P. 1
genie_genetique

genie_genetique

|Views: 1,363|Likes:
Publié parYousfi Axel

More info:

Published by: Yousfi Axel on Apr 16, 2011
Droits d'auteur :Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/17/2015

pdf

text

original

1

UNIVERSITE DE OUAGADOUGOU
---------------------------------
Unité de Formation et de Recherche
En Sciences de La Santé
U.F.R. – S.D.S.
COURS DE GENIE GENETIQUE
NOTES DU COURS:
Prof. Jacques K. SIMPORE,
…AATCGCCGTCCGATTCCGTCACGC…
….TTAGCGGCAGGCTAAGGCAGTGCG…
Noyau cellulaire
Double brin d’ADN
Chromosome
Cellule
…AATCTTGCCGGGTTCCCG…
…TTAGAACGGCCCAAGGGC…
2
Le Ser ment ét hi que pour l es cher cheur s en sci ences de l a
vi e, adapt é et i nspi r é du Ser ment d' Hi ppocr at e médi cal ,
(Science Vol. 286, 19 Nov. 1999, p.1475).
« Je jure d'être fidèle à l'éthique du respect des personnes et des vies humai-
nes et de contribuer au développement de la connaissance et à la plus large
diffusion du savoir.
Je respecterai toutes les espèces dans leur biodiversité : ce respect inspirera
mes actes et mes projets, notamment au cours de mes expérimentations sur
les animaux ou les tissus humains.
Je m'efforcerai de soulager les souffrances de tous les êtres vivants.
Admis(e) à avoir accès à l'intimité tissulaire ou génétique des personnes, je
tairai leur identité et m'astreindrai au secret médical.
Même sous la contrainte, je ne ferai pas usage de mes connaissances contre
les lois de l'humanité.
Je préserverai l'indépendance nécessaire à l'accomplissement de ma mission.
Je m'informerai et réfléchirai au sens de mes expérimentations et à leurs
conséquences.
Je veillerai à ce que mes travaux et recherches ne soient pas utilisés à des
fins de destruction ou de manipulation.
Je respecterai les savoirs des ethnies et des sociétés traditionnelles.
Je n'aurai garde d'oublier mes responsabilités à l'égard des générations pré-
sentes et futures.
Je n'accepterai pas que des considérations de nationalité, de culture, de poli-
tique ou d'avantages matériels me détournent de mes devoirs.
J'interviendrai pour défendre, s'il m'en est donné l'occasion, l'ensemble de ces
règles.
Que les hommes et mes confrères m'accordent leur estime si je suis fidèle à
mes promesses.
Que je sois déshonoré (e) et méprisé (e) si j’y manque ».
3
Pages
SERMENT POUR LES CHERCHEURS EN SCIENCES DE LA VIE 02
INTRODUCTION 05
PREMIERE PARTIE:
LES OUTILS DE LA BIOLOGIE MOLECULAIRE 07
CHAPITRE I : 08
TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE
ET DE QUANTIFICATION DES ACIDES NUCLEIQUES,
I. Extraction, précipitation de L’ADN des eucaryotes et des procaryotes 08
II. Contrôle de la pureté de l'ADN extrait 10
III: Quantification de l'ADN
10
CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES, 13
YAC, BAC, VIRUS
I- Les vecteurs en génie génétique : l'ADN plasmidique 13
II- L'ADN phagique 17
III. Cosmides, YAC et BAC 20
Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE, 24
CARTE DE RESTRICTION
I. Enzymes de restriction 24
II. L’électrophorèse sur gel 30
III. Les enzymes utiles en génie génétique: 31
CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. 36
I - Le clonage 36
II - Les banques génomiques 36
III - Les banques de cADN 38
IV - L’étude de l’ADN cloné 40
CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION DES GÈNES 51
EUCARYOTES DANS LES BACTÉRIES.
I - Les mutagenèses 51
II. Mise en évidence des effets de la modification 56
III. Transfert de l’ADN modifié 57
4
DEUXIEME PARTIE : APPLICTION DE LA BIOLOGIE MOLECULAIRE :
LE GENIE GENETIQUE 59
CHAPITRE VI: LES TECHNOLOGIE DU GENIE GENETIQUE APPLIQUEES
AUX MICRO-ORGANISMES 60
I. La technique de l'ADN recombinant (ADNr) 60
II – Synthèse du facteur VIII humain 63
III – Synthèse de l’insuline humaine 63
IV - Synthèse de l’hormone de croissance (GH) 64
V – Production de vaccins 64
VI - Production de nouvelles antibiotiques 65
VII – Production d’aliments fermentées 68
CHAPITRE VII:
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX VEGETAUX 71
I. – Le plasmide Ti 71
II – Le Terminator 73
III – Application des techniques du génie génétique à l’agriculture 77
CHAPITRE VIII :
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX ANIMAUX 82
I – Les insectes transgéniques 82
II – Les animaux transgéniques 83
CHAPITRE IX : CLONAGE DES MAMMIFERES, PARTHENOGENESE,
CELLULES SOUCHES EMBRYONNAIRES, THERAPIE GENIQUE 87
I – Clonage des organismes entiers 87
II – Les cellules souches embryonnaires 88
III - La parthénogenèse: 93
IV - La thérapie génique: 93
CHAPITRE X :
LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES
DANS LA RECHERCHE SUR LE VIH/SIDA 98
I – Structure du VIH 98
II - Les nouvelles molécules antivirales en développement: 99
III. Vers l’espoir d’obtenir un jour un vaccin anti-VIH. 100
IV. Le génie génétique et la lutte contre le VIH. 101
PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE 107
I - Généralité : Pharmacogénétique et pharmacogénomie 107
II - Les désordres pharmacogénétiques 111
5
BIBLIOGRAPHIE 120
INTRODUCTION
Les méthodes et les techniques de biologie moléculaire développées durant
ces dernières décennies, pour séquencer, « recombiner », transférer et analyser les
produits de l’expression du matériel génétique des diverses espèces vivantes ont
donné lieu à une application sous le nom de « génie génétique ».
