.
• La détection de mutation ponctuelle : Le remplacement d’une base par
une autre peut se traduire par la disparition ou la création de sites de coupures pour
une enzyme de restriction donnée. Cette variation des sites de coupure se traduit
par la disparition d’une ou de deux bandes (suivant la longueur de la sonde utilisée)
et l’apparition d’une bande de taille supérieur dont la longueur est égale à la somme
des longueurs des deux bandes disparues. La création d’un nouveau site de cou-
pure donne le résultat contraire.
40
• La détection des recombinaisons : L’échange entre chromosomes homo-
logues au cours de la méiose est la recombinaison. Dans certains cas, il est possi-
ble de mettre en évidence ces recombinaisons par cette technique.
Figure IV.11
6. La PCR
Définition:
La PCR (Polymerase Chain Reaction), la réaction de polymérisation en
chaîne consiste à amplifier sélectivement une séquence particulière d’ADN par
l’action répétée d’une ADN polymérase. Le fragment d’ADN à amplifier est compris
entre deux séquences (complémentaires des amorces) qui doivent être connues et
la longueur ne peut excéder 10 kb.
Æ Processus:
Pour faire la PCR, on utilise l’ADN polymérase d’une bactérie: Thermophilus
acquaticus qui vit à 75°C dans les eaux thermales. Cette polymérase (Taq polymé-
rase) est toujours active à 94-96°C. La réaction de la PCR comporte trois étapes qui
constituent un cycle au cours duquel la quantité d’ADN à amplifier est doublée. Ces
cycles sont renouvelés entre 20 et 50 fois en fonction de la quantité d’ADN cible de
départ et du but recherché.
• la dénaturation de l’ADN à amplifier à 94°C,
• l’hybridation avec une amorce, appariement primer, annealing à 64°C
• extension de l’amorce à 70 - 72°C par la Taq polymérase.
L’amplification est effectuée par la répétition des cycles qui assure une dupli-
cation exponentielle de chaque brin.
Æ Les éléments de la PCR:
les réactifs et le matériel:
• l’ADN à amplifier
• 2 amorces: sens et anti sens
• tampon de réaction (Buffer)
• MgCl
2
• dNTP
• Taq polymérase
• L’appareil thermocycleur pour PCR
• H
2
O bi-distillée et stérile
Æ L’intérêt et application de la PCR:
La PCR est la méthode actuelle la plus efficace et la plus rapide
d’amplification d’un ADN cible, c’est pourquoi elle est maintenant largement utilisée.
Elle permet de mettre en oeuvre les techniques habituelles de génie génétique
même si l’on ne dispose au départ que d’une faible quantité d’ADN.
CF Figure IV.5 : Les cycles de la PCR
41
7. Étude des polymorphismes : RFLP, VNTR, SSTR, SSCP
Les RFLP (restriction frament length polymorphism) sont des variations de séquence
de l’ADN révélées par des modifications de la carte de restriction. L’ADN est soumis
à une digestion par une ou plusieurs enzymes de restriction suivie d’un Southern
blot. En d’autres termes : l’hydrolyse d’un ADN par une endonucléase conduit à une
série de fragments, appelés fragments de restriction. La longueur des fragments est
déterminée par la distance séparant les séquences spécifiques reconnues par cette
endonucléase. Nous avons les RFLP (Restriction Fragment Length Polymorphism).
Une molécule d’ADN donnée coupée par une enzyme de restriction donnée produit
toujours les mêmes fragments : cette série de fragments fournit une empreinte ca-
ractéristique de l’ADN hydrolysé, on parle de carte d’identité moléculaire.
Nous avons aussi les polymorphismes de répétition : ce sont les minisatelites
ou VNTR (Variable Number of Tandem Repeats) Les VNTR sont des séquences
particulières. Elles sont répétitives, dispersées et très polymorphes. Elles ont sou-
vent 11 à 16 bp (GGAGGTGGGCAGGA [A/G] G. Elles permettent la réalisation de
l’empreinte genetique (ADN finger printing)
Les microsatelites de type (CA)n sont plus fréquent et les mieux caractérisés :
les SSTR (Short Sequences of Tandem Repeats). Ils sont favorisé par des crossing
over inégales lors de la méiose. La chorée de Hungtington qui est une maladie neu-
rodégénérative est provoquée par des crossing-over inégaux. La technique des
SSTR permettent d’établir des polymorphismes à plus de 99,99%. Cette technique
est utilisée dans les tribunaux pour découvrir le coupable, pour déterminer la pater-
nité ou la maternité et elle est désormais utilisé dans la pharmacogénétique.
La mise en évidence des mutations ponctuelles utilise le système de l’analyse
des polymorphisme de conformation de l’ADN simple-brin : SSCP (single Strand
Conformation Polymorphism). La structure secondaire que prend un segment de
l’ADN simple-brin est fonction de sa séquence. Une mutation ponctuelle au sein de
cette séquence modifie la structure secondaire pour qu’il en résulte une modification
de la migration en électrophorèse. Cette propriété permet de mettre en évidence la
présence d’une mutation ponctuelle.
Processus :
- La séquence où l’on souhaite rechercher une mutation est amplifiée
par PCR.
- Cette séquence ne doit pas dépasser 300 à 500 bp.
- L’ADN est marqué par un iso-radioactif au cours de l’amplification.
On peut introduire un nucléotide α
32
P dCTP ou alors utiliser des pri-
mers marqués.
Technique d’empreintes par didéoxynuclotides ou ddF
Les amplicons de la PCR
Réaction de séquence à l’aide de la Taq DNA polymérase avec un primer interne
42
Migration sur un gel d’acrylamide non dénaturant
Par exemple, on a la séquence suivante avec une mutation C à A
5’ ---- AGTGTTACGTGCTA ----à 3’ Pour l’allèle normal
5’ ---- AGTGTTAAGTGCTA ----à 3’ Pour l’allèle muté
Après PCR, on ajoute un seul didéoxynucléotide (par exemple, ddGTP) et des
dNTPs. Puis, une réaction de séquence utilisant la Taq polymérase est réalisée
(avec une amorce marquée).
5’ ---- AGTGTTACG TGCTA ----à 3’ Pour l’allèle normal
3’ ---- TCACAAT
dd
G
5’ ---- AGTGTTAAGTGC TA ----à 3’ Pour l’allèle muté
3’-----TCACAATTCAC
dd
G
NB. L’altération de la conformation spatiale de l’ADN permet de détecter dans un gel
la mutation (SSCP)
Normal Muté
Fig. IV.12 : d’un gel de polyacrylamide en utilisant la technique
de dideoxyfinger-printing
8 . Puces à ADN (microarray) ou ADN chips
La technologie des puces ADN permet l’analyse de l’expression de milliers de
gènes simultanément. Employer les puces ADN vise à caractériser les relations
gène-fonction ou définir et comparer les profils d’expression des messagers expri-
Normal Muté
Bande de faille normale
Bande de faille anormale correspondant à la mutation
43
més dans des cellules isolées dans différentes conditions (exemple : cellules norma-
les comparées aux cellules tumorales) ou soumises à différents traitements (défini-
tion du profil d’action d’une drogue). Les puces ADN sont un outil de choix dans la
recherche et la caractérisation de nouvelles molécules à visée thérapeutique.
Principe :
Synthétisons une série d’oligonucléotides de 8 bp (octamères) représentant
toutes les combinaisons possibles 4
8
= 65.536 : ces 4
8
oligonucléotides sont fixés de
manière ordonnée sur une plaque de silice. La séquence dont on cherche à déter-
miner la composition est hybridée sur ce filtre. Les conditions de stringence sont
telles que, seules, les appariements strictement homologues se réalisent. Un traite-
ment informatique permet d’analyser les résultats.
1 2 3 4 5 6 7 8 9 10 11 12
A
xxxx B
C
D
xxxx E
F
G
xxxx H
I
xxxx J
K
xxxx L
Figure IV.13 : schéma simplifié d’une puce.
Prenons cette puce sur laquelle sont fixés des octamères de séquences che-
vauchantes différentes et ordonnées. Supposons que nous ayons un ADN de 12 bp
et hybridons-le à cette puce. Dans cet exemple nous avons cinq hybridations de
séquences.
Par exemple, si les ADN fixes sur les cases ci-après ont la séquence décrite :
B9 : C A G C C A A T
44
E4 : A G C C A A T A
H12: G C C A A T A C
J1 : C C A A T A C G
L12 : C A A T A C G A
Figure IV.14
La séquence reconstituée est alors : 5’ – CAGCCAATACGA.
Le support utilisé pour fixer les oligonucléotides peut être une plaque de silice. La
synthèse des oligonucléotides se fait in situ : réactions chimiques avec adresse spé-
cifique sur le verre. Ces puces sont très petites, environ 1,6 cm
2
avec un espace
entre les sondes d’environ 50 µm (65.000 sondes fixées).On peut encore diminuer
leur taille. Ainsi, des puces, avec espacement des sondes de 20 µm, permettent de
fixer plusieurs centaines de milliers de sondes, ont été fabriquées. Les industriels
espèrent pouvoir réaliser des puces de 1 µm et pourquoi pas, comme dans
l’industrie informatique, des puces de 0,3 µm !
Secteurs d’application :
• Dans le séquençage de l’ADN mitochondrial (16,6kb).
• Détection de mutations et de polymorphismes,
• Expression de gènes,
• Pharmacogénétique ou pharmacogénomie.
C A G C C A A T A C G A
45
CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION
DES GÈNES EUCARYOTES DANS LES BACTÉRIES.
La fin des années 1970 et le début des années 1980 ont vu se développer
des techniques qui permettent de modifier des paires de bases bien spécifiques
donc de créer différents types de mutations ponctuelles, de délétions et d’insertions
dans des fragments d’ADN cloné. Les fragments d’ADN ou les gènes ainsi modifiés
peuvent ensuite être réintroduits dans l’organisme d’origine pour observer les effets
des mutations sur le phénotype ou sur la régulation de l’expression génétique.
I - LES MUTAGENÈSES
1. Mutagenèse par délétions
L’un des moyens les plus drastiques pour évaluer le rôle d’une séquence de
DNA donnée est de la supprimer. L’analyse des modifications physiologiques qui
suivent cette excision permet alors de connaître le rôle de la séquence « délétée ».
Pour être pleinement informative, la suppression doit être progressive. On emploi
alors la stratégie suivante :
– Création d’une délétion étendue dans l’ADN considéré afin de connaître le
rôle de la séquence
– Création de délétions de plus en plus courtes pour circonscrire les régions
d’intérêt.
– Insertion de séquences plus ou moins longues en fonction de la carte de
restriction.
– Création de mutations ponctuelles pour connaître le rôle de chaque base
dans les mécanismes de régulation ou dans la séquence peptidique.
Le principe consiste à utiliser les enzymes de restriction soit pour « déléter »,
soit pour insérer des portions plus ou moins grandes de DNA dans le gène cloné
afin d’élucider son rôle dans le génome. On utilise pour cela plusieurs stratégies en
fonction des sites restriction :
– Une coupure par une enzyme de restriction suivie de l’action de la nu-
cléase S1 permet de retirer de 3 à 8 paires de bases suivant le type d’enzyme de
restriction (largeur du site de reconnaissance)
– Une coupure par une enzyme de restriction suivie de l’action de
l’exonucléase III permet également de retirer plus de bases en fonction du temps
d’incubation. La nucléase S1 est toujours utile pour raboter les extrémité 5’.
– Une coupure par une enzyme de restriction suivi de l’activité de la nu-
cléase Bal 31 qui dégrade les deux extrémités de l’ADN à la fois. L’étendue du re-
trait dépend du temps d’incubation. La fermeture des deux extrémités restantes est
toujours réalisée par la T4 ligase qui peut joindre deux molécules de DNA ayant des
bouts francs.
46
2. Mutagenèse par insertion:
L’insertion d’une courte séquence dans un gène permet d’élucider l’effet de
position soit d’une base soit d’une séquence de bases dans les phénomènes de ré-
gulation, ou pour connaître l’influence d’un acide aminé dans le fonctionnement
d’une protéine. Le principe utilise les mêmes méthodes que pour la délétion. Le
fragment que l’on veut insérer ou modifier est, soit une substitution de nucléotides,
soit un fragment de restriction purifié, soit un oligonucléotide de synthèse.
a- Les substitutions de nucléotides
Les substitutions des bases peuvent être introduites dans un segment d’ADN
cloné dans un plasmide, après y avoir créé de courtes régions mono-caténaires.
Ces régions mono-caténaires sont alors utilisées pour substituer des paires de ba-
ses ou pour introduire des nucléotides supplémentaires:
∗ soit par une digestion partielle à l’aide de l’exonucléase III (qui a une action
exonucléasique 3à 5) après une coupure par une enzyme de restriction. On aura
donc des bouts 5’ débordants.
∗ soit en exploitant l’activité exonucléasique de l’ADN polymérase I
d’Escherichia coli (qui a trois activités enzymatiques: 5à 3 polymérisante; 5à 3
exonucléasique; et 3à 5 exonucléasique). En effet, en l’absence des désoxyribo-
nucléotides triphosphates, cette enzyme digère un des brins d’un duplex d’ADN
dans la direction 3’ à 5’. On obtient encore des extrémités 5’ débordants.
Exemple : Pour créer donc un mutant contenant une substitution de base par une
désamination de la cytosine.
Figure V.1 : Mutagenèse, substitutions de nucléotides
On procède alors comme il suit:
à Avec une enzyme de restriction donnée comme Hind II, on ouvre dans
l’ADN un site de restriction: un smal.
à Le site est traité avec l’ADN polymérase I modifiée (appelée fragment de
Klenow). En présence de dTTP, ce fragment enzymatique agit comme une exonu-
cléase en effectuant une digestion simple brin 3’à 5’ jusqu’à ce qu’il rencontre un
résidu T.
à L’addition du bisulfite provoque une désamination des résidus cytosines
(C) des brins exposés pour donner de l’uracile (U).
à Après élimination du bisulfite, la molécule de DNA est réparée par
l’addition des quatre dNTP et du fragment de Klenow de la DNA polymérase.
à Le résultat est une substitution d’une paire de bases G-C par une paire A-T.
47
b - La mutagenèse dirigée au moyen d’oligonucléotides:
Les exemples que nous venons de voir possédaient un site de restriction pro-
pice aux bords de la région à modifier. Mais comment créer une mutation dans une
séquence qui ne bénéficie pas de cette situation favorable ? Pour résoudre ce pro-
blème, Michael Smith a inventé la méthode qui utilise des petits oligonucléotides de
synthèse d’une taille de 15 à 25 bases.
Figure V.2 : mutagenèse dirigée au moyen d’oligonucléotides
Le protocole est le suivant:
1. Le gène que l’on désire muter est cloné de préférence dans un vecteur dé-
rivé d’un phage dont le génome est une molécule d’ADN monocaténaire, comme le
phage M13.
2. Un oligonucléotide synthétique dérivé du gène cloné et portant la mutation
désirée est ajouté dans le milieu pour servir d’amorce (primer) pour la synthèse in
vitro du brin complémentaire du vecteur M13.
3. L’amorce synthétique peut donc contenir n’importe quelle base « erronée »
que l’on désire introduire dans la séquence. Il y aura donc un défaut d’appariement
au niveau de cette base avec l’ADN du vecteur. Cependant, si l’hybridation est réali-
sée à basse température et à faible stringence (faible force ionique), une ou deux
bases mal appariées peuvent être tolérées dans la formation de la double hélice.
4. Le brin complémentaire est alors synthétisé in vitro par le fragment de Klé-
now de la DNA polymérase I qui utilise l’oligonucléotide modifié comme amorce.
5. Les deux brins de l’ADN obtenu sont séparés par simple chauffage suivi
d’un refroidissement rapide et transférés par transformation dans E. coli où il seront
répliqués in vivo et produiront finalement un grand nombre d’exemplaires de la sé-
quence mutée que l’on désire (50% pour la séquence mutée et autant de copies de
l’ADN sauvage 50%).
6. Les bactéries ayant incorporé la séquence mutée sont sélectionnées par
hybridation in situ dans des conditions de forte stringence avec l’oligonucléotide mu-
té marqué comme sonde (pour différencier la molécule non mutée).
48
c - La mutagenèse insertionnelle ciblée par recombinaison homologue
On peut cibler le site de la mutagenèse insertionnelle en introduisant une sé-
quence homologue au gène que l’on veut léser. Celle-ci reconnaît sélectivement le
gène endogène et provoque une recombinaison homologue responsable soit d’une
insertion par addition, soit une insertion par remplacement. Dans le cas d’une inser-
tion par remplacement, le gène cible est inactivé. Dans le cas d’une insertion par
addition, les deux gènes sont présents dans le génome. (Figure V.3)
La première construction réussie a utilisé le protocole suivant:
1 – Le vecteur plasmidique utilisé contenait à la fois un fragment du gène
HPRT (Hypoxanthine-guanine PhosphoRibosyl Transférase) pour cibler ce gène in
vivo et un gène néo (ce gène marquer confère à la cellule une résistance à la néo-
mycine)
2 - Le vecteur est introduit par électroporation dans des cellules embryonnai-
res indifférenciées (ES cells : Embryonic Stem cells : cellules staminales em-
bryonnaires indifférenciées pluripotentes et cultivables in vitro de façon prolongée).
3 - Les cellules ayant intégré l’ADN sont sélectionnées par leur résistance au
G418 (un analogue de la néomycine) conférée par le gène néo.
4 - Celles où l’intégration s’est faite par le truchement d’une recombinaison
homologue ayant inactivé le gène HPRT sont alors sélectionnées par leur résistance
à la thioguanine (sélection des cellule HPRT
-
).
Pour réaliser la même opération sur des gènes non sélectionnables (gènes
de régulation), Mansour a élaboré un système de double sélection : le procédé de
sélection positive et négative dont le principe est le suivant :
– Si l’intégration se fait d’une manière aléatoire, c’est-à-dire par insertion, la
construction utilisée est intégrée en totalité, et le gène cible n’est pas touché. La
cellule est sélectionnée positivement par le G418 (résistance conférer par le gène
néo) et négativement par le ganciclovir (tk
+
. La thymidine kinase du virus de lherpes
confère la sensibilité à une drogue antivirale, le ganciclovir, analogue de la thymine).
– En cas de recombinaison homologue par remplacement, les exons C, D et
E endogènes sont remplacés par ceux de la construction (C, D, néo, D , E) et le
gène tk est éliminé en raison de sa position terminale. En ce moment, le gène ciblé
est inactivé car l’exon D exogène est interrompu par le gène neo. La cellule est sé-
lectionnée positivement par G418 ( neo
+
) et résiste au ganciclovir (tk
-
). Les évè-
nements de recombinaison homologue réussis peuvent être vérifiés par la PCR en
utilisant une amorce correspondant à l’ADN exogène (par exemple une séquence
néo) ou une amorce correspondant à une séquence endogène (comme l’exon F du
gène HPRT).
49
Figure V.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue
A B C D E F
C D NEO D F tk
C D NEO D E tk A C D E F
A B C D E F
C D NEO D E tk
A B C D NEO D E F
Gène ciblé
Construction
Gène ciblé
Construction
Intégration
aléatoire
Recombinaison
homologue
50
Figure V.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue
Figure V.4 : La mutagenèse , mutation d’un site de restriction.
3 . Mutagenèse par PCR
• La création d'une mutation artificielle peut être obtenue dans un gène par le
jeu des amplifications à partir d'amorces modifiées.
• On prépare l'amplification du gène ou du cDNA grâce à deux amorces pla-
cées en amont et en aval de la séquence d'intérêt. On prépare aussi par syn-
thèse des oligonucléotides conformes aux séquences des deux brins du gène
autour du codon qui doit être modifié mais dont les bases sont volontairement
changées pour qu'elles permettent la synthèse d'un brin complémentaire
comprenant la substitution (ou la délétion...) souhaitée.
• On fait une première amplification entre chacune des amorces modifiées et
les amorces des extrémités. En réunissant ces deux amplifications et en dé-
naturant l'ADN, on conduit à une renaturation entre les fragments au niveau
des amorces centrales modifiées. Cette hybridation fait apparaître des extré-
mités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux
extrémités de la séquence d'intérêt. La poursuite des cycles en présence des
amorces amont et aval conduit à l'amplification de cette séquence complète
dans laquelle le codon muté a été inséré.
• La création d'une mutation artificielle peut être obtenue dans un gène par le
jeu des amplifications à partir d'amorces modifiées.
• On prépare l'amplification du gène ou du cDNA grâce à deux amorces pla-
cées en amont et en aval de la séquence d'intérêt. On prépare aussi par syn-
thèse des oligonucléotides conformes aux séquences des deux brins du gène
autour du codon qui doit être modifié mais dont les bases sont volontairement
changées pour qu'elles permettent la synthèse d'un brin complémentaire
comprenant la substitution (ou la délétion...) souhaitée.
• On fait une première amplification entre chacune des amorces modifiées et
les amorces des extrémités. En réunissant ces deux amplifications et en dé-
naturant l'ADN, on conduit à une renaturation entre les fragments au niveau
des amorces centrales modifiées. Cette hybridation fait apparaître des extré-
mités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux
extrémités de la séquence d'intérêt. La poursuite des cycles en présence des
amorces amont et aval conduit à l'amplification de cette séquence complète
dans laquelle le codon muté a été inséré.
II. MISE EN ÉVIDENCE DES EFFETS DE LA MODIFICATION
L’effet des modifications est de suivre l’expression d’un gène soit par une
augmentation ou une diminution de la production d’une protéine soit d’étudier les
modifications structurale de la protéine produite. Dans le cas des changements phé-
notypiques le résultat est visuel, mais dans les autres cas, il faut avoir recours soit à
des gènes reporteurs, soit à des promoteurs inductibles.
La séquence de DNA modifiée est couplée à un gène reporteur que la cellule
d’expression ne possède pas et dont le produit est facilement analysable. Les gènes
51
les plus courants sont : le gène de la Chloramphénicol-acétyl transférase (CAT), de
la β-glucuronidase ‘(8-Glu), de la β-galactosidase (8-Gal) et de la luciférine. (CF
Photocopies)
III. TRANSFERT DE L’ADN MODIFIÉ
Le transfert de l’ADN libre dans les cellules s’effectue par transfection avec
différentes techniques suivant le type cellulaire :
La transfection par le phosphate de calcium fait intervenir une internalisation
du complexe DNA-calcium par phagocytose
La transfection par le complexe DEAE dextran est également une internalisa-
tion par phagocytose
L’électroporation utilise l’effet d’une tension électrique sur des cellules en
suspension qui provoque la formation transitoire de pores permettant au DNA de
pénétrer dans la cellule.
Le DNA peut aussi être introduit par des projections de micro-particules enro-
bées de DNA surtout pour les plantes.
Le DNA peut aussi être introduit dans les cellules par micro-injection surtout
dans le cas des ovocytes fécondés.
La transfert de matériel génétique utilise aussi les vecteurs viraux, rétroviraux
et les plasmides que l’on appelle alors des vecteurs navettes.
52
DEUXIÈME PARTIE :
APPLICATION
DE LA BIOLOGIE
MOLECULAIRE :
LE GÉNIE GENETIQUE
53
CHAPITRE VI: LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES
AUX MICRO-ORGANISMES
Les génomes eucaryotes sont beaucoup plus complexes que les génomes
bactériens et phagiques C’est pourquoi les techniques de manipulation de l’ADN
doivent être adaptées aux différents génomes. Les exemples ci-dessous donnent
une idée de la taille du génome de quelques espèces :
• Plasmides à 2 à 5 kb
• Bactériophage / à 4,8 kb
• Bactériophage M13 à 6,4 kb
• E. coli à 4 Mb
• La levure (Saccharomyces cerevisiae) à 4 Mb
• Neurospora crassa à 27 Mb
• C. elegans à 100 Mb
• Drosophila melanogaster à 165 Mb
• Homo sapiens à 3000 Mb
I. LA TECHNIQUE DE L'ADN RECOMBINANT (ADNR)
La technique de l'ADN recombinant (ADNr) est simple dans son principe:
L’ADN recombinant est formé en réunissant des segments d’ADN de différentes
sources par le processus suivant:
> L'ADN d’intérêt est coupé avec une enzyme de restriction,
> L'ADN exogène contenant la séquence d'intérêt est mis en présence
de l’ADN du vecteur digéré par la même enzyme
> Les deux ADN sont ensuite ligaturés avec une enzyme appelée ligase.
> Le DNA obtenu est transféré dans une cellule d’expression
> On analyse les résultats obtenus grâce à des marqueurs présents
dans l’ADN du vecteur
Figure VI.1
1 - Les organismes transgéniques et la recherche en génie génétique
Un organisme transgénique est défini comme provenant d’une cellule dont le
génome a été modifié par l’introduction d’ADN extrinsèque. Cet ADN extrinsèque
peut être une séquence provenant de la même espèce mais qui a subi des modifica-
tions chimiques ou provenir d’une espèce différente. Le gène d’intérêt dans
l’échantillon d’ADN extrinsèque est le transgène.
L’introduction de cet ADN dans une cellule peut s’effectuer par une série de
manipulation diverses : par l’électroporation, la micro-injection, les liposomes, la co-
précipitation par le phosphate de calcium, par la transformation, par infection virale,
ou par un bombardement avec des micro-projectiles de tungstène enrobés d’ADN
dans le cas des cellules végétales.
54
La construction d’organismes transgéniques constitue un bond en avant pour
la recherche en génie génétique. Une des méthodes les plus importantes consiste
en l’utilisation de gènes indicateurs qui permettent de mesurer l’activité d’un gène
spécifique dans le tissu où il s’exprime normalement, malgré l’absence d’un phéno-
type facilement détectable. La région qui contrôle l’expression du gène en question
(promoteur) est alors rattachée à la région codante d’un gène dont l’activité est faci-
lement mesurable et qui constitue alors le gène indicateur. Chaque fois que le gène
étudié est exprimé, le gène indicateur signale sa présence par son activité indica-
trice dans la cellule ou dans les tissus concernés.
La construction de bactéries, de plantes, de champignons et d’animaux trans-
géniques ouvre donc de nombreux débouchés pratiques. Nous avons déjà vu com-
ment les bactéries transgéniques sont utilisées pour la production de différentes pro-
téines, parfois d’origine humaine, utiles en médecine et en pharmacie. Cet aspect de
la recherche est appelé biotechnologie.
L’ADN recombinant : L’action d’une enzyme permettant de souder deux frag-
ments d ‘ADN , comme l’exemple de l’enzyme EcoRI explique simplement le principe
de l’ADN recombinant.
2. Intérêt de la transgenèse
Sur le plan de la biotechnologie :
- Au plan zootechnique : l’un des intérêts majeurs de la transgenèse est
l’amélioration des caractères phénotypiques des animaux de rente: amélioration de
la croissance des animaux, comme le porc, le saumon, l’acquisition de résistances
aux maladies causes de mortalité dans les élevages de lapins, de truites, de car-
pes….
- Au niveau des plantes : La création de plantes résistantes aux insectes, au
stress hydrique et pour la production de protéines utiles comme les anticorps : (maïs
résistant aux insectes, tomates transgéniques à mûrissement lent, bananes vacci-
nantes….)
>Sur le plan médical :
â Production de protéines d’intérêt pharmaceutique : Certaines protéi-
nes trop complexes (glycosylées, carboxyméthylées…) ne peuvent être synthétisées
complètement par les bactéries in vitro. Il faut donc chercher à en obtenir par un
animal transgénique (dans le lait, le sang, les urines…..). L’obtention de ruminants
transgéniques producteurs de protéines d’intérêt pharmaceutique à haute valeur
ajoutée (facteurs VIII et IX de la coagulation, anti-thrombine III, alpha-1-antitrypsine,
activateur du plasminogène, sérum albumine…) représente aujourd’hui un intérêt
financier énorme.
â Xéno transplantation : Face à l’insuffisance des organes humains dispo-
nibles pour les greffes, la recherche d’organes animaux peut représenter une solu-
55
tion palliative. Le porc, physiologiquement proche de l’homme est à l’heure actuelle
le meilleur candidat, d’autant plus que très peu de maladies sont transmissibles du
porc à l’homme. Pour éviter le rejet d’organes porcins transplantés chez l’homme,
les gènes humains des protéines régulatrices du complément sont transférés au
porc. Les cours et les reins de porcs transgéniques obtenus en Grande Bretagne,
aux Etats Unis et en Australie survivent pendant plusieurs semaines quand ils sont
greffées à des primates.
â Modification de la composition du lait : Elle a pour but de mieux adap-
ter le lait des ruminants à la consommation humaine et d’améliorer sa transformation
par l’industrie laitière. L’expression de la lactoferrine humaine dans le lait de vache a
déjà été réalisée. Il s’agit d’un composé du lait humain qui est absent du lait de va-
che. Elle joue un rôle de transporteur de fer, mais aussi un rôle antibactérien (Elle
assure une protection du tube digestif du nouveau-né contre les infections bacté-
riennes). Le taureau hollandais HERMANN est un mâle fondateur transgénique de
ce gène.
A l’inverse, il est envisagé de diminuer la concentration de la béta-
lactoglobuline qui participe à l’intolérance au lait dont souffre une grande partie de la
population mondiale.
Un lait enrichi en anticorps ou en lysozymes pourrait être protecteur du tube
digestif et pourrait même être utilisé chez les nourrissons. Le lait devient alors un
« alicament », c’est à dire simultanément un aliment et un médicament.
â Création de modèles animaux des maladies humaines : Des souris,
mais aussi des ruminants transgéniques peuvent servir de modèles pour l’étude des
maladies humaines à prions. Les souris de même que les lapins peuvent servir aus-
si pour l’étude du SIDA et pour des tests thérapeutiques.
â Risques liés à la transgenèse : Les applications et les espoirs que font
naître la transgenèse sont très nombreux. Néanmoins, l’utilisation de la transgenèse
chez les végétaux et les animaux fait l’objet de vives réserves et controverses :
_ L’utilisation de l’hormone de croissance humaine chez les animaux per-
turbe leur croissance et leur reproduction. Les moutons qui sur-expriment GH (hor-
mone de croissance humaine) sont diabétiques et meurent avant l’âge d’un an.
_ Les risques liés à la consommation des produits OGM comme les protéines
de la vache folle qui provoque des troubles chez l’homme. Les maïs transgéniques
possèdent aussi des gènes de résistance aux ampicillines. Ces transgènes peuvent
donc s’intégrer dans les bactéries du tube digestif humain et conférer des résistan-
ces bactériennes aux antibiotiques que nous utilisons pour nos traitements.
_ Les risques liés à l’environnement : Ces risques sont liés à la dissémina-
tion des organismes transgéniques. Des bactéries et des souris transgéniques qui
s’échappent d’un laboratoire de recherche ou d’un centre de production, les déchets
des produits transgéniques déversés dans la nature constituent de grands dangers
qui guettent sans cesse notre écosystème.
II - SYNTHÈSE DU FACTEUR VIII HUMAIN PAR L’E. COLI
56
Le vecteur utilisé dans cet exemple est le phage T7. Au début de l’infection,
l’ARN polymérase du phage T7 transcrit les gènes précoces à partir d’un promoteur
dit précoce du phage T7. En fin d’infection, la bactérie synthétise des quantités
énormes des produits des gènes dits tardifs du phage T7 (les protéines de la cap-
side et de la queue). A ce moment, les gènes de la bactérie hôte ne sont plus trans-
crits. Par conséquent seules les protéines du phage sont encore synthétisées. Cette
possibilité est utilisée pour produire de grande quantité des protéines d’intérêt
comme le facteur VIII de la coagulation sanguine qui est défectueux chez les hé-
mophiles.
On insère le gène de l’ARN polymérase de T7 dans le chromosome
d’Escherichia coli sous le contrôle du promoteur de l’opéron lactose. Le gène de
l’ARN polymérase de T7 est transcrit à partir du promoteur lac et se trouve norma-
lement réprimé par le répresseur lac. L’addition de l’inducteur IPTG (analogue du
lactose), inactive le répresseur et autorise alors la synthèse de l’ARN polymérase du
phage T7.
Le gène d’intérêt, en l’occurrence, le gène humain (ADNc) du facteur de coa-
gulation du sang, le facteur VIII, a été inséré dans un plasmide à côté d’un promo-
teur tardif du phage T7. L’ARN polymérase du phage T7 produite alors par la bacté-
rie transcrit abondamment ce gène dans le plasmide. Il en résulte une production de
quantités importantes de facteur VIII par les bactéries contenant le plasmide.
Le schéma représente un système de deux vecteurs pour la production en
deux étapes du facteur VIII humain. Le Chromosome d’E. coli est manipulé pour
contenir le gène de l’ARN polymérase du phage T7 placé sous le contrôle du promo-
teur lac. Lorsque la transcription à partir du promoteur lac est induite par l’addition
d’IPTG, le gène de la polymérase du phage T7 est aussi transcrit et traduit en pro-
téine.
Les RNA polymérase de T7 ainsi produites transcrivent activement à leur tour
le gène du facteur VIII à partir du promoteur tardif du T7 présent sur le plasmide. La
grande quantité de mRNA ainsi produite est traduite pour donner une grande quanti-
té de la protéine facteur VIII.
III - SYNTHÈSE DE L’INSULINE HUMAINE PAR E. COLI:
Expression de l’insuline humaine chez Escherichia. coli : Les deux chaînes
d’insuline sont synthétisées séparément sous forme de protéines fusion avec la 8-
galactosidase. Elles sont ensuite libérées par un traitement chimique puis mélan-
gées. L’insuline active est obtenue par une réaction d’oxydation chimique des cys-
téines. Actuellement l’insuline est produite en grande quantité par E. coli par une
insertion de son gène dans un plasmide. Figure VI.2 : Synthèse de l’insuline
IV - SYNTHÈSE DE L’HORMONE DE CROISSANCE HUMAINE
PAR ESCHERICHIA COLI
57
Le schéma de la figure IV.8 donne le protocole de construction pour la syn-
thèse de l’hormone de croissance humaine dans E. coli :
(a) : Dans la première construction, la séquence signal humaine de l’insuline est éli-
minée pour permettre l’expression de la protéine dans les cellules bactériennes. Il
en résulte une méthionine à l’extrémité N-terminal qu’il faut enlever pour avoir la pro-
téine active.
(b) : Dans cette construction, une séquence signal bactérienne est ajoutée pour fa-
voriser la sécrétion du produit de traduction dans l’espace périplasmique. Dans ce
cas, il n’y a plus de méthionine supplémentaire et le produit excrété est de l’hormone
de croissance pure.
V – PRODUCTION DE VACCINS PAR LA TECHNIQUE DE L’ADN
RECOMBINANT :
1 - Les levures transgéniques
La levure Saccharomyces cerevisiae est devenue l’Escherichia. coli des
eucaryotes. L’une des raisons est que la génétique de cette levure est extrêmement
bien développée.
Les vecteurs de levure les plus simples sont dérivés de plasmides bactériens
dans lesquels un fragment d’ADN de levure a été inséré. Quand ils sont introduits
dans les cellules de levure, ces plasmides peuvent s’intégrer dans les chromosomes
par recombinaison homologue faisant intervenir un seul ou deux crossing-over.
Ces plasmides bactériens ne peuvent cependant pas se répliquer dans la levure.
• Dans le premier cas, le plasmide entier est intégré dans le chromosome.
• Dans le second cas, l’allèle cellulaire est remplacé par celui qui est porté
par le plasmide par recombinaison.
Il est alors possible d’introduire des gènes étrangers dans la levure pour en
étudier l’effet sur le phénotype, puis de re-transférer le plasmide dans Escherichia
coli pour manipuler le gène de la levure, pourvu qu’il contienne une origine de répli-
cation bactérienne et un marqueur sélectionnable dans la bactérie. Ces vecteurs
navettes que sont les chromosome artificiels de levure (YAC) sont extrêmement in-
dispensables pour le clonage de grands fragments de génome humain. Comme
exemple :
• le gène qui code pour le facteur VIII de la coagulation sanguine est long de
190 kb
• le gène responsable de la dystrophie musculaire de Duchenne fait 1000 kb.
On réalise alors, l’importance d’avoir des vecteurs à grande capacité
d’emmagasinage pour étudier les gènes humains ou pour produire des protéines
humaines à intérêt thérapeutique.
2 – L’élaboration du vaccin contre l’hépatite B.
58
Chaque année, le virus de l’hépatite B infecte plusieurs centaines de milliers
de personnes dans le monde. On estime qu’aux Etats-Unis, il y a 150 000 infections
par l’hépatite B chaque année. 16 à 19 % de la population du Burkina Faso sont
aussi atteints par l’infection à l’hépatite B. Le virus de l’hépatite B (HBV) qui infecte
le foie, provoque des lésions et dans certains cas des cancers. La particule virale
est recouverte d’un antigène de surface : HbsAg. Cette protéine se retrouve dans le
sang des personnes infectées sous la forme de gros agrégats protéiques.
La fabrication du vaccin contre l’hépatite B, appelé Engérix-B a utilisé la
technologie de l’ADN recombinant. Pour ce faire, le gène de l’antigène de surface du
virus de l’hépatite B (HbsAg) a été introduit dans Saccharomyces cereviciae par
l’intermédiaire d’un YAC. Dans les cellules de levures transgéniques, le gène est
transcrit et traduit en antigènes viraux. Après purification, ces antigènes injectés à
l’homme provoquent une réponse immunitaire par la production des anticorps anti-
Hbs ou anti HbsAg. Cette protéine est actuellement commercialisée et constitue un
vaccin contre l’hépatite B. Figure VI.3 : Production de l’antigène HbsAg
VI - APPLICATION DU GÉNIE GÉNÉTIQUE À L'AMÉLIORATION DE LA
PRODUCTION DES ANTIBIOTIQUES PAR DES BACTÉRIES
L'apparition de bactéries pathogènes multirésistantes aux antibiotiques pose
un grave problème médical. Par exemple, la vancomycine, qui a longtemps été l'an-
tibiotique de référence contre les infections sévères à bactéries Gram+ (endocardi-
tes, septicémies...) est inopérante dans un nombre croissant de cas. Cela rend né-
cessaire la recherche de nouvelles molécules actives contre ces pathogènes.
La synthèse de la pristinamycine par des Streptomyces pristinaespiralis re-
combinants
Les chercheurs ont eu l’idée de construire une souche génétiquement modi-
fiée de Streptomyces pristinaespiralis, bactérie Gram+ qui produit la pristinamycine.
Cette nouvelle souche bactérienne transgénique est stable dans les conditions in-
dustrielles et l'antibiotique est obtenu dans la forme souhaitée.
Les Streptomyces sont des bactéries du sol à Gram
+
qui appartiennent à la
classe des Actinomycètes. Elles présentent des phénomènes de différenciation uni-
ques chez les procaryotes, tels que la formation de mycélium et de spores. Cette
différenciation morphologique s'accompagne d'une différenciation métabolique et de
la production d'une grande variété de métabolites secondaires, présentant tout un
éventail de structures chimiques et d'activités biologiques. Cela rend la production
industrielle de ces métabolites particulièrement intéressante. On peut trouver des
molécules ayant une activité herbicide, anticancéreuse, antihelminthique, anaboli-
sante, antibiotique. Mais les plus connus restent les antibiotiques. L'abondance et la
diversité structurale des antibiotiques synthétisés par les Streptomyces ne se re-
trouvent dans aucun genre bactérien, au point que les Streptomyces sont à l'origine
de 70 % des antibiotiques produits industriellement. Les Streptomyces étaient donc
tout indiquées pour mettre au point de nouvelles molécules actives. Les antibioti-
ques de la famille des streptogramines, en particulier la nouvelle pristinamycine in-
59
jectable, développée par Rhône-Poulenc-Rorer, peuvent fournir un nouveau moyen
de lutter contre les bactéries pathogènes.
La pristinamycine est utilisée en médecine humaine depuis une vingtaine
d'années, mais à cause de sa faible solubilité, son utilisation était limitée, c'est pour-
quoi une forme injectable de pristinamycine constitue une solution intéressante pour
remplacer la vancomycine. La pristinamycine est produite par Streptomyces pristi-
naespiralis. C'est un mélange de deux composants, la pristinamycine I et la pristina-
mycine II. Ces deux composants agissent de façon synergique pour bloquer la syn-
thèse protéique et possèdent, de plus, un effet post-antibiotique puissant (le blocage
se maintient même après disparition de l'antibiotique). Le composant PII est lui-
même un mélange de deux molécules : la PIIA, produit final de la voie de biosyn-
thèse, et la PIIB, le précurseur de la PIIA. La conversion de PIIB en PIIA est obtenue
par oxydation d'un acide aminé, la proline (Fig.). S. pristinaespiralis produit un mé-
lange de ces deux formes dans les proportions de 80 % de PIIA et de 20 % de PIIB.
L'un des composants de la forme soluble mise au point par Rhône-Poulenc-Rorer
est obtenu par modification chimique de la PIIA. Cependant, les souches actuelles
de S. pristinaespiralis sont incapables de réaliser la bioconversion totale de PIIB en
PIIA et la modification par génie génétique de cette souche a permis de la réaliser.
Pristinamycine IIB Pristinamycine IIA
FMN reductase
NADH + H
+
+ FMN --------------------------à NAD
+
+ FMNH
2
PII
A
sybthase
PII
B
+ FMNH2 + O2 --------------------------à PII
A
+ FMN + 2H
2
O
Figure VI.4
La pristinamycine produite naturellement par S. pristinaespiralis est constituée
d'un mélange de deux composants, la pristinamycine I et la pristinamycine II. Cette
dernière est elle-même un mélange de deux molécules : la PIIA, produit final de la
voie de biosynthèse, et la PIIB, précurseur de la PIIA. L'un des composants de la
forme soluble est obtenu par oxydation chimique de la PIIB. Les souches de S. pris-
tinaespiralis sont incapables de réaliser naturellement la bioconversion totale de
60
PIIB en PIIA. Industriellement parlant, il était souhaitable d'obtenir uniquement le
composé PIIA.
Afin d’obtenir une composition totalement soluble, les chercheurs ont introduit
dans une souche de S. pristinaespiralis, par génie génétique, les gènes snaA et
snaB de S. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la
conversion de PIIB en PIIA). La souche de S. pristinaespiralis, nouvellement cons-
truite, est capable de réaliser complètement cette conversion et ne synthétise que le
dérivé PIIA. L'idée de base était que la surexpression de gènes snaA et snaB de S.
pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de
PIIB en PIIA) permettrait une conversion totale. Cette surexpression pouvait être
obtenue en réintroduisant ces gènes sous contrôle d'un promoteur fort dans une
souche de S. pristinaespiralis. L'équipe de Rhône-Poulenc-Rorer a isolé et caracté-
risé les gènes en question.
Processus :
1 - Utilisation d’éléments intégratifs originaux de S. ambofaciens, pSAM2, généti-
quement propres aux Actinomycètes. Ces éléments sont appelés intégratifs car ils
portent des gènes qui permettent une intégration très efficace à un site spécifique
dans le chromosome de la bactérie hôte. Dans le vecteur pSAM2, on intégra les
transgènes du S. pristinaespiralis dont on souhaite l’expression. Ce chimère est une
construction stable. L'ADN intégré dans le chromosome grâce à ce type de vecteurs
est très stable et est transmis à toutes les cellules filles.
2 – clonage de deux gènes snaA et snaB sous contrôle d'un promoteur de transcrip-
tion fort (ermE promoter) dans des vecteurs intégratifs dérivés de pSAM2
3 – Introduction de la construction contenant les deux gènes snaA et snaB dans S.
pristinaespiralis.
4 - La souche ainsi construite est stable dans les conditions industrielles et synthé-
tise de la pristinamycine qu’on extrait et qu’on purifie en vue d’une utilisation théra-
peutique.
5 - Ces résultats montrent que les vecteurs employés sont maintenus de façon sta-
ble en l'absence de pression de sélection, et qu'ils permettent d'éviter les problèmes
d'instabilité structurelle ou ségrégationnelle souvent rencontrés avec des vecteurs
réplicatifs chez Streptomyces. Ils montrent également que la quantité de PIIA syn-
thétase était bien le seul facteur limitant la conversion totale de PIIA en PIIB et qu'il
est possible de réaliser cette conversion sans affecter le niveau total de production.
Référence :
- Sezonov G., Blanc V., Bamas-Jacques N., Friedmann A., Pernodet J.-L. et Guérineau M., 1997.
Complete conversion of antibiotic precursor to pristinamycin IIA by overexpression of Streptomyces
pristinaespiralis biosynthetic genes. Nature Biotechnology, 15, 349-353, 1997.
61
VII – PRODUCTION DES ALIMENTS FERMENTÉS PAR DES
MICRO-ORGANISMES TRANSGÉNIQUES
Depuis fort longtemps, l’homme consomme des aliments fermentés comme le
pain, le fromage, le yoghourt et aussi des boissons fermentées comme la bière, le
vin, le cidre, le dolo.
Ces fermentations sont le résultat du métabolisme des bactéries fermentaires
comme, Lactobacillus delbruekii, Lactobacillus heveticus, Lactobacillus casei, Lacto-
bacillus acidophilus, Lactobacillus lactis,Pediococcus acidilacticus et des levures
comme Saccharomyces cerevitiae.
1. La production de fromage
La présure est une enzyme produite par la caillette des veaux qui coupe la
caséine pour provoquer la coagulation du lait. La production du lait caillé constitue
la première étape dans la production du fromage. Il faut beaucoup de présure pour
la fabrication du fromage alors que sa production par les veaux n’est pas suffisante.
En appliquant la technique de l’ADN recombinant aux bactéries lactiques ou
aux levures, on a pu améliorer la qualité des aliments fermentés. Pour cela, on a
cloné le gène de la présure de veau dans un vecteur d’expression qu’est Saccharo-
myces cerevisiae qui produit alors de la présure de levure. On peut également utili-
ser une bactérie lactique en fonction de son métabolisme et de la rentabilité.
2. La production de la bière
Le moût du malt (comme de mil rouge) est un mélange de mono, di, tri poly-
saccharides et de dextrines qui proviennent de l’hydrolyse de l’amidon par les amy-
lases. Saccharomyces cerevisiae peut faire fermenter tous les polysaccharides sauf
les dextrines qui constituent cependant 22% des hydrates de carbone des céréales
utilisées (orge, seigle, riz, maïs, mil…) pour la production de la bière. Pour améliorer
le goût et la limpidité de la bière, on peut procéder comme suit :
Amélioration du goût de la bière : Saccharomyces diastaticus possède des
enzymes qui dégradent les dextrines pour donner du glucose fermentescible. C’est
le gène DEX qui code pour l’amidon-q-1,4-glucosidase. Ce gène est cloné dans
Saccharomyces cerevisiae pour augmenter la teneur en glucose et donc en éthanol
par fermentation. Le goût de la bière se trouve ainsi amélioré.
Amélioration du goût et de la limpidité de la bière : Aspergillus abwamori
est un champignon qui produit une enzyme : « la glucoamylase » qui dégrade
l’amidon brut en glucose. En clonant les deux gènes responsables de la formation
de ces enzymes dans Saccharomyces cerevisiae on améliore et le goût par
l’hydrolyse de l’amidon et la limpidité de la bière par l’hydrolyse des protéines.
62
CHAPITRE VII: LE GENIE GENETIQUE APPLIQUE AUX VEGETAUX
Les plantes transgéniques
L’avènement de la technologie de l’ADN recombinant a introduit une dimen-
sion nouvelle dans la recherche, parce qu’elle permet désormais de modifier le gé-
nome presque à volonté. L’amélioration n’est plus limitée à la sélection de variants
au sein d’une espèce par la génétique classique. Il est alors possible d’introduire
dans le génome d’une plante de l’ADN provenant d’autres espèces végétales,
d’animaux ou même de bactéries. Le plasmide Ti constitue l’exemple classique pour
les études des plantes transgéniques. Figure VII.1 : Plasmide Ti
I . LE PLASMIDE TI:
1- Définition et action du plasmide Ti dans la nature :
Le plasmide Ti (Tumor Inducing) dérive d’une bactérie du sol appelée Agro-
bacterium tumefaciens. Cette bactérie provoque chez les plantes qu’elle infecte une
maladie du nom de « gale » du collet.
Figure VII.2: Infection par l’agrobacterium tumefaciens.
Les plantes infectées présentent des lésions constituées de cellules dont la
croissance est incontrôlée (des tumeurs ou gales), généralement localisées à la
base (ou collet) de la plante. La production de la tumeur est déterminée par un
grand plasmide circulaire de 200 kb présent dans la bactérie, le plasmide Ti. Lors-
que le plasmide Ti est inséré dans l’ADN chromosomique de la plante, une partie de
son ADN appelé « ADN-T » inséré dirige alors la synthèse d’hormones végétales
qui perturbent la régulation de la croissance des cellules infectées de la plante (ce
qui donne lieu à la formation d’une tumeur) ainsi que la synthèse de nopaline qui
peut être utilisée comme source de carbone et d’azote par la bactérie (symbiose).
Lors de l’infection, la partie du plasmide, appelée « ADN-T », est transférée
dans la plante et insérée au hasard dans le génome cellulaire. La séquence ADN-T
contient:
> des gènes qui codent pour des hormones de croissance végétales et sont
responsables de la tumorisation des cellules de la plante,
> des gènes qui codent pour des enzymes qui conduisent les cellules tumo-
rales à synthétiser des substances appelées opines (nopaline et octopine).
Les gènes qui contrôlent la synthèse des hormones et des opines (nos, ocs)
sont exprimés dans la plante à partir de séquences régulatrices eucaryotes. Par
contre, ceux qui contrôlent la synthèse des enzymes de dégradation des opines
(noc, occ) se trouvent dans la bactérie sous le contrôle de séquences régulatrices
procaryotiques.
Figure VII.3: Processus d’Infection
63
2. Utilisation du plasmide Ti comme vecteur en génie génétique.
En principe, tout fragment d’ADN cloné au sein de l’ADN-T peut comme lui
s’insérer de façon stable dans le génome de la plante qui le reçoit. Le plasmide Ti
est très grand pour les manipulations. Il faut donc construire des dérivés plus petits
qui contiennent l’essentiel de l’ADN-T et l’ADN d’intérêt. On peut construire un plas-
mide intermédiaire par le processus suivant :
Un vecteur intermédiaire qui contient:
• deux segments d’ADN-T qui portent les fragments L et R de la nopaline,
• un marqueur de sélection bactérien de résistance à la spectinomycine
(spc
R
)
• un marqueur de sélection bactérien de résistance à la kanamycine (kan
R
).
• ce vecteur intermédiaire doit posséder des sites de restriction pour l’étude
de l’ADN cloné. (CF Photocopies)
Construire un vecteur Ti désarmé:
• on retire toute la région droite de l’ADN-T, y compris les gènes inducteurs
de tumeurs qui constituent l’aspect gênant de l’ADN-T.
• Ti désarmé conserve l’extrémité gauche (L) de l’ADN-T qui servira de site
de recombinaison pour l’intégration du vecteur intermédiaire.
Les bactéries qui contiennent le plasmide co-intégrat (qui est le résultat de
la fusion du plasmide désarmé et du vecteur intermédiaire), peuvent être utili-
sées pour inoculer des fragments du tissu végétal comme par exemple de petits dis-
ques de feuille.
Si l’infection par la bactérie réussit, son ADN-T sera transféré aux cellules
végétales et tout l’ADN localisé entre les extrémités droite et gauche de l’ADN-T
s’intégrera dans un chromosome de la plante.
Si on place les disques de feuilles sur un milieu nutritif qui contient de la ka-
namycine, seules les cellules qui contiennent l’ADN-T, pourront se multiplier.
La croissance de ces cellules donne lieu à la formation d’un petit amas ou cal,
qui constitue la preuve que les cellules de plantes ont été transformées. Ces cals
peuvent donner des radicelles et fournir par la suite, des plantes transgéniques.
Figure VII.4: Génération de disques de feuilles
3. Expression de l’ADN intégré.
Qu’en est-il de l’expression de l’ADN intégré en même temps que l’ADN-T? Il
peut s’agir de n’importe quel ADN dont on veut tester l’expression dans la plante
prise comme hôte. Dans tous les cas, il faut utiliser un gène d’expression « gène
indicateur » dans le vecteur pour suivre la manifestation de l’ADN intégré. Un cer-
tain nombre de ces gènes indicateurs sont utilisés actuellement avec succès :
64
> L’enzyme luciférase catalyse la réaction d’une substance appelée lucifé-
rine avec ATP. Cette réaction s’accompagne d’une émission de lumière et c’est ce
qui explique la luminescence de la luciole en vol.
> Une plante de tabac transgénique par exemple qui exprime le gène de la
luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de lucifé-
rine.
> Le gène de la luciférase peut donc être utilisé comme indicateur pour étu-
dier, au cours du développement, la régulation de l’expression de l’un ou l’autre
gène de la plante ou de l’ADN intégré.
Le processus est le suivant:
• On fusionne les séquences régulatrices localisées en amont de n’importe
quel gène intéressant au gène de structure de la luciférase,
• La construction est introduite dans une plante en utilisant l’ADN-T.
• L’expression de la luciférase suivra le schéma d’expression du gène dont on
a utilisé la séquence régulatrice.