Le transfert transitoire ou stable d’un DNA étranger dans une cellule proca-
ryote ou eucaryote s’opère grâce à des vecteurs naturels et à de nouveaux vecteurs
issus des constructions: plasmides, bactériophages, virus, cosmides etc. Ces tech-
niques doivent permettre une meilleure compréhension génétique et fonctionnelle
des organismes vivants.
Le génie génétique permet :
• d’identifier et d’isoler,
• de modifier et de transférer,
• de cloner et d’amplifier,
• de contrôler l’expression d’un gène ou d’un transgène dans
le matériel biologique.
Il s’agit donc d’un outil, aux applications très variées qui permet d’intervenir
avec une grande précision sur le patrimoine génétique de tous les organisme vi-
vants.
Cette technique permet d’identifier un gène spécifique parmi les 30.000 gè-
nes environ que compte l’être humain, de l’amplifier afin qu’il soit plus facile d’accès,
de le découper et de l’isoler ensuite des autres molécules d’ADN. Le gène isolé
peut, à la fin, être réinséré dans une molécule d’ADN d’origine différente, ce qui
permet de transférer de l’information génétique d’une cellule vers une autre dans
laquelle il pourra diriger la production d’une protéine particulière, dont il code et dé-
termine la structure (Projet Séquençage génome humain février 2001).
Le résultat obtenu au cours de cette manipulation est la protéine originelle du
premier organisme. Cependant, le génie génétique permet également d’apporter des
modifications à des gènes par une mutagenèse dirigée qui par conséquent produi-
ront des protéines modifiées ou recombinantes.
Les applications directes de la biologie moléculaire:
• En biotechnologie: le génie génétique permet de faire produire par des
micro-organismes recombinants des protéines eucaryotes comme des hormones,
des vaccins, des anticorps monoclonaux et il offre des perspectives nouvelles dans
6
l’industrie agroalimentaire, dans l’amélioration génétique des espèces animales et
végétales.
• En médecine: le but du génie génétique est la prédiction, le diagnostic des
maladies héréditaires et leur soin à travers la thérapie génique et la pharmacogéné-
tique. La thérapie génique somatique qui est différente de la thérapie génique ger-
minale, consiste à transférer certains gènes dans les cellules du patient pour
prévenir l’apparition d’une maladie ou en ralentir l’évolution. Ce type de
génothérapie suscite de très grands espoirs.
• Protection sociale et législation: La médecine «légale» à travers la tech-
nique de l'ADN «finger printing» peut individualiser une personne humaine sans
équivoque car cette technique ne requiert que quelques cellules de la personne
concernée (cellules sanguines, cellules épithéliales, cellules osseuses ou simple-
ment quelques boucles de cheveux).
• Perspective pour demain: avec le projet du génome humain et la techni-
que du clonage positionnel, les génies généticiens cherchent à localiser et à sé-
quencer non seulement les gènes responsables des maladies héréditaires mais
aussi la totalité du génome humain pour créer la cartographie génique de l’homme,
des micro chips. Aujourd’hui, le génome humain a été entièrement séquencé ; mais
une nouvelle problématique se pose: comment déterminer les interactions existan-
tes entre les 20.000 à 30.000 gènes de l’organisme humain ?
Le génie génétique possède, sans doute, aujourd’hui un champ d’application
très large et nous ouvre des perspectives nouvelles. Il s'agit incontestablement
d’une technologie clé pour ce troisième millénaire. Cependant, comme toute techni-
que, le génie génétique a ses limites. Ainsi, dans un organisme vivant, la production
d’une protéine de nature et de fonction données peut nécessiter des informations
présentes à plusieurs endroits de l’ADN. Ces informations plus complexes et plus
complètes peuvent amener un gène à produire de façon différente une même pro-
téine selon l’état physiologique de la cellule, de son stade de développement ou de
différenciation. Plusieurs gènes doivent donc s’associer dans ce processus, afin de
fournir à l’organisme les quantités et les qualités précises de cette protéine en fonc-
tion de son rôle biologique.
Si la technologie génétique sait parfaitement identifier, isoler et modifier un
gène particulier, elle a beaucoup plus de difficultés à l’heure actuelle pour détermi-
ner les liens existant entre les différents gènes. Leur transfert et leur expression,
parfois ectopique, posent encore des problèmes qui restreignent, pour l’instant, le
champ d’application du génie génétique.
7
PREMIÈRE PARTIE :
LES OUTILS
DE LA BIOLOGIE
MOLECULAIRE
8
CHAPITRE I :
TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE
ET DE QUANTIFICATION DES ACIDES NUCLEIQUES,
I. EXTRACTION, PRÉCIPITATION DE L’ADN DES EUCARYOTES
ET DES PROCARYOTES
Toutes les méthodes biochimiques qui permettent d’extraire l’ADN dans les
différents tissus peuvent être utilisées en fonction des espèces, et en tenant compte
de la structure anatomique des cellules. Nous prendrons comme exemple, les cellu-
les eucaryotes humaines, en l’occurrence les cellules sanguines qui sont très ac-
cessibles compte tenu de la moralité et du bénéfice du doute.
Pour ce qui concerne le génome humain comme pour tous les mammifères,
les leucocytes sanguins constituent une source simple de DNA pour les études de
biologie moléculaire.
Un prélèvement de 5 à 10 ml de sang recueilli sur un anticoagulant comme
l'EDTA, permet d’obtenir quelques centaines de microgrammes de DNA sous la
forme de fragments de taille supérieure à 20 kbases. Cette quantité est suffisante
pour entreprendre une expérience d’application en génie génétique.
1. La lyse des cellules eucaryotes.
La lyse des cellules sanguines met en jeu l’intervention de détergents ioni-
ques qui désorganisent la double couche de phospholipides des membranes cellu-
laires.
Le sang fraîchement recueilli (avec un anticoagulant comme l’EDTA) ou dé-
congelé est vigoureusement mélangé à une solution hypotonique pour faire éclater
les hématies dépourvues de noyaux. Les leucocytes sont alors récupérés par centri-
fugation suivie d’un lavage avec la même solution hypotonique.
Ils sont ensuite traités par un mélange de détergent, comme le SDS (Sodium
DodécylSulfate) qui permet de désagréger les membranes cellulaires et de libérer
les contenus cytoplasmiques et nucléaires. En biochimie classique et pour d’autres
applications, il faut d’abord séparer les noyaux du contenu cytoplasmique et de ces
organites cellulaires. Un traitement par la protéinase K (une protéase) permet de
libérer le DNA nucléaire en digérant les histones qui lui sont associées dans les
chromosomes eucaryotes.
L'élimination des protéines non digérées et des lipides se réalise par des pré-
cipitions et des extractions sélectives. Le mélange phénol-chloroforme permet de
dénaturer les protéines car non miscible à l’eau et de densité supérieure à cette der-
nière. Les acides nucléiques n'y sont pas non plus solubles et restent dans le sur-
nageant aqueux.
9
Pour les tissus, il est conseiller de les désagréger par les techniques couran-
tes de biochimie comme le broyage ou les ultrasons. Une congélation préalable
permet de transformer les tissus en une masse solide qui se prête alors à un
concassage par les techniques courantes de broyage. L’extraction et la purification
suivent alors le même protocole.
2. L’ADN des procaryotes
Le schéma de la figure I.2 résume les différents étapes de l’extraction et de la
purification de l’ADN d’Escherischia coli, la bactérie la plus utilisée pour les analyses
en biologie moléculaire. La lyse cellulaire utilise ici une enzyme : le lysozyme qui
permet de dégrader la membrane cellulaire. La purification suit le même schéma que
pour celle de l’ADN des eucaryotes.
3. L’extraction de l’ADN par le mélange phénol / chloroforme.
Le mélange phénol-chloroforme non miscible à l’eau permet de transférer les
protéines dans la phase organique alors que les acides nucléiques restent dans la
phase aqueuse. La phase aqueuse résultante peut subir plusieurs extractions par un
mélange chloroforme-éther pour éliminer les peptides restants, les traces de phénol
et des composés organiques qui y sont solubles. Les acides nucléiques sont alors à
récupérer de la phase aqueuse par des précipitations à l’alcool éthylique ou à
l’isopropanol en fonction des besoins. On obtient alors les acides nucléiques sous la
forme de fibres solides que l’on récupère par centrifugation.
Pour des études biochimiques fines de structure, il convient de procéder à
d’autres purifications. Pour les analyses génétiques (application des diagnostics de
routine), le DNA obtenu est de qualité suffisante et peut être quantifié par simple
pesée.
L'élimination de l'ARN peut être effectuée à la fin ou avant l'étape phénoli-
que. Pour cela, on utilise une RNAase pure ou "DNAase free", c'est à dire, dépour-
vue d'activité DNAase.
L’ADN récupéré sous forme de fibres peut être conservé sous la forme solide
pendant des temps très longs. Il peut aussi être re-dissout dans un tampon stérile de
force ionique moyenne contenant de l'EDTA et dont le pH est compris entre 7 et 8
Figure I.1 : Méthode classique de l’extraction et de la purification de l’ADN
Figure I.2/I.3 : Organigrammes de l’extraction et de la purification de l‘ADN des pro-
caryotes
10
4. Extraction des ARN
Les ARN sont plus difficiles à étudier parce qu’ils sont très sensibles aux ri-
bonucléases (RNase A) qui sont très actives et présentes même sur les doigts du
manipulateur. Elles peuvent résister à un traitement à 90°C pendant une heure. Il
faut donc des conditions de stérilité parfaite pour travailler avec ces acides
nucléiques. Pour l’extraction, les tissus ou les cellules sont homogénéisés dans un tam-
pon acétate contenant :
- Un détergent puissant (SDS ou sarcosyl)
- Un agent dissociant (thiocyanate ou guanidine)
- Un agent réducteur (DTT ou 2-mercaptoéthanol)
Ce type de tampon permet d’inhiber les RNases endogènes, de dénaturer les
acides nucléiques et de dissocier les protéines. Après une centrifugation pour élimi-
ner les débris cellulaires, les RNA sont extraits suivant plusieurs techniques. La
technique par précipitation différentielle du RNA et du DNA en fonction du pH et de
la concentration en éthanol donne de très bons rendements. On peut également uti-
liser l’ultracentrifugation. Le culot est récupéré, lavé avec le tampon acétate et pré-
cipité à l’éthanol. Il peut se conserver congelé à –70°C pendant un an.