• L’expression de la luciférase est alors observable en badigeonnant la plante
avec de la luciférine et en observant la luminescence.
Autres indicateurs utilisés dans les plantes:
• Le gène bactérien « gus » qui code pour la β-glucuronidase. Cette enzyme
produit une coloration bleue par hydrolyse du substrat X-gluc.
• Le gène bactérien « lacZ » qui code pour la β-galactosidase. Cette enzyme
produit une coloration bleue par hydrolyse du composé X-gal.
II – LE TERMINATOR CHEZ LES SEMENCES
Le concept Terminator, auquel correspond un brevet détenu par la compagnie
Monsanto, désigne une technique consistant à introduire un transgène, un gène
exogène tueur qui empêche le développement du germe du grain récolté: la plante
se développe dans les conditions habituelles, donne une récolte normale, mais elle
produit un grain biologiquement stérile.
La technologie fonctionne avec trois gènes et un inducteur chimique:
- Le gène I est un répresseur qui code pour une protéine régulatrice qui se fixe
sur un site opérateur en amont des gènes de structure et inhibe leur trans-
cription. La protéine régulatrice du gène I se fixe sur le « binding site » du
gène II
Gène répresseur
GENE I :
Protéine régulatrice
Répresseur
- Le gène II de l’enzyme recombinase est placé sous le contrôle d’un promo-
teur. Entre le Promoteur et le gène de la recombinase se trouve le « binding
site ». Le gène II produit une enzyme de restriction qui coupe et excise l’ADN
« blocker » du gène III.
Promoteur Binding site gène codant l’enzyme
65
GENE II :
- Le gène III produit une toxine qui est létale pour l’embryon. Ce gène est sous
le contrôle d’un promoteur tardif qui est activé seulement durant le dévelop-
pement de la graine, lors de la croissance de l’embryon. Entre le promoteur
tardif et le gène III se trouve l’ADN « blocker » qui favorise, s’il est excisé, la
transcription et l’expression du gène toxine, produisant la toxine qui tue
l’embryon rendant ainsi stérile les nouvelles semences pour la reproduction.
GENE III :
Promoteur tardif blocker gène de la toxine
- L’inducteur chimique est répandu sur les semis par les compagnies de se-
mences comme Monsanto et Syngeta afin d’activer le gènes II et le gène III.
Une fois ces gènes activés dans ces semences, nous pouvons avoir la pro-
duction mais pas le reproduction.
Processus d’activation du gène terminator dans les semences de vente aux agri-
culteurs :
1 – Introduction de l’inducteur (par exemple du tétracycline) dans les semences,
2 – L’inducteur bloque le « binding site » au niveau du gène II et empêche le
répresseur de se lier,
3 – L’ARN polymérase se lie au promoteur et entame la transcription du gène de
la recombinase
(isomérase) en ARN à synthèse de l’enzyme recombinase.
4 – La recombinase taille et excise la séquence « blocker »,
5 – L’ARN polymérase se lie au « late promoteur » et transcrit le gène de la toxine,
à synthèse de la toxine qui tue les embryons des graines avant les récoltes.
(Schéma) :
66
Inducteur
Graine
Gène répresseur
GENE I :
Protéine régulatrice
Le répresseur se délie
Promoteur gène codant l’enzyme recombinase
GENE II :
Binding site
Synthèse de l’enzyme recombinase
gène de la toxine
GENE III :
Promoteur tardif
blocker
Synthèse de la toxine qui tue l’embryon
Figure VII.5 : Processus d’activation du Terminator
NB. En absence de l’inducteur, le répresseur se lie au « binding site » et empeche la
transcription du gène de la recombinase. Dans ce cas tout est bloqué car il n’y a pas
de recombinase pour exciser la séquence « blocker » et par conséquent, il n’y a pas
de toxine qui puisse tuer les embryons des semences.
67
GENE I :
Protéine régulatrice
Répresseur
Promoteur gène codant l’enzyme recombinase
GENE II :
Binding site
Pas de synthèse de l’enzyme recombinase
gène de la toxine
GENE III :
Promoteur tardif
blocker Pas de production de la toxine
Figure VII.6 : En absence de l’inducteur, le gène codant pour la recombinase
ne transcrit pas.
68
III . L’APPLICATION DU GÉNIE GÉNÉTIQUE À L’AGRICULTURE:
Les applications sont et deviendront de plus en plus nombreuses en fonction
de l’évolution des connaissances des caractéristiques génétiques des plantes et des
réserves humaines contre les OGM. La problématique des OGM est que le gène
TERMINATOR inséré, à travers les techniques du génie génétique, dans le génome
de ces végétaux fait que leurs graines ont seulement une capacité de production et
non de reproduction. L’agriculteur doit toujours dépendre de ces maisons de fabrica-
tion des semences qui ont le brevet. Nous en donnons quelques exemples qui fonc-
tionnent déjà dans ce siècle.
1: L’enzyme luciférase :
L’enzyme luciférase catalyse la réaction de la luciférine avec l’ATP. La réac-
tion s’accompagne d’une émission de lumière et c’est ce qui explique la lumines-
cence de la luciole en vol (la luciole produit cette enzyme d’où son nom). Cette en-
zyme est actuellement utilisée pour suivre la régulation et le génotype du tabac.
Une plante de tabac transgénique qui exprime donc le gène de la luciférase
s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine.
Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier,
au cours du développement, la régulation de l’expression de l’un ou l’autre gène de
la plante ou de l’ADN intégré.
2. Le maïs transgénique
Chaque année les agriculteurs du monde entier perdent 1/10 de leurs récol-
tes de maïs à cause des insectes nuisibles. Le maïs transgénique contient dans son
génome un gène qui code pour une protéine que détestent les insectes et qui en
principe ne doit pas causer de nuisances à l’homme. Cette variété augmente donc le
rendement en éliminant le facteur insecte.
3. Les tomates « flavrsavr »
Ces tomates transgéniques contiennent un gène freinant le mûrissement du
fruit, ce qui leur confère une meilleure résistance au transport et une longue conser-
vation.
Désormais avec l’avènement du génie génétique, non seulement la qualité
des espèces animales et végétales peut être améliorée, mais ces organismes trans-
géniques sont utilisés comme des usines pour produire des protéines « utiles » co-
dées par des gènes d’organismes étrangers.
4. La protection des plantes contre l’infection virale
69
Les virus des plantes représentent un sérieux problème pour l’agriculture car
leurs infections entraînent une diminution de la croissance des plants, du rendement
des récoltes et de leur qualité. Le virus de la mosaïque du tabac (TMV) infecte les
plants de tabac. Une plante transgénique qui exprime la protéine du manteau (coat
Protein : CP) du TMV résiste aux infections par ce virus. La plante transgénique est
déjà produite aux Etats-Unis.
Figure VII.7: production de la protéine CP
5. Lutte contre les insectes ravageurs
Chaque année des milliards de dollars de récoltes sont perdues à cause des
insectes. Les armes les plus utilisées pour lutter contre les insectes sont « les in-
secticides et les pesticides » qui posent actuellement de graves problèmes de
pollution à l’environnement.
_ Le Baccilus thuringensis (Bt), lors de sa sporulation, produit une protéine
cristallisée toxique contre les larves d’un certain nombre d’insectes ravageurs des
cultures et qui ne semble pas être nocive pour les vertébrés. Les plants transgéni-
ques de tabac, de tomates et de coton qui expriment le gène de cette toxine résis-
tent aux larves des insectes.
_ L’utilisation de l’expression transgénique d’inhibiteurs de sérines protéases
des systèmes digestifs des insectes dans les tomates, la pomme de terre, le petit
pois et autres céréales protègent aussi les plantes contre les insectes nuisibles.
Figure VII.8: production de la protéine Bt
6. Eradication des mauvaises herbes et plantes transgéniques tolérantes aux
herbicides
Le glyphosate est la substance active de l’herbicide commercial « Roundup »
beaucoup utilisé à l’heure actuelle. Ce produit tue les plantes en inhibant la 5-
énolpyruvylshikimate-3-phosphate synthétase (EPSPS), une enzyme du chloro-
plaste qui intervient dans la biosynthèse des acides aminés essentiels. Une plante
transgénique qui porte un gène de résistance au glyphosate pousse quatre (4) fois
plus vite en présence de cet herbicide. L’Insertion réussie du gène bactérien de la
résistance au glyphosate a conféré à la plante transgénique une résistance à
l’herbicide et lui permet de survivre à des épandages normaux de glyphosate.
Figure VII.9: résistance aux herbicides
7. Production d’ammoniac (NH
4
) et de nitrate (HNO
3
) par les plantes
Les plantes courantes ne sont pas capables d’assimiler directement l’azote
moléculaire (N
2
). Les paysans américains et européens dépensent chaque année un
peu plus de huit cents milliards des francs CFA pour la fertilisation de leurs champs
par un épandage d’engrais composé essentiellement de sel d’ammonium (NPK). On
peut donc fabriquer des plantes transgéniques capables d’utiliser directement
l’azote moléculaire par le processus théorique suivant :
70
Le gène nif (nitrogen-fixation apparatus) permet à la bactérie Rhizobium des
légumineuse de fixer directement l’azote moléculaire pour donner des sels
d’ammonium (Nitrate, Nitrite, Ammonium). Ce sera le gène d’intérêt.
Le gène nif est inséré dans le plasmide Ti de la bactérie Agrobacterium tume-
faciens
La plante d’intérêt est alors transformée par ce plasmide
Les cellules tumorales de la plante transformée sont prélevées et cultivées in
vitro puis transférées sur différents terrains sous serre.
Les plants capables de pousser rapidement sans un apport d’engrais sont
ceux capables de fixer l’azote moléculaire
Un gène marqueur permet de sélectionner les plants ayant intégré le plas-
mide avec le gène nif.
8. Production d’anticorps monoclonaux par les plantes
Les plantes peuvent aussi servir de bio-réacteurs pour la production
d’anticorps. Cet aspect représente un intérêt commercial pour la production de pro-
téines parmi lesquelles les anticorps monoclonaux. L’expérience réussie a utilisé
une chaîne lourde (H) et une chaîne légère (L) dans deux expériences séparées
pour transférer les gènes des anticorps par l’intermédiaire de l’ADN-T dans deux
plants de tabac. Les plantes transgéniques contenant les gènes des chaînes lourde
et légère ont été croisées afin de produire une descendance contenant les deux gè-
nes. Les feuilles de ces plantes produisent l’anticorps monoclonal inséré (environ
1,5% des protéines traduites).
Figure VII.10: Production d’anticorps monoclonaux
9. La production de la taumatine
La taumatine est un aliment très sucré et même plus doux que le saccharose.
elle est produite par une plante : « Thaumatococcus danielli » qui pousse en Afrique
occidentale. Ce peptide, composé de 207 acides aminés constitue une source im-
portante pour l’apport en acides aminés dans l’alimentation en plus de sa saveur.
Elle est actuellement produite par des bactéries suivant le protocole ci-après :
Il a été construit une molécule chimère ayant des séquences des plasmides
pCI62-8, pBS42, pCI72 et qui porte le gène « tau ».
Cette construction chimère est utilisée pour transformer Bacillus subtilis.
Bacillus subtilis transformé synthétise la taumatine.
Une extraction, suivie d’une purification donne de la taumatine pure
71
CHAPITRE VIII: LE GENIE GENETIQUE APPLIQUE AUX ANIMAUX
I - LES INSECTES TRANSGÉNIQUES
1. Les drosophiles transgéniques.
Dans la drosophile, on a trouvé trois catégories de séquences d’ADN qui ont
la faculté de se transposer, c’est à dire de se déplacer dans le génome d’un chro-
mosome à l’autre. Ce sont des transposons. Les mieux étudiés sont :
• les éléments du type copia : Il existe au moins sept (7) familles d’éléments
de type copia dont la longueur varie de 5 à 8,5 kb. Les membres de ces différentes
familles sont au nombre de 10 à 100 exemplaires par génome. Les éléments de type
copia contiennent deux longues séquences terminales en répétition directe et de
courtes séquences répétées de manière inverse et imparfaite.
• les éléments à rabat ou type FB (pour fold-back) : Ces éléments sont
longs de quelque centaines à quelques milliers de paires de bases. Ils contiennent
tous de longues extrémités en répétition inverse. L’élément peut se rabattre sur lui-
même lors des expériences de renaturation thermique d’ou son nom de rabat. Ce
type d’élément provoque des réarrangements chromosomiques lors de son insertion
et de son excision.
• les éléments P : D’une longueur égale à environ 2,90 kb, Ils portent à leurs
extrémités une séquence répétée inversée de 31 paires de bases. La partie centrale
possède trois cadres ouverts de lecture et peut coder pour au moins trois protéines
dont la transposase et le répresseur de la transposase.
â Les éléments P permettent d’avoir des drosophiles transgéniques
Les éléments P sont des transposons qui sont capables de changer de locali-
sation dans le génome. L’élément P peut donc être facilement utilisé en génie géné-
tique. Ils codent pour une enzyme nommé « transposase », responsable des dépla-
cements de cet ADN dans tout le génome. Ils peuvent donc être utilisés pour :
• effectuer des mutagenèses,
• transférer des gènes spécifiques dans des mouches d’un génotype donné.
Le processus suivant permet d’étudier la génétique moléculaire des mouches
72
a - On injecte dans un embryon de drosophile l’ADN d’un plasmide bactérien
qui contient un élément P dans lequel on a cloné un gène ry
+
de la drosophile (ce
gène donne la coloration rose de l’oil) mais ayant subi une délétion partielle. Cet
élément P modifié ne peut plus se transposer à cause de la délétion.
b - On injecte dans le même embryon (co-injection) de l’ADN qui contient
l’élément P normal qui pourra fournir la « transposase » à la copie du transposon P
contenant la délétion.
Les mouches issues de cet embryon ont toujours le phénotype ry
-
, mais dans
leur descendance, on retrouve une grande proportion d’individu ry
+
. Le gène ry
+
nouvellement acquis montre une hérédité mendélienne et stable, ce qui suggère
qu’il est bien localisé sur un chromosome. L’hybridation in situ montre que le gène
ry
+
(P modifié) et l’élément P normal se retrouvent en différentes positions sur diffé-
rents chromosomes et non à la position normale du locus rosy. Le transposon nor-
mal P a donc fourni la transposase pour permettre l’insertion du transposon anormal
contenant le gène ry
+
.
2. Bio-insecticide et lutte contre le paludisme
En 1976, un entomologiste israélien remarqua une grande quantité de larves
d’insectes mortes dans le désert de Negev au demeurant très infesté par les mousti-
ques et les mouches responsables de deux grands fléaux. Après une étude appro-
fondie au laboratoire, il s’aperçut que les bactéries du genre Bacillus thuringiensis
subsp. israelensis présentes dans les lacs de ce désert tuaient systématiquement
les larves des moustiques et des mouches. A partir de cette découverte, une nou-
velle stratégie de lutte contre l’anophèle et la glossine vecteurs du plasmodium et du
trypanosome a débuté en utilisant la stratégie suivante :
Une production de bio-insecticides par Bacillus thuringiensis capables de tuer
les larves des mouches et des moustiques
Une utilisation des moyens de transport aérien (hélicoptères) pour la pulvéri-
sation de ces bio-insecticides au niveau des fleuves et des plans d’eau infestés par
ces insectes vecteurs.
II - LES ANIMAUX TRANSGÉNIQUES :
1. Les souris transgéniques
Figure. VIII.1
On peut actuellement insérer n’importe quel gène dans la souris afin d’obtenir
l’expression génique de ce transgène. Dans cette transgenèse, la souris qui intègre
par exemple le gène de l’hormone de croissance humaine (GH) acquiert une masse
énorme double ou triple par rapport à ses sours jumelles. Ce type de démarche
peut être appliqué à tous les mammifères pour accroître leur rendement en poids et
donc en intérêt économique.
73
Les organismes transgéniques peuvent être produits par l’injection de vec-
teurs dans des oufs fécondés et réimplantés dans les femelles. Au cours de
l’embryogenèse l’ADN exogène se fraie son chemin jusqu’aux cellules germinales et
se comporte désormais comme un gène endogène. Il passe donc à la descendance
comme un gène nucléaire normal.
On peut aussi transférer l’embryon possédant le transgène dans l’utérus
d’une souris saine pseudo-gestante. La souris qui sera mise bas portera les caractè-
res du transgène mais pas les autres sours.
2. Les bovins transgéniques
La trypanosomiase est causée par un protozoaire parasite qui est transmis
par un insecte vecteur « la glossine hématophage » ou encore « mouche tsé-tsé ».
Le trypanosome empêche la majeure partie des races bovines d’habiter une superfi-
cie de près de dix millions de Km
2
en Afrique. Cette zone qui est la plus fertile du
continent est plus vaste que les Etats-Unis d’Amérique. Le trypanosome possède
des antigènes de surfaces VSGs (glycoprotéines superficielles variables) dont les
gènes mutent à chaque phase de son développement. C’est pour cette raison que
les bovins n’arrivent pas à élaborer des anticorps contre ces types d’antigènes qui
changent constamment de conformation tridimensionnelle par mutation génétique du
protozoaire. (Colonisation du milieu ou Evolution ?).
> Lorsque la mouche tsé-tsé inocule le trypanosome dans un bovin,
l’organisme de ce dernier réagit et synthétise les premiers anticorps pouvant réagir
avec les antigènes présents sur la membrane du trypanosome (VSGs).
> Lorsque le système immunitaire du bovin est en mesure d’éliminer totale-
ment les trypanosomes, les dernières cellules qui survivent changent leurs man-
teaux protéiques antigéniques et se transforment en un second type de parasite.
> L’organisme du bovin se prépare alors de nouveau pour combattre le nou-
veau parasite en secrétant de nouveaux anticorps. Mais dès que le parasite
s’aperçoit qu’il est en train d’être totalement exterminé, il se transforme de nouveau
en un second parasite.
> De cette manière, le trypanosome échappe à la défense immunitaire de
son hôte par des mutations et recombinaisons successives.
Beaucoup d’études récentes ont montré que certaines races bovines résistent
bien à l’infection par le trypanosome. Ce type de résistance, appelée « trypano-
tolérance », se rencontre dans les populations bovines d’espèce Bos taurus, locali-
sée en Afrique occidentale. La race N’Dama, caractérisée par de longues cornes et
une absence de bosse en est un exemple.
Ce type de bovin domestique et d’autres animaux sauvages comme le « buf-
fle » qui ont vécu en Afrique depuis plus de 5 000 ans a.C. ont développé des résis-
tances contre les attaques du trypanosome et sont par conséquent adaptés au mi-
lieu infesté par le parasite.
74
L’espèce bovine comme Bos indicus qui est actuellement très répandue en
Afrique, est arrivée dans ce continent avec l’invasion arabe vers les années 660 p.C.
Elle n’est pas « trypano-résistante »
Cependant, l’économie de plusieurs pays africains est actuellement fondée
sur l’élevage de ces bovins qui ne sont plus trypano-tolérants. Pour leur conférer
cette résistance, on peut employer deux stratégies :
Stratégie I. :
> Identifier le gène qui confère la résistance aux trypanosomes chez les bo-
vins de la race D’Dama
> Cloner ce gène dans un vecteur
> Transférer le vecteur dans des cellules bovines de l’espèce Bos indicus
pour leur conférer la trypano-tolérance.
Stratégie II :
> Importer des embryons de la race N’Dama trypano-tolérante
> Les implanter dans les utérus de femelles de la race Bos indicus sensible à
l’infection
> Réaliser ensuite des croisements des descendances pour disséminer les
gènes de tolérance.
3. Les moutons transgéniques.
On peut manipuler les animaux domestiques non seulement pour améliorer
leurs qualités intrinsèques mais aussi pour produire des protéines étrangères.
Une protéine dont les propriétés thérapeutiques intéressent l’industrie phar-
maceutique est produite dans le lait de moutons transgéniques. Le gène en question
code pour l’activateur tissulaire du plasminogène qui sert à dissoudre les caillots
sanguins chez l’être humain.
Figure VIII.2: Production du plasminogène
La démarche technologique utilisée et réussie est la suivante :
1 - On a placé le gène dans un plasmide, sous le contrôle du promoteur de la
β-lactoglobuline, qui n’est exprimée que dans les tissus mammaires.
2 - Le vecteur d’expression est micro-injecté dans le pronoyau des ovules de
mouton.
3 - Les ovules injectés sont implantées dans des mères porteuses.
4 - Les descendances qui expriment le transgène sont identifiés par amplifica-
tion PCR d’un segment d’ADN chromosomique en utilisant des amorces correspon-
dants à des séquence interne du gène d’intérêt.
5 - Les moutons transgéniques n’expriment ce gène que dans leurs tissus
mammaires et sécrètent alors des quantités importantes de la protéine correspon-
dante dans leur lait à partir duquel la protéine d’intérêt est purifiée.
4 – Le porc transgénique
75
Pour pallier le manque d'organes: xénotransplantation avec le porc.
Le problème majeur qui empêche la réalisation des xénogreffes d'organes aujour-
d'hui est l'existence du rejet hyper aigu qui survient entre les espèces animales phy-
logéniquement distantes. En effet, il serait tout à fait possible de réaliser des xéno-
greffes d'organes à partir de primates supérieurs (chimpanzés) mais cette possibilité
semble peu réalisable car ces espèces animales sont protégées et représentent une
source incontrôlable de transmission de virus à l'homme (Ebola, SIV…) La protéine
DAF (Decay Accelerating Factor) neutralise le complément des primates et favorise
les greffes d’organes.Tandis que dans les greffes allogéniques on utilise surtout
les médicaments immunosuppresseurs comme la cyclosporine pour lutter contre le
phénomène de rejet.
Figure VIII.3 : LE PORC TRANSGéNIQUE.
76
CHAPITRE IX:
CLONAGE DES MAMMIFÈRES, PARTHÉNOGENÈSE, CELLULES SOUCHES
EMBRYONNAIRES (EMBRYONIC STEM CELLS) ET THÉRAPIE GÉNIQUE.
I. - LE CLONAGE DES ORGANISMES ENTIERS:
Un clone de mammifère est une copie génétique d'un organisme entier. Dolly
(première brebis clonée en Angleterre), est un clone de sa mère, ou de ses gènes.
Comme les brebis, les hommes vont-ils eux aussi passer à la "photocopieuse
La technique du clonage est relativement simple dans son principe. Dans le
cas de la brebis Dolly, on a prélevé une cellule dans le pis d'une brebis de race Finn
Set à face blanche. On a prélevé également un ovule sur une autre brebis et on lui a
enlevé le noyau qui contient le bagage génétique. Pourquoi un ovule? Pour qu'il de-
vienne éventuellement un embryon. À l'aide d'un choc électrique, on a fusionné in
vitro la cellule du pis qui contient tous ses gènes et l'ovule vidée de tout matériel
héréditaire.
C'est la raison pour laquelle Dolly n'aura pour tout bagage génétique que ce-
lui que contenait la cellule du pis. L'ovule ainsi " électrisé " se divise et le processus
de vie s'enclenche. Après s'être divisée un nombre suffisant de fois, l'embryon
(stade blastula) est placée dans l'utérus d'une brebis porteuse. Dolly est née de
cette technique, identique en tous points à la brebis qui a fourni la cellule du pis.
Le processus du clonage d'un organisme entier est simple:
a - On prend une cellule ouf et on la vide de son noyau.
b - On prélève le noyau d'une cellule que l’on veut cloner et on le met dans
l'ouf privé du noyau
c - implantation dans l’utérus d’une porteuse
d - L’organisme qui naît porte les caractères du noyau transféré donc de
l’organisme cloné. Cependant certains caractères de l’ouf restent présents à cause
du matériel génétique contenu dans les mitochondries.
Figure IX. 1 : Clonage de Dolly
77
II. LES CELLULES ES (EMBRIONIC STEM CELLS)
OU CELLULES EMBRYONNAIRES PLURIPOTENTES).
Le 6 novembre 1998, le New York Times titrait : « Des scientifiques isolent les cellu-
les à lorigine de la vie ». En effet, en fin 1998, deux équipes de recherches différentes
découvraient presque simultanément avec des méthodes distinctes les cellules souches
embryonnaires, « Embryonic Stem » (ES). L’une travaillait sur des blastocystes des
embryons précoces de moins de sept jours () et l’autre équipe sur des cellules germina-
les primitives ovogonies et spermatogonies (). Chacune de ces cellules ES a la potentiali-
té de devenir n'importe quel tissu du corps humain: cour, muscles, sang, os, cheveux,
nerfs (). D'où leur mystère, leur importance biomédicale et la fascination des biologistes.
Ce sera une technique de photocopie magique pour reproduire un individu à volonté et
en plus, ce système offrira un fond inestimable de pièces de rechange d’organes
humains !
A – Qu’est-ce qu’une cellule souche ?
Une cellule souche est une cellule indifférenciée qui reste capable de se divi-
ser de façon autonome tout au long de la vie, assurant le renouvellement des cellu-
les d’un individu. La division d’une cellule souche produit deux nouvelles cellules :
une cellule souche de « réserve » et une cellule s’engageant dans un processus de
différenciation qui la conduira à remplir une fonction précise.
Tous les êtres vivants pluricellulaires possèdent des cellules souches. Elles
sont à l’origine de tous les tissus et en assurent le renouvellement (remplacement
des cellules disparaissant par vieillissement ou par lésion). Les cellules souches
sont à l’origine de la régénération des membres chez certains animaux (lézards, tri-
tons, etc.). Chez les plantes, elles favorisent le processus du bouturage. Ainsi à
partir d’une seule cellule peut être créée une plante entière.
Nous distinguons quatre catégories de cellules souches en fonction de la diversité
des types cellulaires auxquels elles peuvent donner naissance :
1 - Les cellules souches totipotentes : A elles seules, elles peuvent conduire au
développement d’un être humain. Il s’agit de l’ouf fécondé et des cellules de
l’embryon des premiers jours de sa croissance (morula de 2 à 8 cellules). Avant le
septième jour, cet embryon qui est un blastocyste a au plus 8 blastomères. Il est dé-
jà composé de trois parties : le trophoblaste constitué de blastomères périphériques
(grosses cellules résultant des premières divisions de l’ouf fécondé), la masse cel-
lulaire interne (MCI) constituée d’autres blastomères plus centraux, et le blastocèle
qui est une grande cavité remplie de liquide à l’intérieur de l’embryon. Le tropho-
blaste et la masse cellulaire interne donneront respectivement : le placenta et
l’ensemble de l’embryon. Quant au blastocèle, il est appelé à régresser lors de
l’embryogenèse par l’agrandissement de la cavité amniotique de l’embryon. Spéci-
fions que c’est au stade de cellules souches totipotentes que l’on peut pratiquer le
clonage reproductif par scission embryonnaire.
78
2 - Les cellules souches pluripotentes : Précisons tout de suite quelque chose
d’absolument essentiel qui doit être en permanence dans l’esprit : les cellules sou-
ches pluripotentes qui constituent la masse interne sont destinées à former tous les
tissus de l’organisme mais ne peuvent à elles seules aboutir à la formation d’un indi-
vidu complet car elles ont perdu, à ce stade, la faculté de produire le trophoblaste,
précurseur du placenta. Le placenta a pour fonction de nourrir l’embryon et de le
protéger de tout rejet par le système immunitaire. Les cellules de la masse cellulaire
interne, bien que pouvant donner toutes les cellules de l’organisme, sont incapa-
bles, si on les réimplante dans un utérus, de donner un embryon puis un fotus. Cer-
tes, ces cellules pluripotentes ne peuvent pas évoluer pour former une person-
nes mais de multiples questions se posent : comment peut-on les obtenir tout en
respectant les règles d’éthique ? Peut-on les utiliser dans les recherches du clonage
thérapeutique ?
3 - Les cellules souches multipotentes : Elles sont des cellules souches capables
de donner naissance à un ou plusieurs groupes de cellules ayant une fonction par-
ticulière. Par exemple, les cellules souches présentes dans la moelle osseuse pro-
duisent les globules rouges, les globules blancs et les plaquettes. Elles jouent un
rôle essentiel en assurant le renouvellement des cellules. Elles sont appelées aussi
cellules souches adultes ou cellules souches somatiques. Les cellules souches
adultes peuvent être extraites de la plupart des tissus, y compris du cerveau et de la
moelle épinière. Cependant, elles sont rares et par conséquent très difficiles à
identifier (une cellule souche pour dix ou quinze mille autres cellules dans la moelle
osseuse. La moelle osseuse et le sang du cordon ombilical sont particulièrement
riches en cellules souches adultes. Les cellules souches du sang de cordon
ombilical peuvent être prélevées à la naissance et conservées pour un usage
ultérieur (un tel service est proposé par certaines fondations aux Etats-Unis). Les
cellules souches issues de la moelle ou du cordon peuvent être utilisées pour une
thérapie cellulaire bénéficiant à l’individu ou à ses frères et sours.
4 - Les cellules souches unipotentes : elles ne donnent qu’un seul type de cellu-
les différenciées (peau, foie, muqueuse intestinale, testicule…). Dans certains orga-
nes, tels que le cour et le pancréas, les chercheurs n’ont pas encore découvert de
cellules souches ; par conséquent ils pensent que ces organes n’ont aucune possi-
bilité de régénération en cas de lésion.
B – Recherche sur les cellules souches et l’embryon ?
1 – Les processus génétiques de l’embryogenèse de la fécondation au clivage.
Nous avons choisi délibérément la section fécondation-clivage pour étudier
sommairement les régulations génétiques car c’est à ce stade que nous avons les
différentes manipulations des cellules souches embryonnaires.
Le développement embryonnaire des métazoaires est classiquement subdivi-
sé en quatre phases, essentiellement définies suivant des critères morphologiques :
la fécondation, la segmentation (clivage), la gastrulation et l’organogenèse. On en-
tend par gène de développement ceux qui interviennent précocement au cours du
développement embryonnaire et sont responsables de l’établissement des polarités
(antéro-postérieure, dorso-ventrale) de l’embryon, de la mise en place du plan de
79
base du corps et de la spécification des cellules et des territoires devant donner les
différents organes.
A l’échelle de la cellule, il existe différents niveaux de contrôle du développe-
ment : prolifération cellulaire, migrations, engagement dans une voie de différencia-
tion. Le développement embryonnaire étant un processus continu et progressif, les
différents gènes impliqués ne peuvent être considérés isolément ; au contraire, leur
séquence spatio-temporelle d’expression est largement hiérarchisée et interdépen-
dante. La multiplication cellulaire, régulée par les oncogènes et les facteurs de
croissance, les migrations cellulaires et l’engagement d’une cellule dans une voie de
différentiation constituent en effet des choix de développement non indépendants.
Ils peuvent par ailleurs être autonomes-cellulaires, c’est-à-dire ne dépendre que de
l’information contenue dans la cellule considérée ou être non autonomes, c’est-à-
dire permis par des interactions avec les cellules voisines.
- Des gènes maternels contrôlent les premières divisions de l'ouf
Les premières divisions de l’ouf fécondé s'effectuent sans que les premiers gènes
zygotiques ne soient exprimés. Cela est parfaitement vérifié chez des espèces infé-
rieures (batraciens). La mise en route du génome embryonnaire s'effectue cepen-
dant à un stade précoce, mais très probablement seulement au stade 8 cellules chez
l'homme. En effet, notons qu'il n'y a pas de régionalisation de l'information dans le
cytoplasme du zygote des mammifères jusqu'au stade 8 cellules, contrairement à
d'autres classes de vertébrés : chaque blastomère peut donc être considéré comme
équivalent aux autres.
L'étude des gènes maternels dans le développement embryonnaire pré-
coce est cependant rendue difficile par la très faible quantité de matériel génétique
disponible. Nos connaissances sont donc encore rudimentaires chez les mammifè-
res, encore plus chez l'homme. La distinction entre une information seulement ap-
portée par des ARNm provenant de l'ovule, et celle qui serait apportée par une
transcription persistant selon un patron transcriptionnel conservant le profil d'ex-
pression maternel, est loin d'être résolu (eu égard à la durée de vie des messagers
de la première hypothèse n'est plausible que chez des espèces où les premiers cli-
vages se font dans un espace de temps excessivement court ; c'est le cas des oeufs
de batraciens. Néanmoins, on sait que la durée de vie des ARNm est beaucoup plus
longue dans l’ouf fécondé).
Chez les mammifères il existe le phénomène de imprinting : les génomes pa-
ternel et maternel apportés par les gamètes ne sont pas transcrits de façon équiva-
lente par le zygote, l’origine paternelle ou maternelle de certains gènes entraîne leur
inactivation. L’analyse d’anomalies de ségrégation chromosomique ou d’expériences
de transplantation de pronucléus montre que cette inactivation est nécessaire à un
développement embryonnaire normal. Elle concerne un nombre relativement res-
treint de gènes, impliqués généralement très précocement au cours du développe-
ment, et pourrait être due à une méthylation différentielle des copies paternelle et
maternelle de ces gènes. La méthylation différentielle semble être le processus per-
mettant l’inactivation transcriptionnelle d’un des chromosomes X chez le mammifère
femelle et rétablissant une dose identique à celle du mâle, des facteurs issus de la
transcription de ce chromosome. Le contrôle de l’initiation et du taux de traduction
des ARNm maternels « dormants » dans l’ovocyte est le principal niveau de régula-
tion d’expression génique aux stades de développement précédant la transcription
zygotique. Ce mécanisme permet de contrôler la production de facteurs impliqués
80
dans l’établissement des polarités et dans la régulation du cycle cellulaire.
Des données récentes attribuent à l'ARN maternel oct-3 un rôle dans la première
division de l’ouf et au PDGF-alpha (platelet-derived growth factor) codé par un ARN
maternel un effet autocrine activateur de la division cellulaire.
Le début de l'expression génique embryonnaire n'est donc effective qu'après le
stade 8 blastomères. Elle est concomitante de l'expression sur la membrane plasmi-
que de Cadhérines E, aboutissant à la mise en place de jonctions inter-cellulaires :
c'est l'initiation de la compaction et des phénomènes de polarisation. Ultérieurement
s'exprimeront dans la morula des cadhérines E (épithéliales) et P (dans le tropho-
blaste, futur Placenta), ce qui contribuera largement à la ségrégation cellulaire entre
embryoblaste et trophoblaste.
De la gastrulation à l’organogenèse, d’autres gènes s’activeront et par consé-
quent de nouvelles protéines seront synthétisées afin d’assurer différents contrôles
génétiques. Ainsi aurons-nous un contrôle génétique de la mise en place des polari-
tés embryonnaires, un contrôle génétique de l’établissement du plan de base de
l’organisme et une acquisition d’une identité positionnelle au sein des différents tis-
sus ou champs d’organisation.
2 – Recherche sur l’embryon et manipulation des cellules souches :
La possibilité de cultiver et de manipuler l'embryon préimplantatoire de mam-
mifère requiert une haute technologie et par conséquent un laboratoire de recherche
bien spécialisé. De nombreuses méthodes sont utilisées en recherche fondamentale
pour étudier l’embryogenèse :
a – le clonage
- Le clonage par transfert de noyau
Transfert du noyau dune cellule dun sujet donné dans un oocyte humain énu-
cléé, suivi d’un développement embryonnaire jusqu’au stade de blastocyste et de
l’utilisation des cellules de la masse cellulaire interne (ICM), en vue d’obtenir les ES
et, à partir d’elles, les cellules différenciées souhaitées. La technique de transfert
nucléaire, dérivée d'expériences menées chez les batraciens dans les années 60
consiste d'abord à retirer la métaphase II et le premier globule polaire d'un ovocyte II
maturé. Ensuite, une cellule diploïde est insérée dans la zone pellucide, à côté de
l'ovocyte énucléé. Un choc électrique est appliqué. Il engendre à la fois la fusion
des deux membranes plasmiques et l'activation de l'ovocyte. Le noyau de la cellule
diploïde se retrouve ainsi au sein du cytoplasme ovocytaire. A ce stade, on parle de
zygote ou d'embryon reconstitué, ou encore d'équivalent d’une cellule. L'embryon
reconstitué entame son clivage et, au stade 8-16 cellules chez le bovin, le noyau
transféré prend le contrôle du développement. Au stade blastocyste, l'embryon est
transféré en mère porteuse. L'affinement de la technique a permis à une équipe
écossaise de produire des agneaux en utilisant le noyau de cellules fotales (fibro-
blastes) et même de cellules mammaires d'une brebis adulte. Ces résultats mon-
trent qu'au moins certains types de cellules conservent intact leur potentiel nucléaire
de différenciation malgré leur état de cellule différenciée. Notons cependant que le
taux de succès est, à l'heure actuelle, inversement proportionnel à l'état de différen-
ciation de la cellule diploïde donneuse de noyau. De plus, l’analyse des télomères
des clones obtenus semble montrer que l’ADN des cellules diploïdes donneuses de
81
noyau n’est pas “ rajeuni ” par le transfert nucléaire. Ceci signifie qu‘un clone serait
constitué de cellules dont l’âge correspond à celui de l’organisme d’origine. La
conséquence serait un vieillissement prématuré de ces clones.
Transfert du noyau dune cellule dun sujet donné vers un oocyte dun autre
animal. Un éventuel succès devrait conduire - comme on le suppose - au dévelop-
pement d’un embryon humain, qu’on pourrait utiliser comme dans le cas précédent.
Reprogrammation du noyau dune cellule dun sujet donné en le fusionnant
avec le cytoplasme des ES, obtenant ainsi les “cybrides”: une telle possibilité est
encore à l’étude. De toute façon, même cette voie semblerait exiger une préparation
préalable des ES d’embryons humains.
- Le clonage par séparation des blastomères
Cette technique fut mise au point pour l'étude de la totipotence de différencia-
tion des blastomères. Le zygote est, par définition, une cellule totipotente à la fois
sur le plan cellulaire et sur le plan nucléaire. Qu'en est-il des deux premiers blasto-
mères? A quel stade du développement chaque cellule de l'embryon devient-elle
incapable de se développer en un fotus normal? Willadsen a réalisé une série
d'expériences à l'issue desquelles il montra que chez le mouton, les blastomères
perdent leur totipotence cellulaire en passant au stade 8 cellules (3ème mitose).
Cette technique lui permit également de produire les premiers clones de mouton en
obtenant des paires et des triplés d'agneaux à partir des blastomères d'un même
embryon de stade 2 ou 4 cellules. Un seul agneau fut obtenu à partir d'un blasto-
mère de stade 8 cellules.
En fait, il semble qu'une horloge biologique compte le nombre de mitoses
pour déclencher le processus de blastulation au stade de ± 64 cellules (6-7ème mi-
tose). Un blastomère de stade 8 cellules, isolé, poursuit son développement et dé-
clenchera ce processus de cavitation après 3-4 mitoses, c. à d. lorsqu'il aura donné
naissance à un embryon composé de 8-16 cellules. Ce nombre est trop restreint
pour former un blastocyste capable de s'implanter et sa masse cellulaire interne est
trop réduite pour qu'il poursuive un développement embryonnaire harmonieux.
Cette technique est très délicate et ne fut jamais adoptée pour produire des
clones en série.
- Le clonage chimérique par association
Cette autre technique, développée également par Willadsen, est fondée sur
une observation faite chez l'embryon de souris par Mulnard. Ce dernier a décrit que
les premiers blastomères d'un stade 4 cellules qui subissent leur 3ème mitose four-
nissent par la suite la masse cellulaire interne du futur blastocyste. Les derniers
blastomères du stade 4 cellules qui se divisent donnent le trophectoderme. En as-
sociant un blastomère isolé d'un stade 8 cellules d'une souche A avec un blasto-
mère isolé d'un stade 4 cellules d'une souche B, Willadsen a effectivement montré
que l'agneau obtenu après transfert en mère porteuse était constitué de cellules
descendantes du blastomère de stade 8 cellules. En reconstituant 8 embryons chi-
mériques en associant par paire les cellules d'un embryon 8 cellules de souche A et
de deux embryons 4 cellules de souche B, il obtint un maximum de 5 agneaux de
phénotype A. Comme tous les agneaux d'un groupe proviennent d'un blastomère
d'un même stade 8 cellules, ils constituent un clone.
82
Cette technique est également très délicate et n'a jamais été utilisée pour la
production de clones en série. Elle a cependant permis de préciser que le premier
processus de différenciation cellulaire, l'apparition du trophectoderme, débute au
stade 4-8 cellules, bien avant la cavitation.
III - LA PARTHÉNOGENÈSE:
Du grec ¬qpθsvoç = vierge ;vsvsoiç = engendrer): Une ovule non féconder
d’une lapine peut être stimulée et emprunter la voie de l’embryogenèse pour obtenir
une lapine. La technique est simple:
a - On prend une ovule non fécondée d'une lapine.
b - On stimule l'ovule.
c - L'ovule stimulée commence à se développer et est réimplanté dans
l’utérus de la lapine. Le produit sera une lapine identique à sa mère lapine.
IV - LA THÉRAPIE GÉNIQUE:
De nos jours, plus de trois mille types de maladies héréditaires ont été identi-
fiées. Chaque année, la population mondiale paie un lourd tribut à cause de ces ma-
ladies génétiques cause de mortalité infantile ou de déficience caractérisée.
¢ Dans le monde actuel on estime à cent millions (100 000 000), les person-
nes qui sont atteintes de la mutation du gène qui code pour la glucose-6-phosphate
déshydrogénase qui conduit au favisme
¢ Environ deux cent cinquante millions (250 000 000) de personnes souffrent
de plusieurs types d’anémies liées aux mutations génétiques
¢ Dans les pays développés, le tiers des hospitalisations en pédiatrie sont
liées aux désordres génétiques.
¢ La mucoviscidose, cause de la fibrose cystique, touche environ un enfant
sur 2 500 dans la population caucasienne. Quatre pour cent (4%) de cette popula-
tion portent le gène muté de la mucoviscidose (FC).
¢ En Afrique et en Amérique, la drépanocytose tue à elle seule près de cent
mille enfants noirs par an sans compter les pathologies génétiques multi-factorielles
et cystogéniques
¢ Au Burkina Faso, environ 30% de la population présentent une mutation de
la chaine ß de l’hémoglobine (ßS ou ßC). Près de 5% des enfants sont atteints de la
drépanocytose sous ces diverses formes pathologiques (Hb SS ou Hb SC).
1. La thérapie génique germinale.
83
L’objectif de la thérapie génique germinale consiste à introduire des cellules
transgéniques dans la lignée germinale et donc dans l’individu entier. Cela doit per-
mettre non seulement de corriger l’individu traité, mais aussi de lui faire produire des
gamètes porteurs du génotype corrigé qui seront transmis à la descendance. La cor-
rection doit se faire dans une cellule germinale ou de l’embryon précoce ou les cel-
lules sont totipotentes
La première expérience de thérapie génique ciblée et réussie concerne la
correction d'une délétion du gène HPRT (Hypoxanthine PhosphoRibosyl-
Transférase, un produit d'un gène du chromosome X) dans des cellules embryonnai-
res pluripotentes de souris. Le gène HPRT code pour l'enzyme HPRT qui intervient
dans le métabolisme des nucléotides. Grâce à une recombinaison homologue, une
restauration de l'intégrité du gène anormal a pu être obtenue. Ce succès démontre
que la voie du ciblage génétique, inaugurée pour créer des modèles animaux est
prometteuse. Plusieurs procédés sont utilisés à cette fin
a : La micro-injection d’un gène d’intérêt dans le pronoyau
Figure IX.2: micro-injection d’un gène d’intérêt dans le pro-noyau
¢ La première étape consiste en une fécondation d’un ovule de souris
¢ On injecte alors l’ADN étranger dans le pro-nucléi mâle de l’ovocyte fé-
condé
¢ L’ovocyte est alors implanté dans une mère porteuse
¢ La descendance transgénique est identifiée par la PCR et l’électrophorèse
De nos jours, de nombreux essais géniques se font chez les animaux dans le
but de les transposer un jour chez l’homme. Dans le cas des souris, 10 à 30% des
oufs manipulés donnent des souris vivantes. 40% de ces souris ont reçu le gène
d’intérêt injecté. Le problème à résoudre est que l’ADN injecté s’intègre au hasard,
parfois de manière ectopique dans les chromosomes.
b : La micro-injection du gène dans les cellules embryonnaires
Le processus est le suivant :
¢ On prélève au stade blastocyste des cellules embryonnaires porteuses
d’un génotype muté
¢ On insère dans ces cellules le gène sauvage en culture
¢ Les cellules transgéniques sont de nouveau ré-implantées dans l’embryon
qui se trouve dans le blastocyste.
¢ Les cellules qui portent le gène sauvage vont se retrouver dans les diffé-
rents tissus de l’organisme, y compris dans les cellules germinales qui vont consti-
tuer les gonades. Le transgène peut donc être transmis à la descendance par des
croisements entres les souris transgéniques de la descendance portant le transgène
dans leurs gonades.
De nos jours, aucune thérapie génique germinale n’a encore été entreprise
chez l’homme. La plupart des fragments d’ADN s’intègrent de façon ectopique dans
tout le génome, ce qui constitue un sérieux handicap pour la thérapie humaine, non
84
seulement à cause des possibles interruptions des gènes, mais aussi parce que
l’allèle muté sera toujours présent dans le génome et pourra ségréguer du transgène
dans les générations futures. Il faudrait mettre au point un système de ciblage grâce
auquel le transgène de type sauvage se substitue au gène défectueux par une re-
combinaison en faisant intervenir un double crossing-over.
Figure IX.3 :La micro-injection du gène dans les cellules embryonnaires
2. La génothérapie somatique
La thérapie génique somatique s’attaque uniquement aux cellules du soma et
tente d’éliminer le phénotype pathologique. Il est alors possible de rendre transgéni-
que le corps entier d’un individu. Un certain pourcentage de cellules « guéries »
peuvent atténuer la maladie en codant pour la protéine normale.
La génothérapie somatique consiste en une utilisation des rétrovirus désar-
més (délétions des gènes gag, pol et env) pour l’insertion du gène exogène dans
un organisme. Les premiers vecteurs utilisés ont été des rétrovirus désarmés que
l’on a rendu amphotropes pour permettre leur utilisation dans différentes espèces
et défectifs pour contrôler leur dissémination. Les problèmes liés à la l’insertion des
rétrovirus sont énormes :
Les figures qui suivent illustrent quelques exemples de thérapie somatique dans
différents mammifères
¢ Ils peuvent provoquer des inversions, des délétions, des mutations chez
l’individu traité.
¢ Ils peuvent aussi rencontrer un autre virus dans l’individu traité, se recom-
biner avec ce dernier et devenir pathogènes
¢ Il se pose également le problème de l’immunogénicité de l’organisme (non
reconnaissance du soi).
Figure IX.4 : Thérapie génique somatique : Utilisation de rétrovirus pour un transfert de
gène
Le procédé simple est le suivant :
¢ On prélève quelques cellules somatiques du patient, qu’on cultive
¢ On y introduit des exemplaires du gène sauvage cloné dans un vecteur
désarmé
¢ On réimplante ces cellules transformées dans le corps du patient ou elles
pourront remplir la fonction attendue.
¢ Les figures qui suivent illustrent quelques exemples de thérapie somatique
dans différents mammifères
85
3. Vers la génothérapie avec de l'ADN médicament.
La maîtrise de la méthodologie de transfert des gènes, alliée à une compré-
hension de plus en plus poussée du fonctionnement des gènes, permettent d'envi-
sager leur utilisation dans la lutte contre les maladies acquises. "Le principe consiste
à munir certaines cellules d'une construction génique permettant la production locale
(autocrine), régionale (paracrine), voire générale (endocrine) de facteurs protéiques
(ou nucléiques) ayant un intérêt thérapeutique". Les cancers et les maladies virales
sont candidats à ce type de thérapie.
En effet, dans la thérapie des cancers les premières expériences effectuées
avec les TIL montrent que l'on peut armer des cellules avec des facteurs cytotoxi-
ques (TNF = Tumor Necrosis Factor) ou les doper avec des cytokines.
Dans la thérapie anti-virale, l'idée est de fournir à la cellule les moyens de se
défendre spécifiquement contre le virus par une stratégie adaptée à la biologie du
virus considéré. Il s’agit de mettre à profit la masse de connaissances accumulées
sur sa biologie. Dans le cas du VIH, cet démarche consiste à munir les cellules T de
constructions contenant des gènes mutants transdominants codant pour des pro-
téines virales structurales ou régulatrices anormales ou modifiées.
On peut aussi fabriquer des leurres pour le virus comme la protéine CD4 so-
luble comportant un signal de rétention intracellulaire pour piéger la protéine gp120
du virus ou même un leurre du RNA viral comportant une pseudo séquence TAR.
Une autre approche consiste à éliminer le virus de la cellule infestée par une
toxine protéique (toxine diphtérique, ricine) dont le gène est placé dans une cons-
truction qui en assure l’expression conditionnelle. Il s’agit dans ce cas d’une bombe
à retardement que le virus active lui même (Une protéine régulatrice TAT).
Une autre variante de cette toxigénétique conditionnelle, "consiste à com-
battre le virus HIV en lui apportant le gène de la thymidine kinase (TK) sous
contrôle du LTR du HIV, cette construction étant elle-même incluse dans un
adénovirus recombinant qui en assure la transduction" Dans ce cas, seules les
cellules infectées produisent les signaux transactivateurs du LTR, ce qui entraîne
l'expression du gène TK, rendant les cellules sensibles au gancyclovir, (un analogue
pyrimidique cytotoxique) administré comme médicament.
Ces essais préliminaires ouvrent la voie à une ère de thérapeutique nouvelle,
permettant de s’attaquer à des maladies incurables ou héréditaires et aux maladies
virales comme le SIDA.
86
CHAPITRE X :
LES TECHNIQUES DE LA BIOLOGIE MOLÉCULAIRE APPLIQUÉES DANS LA
RECHERCHE THERAPEUTIQUE DU VIH/SIDA
I – STRUCTURE DU VIH
Figure X.1 : Structure du VIH
L'étude de la structure génétique du VIH permet de comprendre la complexité
de ce virus, certaines de ses manifestations cliniques et biologiques, et d'envisager
des stratégies pour la recherche thérapeutique.
Le VIH, Virus de l’Immunodéficience Humaine, est un rétrovirus de 0,1 µm de
diamètre, du sous-groupe des Lentiviridae, qui a un génome à ARN.
Il a été isolé pour la première fois à l’Institut Pasteur de Paris en 1983. Le VIH-1 est
répandu dans le monde entier tandis que le VIH-2 est essentiellement localisé en Afri-
que. En Afrique subsaharienne on peut trouver chez le même individu une co-
infection : le VIH-1 et le VIH-2 ensemble.
Figure X.2 : Origine du VIH
Structure du VIH : De l’extérieur vers l’intérieur du virus, nous avons :
> L’enveloppe du virion : les glycoprotéines p 120, p 41 et une double couche de
phospholipides.
> La matrice est constituée glycoprotéines p 17.
> La capside, formée par des glycoprotéines p 24 contient : deux filaments d’ARN
de 9200 bp environ enveloppés par la nucléocapside (protéine p 7), la transcriptase
inverse, l’intégrase, la protéase et la ribonucléase.
Le VIH possède 3 gènes rétro-viraux codant pour différentes protéines virales :
> gag (groupe antigène) code pour des protéines internes ("core") : p50 et
p40 qui se cliveront en p13, p18 et p24.
> pol (polymérase) code pour des enzymes nécessaires à sa réplication :
notamment p68 (reverse transcriptase) et p34 (intégrase).
87
> env (enveloppe) code pour des glycoprotéines (gp110 et gp41 issues de
gp 160). La gp 110 est une partie de l'enveloppe responsable de l'interaction avec la
membrane de la cellule cible au niveau du récepteur CD4, permettant la pénétration
du virus. Une autre propriété de l'enveloppe (gp41) est de pouvoir induire la fusion
cellulaire (syncitium) qui est un des éléments cytopathogènes du VIH.
Figure X.3 :gène gag, pol, env
Le VIH possède d’autres gènes codant pour différentes protéines virales