II. CONTRÔLE DE LA PURETÉ DE L'ADN EXTRAIT
Le maximum d'absorption des acides nucléiques se situe à 260 nm. Les pro-
téines, principaux contaminant des préparations absorbent aussi à 260 nm, mais
avec maximum d'absorption qui se situe vers 280 nm à cause des acides aminés
aromatiques. Le rapport R= A
260nm
/ A
280nm
constitue alors un bon moyen pour appré-
cier une éventuelle contamination de la préparation d'ADN par les protéines ou par
les RNA.
Une contamination par les ARN se traduit par une augmentation du rapport R.
Les ARN étant en simple brin, le coefficient moyen d’absorption d’un nucléotide est
supérieur à celui du même nucléotide dans la double hélice à cause de
l’hypochromisme.
*R = A
260nm
/A
280nm
* ADN pur: 1,8 < R < 2
* ADN contaminé par les protéines: R < 1,7
* ADN contaminé par les ARN: R > 2
Le spectre d'absorption U.V. permet également d’estimer les contaminations
éventuelles et permet aussi de quantifier l’ADN de la préparation. L’apparition
d’épaulements donne une idée des différents contaminant.
-Un épaulement à 280 nm indique une contamination protéique.
-Un épaulement à 270 nm indique une contamination par phénol.
11
-Un épaulement à 230 nm indique une contamination par les glucides.
-En absence d'impuretés l'absorbance de la solution d’ADN à 320 nm doit
être autour de zéro.
Figure I.4 : Spectre d’absorption de l’ADN
III: QUANTIFICATION DE L'ADN
a. - Dosage colorimétrique de l'ADN
Il est basé sur la réaction spécifique des 2-désoxypentoses avec la diphény-
lamine. En milieu acide à chaud, le 2-désoxyribose des nucléotides puriques peut
être libérés et former un composé bleu dont le maximum d'absorption se situe à 595
nm. C’est la méthode classique pour mesurer des quantités importantes de DNA (de
l’ordre de quelques milligrammes).
b: Dosage par absorption U.V. de la concentration en ADN
A 260 avec un trajet optique de 1 cm, une unité d'absorbance correspond à
une concentration d’ADN double brin de 50 µg / ml. La concentration de l’ADN d’une
préparation peut être alors calculée par la relation :
A= ε.C.l =
Une unité d’absorbance correspond à 25 µg/ml de RNA ou d’ADN simple brin.
Malheureusement, cette méthode est peu sensible pour manipuler des concentra-
tions d'ADN inférieures à 250 ηg/ml
c. Dosage de l'ADN par fluorescence en présence de BET
Le Bromure d'Ethidium (BET) interagit avec l'ADN en s’y intercalant et une
fois intercalé, le rendement de fluorescence du colorant devient cent fois plus impor-
tant. Le principe de la quantification consiste à comparer à l’oil nu (estimation), ou
mieux après photographie, l'intensité de la fluorescence émise par l'ADN sur un gel
d’électrophorèse. La quantification exacte consiste alors à établir une courbe
d’étalonnage donnant l’intensité de fluorescence d’une solution de BET à laquelle on
ajoute des quantités croissantes de DNA de concentration connue. (Gamme d'éta-
lonnage). Par cette méthode on peut déceler des quantités de DNA de l’ordre de 50
ηg/ml.
d. Dosage fluorimétrique classique de l'ADN.
On utilise un spectrofluorimètre pour mesurer l'intensité de la fluorescence
d'une solution d'ADN en présence d'un excès de BET. On compare ensuite les va-
leurs de ces intensités avec celle d'une solution d'ADN standard (courbe standard).
Le BET peut être remplacé par un autre colorant pour augmenter la sensibilité de la
mesure. Cette méthode permet de mesurer des quantités d’ADN de l’ordre de quel-
ques picogrammes.
12
CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES,
YAC, BAC, VIRUS
I - LES VECTEURS EN GÉNIE GÉNÉTIQUE : L'ADN PLASMIDIQUE
1. Les plasmides.
a : Définition :
Les plasmides sont de petites molécules d'ADN bicaténaires, circulaires,
extra-chromosomiques, susceptibles de se répliquer de façon autonome (réplicons).
Ils sont présents dans le cytoplasme de nombreuses espèces bactériennes. Leur
ADN comprend au minimum les gènes intervenant dans la réplication et la ségréga-
tion de leur matériel génétique dans les cellules filles à chaque cycle de division cel-
lulaire de la cellule hôte Figure II.1.
La plupart des plasmides naturels contiennent des gènes qui confèrent à
l'hôte des propriétés supplémentaires comme la résistance aux antibiotiques. Une
bactérie peut posséder en même temps plusieurs plasmides différents sauf si leur
co-habitation est incompatible avec la survie de la bactérie.
Une bactérie peut posséder un très grand nombre de copies plasmidiques. el-
les sont transférables d’une bactérie à une autre au cours de la conjugaison bacté-
rienne. Leurs utilisations majeures comme vecteurs en génie génétique sont :
> Le clonage et l'amplification d'une séquence d'ADN exogène.