Contrairement aux autres rétrovirus, le VIH possède d'autres gènes intervenant dans
sa réplication. Cette complexité qui lui est caractéristique explique probablement son
haut pouvoir pathogène. Il y a des gènes régulateurs :
> tat (favorise l'augmentation du niveau de la synthèse des protéines vira-
les),
> rev favorise l'augmentation des ARN messagers correspondant aux protéi-
nes de gag, pol et env.
Il y a aussi d'autres gènes, comme vif, qui permet d'augmenter l'infectiosité,
nef (rôle mal connu) et vpu, vpr (vpx pour VIH2). La séquence LTR (Long Terminal
Repeat) peut être considérée comme un promoteur fort et une région régulatrice
pour la production de nouveau virus.
Figure X.4 Mécanisme d’infection
II - LES NOUVELLES MOLÉCULES ANTIVIRALES EN DÉVELOPPEMENT:
1 - Les inhibiteurs de l'entrée du virus :
Il existe 3 types de médicaments qui sont en cours de développement à
l'heure actuelle :
> Inhibiteurs de l'entrée du virus dans les lymphocytes CD4 ;
> Antagonistes des co-récepteurs, ces molécules se fixent sur des récep-
teurs nécessaires à la pénétration du virus dans les cellules ;
> Inhibiteurs de la fusion du VIH : ils empêchent le virus de fusionner avec
la cellule qu'il attaque.
2.- Les INTI et les INNTI sont des inhibiteurs de la transcriptase inverse
Des essais cliniques ont été réalisés sur de nouveaux inhibiteurs de la trans-
criptase reverse : Inhibiteur Nucléosidique de la Transcriptase Inverse (INTI) et Inhi-
biteur Non Nucléosidiques de la Transcriptase Inverse (INNTI). Les premiers essais
ont montré des résultats intéressants en terme d'efficacité sur la charge virale ou sur
des virus présentant des mutations.
3. - Les IP sont des inhibiteurs de la protéase acide virale:
De nouveaux inhibiteurs de la protéase sont en cours de développement à un stade
avancé.
88
4 – classification de quelques molécules antivirales :
Nucléosides : Rétrovir (AZT), Videx (ddI), Hivid (ddC), Epivir (3TC), Zérit (D4T),
Combivir (AZT + 3TC), Ziagen (abacavir).
Non-nucléosides : Viramune (névirapine), Sustiva (efavirenz), Rescriptor
(delavirdine).
Antiprotéases : Invirase ou Fortovase (saquinavir), Crixivan (indinavir), Norvir (rito-
navir), Viracept (nelfinavir), Agénérase (amprénavir), ABT-378/r (voir : Pétition Re-
maides).
Nucléotide : Prévéon (adéfovir).
III. VERS L’ESPOIR D’OBTENIR UN JOUR UN VACCIN ANTI-VIH.
La recherche d'un vaccin contre le VIH a continué de progresser, même si
elle n'a pas accompli de progrès spectaculaire au cours des dernières années écou-
lées. Près de trente essais ont été menés ou sont en cours chez l'homme, en phase
I et II (étude de la tolérance et des réactions immunitaires chez quelques dizaines
de volontaires en phase I et plusieurs centaines en phase II).
De nouvelles approches sont explorées. L'utilisation de virus atténués,
comme cela se pratique pour de nombreux vaccins et qui est évoquée et repoussée
depuis longtemps pour le VIH, fait actuellement grand bruit aux États-Unis où elle
est proposée avec force par un groupe de médecins-chercheurs et bien autres types
de vaccins.
1 - Les deux objectifs d'un vaccin contre le VIH demeurent :
> L'induction d'anticorps capables de neutraliser le virus, dirigés contre les
protéines d'enveloppe (réponse humorale).
> L'induction de cellules T cytotoxiques, CTL, qui détruisent les cellules in-
fectées. Cette induction nécessite que la préparation vaccinale se réplique à l'inté-
rieur des cellules pour que l'antigène du VIH soit présenté au système immunitaire
(réponse cellulaire).
La majorité des résultats obtenus depuis deux ans soulignent l'intérêt de stra-
tégies vaccinales utilisant des combinaisons d'antigènes de plus en plus complexes,
afin de stimuler les différentes composantes du système immunitaire. Un des pro-
blèmes posés par l'obtention vaccinale de réponses immunitaires contre le VIH est
que ces réponses doivent être dirigées contre des souches de virus très variables.
2 - Vaccins sous-unitaires et vaccins synthétiques
Les premiers vaccins sous-unitaires (immunisation par des protéines d'enve-
loppe recombinantes du virus) se sont révélés incapables d'induire des anticorps
neutralisants actifs contre les souches de virus sauvages que l'on trouve chez les
malades et qui sont différentes de celles, longtemps cultivées en laboratoire, utili-
89
sées pour les vaccins (Lemoine FM et al,1999). Certains vaccins sous-unitaires VIH
induisent cependant une protection chez des chimpanzés et des macaques (Le-
moine FM et al,1999). Ils sont utilisés chez l'homme en rappel (boost), après l'injec-
tion d'un vaccin recombinant vivant (prime, d'où le concept de «prime-boost»).
En parallèle, on étudie l'immunogénicité de peptides et antigènes incorporés
dans des liposomes (vésicules d'acides gras qui ont la propriété de pénétrer dans
les cellules) ou des ISCOMS (complexes immuno-stimulateurs). Ces méthodes sem-
blent capables d'induire des réponses immunitaires anti-VIH chez l'homme et anti-
SIV chez le singe, mais sans qu'on sache aujourd'hui si cela procure une protection.
3 - Les virus vivants atténués
Ce sont des virus VIH, ou SIV chez le singe, toujours infectieux mais dont le
pouvoir pathogène est diminué. Cette approche, généralement considérée comme
trop dangereuse chez l'homme, suscite beaucoup d'intérêt depuis que plusieurs di-
zaines de médecins américains ont annoncé qu'ils se portaient volontaires pour un
essai de vaccination par un VIH atténué (Lemoine FM et al,1999).
4 - Vaccins vivants recombinants produit par la biotechnologie
C'est avec des vaccins vivants recombinants (un virus inoffensif auquel on a
ajouté des gènes du VIH) que les essais chez l'homme sont le plus avancés, puis-
qu'un essai de phase II vient de commencer aux États-Unis chez 420 volontaires,
avec une préparation de Pasteur-Mérieux-Connaught. Les vaccins recombinants
utilisent la vaccine ou le canarypox (virus de la variole du canari) exprimant des pro-
téines du VIH. Les premiers vaccins recombinants exprimaient seulement une pro-
téine d'enveloppe. Les préparations actuelles sont porteuses de gènes de plusieurs
protéines d'enveloppe et de protéines internes.
5 - Pseudo-particules (virus-like particles)
Ces vaccins sont constitués de différentes combinaisons de protéines virales
sous forme de particules. L'absence de génome viral les empêche de se répliquer
(Lemoine FM et al,1999).
6. ADN nu
L'administration d'un ADN purifié codant pour une ou plusieurs protéines du
VIH et portant un signal pour la transcription dans la cellule présente deux avanta-
ges, la simplicité et la stabilité du vaccin. Les premiers essais chez l'animal ont mon-
tré que ces vecteurs induisent des CTL et des anticorps neutralisants (Lemoine FM
et al,1999).
Une approche originale utilise des «cochléats» (phosphatidylsérine, choles-
térol et calcium) comme vecteurs de protéines et d'ADN.
90
Au-delà de ces vaccins en perspectives et ces nouveaux médicaments, dont
certains seront prochainement disponibles, les recherches continuent également
dans la direction de la thérapie génique.
IV. LE GÉNIE GÉNÉTIQUE ET LA LUTTE CONTRE LE VIH.
Aujourd'hui, la thérapie génique, instrument du génie génétique, qui consiste
à intervenir sur les gènes d'une cellule pour modifier certaines de ces fonctions ou
capacités, est très avancée dans la thérapie des cancers et de nombreuses patho-
logies génétiques. Pour ce qui concerne le traitement de l'infection par le VIH, les
pistes de recherches sont déjà nombreuses, quelques protocoles d'essais chez
l'homme ont été approuvés et certains sont même en cours d'évaluation.
1 - Comment modifier les gènes d'une cellule ?
Deux approches thérapeutiques sont aujourd'hui utilisées pour combattre le VIH :
La modification directe des gènes des cellules du malade :
On injecte au malade un virus porteur du gène que l'on veut modifier. Ce virus
va s'intégrer au niveau de l'ADN des cellules et insérer le transgène. Les cellules
acquièrent ainsi les nouvelles propriétés conférées par ce gène, par exemple, en
produisant une toxine contre le virus du SIDA.
L'utilisation de cellules déjà modifiées :
On injecte au malade des cellules humaines, par exemple, des cellules immu-
nitaires comme les lymphocytes CD4, qui ont été génétiquement modifiées par la
méthode décrite ci-dessus en laboratoire. Ces cellules chimères agissent comme un
médicament en luttant contre la maladie. Elles sont désormais capables de résister
au virus du SIDA et peuvent apporter au malade une immunité contre les infections.
2 - Mais comment, concrètement, le génie génétique peut-il développer des
stratégies de combat contre le VIH ?
A travers Cinq voies de recherches :
- L'immunisation intracellulaire,
- La destruction sélective des cellules infectées,
- La sécrétion de protéines inhibitrices,
- La pharmacomodulation génétique,
- L'immunothérapie génétique,
a - L'immunisation intracellulaire :
Tandis que la vaccination protège les sujets non infectés de l'infection, l'im-
munisation intracellulaire confère une protection contre un virus à l'échelon cellulaire
chez des sujets infectés. Le principe est simple : il s'agit de modifier la structure gé-
nétique des cellules cibles du VIH (les lymphocytes CD4) afin que celles-ci soient
91
protégées du virus. Plusieurs techniques sont utilisées. La cellules modifiée se met
alors à produire des mutants « transdominants » de protéines virales, des « leurres
ARN » qui miment l’ARN viral, des « molécules antisens » de séquences nucléotidi-
ques. Tous ces éléments générés par la biotechnologie peuvent tromper le VIH ou le
bloquer ou alors rivaliser avec lui dans la recherche des substrats. L'intérêt de l'im-
munisation intracellulaire est qu'elle bloque bien la réplication du virus à l'intérieur
de la cellule.
b - La destruction sélective des cellules infectées :
Une autre approche de la thérapie génique de l'infection par le VIH vise à dé-
truire spécifiquement les cellules infectées à l'aide d'un gène codant pour une
toxine. Un gène « suicide » est placé sous le contrôle transcriptionnel du promoteur
LTR du VIH afin d'entraîner la destruction cellulaire au moment de la synthèse de la
molécule tat, produite lors de la réplication du VIH (Caruso M et al. 1992). Cette
stratégie est difficile à mettre au point et n'apporte aucun avantage sélectif aux cellu-
les transduites, car les lymphocytes sont détruits dès qu'ils sont infectés.
c- La sécrétion de protéines inhibitrices :
Certaines protéines sécrétées naturellement par les lymphocytes ont des pro-
priétés anti-VIH. L'opération consiste à introduire dans l'organisme un gène qui va
produire une quantité élevée de ces protéines. Ce gène peut être implanté de ma-
nière ectopique dans les hépatocytes, via un virus modifié qui est capable d'implan-
ter le transgène. Les chercheurs peuvent aussi utiliser d’autres méthodes comme
"cultiver" des cellules modifiées génétiquement, des fibroblastes de souris, les en-
tourer d'une membrane inerte de collagène pour qu'elles soient "invisibles" par le
système de défense immunitaire du patient, puis les transférer chez le patient atteint
par le VIH. Ces cellules enveloppées et protégées se mettent alors à produire les
protéines anti-VIH (Moullier P, et al. 1993).
d - La pharmacomodulation génétique :
Les médicaments antiviraux actuels agissent pour la plupart à l'intérieur de la
cellule infectée au niveau de laquelle ils pénètrent. C’est ainsi que l’action de la zi-
dovudine est limitée du fait de ses effets toxiques et de l'apparition de souches mu-
tantes résistantes. Le mécanisme cellulaire qui permet de rendre ces médicaments
actifs n'a pas toujours un rendement idéal puisqu’une partie du médicament est éli-
miné de la cellule avant d'avoir été rendu actif. Le principe de la "pharmacomodula-
tion génétique" est d'introduire un gène qui va accélérer l'activation de l'antiviral à
l'intérieur de la cellule. Cette méthode est très intéressante, car elle permettrait ain-
si, à dose d'antiviral identique, d'avoir une efficacité 3 à 10 fois plus importante. Elle
peut également être appliquée pour diminuer les effets indésirables d'autres antivi-
raux qui sont mal tolérés, et dont on pourrait diminuer les doses pour le patient (Ca-
ruso M et al. 1994).
e - L'immunothérapie génétique :
L'immunothérapie génétique correspond à l'utilisation, à des fins thérapeuti-
ques, de cellules immunocompétentes génétiquement modifiées (Lemoine FM et al.
1999). En effet, cette dernière voie de recherche, en plein essor, consiste en l'intro-
92
duction dans l'organisme de cellules génétiquement modifiées, des cellules dendriti-
ques (DC) ou autres qui sont capables de "mimer" le virus du SIDA pour activer une
réponse du système de défense immunitaire de l'organisme. En effet, les DC sont
capables d'apprêter les protéines sous forme de peptides antigéniques et de les pré-
senter soit aux lymphocytes T CD4
+
par le complexe majeur d'histocompatibilité de
classe II (CMH II), soit aux lymphocytes T CD8
+
via le CMH I (Lemoine FM et al.
1999). Lors de l'infection par le VIH, l'organisme n'est pas capable de se défendre
tout seul car le virus n'est pas reconnaissable suffisamment longtemps pour que des
anticorps efficaces puissent être produits. L'immunothérapie génétique permet de
présenter aux lymphocytes des "morceaux du virus" facilement reconnaissables pour
que, en s'attaquant à ces "morceaux", les lymphocytes détruisent les virus. Il s'agit
là, bel et bien, d'une sorte de "vaccination" avec des cellules génétiquement modi-
fiées.
3 . Recherche sur un vaccin contre le VIH/SIDA
Processus et défi de la conception et de la sélection des épitopes: Qu’est-ce qu’un
épitope ?
Comment pouvons-nous induire dans toutes les personnes une réponse immunitaire
spécifique contre un grand nombres d’épitopes VIH peptides des Lymphocytes T
Cytotoxiques (CTL) et des lymphocyte T helper ?
Immunogénétique Reverse
Nous avons :
- la génétique directe:
du phénotype, à partir de la configuration de la protéine, on remonte au gène qui a
spécifiée cette séquence peptidique.
- la génétique reverse:
De l’ADN, du gènes spécifique on cherche à découvrir la protéine codée, synthéti-
sée.
* Sélection des peptides à travers la technique de l’immunogénétique Reverse.
Fondement: rechercher les gènes qui spécifient les protéines du système immuni-
taire.
A partir de la technique de l’immunogénétique reverse: trouver des peptides des
allèles des classes HLA I et II capable de couvrir plus de 90% des haplotypes HLA
de diverses populations ciblées.
A partir de la technique de l’immunogénétique reverse: Acquérir une grande in-
formation sur les séquences des acides aminés des protéines du VIH de divers cla-
des du VIH.
* Les défis d’élaboration des épitopes CTL du VIH spécifique par la technique de
l’immunogénétique reverse:
- variabilité génétique du VIH,
- polymorphismes alléliques des populations ciblées,
Défis d’élaboration des épitopes CTL du VIH spécifique Nécessité d’informations
sur:
93
1) La variabilité génétique du VIH,
2) La base génétique humaine de la distribution des allèles du système HLA de la
population ciblée
Nous trouvons des donnés sur la variabilité génétiques et la distribution des allèles
du systèmes HLA des populations de l’Afrique de l’Ouest dans le dépôt du Gene
Bank. Connaissance des fréquences des allèles du système HLA de classe I et de
classe II au sein des populations ciblées ( Burkina Faso).
Utilisation des épitopes promiscuous du système HLA de la classe I et II pour la po-
pulation ciblée. Concevoir les épitopes peptidiques par la technique de
l’Immunogénétique Reverse.
Tester les épitopes du VIH sélectionnés pour établir la capacité d’être identifié par
un Lymphocyte T Cytotoxique (CTL) VIH-spécifique et pour recueillir la réponse du
lymphocyte T helper. Figure VIII.7
CHAPITRE XI : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE
I - GÉNÉRALITÉ : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE
A - Historique :
En 1902 Archibald Garrod, médecin anglais appliquait pour la première fois
les lois de Grégoire Mendel à la transmission des maladies héréditaires de l’homme.
Il émit comme hypothèse selon laquelle les facteurs héréditaires (les gènes) contrô-
leraient certaines réactions métaboliques. Successivement il théorisait la nature in-
dividuelle (due à la variabilité et à la spécificité chimique des processus
métaboliques) de toutes les réponses de l’organisme au regard des éléments
étrangers, les agents pathologiques, les aliments ou les médicaments.
Au moment où les recherches fondamentales explicitaient les mécanismes
biochimiques et genetico-moléculaires associés aux pathologies héréditaires, Linus
Pauling en 1949 démontrait que l’anémie falciforme, la drépanocytose, « sick cell »
est une maladie due à une anomalie structurale de la molécule de l’hémoglobine.
Par la suite les chercheurs démontrèrent que cette anomalie structurelle protéique
correspondait à une altération de l’information génétique codée dans l’ADN. C’est à
ce moment qu’ils découvrirent aussi les premiers exemples d’hérédité de certaines
réactions anormales aux médicaments. Le premier exemple est la réaction d’anémie
hémolytique inattendue des soldats américains d’origine africaine, après la prise de
la primaquine, un médicament antimalarique. L’étude moléculaire permit de décou-
vrir chez les personnes qui ne tolèrent pas la primaquine le déficit enzymatique de la
G6PD (Glucose 6 phosphate déshydrogénase). L’étude fondamentale génétique de
94
la susceptibilité individuelle à réagir de manière anormale avec des conséquences
destructives après l’absorption de médicaments, fut appelée, en 1959, pharmacogé-
nétique.
A partir des années 70, les études de pharmacogénétique commencèrent à
montrer que la variabilité individuelle dans le métabolisme des médicaments peut
dépendre non seulement de variations d’un seul gène avec ses allèles mais aussi
de l’interaction de plusieurs gènes mutés dans l’organisme. C’est ainsi qu’à partir
des année 90, les chercheurs émirent le concept de pharmacogénomique pour ex-
pliquer la variabilité individuelle dans la réponse aux médicaments utilisant des
techniques qui permettent d’évaluer l’expression et l’action de plusieurs gènes.
B - Qu'est-ce que la pharmacogénétique ?
La pharmacogénétique est définie comme l’étude des variations génétique-
ment contrôlées de la réponse à un médicament. Elle étudie les mécanismes de
fonctionnement utilisés par la cellule-cible ou la cellule de détoxication, vis-à-vis
d'un médicament administré. La pharmacogénétique a connu un grand développe-
ment en ces dernières années grâce à l’utilisation des techniques de biologie molé-
culaire comme l’analyse des polymorphismes de restriction (RFLP), SSTR,
l’amplification en chaîne par la polymérase (PCR), les méthodes de transfection et le
développement des chips.
La pharmacogénétique qui permet d’établir un lien entre le polymorphisme de
la structure génique et la variabilité de la réponse à l’effet d’un médicament a
comme objectifs :
1 - Rechercher les gènes qui codent pour les enzymes de transformation des médi-
caments.
2 - Élaborer des tests qui montrent que le patient qui doit prendre tel médicament
possède les enzymes de transformation nécessaires.
3 - Tester directement l'activité des enzymes de transformation des médicaments :
des tests devraient se développer de plus en plus pour étudier, à l'avance, la façon
dont chaque individu va transformer puis éliminer tel ou tel médicament.
4 - Déterminer les doses de médicaments à utiliser chez les enfants ou les person-
nes âgées. En effet, la synthèse des enzymes de transformation des médicaments et
leur activité évoluent en fonction de l'âge. Certaines de ces enzymes ne sont pas
encore "matures" chez des enfants ; par contre, chez les personnes âgées, certai-
nes enzymes peuvent avoir une activité réduite.
5 - Identifier pour tous les nouveaux médicaments, les enzymes de transformation
impliquées. La pharmacogénétique représente donc aujourd'hui une composante
importante dans le développement d'un nouveau médicament.
La pharmacogénomie ou la pharmacogénomique est plus difficile à définir. Il
s'agit d'étudier simultanément les modulations, positives ou négatives, de l'expres-
sion des gènes, induites par les composés pharmacologiques analysés. Quelle mo-
dification de l'expression d'un ou de plusieurs gènes induit une molécule donnée?
Autrement dit, à côté de l'effet thérapeutique principal recherché, quelles autres mo-
difications du génome ou du protéome (dans le cadre de ce qu'il est convenu d'ap-
peler la protéomique) peut-on observer, et quelles conséquences directes ou indi-
rectes faut-il en déduire, pour le développement d'une molécule a priori sélectionnée
pour devenir un médicament?
95
C - Pharmacogénétique : Les liens entre les enzymes de transformation
des médicaments et les cancers ?
Les enzymes ont des conséquences multiples dépendant :
* de leur fonction ;
* de la vitesse à laquelle ils agissent ;
* des vertus pharmacologiques de la substance qu'ils détruisent ;
* des propriétés toxicologiques de la substance qu'ils créent.
- Rendre les médicaments efficaces.
Pour qu'un médicament soit efficace, il faut plusieurs conditions : avoir des enzymes
qui transforment le médicament en une substance active (parfois les médicaments
sont directement actifs et n’ont pas besoin de cette étape d'activation), et d'autres
enzymes qui ne dégradent pas trop rapidement cette substance active (pour que le
médicament reste efficace plus longtemps). A l'inverse, les personnes qui n'ont pas
d'enzymes adéquates ne pourront pas utiliser un médicament donné et donc ne tire-
ront pas le bénéfice thérapeutique attendu. L'efficacité d'un traitement dépend donc
directement de la présence et du fonctionnement de certaines enzymes.
- Éliminer les toxiques.
Les enzymes agissent d'une autre façon : certains créent des produits toxiques,
d'autres permettent d'éliminer ces agents toxiques. Ainsi, certaines personnes vont
fabriquer plus de molécules toxiques que d'autres sujets suite à la prise d'un médi-
cament donné. Ces personnes risquent alors de développer plus d'effets indésira-
bles (effets secondaires). Inversement, certaines personnes éliminent plus rapide-
ment ou plus efficacement certains produits toxiques. Ce caractère leur permet
d'être protégées contre l'action de ces toxiques. Ainsi, on sait que certains fumeurs
risquent, plus que d'autres, de développer un cancer du poumon après activation
des produits contenus dans la fumée de tabac par leur transformation enzymatique
en produits cancérigènes.
Afin de mieux combiner les médicaments les uns avec les autres, les personnes
sous traitement peuvent prendre plusieurs médicaments en même temps, pour trai-
ter différentes maladies. Parfois, certaines enzymes de transformation modifient plu-
sieurs médicaments et il peut alors se poser des problèmes de compétition,
d’inhibition ou d’interaction médicamenteuse. Il est important de connaître quels sont
les médicaments qui interagissent les uns avec les autres pour éviter de les combi-
ner.
- Quelques exemples pratiques.
* Une personne sur 300 ne possède par une enzyme nécessaire pour la dégradation
du 5-fluoro-uracile, un médicament utilisé pour le traitement du cancer du côlon. La
conséquence de cette absence est que la personne ne pourra pas éliminer le médi-
cament, qui va alors s'accumuler dans le corps et créer des effets toxiques. D'ores et
déjà, des tests sont disponibles pour vérifier la présence de cette enzyme et pour
mesurer son activité avant de débuter un traitement.
* De même, une personne sur 300 possède une enzyme de transformation de cer-
tains médicaments (l'AZT, le mercaptopurine et la thioguanine) trop performante :
elle modifie trop rapidement ces médicaments qui ne pourront alors pas agir sur les
96
cellules cibles.
* On peut encore citer des enzymes de détoxication (appelées transférases) qui sont
présentes en quantité variable d'une personne à l'autre. Elles agissent principale-
ment en rendant solubles certaines substances chimiques pour qu'elles soient en-
suite éliminées par le foie et/ou les reins.
D – L’épidémiologie des réponses idiosyncrasiques
L’idiosyncrasie idios (ιδιος) en grec = particulier ; sunkrasis (συνκρασις)= mélange).
C’est la manière d’être particulière à chaque individu, qui l’amène à avoir des réac-
tions, des comportements qui lui sont propres.
Les réponses idiosyncrasiques ont une corrélation, au sein de la population, avec
les mutations génétiques et les facteurs variés comme le sexe, l’âge, l’aire géogra-
phique et le groupe ethnique.
La pathologie transmise par les chromosomes sexuels peuvent toucher un
sexe plus que l’autre.
- Une altération transmise en mode récessif avec le chromosome X se manifeste
chez les sujets de sexe masculin, en tant que hémizygote.
L’âge joue dans la pathogenèse dans la mesure où certaines altérations génétiques
peuvent se manifester non à la naissance, mais en âge juvénile ou adulte.
- L’aire géographique est importante quand l’environnement exerce une pres-
sion sélective et favorise l’affirmation d’un profil génétique déterminant. Par
exemple, la présence du gène pour la variante A- de l’enzyme G6PD. La
G6PD tend à se manifester surtout dans les zones endémiques du paludisme.
- Les différences génétiques entre les diverses ethnies sont responsables de la
variation dans la réponse aux médicaments. L’incidence de l’anémie hémoly-
tique induite par les médicaments est mineure chez les caucasiens par rap-
port aux autres populations, tandis que le gène muté qui code une enzyme
pseudo-cholinestérase s’exprime plus chez les européens avec une fré-
quence de 2%.
E - Les critères d’étude en pharmacogénétique
En face d’une réponse pharmacologique atypique, il faudrait suspecter une
base génétique. Mais pour que cela soit accepté, il faudrait des recherches docu-
mentées, appropriées.
L’examen clinique est de par soi-même insuffisant, cependant le cadre clini-
que symptomatique est parfois évident et suggestif, comme dans le cas d’une ap-
née prolongée par suite de l’absorption d’un médicament.
L’information plus certaine est l’étude des familles et des groupes de ju-
meaux. Les études familiales ont permis d’établir , par exemple, que la bio-
transformation de certains médicaments, comme la dicoumarole et la phénylbuta-
zone, dépend des enzymes qui, du point de vue génétique, s’expriment d’une ma-
nière polygénique. Les effets de plusieurs produits comme l’isoniazide, la phénylbu-
tazone et l’halothane, sont évalués en utilisant les jumeaux homozygotes.
97
Les études au niveau des jumeaux comparent les réactions à l’intérieur des
groupes de jumeaux homozygotes et des jumeaux hétérozygotes. Les jumeaux ho-
mozygotes tendent à avoir un profil pharmacogénétique très similaires par rapport à
un type de médicament ; tandis que les jumeaux hétérozygotes présentent des va-
riations énormes comparables aux individus consanguins. Au niveau des jumeaux,
le paramètre qui détermine la pharmacocinétique d’un médicament déterminé, la
demie-vie plasmatique et la contribution de l’hérédité est le coefficient de l’Hérédité
qui s’exprime par l’équation :
h
2
= (V
d
-V
m
)
-----------
V
d
h = Coefficient d’hérédité ; Vd = variance calculée à l’intérieur de jumeaux hétérozy-
gotes et Vm est la variance calculé à l’intérieur des jumeaux homozygotes.
La valeur de h peut varier entre 0 (dans le cas où la contribution génétique est insuf-
fisante ou nulle) à un (dans le cas où l’influence génétique est déterminante).
Dans le cas de la dicoumarole, la phénylbutazone, l’halothane et la nortriptyline, le
coefficient d’hérédité varie entre 0,88 et 0,98.
Exemples de désordres pharmacogénétiques :
Tableau IX.I : Désordres pharmacogénétiques
Altération génétique Médicament Manifestation pathologique
Désordres pharmacogénétiques avec apparition de phénomènes toxiques ou
imprévisibles
G6PD Antimalariques, sulfami-
des, nitrofuranes
Anémie hémolytique
NADH-méta-hémoglobine
réductase
Nitrite, sulfonamides Méta-hémoglobinémie
Pseudo-cholinestérase Succinylcholine Apnée
Polymorphisme de la
N-acetyltransferase
Isoniazide, procaïnamide,
clonazepam
Apparaît la toxicité du mé-
dicament
Transferrine Fer hémochromatose
Désordres pharmacogénétiques avec absence d’effet pharmacologique atten-
du (résistance à l’action des médicaments)
Altération génétique Médicament Effet thérapeutique attendu
Absence du facteur intrin-
sèque
Vit. B12 Absence
Activité antianémique
Réduction des récepteurs
beta2 adrénergique
Beta2 stimulants Absence
Activité antiasthmatique
Altération des récepteurs Insuline Absence
98
de l’insuline Activité antidiabétique
Réduction de la synthèse
du HGPRT
6-mercaptopurine azathio-
prine
Absence
Activité antitumorale
Activité immunosupressive
II - LES DÉSORDRES PHARMACOGÉNÉTIQUES
Les désordres pharmacogénétiques peuvent être classés selon la base des caracté-
ristiques cliniques des réponses idiosyncrasiques et aux altérations génétiques qui
sont à leur origine. Selon ce critère, les réactions idiosyncrasiques peuvent consis-
ter dans l’apparition des effets toxiques ou imprévisibles, ou alors en un manque
d’effet thérapeutique attendu.
La pharmacogénétique est la discipline qui décrit les réponses inusuelles aux
médicaments (idiosyncrasie) sur la base de mécanismes héréditaires. Les variations
interindividuelles de la réponse aux médicaments sont d'observation fréquente, cer-
tains malades ne répondant pas à des doses habituelles, voire élevées, de médica-
ments, tandis que d'autres présentent des accidents de surdosage. De nombreux
facteurs sont connus pour retentir sur la susceptibilité individuelle ; sans compter de
l'observance et des variations liées à l'observateur, ils peuvent être en rapport avec
le malade lui-même (facteurs intrinsèques) : âge, pathologie(s), statut hormonal,
compétence immunologique, génotype, enzymes, ou dépendre de conditions exté-
rieures (facteurs extrinsèques) : variations nycthémérales, facteurs environnemen-
taux, état nutritionnel, consommation d'alcool ou de tabac, stress, activité physique,
en représentent des exemples. Enfin lors d'administrations concomitantes, les inte-
ractions médicamenteuses constituent un dernier volet. La connaissance de ces fac-
teurs de variation peut aider à corriger un schéma posologique pour l'adapter à cha-
que sujet afin d’éviter les phénomènes toxiques et imprévisibles.
A. Variations d'ordre pharmacocinétique
1 - Au niveau de la résorption
Les patients atteints d'anémie pernicieuse juvénile souffrent d'une malabsorp-
tion de la vitamine B12 d'origine génétique. Il existe également une perturbation
congénitale de la résorption de l'acide folique accompagnée de modifications de son
métabolisme qui conduisent à des réponses atypiques en cas d'administration de
folates ou d'analogues tel le méthotrexate.
2 - Au niveau de la métabolisation
Le polymorphisme d'acétylation. L'exemple le plus connu concerne l'iso-
niazide (Rimifon®). Sa biotransformation est catalysée par une N-acétyl transférase
à localisation hépatique préférentielle. Dans une population, il existe une répartition
bimodale de la capacité d'acétylation définissant les acétylateurs rapides (demi-vie
d'environ 2 h) et les acétylateurs lents (demi-vie d'environ 6 h) (figure 5). La réparti-
tion varie selon les ethnies. Environ 45% des Européens sont acétylateurs rapides
contre 80-90% des Asiatiques et la quasi totalité des Esquimaux. Ils ne sont par
contre que 17% parmi les Égyptiens. Le caractère acétylateur lent se transmet selon
99
le mode autosomique récessif. Pour une posologie standard les risques d'apparition
d'effets indésirables par surdosage, en particulier neurologiques, sont plus élevés
chez les acétylateurs lents ; mais en revanche chez les acétylateurs rapides la pro-
duction plus importante, in situ, d'un métabolite hépatotoxique majorerait le risque
d'hépatite.
L'adaptation posologique chez le sujet à risque, et en particulier chez l'enfant,
peut se faire à partir de l'administration d'une dose test et du dosage de l'isoniazide
plasmatique 3 h après. L'application de la formule ci-dessous permet de déterminer
l'indice d'acétylation:
Isoniazidémie à la 3
è
H + 0,6
--------------------------------------
Dose administrée (mg/kg/j)
Fréq.
24
20
16
12
8
4
0
Rapides (R/R ou R/r)
Leats (r/r)
100
Concentrations plasmatiques de lisoniazide mesurées 6 heures après
administration dune dose moyenne de 9,8 mg/kg à 267 membres de 53 familles
(daprès Evans)
En dehors de l'isoniazide, des tests basés sur l'acétylation d'autres molécules
ont également été standardisés : procaïnamide et son métabolite acétylé le NAPA
ou métabolites de la caféine entre autre. L'avantage du test à la caféine est qu'il
peut être réalisé après la simple prise d'un café, sans ingestion de molécule médi-
camenteuse.
L'intérêt du phénotypage d'acétylation dépasse l'adaptation posologique de
l'isoniazide puisqu'il permet également de prévoir le comportement vis-à-vis d'autres
médicaments qui suivent cette voie de métabolisation (hydralazine, procaïnamide,
dapsone, certains sulfamides, aminogluthétimide, caféine, nitrazépam, par exemple).
Le lupus érythémateux induit par l'hydralazine ou la procaïnamide se ren-
contre préférentiellement chez les acétylateurs lents, encore que d'autres facteurs
de prédisposition (typage HLA-DR4 par exemple) soient connus. Enfin, le phénotype
d'acétylation détermine également le métabolisme des amines aromatiques cancéri-
gènes ; ainsi le cancer de la vessie provoqué par les amines est plus fréquent chez
les acétylateurs lents exposés. D'autres pathologies associées au polymorphisme
d'acétylation sont également suspectées.
Le polymorphisme d'oxydation. L'oxydation est impliquée dans la métabolisation
d'un grand nombre de médicaments. Ils suivent la voie des mono-oxygénases hépa-
tiques sous la dépendance d'isoenzymes des cytochromes P450. Ce polymorphisme
a primitivement été mis en évidence avec la débrisoquine, une molécule antihyper-
tensive. Les fortes variations de sa posologie nécessaire pour contrôler l'hyperten-
sion a conduit à la mise en évidence d'un déficit en débrisoquine 4-hydroxylase chez
certains patients. C'est le cytochrome P450 II D6 qui est responsable de ce déficit
qui concerne 5-10% de la population de race blanche mais varie selon les ethnies ;
il se transmet sur le mode autosomique dominant. Pour dépister les métabolisateurs
lents, un test dit à la débrisoquine s'est diffusé. Après administration d'une dose test
de 10 mg, la molécule mère et son métabolite sont dosés dans les urines recueillies
pendant 8 heures. On calcule alors un quotient métabolique qui est compris entre
0,01 et 10 chez les métaboliseurs rapides mais entre 20 et 200 pour les métaboli-
seurs lents. Une vingtaine de médicaments sont métabolisés par le cytochrome
0 2 4 6 8 10 12
Concentration plasmatique de l’isoniazide µg/ml
101
P450 II D6 ; en particulier ce polymorphisme est observé pour les bêta-bloquants,
les antiarythmiques, les neuroleptiques, la plupart des antidépresseurs tricycliques
et les inhibiteurs de la recapture de la sérotonine. Ce test a servi dans de nombreu-
ses études visant à rechercher une susceptibilité particulière à des médicaments ou
des toxiques pouvant servir de support à l'apparition d'effets indésirables ou de cer-
taines pathologies d'étiologie mal connues. Différents autres tests se sont dévelop-
pés, tests au dextrométhorphan, à la sparteïne, à la caféine pour explorer cette
même voie métabolique. Mais il existe également d'autres polymorphismes d'oxyda-
tion indépendants de la voie suivie par la débrisoquine.
Les butyrylcholinestérases atypiques. Certains sujets (1 % de la population eu-
ropéenne) présentent une curarisation prolongée après administration de
succinylcholine. Chez ces personnes l'hydrolyse de la succinylcholine par les
pseudo-cholinestérases plasmatiques et hépatiques se fait très lentement, l'affinité
pour le substrat étant très diminuée par rapport à des sujets normaux. Les sujets
hypersensibles sont homozygotes pour le gène anormal, la fréquence étant évaluée
à 1/2 500. Il existe un moyen, le test à la dibucaïne, pour dépister les patients
porteurs. Cet anesthésique local inhibe in vitro les pseudocholinestérases normales,
alors qu'il n'a que peu d'effet sur les enzymes atypiques. Il est défini un Dibucaïne
Number (DN) qui est de l'ordre de 80 (correspondant à 80% d'inhibition) chez les
sujets sains, mais seulement de 20 chez les sujets porteurs de l'anomalie. Les
butyrylcholinestérases sont également impliquées dans l'inactivation d'autres
médicaments et drogues sans que les conséquences cliniques d'un déficit soient
très claires. En revanche, il existe des sujets qui hydrolysent la succinylcholine plus
rapidement que les personnes normales et qui, de ce fait sont résistantes à cette
substance. Beaucoup plus rare que l'hypersensibilité, cette anomalie porte le nom
de Cynthiana, du nom de la ville Américaine où furent caractérisés les premiers cas.
L'hypoxanthine-guanine phosphoribosyl transférase (HGPRT). Chez les pa-
tients souffrant d'un déficit en hypoxanthine-guanine phosphoribosyl transférase
(maladie de Lesch-Nyhan), les analogues des bases puriques (6-mercaptopurine :
Purinéthol®), azathioprine : Imurel®) utilisés comme anticancéreux ou immuno-
suppresseurs ne sont pas métabolisés. Ces molécules étant en fait des prodrogues
devant être transformées en nucléotides pour être actives, l'absence de métabolisa-
tion les rend inefficaces chez ces malades.
L'uridine diphosphate glucuronosyl transférase. La maladie de Gilbert (5 % de la
population Française) comme la maladie de Crigler-Najjar sont liées à un déficit de
l'uridine diphosphate glucuronosyl transférase. Ce défaut du mécanisme de la glucu-
roconjugaison induit une hyperbilirubinémie mais provoque également une sensibili-
té particulière à des médicaments qui suivent cette voie de métabolisation (paracé-
tamol, salicylés, hydrate de chloral, menthol, morphines, oxazépam, corticostéroïdes
par exemple).
Les enzymes de S- et 0-méthylation. Des déficits des thiopurines méthyltransféra-
ses et thiol méthyltransférases, enzymes respectivement impliquées dans le métabo-
lisme de la 6-mercaptopurine et de l'azathioprine et dans la S-méthylation du capto-
pril (Lopril®) et de la D-pénicillamine (Trolovol®), ont été rapportés. Il existe une
corrélation entre l'activité de la thiopurine méthyltransférase érythrocytaire et la
concentration en 6-thioguanine. Le niveau d'activité de la catéchol-O-méthyl transfé-
rase (COMT) est également contrôlé par le polymorphisme génétique. Où cette acti-
102
vité est impliquée dans le métabolisme de la l-dopa et de l'α-méthyldopa. Des inhibi-
teurs de la COMT sont à l'étude dans le traitement de la maladie de Parkinson.
Les glutathion-S-transférases (GST). Les GST représentent une famille d'enzy-
mes catalysant la conjugaison entre le glutathion réduit et une variété de molécules
électrophiles, y compris des carcinogènes. Elles sont fortement exprimées chez
l'homme dans les hépatocytes. Quatre isoformes sont décrites chez l'homme, l'ex-
pression des GST µ et θ étant soumises à un polymorphisme génétique. Un déficit
en GST µ semble lié à une fréquence accrue de cancers. La sensibilité à
l’hépatotoxicité de la tacrine (Cognex®) des patients souffrant de la maladie d'Alz-
heimer pourrait être liée à l'absence d'expression de GST empêchant la détoxifica-
tion de métabolites réactifs. Ce métabolisme interroge l'activité du cytochrome P450
1A2 qui peut être exploré, là encore, par un test à la caféine.
Alcool et aldéhyde déshydrogénases. L'alcool déshydrogénase (ADH) représente
la principale voie oxydative du métabolisme de l'éthanol ; elle catalyse la réaction
réversible des alcools primaire et secondaire en aldéhyde et cétone. Elle est égale-
ment impliquée dans l'interconversion rétinol-rétinal, le métabolisme des stéroïdes et
des acides biliaires mais aussi des composés digitaliques. Trois grandes classes
d'ADH sont connues ainsi qu'une forme atypique retrouvée chez seulement 5 à 10 %
des Anglais mais 85 % des Chinois et des Japonais. Les différences entre les for-
mes polymorphiques de l'ADH peuvent contribuer à expliquer les variations interin-
dividuelles de vitesse d'élimination de l'alcool. La compétition entre l'alcool et les
glycosides cardiaques pour l'ADH peut augmenter notablement leurs concentrations.
Les formes d'ADH à forte activité catalytique produisent de plus fortes concentra-
tions sanguines d'acétaldéhyde à l'origine des symptômes d'intolérance à l'alcool.
Mais un lien entre alcoolisme et génotype des isoenzymes d'ADH n'a pu être mis en
évidence. La détoxification de l'acétaldéhyde est sous la dépendance de l'aldéhyde
déshydrogénase (ALDH). Au moins quatre isoenzymes sont décrites. Un polymor-
phisme génétique a été mis en évidence pour l'isoenzyme mitochondriale hépatique
ALDH2. 50% des Chinois, des Japonais, des Indiens Sud Américains et des popula-
tions d'origine mongole présentent un déficit d'ALDH2 alors qu'il est totalement ab-
sent des populations de race blanche et noire. Il existe une corrélation positive entre
déficit en ALDH2, taux sanguin d'acétaldéhyde et hypersensibilité à l'alcool. Une
faible incidence de ce déficit est retrouvée chez les alcooliques. Plusieurs enzymes
de cette famille sont inhibées par le disulfiram (Espéral®) ou ses métabolites, expli-
quant son effet antabuse.
B. Variations d'ordre pharmacodynamique
1 - Au niveau d'une protéine
Un déficit ou une hyper-production enzymatique, une modification de la struc-
ture d'une protéine peuvent être responsables de l'apparition d'effets médicamen-
teux inconnus dans la population normale ou au contraire de l'absence de l'action
habituellement observée.
La glucose-6-phosphate-déshydrogénase (G6PD). La G6PD représente la prin-
cipale voie de production du NADPH du globule rouge, cofacteur indispensable au
cycle du glutathion. Le déficit du G6PD est une maladie génétique héréditaire liée
au sexe car le gène qui code cette enzyme se trouve sur le chromosome X. En ab-
103
sence du G6PD et en présence d'un oxydant, l'hémoglobine est dénaturée et préci-
pite sous la forme de corps de Heinz. Les hématies fragilisées sont exposées au
risque de crise hémolytique. Les deux principaux variants (G6PDA
-
et G6PDA
+
) af-
fectent les Noirs Américains, les populations Méditerranéennes et les africains où
l'hémolyse est la plus sévère. Il est à noter que l'activité de la G6PD est toujours
faible chez le nouveau-né, le rendant sensible au risque hémolytique. Ce déficit ne
s'exprime qu'en présence d'un xéno biotique oxydant qui peut être un aliment (fève)
ou un médicament. La transmission est liée au sexe.
Les porteurs hétérozygotes sont plus résistants à l'infection par Plasmodium falcipa-
rum, ce qui expliquerait la conservation du gène dans la population.
De nombreux médicaments provoquent des accidents hémolytiques en particulier
parmi les antipaludéens, les antalgiques et les anti-infectieux (Tableau).
Tableau IX.II: Quelques médicaments pouvant déclencher une hémolyse chez un
sujet atteint de déficit érythrocytaire en G6PD
Médicaments qui provoquent une anémie hémolytique cliniquement significative
chez les sujets avec déficit en G6PD
Antimalariques :
Pamaquine
Primaquine, mepacrine
Analgésiques :
Acide acetylsalicylique, phenacétine
Acetanilide, aminophenazone
Nitofuranes :
nitrofurantoine
nitrofurasone
Sulfones:
diaminodimetylsulfone
thiazolsulfone
Sulfamides:
sulfacetamide,
Autres:
bleu de méthylène
104
sulfamotoxazole
sulfanilamide, sulfapiridine
acide ascorbique
phenylhydrazine
probénécide
Par ailleurs, dans certaines hémoglobinopathies, l'hémoglobine est également ins-
table, facilement dénaturée en corps de Heinz et associée à des crises hémolytiques
induites par des médicaments.
La methémoglobinémie. Plusieurs modifications structurelles de l'hémoglobine ou
de la methémoglobine réductase peuvent être responsables de la methémoglobiné-
mie congénitale. Chez les patients atteints, les substances connues pour être à l'ori-
gine de la formation de methémoglobine doivent être evitées (oxydants directs : ni-
trates, nitrites, chlorates, quinines ou indirects : aniline...) ainsi que tous les médi-
caments contre-indiqués dans le déficit en G6PD.
La delta aminolévulinique synthétase (ALA-synthétase). Les porphyries sont ca-
ractérisées par une anomalie de la régulation de la synthèse de l'hème due à un
déficit enzymatique. Ce déficit entraîne une dérégulation de l'ALA synthétase et
conduit à l'accumulation de grandes quantités de précurseurs de l'hème. Selon le
site primaire d'expression de l'anomalie génétique, différents précurseurs vont s'ac-
cumuler correspondant à des formes différentes de la maladie. Le lien entre l'accu-
mulation de ces précurseurs et les symptômes de la maladie est encore mal appré-
hendé. Les précurseurs sont éliminés dans les urines où ils sont transformés en
porphyrines. Ces maladies se transmettent selon le mode autosomique dominant.
Chez les malades porteurs de cette anomalie, des crises, parfois mortelles, sont dé-
clenchées par les médicaments inducteurs enzymatiques qui, en augmentant encore
l'activité de l'ALA-synthétase, majorent les conséquences de sa dysrégulation. Parmi
les principaux, figurent les barbituriques, la phénytoïne, l'alcool mais aussi la chlo-
roquine, les sulfamides, l'amidopyrine, la griséofulvine, les oestrogènes, liste non
limitative. Les malades porteurs de cette affection doivent être précisément informés
des médicaments et autres substances qui leur sont contre-indiqués.
Certains produits particulièrement puissants, comme par exemple un fongicide
l'hexachlorobenzène, peuvent déclencher des porphyries, d'origine toxique, même
chez des personnes non porteuses d'anomalies héréditaires.
Tableau IX.III: fréquences zygotiques du HbS, HbC, Alpha
-3.7
Thal et G6PDA
-
au Burkina Faso
Groupe Ethnique Fréquences genotypiques
HbS HbC
Alpha
-3.7
Thal G6PDA
-
Mossi (M) 0.024 (8/334) 0.117 (39/334) 0.227 (25/110) 0.195 (51/262)
Rimaibé (R) 0.030 (7/236) 0.127 (30/236) 0.134 (15/112) 0.185 (25/135)
M+R 0.026 (15/570) 0.121 (69/570) 0.180 (40/222) 0.191 (76/397)
Fulani (F) 0.022 (3/136) 0.059 (8/136) 0.103 (12/116) 0.069 (7/101)
2 - Au niveau d'un récepteur
105
Des modifications de l'affinité d'un récepteur peuvent également expliquer
une variabilité de l'action de certaines molécules et en particulier rendre compte de
la résistance à un médicament.
La résistance à la warfarine. Chez quelques rares malades l'administration, même
à forte dose, de warfarine ne s'accompagne pas de modifications du taux de pro-
thrombine. Les anticoagulants coumariniques inhibent la coagulation en bloquant la
synthèse hépatique vitamine K dépendante de quatre protéines impliquées dans le
processus (facteurs II, VII, IX et X). Ils bloquent le cycle de régénération de la vita-
mine K. L'exploration des patients résistants a montré l'absence de modifications
pharmacocinétiques de la warfarine. Il s'agirait en fait d'une modification génétique
du récepteur hépatique.
La résistance aux hormones stéroïdes. La résistance se manifeste à la fois pour
les hormones endogènes et exogènes. Différents syndromes de résistance aux an-
drogènes sont connus. Ils sont liés au chromosome X et correspondent à une modi-
fication de récepteurs intracytoplasmiques. Certains types de résistance à la vita-
mine D sont également reliés à un dysfonctionnement du récepteur tissulaire.
Autres syndromes. Les patients souffrant de mucoviscidose présentent des répon-
ses anormales aux molécules à propriété α-adrénergique, β-adrénergique et choli-
nergique. La trisomie 21 s'accompagne d'une hypersensibilité à l'atropine et aux β-
adrénergiques. La dysautonomie familiale est associée à une hypersensibilité à la
noradrénaline. L'insensibilité à l'amertume de la phénylthiourée ou à l'odeur de cya-
nure sont dues à une anomalie héréditaire des récepteurs sensoriels correspon-
dants.
3 - Variations de mécanisme mal déterminé
L'hypertension oculaire aux corticoïdes. L'administration de collyre aux corticoï-
des provoque dans 5% de la population un glaucome aigu par augmentation de la
pression intra-oculaire. Cette réponse, dont l'éthiopathogénie n'est pas connue, se
transmet selon le mode autosomique récessif.
L'hyperthermie maligne déclenchée par une anesthésie générale. L'incidence
en serait de 1 pour 15 000 anesthésies chez l'enfant et de 1 pour 50 000 à 100 000
chez l'adulte. Le syndrome comprend une très forte hyperthermie, qui peut atteindre
43°, une tachycardie, des arythmies et une rigidité musculaire. L'évolution est le plus
souvent mortelle. Le caractère familial est établi et cette susceptibilité particulière
pourrait être liée à une augmentation idiopathique du calcium sarcoplasmique.
L'anomalie peut être détectée de façon préventive sur une biopsie musculaire, le
muscle des personnes concernées présentant une réponse contractile anormale
quand il est exposé à la caféine ou à l'halothane.
L'anémie aplasique au chloramphénicol. En dehors de l'aplasie réversible dose-
dépendante, dans quelques rares cas, le chloramphénicol peut déclencher une apla-
sie irréversible dose-indépendante chez des sujets génétiquement prédisposés.
Nous venons de passer en revue les principaux facteurs de variation de l'acti-
vité des médicaments. On en retiendra que ces connaissances méritent d'être hié-
rarchisées : certaines relèvent surtout d'une recherche fondamentale tandis que
d'autres présentent une pertinence clinique. Le monitoring médicamenteux comme
106
les différents tests de phénotypages disponsibles représentent une aide spécialisée
à la thérapeutique. Ces notions s'intègrent au développement du médicament ; les
essais cliniques de phase I et II s'efforcent de maîtriser ces facteurs de variation.
BIBLIOGRAPHIE ET REFERENCES
ANTHONY J.F. GRIFFITHS, JEFFREY H. MILLER, DAVID T. SUZUKI, RICHARD C. LEWONTIN,
WILLIAM. M. GELBART, An introduction to genetics analysis, Seventh edition, Freeman, USA 2000.
BENTUÉ-FERRER, REYMANN, les facteurs de variation de l’activité des médicaments, cours
BRUCE A. , Dennis B., Biologie moléculaire de la cellule, Flammarion, Médecine-Sciences, Paris
1995.
CARUSO M, KLATZMANN D. Genetically controlled pharmacomodulation for HIV gene
therapy. CR Acad Sci Paris 1994 ; 317 : 1027-30.
CARUSO M, KLATZMANN D. Selective killing of CD4
+
cells harboring a human immunode-
ficiency virus-inducible suicide gene prevents viral spread in an infected cell population.
Proc Natl Acad Sci USA 1992 ; 89 : 182-6.
107
CHEVALLIER M. D., Rapport sur les applications des biotechnologies à l’agriculture et à l’industrie
agroalimentaire, Office Parlementaire des choix scientifiques et technologiques, Assemblée Natio-
nale Française,
DEFAYE J. , et al. (eds), Risk managementin Biotechnology, Technique DNA tests, n.05200301203,
US Government Printing Office,
ERLICH H.A. –ARNHEIM N., Genetic analysis using the polymerase chain reaction (PCR), « Annu.
Rev. Genet. », 1992, 26 pp. 479-506.
GLICK BERNARD R., PASTERNAK JACK J., Molecular biotechnology, ASM press, second edition,
Washington 1998.
KAPLAN J.C., Biologie moléculaire et médecine, « 2°édition, Médecine-Sciences,
KRIMSKY S., Genetic Alchemy : a social history of the DNA Controversy,
Lemoine F.M.; D. KLATZMANN; S. HERSON; Thérapie génique de l'infection par le VIH,
Virologie. Vol. 3, Numéro 3, Mai - Juin 1999 : 217-26.
LONCLE D., Amaudric M., Génie Génétique, Doin, Paris 1991,
MARGARET W., génétique médicale, médecine-sciences, Paris 1995.
MERTENS T. R. Human genetics : readings on the implications of genetic engeering, John Wiley and
Sons, New York 1975.
NUSSBAUM ROBERT L, Genetics in medicine, Saunders\company, sixth edition, USA 2001.
PAOLETTI R., NICOSIA S., CLEMENTI F., FUMAGALI G., Pharmacologie générale et moléculaire,
Seconde édition, UTET, Turin 2003.
SIMPORE J. , Thérapie génique implications, perspectives et éthique, Camillianum, n° 11, Rome
1995, p. 67-100.
SIMPORE J., Génie génétique : procédés biotechnologies, enjeux thérapeutiques, économiques et
éthiques, imprimerie du MSSRS, Ouagadougou septembre 2000.
WATSON J., Gilman M., DNA Ricombinante, Zanichelli, Bologna 1994 pp. 375-389.
WILLIAMSON B., Gene therapy, « Nature », 1982, 298, pp. 262-264.