> L'étude des mécanismes de l'expression d'une séquence d'ADN exogène.
> L'introduction des gènes dans les cellules bactériennes (transformation) ou
animales (transfections) ou dans des organismes entiers (animaux transgéniques).
> A l'échelle industrielle, la production des protéines codées par les gènes
contenus dans l’ADN inséré.
b : Caractéristiques des plasmides utilisés en génie génétique
La cellule hôte la plus utilisée est Escherichia coli. Les plasmides naturels dits
de première génération ont été utilisés dans le passé comme vecteur de clonage,
mais les plasmides utilisés actuellement sont modifiés et sont donc des chimères
obtenues par des recombinaisons de différents plasmides naturels et de DNA viral.
Ils sont petits de taille pour permettre l'insertion d'une importante quantité d'ADN
exogène tout en maintenant une bonne efficacité de transformation. Ils possèdent :
> Une origine de réplication de type relâché : la séquence ori. Le nombre de
copies par cellule est très important (plusieurs centaines par cellule)
> Un gène de résistance à un antibiotique auquel la souche hôte est sensi-
ble, ce qui permet la sélection des cellules résistantes qui survivent sur un milieu
contenant l’antibiotique en question.
> Un second gène marqueur phénotypique (soit un deuxième gène de résis-
tance à un second antibiotique ou le gène Lac Z' ) qui permet de reconnaître parmi
les colonies transformées celles qui hébergent un plasmide recombinant.
> Un ou plusieurs sites de restriction (polylinker) qui permettent la linéarisa-
tion du plasmide préalable à l'insertion de l'ADN exogène.
13
c : Deux vecteurs plasmidiques : pBR 322 et pUC18
Le plasmide pBR322 est très simple dans sa structure. Il contient 2 gènes de
résistance aux antibiotiques, tet
R
et amp
R
. Chacun de ces gènes contient un site de
restriction qui est utilisé pour le clonage. L'ADN du donneur peut être, par exemple,
inséré dans le gène tet
R
. Une insertion réussie se traduira par l'inactivation de ce
gène qui ne sera plus capable de conférer la résistance à la tétracycline à la cellule
hôte. C'est pourquoi le protocole de clonage consistera à mélanger l’ADN du plas-
mide et l’ADN du donneur digérés par une même enzyme de restriction suivi d’une
ligaturation.
Cette préparation est alors utilisée pour transformer les bactéries et sélec-
tionner les colonies résistantes à l'ampicilline. Ces dernières doivent avoir été
transformés avec succès par une molécule de plasmide recombinante.
Parmi les colonies Amp
R
, seules celles qui s'avèrent sensibles à la tétracy-
cline contiennent une insertion, en d'autres termes, seules les colonies amp
R
tet
S
contiennent de l'ADN recombinant (ADN du plasmide et ADN inséré). L’insertion de
l’ADN étranger dans pBR322 est détectée par l’inactivation du gène de résistance
(tet
R
), indiqué par le phénotype tet
S
(sensible).
Figure II.2 : Le plasmide pBR322
d : Les plasmides pUC
Les plasmides de la famille pUC sont des vecteurs plus élaborés dont la
structure permet la sélection visuelle directe des colonies contenant l’ADN inséré.
L'élément clé est une petite portion du gène de la β-galactosidase d’Escherichia coli.
Un segment d'ADN synthétique appelé adaptateur (en anglais, polylinker ou clo-
ning site) contient de nombreux sites de restriction utiles pour l'insertion des frag-
ments de l'ADN du donneur. L'adaptateur est en phase avec la séquence codant la
β-galactosidase mais n'interfère pas avec son fonctionnement.
Figure II.3 : plasmides pUC
L’origine de réplication ori des plasmides pUC diffère légèrement par muta-
tions de celle de pBR322, ce qui explique le très grand nombre de copies des plas-
mides pUC dans une cellule bactérienne et par suite des vecteurs de troisième gé-
nération qui en dérivent.
L'insertion d’un vecteur dans pUC est détecté par l'inactivation de la fonction
galactosidase du gène Z', qui se traduit par l'incapacité de la cellule hôte à convertir
le substrat artificiel X-Galactoside en un colorant bleu (X= paranitrophénol).
X-Galactoside → X (colorant bleu) + Galactose
En résumé, les plasmides sont des fragments d'ADN extra-chromosomiques
circulaire présents dans les bactéries et susceptibles de se répliquer de façon auto-
nome. Ils peuvent porter des gènes de résistances aux antibiotiques. Expérimenta-
lement ils sont utilisés comme vecteur pour transporter de l’ADN exogène.
14
Vecteurs Taille en
bp
Nombres de
copies par cel-
lule
Marqueur phénoty-
pique
Quelques sites
uniques
de restriction
pBR322 4363 15 à 20 Tétracycline
Ampicilline
EcoR I, Hind III, Pvu
II,
Nde I, Afl III
pPUC18 686 ≈ 500 Ampicilline Lac Z' 13 sites de restric-
tion
sur un polylinker
Tableau I. 1 : Quelques caractéristiques des deux plasmides utilisés en génie
génétique.
Les plasmides de première génération: ce sont les plasmides rencontrés dans
la nature. Il s'agit des plasmides ColE1, RSF2124, pSC101. Ces types de plasmides
n'ont pas les propriétés requises pour les manipulations génétiques.