Le Serment éthique pour les chercheurs en sciences de la vie, adapté et inspiré du Serment d'Hippocrate médical,
(Science Vol. 286, 19 Nov. 1999, p.1475).

« Je jure d'être fidèle à l'éthique du respect des personnes et des vies humaines et de contribuer au développement de la connaissance et à la plus large diffusion du savoir.

Je respecterai toutes les espèces dans leur biodiversité : ce respect inspirera
mes actes et mes projets, notamment au cours de mes expérimentations sur les animaux ou les tissus humains.

Je m'efforcerai de soulager les souffrances de tous les êtres vivants. Admis(e) à avoir accès à l'intimité tissulaire ou génétique des personnes, je
tairai leur identité et m'astreindrai au secret médical.

Même sous la contrainte, je ne ferai pas usage de mes connaissances contre
les lois de l'humanité.

Je préserverai l'indépendance nécessaire à l'accomplissement de ma mission. Je m'informerai et réfléchirai au sens de mes expérimentations et à leurs
conséquences.

Je veillerai à ce que mes travaux et recherches ne soient pas utilisés à des
fins de destruction ou de manipulation.

Je respecterai les savoirs des ethnies et des sociétés traditionnelles. Je n'aurai garde d'oublier mes responsabilités à l'égard des générations présentes et futures.

Je n'accepterai pas que des considérations de nationalité, de culture, de politique ou d'avantages matériels me détournent de mes devoirs.

J'interviendrai pour défendre, s'il m'en est donné l'occasion, l'ensemble de ces
règles.

Que les hommes et mes confrères m'accordent leur estime si je suis fidèle à
mes promesses.

Que je sois déshonoré (e) et méprisé (e) si j’y manque ».

2

Pages SERMENT POUR LES CHERCHEURS EN SCIENCES DE LA VIE INTRODUCTION 02 05

PREMIERE PARTIE: LES OUTILS DE LA BIOLOGIE MOLECULAIRE
CHAPITRE I : TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE ET DE QUANTIFICATION DES ACIDES NUCLEIQUES, I. Extraction, précipitation de L’ADN des eucaryotes et des procaryotes II. Contrôle de la pureté de l'ADN extrait III: Quantification de l'ADN 10 CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES, YAC, BAC, VIRUS

07

08

08 10

13

I- Les vecteurs en génie génétique : l'ADN plasmidique II- L'ADN phagique III. Cosmides, YAC et BAC

13 17 20

Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE, CARTE DE RESTRICTION I. Enzymes de restriction II. L’électrophorèse sur gel III. Les enzymes utiles en génie génétique: CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. I - Le clonage II - Les banques génomiques III - Les banques de cADN IV - L’étude de l’ADN cloné CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION DES GÈNES EUCARYOTES DANS LES BACTÉRIES. I - Les mutagenèses II. Mise en évidence des effets de la modification III. Transfert de l’ADN modifié

24

24 30 31 36 36 36 38 40 51

51 56 57

3

Les désordres pharmacogénétiques 60 60 63 63 64 64 65 68 71 71 73 77 82 82 83 87 87 88 93 93 98 98 99 100 101 107 107 111 4 . – Le plasmide Ti II – Le Terminator III – Application des techniques du génie génétique à l’agriculture CHAPITRE VIII : LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX ANIMAUX I – Les insectes transgéniques II – Les animaux transgéniques CHAPITRE IX : CLONAGE DES MAMMIFERES. IV.La parthénogenèse: IV . La technique de l'ADN recombinant (ADNr) II – Synthèse du facteur VIII humain III – Synthèse de l’insuline humaine IV .La thérapie génique: CHAPITRE X : LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES DANS LA RECHERCHE SUR LE VIH/SIDA I – Structure du VIH II . CELLULES SOUCHES EMBRYONNAIRES. THERAPIE GENIQUE I – Clonage des organismes entiers II – Les cellules souches embryonnaires III .Les nouvelles molécules antivirales en développement: III. Vers l’espoir d’obtenir un jour un vaccin anti-VIH. PARTHENOGENESE.Généralité : Pharmacogénétique et pharmacogénomie II . PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE I .DEUXIEME PARTIE : APPLICTION DE LA BIOLOGIE MOLECULAIRE : LE GENIE GENETIQUE 59 CHAPITRE VI: LES TECHNOLOGIE DU GENIE GENETIQUE APPLIQUEES AUX MICRO-ORGANISMES I. Le génie génétique et la lutte contre le VIH.Synthèse de l’hormone de croissance (GH) V – Production de vaccins VI .Production de nouvelles antibiotiques VII – Production d’aliments fermentées CHAPITRE VII: LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX VEGETAUX I.

Ces techniques doivent permettre une meilleure compréhension génétique et fonctionnelle des organismes vivants. dont il code et détermine la structure (Projet Séquençage génome humain février 2001). être réinséré dans une molécule d’ADN d’origine différente. Cependant. • de cloner et d’amplifier. Le génie génétique permet : • d’identifier et d’isoler. pour séquencer. des vaccins.BIBLIOGRAPHIE INTRODUCTION 120 Les méthodes et les techniques de biologie moléculaire développées durant ces dernières décennies. de le découper et de l’isoler ensuite des autres molécules d’ADN. ce qui permet de transférer de l’information génétique d’une cellule vers une autre dans laquelle il pourra diriger la production d’une protéine particulière. bactériophages. • de modifier et de transférer. virus. des anticorps monoclonaux et il offre des perspectives nouvelles dans 5 . Il s’agit donc d’un outil.000 gènes environ que compte l’être humain. aux applications très variées qui permet d’intervenir avec une grande précision sur le patrimoine génétique de tous les organisme vivants. transférer et analyser les produits de l’expression du matériel génétique des diverses espèces vivantes ont donné lieu à une application sous le nom de « génie génétique ». « recombiner ». à la fin. Le résultat obtenu au cours de cette manipulation est la protéine originelle du premier organisme. Les applications directes de la biologie moléculaire: • En biotechnologie: le génie génétique permet de faire produire par des micro-organismes recombinants des protéines eucaryotes comme des hormones. Le transfert transitoire ou stable d’un DNA étranger dans une cellule procaryote ou eucaryote s’opère grâce à des vecteurs naturels et à de nouveaux vecteurs issus des constructions: plasmides. • de contrôler l’expression d’un gène ou d’un transgène dans le matériel biologique. Le gène isolé peut. cosmides etc. le génie génétique permet également d’apporter des modifications à des gènes par une mutagenèse dirigée qui par conséquent produiront des protéines modifiées ou recombinantes. de l’amplifier afin qu’il soit plus facile d’accès. Cette technique permet d’identifier un gène spécifique parmi les 30.

La thérapie génique somatique qui est différente de la thérapie génique germinale. Leur transfert et leur expression. de son stade de développement ou de différenciation. le champ d’application du génie génétique. aujourd’hui un champ d’application très large et nous ouvre des perspectives nouvelles. Ainsi. isoler et modifier un gène particulier. les génies généticiens cherchent à localiser et à séquencer non seulement les gènes responsables des maladies héréditaires mais aussi la totalité du génome humain pour créer la cartographie génique de l’homme. • Protection sociale et législation: La médecine «légale» à travers la technique de l'ADN «finger printing» peut individualiser une personne humaine sans équivoque car cette technique ne requiert que quelques cellules de la personne concernée (cellules sanguines. des micro chips. cellules épithéliales. dans l’amélioration génétique des espèces animales et végétales. 6 . le génome humain a été entièrement séquencé . • En médecine: le but du génie génétique est la prédiction. le génie génétique a ses limites. Aujourd’hui. la production d’une protéine de nature et de fonction données peut nécessiter des informations présentes à plusieurs endroits de l’ADN. • Perspective pour demain: avec le projet du génome humain et la technique du clonage positionnel. Il s'agit incontestablement d’une technologie clé pour ce troisième millénaire. afin de fournir à l’organisme les quantités et les qualités précises de cette protéine en fonction de son rôle biologique. le diagnostic des maladies héréditaires et leur soin à travers la thérapie génique et la pharmacogénétique. Si la technologie génétique sait parfaitement identifier. dans un organisme vivant.l’industrie agroalimentaire. consiste à transférer certains gènes dans les cellules du patient pour prévenir l’apparition d’une maladie ou en ralentir l’évolution.000 à 30. sans doute. pour l’instant.000 gènes de l’organisme humain ? Le génie génétique possède. comme toute technique. elle a beaucoup plus de difficultés à l’heure actuelle pour déterminer les liens existant entre les différents gènes. posent encore des problèmes qui restreignent. parfois ectopique. Cependant. Plusieurs gènes doivent donc s’associer dans ce processus. cellules osseuses ou simplement quelques boucles de cheveux). Ce type de génothérapie suscite de très grands espoirs. Ces informations plus complexes et plus complètes peuvent amener un gène à produire de façon différente une même protéine selon l’état physiologique de la cellule. mais une nouvelle problématique se pose: comment déterminer les interactions existantes entre les 20.

PREMIÈRE PARTIE : LES OUTILS DE LA BIOLOGIE MOLECULAIRE 7 .

Un prélèvement de 5 à 10 ml de sang recueilli sur un anticoagulant comme l'EDTA. DE CONTRÔLE DE PURETE ET DE QUANTIFICATION DES ACIDES NUCLEIQUES. PRÉCIPITATION DE L’ADN DES EUCARYOTES ET DES PROCARYOTES Toutes les méthodes biochimiques qui permettent d’extraire l’ADN dans les différents tissus peuvent être utilisées en fonction des espèces. et en tenant compte de la structure anatomique des cellules. Un traitement par la protéinase K (une protéase) permet de libérer le DNA nucléaire en digérant les histones qui lui sont associées dans les chromosomes eucaryotes. comme le SDS (Sodium DodécylSulfate) qui permet de désagréger les membranes cellulaires et de libérer les contenus cytoplasmiques et nucléaires. Nous prendrons comme exemple. Pour ce qui concerne le génome humain comme pour tous les mammifères.CHAPITRE I : TECHNIQUES D’EXTRACTION. les leucocytes sanguins constituent une source simple de DNA pour les études de biologie moléculaire. En biochimie classique et pour d’autres applications. permet d’obtenir quelques centaines de microgrammes de DNA sous la forme de fragments de taille supérieure à 20 kbases. les cellules eucaryotes humaines. Le sang fraîchement recueilli (avec un anticoagulant comme l’EDTA) ou décongelé est vigoureusement mélangé à une solution hypotonique pour faire éclater les hématies dépourvues de noyaux. Les acides nucléiques n'y sont pas non plus solubles et restent dans le surnageant aqueux. I. il faut d’abord séparer les noyaux du contenu cytoplasmique et de ces organites cellulaires. L'élimination des protéines non digérées et des lipides se réalise par des précipitions et des extractions sélectives. en l’occurrence les cellules sanguines qui sont très accessibles compte tenu de la moralité et du bénéfice du doute. Cette quantité est suffisante pour entreprendre une expérience d’application en génie génétique. La lyse des cellules eucaryotes. La lyse des cellules sanguines met en jeu l’intervention de détergents ioniques qui désorganisent la double couche de phospholipides des membranes cellulaires. 1. Ils sont ensuite traités par un mélange de détergent. EXTRACTION. Le mélange phénol-chloroforme permet de dénaturer les protéines car non miscible à l’eau et de densité supérieure à cette dernière. Les leucocytes sont alors récupérés par centrifugation suivie d’un lavage avec la même solution hypotonique. 8 .

3 : Organigrammes de l’extraction et de la purification de l‘ADN des procaryotes 9 . il convient de procéder à d’autres purifications. Pour les analyses génétiques (application des diagnostics de routine). Le mélange phénol-chloroforme non miscible à l’eau permet de transférer les protéines dans la phase organique alors que les acides nucléiques restent dans la phase aqueuse. les traces de phénol et des composés organiques qui y sont solubles. La lyse cellulaire utilise ici une enzyme : le lysozyme qui permet de dégrader la membrane cellulaire. le DNA obtenu est de qualité suffisante et peut être quantifié par simple pesée. 2. Les acides nucléiques sont alors à récupérer de la phase aqueuse par des précipitations à l’alcool éthylique ou à l’isopropanol en fonction des besoins. Une congélation préalable permet de transformer les tissus en une masse solide qui se prête alors à un concassage par les techniques courantes de broyage. Il peut aussi être re-dissout dans un tampon stérile de force ionique moyenne contenant de l'EDTA et dont le pH est compris entre 7 et 8 Figure I. c'est à dire. L’extraction et la purification suivent alors le même protocole. La phase aqueuse résultante peut subir plusieurs extractions par un mélange chloroforme-éther pour éliminer les peptides restants. La purification suit le même schéma que pour celle de l’ADN des eucaryotes. la bactérie la plus utilisée pour les analyses en biologie moléculaire.2/I. dépourvue d'activité DNAase. L'élimination de l'ARN peut être effectuée à la fin ou avant l'étape phénolique. il est conseiller de les désagréger par les techniques courantes de biochimie comme le broyage ou les ultrasons. Pour des études biochimiques fines de structure. Pour cela.1 : Méthode classique de l’extraction et de la purification de l’ADN Figure I.Pour les tissus. on utilise une RNAase pure ou "DNAase free". L’ADN des procaryotes Le schéma de la figure I.2 résume les différents étapes de l’extraction et de la purification de l’ADN d’Escherischia coli. L’extraction de l’ADN par le mélange phénol / chloroforme. L’ADN récupéré sous forme de fibres peut être conservé sous la forme solide pendant des temps très longs. 3. On obtient alors les acides nucléiques sous la forme de fibres solides que l’on récupère par centrifugation.

Après une centrifugation pour éliminer les débris cellulaires. Les protéines. permet également d’estimer les contaminations éventuelles et permet aussi de quantifier l’ADN de la préparation.Un agent dissociant (thiocyanate ou guanidine) . Il peut se conserver congelé à –70°C pendant un an. Elles peuvent résister à un traitement à 90°C pendant une heure. l’extraction. les RNA sont extraits suivant plusieurs techniques. de dénaturer les acides nucléiques et de dissocier les protéines. CONTRÔLE DE LA PURETÉ DE L'ADN EXTRAIT Le maximum d'absorption des acides nucléiques se situe à 260 nm. Le rapport R= A260nm / A280nm constitue alors un bon moyen pour apprécier une éventuelle contamination de la préparation d'ADN par les protéines ou par les RNA. les tissus ou les cellules sont homogénéisés dans un tamPour pon acétate contenant : . 10 . principaux contaminant des préparations absorbent aussi à 260 nm. Les ARN étant en simple brin.8 < R < 2 R < 1. mais avec maximum d'absorption qui se situe vers 280 nm à cause des acides aminés aromatiques. le coefficient moyen d’absorption d’un nucléotide est supérieur à celui du même nucléotide dans la double hélice à cause de l’hypochromisme. II.Un détergent puissant (SDS ou sarcosyl) . La technique par précipitation différentielle du RNA et du DNA en fonction du pH et de la concentration en éthanol donne de très bons rendements. Extraction des ARN Les ARN sont plus difficiles à étudier parce qu’ils sont très sensibles aux ribonucléases (RNase A) qui sont très actives et présentes même sur les doigts du manipulateur.7 R>2 Le spectre d'absorption U.Un agent réducteur (DTT ou 2-mercaptoéthanol) Ce type de tampon permet d’inhiber les RNases endogènes.V. -Un épaulement à 280 nm indique une contamination protéique. Il faut donc des conditions de stérilité parfaite pour travailler avec ces acides nucléiques. *R = A260nm/A280nm * ADN pur: * ADN contaminé par les protéines: * ADN contaminé par les ARN: 1. Le culot est récupéré. -Un épaulement à 270 nm indique une contamination par phénol. On peut également utiliser l’ultracentrifugation. L’apparition d’épaulements donne une idée des différents contaminant. Une contamination par les ARN se traduit par une augmentation du rapport R.4. lavé avec le tampon acétate et précipité à l’éthanol.

Dosage fluorimétrique classique de l'ADN.l = Une unité d’absorbance correspond à 25 g/ml de RNA ou d’ADN simple brin. La quantification exacte consiste alors à établir une courbe d’étalonnage donnant l’intensité de fluorescence d’une solution de BET à laquelle on ajoute des quantités croissantes de DNA de concentration connue. cette méthode est peu sensible pour manipuler des concentrations d'ADN inférieures à 250 ηg/ml c. Le BET peut être remplacé par un autre colorant pour augmenter la sensibilité de la mesure. Malheureusement.-Un épaulement à 230 nm indique une contamination par les glucides. Par cette méthode on peut déceler des quantités de DNA de l’ordre de 50 ηg/ml. Dosage de l'ADN par fluorescence en présence de BET Le Bromure d'Ethidium (BET) interagit avec l'ADN en s’y intercalant et une fois intercalé. En milieu acide à chaud. La concentration de l’ADN d’une préparation peut être alors calculée par la relation : A= ε. . ou mieux après photographie. On utilise un spectrofluorimètre pour mesurer l'intensité de la fluorescence d'une solution d'ADN en présence d'un excès de BET. une unité d'absorbance correspond à une concentration d’ADN double brin de 50 µg / ml. (Gamme d'étalonnage). Le principe de la quantification consiste à comparer à l’ il nu (estimation).C. Figure I. le rendement de fluorescence du colorant devient cent fois plus important. de la concentration en ADN A 260 avec un trajet optique de 1 cm. l'intensité de la fluorescence émise par l'ADN sur un gel d’électrophorèse.Dosage colorimétrique de l'ADN Il est basé sur la réaction spécifique des 2-désoxypentoses avec la diphénylamine. d. -En absence d'impuretés l'absorbance de la solution d’ADN à 320 nm doit être autour de zéro.V. Cette méthode permet de mesurer des quantités d’ADN de l’ordre de quelques picogrammes.4 : Spectre d’absorption de l’ADN III: QUANTIFICATION DE L'ADN a. b: Dosage par absorption U. On compare ensuite les valeurs de ces intensités avec celle d'une solution d'ADN standard (courbe standard). 11 . C’est la méthode classique pour mesurer des quantités importantes de DNA (de l’ordre de quelques milligrammes). le 2-désoxyribose des nucléotides puriques peut être libérés et former un composé bleu dont le maximum d'absorption se situe à 595 nm.

LES VECTEURS EN GÉNIE GÉNÉTIQUE : L'ADN PLASMIDIQUE 1. BAC. 12 . la production des protéines codées par les gènes contenus dans l’ADN inséré. PHAGES. COSMIDES. La plupart des plasmides naturels contiennent des gènes qui confèrent à l'hôte des propriétés supplémentaires comme la résistance aux antibiotiques. Les plasmides naturels dits de première génération ont été utilisés dans le passé comme vecteur de clonage. Leurs utilisations majeures comme vecteurs en génie génétique sont : Le clonage et l'amplification d'une séquence d'ADN exogène. b : Caractéristiques des plasmides utilisés en génie génétique La cellule hôte la plus utilisée est Escherichia coli. Un second gène marqueur phénotypique (soit un deuxième gène de résistance à un second antibiotique ou le gène Lac Z' ) qui permet de reconnaître parmi les colonies transformées celles qui hébergent un plasmide recombinant. a : Définition : Les plasmides sont de petites molécules d'ADN bicaténaires. susceptibles de se répliquer de façon autonome (réplicons). Une bactérie peut posséder un très grand nombre de copies plasmidiques.CHAPITRE II : LES VECTEURS : PLASMIDES. extra-chromosomiques. A l'échelle industrielle. elles sont transférables d’une bactérie à une autre au cours de la conjugaison bactérienne. Les plasmides. mais les plasmides utilisés actuellement sont modifiés et sont donc des chimères obtenues par des recombinaisons de différents plasmides naturels et de DNA viral. L'étude des mécanismes de l'expression d'une séquence d'ADN exogène. circulaires. YAC. L'introduction des gènes dans les cellules bactériennes (transformation) ou animales (transfections) ou dans des organismes entiers (animaux transgéniques). Leur ADN comprend au minimum les gènes intervenant dans la réplication et la ségrégation de leur matériel génétique dans les cellules filles à chaque cycle de division cellulaire de la cellule hôte Figure II. Ils sont petits de taille pour permettre l'insertion d'une importante quantité d'ADN exogène tout en maintenant une bonne efficacité de transformation. ce qui permet la sélection des cellules résistantes qui survivent sur un milieu contenant l’antibiotique en question.1. Le nombre de copies par cellule est très important (plusieurs centaines par cellule) Un gène de résistance à un antibiotique auquel la souche hôte est sensible. Une bactérie peut posséder en même temps plusieurs plasmides différents sauf si leur co-habitation est incompatible avec la survie de la bactérie. Ils possèdent : Une origine de réplication de type relâché : la séquence ori. Ils sont présents dans le cytoplasme de nombreuses espèces bactériennes. VIRUS I . Un ou plusieurs sites de restriction (polylinker) qui permettent la linéarisation du plasmide préalable à l'insertion de l'ADN exogène.

Ces dernières doivent avoir été transformés avec succès par une molécule de plasmide recombinante. Il contient 2 gènes de résistance aux antibiotiques. Un segment d'ADN synthétique appelé adaptateur (en anglais. ce qui explique le très grand nombre de copies des plasmides pUC dans une cellule bactérienne et par suite des vecteurs de troisième génération qui en dérivent. Figure II. par exemple. qui se traduit par l'incapacité de la cellule hôte à convertir le substrat artificiel X-Galactoside en un colorant bleu (X= paranitrophénol). indiqué par le phénotype tetS (sensible). X-Galactoside → X (colorant bleu) + Galactose En résumé. seules les colonies ampR tetS contiennent de l'ADN recombinant (ADN du plasmide et ADN inséré). Expérimentalement ils sont utilisés comme vecteur pour transporter de l’ADN exogène. 13 . seules celles qui s'avèrent sensibles à la tétracycline contiennent une insertion.c : Deux vecteurs plasmidiques : pBR 322 et pUC18 Le plasmide pBR322 est très simple dans sa structure. les plasmides sont des fragments d'ADN extra-chromosomiques circulaire présents dans les bactéries et susceptibles de se répliquer de façon autonome. Cette préparation est alors utilisée pour transformer les bactéries et sélectionner les colonies résistantes à l'ampicilline. Figure II. L'insertion d’un vecteur dans pUC est détecté par l'inactivation de la fonction galactosidase du gène Z'. C'est pourquoi le protocole de clonage consistera à mélanger l’ADN du plasmide et l’ADN du donneur digérés par une même enzyme de restriction suivi d’une ligaturation.2 : Le plasmide pBR322 d : Les plasmides pUC Les plasmides de la famille pUC sont des vecteurs plus élaborés dont la structure permet la sélection visuelle directe des colonies contenant l’ADN inséré. L'ADN du donneur peut être. Ils peuvent porter des gènes de résistances aux antibiotiques. Une insertion réussie se traduira par l'inactivation de ce gène qui ne sera plus capable de conférer la résistance à la tétracycline à la cellule hôte. L'élément clé est une petite portion du gène de la β-galactosidase d’Escherichia coli. polylinker ou cloning site) contient de nombreux sites de restriction utiles pour l'insertion des fragments de l'ADN du donneur.3 : plasmides pUC L’origine de réplication ori des plasmides pUC diffère légèrement par mutations de celle de pBR322. inséré dans le gène tetR. Chacun de ces gènes contient un site de restriction qui est utilisé pour le clonage. en d'autres termes. Parmi les colonies AmpR. tetR et ampR. L'adaptateur est en phase avec la séquence codant la β-galactosidase mais n'interfère pas avec son fonctionnement. L’insertion de l’ADN étranger dans pBR322 est détectée par l’inactivation du gène de résistance (tetR).

Le gène LacZ permet la sélection des recombinants par la couleur des colonies. le gène de résistance à l’ampicilline AmpR et une partie du gène lacZ. 11 sont localisés dans les gènes de résistance aux antibiotiques. Il s'agit des plasmides ColE1. Sal 1. Ces types de plasmides n'ont pas les propriétés requises pour les manipulations génétiques. Les plasmides de première génération: ce sont les plasmides rencontrés dans la nature. Pvu 1. 1 : Quelques caractéristiques des deux plasmides utilisés en génie génétique. Leur petite taille permet l’insertion d’un ADN assez grand et une croissance rapide des plasmides. Xma 1 et Nru 1 dans le gène TcR Cla 1 et Hinh III dans le promoteur du gène TcR Pst 1. BamH 1. et Sca 1 dans le gène AmpR L'insertion d'ADN étranger dans un quelconque de ces sites se traduit par la perte de la résistance à l'antibiotique. Il faut donc pour cela utiliser les bactéries lac-. Nde I. pSC101. Il possède deux gènes de résistance aux antibiotiques : l’un pour la tétracycline TcR et l’autre pour l’ampicilline AmpR et 20 sites uniques pour les enzymes de restriction.Vecteurs Taille en bp pBR322 4363 Nombres de Marqueur phénotycopies par cel. Un polylinker est inséré dans le gène lacZ. Hind III. la famille pUC: Ce plasmide de 2 600 paires de bases environ dont pUC18 possèdent : un promoteur et un opérateur efficace de transcription. Afl III 13 sites de restriction sur un polylinker Tableau I. La présence de ce polylinker n’interfère pas avec le fonctionnement du gène de la -galatosidase. RSF2124. (pBR312 à 328) obtenus par construction. Les plasmides de seconde génération: ce sont les plasmides de la famille pBR. Le plus utilisé est le plasmide pBR322. Pvu II. constitué de 4 363 paires de bases. 14 .pique lule 15 à 20 Tétracycline Ampicilline ≈ 500 Ampicilline Lac Z' pPUC18 686 Quelques sites uniques de restriction EcoR I. Parmi les sites uniques. Sph 1. EcoR V. Les plasmides de 3ème génération : Ces plasmides ont été construits pour faciliter le travail de sous clonage et pour une sélection des clones recombinants. Les différents plasmides de cette famille diffèrent les uns des autres par la taille de leur polylinker.

car ils permettent de transcrire en ARN la séquence d’ADN qui a été insérée dans le polylinker. le gène de résistance AmpR et le promoteur de la RNA polymérase du phage SP6 qui provient de Salmonella. Figure II. plus de 500 exemplaires par cellule. Les plasmides Blue-Script®. Il possède.La famille pSP . Figure I. Extraction et purification de l’ADN plasmidique Il existe de nombreuses méthodes d'extraction et de purification des plasmides . Les principales techniques de purification sont : Le lysat clair est soumis à une ultracentrifugation dans du chlorure de césium (CsCl ) en présence de bromure d’éthidium (BET) saturant.4 : Le plasmide Blue-Script II . Cette solution est appelée lysat clair. Le plasmide BlueScript® est un petit plasmide de 2961 paires de bases à haut nombre de copies. le gène lacZ’ (codant pour le peptide de la -galactosidase et contenant les séquences régulatrices de l’opéron lactose) qui permet la sélection des colonies. De plus. typhimurium immédiatement adjacent au polylinker. Ils possèdent en plus sur le brin complémentaire. Ce sont les plasmides les plus complexes car ils combinent tous les avantages des vecteurs précédents. Ils sont plus petits que pBR322 (entre 2900 et 3000 bp). 2-Lyse des bactéries pour libérer le plasmide : La lyse des cellules est réalisée dans les conditions permettant d'obtenir l'ADN plasmidique purifié dans une solution ne contenant que très peu d'ADN chromosomique et de protéines: Le traitement des bactéries par le lysozyme suivi d’un traitement avec un détergent (Triton 100 ou SDS) ou d’un traitement basique fait passer les RNA et les plasmides en solution tandis que l’ADN bactérien reste emprisonné dans les fantômes bactériens . 2. Ces plasmides possèdent : un polylinker. Chaque fois que ce gène est exprimé. 3-purification du plasmide à partir du lysat.6 : Le plasmide pUC18. l’ADN inséré est aussi exprimé d’ou la production de la protéine correspondante. 15 . due à sa petite taille. L’avantage de ces plasmides est de pouvoir transcrire l’ADN inséré en une grande quantité d’ARN sur les deux brins pour servir de ribosondes ou pour la traduction en protéines. de l’autre côté du polylinker. La haute efficacité de transformation. Toutes comportent cependant trois (3) étapes principales : 1-Croissance des bactéries hôtes avec éventuellement amplification du plasmide en ajoutant par exemple du chloramphénicol qui bloque la croissance bactérienne sans affecter la réplication de l’ADN plasmidique. Les plasmides Gemini (1 à 4) dérivent des précédents. outre le gène de résistance à l’ampicilline. un promoteur de la RNA polymérase du phage T7. Ces types de plasmides offrent un avantage. l’ADN inséré est sous la dépendance du promoteur du gène lacZ’. constitue un intérêt avantageux pour ce vecteur en biotechnologie.

7 La région centrale du génome du phage λ n'est pas nécessaire pour la réplication ou l'encapsidation des molécules d’ADN de λ dans Escherichia coli et peut donc être excisée par des enzymes de restriction et écartée. La bactérie éclate et les nouvelles particules virales infestent les bactéries voisines. Il est constitué d'un ADN double brin linéaire de 48.La précipitation différentielle de l'ADN plasmidique par le polyéthylène glycol (PEG ) permet aussi d'éliminer les petits fragments d'ADN et d'ARN non précipités et d’obtenir des plasmides de pureté appréciable. c’est à dire qu’il se réplique en même temps que le chromosome bactérien mais reste intégré à ce chromosome. Cette propriété permet de sélectionner les particules du phage λ naturel des phages λ contenant des ADN étrangers. Les bactéries à prophage intégré sont appelées des bactéries lysogènes. Les extrémités appelés COS sont constituées par de l'ADN sous forme simple brin sur une longueur de 12 bases. Il se forme alors une plage de lyse sur une boite de Pétri. Il reste à l’état de repos. La chromatographie d'échange d'ions. Ces différents constituants s’assemblent et forment de nouvelles particules phagiques dès que commence la réplication de l’ADN phagique. Il ne se produit pas de nouveaux virions.502 paires de bases. 16 . Le métabolisme et la viabilité des bactéries ne sont pas modifiés tant que la bactérie reste dans cet état. Lorsque l’ADN du phage pénètre dans une bactérie. 5. La circularisation est observée dans la bactérie immédiatement après l’infection. Leur multiplication est rapide et le nombre de copies par cellule bactérienne est très important. dans les conditions appropriées de force ionique et de pH. l’ADN du phage intégré dans le chromosome bactérien prend immédiatement en charge le système de transcription et de traduction de la cellule hôte qui commence la synthèse des constituants protéiques du phage. Le bactériophage λ est un vecteur de clonage efficace pour plusieurs raisons: Les extrémités cohésives permettent au phage de se concaténer et de se circulariser. 6 Réponse lysogénique : L’ADN du phage est intégré dans le chromosome bactérien. 1. La lysogénie peut être supprimée par des agents inducteurs de la virulence des phages (rayons X. Figure II.Le phage Lambda λ Le phage λ est un bactériophage de 1ère génération. Figure II. La tête du phage λ peut encapsider spécifiquement un ADN chromosomique d’environ 5 kb. Figure II. permet également à l'ADN plasmidique d’être absorbé sélectivement. agents mutagènes…) Deux types de phages qui infectent Escherichia coli sont d'usage fréquent en génie génétique: le phage λ et le phage M13.L'ADN PHAGIQUE Les bactériophages ou phages sont des particules virales qui infectent les bactéries. II. deux types de réponses peuvent se produire : Une réponse lytique : Dans ce cas.

A partir des phages sauvages. ces sites sont souvent localisés dans les régions du génome indispensables pour le cycle lytique du phage. lorsque la culture est réalisée sur un milieu contenant le substrat X-gal et l’IPTG. Le phage λ ZAP II est une forme améliorée du précédent qui permet de visualiser l’expression du DNA inséré. La sélection des recombinants se fait en analysant la coloration bleue ou blanche. Figure II. Le phage λgt 11 est utilisé dans la stratégie de l’insertion pour cloner les cDNA dont la longueur varie de 6 à 8 kb. si bien que la taille de l'ADN étranger qui pourrait être inséré est très limitée. Les molécules d’ADN ainsi obtenues peuvent être introduites dans E. 8 Le génome du phage λ : Les gènes AWBCNu3DEFIFII codent pour les protéines de la tête Les gènes ZUVGTHMLKIJ codent pour les protéines de la queue Les gènes att int xis permettent la recombinaison Les gènes cIII N cl cro cII assurent la régulation Les gènes O P assurent la réplication Le gèneQ est également un gène de régulation Les gènes R S permettent la lyse bactérienne La partie centrale peut être délétée pour insérer un ADN exogène 2: Dérivés du phage λ utilisés comme vecteur de clonage Le bactériophage λ sauvage ne peut pas être toujours utilisé pour le clonage car son ADN comporte des sites multiples pour beaucoup d'endonucléases de restriction utilisées dans les différents processus de clonage. Il sert de vecteur d’expression car la séquence insérée pourra être exprimée dans la bactérie sous forme de protéine. : Les phages EMBL 3 et 4 17 . 3. on a construit des phages qui n'ont qu'un (pour vecteur d’insertion) ou deux (pour vecteurs de substitution) sites de restrictions situées dans les parties non essentielles du génome de phage λ. De plus. La longueur de l'ADN pouvant être encapsidé ne peut dépasser 5 kb. coli par la transformation ou être encapsidées in vitro dans les têtes d’un bactériophage.Les "deux bras" restants sont ensuite ligaturés avec l'ADN du donneur digéré par les mêmes enzymes de restriction. permettant la recherche du recombinant désiré à l’aide d’un anticorps dirigé contre la protéine synthétisée.

5. Ils constituent des phages de choix pour la constitution des banques génomiques. on peut hybrider un oligonucléotide de synthèse qui servira alors d'amorce pour la DNA polymérase. La multiplication intracellulaire du phage fait intervenir une forme réplicative (RF) constituée par l'association du brin génomique (+) et d’un brin complémentaire nouvellement synthétisé noté brin (-). La taille de l’ADN à insérer varie de 9 à 23 kb. Le polylinker de ces phages comporte un plus grand nombre de sites de coupures uniques pour deux enzymes de restriction : Sfi dans la version 11.9 Le bactériophage M13 qui infecte Escherichia coli (seules les bactéries mâles peuvent être infectées) est un phage filamenteux dont la particularité et l'intérêt résident dans son matériel génétique. Ce dernier devient la matrice pour la synthèse de nouveaux brins (+) qui seront encapsidés et relâchés dans le milieu.Ces deux phages sont très proches du phage λ classique. 4. On peut y introduire des fragments de 15 à 20 kb. Les ribosondes sont utilisées pour cribler de nouveau la banque et ainsi isoler les segments adjacents au DNA cloné. .Addition de promoteurs pour des RNA polymérases spécifiques : Un promoteur de la T7 RNA polymérase est ajouté à l’extrémité du bras gauche avant le polylinker et le promoteur de la T3 RNA polymérase à l’extrémité droit. : Les phages GEMR 11 et 12 Ces deux phages sont destinés à la réalisation de banques génomiques et sont des versions améliorées des phages EMBL.. La forme réplicative (RF) bicaténaire peut aussi être extraite de la cellule de la même manière que l’ADN d’un plasmide. Not dans version 12 car les sites de coupure de ces enzymes sont très rare. Les modifications pour en faire un vecteur sont : 18 .Modification du polylinker. Ils en diffèrent par deux types d’améliorations : . Le phage M13 a été modifié de manière a pouvoir introduire un ADN étranger dans la forme réplicative au niveau d'un site unique de restriction. L’addition d’un site Xho I simplifie la réalisation des banques génomiques. Ces deux promoteurs permettent de synthétiser des ribosondes correspondant spécifiquement à chacun des brins de l’ADN cloné. Ainsi. Ils en diffèrent par la présence d’un polylinker aux deux extrémités de la zone de DNA qui sera délété pour être remplacé par le DNA à cloner. Le matériel génétique de ce phage est constitué d’une molécule d'ADN circulaire monocaténaire de 6407 paires de bases notée brin (+). il est certain de marcher sur le chromosome sans se tromper d’avancer dans le bon sens. : Le phage M13 et ses dérivés Figure II. Sur cette séquence connue. L'ADN phagique (+) peut être extrait à partir des virions de manière analogue à l'ADN du phage λ. La forme réplicative recombinée peut ensuite être introduite dans une cellule hôte par transformation comme un plasmide de manière a disposer sur le brin (+) d'une séquence connue au voisinage de l'insertion. Les deux phages ne diffèrent que par l’orientation du polylinker.

trois régions chromosomiques sont importantes pour sa réplication. coli par infection phagique. Les cosmides peuvent contenir des insertions d’ADN environ trois fois plus longs que ceux portés par les phages λ (45 kb). L'isolement des clones est obtenu en réalisant l'infection sur un milieu semi-solide. Ceci est dû à ce que la majeure partie de la structure du phage a été déletée tandis que les séquences signaux responsables de l'encapsidation subsistent (les sites COS). III. Le génome de la levure Saccharomyces cerevisiae est constitué de 16 chromosomes de taille comprise entre 250 et 2 000 kb.L’addition d’un gène lacZ pour permettre la sélection des recombinants (système des bactéries bleues et blanches en présence d’IPTG et de X-gal).L’addition d’un polylinker pour faciliter l’insertion des séquences de DNA . on forme des particules virales par encapsidation in vitro en ajoutant les protéines de la capside et de la queue. Chez la levure. Les virions se reproduisent ensuite par le cycle lytique. Les particules virales ainsi formés permettent une introduction très efficace de l'ADN recombinant de la cellule hôte E. Leur ADN peut se répliquer au niveau de la cellule hôte comme celui d'un plasmide ou être encapsidé comme celui d'un phage pour faire une infection. 6. 19 . centromériques (CEN). Figure II. Les YAC Le YAC ou chromosome artificiel de levure (Yeast Artificial Chromosome). Chaque particule virale donne alors naissance à un clone sous la forme d'une plage de lyse sur le tapis bactérien. Les cosmides Les cosmides sont des vecteurs hybrides constitués d’un plasmide classique auquel ont été ajoutées les séquences COS du phage λ. : Infection Avec l'ADN recombiné par insertion ou substitution.. COSMIDES. • Le séquençage de l'ADN par la méthode de Sanger • Dans certaines techniques de mutagenèse dirigée in vitro. on utilise alors comme amorce (primer) un oligonucléotide complémentaire de l'insert mais possédant la modification de séquence souhaitée. ce qui permet une bonne amplification de l'ADN recombinant. Les YAC permettent de cloner de 150 à 1 000 kb de fragments d’ADN. YAC ET BAC 1.10 2. Les séquences télomériques (Tel). La possibilité de disposer d'une insertion dans un ADN monocaténaire circulaire fait des dérivés du phage M13 des vecteurs très utilisés en génie génétique pour : • La création de mutations ponctuelles • La synthèse de sondes nucléiques. et une séquence ARS (Autonomous Replicating Sequence).