Les plasmides de seconde génération: ce sont les plasmides de la famille
pBR. (pBR312 à 328) obtenus par construction. Le plus utilisé est le plasmide
pBR322, constitué de 4 363 paires de bases. Il possède deux gènes de résistance
aux antibiotiques : l’un pour la tétracycline Tc
R
et l’autre pour l’ampicilline Amp
R
et
20 sites uniques pour les enzymes de restriction. Parmi les sites uniques, 11 sont
localisés dans les gènes de résistance aux antibiotiques.
EcoR V, BamH 1, Sph 1, Sal 1, Xma 1 et Nru 1 dans le gène Tc
R
Cla 1 et Hinh III dans le promoteur du gène Tc
R
Pst 1, Pvu 1, et Sca 1 dans le gène Amp
R
L'insertion d'ADN étranger dans un quelconque de ces sites se traduit par la
perte de la résistance à l'antibiotique.
Les plasmides de 3
ème
génération : Ces plasmides ont été construits pour facili-
ter le travail de sous clonage et pour une sélection des clones recombinants.
> la famille pUC: Ce plasmide de 2 600 paires de bases environ dont
pUC18 possèdent : un promoteur et un opérateur efficace de transcription, le gène
de résistance à l’ampicilline Amp
R
et une partie du gène lacZ. Un polylinker est insé-
ré dans le gène lacZ. La présence de ce polylinker n’interfère pas avec le fonction-
nement du gène de la 8-galatosidase. Le gène LacZ permet la sélection des recom-
binants par la couleur des colonies. Il faut donc pour cela utiliser les bactéries lac
-
.
Les différents plasmides de cette famille diffèrent les uns des autres par la taille de
leur polylinker. Leur petite taille permet l’insertion d’un ADN assez grand et une
croissance rapide des plasmides.
15
> La famille pSP . Ils sont plus petits que pBR322 (entre 2900 et 3000 bp).
Ces plasmides possèdent : un polylinker, le gène de résistance Amp
R
et le promo-
teur de la RNA polymérase du phage SP6 qui provient de Salmonella. typhimurium
immédiatement adjacent au polylinker. Ces types de plasmides offrent un avantage,
car ils permettent de transcrire en ARN la séquence d’ADN qui a été insérée dans le
polylinker.
> Les plasmides Gemini (1 à 4) dérivent des précédents. Ils possèdent en
plus sur le brin complémentaire, de l’autre côté du polylinker, un promoteur de la
RNA polymérase du phage T7. L’avantage de ces plasmides est de pouvoir trans-
crire l’ADN inséré en une grande quantité d’ARN sur les deux brins pour servir de
ribosondes ou pour la traduction en protéines.
> Les plasmides Blue-Script
®
. Ce sont les plasmides les plus complexes
car ils combinent tous les avantages des vecteurs précédents. Le plasmide Blue-
Script
®
est un petit plasmide de 2961 paires de bases à haut nombre de copies, plus
de 500 exemplaires par cellule. Il possède, outre le gène de résistance à
l’ampicilline, le gène lacZ’ (codant pour le peptide q de la 8-galactosidase et conte-
nant les séquences régulatrices de l’opéron lactose) qui permet la sélection des co-
lonies. De plus, l’ADN inséré est sous la dépendance du promoteur du gène lacZ’.
Chaque fois que ce gène est exprimé, l’ADN inséré est aussi exprimé d’ou la pro-
duction de la protéine correspondante. La haute efficacité de transformation, due à
sa petite taille, constitue un intérêt avantageux pour ce vecteur en biotechnologie.
Figure I.6 : Le plasmide pUC18.
Figure II.4 : Le plasmide Blue-Script II ;
2. Extraction et purification de l’ADN plasmidique
Il existe de nombreuses méthodes d'extraction et de purification des plasmi-
des . Toutes comportent cependant trois (3) étapes principales :
1-Croissance des bactéries hôtes avec éventuellement amplification du
plasmide en ajoutant par exemple du chloramphénicol qui bloque la croissance bac-
térienne sans affecter la réplication de l’ADN plasmidique.
2-Lyse des bactéries pour libérer le plasmide : La lyse des cellules est réali-
sée dans les conditions permettant d'obtenir l'ADN plasmidique purifié dans une so-
lution ne contenant que très peu d'ADN chromosomique et de protéines: Le traite-
ment des bactéries par le lysozyme suivi d’un traitement avec un détergent (Triton
100 ou SDS) ou d’un traitement basique fait passer les RNA et les plasmides en so-
lution tandis que l’ADN bactérien reste emprisonné dans les fantômes bactériens .
Cette solution est appelée lysat clair.
3-purification du plasmide à partir du lysat. Les principales techniques de
purification sont :
> Le lysat clair est soumis à une ultracentrifugation dans du chlorure de cé-
sium (CsCl ) en présence de bromure d’éthidium (BET) saturant.
16
> La précipitation différentielle de l'ADN plasmidique par le polyéthylène gly-
col (PEG ) permet aussi d'éliminer les petits fragments d'ADN et d'ARN non précipi-
tés et d’obtenir des plasmides de pureté appréciable.
> La chromatographie d'échange d'ions, dans les conditions appropriées de
force ionique et de pH, permet également à l'ADN plasmidique d’être absorbé sélec-
tivement.
II- L'ADN PHAGIQUE
Les bactériophages ou phages sont des particules virales qui infectent les
bactéries. Leur multiplication est rapide et le nombre de copies par cellule bacté-
rienne est très important. Figure II. 5.