Ce facteur peut contenir de grands fragments d'ADN d'E. Le vecteur pBeloBAC11 porte ces gènes essentiels ainsi qu'un gène de résistance au chloramphénicol et la portion lacZa du gène b-galactosidase avec 2 sites de restriction HindIII et BamHI qui permettent le clonage de fragments d'ADN étranger Le facteur de fertilité F est utilisé lors de la conjugaison bactérienne. les PAC PAC : Chromosomes artificiels dérivés du phage P1 (PAC. les cosmides (35 à 45 kb). Les BAC Figure II.5x10+5 colonies/µg insert). Le vecteur pCYPAC1 permet de cloner des fragments qui ont une taille de 130 à 150 kb avec une efficacité qui est intermédiaire entre celle des cosmides et celle des YACs (1. Les gènes oriS et repE régissent la réplication unidirectionnelle du plasmide tandis que les gènes parA et parB maintiennent le nombre de copies de celui-ci à 1 à 2 copies par cellule. Le plasmide F a aussi la capacité de s'intégrer dans le chromosome bactérien et de s'en exciser.celles qui ne l'ont pas dans leur cytoplasme sont dites F(-) . 20 . les PAC (130 à 150 kb). les BAC peuvent incorporer des inserts d'ADN étranger pouvant atteindre 300 kb. Un plasmide qui a cette capacité est appelé un épisome. par exemple des sous-fragments de l'insert d'un phage ou d'un cosmide recombinant. Figure II. On peut cependant introduire dans l’ADN cloné des séquence bactérienne pour la sélection. coli sous la forme de dérivés F'.Celles qui l'ont perdue. Figure II. après l'avoir intégré dans leur chromosome sont F'. P1-derived artificial chromosomes) Mise au point dans les années 1990 un vecteur dérivé du bactériophage P1.13 Les BAC (Bacterial Artificial Chromosome) ont pour base le facteur sexuel F de 7 kb de Escherichia coli. Les ADNc (voir plus loin) sont clonés dans des plasmides ou des phages d'insertion. . Les YAC n'exigent que les cellules de levures comme hôtes. Les BAC et les PAC sont devenus les vecteurs principaux pour le séquençage du génome humain. La taille du DNA cloné peut donc atteindre de 1 000 à 2 000 kb.Les bactéries qui le possèdent dans leur cytoplasme sont dites F(+) . La taille des fragments d'ADN étranger qui peuvent être acceptés par le bactériophage lambda (10 à 20 kb).11 3 . Le plasmide F porte des gènes qui sont essentiels pour réguler sa propre réplication et pour contrôler aussi le nombre de copies du plasmide F.12 4. Ils acceptent des fragments de taille moyenne (jusqu'à 10 kb). Conclusion Les plasmides sont très utilisés pour le génie génétique. les BAC (160 à 200 kb) et les YAC (250 à 1.Celles qui l'ont intégré dans leur chromosome sont dites Hfr .500 kb) en font les vecteurs de choix pour construire et amplifier des banques d'ADN génomique. De manière similaire.On a donc construit des chromosomes artificiels contenant ces régions essentielles et du DNA que l’on désire cloner.

CARTE DE RESTRICTION I. Les enzymes de restriction constituent donc un système de défense de la bactérie. Les gènes ou fragments de gènes deviennent ainsi des entités physiques isolables et non plus de l’information noyée dans la masse du contenu génomique. Ces enzymes de restriction reconnaissent des sites particuliers sur l'ADN et coupent la molécule double brins soit au niveau du site de reconnaissance soit quelques nucléotides plus loin. La souche d'Escherichia coli B possède une endonucléase appelée EcoR1 qui reconnaît spécifiquement la séquence bicaténaire suivante: ↓ 5’G AATT C3’ 3’C TTAA G5’ ↑ CH3 ↓ | 5’G *AATT C3’ 3’C TTAA* G5’ | ↑ CH3 Pas de coupure Coupure L'enzyme catalyse l'hydrolyse d'une liaison phosphodiester dans le site reconnu au niveau des deux flèches. Définition et origine Les enzymes de restriction sont des endonucléases qui coupent d’une manière définie et reproductible l’ADN double-brin quelle que soit son origine. ÉLECTROPHORÈSE. Elles ont permis de caractériser un génome entier en une série de fragments reproductibles. Le système de restriction formé par le couple EcoR1 / MEcoR1 permet aux cellules bactériennes d'hydrolyser un éventuel ADN étranger. la coupure ne peut avoir lieu que si les adénines (A) figurées en gras ne sont pas méthylées. Les souches d’Escherichia coli R possèdent en plus de l’enzyme qui coupe la séquence reconnue par (EcoR1) une autre qui assure la méthylation (EcoR1 méthylase ou MEcoR1) qui reconnaît la même séquence mais méthyle les deux adénines. Ces enzymes ont été mis en évidence par le phénomène de la lysogénie. ENZYMES DE RESTRICTION 1. tout en conservant l'intégrité de leur propre génome. phagique en particulier. Ces enzymes constituent un système de défense de la bactérie surtout contre l'ADN des virus au cours de leur infection. Une activité méthylase qui méthyle une base donnée (A ou C) au niveau du site de restriction du génome de la cellule bactérienne pour empêcher sa propre dégradation par l’activité restrictive. 21 . Le phénomène de restriction résulte de l’existence dans la bactérie de deux types d’activité enzymatique : Une activité de restriction qui coupe le DNA lorsqu’il est reconnu comme étranger à la cellule hôte. Les cellules bactériennes contiennent beaucoup d'endonucléases spécifiques capables de reconnaître l'ADN des autres espèces et l’ADN des virus qui les infectent.Chapitre III: ENZYME DE RESTRICTION. Cependant.

Elle catalyse ensuite un clivage double brin au niveau des liaisons phosphodiester spécifiques à l'organisation de la séquence de reconnaissance. Figure III. par la localisation de leur activité catalytique. Chaque endonucléase a un nom de code déterminé selon les principes suivants : • • • • La première lettre en majuscule est l'initiale du genre de la bactérie. En 1990. en minuscule désignent l'espèces de la bactérie.1 22 . entre le groupe 3' OH et le phosphate génère une extrémité 5' phosphate d'un côté de la coupure et un groupe 3' OH de l'autre. l'enzyme se déplace sur l'DNA et coupe de manière aléatoire mille à quatre mille bases plus loin (Système de boucles d’ADN ?). Les deux lettres suivantes.Il existe 3 types d'enzymes de restriction qui diffèrent les unes des autres. on avait recensé plus de mille endonucléases isolées à partir de 867 espèces bactériennes différentes. En 1973. Mécanisme d'action des endonucléases de restriction a: Caractéristique de l'hydrolyse. Enzyme de type I: Ayant reconnu la séquence cible. Seules les enzymes de type II qui coupent au niveau du site de reconnaissance sont utilisés en génie génétique parce qu’on peut contrôler parfaitement le site de coupure et donc les extrémités engendrées. L'hydrolyse d'une liaison phosphodiester. Enzyme de type III : L'enzyme reconnaît la séquence cible et coupe la molécule de DNA 20 à 25 bases plus loin. Exemple : EcoR 1: E = Escherichia Co = espèce Coli R = Souche RY13 I = 1ère endonucléase isolée 3. Nomenclature des enzymes de restriction. Un chiffre romain distingue les enzymes d'une même souche dans l'ordre de leur découverte. Une endonucléase de restriction se lie à une séquence spécifique qu'elle reconnaît sur l'ADN: c’est le site de restriction. Smith et Nathan ont proposé une nomenclature qui est définitivement adoptée. Enzyme de type II: L'enzyme coupe l'ADN au niveau de la séquence reconnue. (pas toujours présente) désigne la souche bactérienne. La 4ème lettre en majuscule. 2.

Ces enzymes sont très utilisées pour fabriquer des ADN recombinants. Un nombre assez restreint d’enzymes de restriction reconnaît des séquences plus complexes. On observe sur les 2 brins la même séquence (5’→3’) mais en sens inverse.b: Sites de restriction La plupart des sites de restriction comporte de 4 à 6 paires de bases. De telle séquence sont dites palindromiques. car les fragments de différents ADN coupés par la même enzyme donnent les mêmes bouts qui peuvent s'associer par leur extrémités cohésives. L'association est ensuite rendue covalente par l’action d'une ADN ligase. ↓Hae III 5'  GGCC  3' 3'  CCGG  5' ↑ → → 5'GG 3'CC + + CC 3' GG 5' Ces types de coupes sont utilisées lorsqu’on désire faire un tailing (allongement de l’extrémité 3’OH) ou un marquage pour un séquençage. Coupure décalée du coté 5’ : Ce type de coupure génère des extrémités 5’P débordantes ou sortantes. ↓ Exemple : EcoR 1 : 5’G AATTC3’ 3’CTTAA G5’ ↑ c: Différents types de coupure Les enzymes de restriction de type II peuvent donner deux types de coupures : Les coupures à bouts francs (blunt ends ou flush ends). Les extrémités débordantes résultent d'une coupure décalée et les extrémités obtenues sont auto complémentaires entre elles. L’enzyme coupe exactement au même niveau sur les deux brins de la séquence reconnue soit au niveau de l’axe ou du centre de symétrie. Exemple. Elles peuvent donc se réapparier spontanément si les conditions sont favorables. Exemple : les coupures par Pst I : 23 . On parle alors d'extrémités cohésives ou de bouts collants "Sticky ends". les coupures de EcoR 1 : 5’ G/AATTC 3’ CTTAA/G 5’ → → 5’ G 3’ 3’ CTTAA 5’ + + 5’AATTC 3’ 3’G 5’ Coupure décalée du coté 3’: Ce type de coupure génère des extrémités 3’OH débordantes ou sortantes. Les séquences de restriction présentent toujours une double symétrique par rapport à un centre ou à un plan de symétrie. les coupures décalées donnent des extrémités cohésives.

C'est le cas de BamH I et Sau3AI qui donnent les même extrémités cohésives car le site de reconnaissance de Sau3A1 est contenu dans celui de BamH 1.C/TNAG.3’ 3’......1 : Quelques enzymes de restriction de type II et leur site de coupure N = Toute base (purine ou pyrimidine) e: Isoschizomères et enzymes compatibles: On appelle isoschizomères 2 enzymes différentes qui reconnaissent le même site de restriction.3’ 3’..5’ EcoRI Providencia stuarti Microcoleus Nocardia otitidis-caviarum PstI MstII NotI Tableau II.1 ci-dessous donne la liste de quelques enzymes de restriction et leur sites de coupure.GAT/ATC. Exemple : Msp I: NNC/CGGNN NNGGC/CNN et Hpa II NNC/CGGNN NNGGC/CNN Deux enzymes compatibles ont des sites de restriction différents mais donnent naissance aux mêmes extrémités cohésives....5’ 5’. Micro-organisme Thermus aquaticus Haemophilus haemolyticus Desulfovibrio desulfuricans Escherichia coli Sigle de l’enzyme TaqI HhaI DdeI EcoRV Séquence 5’.5’ 5’..GA/CGTC.. BamH I NNNG/GATCCNN et Sau 3A I NNN/GATCNNN 24 .....5’ 5’...5’ 5’...C/GCG... L’enzyme coupe les deux brins de l’ADN au niveau du centre ou de l’axe de symétrie...CTA/TAG.5’ 5’......T/CGA.3’ 3’.GANT/C.3’ 3’..5’ 5’..CC/TNAGG.......GGANT/CC....3’ 3’.5’ 5’.3’ 3’.G/AATTC.GCG/C...3’ 3’. On obtient des extrémités franches (blund ends) qui n’ont pas un grand intérêt en génie génétique sauf pour réaliser des « taillings à l’extrémité 3’OH).....AGC/T.5’ CTGCA/G 3’ → 5’ CTGCA 3’ + 5’ G 3’ 3’ G/ACGTC 5’ → 3’ G + 3’ ACGTC 5’ Les coupures franches .....GC/GGCCGC..3’ 3’.......CGCCG/GCG.CTTAA/G........CTGCA/G. Exemple : Hae III : 5’ GG/CC 3’ 3’ CC/GG 5’ → → 5’ GG 3’ CC + + 5’CC 3’ 3’GG 5’ Le tableau II..

L'un des résultats les plus intéressants des études des polymorphismes de l'environnement du gène drépanocytaire a été l'observation d'un déséquilibre de liaison : les polymorphismes ne sont pas distribués au hasard mais forment un petit nombre d'haplotypes bien définis. L'association de plusieurs de ces polymorphismes définit un haplotype.1 : Les haplotypes 25 . toujours le même nombre de fragments qui donne ce que l’on appelle RFLP (pour longueur des fragments de restriction polymorphiques ou Restriction Fragments Lengh Polymorphism en Anglais).+ Figure III. La longueur des fragments est déterminée par la distance séparant les séquences de restrictions reconnues par cette endonucléase. sont fréquentes.2 E Gγ Αγ ψβ δ β H inc II XmnI Hind III TaqI HindIII PvuII Hinc II Hinf I Rsa I AvaII HinfI HpaI BamH I Haplotype HbS Bénin Bantou Sénégal + + . On obtient pour un ADN donné.NNNCCTAG/G NNNCTAG/NNN Ainsi. Lorsque ces modifications portent sur des sites reconnus très spécifiquement par certaines endonucleases (enzymes de restriction) elles sont faciles à mettre en évidence par les méthodes de cartographie génique (polymorphisme de taille des fragments de restriction) RFLP.+ . On parle alors de carte d'identité moléculaire.+ + + + + + + + + + + + + + . BamH I donne les mêmes extrémités cohésives que Sau3A I avec qui elle est compatible. Une molécule d'ADN déterminée. + Cameroun - + .+ + + + + + + + + . Il a été ainsi observé que la mutation drépanocytaire a été trouvée associée à 5 haplotypes désignées d'après leur épicentre. Figure III.+ + . Exemple : CARACTERISATION DE L’HAPLOTYPE DREPANOCYTAIRE Des variations de la séquence nucléotidique.+ + + + + + + - Arabo Ind. Elles sont désignées sous le terme de polymorphisme. 4. Carte et fragments de restriction L'hydrolyse d'un ADN par une endonucléase de restriction conduit à une série de fragments dits de restriction dont le nombre est fonction du nombre de sites de restriction présent sur cet ADN. donne toujours les mêmes fragments et cette série de fragment constitue une empreinte caractéristique de l'ADN hydrolysé. sans conséquence pathologique directe.+ + + + .

Une carte de restriction est une séquence de sites de restriction séparés par des distances précises sur l'ADN et mesurée en paire de bases (bp). Figure III. .3 Exercice et corrigé: Détermination des sites de coupure de deux enzymes de restriction A et B sur un fragment d’ADN .L’enzyme B coupe et donne deux fragments : 3 Kb et 7 Kb . Diverses techniques permettent d'obtenir de telles cartes. Elles passent toutes par une digestion de l'ADN à analyser par une enzyme de restriction suivie d’une électrophorèse pour la séparation des fragments et la détermination de leurs tailles. On obtient un certain nombre de fragments pour chaque enzyme.L’enzyme A coupe et donne deux fragments : 2 Kb et 8 Kb . Chaque fragment produit par l’enzyme A est d’abord élué du gel et digéré ensuite par l’enzyme B et inversement.Les enzymes A et B coupent et donnent trois fragments 2 Kb. 3Kb et 5 Kb Déterminez les sites de coupures : 10 Kb d ADN 2 Kb A 8 Kb 7 Kb 3 Kb B 2 Kb 5 Kb 3 Kb A B 26 . L'analyse par double digestion est obtenue quand l'ADN est digérée séparément par 2 enzymes différentes A et B. Ces fragments sont ensuite analysés par électrophorèse sur gel d’agarose. La confrontation des différents résultats permet de situer les sites de coupure les uns par rapports aux autres sur la séquence nucléotidique.

Les échantillons d'ADN. Un exemple est 27 . Le bleu de bromophénol (violet ) migre avec les fragments de petites tailles (donc plus vite ) alors que le xylène cyanol (bleu turquoise ) migre avec les fragments de grande taille. (PFGE pour Pulsed Field Gel Electrophoresis). Des marqueurs composés d'une série de fragments. 1 . L’ÉLECTROPHORÈSE SUR GEL Figure III.II. On peut ainsi suivre indirectement la migration de l'ADN sur le gel. avant d'être déposés dans les puits. L’électrophorèse sur gel d'agarose en champ pulsé (PFGE) permet de séparer des fragments d'ADN double brin dont la taille peut varier de 220 000 à 2 500 000 paires de bases.Suivi de la migration . 2 .Etalonnage d'un gel On étalonne les gels avec des marqueurs de taille. Cette technique est aussi mise à profit pour la séparation des chromosomes interphasiques. Les deux marqueurs (colorants) migrent à des vitesses différentes. chacun constitué d'une à plusieurs répétition d'un même fragment d'ADN de taille connue. Les différents types d'électrophorèse utilisés dans les laboratoires de biologie moléculaire. Un marqueur de taille est un mélange de fragments d'ADN linéaire bicaténaires dont les tailles sont connues. il existe deux type de marqueurs de tailles : Des marqueurs fabriqués à partir d'une molécule d'ADN naturelle digérée par des enzymes de restriction. sont mélangés avec une solution de charge qui contient : un alourdisseur (glycérol ou saccharose ) pour entraïner l'ADN au fond du puits des marqueurs de mobilité (colorants visibles : bleu de bromophénol et xylène cyanol) Des marqueurs de taille pour l’identification (dans le puits de référence) un agent dénaturant comme le SDS ou l’urée pour arrêter les réactions enzymatiques suivant la nature du gel. permettent de séparer les acides nucléiques en fonction de leur taille: L'électrophorèse horizontale sur gel d'agarose permet de séparer les fragments d'ADN de 300 à 10 000 paires de bases en fonction de la concentration du gel en agarose L'électrophorèse verticale sur gel de polyacrilamide permet de séparer les fragments d'ADN dont les longueurs vont de 1 à 1 000 nucléotides en fonction de la longueur du gel et de la tension appliquée (de 1 000 à 2000 volts / cm).4.

Il en est de même des polymérases extraites des archéobactéries comme des bactéries du genre Thermus comme la polymérase de Bacillus steatothermophilus. Une détection encore plus sensible implique l'incorporation d'un radio isotope dans les molécules d'ADN avant électrophorèse. donc il doit être manipulé avec beaucoup de soins. La T4 DNA polymérase. Cette enzyme extraite d’Escherichia Coli intervient dans les activités de réparation du chromosome bactérien par le phénomène de nick translation.l'échelle d'ADN de 1 Kb de GIBCO BRL. Le 32P est actuellement utilisé puisqu'il peut être incorporé dans les phosphates 5' de l'ADN et émet des particules très énergétiques facilement détectées par autoradiographie. Révélation : Les bandes d'ADN sur un gel de polyacrylamide ou d'agarose ne sont pas visibles si l'ADN n'est pas marqué ou coloré. Elle possède les mêmes propriétés que le fragment de Klenow et possède les mêmes utilisation en biologie moléculaire. LES ENZYMES UTILES EN GÉNIE GÉNÉTIQUE: 1.5 III. Elle peut toujours travailler entre 80 et 94°C. Les différents fragments sont formés de 1 à 12 répétitions d'un même segment de 1018 bp. 2. 3. Figure III. La DNA polymérase I. La Taq polymérase C’est une enzyme extraite de la bactérie Thermus aquaticus. Une méthode sensible de coloration de l'ADN consiste à plonger le gel après électrophorèse dans du bromure d'éthidium (BET) qui devient cent fois plus fluorescent sous illumination ultra-violette lorsqu'il est lié à l'ADN. L’enzyme est produite par les bactéries E. Ces enzymes ne possèdent pas une activité de correction des épreu- 28 . espèce bactérienne vivant dans les eaux chaudes et qui présente une grande résistance à la dénaturation thermique. 3. d’où son utilisation en PCR. Le BET est une produit hautement mutagène. Coli infestées par le bactériophage T4. Elle est utilisée sous sa forme de «fragment de Klenow» qui est dépourvu de l’activité exonucléasique (5’→3’) par suite d’un traitement protéasique pour: Déterminer les séquences nucléotidiques d’un ADN par la méthode de Sanger. Pour convertir les bouts cohésifs en bouts francs Pour le marquage des DNA Pour la construction de sondes ou de vecteurs à partir d’un ADN simple ou double brin.

coli ou M. La transcriptase inverse. La terminal transférase C’est une enzyme couramment extraite du thymus de veau qui permet l’addition de désoxyribonucléotides. La transcriptase inverse est un enzyme produite par les rétros virus qui permet de recopier un ARN en un DNA. Elle possède aussi une activité RNAase H qui permet de dégrader le RNA dans un hybride ADN-ARN. Pour la construction des banques de cDNA Pour détermination des séquences nucléotidiques par la méthode de Sanger Pour la PCR sur les RNA messagers (R-PCR). Elle permet donc: de rajouter une queue (tailing) à l’extrémité 3’ en vue de créer des extrémités cohésives pour l’insertion d’un ADN de marquer l’extrémité 3’OH pour le séquençage des acides nucléiques par la méthode de Maxam-Gilbert. La poly A polymérase 29 . La séquence de l’ARN résultant dépend de la concentration relative des différents nucléotides présents dans la solution. 4. sans besoin d’amorce à l’extrémité 3’OH libre d’un DNA simple ou double brin. Elle est utilisée chaque fois qu’il est nécessaire de transformer un ARN en un ADN. n XDP → (XMP)n + n Pi Elle a été utilisée pour déchiffrer le code génétique. La polynucléotide phosphorylase Cette enzyme d’origine bactérienne (E. elle permet: La synthèse de polyribonucléotides froids ou radio-actfs La dégradation de la queue polyrA des mARN eucaryotes à cause de son activité nucléolytique Un marquage intensif des extrémité 3’OH des ribonucléotides Le marquage sur le phosphore des ribonucléotides diphosphates à cause de son activité d’échange de phosphate.ves (proof reading = activité exonucléasique 3’→5’) et de ce fait introduisent beaucoup d’erreurs au cours de la réplication. Actuellement. luteus) catalyse la polymérisation de ribonucléotides diphosphates pour donner un ARN. 7. 6. 5.

à partir d’un gène cloné. Les ARN polymérases Les ARN polymérases de tous les organismes transcrivent l’un des deux brins de la double hélice de l’ADN en un ARN simple brin. les études sur les différents RNA résultant de la transcription d’un DNA cloné. coli n’agit que si les deux DNA sont associés par des extrémités cohésives ou dans le cas d’une cassure sur un seul brin. RNA-protéines. coli infesté par le phage T7 et la T3 RNA polymérase extraite aussi de E. Son substrat est spécifiquement l’ATP. Extraite d’E. Ce sont les polymérases des procaryotes qui sont le plus souvent utilisées en biologie moléculaire car elle possèdent des promoteurs très spécifiques qui permettent de conditionner et de révéler l’expression des gènes recombinés dans une cellule transfectée. Les ligases assurent la formation d’une liaison phosphodiester entre une extrémité 3’OH et une extrémité 5’phosphate de deux nucléotides déjà incorporés dans un acide nucléique. la T7 RNA polymérase extraite d’E. Ces polymérases permettent aussi de produire. la détermination de la séquence d’un ADN cloné dans un vecteur possédant. coli infestée par le phage T4. mais aussi les extrémités à bouts francs en présence d’éthylène glycol. T7 ou T3. ce qui lui permet de relier les extrémités cohésives. dans le sens 5’→3’. Coli. Elle est donc utilisée pour la soudure des extrémités cohésives lors de la construction des vecteurs. L’enzyme d’E. devant le DNA cloné. 8. Coli infesté par le phage T4. Les Ligases La DNA ligase d’E. Les plus utilisées sont: la polymérase de SP6 extraite de Salmonella typhimurium LT2. Extraite d’E. de régulations et des interactions RNA-DNA.Enzyme eucaryote. La synthèse s’effectue sans amorce à partir du promoteur (site de fixation et d’initiation de l’enzyme) et nécessite toujours les ribonucléotides triphosphates et du Mg2+ comme cofacteur. elle joue le même rôle que la ligase de E. 9. La RNA ligase. Elle possède donc les mêmes utilisations que la polynucléotide phosphorylase et la terminal transférase. Cependant. l’un quelconque des promoteurs SP6. les quantités de RNA suffisantes pour les études de structure. Ces polymérases permettent: la synthèse de sondes hautement marqués soit par un nucléotide radioactif soit par un nucléotide biotinylé (marquage froid). coli. coli infesté par le phage T3. La T4 ligase. Cette enzyme utilise le NAD+ comme cofacteur. elle présente un avantage sur cette dernière car elle utilise l’ATP au lieu du NAD+ comme source d’énergie. elle réalise la ligation entre deux RNA en créant entre eux une liaison phosphodiester entre l’extrémité 3’OH libre et l’extrémité 5’phosphate libre de l’autre molécule. Elle utilise aussi l’ATP 30 . elle catalyse l’addition d’une queue polyrA à l’extrémité 3’OH des ARN messagers eucaryotes.

Les RNases La RNase A. Elle permet donc la détection des hybrides DNA-RNA et la destruction de l’ARN dans un hybride après une transcription inverse pour la synthèse du second brin de cDNA. éliminer le DNA d’une préparation protéique ou de RNA.RNA (RNA mixtes). Elle permet donc d’obtenir des ADN simple brin. Elle permet également de détecter les mismatches dans les hybrides DNA-RNA. 31 . La DNase I Cette enzyme extraite du pancréas est une endonucléase qui coupe le DNA après un base pyrimidique. soit la construction de liaisons inter ou intra . L’enzyme dégrade spécifiquement les acides nucléiques en simple brin. Elle catalyse l’hydrolyse séquentielle des nucléotides d’un ADN dans le sens 3’ 5 à partir d’une extrémité 3’OH libre. Les DNA bicaténaires et les hybrides DNA-RNA ne sont pas attaquées. Elle permet : Une étude des hybrides DNA-RNA L’élimination des extrémités simple brin d’un DNA double brin Le suppression des boucles dans la synthèse de cDNA La détermination des origines de la transcription L’exonucléase III. La RNase H : Elle détruit le RNA dans les hybrides DNA-RNA. Elle coupe aussi bien les acides nucléiques en simple ou en double brins. pour la création de cassures (nicks) pour le marquage de l’ADN par nick translation. 10. Elle permet donc soit un marquage des ARN. Elle est utilisée pour analyser les gènes actifs de la chromatine. libérant une extrémité 3’OH et une extrémité 5’phosphate. Les nucléases. La nucléase S1. Elle est utilisée pour éliminer le RNA dans une préparation protéique ou de DNA. Cette enzyme très résistante (se maintient après 1 heure à 90°c) hydrolyse spécifiquement les RNA simple brin après une pyrimidine. 11.qui est hydrolysé et AMP et en pyrophosphate. De plus elle possède une activité 3’ phosphatase.

identique en tous points à la brebis qui a fourni la cellule du pis. I . le clonage est la sélection d’un clone parmi un ensemble de clones bactériens recombinants qui porte le nom de banque (library). C'est la raison pour laquelle Dolly n'a eu pour tout bagage génétique que celui que contenait la cellule du pis. on a prélevé une cellule dans le pis d'une brebis de race Finn Set à face blanche. Sur cet ovule. Après s'être divisé un nombre suffisant de fois. Le clonage des animaux supérieurs: les mammifères. On a prélevé également un ovule sur une autre brebis. Dolly est née de cette technique. Le principe du clonage n'est pas très compliqué en soit.LE CLONAGE Le clonage des micro-organismes est différent de celle des organismes supérieurs comme les mammifères. 2.CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. 32 . on a fusionné in vitro la cellule du pis qui contient tous ses gènes et l'ovule vidé de tout son matériel héréditaire. Stricto sensu. Dans le cas de Dolly (la première brebis clonée). l’embryon au stade blastocyte a été placé dans l'utérus d'une brebis porteuse. Clonage de l’ADN dans les micro-organismes: Le but du clonage est d’obtenir un grand nombre de copies absolument pures d’une séquence donnée d’ADN. Pourquoi un ovule? Pour qu'il devienne éventuellement un embryon. Il existe 2 types de banques d’ADN : les banques génomiques et les banques d’ADNc. À l'aide d'un choc électrique. 1. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche. on a enlevé le noyau qui contient le matériel génétique.

qui dérive de la loi de Poisson est : log ( 1-P ) N =. compte tenu de la longueur des inserts.99 0. sous une forme morcelée.-------------log ( 1-1 / n) P = Probabilité de présence d une séquence donnée n = ( longueur du génome ) / ( longueur moyenne des fragments insérés ). d’où le terme de banque génomique. Probabilité de présence d’une séquence donnée 0. l’ensemble de l’information d’un individu telle qu’elle existe dans son génome. l’ensemble des séquences du génome. 2 – Etablissement d’une banque génomique. Les différentes étapes principales sont les suivantes : • Extraction de l’ADN nucléaire • Digestion du génome avec des enzymes de restriction • Insertion des fragments d’ADN dans des vecteurs (plasmide ou phage ou YAC).90 0. Clarke et Carbon ont établi une formule statistique permettant de déterminer le nombre de clones nécessaires.80 Longueur de l’insert en (kb) 15 20 30 35 40 860 640 430 370 320 560 415 280 240 210 430 320 215 185 160 300 225 150 130 115 Tableau IV.II . Cette formule. Si la banque est correctement établie. puis dans un hôte approprié.95 0. au moins une fois. elle contiendra. plus faible sera le nombre des clones nécessaires.1 : Nombre de clones (en milliers) que doit contenir une banque génomique pour être représentative d’un génome.LES BANQUES GÉNOMIQUES 1 . Une banque génomique ne sera représentative que si elle contient. Le vecteur doit être choisi en fonction de la taille des fragments d’ADN à insérer. Il est donc évident que plus les inserts seront longs.La fragmentation de l’ADN tout entier d’une cellule et son introduction dans des vecteurs Construire une banque génomique consiste à fragmenter l’ADN tout entier d’une cellule (la méthode du shotgun) et à introduire chaque fragment dans un vecteur. • Ligature avec l’ADN ligase • Transformation (avec des plasmides) ou infection (avec phages) des bactéries • Culture des bactéries sur des milieux entiers 33 .

La majeure partie des ARN messagers des eucaryotes possède une queue poly(A) rajoutée après le transcription et avant le transfert vers le cytoplasme.peuvent recevoir des fragments d’ADN de 150kb à 1 000 kb. L’amplification n’est réalisable que lorsqu’on travaille avec des phages. Un banque de cDNA doit contenir au moins une copie de tous les ARNm présents dans la cellule. d’augmenter le nombre de copies de chaque fragment inséré. les pertes de séquences sont très rapides et on est alors obligé de refaire la banque chaque fois. Le processus de formation de l’ADNc comprend deux étapes: 1 .1: Schéma pour la réalisation pratique d’une banque génomique à partir de phages. 3.Les avantages des banques génomiques: Les banques génomiques permettent de connaître: . mais ceux dont l’état de différentiation cellulaire permet la transcription. Ces vecteurs permettent de marcher sur le chromosome.• Toutes les bactéries qui portent une chimère se multiplieront et donneront des clones. mais doit servir à plusieurs clonages successifs. Les YAC. c’est à dire. donc. il existe plusieurs types d’ARN : l’ARN messager. ou les BAC. Pour pallier à cet inconvénient. dans la plupart des cas.L’isolement de l’ARN poly A+ (poly adénine): Dans la cellule eucaryote.Les introns Malheureusement l’ADN génomique est fragmenté au hasard. Avec les cosmides et les YAC.Les séquences de régulation . il faut utiliser les chromosomes artificiels de levure (YAC) comme vecteur de clonage.Les régions non transcrites des exons . Amplification de la banque Lorsque la banque n’est pas d’usage unique.LES BANQUES DE CADN L’ADN complémentaire (ADNc) est la copie sous forme d’ADN d’un ARN messager (ARNm). III .Les gènes silencieux . 4 . Figure IV. on obtient des gènes fragmentés incapables de coder pour des protéines biologiquement actives. l’ARN de transfert et l’ARN ribosomal. Ces banques sont essentiellement tissulaires puisqu’une cellule d’un tissu donné ne possède pas tous les ARN messagers de l’individu. il convient de l’amplifier. ARNm (eucaryote) 34 .

2 : Les principales étapes de la purification des ARN messagers eucaryotes ayant une queue poly-rA en utilisant la chromatographie d’affinité. Seuls les ARNm qui possèdent les queues poly rA seront retenus sur la colonne par hybridation par les oligo-thymidilates. le brin de RNA est coupé en plusieurs endroits par la RNase H. Sur une colonne chromatographique. Cependant. Les ARNm sont ensuite « élués » par un agent dissociant. On fait alors passer l’ARN cellulaire dans la colonne. Un poly dG synthétique est alors utilisé pour s’hybrider à la queue poly dC et servir d’amorce pour la synthèse du brin complémentaire par le fragment de Klenow de la DNA polymérase I. La figure III.3 résume les principales étapes de la purification des ARN messagers eucaryotes ayant une queue poly-rA. Il y a cependant une perte d’information au niveau de l’extrémité 5’.Le passage de l’ARN à l’ADN Cette étape est toujours réalisée grâce à la transcriptase reverse isolée d’un rétrovirus. Figure IV. Après la synthèse du premier brin par la reverse transcriptase. Plusieurs techniques sont utilisées pour la préparation de l’ADNc : la transcriptase reverse : La synthèse de l’ADNc commence en 3’ de l’ARNm.3 : La technique de base de la synthèse du cDNA à partir du mRNA par la reverse transcriptase. Figure IV. Si la molécule de l’ARNm est longue. la transcription peut ne pas aboutir à l’extrémité 5’ à cause de la boucle formée à cette extrémité par la transcriptase reverse. Les courts fragment d’ARN servent alors d’amorce pour la DNA polymérase I qui synthétise le brin d’ADN par son activité polymérasique 5’ ? 3’ et détruit les restes d’ARN par son activité exonucléasique 35 . La technique « copie entière » par addition de queues uniformes « tailing » Après la synthèse du premier brin de cDNA par la reverse transcriptase. 2 . les oligo-désoxythymidine (dT) sont liés à la cellulose ou à l’agarose par des liaisons covalentes.5’ GGGAUCACUUGCGCAGCGCAUGCU(AAAAAAAAAA)n 3’ queue poly(A) On utilise les queues poly rA pour purifier l’ARNm en écartant les autres types d’ARN. La boucle est détruite par l’action de la nucléase S1. Le début de l’opération est identique aux techniques précédentes. la transcription par la transcriptase reverse n’est pas parfaite. elle tend à baisser lorsqu’elle rencontre des obstacles que sont les structures secondaires de l’ARN. Les autres ARN sont éliminés par un lavage avec le tampon. La technique « copie entière » par cassure à la RNase H. une queue poly dC est créée à l’extrémité 3’ par la terminal transférase en présence de dCTP.

On peut utiliser un anticorps dirigé contre le produit de l’expression de l’ADN inséré dans le cas d’une banque d’expression. Les oligonucléotides purifiés sont marqués au 32P et utilisés comme sonde d’hybridation in situ d’une banque génomique.On utilise ensuite une sonde spécifique marquée par un radio-isotope ( 32P.Celles qui emploient les oligonucléotides de synthèse. La PCR : Cette technique permet d’obtenir rapidement une grande quantité de l’ADNc une fois l’ADNc disponible .5 IV .(Polymerase Chain Reaction pour Réaction de Polymérisation en Chaîne) Figure IV. dans un criblage classique.Celles qui utilisent les anticorps. Beaucoup de techniques ont été utilisées pour le criblage des colonies. Le criblage par des oligonucléotides de synthèse : Le principe consiste à utiliser. Figure IV. l’hybridation différentielle et la complémentation d’un défaut génétique de l’hôte qui ont eu gloire dans les années 1975-1980 ne sont pratiquement plus utilisées à cause de leur lourdeur. 2.Une réplique des clones est réalisée sur un filtre de nitrocellulose ou sur nylon . Le code génétique permet de déterminer les séquences possibles du gène correspondant (dégénérescence du code). une sonde oligonucléotidique marquée synthétisée à partir des données de séquençage d’une fraction de la protéine. 35 S) pour une hybridation. . 1. . Les appareils automatiques permettent actuellement de séquencer une protéine en 24 heures et de synthétiser des oligonucléotides dans le même laps de temps. On utilise généralement un pool d’oligonucléotides courts de 18 à 25 bases ou quelques oligonucléotides longs de 40 à 45 bases. la révélation de la séquence insérée est réalisée par une simple autoradiographie. Le criblage par des anticorps : 36 . la suite est identique à la méthode par la RNase H. mais les techniques les plus sensibles et les plus utilisées sont: .4 La technique du multi-amorçage au hasard : Cette méthode utilise la technique de synthèse de l’ADNc utilisant un multi-amorçage au hasard avec des oligonucléotides de 6 à 10 nucléotides de long : « Random primer ». Les autres techniques comme l’hybridation de sélection. On peut alors utiliser la T4 DNA polymérase pour parfaire la synthèse au niveau des extrémités.3’ ? 5’. Dans ce cas.L’ÉTUDE DE L’ADN CLONÉ Le criblage ou la recherche du bon clone au sein d’une banque génomique est toujours un problème difficile à résoudre en fonction des vecteurs utilisés. Le processus général utilisé pour le screening se pratique ainsi : .

La révélation des différentes bandes est faite soit par : . Après électrophorèse sur gel de polyacrylamide des 4 produits de réaction et autoradiographie. On obtient ainsi un fragment dont une seule extrémité 5’ est marquée. Deux méthodes classiques sont alors utilisées. Le complexe antigène-anticorps est révélé par un autre complexe protéique possédant soit une activité enzymatique dont les produits sont colorés ( -galactosidase). les exons et les zones de régulation de l’ADN inséré dans le vecteur.Cette technique ne peut se réaliser que sur une banque d’expression puisqu’elle vise à révéler le produit d’expression d’un gène cloné. Figure IV. les positions relatives des différentes bases sont déduites de la comparaison des distances de migration des fragments marqués en 5’. Il faut pour cela disposer d’un anticorps. 32P.7 : Criblage d’une bibliothèque d’expression avec les anticorps 3. 37 . Il doit ensuite être digéré par une endonucléase de restriction en deux fragments différents de taille. qui sont séparés par électrophorèse. 35S) suivi d’une autoradiographie.Un marquage chimique ou enzymatique des produits obtenus pour le séquençage (utilisation de radio-isotopes. Electrophorèse (Cf.La méthode de Maxam et Gilbert: la méthode chimique. au moyen de réactifs chimiques différents. de préférence polyclonal dirigé contre le produit du gène. . Il est séparé en 4 lots et dans chaque lot.Une utilisation du bromure d’éthidium et une lecture sous une illumination ultra-violette.6: Criblage d’une bibliothèque d’expression avec une sonde Figure IV. soit marqué à l’iode 125. a . ci-dessus) Elle permet de récupérer les fractions d’intérêt pour un séquençage de l’ADN inséré. Le séquençage : Il a pour but la détermination de la séquence nucléotidique de l’ADN isolé pour définir les introns. 4. L’ADN double brin à séquencer est d’abord marqué au 32P au niveau du phosphate en 5’. on réalise une coupure au niveau d’un type de base différent.

la conséquence est un arrêt de l’élongation lorsqu’un didésoxyribonucléotide est incorporé dans un brin d’ADN en synthèse.TGCACTTGAACG 32 P.TGCACTTGA 32 P. Figure IV.TG 32 P. Cette méthode met à profit l’absence d’un hydroxyle en 3’ d’un ddXTP qui ne permet pas la formation d’une liaison phosphodiester.La méthode de Sanger: la méthode enzymatique.TGCACTTGAACGCA 32 P.TGCACTTGAACGCAT 32 P. La méthode de séquençage enzymatique mise au point par Sanger par l’incorporation de didésoxyribonucléotides terminateurs de chaîne a été universellement adoptée.TGCACTTGAACGCATG 32 P. La séquence de l’ADN. est alors : 5’-TGCACTTGAACGCATGCT-3’ b .TGCACTTGAA 32 P.TGCAC 32 P.TGCACTTG 32 P.TGCACTT 32 P. méthode enzymatique 38 . lue directement de bas en haut du gel. Ce phénomène est à la base de la méthode de Sanger.TGCACTTGAACGC 32 P.9 : Séquençage.TGC 32 P.T 32 P- 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 T C G T A C G C A A G T T C A C G T Figure IV.TGCA 32 P.TGCACTTGAACGCATGC 32 P.8 : La méthode de séquençage des acides nucléiques de Maxam Gilbert : Un traitement chimique permet de cliver spécifiquement au niveau de chaque base qui produit alors des fragments radioactifs de tailles différentes.TGCACT 32 P.Séquence détectée sur le gel Lecture 3 →-5’ Ordre des taches T C G A Lecture 3’→5’ 32 32 PTGCACTTGAACGCATGCT P.TGCACTTGAAC 32 P.

• La mise en évidence de pseudo-gènes et de gènes apparentés : Une sonde suffisamment longue peut s’hybrider avec des séquences non totalement complémentaire : pseudogènes. Figure IV. il est possible de mettre en évidence une délétion pourvue qu’elle ne soit pas très grande. préalablement séparés par électrophorèse. Cette variation des sites de coupure se traduit par la disparition d’une ou de deux bandes (suivant la longueur de la sonde utilisée) et l’apparition d’une bande de taille supérieur dont la longueur est égale à la somme des longueurs des deux bandes disparues. Le processus est le suivant: • L’ADN génomique est d’abord fragmenté par une enzyme de restriction appropriée • Les fragments sont ensuite séparés par électrophorèse sur gel d’agarose. Il est donc facile d’établir une carte de restriction par cette méthode.10 : Southern Blot Cette technique permet : • L’établissement des cartes de restriction : Les enzymes de restriction coupent l’ADN au niveau de séquences bien définie. marquée et spécifique. on forme des liaisons covalentes entre le DNA et le nylon de sorte que le support peut être utilisé plusieurs fois avec d’autres sondes. avec des fragments de restriction d’ADN. • Le support solide est hybridé avec une sonde mono-brin marquée à faible stringence puis lavé • Le ou les fragments reconnus par la sonde sont révélés par la technique de l’autoradiographie. • Les mutations par délétions : Cette technique permettant de visualiser un gène. 39 . dénaturés et transférés sur une membrane.5. Ces gènes sont mis en évidence en fonction des conditions d’hybridation (stringence). par une hybridation avec une sonde. Analyse du génome et de ses modifications: Le Southern blot C’est la méthode d’analyse de l’ADN imaginée par Southern en 1975 pour visualiser les gènes ou toute séquence d’un ADN génomique. • L’ADN dénaturé (simple brin) est transféré par capillarité sur un support solide (filtre de nitrocellulose ou nylon). Les membranes de nylon sont les plus utilisées car par un traitement au UV (254 nm). • La détection de mutation ponctuelle : Le remplacement d’une base par une autre peut se traduire par la disparition ou la création de sites de coupures pour une enzyme de restriction donnée. • L’ADN est dénaturé in situ par une solution de soude. gènes d’une même famille ou gènes homologues d’une espèce différente. La création d’un nouveau site de coupure donne le résultat contraire.

il est possible de mettre en évidence ces recombinaisons par cette technique. • l’hybridation avec une amorce. Figure IV. c’est pourquoi elle est maintenant largement utilisée. annealing à 64°C • extension de l’amorce à 70 . CF Figure IV. Cette polymérase (Taq polymérase) est toujours active à 94-96°C. Le fragment d’ADN à amplifier est compris entre deux séquences (complémentaires des amorces) qui doivent être connues et la longueur ne peut excéder 10 kb. La réaction de la PCR comporte trois étapes qui constituent un cycle au cours duquel la quantité d’ADN à amplifier est doublée.5 : Les cycles de la PCR 40 . Æ Les éléments de la PCR: les réactifs et le matériel: • l’ADN à amplifier • 2 amorces: sens et anti sens • tampon de réaction (Buffer) • MgCl2 • dNTP • Taq polymérase • L’appareil thermocycleur pour PCR • H2O bi-distillée et stérile Æ L’intérêt et application de la PCR: La PCR est la méthode actuelle la plus efficace et la plus rapide d’amplification d’un ADN cible. Elle permet de mettre en oeuvre les techniques habituelles de génie génétique même si l’on ne dispose au départ que d’une faible quantité d’ADN. L’amplification est effectuée par la répétition des cycles qui assure une duplication exponentielle de chaque brin.72°C par la Taq polymérase. appariement primer. • la dénaturation de l’ADN à amplifier à 94°C.11 6.• La détection des recombinaisons : L’échange entre chromosomes homologues au cours de la méiose est la recombinaison. La PCR Définition: La PCR (Polymerase Chain Reaction). Dans certains cas. Æ Processus: Pour faire la PCR. on utilise l’ADN polymérase d’une bactérie: Thermophilus acquaticus qui vit à 75°C dans les eaux thermales. la réaction de polymérisation en chaîne consiste à amplifier sélectivement une séquence particulière d’ADN par l’action répétée d’une ADN polymérase. Ces cycles sont renouvelés entre 20 et 50 fois en fonction de la quantité d’ADN cible de départ et du but recherché.

pour déterminer la paternité ou la maternité et elle est désormais utilisé dans la pharmacogénétique. Une mutation ponctuelle au sein de cette séquence modifie la structure secondaire pour qu’il en résulte une modification de la migration en électrophorèse. Nous avons les RFLP (Restriction Fragment Length Polymorphism). La longueur des fragments est déterminée par la distance séparant les séquences spécifiques reconnues par cette endonucléase. Une molécule d’ADN donnée coupée par une enzyme de restriction donnée produit toujours les mêmes fragments : cette série de fragments fournit une empreinte caractéristique de l’ADN hydrolysé.99%. Elles ont souvent 11 à 16 bp (GGAGGTGGGCAGGA [A/G] G. La technique des SSTR permettent d’établir des polymorphismes à plus de 99. Cette séquence ne doit pas dépasser 300 à 500 bp. La structure secondaire que prend un segment de l’ADN simple-brin est fonction de sa séquence. VNTR. on parle de carte d’identité moléculaire. L’ADN est marqué par un iso-radioactif au cours de l’amplification. Cette technique est utilisée dans les tribunaux pour découvrir le coupable. SSTR. appelés fragments de restriction. dispersées et très polymorphes. Ils sont favorisé par des crossing over inégales lors de la méiose. La chorée de Hungtington qui est une maladie neurodégénérative est provoquée par des crossing-over inégaux.7. En d’autres termes : l’hydrolyse d’un ADN par une endonucléase conduit à une série de fragments. Processus : La séquence où l’on souhaite rechercher une mutation est amplifiée par PCR. Étude des polymorphismes : RFLP. SSCP Les RFLP (restriction frament length polymorphism) sont des variations de séquence de l’ADN révélées par des modifications de la carte de restriction. On peut introduire un nucléotide α32P dCTP ou alors utiliser des primers marqués. Elles sont répétitives. Technique d’empreintes par didéoxynuclotides ou ddF Les amplicons de la PCR Réaction de séquence à l’aide de la Taq DNA polymérase avec un primer interne 41 . Nous avons aussi les polymorphismes de répétition : ce sont les minisatelites ou VNTR (Variable Number of Tandem Repeats) Les VNTR sont des séquences particulières. Elles permettent la réalisation de l’empreinte genetique (ADN finger printing) Les microsatelites de type (CA)n sont plus fréquent et les mieux caractérisés : les SSTR (Short Sequences of Tandem Repeats). Cette propriété permet de mettre en évidence la présence d’une mutation ponctuelle. La mise en évidence des mutations ponctuelles utilise le système de l’analyse des polymorphisme de conformation de l’ADN simple-brin : SSCP (single Strand Conformation Polymorphism). L’ADN est soumis à une digestion par une ou plusieurs enzymes de restriction suivie d’un Southern blot.

Migration sur un gel d’acrylamide non dénaturant Par exemple.AGTGTTAAGTGCTA ----à 3’ Pour l’allèle muté Après PCR. L’altération de la conformation spatiale de l’ADN permet de détecter dans un gel la mutation (SSCP) Normal Muté Muté Normal Bande de faille anormale correspondant à la mutation Bande de faille normale Fig.12 : d’un gel de polyacrylamide en utilisant la technique de dideoxyfinger-printing 8 .AGTGTTACGTGCTA ----à 3’ Pour l’allèle normal 5’ ---. on a la séquence suivante avec une mutation C à A 5’ ---. Employer les puces ADN vise à caractériser les relations gène-fonction ou définir et comparer les profils d’expression des messagers expri- 42 .AGTGTTACG TGCTA ----à 3’ Pour l’allèle normal 3’ ---. IV.TCACAATddG 5’ ---.AGTGTTAAGTGC TA ----à 3’ Pour l’allèle muté 3’-----TCACAATTCACddG NB. ddGTP) et des dNTPs. une réaction de séquence utilisant la Taq polymérase est réalisée (avec une amorce marquée). 5’ ---. on ajoute un seul didéoxynucléotide (par exemple. Puces à ADN (microarray) ou ADN chips La technologie des puces ADN permet l’analyse de l’expression de milliers de gènes simultanément. Puis.

Les puces ADN sont un outil de choix dans la recherche et la caractérisation de nouvelles molécules à visée thérapeutique. La séquence dont on cherche à déterminer la composition est hybridée sur ce filtre.13 : schéma simplifié d’une puce. Dans cet exemple nous avons cinq hybridations de séquences. si les ADN fixes sur les cases ci-après ont la séquence décrite : B9 : C A G C C A A T 43 . Prenons cette puce sur laquelle sont fixés des octamères de séquences chevauchantes différentes et ordonnées. Supposons que nous ayons un ADN de 12 bp et hybridons-le à cette puce. seules. 1 2 3 4 5 6 7 8 9 10 11 12 A xxxx B C D xxxx E F G xxxx H I xxxx J K xxxx L Figure IV. Un traitement informatique permet d’analyser les résultats. Principe : Synthétisons une série d’oligonucléotides de 8 bp (octamères) représentant toutes les combinaisons possibles 48 = 65.més dans des cellules isolées dans différentes conditions (exemple : cellules normales comparées aux cellules tumorales) ou soumises à différents traitements (définition du profil d’action d’une drogue).536 : ces 48 oligonucléotides sont fixés de manière ordonnée sur une plaque de silice. les appariements strictement homologues se réalisent. Par exemple. Les conditions de stringence sont telles que.

6kb). 44 .On peut encore diminuer leur taille. comme dans l’industrie informatique. avec espacement des sondes de 20 µm. Pharmacogénétique ou pharmacogénomie. Expression de gènes. Ces puces sont très petites. Les industriels espèrent pouvoir réaliser des puces de 1 µm et pourquoi pas.000 sondes fixées). des puces de 0.3 µm ! Secteurs d’application : • • • • Dans le séquençage de l’ADN mitochondrial (16. environ 1. permettent de fixer plusieurs centaines de milliers de sondes.6 cm2 avec un espace entre les sondes d’environ 50 µm (65.E4 : H12: J1 : L12 : C Figure IV.14 A G G C C C C C C C A A A A A A A A A A T T T T T A A A A A C C C C G G G A A A G C C La séquence reconstituée est alors : 5’ – CAGCCAATACGA. des puces. La synthèse des oligonucléotides se fait in situ : réactions chimiques avec adresse spécifique sur le verre. Détection de mutations et de polymorphismes. ont été fabriquées. Ainsi. Le support utilisé pour fixer les oligonucléotides peut être une plaque de silice.

La nucléase S1 est toujours utile pour raboter les extrémité 5’. de délétions et d’insertions dans des fragments d’ADN cloné. soit pour insérer des portions plus ou moins grandes de DNA dans le gène cloné afin d’élucider son rôle dans le génome. EXPRESSION DES GÈNES EUCARYOTES DANS LES BACTÉRIES. I . La fin des années 1970 et le début des années 1980 ont vu se développer des techniques qui permettent de modifier des paires de bases bien spécifiques donc de créer différents types de mutations ponctuelles. Mutagenèse par délétions L’un des moyens les plus drastiques pour évaluer le rôle d’une séquence de DNA donnée est de la supprimer. L’analyse des modifications physiologiques qui suivent cette excision permet alors de connaître le rôle de la séquence « délétée ». – Une coupure par une enzyme de restriction suivi de l’activité de la nucléase Bal 31 qui dégrade les deux extrémités de l’ADN à la fois. On emploi alors la stratégie suivante : – Création d’une délétion étendue dans l’ADN considéré afin de connaître le rôle de la séquence – Création de délétions de plus en plus courtes pour circonscrire les régions d’intérêt. Les fragments d’ADN ou les gènes ainsi modifiés peuvent ensuite être réintroduits dans l’organisme d’origine pour observer les effets des mutations sur le phénotype ou sur la régulation de l’expression génétique. 45 . La fermeture des deux extrémités restantes est toujours réalisée par la T4 ligase qui peut joindre deux molécules de DNA ayant des bouts francs. – Création de mutations ponctuelles pour connaître le rôle de chaque base dans les mécanismes de régulation ou dans la séquence peptidique. – Insertion de séquences plus ou moins longues en fonction de la carte de restriction. L’étendue du retrait dépend du temps d’incubation. On utilise pour cela plusieurs stratégies en fonction des sites restriction : – Une coupure par une enzyme de restriction suivie de l’action de la nucléase S1 permet de retirer de 3 à 8 paires de bases suivant le type d’enzyme de restriction (largeur du site de reconnaissance) – Une coupure par une enzyme de restriction suivie de l’action de l’exonucléase III permet également de retirer plus de bases en fonction du temps d’incubation. Le principe consiste à utiliser les enzymes de restriction soit pour « déléter ».CHAPITRE V: MUTAGENÈSE IN VITRO. Pour être pleinement informative. la suppression doit être progressive.LES MUTAGENÈSES 1.

1 : Mutagenèse. cette enzyme digère un des brins d’un duplex d’ADN dans la direction 3’ à 5’. la molécule de DNA est réparée par l’addition des quatre dNTP et du fragment de Klenow de la DNA polymérase. Le principe utilise les mêmes méthodes que pour la délétion. Figure V. ou pour connaître l’influence d’un acide aminé dans le fonctionnement d’une protéine. à Le site est traité avec l’ADN polymérase I modifiée (appelée fragment de Klenow). soit un oligonucléotide de synthèse. 46 . on ouvre dans l’ADN un site de restriction: un smal. En effet. On obtient encore des extrémités 5’ débordants. a. soit un fragment de restriction purifié. après y avoir créé de courtes régions mono-caténaires. Mutagenèse par insertion: L’insertion d’une courte séquence dans un gène permet d’élucider l’effet de position soit d’une base soit d’une séquence de bases dans les phénomènes de régulation. et 3 à 5 exonucléasique).Les substitutions de nucléotides Les substitutions des bases peuvent être introduites dans un segment d’ADN cloné dans un plasmide. Exemple : Pour créer donc un mutant contenant une substitution de base par une désamination de la cytosine. Le fragment que l’on veut insérer ou modifier est. ce fragment enzymatique agit comme une exonucléase en effectuant une digestion simple brin 3’à5’ jusqu’à ce qu’il rencontre un résidu T. 5 à 3 exonucléasique. ∗ soit en exploitant l’activité exonucléasique de l’ADN polymérase I d’Escherichia coli (qui a trois activités enzymatiques: 5 à 3 polymérisante. à L’addition du bisulfite provoque une désamination des résidus cytosines (C) des brins exposés pour donner de l’uracile (U). à Le résultat est une substitution d’une paire de bases G-C par une paire A-T. On aura donc des bouts 5’ débordants. En présence de dTTP. à Après élimination du bisulfite. en l’absence des désoxyribonucléotides triphosphates. soit une substitution de nucléotides.2. substitutions de nucléotides On procède alors comme il suit: à Avec une enzyme de restriction donnée comme Hind II. Ces régions mono-caténaires sont alors utilisées pour substituer des paires de bases ou pour introduire des nucléotides supplémentaires: ∗ soit par une digestion partielle à l’aide de l’exonucléase III (qui a une action exonucléasique 3 à 5 ) après une coupure par une enzyme de restriction.

2 : mutagenèse dirigée au moyen d’oligonucléotides Le protocole est le suivant: 1. Les deux brins de l’ADN obtenu sont séparés par simple chauffage suivi d’un refroidissement rapide et transférés par transformation dans E. Le gène que l’on désire muter est cloné de préférence dans un vecteur dérivé d’un phage dont le génome est une molécule d’ADN monocaténaire. 47 . Il y aura donc un défaut d’appariement au niveau de cette base avec l’ADN du vecteur. Figure V. 5. Un oligonucléotide synthétique dérivé du gène cloné et portant la mutation désirée est ajouté dans le milieu pour servir d’amorce (primer) pour la synthèse in vitro du brin complémentaire du vecteur M13. 2. comme le phage M13. Michael Smith a inventé la méthode qui utilise des petits oligonucléotides de synthèse d’une taille de 15 à 25 bases. Le brin complémentaire est alors synthétisé in vitro par le fragment de Klénow de la DNA polymérase I qui utilise l’oligonucléotide modifié comme amorce.b . L’amorce synthétique peut donc contenir n’importe quelle base « erronée » que l’on désire introduire dans la séquence. une ou deux bases mal appariées peuvent être tolérées dans la formation de la double hélice. Mais comment créer une mutation dans une séquence qui ne bénéficie pas de cette situation favorable ? Pour résoudre ce problème.La mutagenèse dirigée au moyen d’oligonucléotides: Les exemples que nous venons de voir possédaient un site de restriction propice aux bords de la région à modifier. Les bactéries ayant incorporé la séquence mutée sont sélectionnées par hybridation in situ dans des conditions de forte stringence avec l’oligonucléotide muté marqué comme sonde (pour différencier la molécule non mutée). coli où il seront répliqués in vivo et produiront finalement un grand nombre d’exemplaires de la séquence mutée que l’on désire (50% pour la séquence mutée et autant de copies de l’ADN sauvage 50%). Cependant. 4. si l’hybridation est réalisée à basse température et à faible stringence (faible force ionique). 6. 3.

le gène ciblé est inactivé car l’exon D exogène est interrompu par le gène neo. La cellule est sélectionnée positivement par G418 ( neo+ ) et résiste au ganciclovir (tk-). D.La mutagenèse insertionnelle ciblée par recombinaison homologue On peut cibler le site de la mutagenèse insertionnelle en introduisant une séquence homologue au gène que l’on veut léser. En ce moment. c’est-à-dire par insertion. – En cas de recombinaison homologue par remplacement. Pour réaliser la même opération sur des gènes non sélectionnables (gènes de régulation). le ganciclovir. D .c . 3 . 48 . et le gène cible n’est pas touché.3) La première construction réussie a utilisé le protocole suivant: 1 – Le vecteur plasmidique utilisé contenait à la fois un fragment du gène HPRT (Hypoxanthine-guanine PhosphoRibosyl Transférase) pour cibler ce gène in vivo et un gène néo (ce gène marquer confère à la cellule une résistance à la néomycine) 2 . soit une insertion par remplacement.Le vecteur est introduit par électroporation dans des cellules embryonnaires indifférenciées (ES cells : Embryonic Stem cells : cellules staminales embryonnaires indifférenciées pluripotentes et cultivables in vitro de façon prolongée).Celles où l’intégration s’est faite par le truchement d’une recombinaison homologue ayant inactivé le gène HPRT sont alors sélectionnées par leur résistance à la thioguanine (sélection des cellule HPRT-). Dans le cas d’une insertion par remplacement. néo. les deux gènes sont présents dans le génome.Les cellules ayant intégré l’ADN sont sélectionnées par leur résistance au G418 (un analogue de la néomycine) conférée par le gène néo. 4 . la construction utilisée est intégrée en totalité. E) et le gène tk est éliminé en raison de sa position terminale. Mansour a élaboré un système de double sélection : le procédé de sélection positive et négative dont le principe est le suivant : – Si l’intégration se fait d’une manière aléatoire. Dans le cas d’une insertion par addition. D et E endogènes sont remplacés par ceux de la construction (C. (Figure V. Celle-ci reconnaît sélectivement le gène endogène et provoque une recombinaison homologue responsable soit d’une insertion par addition. les exons C. analogue de la thymine). La thymidine kinase du virus de l herpes confère la sensibilité à une drogue antivirale. le gène cible est inactivé. La cellule est sélectionnée positivement par le G418 (résistance conférer par le gène néo) et négativement par le ganciclovir (tk+. Les évènements de recombinaison homologue réussis peuvent être vérifiés par la PCR en utilisant une amorce correspondant à l’ADN exogène (par exemple une séquence néo) ou une amorce correspondant à une séquence endogène (comme l’exon F du gène HPRT).

3 : La mutagenèse insertionnelle ciblée par recombinaison homologue A B C D E F Gène ciblé C D NEO D F tk Construction C D NEO D E tk A C D E F Intégration aléatoire A B C D E F Gène ciblé C D NEO D E tk Construction Recombinaison homologue A B C D NEO D E F 49 .Figure V.

La poursuite des cycles en présence des amorces amont et aval conduit à l'amplification de cette séquence complète dans laquelle le codon muté a été inséré.Figure V. mais dans les autres cas. Mutagenèse par PCR • La création d'une mutation artificielle peut être obtenue dans un gène par le jeu des amplifications à partir d'amorces modifiées. on conduit à une renaturation entre les fragments au niveau des amorces centrales modifiées. Dans le cas des changements phénotypiques le résultat est visuel. En réunissant ces deux amplifications et en dénaturant l'ADN. La séquence de DNA modifiée est couplée à un gène reporteur que la cellule d’expression ne possède pas et dont le produit est facilement analysable. On fait une première amplification entre chacune des amorces modifiées et les amorces des extrémités. 3 . Les gènes 50 . On fait une première amplification entre chacune des amorces modifiées et les amorces des extrémités. On prépare l'amplification du gène ou du cDNA grâce à deux amorces placées en amont et en aval de la séquence d'intérêt. Cette hybridation fait apparaître des extrémités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux extrémités de la séquence d'intérêt.. En réunissant ces deux amplifications et en dénaturant l'ADN. On prépare aussi par synthèse des oligonucléotides conformes aux séquences des deux brins du gène autour du codon qui doit être modifié mais dont les bases sont volontairement changées pour qu'elles permettent la synthèse d'un brin complémentaire comprenant la substitution (ou la délétion.) souhaitée. soit à des promoteurs inductibles.. La création d'une mutation artificielle peut être obtenue dans un gène par le jeu des amplifications à partir d'amorces modifiées. on conduit à une renaturation entre les fragments au niveau des amorces centrales modifiées.. MISE EN ÉVIDENCE DES EFFETS DE LA MODIFICATION L’effet des modifications est de suivre l’expression d’un gène soit par une augmentation ou une diminution de la production d’une protéine soit d’étudier les modifications structurale de la protéine produite. Cette hybridation fait apparaître des extrémités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux extrémités de la séquence d'intérêt. • • • • • II. On prépare aussi par synthèse des oligonucléotides conformes aux séquences des deux brins du gène autour du codon qui doit être modifié mais dont les bases sont volontairement changées pour qu'elles permettent la synthèse d'un brin complémentaire comprenant la substitution (ou la délétion..) souhaitée. il faut avoir recours soit à des gènes reporteurs. mutation d’un site de restriction. On prépare l'amplification du gène ou du cDNA grâce à deux amorces placées en amont et en aval de la séquence d'intérêt. La poursuite des cycles en présence des amorces amont et aval conduit à l'amplification de cette séquence complète dans laquelle le codon muté a été inséré.4 : La mutagenèse .3 : La mutagenèse insertionnelle ciblée par recombinaison homologue Figure V.

La transfert de matériel génétique utilise aussi les vecteurs viraux. Le DNA peut aussi être introduit dans les cellules par micro-injection surtout dans le cas des ovocytes fécondés. 51 .les plus courants sont : le gène de la Chloramphénicol-acétyl transférase (CAT). Le DNA peut aussi être introduit par des projections de micro-particules enrobées de DNA surtout pour les plantes. de la β-galactosidase ( -Gal) et de la luciférine. rétroviraux et les plasmides que l’on appelle alors des vecteurs navettes. TRANSFERT DE L’ADN MODIFIÉ Le transfert de l’ADN libre dans les cellules s’effectue par transfection avec différentes techniques suivant le type cellulaire : La transfection par le phosphate de calcium fait intervenir une internalisation du complexe DNA-calcium par phagocytose La transfection par le complexe DEAE dextran est également une internalisation par phagocytose L’électroporation utilise l’effet d’une tension électrique sur des cellules en suspension qui provoque la formation transitoire de pores permettant au DNA de pénétrer dans la cellule. (CF Photocopies) III. de la β-glucuronidase ‘( -Glu).

DEUXIÈME PARTIE : APPLICATION DE LA BIOLOGIE MOLECULAIRE :
LE GÉNIE GENETIQUE
52

CHAPITRE VI:

LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX MICRO-ORGANISMES

Les génomes eucaryotes sont beaucoup plus complexes que les génomes bactériens et phagiques C’est pourquoi les techniques de manipulation de l’ADN doivent être adaptées aux différents génomes. Les exemples ci-dessous donnent une idée de la taille du génome de quelques espèces : • Plasmides • Bactériophage • Bactériophage M13 • E. coli • La levure (Saccharomyces cerevisiae) • Neurospora crassa • C. elegans • Drosophila melanogaster • Homo sapiens à à à à à à à à à 2 à 5 kb 4,8 kb 6,4 kb 4 Mb 4 Mb 27 Mb 100 Mb 165 Mb 3000 Mb

I. LA TECHNIQUE DE L'ADN RECOMBINANT (ADNR) La technique de l'ADN recombinant (ADNr) est simple dans son principe: L’ADN recombinant est formé en réunissant des segments d’ADN de différentes sources par le processus suivant: L'ADN d’intérêt est coupé avec une enzyme de restriction, L'ADN exogène contenant la séquence d'intérêt est mis en présence de l’ADN du vecteur digéré par la même enzyme Les deux ADN sont ensuite ligaturés avec une enzyme appelée ligase. Le DNA obtenu est transféré dans une cellule d’expression On analyse les résultats obtenus grâce à des marqueurs présents dans l’ADN du vecteur Figure VI.1 1 - Les organismes transgéniques et la recherche en génie génétique Un organisme transgénique est défini comme provenant d’une cellule dont le génome a été modifié par l’introduction d’ADN extrinsèque. Cet ADN extrinsèque peut être une séquence provenant de la même espèce mais qui a subi des modifications chimiques ou provenir d’une espèce différente. Le gène d’intérêt dans l’échantillon d’ADN extrinsèque est le transgène. L’introduction de cet ADN dans une cellule peut s’effectuer par une série de manipulation diverses : par l’électroporation, la micro-injection, les liposomes, la coprécipitation par le phosphate de calcium, par la transformation, par infection virale, ou par un bombardement avec des micro-projectiles de tungstène enrobés d’ADN dans le cas des cellules végétales.

53

La construction d’organismes transgéniques constitue un bond en avant pour la recherche en génie génétique. Une des méthodes les plus importantes consiste en l’utilisation de gènes indicateurs qui permettent de mesurer l’activité d’un gène spécifique dans le tissu où il s’exprime normalement, malgré l’absence d’un phénotype facilement détectable. La région qui contrôle l’expression du gène en question (promoteur) est alors rattachée à la région codante d’un gène dont l’activité est facilement mesurable et qui constitue alors le gène indicateur. Chaque fois que le gène étudié est exprimé, le gène indicateur signale sa présence par son activité indicatrice dans la cellule ou dans les tissus concernés. La construction de bactéries, de plantes, de champignons et d’animaux transgéniques ouvre donc de nombreux débouchés pratiques. Nous avons déjà vu comment les bactéries transgéniques sont utilisées pour la production de différentes protéines, parfois d’origine humaine, utiles en médecine et en pharmacie. Cet aspect de la recherche est appelé biotechnologie. L’ADN recombinant : L’action d’une enzyme permettant de souder deux fragments d ‘ADN , comme l’exemple de l’enzyme EcoRI explique simplement le principe de l’ADN recombinant. 2. Intérêt de la transgenèse Sur le plan de la biotechnologie : - Au plan zootechnique : l’un des intérêts majeurs de la transgenèse est l’amélioration des caractères phénotypiques des animaux de rente: amélioration de la croissance des animaux, comme le porc, le saumon, l’acquisition de résistances aux maladies causes de mortalité dans les élevages de lapins, de truites, de carpes…. - Au niveau des plantes : La création de plantes résistantes aux insectes, au stress hydrique et pour la production de protéines utiles comme les anticorps : (maïs résistant aux insectes, tomates transgéniques à mûrissement lent, bananes vaccinantes….) Sur le plan médical : â Production de protéines d’intérêt pharmaceutique : Certaines protéines trop complexes (glycosylées, carboxyméthylées…) ne peuvent être synthétisées complètement par les bactéries in vitro. Il faut donc chercher à en obtenir par un animal transgénique (dans le lait, le sang, les urines…..). L’obtention de ruminants transgéniques producteurs de protéines d’intérêt pharmaceutique à haute valeur ajoutée (facteurs VIII et IX de la coagulation, anti-thrombine III, alpha-1-antitrypsine, activateur du plasminogène, sérum albumine…) représente aujourd’hui un intérêt financier énorme. â Xéno transplantation : Face à l’insuffisance des organes humains disponibles pour les greffes, la recherche d’organes animaux peut représenter une solu-

54

il est envisagé de diminuer la concentration de la bétalactoglobuline qui participe à l’intolérance au lait dont souffre une grande partie de la population mondiale. â Création de modèles animaux des maladies humaines : Des souris. II . Les maïs transgéniques possèdent aussi des gènes de résistance aux ampicillines. Il s’agit d’un composé du lait humain qui est absent du lait de vache. aux Etats Unis et en Australie survivent pendant plusieurs semaines quand ils sont greffées à des primates. c’est à dire simultanément un aliment et un médicament. mais aussi des ruminants transgéniques peuvent servir de modèles pour l’étude des maladies humaines à prions. Les c urs et les reins de porcs transgéniques obtenus en Grande Bretagne. Néanmoins. Le lait devient alors un « alicament ». Les moutons qui sur-expriment GH (hormone de croissance humaine) sont diabétiques et meurent avant l’âge d’un an. _ Les risques liés à l’environnement : Ces risques sont liés à la dissémination des organismes transgéniques.tion palliative. L’expression de la lactoferrine humaine dans le lait de vache a déjà été réalisée. â Risques liés à la transgenèse : Les applications et les espoirs que font naître la transgenèse sont très nombreux. mais aussi un rôle antibactérien (Elle assure une protection du tube digestif du nouveau-né contre les infections bactériennes). _ Les risques liés à la consommation des produits OGM comme les protéines de la vache folle qui provoque des troubles chez l’homme. COLI 55 . d’autant plus que très peu de maladies sont transmissibles du porc à l’homme. physiologiquement proche de l’homme est à l’heure actuelle le meilleur candidat. Les souris de même que les lapins peuvent servir aussi pour l’étude du SIDA et pour des tests thérapeutiques. A l’inverse. Elle joue un rôle de transporteur de fer. Des bactéries et des souris transgéniques qui s’échappent d’un laboratoire de recherche ou d’un centre de production. Le taureau hollandais HERMANN est un mâle fondateur transgénique de ce gène.SYNTHÈSE DU FACTEUR VIII HUMAIN PAR L’E. l’utilisation de la transgenèse chez les végétaux et les animaux fait l’objet de vives réserves et controverses : _ L’utilisation de l’hormone de croissance humaine chez les animaux perturbe leur croissance et leur reproduction. les gènes humains des protéines régulatrices du complément sont transférés au porc. Pour éviter le rejet d’organes porcins transplantés chez l’homme. Le porc. â Modification de la composition du lait : Elle a pour but de mieux adapter le lait des ruminants à la consommation humaine et d’améliorer sa transformation par l’industrie laitière. Un lait enrichi en anticorps ou en lysozymes pourrait être protecteur du tube digestif et pourrait même être utilisé chez les nourrissons. Ces transgènes peuvent donc s’intégrer dans les bactéries du tube digestif humain et conférer des résistances bactériennes aux antibiotiques que nous utilisons pour nos traitements. les déchets des produits transgéniques déversés dans la nature constituent de grands dangers qui guettent sans cesse notre écosystème.

coli : Les deux chaînes d’insuline sont synthétisées séparément sous forme de protéines fusion avec la galactosidase. Le Chromosome d’E. Cette possibilité est utilisée pour produire de grande quantité des protéines d’intérêt comme le facteur VIII de la coagulation sanguine qui est défectueux chez les hémophiles. Lorsque la transcription à partir du promoteur lac est induite par l’addition d’IPTG.Le vecteur utilisé dans cet exemple est le phage T7. a été inséré dans un plasmide à côté d’un promoteur tardif du phage T7. les gènes de la bactérie hôte ne sont plus transcrits. Il en résulte une production de quantités importantes de facteur VIII par les bactéries contenant le plasmide. Actuellement l’insuline est produite en grande quantité par E. Les RNA polymérase de T7 ainsi produites transcrivent activement à leur tour le gène du facteur VIII à partir du promoteur tardif du T7 présent sur le plasmide. L’addition de l’inducteur IPTG (analogue du lactose). L’ARN polymérase du phage T7 produite alors par la bactérie transcrit abondamment ce gène dans le plasmide. l’ARN polymérase du phage T7 transcrit les gènes précoces à partir d’un promoteur dit précoce du phage T7. inactive le répresseur et autorise alors la synthèse de l’ARN polymérase du phage T7. III .2 : Synthèse de l’insuline IV . en l’occurrence. la bactérie synthétise des quantités énormes des produits des gènes dits tardifs du phage T7 (les protéines de la capside et de la queue). A ce moment.SYNTHÈSE DE L’HORMONE DE CROISSANCE HUMAINE PAR ESCHERICHIA COLI 56 . La grande quantité de mRNA ainsi produite est traduite pour donner une grande quantité de la protéine facteur VIII. COLI: Expression de l’insuline humaine chez Escherichia. L’insuline active est obtenue par une réaction d’oxydation chimique des cystéines. le facteur VIII. On insère le gène de l’ARN polymérase de T7 dans le chromosome d’Escherichia coli sous le contrôle du promoteur de l’opéron lactose. coli est manipulé pour contenir le gène de l’ARN polymérase du phage T7 placé sous le contrôle du promoteur lac. En fin d’infection. le gène de la polymérase du phage T7 est aussi transcrit et traduit en protéine. Par conséquent seules les protéines du phage sont encore synthétisées. Figure VI. Le schéma représente un système de deux vecteurs pour la production en deux étapes du facteur VIII humain. Elles sont ensuite libérées par un traitement chimique puis mélangées.SYNTHÈSE DE L’INSULINE HUMAINE PAR E. coli par une insertion de son gène dans un plasmide. Le gène d’intérêt. Au début de l’infection. le gène humain (ADNc) du facteur de coagulation du sang. Le gène de l’ARN polymérase de T7 est transcrit à partir du promoteur lac et se trouve normalement réprimé par le répresseur lac.

l’importance d’avoir des vecteurs à grande capacité d’emmagasinage pour étudier les gènes humains ou pour produire des protéines humaines à intérêt thérapeutique. ces plasmides peuvent s’intégrer dans les chromosomes par recombinaison homologue faisant intervenir un seul ou deux crossing-over. L’une des raisons est que la génétique de cette levure est extrêmement bien développée. • Dans le premier cas. 2 – L’élaboration du vaccin contre l’hépatite B. Il est alors possible d’introduire des gènes étrangers dans la levure pour en étudier l’effet sur le phénotype. Les vecteurs de levure les plus simples sont dérivés de plasmides bactériens dans lesquels un fragment d’ADN de levure a été inséré.Le schéma de la figure IV. Il en résulte une méthionine à l’extrémité N-terminal qu’il faut enlever pour avoir la protéine active. pourvu qu’il contienne une origine de réplication bactérienne et un marqueur sélectionnable dans la bactérie. Ces vecteurs navettes que sont les chromosome artificiels de levure (YAC) sont extrêmement indispensables pour le clonage de grands fragments de génome humain.Les levures transgéniques La levure Saccharomyces cerevisiae est devenue l’Escherichia. V – PRODUCTION DE VACCINS PAR LA TECHNIQUE DE L’ADN RECOMBINANT : 1 . 57 . On réalise alors. Dans ce cas. le plasmide entier est intégré dans le chromosome. une séquence signal bactérienne est ajoutée pour favoriser la sécrétion du produit de traduction dans l’espace périplasmique. • Dans le second cas. Quand ils sont introduits dans les cellules de levure. (b) : Dans cette construction. puis de re-transférer le plasmide dans Escherichia coli pour manipuler le gène de la levure. il n’y a plus de méthionine supplémentaire et le produit excrété est de l’hormone de croissance pure. Ces plasmides bactériens ne peuvent cependant pas se répliquer dans la levure. la séquence signal humaine de l’insuline est éliminée pour permettre l’expression de la protéine dans les cellules bactériennes. Comme exemple : • le gène qui code pour le facteur VIII de la coagulation sanguine est long de 190 kb • le gène responsable de la dystrophie musculaire de Duchenne fait 1000 kb. coli : (a) : Dans la première construction. l’allèle cellulaire est remplacé par celui qui est porté par le plasmide par recombinaison. coli des eucaryotes.8 donne le protocole de construction pour la synthèse de l’hormone de croissance humaine dans E.

16 à 19 % de la population du Burkina Faso sont aussi atteints par l’infection à l’hépatite B. Les Streptomyces étaient donc tout indiquées pour mettre au point de nouvelles molécules actives.Chaque année.3 : Production de l’antigène HbsAg VI .. La particule virale est recouverte d’un antigène de surface : HbsAg. L'abondance et la diversité structurale des antibiotiques synthétisés par les Streptomyces ne se retrouvent dans aucun genre bactérien. Dans les cellules de levures transgéniques. le virus de l’hépatite B infecte plusieurs centaines de milliers de personnes dans le monde. antihelminthique. présentant tout un éventail de structures chimiques et d'activités biologiques. Les antibiotiques de la famille des streptogramines. On estime qu’aux Etats-Unis. Par exemple.APPLICATION DU GÉNIE GÉNÉTIQUE À L'AMÉLIORATION DE LA PRODUCTION DES ANTIBIOTIQUES PAR DES BACTÉRIES L'apparition de bactéries pathogènes multirésistantes aux antibiotiques pose un grave problème médical. Les Streptomyces sont des bactéries du sol à Gram+ qui appartiennent à la classe des Actinomycètes. ces antigènes injectés à l’homme provoquent une réponse immunitaire par la production des anticorps antiHbs ou anti HbsAg. tels que la formation de mycélium et de spores. en particulier la nouvelle pristinamycine in- 58 . Cela rend nécessaire la recherche de nouvelles molécules actives contre ces pathogènes. il y a 150 000 infections par l’hépatite B chaque année. anabolisante. au point que les Streptomyces sont à l'origine de 70 % des antibiotiques produits industriellement. septicémies. Pour ce faire. bactérie Gram+ qui produit la pristinamycine. Cela rend la production industrielle de ces métabolites particulièrement intéressante. appelé Engérix-B a utilisé la technologie de l’ADN recombinant.. Cette protéine est actuellement commercialisée et constitue un vaccin contre l’hépatite B. Figure VI. Après purification. Cette différenciation morphologique s'accompagne d'une différenciation métabolique et de la production d'une grande variété de métabolites secondaires.) est inopérante dans un nombre croissant de cas. On peut trouver des molécules ayant une activité herbicide. Mais les plus connus restent les antibiotiques. Cette nouvelle souche bactérienne transgénique est stable dans les conditions industrielles et l'antibiotique est obtenu dans la forme souhaitée. La synthèse de la pristinamycine par des Streptomyces pristinaespiralis recombinants Les chercheurs ont eu l’idée de construire une souche génétiquement modifiée de Streptomyces pristinaespiralis. la vancomycine. Le virus de l’hépatite B (HBV) qui infecte le foie. anticancéreuse. le gène est transcrit et traduit en antigènes viraux. antibiotique. Cette protéine se retrouve dans le sang des personnes infectées sous la forme de gros agrégats protéiques. provoque des lésions et dans certains cas des cancers. Elles présentent des phénomènes de différenciation uniques chez les procaryotes. La fabrication du vaccin contre l’hépatite B. le gène de l’antigène de surface du virus de l’hépatite B (HbsAg) a été introduit dans Saccharomyces cereviciae par l’intermédiaire d’un YAC. qui a longtemps été l'antibiotique de référence contre les infections sévères à bactéries Gram+ (endocardites.

Cependant. S. Ces deux composants agissent de façon synergique pour bloquer la synthèse protéique et possèdent. précurseur de la PIIA. La pristinamycine est produite par Streptomyces pristinaespiralis. pristinaespiralis est constituée d'un mélange de deux composants. un effet post-antibiotique puissant (le blocage se maintient même après disparition de l'antibiotique). Les souches de S. la pristinamycine I et la pristinamycine II. c'est pourquoi une forme injectable de pristinamycine constitue une solution intéressante pour remplacer la vancomycine. et la PIIB. C'est un mélange de deux composants. peuvent fournir un nouveau moyen de lutter contre les bactéries pathogènes. Le composant PII est luimême un mélange de deux molécules : la PIIA. le précurseur de la PIIA.jectable.). Cette dernière est elle-même un mélange de deux molécules : la PIIA. La conversion de PIIB en PIIA est obtenue par oxydation d'un acide aminé.4 La pristinamycine produite naturellement par S. développée par Rhône-Poulenc-Rorer. pristinaespiralis produit un mélange de ces deux formes dans les proportions de 80 % de PIIA et de 20 % de PIIB. Pristinamycine IIB FMN reductase NADH + H+ + FMN --------------------------à Pristinamycine IIA NAD+ + FMNH2 PIIA sybthase PIIB + FMNH2 + O2 --------------------------à Figure VI. produit final de la voie de biosynthèse. la pristinamycine I et la pristinamycine II. produit final de la voie de biosynthèse. et la PIIB. pristinaespiralis sont incapables de réaliser naturellement la bioconversion totale de PIIA + FMN + 2H2O 59 . la proline (Fig. La pristinamycine est utilisée en médecine humaine depuis une vingtaine d'années. son utilisation était limitée. L'un des composants de la forme soluble mise au point par Rhône-Poulenc-Rorer est obtenu par modification chimique de la PIIA. mais à cause de sa faible solubilité. pristinaespiralis sont incapables de réaliser la bioconversion totale de PIIB en PIIA et la modification par génie génétique de cette souche a permis de la réaliser. les souches actuelles de S. L'un des composants de la forme soluble est obtenu par oxydation chimique de la PIIB. de plus.

Ils montrent également que la quantité de PIIA synthétase était bien le seul facteur limitant la conversion totale de PIIA en PIIB et qu'il est possible de réaliser cette conversion sans affecter le niveau total de production. L'idée de base était que la surexpression de gènes snaA et snaB de S. pristinaespiralis dont on souhaite l’expression. Référence : .Sezonov G. 4 . pristinaespiralis. 1997.. 60 . pristinaespiralis. on intégra les transgènes du S. il était souhaitable d'obtenir uniquement le composé PIIA. par génie génétique. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de PIIB en PIIA) permettrait une conversion totale. La souche de S. 2 – clonage de deux gènes snaA et snaB sous contrôle d'un promoteur de transcription fort (ermE promoter) dans des vecteurs intégratifs dérivés de pSAM2 3 – Introduction de la construction contenant les deux gènes snaA et snaB dans S. Bamas-Jacques N. L'équipe de Rhône-Poulenc-Rorer a isolé et caractérisé les gènes en question. et qu'ils permettent d'éviter les problèmes d'instabilité structurelle ou ségrégationnelle souvent rencontrés avec des vecteurs réplicatifs chez Streptomyces. génétiquement propres aux Actinomycètes. Cette surexpression pouvait être obtenue en réintroduisant ces gènes sous contrôle d'un promoteur fort dans une souche de S.La souche ainsi construite est stable dans les conditions industrielles et synthétise de la pristinamycine qu’on extrait et qu’on purifie en vue d’une utilisation thérapeutique. pristinaespiralis.Ces résultats montrent que les vecteurs employés sont maintenus de façon stable en l'absence de pression de sélection. Dans le vecteur pSAM2.. Friedmann A. les chercheurs ont introduit dans une souche de S. est capable de réaliser complètement cette conversion et ne synthétise que le dérivé PIIA. pSAM2. 5 ..-L. Complete conversion of antibiotic precursor to pristinamycin IIA by overexpression of Streptomyces pristinaespiralis biosynthetic genes.. ambofaciens. Pernodet J. 349-353. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de PIIB en PIIA). Industriellement parlant. Ce chimère est une construction stable. Afin d’obtenir une composition totalement soluble. Processus : 1 ..Utilisation d’éléments intégratifs originaux de S. Nature Biotechnology. L'ADN intégré dans le chromosome grâce à ce type de vecteurs est très stable et est transmis à toutes les cellules filles.PIIB en PIIA. Blanc V. 1997. et Guérineau M. 15. nouvellement construite. pristinaespiralis. Ces éléments sont appelés intégratifs car ils portent des gènes qui permettent une intégration très efficace à un site spécifique dans le chromosome de la bactérie hôte. les gènes snaA et snaB de S.

La production de la bière Le moût du malt (comme de mil rouge) est un mélange de mono. tri polysaccharides et de dextrines qui proviennent de l’hydrolyse de l’amidon par les amylases. on a pu améliorer la qualité des aliments fermentés. Pour cela. on peut procéder comme suit : Amélioration du goût de la bière : Saccharomyces diastaticus possède des enzymes qui dégradent les dextrines pour donner du glucose fermentescible. le vin.Pediococcus acidilacticus et des levures comme Saccharomyces cerevitiae. En clonant les deux gènes responsables de la formation de ces enzymes dans Saccharomyces cerevisiae on améliore et le goût par l’hydrolyse de l’amidon et la limpidité de la bière par l’hydrolyse des protéines. Lactobacillus heveticus. le yoghourt et aussi des boissons fermentées comme la bière. mil…) pour la production de la bière. le fromage. C’est le gène DEX qui code pour l’amidon. on a cloné le gène de la présure de veau dans un vecteur d’expression qu’est Saccharomyces cerevisiae qui produit alors de la présure de levure.VII – PRODUCTION DES ALIMENTS FERMENTÉS PAR DES MICRO-ORGANISMES TRANSGÉNIQUES Depuis fort longtemps. Amélioration du goût et de la limpidité de la bière : Aspergillus abwamori est un champignon qui produit une enzyme : « la glucoamylase » qui dégrade l’amidon brut en glucose. 2. Ce gène est cloné dans Saccharomyces cerevisiae pour augmenter la teneur en glucose et donc en éthanol par fermentation. La production du lait caillé constitue la première étape dans la production du fromage. di. Ces fermentations sont le résultat du métabolisme des bactéries fermentaires comme. La production de fromage La présure est une enzyme produite par la caillette des veaux qui coupe la caséine pour provoquer la coagulation du lait. Saccharomyces cerevisiae peut faire fermenter tous les polysaccharides sauf les dextrines qui constituent cependant 22% des hydrates de carbone des céréales utilisées (orge. Lactobacillus acidophilus. 1. riz. 61 . Il faut beaucoup de présure pour la fabrication du fromage alors que sa production par les veaux n’est pas suffisante.4-glucosidase. Lactobacillus lactis. seigle. On peut également utiliser une bactérie lactique en fonction de son métabolisme et de la rentabilité. maïs. Lactobacillus casei. le dolo.-1. le cidre. l’homme consomme des aliments fermentés comme le pain. En appliquant la technique de l’ADN recombinant aux bactéries lactiques ou aux levures. Lactobacillus delbruekii. Pour améliorer le goût et la limpidité de la bière. Le goût de la bière se trouve ainsi amélioré.

occ) se trouvent dans la bactérie sous le contrôle de séquences régulatrices procaryotiques. Le plasmide Ti constitue l’exemple classique pour les études des plantes transgéniques. le plasmide Ti. La séquence ADN-T contient: des gènes qui codent pour des hormones de croissance végétales et sont responsables de la tumorisation des cellules de la plante. Les gènes qui contrôlent la synthèse des hormones et des opines (nos. ocs) sont exprimés dans la plante à partir de séquences régulatrices eucaryotes. Figure VII.3: Processus d’Infection 62 . Par contre. une partie de son ADN appelé « ADN-T » inséré dirige alors la synthèse d’hormones végétales qui perturbent la régulation de la croissance des cellules infectées de la plante (ce qui donne lieu à la formation d’une tumeur) ainsi que la synthèse de nopaline qui peut être utilisée comme source de carbone et d’azote par la bactérie (symbiose). Lors de l’infection.Définition et action du plasmide Ti dans la nature : Le plasmide Ti (Tumor Inducing) dérive d’une bactérie du sol appelée Agrobacterium tumefaciens. ceux qui contrôlent la synthèse des enzymes de dégradation des opines (noc. Cette bactérie provoque chez les plantes qu’elle infecte une maladie du nom de « gale » du collet.CHAPITRE VII: LE GENIE GENETIQUE APPLIQUE AUX VEGETAUX Les plantes transgéniques L’avènement de la technologie de l’ADN recombinant a introduit une dimension nouvelle dans la recherche. La production de la tumeur est déterminée par un grand plasmide circulaire de 200 kb présent dans la bactérie. L’amélioration n’est plus limitée à la sélection de variants au sein d’une espèce par la génétique classique. d’animaux ou même de bactéries. Les plantes infectées présentent des lésions constituées de cellules dont la croissance est incontrôlée (des tumeurs ou gales). généralement localisées à la base (ou collet) de la plante.1 : Plasmide Ti I . appelée « ADN-T ». est transférée dans la plante et insérée au hasard dans le génome cellulaire. Figure VII. la partie du plasmide.2: Infection par l’agrobacterium tumefaciens. LE PLASMIDE TI: 1. Il est alors possible d’introduire dans le génome d’une plante de l’ADN provenant d’autres espèces végétales. des gènes qui codent pour des enzymes qui conduisent les cellules tumorales à synthétiser des substances appelées opines (nopaline et octopine). parce qu’elle permet désormais de modifier le génome presque à volonté. Lorsque le plasmide Ti est inséré dans l’ADN chromosomique de la plante. Figure VII.

• un marqueur de sélection bactérien de résistance à la spectinomycine (spcR) • un marqueur de sélection bactérien de résistance à la kanamycine (kanR). pourront se multiplier. Si l’infection par la bactérie réussit. • Ti désarmé conserve l’extrémité gauche (L) de l’ADN-T qui servira de site de recombinaison pour l’intégration du vecteur intermédiaire. En principe. son ADN-T sera transféré aux cellules végétales et tout l’ADN localisé entre les extrémités droite et gauche de l’ADN-T s’intégrera dans un chromosome de la plante. peuvent être utilisées pour inoculer des fragments du tissu végétal comme par exemple de petits disques de feuille. seules les cellules qui contiennent l’ADN-T. qui constitue la preuve que les cellules de plantes ont été transformées. Si on place les disques de feuilles sur un milieu nutritif qui contient de la kanamycine. Dans tous les cas. Figure VII. y compris les gènes inducteurs de tumeurs qui constituent l’aspect gênant de l’ADN-T. Ces cals peuvent donner des radicelles et fournir par la suite. Un certain nombre de ces gènes indicateurs sont utilisés actuellement avec succès : 63 . Utilisation du plasmide Ti comme vecteur en génie génétique. il faut utiliser un gène d’expression « gène indicateur » dans le vecteur pour suivre la manifestation de l’ADN intégré. La croissance de ces cellules donne lieu à la formation d’un petit amas ou cal. Les bactéries qui contiennent le plasmide co-intégrat (qui est le résultat de la fusion du plasmide désarmé et du vecteur intermédiaire). Il faut donc construire des dérivés plus petits qui contiennent l’essentiel de l’ADN-T et l’ADN d’intérêt.4: Génération de disques de feuilles 3. On peut construire un plasmide intermédiaire par le processus suivant : Un vecteur intermédiaire qui contient: • deux segments d’ADN-T qui portent les fragments L et R de la nopaline. tout fragment d’ADN cloné au sein de l’ADN-T peut comme lui s’insérer de façon stable dans le génome de la plante qui le reçoit. des plantes transgéniques. Le plasmide Ti est très grand pour les manipulations. Qu’en est-il de l’expression de l’ADN intégré en même temps que l’ADN-T? Il peut s’agir de n’importe quel ADN dont on veut tester l’expression dans la plante prise comme hôte. (CF Photocopies) Construire un vecteur Ti désarmé: • on retire toute la région droite de l’ADN-T.2. • ce vecteur intermédiaire doit posséder des sites de restriction pour l’étude de l’ADN cloné. Expression de l’ADN intégré.

Cette enzyme produit une coloration bleue par hydrolyse du substrat X-gluc. Promoteur Binding site gène codant l’enzyme 64 . La protéine régulatrice du gène I se fixe sur le « binding site » du gène II Gène répresseur GENE I : Protéine régulatrice Répresseur - Le gène II de l’enzyme recombinase est placé sous le contrôle d’un promoteur. • Le gène bactérien « lacZ » qui code pour la β-galactosidase. Entre le Promoteur et le gène de la recombinase se trouve le « binding site ». Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier. la régulation de l’expression de l’un ou l’autre gène de la plante ou de l’ADN intégré. mais elle produit un grain biologiquement stérile. • L’expression de la luciférase est alors observable en badigeonnant la plante avec de la luciférine et en observant la luminescence. Autres indicateurs utilisés dans les plantes: • Le gène bactérien « gus » qui code pour la β-glucuronidase. au cours du développement.L’enzyme luciférase catalyse la réaction d’une substance appelée luciférine avec ATP. donne une récolte normale. Une plante de tabac transgénique par exemple qui exprime le gène de la luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine. Cette réaction s’accompagne d’une émission de lumière et c’est ce qui explique la luminescence de la luciole en vol. désigne une technique consistant à introduire un transgène. • L’expression de la luciférase suivra le schéma d’expression du gène dont on a utilisé la séquence régulatrice. un gène exogène tueur qui empêche le développement du germe du grain récolté: la plante se développe dans les conditions habituelles. Le processus est le suivant: • On fusionne les séquences régulatrices localisées en amont de n’importe quel gène intéressant au gène de structure de la luciférase.Le gène I est un répresseur qui code pour une protéine régulatrice qui se fixe sur un site opérateur en amont des gènes de structure et inhibe leur transcription. La technologie fonctionne avec trois gènes et un inducteur chimique: . Le gène II produit une enzyme de restriction qui coupe et excise l’ADN « blocker » du gène III. Cette enzyme produit une coloration bleue par hydrolyse du composé X-gal. • La construction est introduite dans une plante en utilisant l’ADN-T. auquel correspond un brevet détenu par la compagnie Monsanto. II – LE TERMINATOR CHEZ LES SEMENCES Le concept Terminator.

nous pouvons avoir la production mais pas le reproduction. 2 – L’inducteur bloque le « binding site » au niveau du gène II et empêche le répresseur de se lier. à synthèse de la toxine qui tue les embryons des graines avant les récoltes. lors de la croissance de l’embryon. Une fois ces gènes activés dans ces semences. GENE III : Promoteur tardif blocker gène de la toxine - L’inducteur chimique est répandu sur les semis par les compagnies de semences comme Monsanto et Syngeta afin d’activer le gènes II et le gène III. s’il est excisé. Processus d’activation du gène terminator dans les semences de vente aux agriculteurs : 1 – Introduction de l’inducteur (par exemple du tétracycline) dans les semences. 5 – L’ARN polymérase se lie au « late promoteur » et transcrit le gène de la toxine. la transcription et l’expression du gène toxine. (Schéma) : 65 . produisant la toxine qui tue l’embryon rendant ainsi stérile les nouvelles semences pour la reproduction. 3 – L’ARN polymérase se lie au promoteur et entame la transcription du gène de la recombinase (isomérase) en ARN à synthèse de l’enzyme recombinase. Entre le promoteur tardif et le gène III se trouve l’ADN « blocker » qui favorise. 4 – La recombinase taille et excise la séquence « blocker ». Ce gène est sous le contrôle d’un promoteur tardif qui est activé seulement durant le développement de la graine.GENE II : - Le gène III produit une toxine qui est létale pour l’embryon.