Lorsque l’ADN du phage pénètre dans une bactérie, deux types de réponses
peuvent se produire :
Une réponse lytique : Dans ce cas, l’ADN du phage intégré dans le
chromosome bactérien prend immédiatement en charge le système de transcription
et de traduction de la cellule hôte qui commence la synthèse des constituants pro-
téiques du phage. Ces différents constituants s’assemblent et forment de nouvelles
particules phagiques dès que commence la réplication de l’ADN phagique. La bacté-
rie éclate et les nouvelles particules virales infestent les bactéries voisines. Il se
forme alors une plage de lyse sur une boite de Pétri. Figure II. 6
Réponse lysogénique : L’ADN du phage est intégré dans le chromosome
bactérien. Il reste à l’état de repos, c’est à dire qu’il se réplique en même temps que
le chromosome bactérien mais reste intégré à ce chromosome. Il ne se produit pas
de nouveaux virions. Le métabolisme et la viabilité des bactéries ne sont pas modi-
fiés tant que la bactérie reste dans cet état. Les bactéries à prophage intégré sont
appelées des bactéries lysogènes. La lysogénie peut être supprimée par des
agents inducteurs de la virulence des phages (rayons X, agents mutagènes…)
Deux types de phages qui infectent Escherichia coli sont d'usage fréquent en
génie génétique: le phage λ et le phage M13.
1- Le phage Lambda λ
Le phage λ est un bactériophage de 1
ère
génération. Il est constitué d'un ADN
double brin linéaire de 48.502 paires de bases. Les extrémités appelés COS sont
constituées par de l'ADN sous forme simple brin sur une longueur de 12 bases. Le
bactériophage λ est un vecteur de clonage efficace pour plusieurs raisons:
> Les extrémités cohésives permettent au phage de se concaténer et de se
circulariser. La circularisation est observée dans la bactérie immédiatement après
l’infection.
> La tête du phage λ peut encapsider spécifiquement un ADN chromosomi-
que d’environ 5 kb. Cette propriété permet de sélectionner les particules du phage λ
naturel des phages λ contenant des ADN étrangers. Figure II. 7
> La région centrale du génome du phage λ n'est pas nécessaire pour la ré-
plication ou l'encapsidation des molécules d’ADN de λ dans Escherichia coli et peut
donc être excisée par des enzymes de restriction et écartée.
17
> Les "deux bras" restants sont ensuite ligaturés avec l'ADN du donneur di-
géré par les mêmes enzymes de restriction.
> Les molécules d’ADN ainsi obtenues peuvent être introduites dans E. coli
par la transformation ou être encapsidées in vitro dans les têtes d’un bactériophage.
Figure II. 8
Le génome du phage λ :
Les gènes AWBCNu3DEF
I
F
II
codent pour les protéines de la tête
Les gènes ZUVGTHMLKIJ codent pour les protéines de la queue
Les gènes att int xis q 8 v permettent la recombinaison
Les gènes cIII N cl cro cII assurent la régulation
Les gènes O P assurent la réplication
Le gèneQ est également un gène de régulation
Les gènes R S permettent la lyse bactérienne
La partie centrale peut être délétée pour insérer un ADN exogène
2: Dérivés du phage λ utilisés comme vecteur de clonage
Le bactériophage λ sauvage ne peut pas être toujours utilisé pour le clonage
car son ADN comporte des sites multiples pour beaucoup d'endonucléases de res-
triction utilisées dans les différents processus de clonage. De plus, ces sites sont
souvent localisés dans les régions du génome indispensables pour le cycle lytique
du phage.
La longueur de l'ADN pouvant être encapsidé ne peut dépasser 5 kb, si bien
que la taille de l'ADN étranger qui pourrait être inséré est très limitée.
A partir des phages sauvages, on a construit des phages qui n'ont qu'un
(pour vecteur d’insertion) ou deux (pour vecteurs de substitution) sites de restric-
tions situées dans les parties non essentielles du génome de phage λ.
Le phage λgt 11 est utilisé dans la stratégie de l’insertion pour cloner les
cDNA dont la longueur varie de 6 à 8 kb. Il sert de vecteur d’expression car la sé-
quence insérée pourra être exprimée dans la bactérie sous forme de protéine, per-
mettant la recherche du recombinant désiré à l’aide d’un anticorps dirigé contre la
protéine synthétisée.
Le phage λ ZAP II est une forme améliorée du précédent qui permet de vi-
sualiser l’expression du DNA inséré. La sélection des recombinants se fait en analy-
sant la coloration bleue ou blanche, lorsque la culture est réalisée sur un milieu
contenant le substrat X-gal et l’IPTG.
3. : Les phages EMBL 3 et 4
18
Ces deux phages sont très proches du phage λ classique. Ils en diffèrent par
la présence d’un polylinker aux deux extrémités de la zone de DNA qui sera délété
pour être remplacé par le DNA à cloner. Les deux phages ne diffèrent que par
l’orientation du polylinker. On peut y introduire des fragments de 15 à 20 kb. Ils
constituent des phages de choix pour la constitution des banques génomiques.