Inducteur

Graine

Gène répresseur GENE I : Protéine régulatrice

Le répresseur se délie Promoteur GENE II : Binding site Synthèse de l’enzyme recombinase gène codant l’enzyme recombinase

gène de la toxine GENE III :

Promoteur tardif blocker Synthèse de la toxine qui tue l’embryon

Figure VII.5 : Processus d’activation du Terminator NB. En absence de l’inducteur, le répresseur se lie au « binding site » et empeche la transcription du gène de la recombinase. Dans ce cas tout est bloqué car il n’y a pas de recombinase pour exciser la séquence « blocker » et par conséquent, il n’y a pas de toxine qui puisse tuer les embryons des semences.

66

GENE I : Protéine régulatrice Répresseur

Promoteur GENE II : Binding site

gène codant l’enzyme recombinase

Pas de synthèse de l’enzyme recombinase gène de la toxine GENE III :

Promoteur tardif blocker Pas de production de la toxine

Figure VII.6 : En absence de l’inducteur, le gène codant pour la recombinase ne transcrit pas.

67

III . L’APPLICATION DU GÉNIE GÉNÉTIQUE À L’AGRICULTURE: Les applications sont et deviendront de plus en plus nombreuses en fonction de l’évolution des connaissances des caractéristiques génétiques des plantes et des réserves humaines contre les OGM. La problématique des OGM est que le gène TERMINATOR inséré, à travers les techniques du génie génétique, dans le génome de ces végétaux fait que leurs graines ont seulement une capacité de production et non de reproduction. L’agriculteur doit toujours dépendre de ces maisons de fabrication des semences qui ont le brevet. Nous en donnons quelques exemples qui fonctionnent déjà dans ce siècle. 1: L’enzyme luciférase : L’enzyme luciférase catalyse la réaction de la luciférine avec l’ATP. La réaction s’accompagne d’une émission de lumière et c’est ce qui explique la luminescence de la luciole en vol (la luciole produit cette enzyme d’où son nom). Cette enzyme est actuellement utilisée pour suivre la régulation et le génotype du tabac. Une plante de tabac transgénique qui exprime donc le gène de la luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine. Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier, au cours du développement, la régulation de l’expression de l’un ou l’autre gène de la plante ou de l’ADN intégré. 2. Le maïs transgénique Chaque année les agriculteurs du monde entier perdent 1/10 de leurs récoltes de maïs à cause des insectes nuisibles. Le maïs transgénique contient dans son génome un gène qui code pour une protéine que détestent les insectes et qui en principe ne doit pas causer de nuisances à l’homme. Cette variété augmente donc le rendement en éliminant le facteur insecte. 3. Les tomates « flavrsavr » Ces tomates transgéniques contiennent un gène freinant le mûrissement du fruit, ce qui leur confère une meilleure résistance au transport et une longue conservation. Désormais avec l’avènement du génie génétique, non seulement la qualité des espèces animales et végétales peut être améliorée, mais ces organismes transgéniques sont utilisés comme des usines pour produire des protéines « utiles » codées par des gènes d’organismes étrangers. 4. La protection des plantes contre l’infection virale

68

Les paysans américains et européens dépensent chaque année un peu plus de huit cents milliards des francs CFA pour la fertilisation de leurs champs par un épandage d’engrais composé essentiellement de sel d’ammonium (NPK). Les armes les plus utilisées pour lutter contre les insectes sont « les insecticides et les pesticides » qui posent actuellement de graves problèmes de pollution à l’environnement.Les virus des plantes représentent un sérieux problème pour l’agriculture car leurs infections entraînent une diminution de la croissance des plants. produit une protéine cristallisée toxique contre les larves d’un certain nombre d’insectes ravageurs des cultures et qui ne semble pas être nocive pour les vertébrés. On peut donc fabriquer des plantes transgéniques capables d’utiliser directement l’azote moléculaire par le processus théorique suivant : 69 . Le virus de la mosaïque du tabac (TMV) infecte les plants de tabac. Les plants transgéniques de tabac. le petit pois et autres céréales protègent aussi les plantes contre les insectes nuisibles. La plante transgénique est déjà produite aux Etats-Unis. Ce produit tue les plantes en inhibant la 5énolpyruvylshikimate-3-phosphate synthétase (EPSPS). Figure VII. Figure VII. du rendement des récoltes et de leur qualité.8: production de la protéine Bt 6. une enzyme du chloroplaste qui intervient dans la biosynthèse des acides aminés essentiels. Une plante transgénique qui exprime la protéine du manteau (coat Protein : CP) du TMV résiste aux infections par ce virus. Figure VII. de tomates et de coton qui expriment le gène de cette toxine résistent aux larves des insectes.9: résistance aux herbicides 7. L’Insertion réussie du gène bactérien de la résistance au glyphosate a conféré à la plante transgénique une résistance à l’herbicide et lui permet de survivre à des épandages normaux de glyphosate. Production d’ammoniac (NH4) et de nitrate (HNO3) par les plantes Les plantes courantes ne sont pas capables d’assimiler directement l’azote moléculaire (N2). lors de sa sporulation. Lutte contre les insectes ravageurs Chaque année des milliards de dollars de récoltes sont perdues à cause des insectes. _ Le Baccilus thuringensis (Bt). Eradication des mauvaises herbes et plantes transgéniques tolérantes aux herbicides Le glyphosate est la substance active de l’herbicide commercial « Roundup » beaucoup utilisé à l’heure actuelle. la pomme de terre. Une plante transgénique qui porte un gène de résistance au glyphosate pousse quatre (4) fois plus vite en présence de cet herbicide.7: production de la protéine CP 5. _ L’utilisation de l’expression transgénique d’inhibiteurs de sérines protéases des systèmes digestifs des insectes dans les tomates.

Les feuilles de ces plantes produisent l’anticorps monoclonal inséré (environ 1. pCI72 et qui porte le gène « tau ». Les plantes transgéniques contenant les gènes des chaînes lourde et légère ont été croisées afin de produire une descendance contenant les deux gènes. Ammonium). Cet aspect représente un intérêt commercial pour la production de protéines parmi lesquelles les anticorps monoclonaux. Ce peptide. L’expérience réussie a utilisé une chaîne lourde (H) et une chaîne légère (L) dans deux expériences séparées pour transférer les gènes des anticorps par l’intermédiaire de l’ADN-T dans deux plants de tabac.10: Production d’anticorps monoclonaux 9. Production d’anticorps monoclonaux par les plantes Les plantes peuvent aussi servir de bio-réacteurs pour la production d’anticorps. Nitrite. elle est produite par une plante : « Thaumatococcus danielli » qui pousse en Afrique occidentale. Une extraction. composé de 207 acides aminés constitue une source importante pour l’apport en acides aminés dans l’alimentation en plus de sa saveur. Elle est actuellement produite par des bactéries suivant le protocole ci-après : Il a été construit une molécule chimère ayant des séquences des plasmides pCI62-8. Le gène nif est inséré dans le plasmide Ti de la bactérie Agrobacterium tumefaciens La plante d’intérêt est alors transformée par ce plasmide Les cellules tumorales de la plante transformée sont prélevées et cultivées in vitro puis transférées sur différents terrains sous serre. La production de la taumatine La taumatine est un aliment très sucré et même plus doux que le saccharose. Ce sera le gène d’intérêt.Le gène nif (nitrogen-fixation apparatus) permet à la bactérie Rhizobium des légumineuse de fixer directement l’azote moléculaire pour donner des sels d’ammonium (Nitrate.5% des protéines traduites). 8. Les plants capables de pousser rapidement sans un apport d’engrais sont ceux capables de fixer l’azote moléculaire Un gène marqueur permet de sélectionner les plants ayant intégré le plasmide avec le gène nif. Bacillus subtilis transformé synthétise la taumatine. Cette construction chimère est utilisée pour transformer Bacillus subtilis. Figure VII. pBS42. suivie d’une purification donne de la taumatine pure 70 .

• transférer des gènes spécifiques dans des mouches d’un génotype donné. Ils contiennent tous de longues extrémités en répétition inverse. Ils peuvent donc être utilisés pour : • effectuer des mutagenèses. Ce type d’élément provoque des réarrangements chromosomiques lors de son insertion et de son excision. Ce sont des transposons. responsable des déplacements de cet ADN dans tout le génome. Les éléments de type copia contiennent deux longues séquences terminales en répétition directe et de courtes séquences répétées de manière inverse et imparfaite. on a trouvé trois catégories de séquences d’ADN qui ont la faculté de se transposer. Ils codent pour une enzyme nommé « transposase ». L’élément P peut donc être facilement utilisé en génie génétique. Les mieux étudiés sont : • les éléments du type copia : Il existe au moins sept (7) familles d’éléments de type copia dont la longueur varie de 5 à 8. • les éléments à rabat ou type FB (pour fold-back) : Ces éléments sont longs de quelque centaines à quelques milliers de paires de bases. c’est à dire de se déplacer dans le génome d’un chromosome à l’autre. L’élément peut se rabattre sur luimême lors des expériences de renaturation thermique d’ou son nom de rabat. La partie centrale possède trois cadres ouverts de lecture et peut coder pour au moins trois protéines dont la transposase et le répresseur de la transposase.CHAPITRE VIII: LE GENIE GENETIQUE APPLIQUE AUX ANIMAUX I . • les éléments P : D’une longueur égale à environ 2. Ils portent à leurs extrémités une séquence répétée inversée de 31 paires de bases.5 kb. Les drosophiles transgéniques. â Les éléments P permettent d’avoir des drosophiles transgéniques Les éléments P sont des transposons qui sont capables de changer de localisation dans le génome.LES INSECTES TRANSGÉNIQUES 1. Le processus suivant permet d’étudier la génétique moléculaire des mouches 71 . Les membres de ces différentes familles sont au nombre de 10 à 100 exemplaires par génome.90 kb. Dans la drosophile.

Après une étude approfondie au laboratoire. on retrouve une grande proportion d’individu ry+. VIII. la souris qui intègre par exemple le gène de l’hormone de croissance humaine (GH) acquiert une masse énorme double ou triple par rapport à ses s urs jumelles.a . Ce type de démarche peut être appliqué à tous les mammifères pour accroître leur rendement en poids et donc en intérêt économique.On injecte dans un embryon de drosophile l’ADN d’un plasmide bactérien qui contient un élément P dans lequel on a cloné un gène ry+ de la drosophile (ce gène donne la coloration rose de l’ il) mais ayant subi une délétion partielle. israelensis présentes dans les lacs de ce désert tuaient systématiquement les larves des moustiques et des mouches. un entomologiste israélien remarqua une grande quantité de larves d’insectes mortes dans le désert de Negev au demeurant très infesté par les moustiques et les mouches responsables de deux grands fléaux. Cet élément P modifié ne peut plus se transposer à cause de la délétion. une nouvelle stratégie de lutte contre l’anophèle et la glossine vecteurs du plasmodium et du trypanosome a débuté en utilisant la stratégie suivante : Une production de bio-insecticides par Bacillus thuringiensis capables de tuer les larves des mouches et des moustiques Une utilisation des moyens de transport aérien (hélicoptères) pour la pulvérisation de ces bio-insecticides au niveau des fleuves et des plans d’eau infestés par ces insectes vecteurs. L’hybridation in situ montre que le gène ry+ (P modifié) et l’élément P normal se retrouvent en différentes positions sur différents chromosomes et non à la position normale du locus rosy. b . Dans cette transgenèse. Les souris transgéniques Figure. 72 . Le transposon normal P a donc fourni la transposase pour permettre l’insertion du transposon anormal contenant le gène ry+. mais dans leur descendance. 2. Le gène ry+ nouvellement acquis montre une hérédité mendélienne et stable. II . A partir de cette découverte.On injecte dans le même embryon (co-injection) de l’ADN qui contient l’élément P normal qui pourra fournir la « transposase » à la copie du transposon P contenant la délétion. ce qui suggère qu’il est bien localisé sur un chromosome.LES ANIMAUX TRANSGÉNIQUES : 1. il s’aperçut que les bactéries du genre Bacillus thuringiensis subsp. Bio-insecticide et lutte contre le paludisme En 1976.1 On peut actuellement insérer n’importe quel gène dans la souris afin d’obtenir l’expression génique de ce transgène. Les mouches issues de cet embryon ont toujours le phénotype ry-.

C. localisée en Afrique occidentale. Beaucoup d’études récentes ont montré que certaines races bovines résistent bien à l’infection par le trypanosome. C’est pour cette raison que les bovins n’arrivent pas à élaborer des anticorps contre ces types d’antigènes qui changent constamment de conformation tridimensionnelle par mutation génétique du protozoaire. (Colonisation du milieu ou Evolution ?). l’organisme de ce dernier réagit et synthétise les premiers anticorps pouvant réagir avec les antigènes présents sur la membrane du trypanosome (VSGs). Il passe donc à la descendance comme un gène nucléaire normal. Le trypanosome possède des antigènes de surfaces VSGs (glycoprotéines superficielles variables) dont les gènes mutent à chaque phase de son développement. appelée « trypanotolérance ». La souris qui sera mise bas portera les caractères du transgène mais pas les autres s urs.Les organismes transgéniques peuvent être produits par l’injection de vecteurs dans des ufs fécondés et réimplantés dans les femelles. Ce type de résistance. La race N’Dama. De cette manière. Les bovins transgéniques La trypanosomiase est causée par un protozoaire parasite qui est transmis par un insecte vecteur « la glossine hématophage » ou encore « mouche tsé-tsé ». Mais dès que le parasite s’aperçoit qu’il est en train d’être totalement exterminé. Lorsque le système immunitaire du bovin est en mesure d’éliminer totalement les trypanosomes. Ce type de bovin domestique et d’autres animaux sauvages comme le « buffle » qui ont vécu en Afrique depuis plus de 5 000 ans a. 2. ont développé des résistances contre les attaques du trypanosome et sont par conséquent adaptés au milieu infesté par le parasite. Au cours de l’embryogenèse l’ADN exogène se fraie son chemin jusqu’aux cellules germinales et se comporte désormais comme un gène endogène. se rencontre dans les populations bovines d’espèce Bos taurus. caractérisée par de longues cornes et une absence de bosse en est un exemple. Le trypanosome empêche la majeure partie des races bovines d’habiter une superficie de près de dix millions de Km2 en Afrique. il se transforme de nouveau en un second parasite. 73 . On peut aussi transférer l’embryon possédant le transgène dans l’utérus d’une souris saine pseudo-gestante. Lorsque la mouche tsé-tsé inocule le trypanosome dans un bovin. les dernières cellules qui survivent changent leurs manteaux protéiques antigéniques et se transforment en un second type de parasite. le trypanosome échappe à la défense immunitaire de son hôte par des mutations et recombinaisons successives. L’organisme du bovin se prépare alors de nouveau pour combattre le nouveau parasite en secrétant de nouveaux anticorps. Cette zone qui est la plus fertile du continent est plus vaste que les Etats-Unis d’Amérique.

Une protéine dont les propriétés thérapeutiques intéressent l’industrie pharmaceutique est produite dans le lait de moutons transgéniques. 3. est arrivée dans ce continent avec l’invasion arabe vers les années 660 p. Figure VIII. 2 . Pour leur conférer cette résistance. Stratégie II : Importer des embryons de la race N’Dama trypano-tolérante Les implanter dans les utérus de femelles de la race Bos indicus sensible à l’infection Réaliser ensuite des croisements des descendances pour disséminer les gènes de tolérance. 5 . Elle n’est pas « trypano-résistante » Cependant.L’espèce bovine comme Bos indicus qui est actuellement très répandue en Afrique. sous le contrôle du promoteur de la β-lactoglobuline.Les descendances qui expriment le transgène sont identifiés par amplification PCR d’un segment d’ADN chromosomique en utilisant des amorces correspondants à des séquence interne du gène d’intérêt. Le gène en question code pour l’activateur tissulaire du plasminogène qui sert à dissoudre les caillots sanguins chez l’être humain. 4 – Le porc transgénique 74 .C. : Identifier le gène qui confère la résistance aux trypanosomes chez les bovins de la race D’Dama Cloner ce gène dans un vecteur Transférer le vecteur dans des cellules bovines de l’espèce Bos indicus pour leur conférer la trypano-tolérance.On a placé le gène dans un plasmide.2: Production du plasminogène La démarche technologique utilisée et réussie est la suivante : 1 . On peut manipuler les animaux domestiques non seulement pour améliorer leurs qualités intrinsèques mais aussi pour produire des protéines étrangères. qui n’est exprimée que dans les tissus mammaires. Les moutons transgéniques. 4 . on peut employer deux stratégies : Stratégie I.Les ovules injectés sont implantées dans des mères porteuses.Le vecteur d’expression est micro-injecté dans le pronoyau des ovules de mouton.Les moutons transgéniques n’expriment ce gène que dans leurs tissus mammaires et sécrètent alors des quantités importantes de la protéine correspondante dans leur lait à partir duquel la protéine d’intérêt est purifiée. l’économie de plusieurs pays africains est actuellement fondée sur l’élevage de ces bovins qui ne sont plus trypano-tolérants. 3 .

3 : LE PORC TRANSGéNIQUE. il serait tout à fait possible de réaliser des xénogreffes d'organes à partir de primates supérieurs (chimpanzés) mais cette possibilité semble peu réalisable car ces espèces animales sont protégées et représentent une source incontrôlable de transmission de virus à l'homme (Ebola. En effet.Pour pallier le manque d'organes: xénotransplantation avec le porc.Tandis que dans les greffes allogéniques on utilise surtout les médicaments immunosuppresseurs comme la cyclosporine pour lutter contre le phénomène de rejet. Figure VIII. 75 . Le problème majeur qui empêche la réalisation des xénogreffes d'organes aujourd'hui est l'existence du rejet hyper aigu qui survient entre les espèces animales phylogéniquement distantes. SIV…) La protéine DAF (Decay Accelerating Factor) neutralise le complément des primates et favorise les greffes d’organes.

Dolly est née de cette technique. Le processus du clonage d'un organisme entier est simple: a . Dolly (première brebis clonée en Angleterre). 1 : Clonage de Dolly 76 . . C'est la raison pour laquelle Dolly n'aura pour tout bagage génétique que celui que contenait la cellule du pis. on a prélevé une cellule dans le pis d'une brebis de race Finn Set à face blanche.On prend une cellule uf et on la vide de son noyau. est un clone de sa mère. Dans le cas de la brebis Dolly.implantation dans l’utérus d’une porteuse d . Pourquoi un ovule? Pour qu'il devienne éventuellement un embryon. identique en tous points à la brebis qui a fourni la cellule du pis.CHAPITRE IX: CLONAGE DES MAMMIFÈRES. ou de ses gènes. l'embryon (stade blastula) est placée dans l'utérus d'une brebis porteuse. Cependant certains caractères de l’ uf restent présents à cause du matériel génétique contenu dans les mitochondries. on a fusionné in vitro la cellule du pis qui contient tous ses gènes et l'ovule vidée de tout matériel héréditaire. I.On prélève le noyau d'une cellule que l’on veut cloner et on le met dans l' uf privé du noyau c . PARTHÉNOGENÈSE. les hommes vont-ils eux aussi passer à la "photocopieuse La technique du clonage est relativement simple dans son principe. Après s'être divisée un nombre suffisant de fois. Figure IX. Comme les brebis.LE CLONAGE DES ORGANISMES ENTIERS: Un clone de mammifère est une copie génétique d'un organisme entier. b .L’organisme qui naît porte les caractères du noyau transféré donc de l’organisme cloné. On a prélevé également un ovule sur une autre brebis et on lui a enlevé le noyau qui contient le bagage génétique. CELLULES SOUCHES EMBRYONNAIRES (EMBRYONIC STEM CELLS) ET THÉRAPIE GÉNIQUE. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche. À l'aide d'un choc électrique.

etc. En effet. 77 . La division d’une cellule souche produit deux nouvelles cellules : une cellule souche de « réserve » et une cellule s’engageant dans un processus de différenciation qui la conduira à remplir une fonction précise. sang. tritons. cheveux.). il est appelé à régresser lors de l’embryogenèse par l’agrandissement de la cavité amniotique de l’embryon. ce système offrira un fond inestimable de pièces de rechange d’organes humains ! A – Qu’est-ce qu’une cellule souche ? Une cellule souche est une cellule indifférenciée qui reste capable de se diviser de façon autonome tout au long de la vie. Le trophoblaste et la masse cellulaire interne donneront respectivement : le placenta et l’ensemble de l’embryon. L’une travaillait sur des blastocystes des embryons précoces de moins de sept jours () et l’autre équipe sur des cellules germinales primitives ovogonies et spermatogonies (). Chez les plantes. la masse cellulaire interne (MCI) constituée d’autres blastomères plus centraux. os. Le 6 novembre 1998. Ce sera une technique de photocopie magique pour reproduire un individu à volonté et en plus. assurant le renouvellement des cellules d’un individu. LES CELLULES ES (EMBRIONIC STEM CELLS) OU CELLULES EMBRYONNAIRES PLURIPOTENTES). Il s’agit de l’ uf fécondé et des cellules de l’embryon des premiers jours de sa croissance (morula de 2 à 8 cellules). Tous les êtres vivants pluricellulaires possèdent des cellules souches. elles peuvent conduire au développement d’un être humain. cet embryon qui est un blastocyste a au plus 8 blastomères. Quant au blastocèle. Il est déjà composé de trois parties : le trophoblaste constitué de blastomères périphériques (grosses cellules résultant des premières divisions de l’ uf fécondé). et le blastocèle qui est une grande cavité remplie de liquide à l’intérieur de l’embryon. muscles. leur importance biomédicale et la fascination des biologistes. nerfs (). Chacune de ces cellules ES a la potentialité de devenir n'importe quel tissu du corps humain: c ur. Elles sont à l’origine de tous les tissus et en assurent le renouvellement (remplacement des cellules disparaissant par vieillissement ou par lésion). le New York Times titrait : « Des scientifiques isolent les cellules à l origine de la vie ». deux équipes de recherches différentes découvraient presque simultanément avec des méthodes distinctes les cellules souches embryonnaires.Les cellules souches totipotentes : A elles seules. Spécifions que c’est au stade de cellules souches totipotentes que l’on peut pratiquer le clonage reproductif par scission embryonnaire. Avant le septième jour. « Embryonic Stem » (ES). D'où leur mystère. elles favorisent le processus du bouturage. en fin 1998. Les cellules souches sont à l’origine de la régénération des membres chez certains animaux (lézards. Nous distinguons quatre catégories de cellules souches en fonction de la diversité des types cellulaires auxquels elles peuvent donner naissance : 1 . Ainsi à partir d’une seule cellule peut être créée une plante entière.II.

foie. Elles jouent un rôle essentiel en assurant le renouvellement des cellules. testicule…). 4 .Les cellules souches multipotentes : Elles sont des cellules souches capables de donner naissance à un ou plusieurs groupes de cellules ayant une fonction particulière. muqueuse intestinale. ces cellules pluripotentes ne peuvent pas évoluer pour former une personnes mais de multiples questions se posent : comment peut-on les obtenir tout en respectant les règles d’éthique ? Peut-on les utiliser dans les recherches du clonage thérapeutique ? 3 .2 . de la mise en place du plan de 78 . Les cellules souches du sang de cordon ombilical peuvent être prélevées à la naissance et conservées pour un usage ultérieur (un tel service est proposé par certaines fondations aux Etats-Unis). à ce stade. tels que le c ur et le pancréas. Les cellules de la masse cellulaire interne. Dans certains organes.Les cellules souches pluripotentes : Précisons tout de suite quelque chose d’absolument essentiel qui doit être en permanence dans l’esprit : les cellules souches pluripotentes qui constituent la masse interne sont destinées à former tous les tissus de l’organisme mais ne peuvent à elles seules aboutir à la formation d’un individu complet car elles ont perdu. par conséquent ils pensent que ces organes n’ont aucune possibilité de régénération en cas de lésion. Cependant. Par exemple. les cellules souches présentes dans la moelle osseuse produisent les globules rouges. Nous avons choisi délibérément la section fécondation-clivage pour étudier sommairement les régulations génétiques car c’est à ce stade que nous avons les différentes manipulations des cellules souches embryonnaires. La moelle osseuse et le sang du cordon ombilical sont particulièrement riches en cellules souches adultes. sont incapables. Les cellules souches adultes peuvent être extraites de la plupart des tissus. elles sont rares et par conséquent très difficiles à identifier (une cellule souche pour dix ou quinze mille autres cellules dans la moelle osseuse. essentiellement définies suivant des critères morphologiques : la fécondation. la segmentation (clivage). la gastrulation et l’organogenèse. Elles sont appelées aussi cellules souches adultes ou cellules souches somatiques. Les cellules souches issues de la moelle ou du cordon peuvent être utilisées pour une thérapie cellulaire bénéficiant à l’individu ou à ses frères et s urs. les globules blancs et les plaquettes.Les cellules souches unipotentes : elles ne donnent qu’un seul type de cellules différenciées (peau. bien que pouvant donner toutes les cellules de l’organisme. si on les réimplante dans un utérus. Le développement embryonnaire des métazoaires est classiquement subdivisé en quatre phases. de donner un embryon puis un f tus. les chercheurs n’ont pas encore découvert de cellules souches . y compris du cerveau et de la moelle épinière. B – Recherche sur les cellules souches et l’embryon ? 1 – Les processus génétiques de l’embryogenèse de la fécondation au clivage. Le placenta a pour fonction de nourrir l’embryon et de le protéger de tout rejet par le système immunitaire. On entend par gène de développement ceux qui interviennent précocement au cours du développement embryonnaire et sont responsables de l’établissement des polarités (antéro-postérieure. dorso-ventrale) de l’embryon. la faculté de produire le trophoblaste. Certes. précurseur du placenta.

notons qu'il n'y a pas de régionalisation de l'information dans le cytoplasme du zygote des mammifères jusqu'au stade 8 cellules. encore plus chez l'homme. La distinction entre une information seulement apportée par des ARNm provenant de l'ovule. engagement dans une voie de différenciation. migrations. Le développement embryonnaire étant un processus continu et progressif. La multiplication cellulaire. Le contrôle de l’initiation et du taux de traduction des ARNm maternels « dormants » dans l’ovocyte est le principal niveau de régulation d’expression génique aux stades de développement précédant la transcription zygotique. La mise en route du génome embryonnaire s'effectue cependant à un stade précoce. Néanmoins. L'étude des gènes maternels dans le développement embryonnaire précoce est cependant rendue difficile par la très faible quantité de matériel génétique disponible. il existe différents niveaux de contrôle du développement : prolifération cellulaire. et celle qui serait apportée par une transcription persistant selon un patron transcriptionnel conservant le profil d'expression maternel. les migrations cellulaires et l’engagement d’une cellule dans une voie de différentiation constituent en effet des choix de développement non indépendants. au contraire. contrairement à d'autres classes de vertébrés : chaque blastomère peut donc être considéré comme équivalent aux autres. c’est-à-dire ne dépendre que de l’information contenue dans la cellule considérée ou être non autonomes. A l’échelle de la cellule. c’est-àdire permis par des interactions avec les cellules voisines. et pourrait être due à une méthylation différentielle des copies paternelle et maternelle de ces gènes. Cela est parfaitement vérifié chez des espèces inférieures (batraciens). l’origine paternelle ou maternelle de certains gènes entraîne leur inactivation. des facteurs issus de la transcription de ce chromosome. les différents gènes impliqués ne peuvent être considérés isolément . Ils peuvent par ailleurs être autonomes-cellulaires. régulée par les oncogènes et les facteurs de croissance. mais très probablement seulement au stade 8 cellules chez l'homme. est loin d'être résolu (eu égard à la durée de vie des messagers de la première hypothèse n'est plausible que chez des espèces où les premiers clivages se font dans un espace de temps excessivement court . c'est le cas des oeufs de batraciens. impliqués généralement très précocement au cours du développement. Elle concerne un nombre relativement restreint de gènes. En effet.Des gènes maternels contrôlent les premières divisions de l' uf Les premières divisions de l’ uf fécondé s'effectuent sans que les premiers gènes zygotiques ne soient exprimés. Chez les mammifères il existe le phénomène de imprinting : les génomes paternel et maternel apportés par les gamètes ne sont pas transcrits de façon équivalente par le zygote. Ce mécanisme permet de contrôler la production de facteurs impliqués 79 .base du corps et de la spécification des cellules et des territoires devant donner les différents organes. L’analyse d’anomalies de ségrégation chromosomique ou d’expériences de transplantation de pronucléus montre que cette inactivation est nécessaire à un développement embryonnaire normal. Nos connaissances sont donc encore rudimentaires chez les mammifères. leur séquence spatio-temporelle d’expression est largement hiérarchisée et interdépendante. . La méthylation différentielle semble être le processus permettant l’inactivation transcriptionnelle d’un des chromosomes X chez le mammifère femelle et rétablissant une dose identique à celle du mâle. on sait que la durée de vie des ARNm est beaucoup plus longue dans l’ uf fécondé).

L'embryon reconstitué entame son clivage et. Elle est concomitante de l'expression sur la membrane plasmique de Cadhérines E. futur Placenta). A ce stade. De nombreuses méthodes sont utilisées en recherche fondamentale pour étudier l’embryogenèse : a – le clonage . à partir d’elles. Notons cependant que le taux de succès est. suivi d’un développement embryonnaire jusqu’au stade de blastocyste et de l’utilisation des cellules de la masse cellulaire interne (ICM). De la gastrulation à l’organogenèse. l’analyse des télomères des clones obtenus semble montrer que l’ADN des cellules diploïdes donneuses de 80 . Des données récentes attribuent à l'ARN maternel oct-3 un rôle dans la première division de l’ uf et au PDGF-alpha (platelet-derived growth factor) codé par un ARN maternel un effet autocrine activateur de la division cellulaire. au stade 8-16 cellules chez le bovin.dans l’établissement des polarités et dans la régulation du cycle cellulaire. le noyau transféré prend le contrôle du développement. 2 – Recherche sur l’embryon et manipulation des cellules souches : La possibilité de cultiver et de manipuler l'embryon préimplantatoire de mammifère requiert une haute technologie et par conséquent un laboratoire de recherche bien spécialisé. Il engendre à la fois la fusion des deux membranes plasmiques et l'activation de l'ovocyte. en vue d’obtenir les ES et. Ensuite. L'affinement de la technique a permis à une équipe écossaise de produire des agneaux en utilisant le noyau de cellules f tales (fibroblastes) et même de cellules mammaires d'une brebis adulte. Le début de l'expression génique embryonnaire n'est donc effective qu'après le stade 8 blastomères. à l'heure actuelle. un contrôle génétique de l’établissement du plan de base de l’organisme et une acquisition d’une identité positionnelle au sein des différents tissus ou champs d’organisation. on parle de zygote ou d'embryon reconstitué. La technique de transfert nucléaire. d’autres gènes s’activeront et par conséquent de nouvelles protéines seront synthétisées afin d’assurer différents contrôles génétiques. Le noyau de la cellule diploïde se retrouve ainsi au sein du cytoplasme ovocytaire. Ces résultats montrent qu'au moins certains types de cellules conservent intact leur potentiel nucléaire de différenciation malgré leur état de cellule différenciée.Le clonage par transfert de noyau Transfert du noyau d une cellule d un sujet donné dans un oocyte humain énucléé. aboutissant à la mise en place de jonctions inter-cellulaires : c'est l'initiation de la compaction et des phénomènes de polarisation. De plus. Ultérieurement s'exprimeront dans la morula des cadhérines E (épithéliales) et P (dans le trophoblaste. Un choc électrique est appliqué. Ainsi aurons-nous un contrôle génétique de la mise en place des polarités embryonnaires. l'embryon est transféré en mère porteuse. une cellule diploïde est insérée dans la zone pellucide. dérivée d'expériences menées chez les batraciens dans les années 60 consiste d'abord à retirer la métaphase II et le premier globule polaire d'un ovocyte II maturé. les cellules différenciées souhaitées. ce qui contribuera largement à la ségrégation cellulaire entre embryoblaste et trophoblaste. à côté de l'ovocyte énucléé. ou encore d'équivalent d’une cellule. Au stade blastocyste. inversement proportionnel à l'état de différenciation de la cellule diploïde donneuse de noyau.

Cette technique est très délicate et ne fut jamais adoptée pour produire des clones en série. c. . De toute façon. isolé.Le clonage chimérique par association Cette autre technique. à d. Comme tous les agneaux d'un groupe proviennent d'un blastomère d'un même stade 8 cellules. Les derniers blastomères du stade 4 cellules qui se divisent donnent le trophectoderme. La conséquence serait un vieillissement prématuré de ces clones.noyau n’est pas “ rajeuni ” par le transfert nucléaire. par définition. Un blastomère de stade 8 cellules.Le clonage par séparation des blastomères Cette technique fut mise au point pour l'étude de la totipotence de différenciation des blastomères. est fondée sur une observation faite chez l'embryon de souris par Mulnard. Le zygote est. Ce dernier a décrit que les premiers blastomères d'un stade 4 cellules qui subissent leur 3ème mitose fournissent par la suite la masse cellulaire interne du futur blastocyste. les blastomères perdent leur totipotence cellulaire en passant au stade 8 cellules (3ème mitose). Reprogrammation du noyau d une cellule d un sujet donné en le fusionnant avec le cytoplasme des ES. Un éventuel succès devrait conduire . ils constituent un clone. poursuit son développement et déclenchera ce processus de cavitation après 3-4 mitoses. Qu'en est-il des deux premiers blastomères? A quel stade du développement chaque cellule de l'embryon devient-elle incapable de se développer en un f tus normal? Willadsen a réalisé une série d'expériences à l'issue desquelles il montra que chez le mouton. Willadsen a effectivement montré que l'agneau obtenu après transfert en mère porteuse était constitué de cellules descendantes du blastomère de stade 8 cellules. . 81 . Transfert du noyau d une cellule d un sujet donné vers un oocyte d un autre animal. En associant un blastomère isolé d'un stade 8 cellules d'une souche A avec un blastomère isolé d'un stade 4 cellules d'une souche B. Cette technique lui permit également de produire les premiers clones de mouton en obtenant des paires et des triplés d'agneaux à partir des blastomères d'un même embryon de stade 2 ou 4 cellules. Ce nombre est trop restreint pour former un blastocyste capable de s'implanter et sa masse cellulaire interne est trop réduite pour qu'il poursuive un développement embryonnaire harmonieux. lorsqu'il aura donné naissance à un embryon composé de 8-16 cellules. En fait. développée également par Willadsen. obtenant ainsi les “cybrides”: une telle possibilité est encore à l’étude. même cette voie semblerait exiger une préparation préalable des ES d’embryons humains. Ceci signifie qu‘un clone serait constitué de cellules dont l’âge correspond à celui de l’organisme d’origine. qu’on pourrait utiliser comme dans le cas précédent. une cellule totipotente à la fois sur le plan cellulaire et sur le plan nucléaire. il semble qu'une horloge biologique compte le nombre de mitoses pour déclencher le processus de blastulation au stade de ± 64 cellules (6-7ème mitose). Un seul agneau fut obtenu à partir d'un blastomère de stade 8 cellules.au développement d’un embryon humain. En reconstituant 8 embryons chimériques en associant par paire les cellules d'un embryon 8 cellules de souche A et de deux embryons 4 cellules de souche B.comme on le suppose . il obtint un maximum de 5 agneaux de phénotype A.

l'apparition du trophectoderme. cause de la fibrose cystique.On stimule l'ovule. la population mondiale paie un lourd tribut à cause de ces maladies génétiques cause de mortalité infantile ou de déficience caractérisée. IV .On prend une ovule non fécondée d'une lapine. ¢ En Afrique et en Amérique. = engendrer): Une ovule non féconder d’une lapine peut être stimulée et emprunter la voie de l’embryogenèse pour obtenir une lapine. bien avant la cavitation. débute au stade 4-8 cellules. Près de 5% des enfants sont atteints de la drépanocytose sous ces diverses formes pathologiques (Hb SS ou Hb SC). les personnes qui sont atteintes de la mutation du gène qui code pour la glucose-6-phosphate déshydrogénase qui conduit au favisme ¢ Environ deux cent cinquante millions (250 000 000) de personnes souffrent de plusieurs types d’anémies liées aux mutations génétiques ¢ Dans les pays développés. La thérapie génique germinale. 1. la drépanocytose tue à elle seule près de cent mille enfants noirs par an sans compter les pathologies génétiques multi-factorielles et cystogéniques ¢ Au Burkina Faso. environ 30% de la population présentent une mutation de la chaine ß de l’hémoglobine (ßS ou ßC). Quatre pour cent (4%) de cette population portent le gène muté de la mucoviscidose (FC). Le produit sera une lapine identique à sa mère lapine. Elle a cependant permis de préciser que le premier processus de différenciation cellulaire.LA PARTHÉNOGENÈSE: Du grec θ = vierge . ¢ La mucoviscidose. 82 . La technique est simple: a . III . b . touche environ un enfant sur 2 500 dans la population caucasienne. plus de trois mille types de maladies héréditaires ont été identifiées.LA THÉRAPIE GÉNIQUE: De nos jours. c . ¢ Dans le monde actuel on estime à cent millions (100 000 000). Chaque année.L'ovule stimulée commence à se développer et est réimplanté dans l’utérus de la lapine. le tiers des hospitalisations en pédiatrie sont liées aux désordres génétiques.Cette technique est également très délicate et n'a jamais été utilisée pour la production de clones en série.

Dans le cas des souris. de nombreux essais géniques se font chez les animaux dans le but de les transposer un jour chez l’homme. Cela doit permettre non seulement de corriger l’individu traité. De nos jours. parfois de manière ectopique dans les chromosomes. ¢ Les cellules qui portent le gène sauvage vont se retrouver dans les différents tissus de l’organisme. Le gène HPRT code pour l'enzyme HPRT qui intervient dans le métabolisme des nucléotides. Grâce à une recombinaison homologue. Le problème à résoudre est que l’ADN injecté s’intègre au hasard. un produit d'un gène du chromosome X) dans des cellules embryonnaires pluripotentes de souris. y compris dans les cellules germinales qui vont constituer les gonades. b : La micro-injection du gène dans les cellules embryonnaires Le processus est le suivant : ¢ On prélève au stade blastocyste des cellules embryonnaires porteuses d’un génotype muté ¢ On insère dans ces cellules le gène sauvage en culture ¢ Les cellules transgéniques sont de nouveau ré-implantées dans l’embryon qui se trouve dans le blastocyste.L’objectif de la thérapie génique germinale consiste à introduire des cellules transgéniques dans la lignée germinale et donc dans l’individu entier. aucune thérapie génique germinale n’a encore été entreprise chez l’homme. inaugurée pour créer des modèles animaux est prometteuse. La plupart des fragments d’ADN s’intègrent de façon ectopique dans tout le génome.2: micro-injection d’un gène d’intérêt dans le pro-noyau ¢ La première étape consiste en une fécondation d’un ovule de souris ¢ On injecte alors l’ADN étranger dans le pro-nucléi mâle de l’ovocyte fécondé ¢ L’ovocyte est alors implanté dans une mère porteuse ¢ La descendance transgénique est identifiée par la PCR et l’électrophorèse De nos jours. une restauration de l'intégrité du gène anormal a pu être obtenue. Le transgène peut donc être transmis à la descendance par des croisements entres les souris transgéniques de la descendance portant le transgène dans leurs gonades. Plusieurs procédés sont utilisés à cette fin a : La micro-injection d’un gène d’intérêt dans le pronoyau Figure IX. 40% de ces souris ont reçu le gène d’intérêt injecté. mais aussi de lui faire produire des gamètes porteurs du génotype corrigé qui seront transmis à la descendance. 10 à 30% des ufs manipulés donnent des souris vivantes. ce qui constitue un sérieux handicap pour la thérapie humaine. non 83 . Ce succès démontre que la voie du ciblage génétique. La correction doit se faire dans une cellule germinale ou de l’embryon précoce ou les cellules sont totipotentes La première expérience de thérapie génique ciblée et réussie concerne la correction d'une délétion du gène HPRT (Hypoxanthine PhosphoRibosylTransférase.

Figure IX. pol et env) pour l’insertion du gène exogène dans un organisme. Un certain pourcentage de cellules « guéries » peuvent atténuer la maladie en codant pour la protéine normale. Il est alors possible de rendre transgénique le corps entier d’un individu. ¢ Ils peuvent aussi rencontrer un autre virus dans l’individu traité. des mutations chez l’individu traité.3 :La micro-injection du gène dans les cellules embryonnaires 2.seulement à cause des possibles interruptions des gènes.4 : Thérapie génique somatique : Utilisation de rétrovirus pour un transfert de gène Le procédé simple est le suivant : ¢ On prélève quelques cellules somatiques du patient. La génothérapie somatique La thérapie génique somatique s’attaque uniquement aux cellules du soma et tente d’éliminer le phénotype pathologique. ¢ Les figures qui suivent illustrent quelques exemples de thérapie somatique dans différents mammifères 84 . Les problèmes liés à la l’insertion des rétrovirus sont énormes : Les figures qui suivent illustrent quelques exemples de thérapie somatique dans différents mammifères ¢ Ils peuvent provoquer des inversions. se recombiner avec ce dernier et devenir pathogènes ¢ Il se pose également le problème de l’immunogénicité de l’organisme (non reconnaissance du soi). mais aussi parce que l’allèle muté sera toujours présent dans le génome et pourra ségréguer du transgène dans les générations futures. Figure IX. La génothérapie somatique consiste en une utilisation des rétrovirus désarmés (délétions des gènes gag. des délétions. qu’on cultive ¢ On y introduit des exemplaires du gène sauvage cloné dans un vecteur désarmé ¢ On réimplante ces cellules transformées dans le corps du patient ou elles pourront remplir la fonction attendue. Il faudrait mettre au point un système de ciblage grâce auquel le transgène de type sauvage se substitue au gène défectueux par une recombinaison en faisant intervenir un double crossing-over. Les premiers vecteurs utilisés ont été des rétrovirus désarmés que l’on a rendu amphotropes pour permettre leur utilisation dans différentes espèces et défectifs pour contrôler leur dissémination.

alliée à une compréhension de plus en plus poussée du fonctionnement des gènes. Dans la thérapie anti-virale. seules les cellules infectées produisent les signaux transactivateurs du LTR. cette construction étant elle-même incluse dans un adénovirus recombinant qui en assure la transduction" Dans ce cas. régionale (paracrine). (un analogue pyrimidique cytotoxique) administré comme médicament. "Le principe consiste à munir certaines cellules d'une construction génique permettant la production locale (autocrine). La maîtrise de la méthodologie de transfert des gènes. Il s’agit de mettre à profit la masse de connaissances accumulées sur sa biologie. Ces essais préliminaires ouvrent la voie à une ère de thérapeutique nouvelle. ricine) dont le gène est placé dans une construction qui en assure l’expression conditionnelle. Les cancers et les maladies virales sont candidats à ce type de thérapie. ce qui entraîne l'expression du gène TK. dans la thérapie des cancers les premières expériences effectuées avec les TIL montrent que l'on peut armer des cellules avec des facteurs cytotoxiques (TNF = Tumor Necrosis Factor) ou les doper avec des cytokines. voire générale (endocrine) de facteurs protéiques (ou nucléiques) ayant un intérêt thérapeutique". On peut aussi fabriquer des leurres pour le virus comme la protéine CD4 soluble comportant un signal de rétention intracellulaire pour piéger la protéine gp120 du virus ou même un leurre du RNA viral comportant une pseudo séquence TAR. Une autre variante de cette toxigénétique conditionnelle. Vers la génothérapie avec de l'ADN médicament.3. rendant les cellules sensibles au gancyclovir. cet démarche consiste à munir les cellules T de constructions contenant des gènes mutants transdominants codant pour des protéines virales structurales ou régulatrices anormales ou modifiées. Il s’agit dans ce cas d’une bombe à retardement que le virus active lui même (Une protéine régulatrice TAT). 85 . l'idée est de fournir à la cellule les moyens de se défendre spécifiquement contre le virus par une stratégie adaptée à la biologie du virus considéré. "consiste à combattre le virus HIV en lui apportant le gène de la thymidine kinase (TK) sous contrôle du LTR du HIV. permettant de s’attaquer à des maladies incurables ou héréditaires et aux maladies virales comme le SIDA. En effet. Dans le cas du VIH. Une autre approche consiste à éliminer le virus de la cellule infestée par une toxine protéique (toxine diphtérique. permettent d'envisager leur utilisation dans la lutte contre les maladies acquises.

est un rétrovirus de 0. La matrice est constituée glycoprotéines p 17.CHAPITRE X : LES TECHNIQUES DE LA BIOLOGIE MOLÉCULAIRE APPLIQUÉES DANS LA RECHERCHE THERAPEUTIQUE DU VIH/SIDA I – STRUCTURE DU VIH Figure X. formée par des glycoprotéines p 24 contient : deux filaments d’ARN de 9200 bp environ enveloppés par la nucléocapside (protéine p 7). certaines de ses manifestations cliniques et biologiques. p 41 et une double couche de phospholipides.1 m de diamètre. l’intégrase. pol (polymérase) code pour des enzymes nécessaires à sa réplication : notamment p68 (reverse transcriptase) et p34 (intégrase). En Afrique subsaharienne on peut trouver chez le même individu une coinfection : le VIH-1 et le VIH-2 ensemble.2 : Origine du VIH Structure du VIH : De l’extérieur vers l’intérieur du virus. Il a été isolé pour la première fois à l’Institut Pasteur de Paris en 1983. nous avons : L’enveloppe du virion : les glycoprotéines p 120.1 : Structure du VIH L'étude de la structure génétique du VIH permet de comprendre la complexité de ce virus. La capside. du sous-groupe des Lentiviridae. la protéase et la ribonucléase. Figure X. Virus de l’Immunodéficience Humaine. Le VIH possède 3 gènes rétro-viraux codant pour différentes protéines virales : gag (groupe antigène) code pour des protéines internes ("core") : p50 et p40 qui se cliveront en p13. p18 et p24. Le VIH-1 est répandu dans le monde entier tandis que le VIH-2 est essentiellement localisé en Afrique. qui a un génome à ARN. et d'envisager des stratégies pour la recherche thérapeutique. Le VIH. la transcriptase inverse. 86 .

3 :gène gag.LES NOUVELLES MOLÉCULES ANTIVIRALES EN DÉVELOPPEMENT: 1 . nef (rôle mal connu) et vpu. Figure X. La séquence LTR (Long Terminal Repeat) peut être considérée comme un promoteur fort et une région régulatrice pour la production de nouveau virus. Les premiers essais ont montré des résultats intéressants en terme d'efficacité sur la charge virale ou sur des virus présentant des mutations. pol. vpr (vpx pour VIH2). . le VIH possède d'autres gènes intervenant dans sa réplication.Les inhibiteurs de l'entrée du virus : Il existe 3 types de médicaments qui sont en cours de développement à l'heure actuelle : Inhibiteurs de l'entrée du virus dans les lymphocytes CD4 . 2. Figure X.Les IP sont des inhibiteurs de la protéase acide virale: De nouveaux inhibiteurs de la protéase sont en cours de développement à un stade avancé. Antagonistes des co-récepteurs. Cette complexité qui lui est caractéristique explique probablement son haut pouvoir pathogène. Il y a des gènes régulateurs : tat (favorise l'augmentation du niveau de la synthèse des protéines virales). env Le VIH possède d’autres gènes codant pour différentes protéines virales Contrairement aux autres rétrovirus.. Une autre propriété de l'enveloppe (gp41) est de pouvoir induire la fusion cellulaire (syncitium) qui est un des éléments cytopathogènes du VIH. Il y a aussi d'autres gènes. rev favorise l'augmentation des ARN messagers correspondant aux protéines de gag.4 Mécanisme d’infection II . La gp 110 est une partie de l'enveloppe responsable de l'interaction avec la membrane de la cellule cible au niveau du récepteur CD4. Inhibiteurs de la fusion du VIH : ils empêchent le virus de fusionner avec la cellule qu'il attaque. permettant la pénétration du virus. 3. pol et env. 87 . qui permet d'augmenter l'infectiosité. comme vif.Les INTI et les INNTI sont des inhibiteurs de la transcriptase inverse Des essais cliniques ont été réalisés sur de nouveaux inhibiteurs de la transcriptase reverse : Inhibiteur Nucléosidique de la Transcriptase Inverse (INTI) et Inhibiteur Non Nucléosidiques de la Transcriptase Inverse (INNTI). ces molécules se fixent sur des récepteurs nécessaires à la pénétration du virus dans les cellules .env (enveloppe) code pour des glycoprotéines (gp110 et gp41 issues de gp 160).

CTL. La majorité des résultats obtenus depuis deux ans soulignent l'intérêt de stratégies vaccinales utilisant des combinaisons d'antigènes de plus en plus complexes. Norvir (ritonavir). longtemps cultivées en laboratoire. dirigés contre les protéines d'enveloppe (réponse humorale). Epivir (3TC). Ziagen (abacavir). en phase I et II (étude de la tolérance et des réactions immunitaires chez quelques dizaines de volontaires en phase I et plusieurs centaines en phase II). Un des problèmes posés par l'obtention vaccinale de réponses immunitaires contre le VIH est que ces réponses doivent être dirigées contre des souches de virus très variables. fait actuellement grand bruit aux États-Unis où elle est proposée avec force par un groupe de médecins-chercheurs et bien autres types de vaccins.Les deux objectifs d'un vaccin contre le VIH demeurent : L'induction d'anticorps capables de neutraliser le virus.Vaccins sous-unitaires et vaccins synthétiques Les premiers vaccins sous-unitaires (immunisation par des protéines d'enveloppe recombinantes du virus) se sont révélés incapables d'induire des anticorps neutralisants actifs contre les souches de virus sauvages que l'on trouve chez les malades et qui sont différentes de celles. qui détruisent les cellules infectées. Sustiva (efavirenz). Viracept (nelfinavir). Combivir (AZT + 3TC). Nucléotide : Prévéon (adéfovir). ABT-378/r (voir : Pétition Remaides). Zérit (D4T). L'induction de cellules T cytotoxiques. L'utilisation de virus atténués. 1 . Crixivan (indinavir). Agénérase (amprénavir). afin de stimuler les différentes composantes du système immunitaire. même si elle n'a pas accompli de progrès spectaculaire au cours des dernières années écoulées. utili- 88 . III. Videx (ddI). De nouvelles approches sont explorées. Antiprotéases : Invirase ou Fortovase (saquinavir). Hivid (ddC). 2 . Non-nucléosides : Viramune (névirapine). comme cela se pratique pour de nombreux vaccins et qui est évoquée et repoussée depuis longtemps pour le VIH. Rescriptor (delavirdine). VERS L’ESPOIR D’OBTENIR UN JOUR UN VACCIN ANTI-VIH. Près de trente essais ont été menés ou sont en cours chez l'homme.4 – classification de quelques molécules antivirales : Nucléosides : Rétrovir (AZT). La recherche d'un vaccin contre le VIH a continué de progresser. Cette induction nécessite que la préparation vaccinale se réplique à l'intérieur des cellules pour que l'antigène du VIH soit présenté au système immunitaire (réponse cellulaire).

L'absence de génome viral les empêche de se répliquer (Lemoine FM et al. 5 . Les vaccins recombinants utilisent la vaccine ou le canarypox (virus de la variole du canari) exprimant des protéines du VIH. 89 .1999). 3 . Les premiers essais chez l'animal ont montré que ces vecteurs induisent des CTL et des anticorps neutralisants (Lemoine FM et al. Cette approche.1999). toujours infectieux mais dont le pouvoir pathogène est diminué. Une approche originale utilise des «cochléats» (phosphatidylsérine. généralement considérée comme trop dangereuse chez l'homme. cholestérol et calcium) comme vecteurs de protéines et d'ADN. Les premiers vaccins recombinants exprimaient seulement une protéine d'enveloppe.Pseudo-particules (virus-like particles) Ces vaccins sont constitués de différentes combinaisons de protéines virales sous forme de particules. puisqu'un essai de phase II vient de commencer aux États-Unis chez 420 volontaires. Ces méthodes semblent capables d'induire des réponses immunitaires anti-VIH chez l'homme et antiSIV chez le singe. ADN nu L'administration d'un ADN purifié codant pour une ou plusieurs protéines du VIH et portant un signal pour la transcription dans la cellule présente deux avantages. En parallèle.1999). on étudie l'immunogénicité de peptides et antigènes incorporés dans des liposomes (vésicules d'acides gras qui ont la propriété de pénétrer dans les cellules) ou des ISCOMS (complexes immuno-stimulateurs). 6. la simplicité et la stabilité du vaccin. avec une préparation de Pasteur-Mérieux-Connaught. Certains vaccins sous-unitaires VIH induisent cependant une protection chez des chimpanzés et des macaques (Lemoine FM et al.Vaccins vivants recombinants produit par la biotechnologie C'est avec des vaccins vivants recombinants (un virus inoffensif auquel on a ajouté des gènes du VIH) que les essais chez l'homme sont le plus avancés.1999). d'où le concept de «prime-boost»). ou SIV chez le singe. après l'injection d'un vaccin recombinant vivant (prime. mais sans qu'on sache aujourd'hui si cela procure une protection.1999). suscite beaucoup d'intérêt depuis que plusieurs dizaines de médecins américains ont annoncé qu'ils se portaient volontaires pour un essai de vaccination par un VIH atténué (Lemoine FM et al. Les préparations actuelles sont porteuses de gènes de plusieurs protéines d'enveloppe et de protéines internes.Les virus vivants atténués Ce sont des virus VIH. 4 .sées pour les vaccins (Lemoine FM et al. Ils sont utilisés chez l'homme en rappel (boost).

concrètement. Le principe est simple : il s'agit de modifier la structure génétique des cellules cibles du VIH (les lymphocytes CD4) afin que celles-ci soient 90 . L'utilisation de cellules déjà modifiées : On injecte au malade des cellules humaines. qui ont été génétiquement modifiées par la méthode décrite ci-dessus en laboratoire. quelques protocoles d'essais chez l'homme ont été approuvés et certains sont même en cours d'évaluation. l'immunisation intracellulaire confère une protection contre un virus à l'échelon cellulaire chez des sujets infectés. Elles sont désormais capables de résister au virus du SIDA et peuvent apporter au malade une immunité contre les infections. est très avancée dans la thérapie des cancers et de nombreuses pathologies génétiques. Les cellules acquièrent ainsi les nouvelles propriétés conférées par ce gène. .Comment modifier les gènes d'une cellule ? Deux approches thérapeutiques sont aujourd'hui utilisées pour combattre le VIH : La modification directe des gènes des cellules du malade : On injecte au malade un virus porteur du gène que l'on veut modifier.La destruction sélective des cellules infectées. 1 . par exemple. par exemple.La sécrétion de protéines inhibitrices. des cellules immunitaires comme les lymphocytes CD4. 2 .Au-delà de ces vaccins en perspectives et ces nouveaux médicaments.La pharmacomodulation génétique. en produisant une toxine contre le virus du SIDA. la thérapie génique. qui consiste à intervenir sur les gènes d'une cellule pour modifier certaines de ces fonctions ou capacités. dont certains seront prochainement disponibles. le génie génétique peut-il développer des stratégies de combat contre le VIH ? A travers Cinq voies de recherches : . instrument du génie génétique.L'immunisation intracellulaire : Tandis que la vaccination protège les sujets non infectés de l'infection.Mais comment. Ces cellules chimères agissent comme un médicament en luttant contre la maladie. les pistes de recherches sont déjà nombreuses. LE GÉNIE GÉNÉTIQUE ET LA LUTTE CONTRE LE VIH. a .L'immunisation intracellulaire. .L'immunothérapie génétique. . . IV. Aujourd'hui. Pour ce qui concerne le traitement de l'infection par le VIH. les recherches continuent également dans la direction de la thérapie génique. Ce virus va s'intégrer au niveau de l'ADN des cellules et insérer le transgène.

produite lors de la réplication du VIH (Caruso M et al. Ce gène peut être implanté de manière ectopique dans les hépatocytes. L'intérêt de l'immunisation intracellulaire est qu'elle bloque bien la réplication du virus à l'intérieur de la cellule. La cellules modifiée se met alors à produire des mutants « transdominants » de protéines virales. de cellules immunocompétentes génétiquement modifiées (Lemoine FM et al. Tous ces éléments générés par la biotechnologie peuvent tromper le VIH ou le bloquer ou alors rivaliser avec lui dans la recherche des substrats. C’est ainsi que l’action de la zidovudine est limitée du fait de ses effets toxiques et de l'apparition de souches mutantes résistantes. En effet.La pharmacomodulation génétique : Les médicaments antiviraux actuels agissent pour la plupart à l'intérieur de la cellule infectée au niveau de laquelle ils pénètrent. Cette méthode est très intéressante.L'immunothérapie génétique : L'immunothérapie génétique correspond à l'utilisation. consiste en l'intro- 91 . à des fins thérapeutiques. à dose d'antiviral identique. et dont on pourrait diminuer les doses pour le patient (Caruso M et al. Le principe de la "pharmacomodulation génétique" est d'introduire un gène qui va accélérer l'activation de l'antiviral à l'intérieur de la cellule. e .protégées du virus. car elle permettrait ainsi. 1999). des fibroblastes de souris. L'opération consiste à introduire dans l'organisme un gène qui va produire une quantité élevée de ces protéines. et al. cette dernière voie de recherche. les entourer d'une membrane inerte de collagène pour qu'elles soient "invisibles" par le système de défense immunitaire du patient. Les chercheurs peuvent aussi utiliser d’autres méthodes comme "cultiver" des cellules modifiées génétiquement. des « molécules antisens » de séquences nucléotidiques. 1994). d . 1993). via un virus modifié qui est capable d'implanter le transgène. puis les transférer chez le patient atteint par le VIH. b . d'avoir une efficacité 3 à 10 fois plus importante. Un gène « suicide » est placé sous le contrôle transcriptionnel du promoteur LTR du VIH afin d'entraîner la destruction cellulaire au moment de la synthèse de la molécule tat. des « leurres ARN » qui miment l’ARN viral. Le mécanisme cellulaire qui permet de rendre ces médicaments actifs n'a pas toujours un rendement idéal puisqu’une partie du médicament est éliminé de la cellule avant d'avoir été rendu actif. car les lymphocytes sont détruits dès qu'ils sont infectés.La sécrétion de protéines inhibitrices : Certaines protéines sécrétées naturellement par les lymphocytes ont des propriétés anti-VIH. c.La destruction sélective des cellules infectées : Une autre approche de la thérapie génique de l'infection par le VIH vise à détruire spécifiquement les cellules infectées à l'aide d'un gène codant pour une toxine. Cette stratégie est difficile à mettre au point et n'apporte aucun avantage sélectif aux cellules transduites. 1992). Elle peut également être appliquée pour diminuer les effets indésirables d'autres antiviraux qui sont mal tolérés. Ces cellules enveloppées et protégées se mettent alors à produire les protéines anti-VIH (Moullier P. Plusieurs techniques sont utilisées. en plein essor.

duction dans l'organisme de cellules génétiquement modifiées. Lors de l'infection par le VIH. on remonte au gène qui a spécifiée cette séquence peptidique. * Sélection des peptides à travers la technique de l’immunogénétique Reverse. Fondement: rechercher les gènes qui spécifient les protéines du système immunitaire. des cellules dendritiques (DC) ou autres qui sont capables de "mimer" le virus du SIDA pour activer une réponse du système de défense immunitaire de l'organisme. A partir de la technique de l’immunogénétique reverse: Acquérir une grande information sur les séquences des acides aminés des protéines du VIH de divers clades du VIH. à partir de la configuration de la protéine.la génétique reverse: De l’ADN. les lymphocytes détruisent les virus. . l'organisme n'est pas capable de se défendre tout seul car le virus n'est pas reconnaissable suffisamment longtemps pour que des anticorps efficaces puissent être produits. d'une sorte de "vaccination" avec des cellules génétiquement modifiées. soit aux lymphocytes T CD8+ via le CMH I (Lemoine FM et al. Recherche sur un vaccin contre le VIH/SIDA Processus et défi de la conception et de la sélection des épitopes: Qu’est-ce qu’un épitope ? Comment pouvons-nous induire dans toutes les personnes une réponse immunitaire spécifique contre un grand nombres d’épitopes VIH peptides des Lymphocytes T Cytotoxiques (CTL) et des lymphocyte T helper ? Immunogénétique Reverse Nous avons : . en s'attaquant à ces "morceaux". 1999). 3 . synthétisée. A partir de la technique de l’immunogénétique reverse: trouver des peptides des allèles des classes HLA I et II capable de couvrir plus de 90% des haplotypes HLA de diverses populations ciblées. du gènes spécifique on cherche à découvrir la protéine codée.polymorphismes alléliques des populations ciblées. En effet.variabilité génétique du VIH. bel et bien. les DC sont capables d'apprêter les protéines sous forme de peptides antigéniques et de les présenter soit aux lymphocytes T CD4+ par le complexe majeur d'histocompatibilité de classe II (CMH II). . Défis d’élaboration des épitopes CTL du VIH spécifique Nécessité d’informations sur: 92 . L'immunothérapie génétique permet de présenter aux lymphocytes des "morceaux du virus" facilement reconnaissables pour que. Il s'agit là. * Les défis d’élaboration des épitopes CTL du VIH spécifique par la technique de l’immunogénétique reverse: .la génétique directe: du phénotype.

C’est à ce moment qu’ils découvrirent aussi les premiers exemples d’hérédité de certaines réactions anormales aux médicaments. un médicament antimalarique. L’étude moléculaire permit de découvrir chez les personnes qui ne tolèrent pas la primaquine le déficit enzymatique de la G6PD (Glucose 6 phosphate déshydrogénase).7 CHAPITRE XI : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE I . Linus Pauling en 1949 démontrait que l’anémie falciforme. Connaissance des fréquences des allèles du système HLA de classe I et de classe II au sein des populations ciblées ( Burkina Faso). Figure VIII. les aliments ou les médicaments. médecin anglais appliquait pour la première fois les lois de Grégoire Mendel à la transmission des maladies héréditaires de l’homme. Utilisation des épitopes promiscuous du système HLA de la classe I et II pour la population ciblée. Le premier exemple est la réaction d’anémie hémolytique inattendue des soldats américains d’origine africaine. la drépanocytose. les agents pathologiques.Historique : En 1902 Archibald Garrod. Par la suite les chercheurs démontrèrent que cette anomalie structurelle protéique correspondait à une altération de l’information génétique codée dans l’ADN.GÉNÉRALITÉ : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE A . Tester les épitopes du VIH sélectionnés pour établir la capacité d’être identifié par un Lymphocyte T Cytotoxique (CTL) VIH-spécifique et pour recueillir la réponse du lymphocyte T helper. Au moment où les recherches fondamentales explicitaient les mécanismes biochimiques et genetico-moléculaires associés aux pathologies héréditaires. Concevoir les épitopes peptidiques par la technique de l’Immunogénétique Reverse. « sick cell » est une maladie due à une anomalie structurale de la molécule de l’hémoglobine. L’étude fondamentale génétique de 93 .1) La variabilité génétique du VIH. Il émit comme hypothèse selon laquelle les facteurs héréditaires (les gènes) contrôleraient certaines réactions métaboliques. après la prise de la primaquine. Successivement il théorisait la nature individuelle (due à la variabilité et à la spécificité chimique des processus métaboliques) de toutes les réponses de l’organisme au regard des éléments étrangers. 2) La base génétique humaine de la distribution des allèles du système HLA de la population ciblée Nous trouvons des donnés sur la variabilité génétiques et la distribution des allèles du systèmes HLA des populations de l’Afrique de l’Ouest dans le dépôt du Gene Bank.

SSTR. chez les personnes âgées. les enzymes de transformation impliquées. de l'expression des gènes. les méthodes de transfection et le développement des chips. 4 . C’est ainsi qu’à partir des année 90. par contre. pour le développement d'une molécule a priori sélectionnée pour devenir un médicament? 94 . La pharmacogénomie ou la pharmacogénomique est plus difficile à définir. les études de pharmacogénétique commencèrent à montrer que la variabilité individuelle dans le métabolisme des médicaments peut dépendre non seulement de variations d’un seul gène avec ses allèles mais aussi de l’interaction de plusieurs gènes mutés dans l’organisme. vis-à-vis d'un médicament administré. Elle étudie les mécanismes de fonctionnement utilisés par la cellule-cible ou la cellule de détoxication.Élaborer des tests qui montrent que le patient qui doit prendre tel médicament possède les enzymes de transformation nécessaires. à côté de l'effet thérapeutique principal recherché. la façon dont chaque individu va transformer puis éliminer tel ou tel médicament. La pharmacogénétique représente donc aujourd'hui une composante importante dans le développement d'un nouveau médicament.Qu'est-ce que la pharmacogénétique ? La pharmacogénétique est définie comme l’étude des variations génétiquement contrôlées de la réponse à un médicament. la synthèse des enzymes de transformation des médicaments et leur activité évoluent en fonction de l'âge. à l'avance.Identifier pour tous les nouveaux médicaments. l’amplification en chaîne par la polymérase (PCR).Tester directement l'activité des enzymes de transformation des médicaments : des tests devraient se développer de plus en plus pour étudier.la susceptibilité individuelle à réagir de manière anormale avec des conséquences destructives après l’absorption de médicaments. en 1959. fut appelée. 5 . Certaines de ces enzymes ne sont pas encore "matures" chez des enfants .Déterminer les doses de médicaments à utiliser chez les enfants ou les personnes âgées. positives ou négatives. Il s'agit d'étudier simultanément les modulations. certaines enzymes peuvent avoir une activité réduite. 2 .Rechercher les gènes qui codent pour les enzymes de transformation des médicaments. pharmacogénétique. Quelle modification de l'expression d'un ou de plusieurs gènes induit une molécule donnée? Autrement dit. La pharmacogénétique a connu un grand développement en ces dernières années grâce à l’utilisation des techniques de biologie moléculaire comme l’analyse des polymorphismes de restriction (RFLP). quelles autres modifications du génome ou du protéome (dans le cadre de ce qu'il est convenu d'appeler la protéomique) peut-on observer. La pharmacogénétique qui permet d’établir un lien entre le polymorphisme de la structure génique et la variabilité de la réponse à l’effet d’un médicament a comme objectifs : 1 . B . 3 . les chercheurs émirent le concept de pharmacogénomique pour expliquer la variabilité individuelle dans la réponse aux médicaments utilisant des techniques qui permettent d’évaluer l’expression et l’action de plusieurs gènes. et quelles conséquences directes ou indirectes faut-il en déduire. A partir des années 70. En effet. induites par les composés pharmacologiques analysés.

Éliminer les toxiques. Pour qu'un médicament soit efficace. des tests sont disponibles pour vérifier la présence de cette enzyme et pour mesurer son activité avant de débuter un traitement. Ainsi.Pharmacogénétique : Les liens entre les enzymes de transformation des médicaments et les cancers ? Les enzymes ont des conséquences multiples dépendant : * de leur fonction . * des vertus pharmacologiques de la substance qu'ils détruisent .C . plus que d'autres. L'efficacité d'un traitement dépend donc directement de la présence et du fonctionnement de certaines enzymes. certaines enzymes de transformation modifient plusieurs médicaments et il peut alors se poser des problèmes de compétition. pour traiter différentes maladies. une personne sur 300 possède une enzyme de transformation de certains médicaments (l'AZT. on sait que certains fumeurs risquent. d’inhibition ou d’interaction médicamenteuse. certaines personnes vont fabriquer plus de molécules toxiques que d'autres sujets suite à la prise d'un médicament donné. * de la vitesse à laquelle ils agissent . D'ores et déjà. Ainsi. . La conséquence de cette absence est que la personne ne pourra pas éliminer le médicament. Ces personnes risquent alors de développer plus d'effets indésirables (effets secondaires). * Une personne sur 300 ne possède par une enzyme nécessaire pour la dégradation du 5-fluoro-uracile. un médicament utilisé pour le traitement du cancer du côlon.Quelques exemples pratiques. Inversement. qui va alors s'accumuler dans le corps et créer des effets toxiques. il faut plusieurs conditions : avoir des enzymes qui transforment le médicament en une substance active (parfois les médicaments sont directement actifs et n’ont pas besoin de cette étape d'activation). le mercaptopurine et la thioguanine) trop performante : elle modifie trop rapidement ces médicaments qui ne pourront alors pas agir sur les 95 . les personnes qui n'ont pas d'enzymes adéquates ne pourront pas utiliser un médicament donné et donc ne tireront pas le bénéfice thérapeutique attendu. Ce caractère leur permet d'être protégées contre l'action de ces toxiques. et d'autres enzymes qui ne dégradent pas trop rapidement cette substance active (pour que le médicament reste efficace plus longtemps). Les enzymes agissent d'une autre façon : certains créent des produits toxiques. .Rendre les médicaments efficaces. certaines personnes éliminent plus rapidement ou plus efficacement certains produits toxiques. Il est important de connaître quels sont les médicaments qui interagissent les uns avec les autres pour éviter de les combiner. d'autres permettent d'éliminer ces agents toxiques. Parfois. de développer un cancer du poumon après activation des produits contenus dans la fumée de tabac par leur transformation enzymatique en produits cancérigènes. les personnes sous traitement peuvent prendre plusieurs médicaments en même temps. Afin de mieux combiner les médicaments les uns avec les autres. * De même. * des propriétés toxicologiques de la substance qu'ils créent. . A l'inverse.

Les effets de plusieurs produits comme l’isoniazide. appropriées. du point de vue génétique. C’est la manière d’être particulière à chaque individu. mais en âge juvénile ou adulte. La pathologie transmise par les chromosomes sexuels peuvent toucher un sexe plus que l’autre. D – L’épidémiologie des réponses idiosyncrasiques L’idiosyncrasie idios (ιδιος) en grec = particulier . que la biotransformation de certains médicaments.Une altération transmise en mode récessif avec le chromosome X se manifeste chez les sujets de sexe masculin. cependant le cadre clinique symptomatique est parfois évident et suggestif. L’âge joue dans la pathogenèse dans la mesure où certaines altérations génétiques peuvent se manifester non à la naissance. sunkrasis (συνκρασις)= mélange). - E . tandis que le gène muté qui code une enzyme pseudo-cholinestérase s’exprime plus chez les européens avec une fréquence de 2%. Elles agissent principalement en rendant solubles certaines substances chimiques pour qu'elles soient ensuite éliminées par le foie et/ou les reins. L’examen clinique est de par soi-même insuffisant. Par exemple. dépend des enzymes qui. L’incidence de l’anémie hémolytique induite par les médicaments est mineure chez les caucasiens par rapport aux autres populations. Les études familiales ont permis d’établir . la présence du gène pour la variante A. comme la dicoumarole et la phénylbutazone. s’expriment d’une manière polygénique. en tant que hémizygote.Les critères d’étude en pharmacogénétique En face d’une réponse pharmacologique atypique. * On peut encore citer des enzymes de détoxication (appelées transférases) qui sont présentes en quantité variable d'une personne à l'autre. des comportements qui lui sont propres.de l’enzyme G6PD.cellules cibles. 96 . il faudrait des recherches documentées. . Les réponses idiosyncrasiques ont une corrélation. par exemple. L’information plus certaine est l’étude des familles et des groupes de jumeaux. la phénylbutazone et l’halothane. l’aire géographique et le groupe ethnique. il faudrait suspecter une base génétique. au sein de la population. sont évalués en utilisant les jumeaux homozygotes. L’aire géographique est importante quand l’environnement exerce une pression sélective et favorise l’affirmation d’un profil génétique déterminant. avec les mutations génétiques et les facteurs variés comme le sexe. Les différences génétiques entre les diverses ethnies sont responsables de la variation dans la réponse aux médicaments. La G6PD tend à se manifester surtout dans les zones endémiques du paludisme. comme dans le cas d’une apnée prolongée par suite de l’absorption d’un médicament. Mais pour que cela soit accepté. l’âge. qui l’amène à avoir des réactions.

I : Désordres pharmacogénétiques Altération génétique Médicament Manifestation pathologique Désordres pharmacogénétiques avec apparition de phénomènes toxiques ou imprévisibles G6PD Antimalariques.88 et 0. Vd = variance calculée à l’intérieur de jumeaux hétérozygotes et Vm est la variance calculé à l’intérieur des jumeaux homozygotes. sulfonamides Méta-hémoglobinémie réductase Pseudo-cholinestérase Succinylcholine Apnée Polymorphisme de la Isoniazide. B12 Absence sèque Activité antianémique Réduction des récepteurs Beta2 stimulants Absence beta2 adrénergique Activité antiasthmatique Altération des récepteurs Insuline Absence 97 . le paramètre qui détermine la pharmacocinétique d’un médicament déterminé. Les jumeaux homozygotes tendent à avoir un profil pharmacogénétique très similaires par rapport à un type de médicament . la demie-vie plasmatique et la contribution de l’hérédité est le coefficient de l’Hérédité qui s’exprime par l’équation : h2 = (Vd-Vm) ----------Vd h = Coefficient d’hérédité . tandis que les jumeaux hétérozygotes présentent des variations énormes comparables aux individus consanguins. sulfamiAnémie hémolytique des. Apparaît la toxicité du méN-acetyltransferase clonazepam dicament Transferrine Fer hémochromatose Désordres pharmacogénétiques avec absence d’effet pharmacologique attendu (résistance à l’action des médicaments) Altération génétique Médicament Effet thérapeutique attendu Absence du facteur intrin.Vit. procaïnamide. nitrofuranes NADH-méta-hémoglobine Nitrite.98. Exemples de désordres pharmacogénétiques : Tableau IX.Les études au niveau des jumeaux comparent les réactions à l’intérieur des groupes de jumeaux homozygotes et des jumeaux hétérozygotes. Dans le cas de la dicoumarole. l’halothane et la nortriptyline. le coefficient d’hérédité varie entre 0. la phénylbutazone. Au niveau des jumeaux. La valeur de h peut varier entre 0 (dans le cas où la contribution génétique est insuffisante ou nulle) à un (dans le cas où l’influence génétique est déterminante).

il existe une répartition bimodale de la capacité d'acétylation définissant les acétylateurs rapides (demi-vie d'environ 2 h) et les acétylateurs lents (demi-vie d'environ 6 h) (figure 5). les réactions idiosyncrasiques peuvent consister dans l’apparition des effets toxiques ou imprévisibles. La pharmacogénétique est la discipline qui décrit les réponses inusuelles aux médicaments (idiosyncrasie) sur la base de mécanismes héréditaires.Au niveau de la résorption Les patients atteints d'anémie pernicieuse juvénile souffrent d'une malabsorption de la vitamine B12 d'origine génétique. sans compter de l'observance et des variations liées à l'observateur. certains malades ne répondant pas à des doses habituelles.Absence du HGPRT prine Activité antitumorale Activité immunosupressive II . pathologie(s). consommation d'alcool ou de tabac.Au niveau de la métabolisation Le polymorphisme d'acétylation. Ils ne sont par contre que 17% parmi les Égyptiens. De nombreux facteurs sont connus pour retentir sur la susceptibilité individuelle . 2 . en représentent des exemples.de l’insuline Activité antidiabétique Réduction de la synthèse 6-mercaptopurine azathio.LES DÉSORDRES PHARMACOGÉNÉTIQUES Les désordres pharmacogénétiques peuvent être classés selon la base des caractéristiques cliniques des réponses idiosyncrasiques et aux altérations génétiques qui sont à leur origine. de médicaments. Les variations interindividuelles de la réponse aux médicaments sont d'observation fréquente. Il existe également une perturbation congénitale de la résorption de l'acide folique accompagnée de modifications de son métabolisme qui conduisent à des réponses atypiques en cas d'administration de folates ou d'analogues tel le méthotrexate. Le caractère acétylateur lent se transmet selon 98 . A. La répartition varie selon les ethnies. génotype. tandis que d'autres présentent des accidents de surdosage. Variations d'ordre pharmacocinétique 1 . La connaissance de ces facteurs de variation peut aider à corriger un schéma posologique pour l'adapter à chaque sujet afin d’éviter les phénomènes toxiques et imprévisibles. statut hormonal. activité physique. Enfin lors d'administrations concomitantes. Selon ce critère. ou dépendre de conditions extérieures (facteurs extrinsèques) : variations nycthémérales. ou alors en un manque d’effet thérapeutique attendu. Dans une population. L'exemple le plus connu concerne l'isoniazide (Rimifon®). Environ 45% des Européens sont acétylateurs rapides contre 80-90% des Asiatiques et la quasi totalité des Esquimaux. compétence immunologique. ils peuvent être en rapport avec le malade lui-même (facteurs intrinsèques) : âge. voire élevées. facteurs environnementaux. état nutritionnel. stress. Sa biotransformation est catalysée par une N-acétyl transférase à localisation hépatique préférentielle. enzymes. les interactions médicamenteuses constituent un dernier volet.

le mode autosomique récessif. L'adaptation posologique chez le sujet à risque.6 -------------------------------------Dose administrée (mg/kg/j) Rapides (R/R ou R/r) Fréq. L'application de la formule ci-dessous permet de déterminer l'indice d'acétylation: Isoniazidémie à la 3è H + 0. 24 Leats (r/r) 20 16 12 8 4 99 0 . mais en revanche chez les acétylateurs rapides la production plus importante. Pour une posologie standard les risques d'apparition d'effets indésirables par surdosage. en particulier neurologiques. peut se faire à partir de l'administration d'une dose test et du dosage de l'isoniazide plasmatique 3 h après. et en particulier chez l'enfant. sont plus élevés chez les acétylateurs lents . d'un métabolite hépatotoxique majorerait le risque d'hépatite. in situ.

Le polymorphisme d'oxydation. Une vingtaine de médicaments sont métabolisés par le cytochrome 100 . procaïnamide. Ils suivent la voie des mono-oxygénases hépatiques sous la dépendance d'isoenzymes des cytochromes P450. des tests basés sur l'acétylation d'autres molécules ont également été standardisés : procaïnamide et son métabolite acétylé le NAPA ou métabolites de la caféine entre autre. On calcule alors un quotient métabolique qui est compris entre 0. Ce polymorphisme a primitivement été mis en évidence avec la débrisoquine. aminogluthétimide. Enfin. Le lupus érythémateux induit par l'hydralazine ou la procaïnamide se rencontre préférentiellement chez les acétylateurs lents. C'est le cytochrome P450 II D6 qui est responsable de ce déficit qui concerne 5-10% de la population de race blanche mais varie selon les ethnies . par exemple). sans ingestion de molécule médicamenteuse.01 et 10 chez les métaboliseurs rapides mais entre 20 et 200 pour les métaboliseurs lents. encore que d'autres facteurs de prédisposition (typage HLA-DR4 par exemple) soient connus. L'oxydation est impliquée dans la métabolisation d'un grand nombre de médicaments. Pour dépister les métabolisateurs lents. le phénotype d'acétylation détermine également le métabolisme des amines aromatiques cancérigènes . Les fortes variations de sa posologie nécessaire pour contrôler l'hypertension a conduit à la mise en évidence d'un déficit en débrisoquine 4-hydroxylase chez certains patients. un test dit à la débrisoquine s'est diffusé. la molécule mère et son métabolite sont dosés dans les urines recueillies pendant 8 heures. dapsone. certains sulfamides.0 2 4 6 8 10 12 Concentration plasmatique de l’isoniazide µg/ml Concentrations plasmatiques de l isoniazide mesurées 6 heures après administration d une dose moyenne de 9. il se transmet sur le mode autosomique dominant. une molécule antihypertensive. L'avantage du test à la caféine est qu'il peut être réalisé après la simple prise d'un café. ainsi le cancer de la vessie provoqué par les amines est plus fréquent chez les acétylateurs lents exposés. Après administration d'une dose test de 10 mg.8 mg/kg à 267 membres de 53 familles (d après Evans) En dehors de l'isoniazide. caféine. nitrazépam. D'autres pathologies associées au polymorphisme d'acétylation sont également suspectées. L'intérêt du phénotypage d'acétylation dépasse l'adaptation posologique de l'isoniazide puisqu'il permet également de prévoir le comportement vis-à-vis d'autres médicaments qui suivent cette voie de métabolisation (hydralazine.

Ce défaut du mécanisme de la glucuroconjugaison induit une hyperbilirubinémie mais provoque également une sensibilité particulière à des médicaments qui suivent cette voie de métabolisation (paracétamol. azathioprine : Imurel®) utilisés comme anticancéreux ou immunosuppresseurs ne sont pas métabolisés. hydrate de chloral. Les enzymes de S. menthol. les antiarythmiques. du nom de la ville Américaine où furent caractérisés les premiers cas. de ce fait sont résistantes à cette substance. morphines. Il existe un moyen. Cet anesthésique local inhibe in vitro les pseudocholinestérases normales. les analogues des bases puriques (6-mercaptopurine : Purinéthol®). Il existe une corrélation entre l'activité de la thiopurine méthyltransférase érythrocytaire et la concentration en 6-thioguanine. Certains sujets (1 % de la population européenne) présentent une curarisation prolongée après administration de succinylcholine. La maladie de Gilbert (5 % de la population Française) comme la maladie de Crigler-Najjar sont liées à un déficit de l'uridine diphosphate glucuronosyl transférase. ont été rapportés. Des déficits des thiopurines méthyltransférases et thiol méthyltransférases. les neuroleptiques. corticostéroïdes par exemple). à la sparteïne.P450 II D6 . Ce test a servi dans de nombreuses études visant à rechercher une susceptibilité particulière à des médicaments ou des toxiques pouvant servir de support à l'apparition d'effets indésirables ou de certaines pathologies d'étiologie mal connues. En revanche. il existe des sujets qui hydrolysent la succinylcholine plus rapidement que les personnes normales et qui. mais seulement de 20 chez les sujets porteurs de l'anomalie. Les butyrylcholinestérases atypiques. alors qu'il n'a que peu d'effet sur les enzymes atypiques. l'absence de métabolisation les rend inefficaces chez ces malades. L'hypoxanthine-guanine phosphoribosyl transférase (HGPRT). Beaucoup plus rare que l'hypersensibilité. à la caféine pour explorer cette même voie métabolique. oxazépam. Chez les patients souffrant d'un déficit en hypoxanthine-guanine phosphoribosyl transférase (maladie de Lesch-Nyhan). l'affinité pour le substrat étant très diminuée par rapport à des sujets normaux. Les sujets hypersensibles sont homozygotes pour le gène anormal. la plupart des antidépresseurs tricycliques et les inhibiteurs de la recapture de la sérotonine. le test à la dibucaïne. L'uridine diphosphate glucuronosyl transférase.et 0-méthylation. Ces molécules étant en fait des prodrogues devant être transformées en nucléotides pour être actives. pour dépister les patients porteurs. Les butyrylcholinestérases sont également impliquées dans l'inactivation d'autres médicaments et drogues sans que les conséquences cliniques d'un déficit soient très claires. la fréquence étant évaluée à 1/2 500. enzymes respectivement impliquées dans le métabolisme de la 6-mercaptopurine et de l'azathioprine et dans la S-méthylation du captopril (Lopril®) et de la D-pénicillamine (Trolovol®). Où cette acti- 101 . Il est défini un Dibucaïne Number (DN) qui est de l'ordre de 80 (correspondant à 80% d'inhibition) chez les sujets sains. salicylés. Mais il existe également d'autres polymorphismes d'oxydation indépendants de la voie suivie par la débrisoquine. Le niveau d'activité de la catéchol-O-méthyl transférase (COMT) est également contrôlé par le polymorphisme génétique. en particulier ce polymorphisme est observé pour les bêta-bloquants. Chez ces personnes l'hydrolyse de la succinylcholine par les pseudo-cholinestérases plasmatiques et hépatiques se fait très lentement. cette anomalie porte le nom de Cynthiana. tests au dextrométhorphan. Différents autres tests se sont développés.

50% des Chinois.vité est impliquée dans le métabolisme de la l-dopa et de l'α-méthyldopa. cofacteur indispensable au cycle du glutathion. taux sanguin d'acétaldéhyde et hypersensibilité à l'alcool. Les différences entre les formes polymorphiques de l'ADH peuvent contribuer à expliquer les variations interindividuelles de vitesse d'élimination de l'alcool. des Japonais. le métabolisme des stéroïdes et des acides biliaires mais aussi des composés digitaliques. elle catalyse la réaction réversible des alcools primaire et secondaire en aldéhyde et cétone. Les formes d'ADH à forte activité catalytique produisent de plus fortes concentrations sanguines d'acétaldéhyde à l'origine des symptômes d'intolérance à l'alcool. Elle est également impliquée dans l'interconversion rétinol-rétinal. Les glutathion-S-transférases (GST). La sensibilité à l’hépatotoxicité de la tacrine (Cognex®) des patients souffrant de la maladie d'Alzheimer pourrait être liée à l'absence d'expression de GST empêchant la détoxification de métabolites réactifs. La compétition entre l'alcool et les glycosides cardiaques pour l'ADH peut augmenter notablement leurs concentrations. Des inhibiteurs de la COMT sont à l'étude dans le traitement de la maladie de Parkinson. Les GST représentent une famille d'enzymes catalysant la conjugaison entre le glutathion réduit et une variété de molécules électrophiles. des Indiens Sud Américains et des populations d'origine mongole présentent un déficit d'ALDH2 alors qu'il est totalement absent des populations de race blanche et noire.Au niveau d'une protéine Un déficit ou une hyper-production enzymatique. En ab- 102 . La glucose-6-phosphate-déshydrogénase (G6PD). Plusieurs enzymes de cette famille sont inhibées par le disulfiram (Espéral®) ou ses métabolites. Un déficit en GST µ semble lié à une fréquence accrue de cancers. Mais un lien entre alcoolisme et génotype des isoenzymes d'ADH n'a pu être mis en évidence. Quatre isoformes sont décrites chez l'homme. Au moins quatre isoenzymes sont décrites. Un polymorphisme génétique a été mis en évidence pour l'isoenzyme mitochondriale hépatique ALDH2. l'expression des GST µ et θ étant soumises à un polymorphisme génétique. Il existe une corrélation positive entre déficit en ALDH2. Alcool et aldéhyde déshydrogénases. par un test à la caféine. Variations d'ordre pharmacodynamique 1 . y compris des carcinogènes. Le déficit du G6PD est une maladie génétique héréditaire liée au sexe car le gène qui code cette enzyme se trouve sur le chromosome X. Ce métabolisme interroge l'activité du cytochrome P450 1A2 qui peut être exploré. La détoxification de l'acétaldéhyde est sous la dépendance de l'aldéhyde déshydrogénase (ALDH). Une faible incidence de ce déficit est retrouvée chez les alcooliques. Elles sont fortement exprimées chez l'homme dans les hépatocytes. une modification de la structure d'une protéine peuvent être responsables de l'apparition d'effets médicamenteux inconnus dans la population normale ou au contraire de l'absence de l'action habituellement observée. là encore. expliquant son effet antabuse. L'alcool déshydrogénase (ADH) représente la principale voie oxydative du métabolisme de l'éthanol . Trois grandes classes d'ADH sont connues ainsi qu'une forme atypique retrouvée chez seulement 5 à 10 % des Anglais mais 85 % des Chinois et des Japonais. La G6PD représente la principale voie de production du NADPH du globule rouge. B.

les populations Méditerranéennes et les africains où l'hémolyse est la plus sévère. Tableau IX. La transmission est liée au sexe. Sulfones: diaminodimetylsulfone thiazolsulfone Autres: bleu de méthylène 103 . ce qui expliquerait la conservation du gène dans la population.et G6PDA+) affectent les Noirs Américains. Ce déficit ne s'exprime qu'en présence d'un xéno biotique oxydant qui peut être un aliment (fève) ou un médicament. aminophenazone Nitofuranes : nitrofurantoine nitrofurasone Sulfamides: sulfacetamide. Les hématies fragilisées sont exposées au risque de crise hémolytique.sence du G6PD et en présence d'un oxydant. Il est à noter que l'activité de la G6PD est toujours faible chez le nouveau-né. l'hémoglobine est dénaturée et précipite sous la forme de corps de Heinz. phenacétine Primaquine. De nombreux médicaments provoquent des accidents hémolytiques en particulier parmi les antipaludéens. le rendant sensible au risque hémolytique. les antalgiques et les anti-infectieux (Tableau). mepacrine Acetanilide. Les deux principaux variants (G6PDA.II: Quelques médicaments pouvant déclencher une hémolyse chez un sujet atteint de déficit érythrocytaire en G6PD Médicaments qui provoquent une anémie hémolytique cliniquement significative chez les sujets avec déficit en G6PD Antimalariques : Analgésiques : Pamaquine Acide acetylsalicylique. Les porteurs hétérozygotes sont plus résistants à l'infection par Plasmodium falciparum.

7 Thal et G6PDA- 2 . la griséofulvine. les substances connues pour être à l'origine de la formation de methémoglobine doivent être evitées (oxydants directs : nitrates. figurent les barbituriques. même chez des personnes non porteuses d'anomalies héréditaires. comme par exemple un fongicide l'hexachlorobenzène. nitrites.Au niveau d'un récepteur 104 . des crises. majorent les conséquences de sa dysrégulation.127 (30/236) 0.103 (12/116) G6PDA0.185 (25/135) 0. Certains produits particulièrement puissants. sulfapiridine acide ascorbique phenylhydrazine probénécide Par ailleurs. dans certaines hémoglobinopathies. différents précurseurs vont s'accumuler correspondant à des formes différentes de la maladie.026 (15/570) 0. Les porphyries sont caractérisées par une anomalie de la régulation de la synthèse de l'hème due à un déficit enzymatique.. Tableau IX.7 Thal 0. l'alcool mais aussi la chloroquine. La delta aminolévulinique synthétase (ALA-synthétase).121 (69/570) 0. sont déclenchées par les médicaments inducteurs enzymatiques qui.059 (8/136) Fréquences genotypiques Alpha-3. Le lien entre l'accumulation de ces précurseurs et les symptômes de la maladie est encore mal appréhendé. l'hémoglobine est également instable. l'amidopyrine. peuvent déclencher des porphyries.) ainsi que tous les médicaments contre-indiqués dans le déficit en G6PD.sulfamotoxazole sulfanilamide.191 (76/397) 0.024 (8/334) 0. liste non limitative. HbC.III: fréquences zygotiques du au Burkina Faso Groupe Ethnique HbS Mossi (M) Rimaibé (R) M+R Fulani (F) 0. La methémoglobinémie.195 (51/262) 0.030 (7/236) 0. Plusieurs modifications structurelles de l'hémoglobine ou de la methémoglobine réductase peuvent être responsables de la methémoglobinémie congénitale.. Selon le site primaire d'expression de l'anomalie génétique.180 (40/222) 0.022 (3/136) HbC 0. Parmi les principaux. Ces maladies se transmettent selon le mode autosomique dominant. chlorates. facilement dénaturée en corps de Heinz et associée à des crises hémolytiques induites par des médicaments.117 (39/334) 0. parfois mortelles. les oestrogènes. quinines ou indirects : aniline. Alpha-3. d'origine toxique. les sulfamides.134 (15/112) 0. Les malades porteurs de cette affection doivent être précisément informés des médicaments et autres substances qui leur sont contre-indiqués. la phénytoïne. Chez les malades porteurs de cette anomalie. en augmentant encore l'activité de l'ALA-synthétase.069 (7/101) HbS. Ce déficit entraîne une dérégulation de l'ALA synthétase et conduit à l'accumulation de grandes quantités de précurseurs de l'hème. Les précurseurs sont éliminés dans les urines où ils sont transformés en porphyrines. Chez les patients atteints.227 (25/110) 0.

Ils bloquent le cycle de régénération de la vitamine K. Ils sont liés au chromosome X et correspondent à une modification de récepteurs intracytoplasmiques. qui peut atteindre 43°. La résistance aux hormones stéroïdes. Il s'agirait en fait d'une modification génétique du récepteur hépatique. 3 . L'évolution est le plus souvent mortelle. Le monitoring médicamenteux comme 105 . Différents syndromes de résistance aux androgènes sont connus. le muscle des personnes concernées présentant une réponse contractile anormale quand il est exposé à la caféine ou à l'halothane. dans quelques rares cas. La résistance se manifeste à la fois pour les hormones endogènes et exogènes.Variations de mécanisme mal déterminé L'hypertension oculaire aux corticoïdes. de warfarine ne s'accompagne pas de modifications du taux de prothrombine. β-adrénergique et cholinergique. dont l'éthiopathogénie n'est pas connue. une tachycardie. La trisomie 21 s'accompagne d'une hypersensibilité à l'atropine et aux βadrénergiques. Chez quelques rares malades l'administration. L'anémie aplasique au chloramphénicol. Les patients souffrant de mucoviscidose présentent des réponses anormales aux molécules à propriété α-adrénergique. Les anticoagulants coumariniques inhibent la coagulation en bloquant la synthèse hépatique vitamine K dépendante de quatre protéines impliquées dans le processus (facteurs II. des arythmies et une rigidité musculaire. On en retiendra que ces connaissances méritent d'être hiérarchisées : certaines relèvent surtout d'une recherche fondamentale tandis que d'autres présentent une pertinence clinique. Le caractère familial est établi et cette susceptibilité particulière pourrait être liée à une augmentation idiopathique du calcium sarcoplasmique. se transmet selon le mode autosomique récessif. L'administration de collyre aux corticoïdes provoque dans 5% de la population un glaucome aigu par augmentation de la pression intra-oculaire. La résistance à la warfarine. Cette réponse. Autres syndromes. L'anomalie peut être détectée de façon préventive sur une biopsie musculaire. le chloramphénicol peut déclencher une aplasie irréversible dose-indépendante chez des sujets génétiquement prédisposés. L'incidence en serait de 1 pour 15 000 anesthésies chez l'enfant et de 1 pour 50 000 à 100 000 chez l'adulte. VII. En dehors de l'aplasie réversible dosedépendante. L'insensibilité à l'amertume de la phénylthiourée ou à l'odeur de cyanure sont dues à une anomalie héréditaire des récepteurs sensoriels correspondants. même à forte dose. IX et X). Certains types de résistance à la vitamine D sont également reliés à un dysfonctionnement du récepteur tissulaire. L'exploration des patients résistants a montré l'absence de modifications pharmacocinétiques de la warfarine. L'hyperthermie maligne déclenchée par une anesthésie générale. Nous venons de passer en revue les principaux facteurs de variation de l'activité des médicaments. La dysautonomie familiale est associée à une hypersensibilité à la noradrénaline. Le syndrome comprend une très forte hyperthermie.Des modifications de l'affinité d'un récepteur peuvent également expliquer une variabilité de l'action de certaines molécules et en particulier rendre compte de la résistance à un médicament.

GRIFFITHS. BENTUÉ-FERRER. CR Acad Sci Paris 1994 . Genetically controlled pharmacomodulation for HIV gene therapy. Selective killing of CD4+ cells harboring a human immunodeficiency virus-inducible suicide gene prevents viral spread in an infected cell population. Médecine-Sciences. MILLER. . CARUSO M. Freeman. Ces notions s'intègrent au développement du médicament . 106 . les essais cliniques de phase I et II s'efforcent de maîtriser ces facteurs de variation. USA 2000. KLATZMANN D. WILLIAM. BIBLIOGRAPHIE ET REFERENCES ANTHONY J. Dennis B. 89 : 182-6. LEWONTIN.. 317 : 1027-30. JEFFREY H. An introduction to genetics analysis. GELBART. RICHARD C. DAVID T.les différents tests de phénotypages disponsibles représentent une aide spécialisée à la thérapeutique. Biologie moléculaire de la cellule. REYMANN. Seventh edition.F. CARUSO M. Paris 1995. Flammarion. cours BRUCE A. SUZUKI. les facteurs de variation de l’activité des médicaments. KLATZMANN D. M. Proc Natl Acad Sci USA 1992 .

Lemoine F. Génie génétique : procédés biotechnologies. ASM press. NICOSIA S. 298. Genetic analysis using the polymerase chain reaction (PCR). Paris 1995. enjeux thérapeutiques. (eds). 479-506. Genet. CLEMENTI F. médecine-sciences. UTET. second edition. S.C.. Office Parlementaire des choix scientifiques et technologiques. Zanichelli. Risk managementin Biotechnology. génétique médicale. R.. KRIMSKY S. Assemblée Nationale Française. Mai . Technique DNA tests. Washington 1998. .05200301203. 1992. DEFAYE J. 26 pp. Human genetics : readings on the implications of genetic engeering.. LONCLE D. 107 . et al. SIMPORE J. Paris 1991. NUSSBAUM ROBERT L.Juin 1999 : 217-26.. ERLICH H. 375-389. Rome 1995. WILLIAMSON B. HERSON.. KAPLAN J. PAOLETTI R. Doin... US Government Printing Office. n° 11. Vol. Genetics in medicine. perspectives et éthique.. GLICK BERNARD R. USA 2001. New York 1975. ». pp.A.CHEVALLIER M. D. Biologie moléculaire et médecine. « Annu. Gene therapy. 1982.. Rapport sur les applications des biotechnologies à l’agriculture et à l’industrie agroalimentaire. Médecine-Sciences. économiques et éthiques. Rev.. Thérapie génique implications. Camillianum. « Nature ».. MARGARET W. 262-264. n. « 2° édition. Seconde édition. FUMAGALI G. imprimerie du MSSRS. Genetic Alchemy : a social history of the DNA Controversy.M. Thérapie génique de l'infection par le VIH. Génie Génétique. WATSON J. SIMPORE J. p. Ouagadougou septembre 2000. . KLATZMANN. Saunders\company. Virologie. D.. Turin 2003. –ARNHEIM N.. 67-100.. John Wiley and Sons. Numéro 3. Pharmacologie générale et moléculaire. 3. Amaudric M.. Molecular biotechnology. MERTENS T.. DNA Ricombinante. sixth edition... PASTERNAK JACK J. Gilman M. Bologna 1994 pp.

Sign up to vote on this title
UsefulNot useful