4. : Les phages GEM
R
11 et 12
Ces deux phages sont destinés à la réalisation de banques génomiques et
sont des versions améliorées des phages EMBL. La taille de l’ADN à insérer varie
de 9 à 23 kb. Ils en diffèrent par deux types d’améliorations :
- Modification du polylinker. Le polylinker de ces phages comporte un plus
grand nombre de sites de coupures uniques pour deux enzymes de restriction : Sfi
dans la version 11, Not dans version 12 car les sites de coupure de ces enzymes
sont très rare. L’addition d’un site Xho I simplifie la réalisation des banques génomi-
ques.
- Addition de promoteurs pour des RNA polymérases spécifiques : Un
promoteur de la T7 RNA polymérase est ajouté à l’extrémité du bras gauche avant le
polylinker et le promoteur de la T3 RNA polymérase à l’extrémité droit. Ces deux
promoteurs permettent de synthétiser des ribosondes correspondant spécifiquement
à chacun des brins de l’ADN cloné. Les ribosondes sont utilisées pour cribler de
nouveau la banque et ainsi isoler les segments adjacents au DNA cloné. Ainsi, il est
certain de marcher sur le chromosome sans se tromper d’avancer dans le bon sens.
5. : Le phage M13 et ses dérivés
Figure II.9
Le bactériophage M13 qui infecte Escherichia coli (seules les bactéries mâles
peuvent être infectées) est un phage filamenteux dont la particularité et l'intérêt rési-
dent dans son matériel génétique. Le matériel génétique de ce phage est constitué
d’une molécule d'ADN circulaire monocaténaire de 6407 paires de bases notée brin
(+).
La multiplication intracellulaire du phage fait intervenir une forme réplicative
(RF) constituée par l'association du brin génomique (+) et d’un brin complémentaire
nouvellement synthétisé noté brin (-). Ce dernier devient la matrice pour la synthèse
de nouveaux brins (+) qui seront encapsidés et relâchés dans le milieu.
L'ADN phagique (+) peut être extrait à partir des virions de manière analogue à
l'ADN du phage λ.. La forme réplicative (RF) bicaténaire peut aussi être extraite de
la cellule de la même manière que l’ADN d’un plasmide.
Le phage M13 a été modifié de manière a pouvoir introduire un ADN étranger
dans la forme réplicative au niveau d'un site unique de restriction. La forme réplica-
tive recombinée peut ensuite être introduite dans une cellule hôte par transformation
comme un plasmide de manière a disposer sur le brin (+) d'une séquence connue au
voisinage de l'insertion. Sur cette séquence connue, on peut hybrider un oligonu-
cléotide de synthèse qui servira alors d'amorce pour la DNA polymérase. Les modi-
fications pour en faire un vecteur sont :
19
- L’addition d’un polylinker pour faciliter l’insertion des séquences de DNA
- L’addition d’un gène lacZ pour permettre la sélection des recombinants (sys-
tème des bactéries bleues et blanches en présence d’IPTG et de X-gal).
La possibilité de disposer d'une insertion dans un ADN monocaténaire circu-
laire fait des dérivés du phage M13 des vecteurs très utilisés en génie génétique
pour :
• La création de mutations ponctuelles
• La synthèse de sondes nucléiques.
• Le séquençage de l'ADN par la méthode de Sanger
• Dans certaines techniques de mutagenèse dirigée in vitro, on utilise alors
comme amorce (primer) un oligonucléotide complémentaire de l'insert mais possé-
dant la modification de séquence souhaitée.
6. : Infection
Avec l'ADN recombiné par insertion ou substitution, on forme des particules
virales par encapsidation in vitro en ajoutant les protéines de la capside et de la
queue. Les particules virales ainsi formés permettent une introduction très efficace
de l'ADN recombinant de la cellule hôte E. coli par infection phagique. Les virions se
reproduisent ensuite par le cycle lytique, ce qui permet une bonne amplification de
l'ADN recombinant. L'isolement des clones est obtenu en réalisant l'infection sur un
milieu semi-solide. Chaque particule virale donne alors naissance à un clone sous la
forme d'une plage de lyse sur le tapis bactérien.
III. COSMIDES, YAC ET BAC
1. Les cosmides
Les cosmides sont des vecteurs hybrides constitués d’un plasmide classique auquel
ont été ajoutées les séquences COS du phage λ. Leur ADN peut se répliquer au
niveau de la cellule hôte comme celui d'un plasmide ou être encapsidé comme celui
d'un phage pour faire une infection. Les cosmides peuvent contenir des insertions
d’ADN environ trois fois plus longs que ceux portés par les phages λ (45 kb). Ceci
est dû à ce que la majeure partie de la structure du phage a été déletée tandis que
les séquences signaux responsables de l'encapsidation subsistent (les sites COS).
Figure II.10
2. Les YAC
Le YAC ou chromosome artificiel de levure (Yeast Artificial Chromosome).
Les YAC permettent de cloner de 150 à 1 000 kb de fragments d’ADN. Le génome
de la levure Saccharomyces cerevisiae est constitué de 16 chromosomes de taille
comprise entre 250 et 2 000 kb. Chez la levure, trois régions chromosomiques sont
importantes pour sa réplication. Les séquences télomériques (Tel), centromériques
(CEN), et une séquence ARS (Autonomous Replicating Sequence).
20
On a donc construit des chromosomes artificiels contenant ces régions es-
sentielles et du DNA que l’on désire cloner. La taille du DNA cloné peut donc attein-
dre de 1 000 à 2 000 kb. Les YAC n'exigent que les cellules de levures comme hô-
tes. On peut cependant introduire dans l’ADN cloné des séquence bactérienne pour
la sélection.
Figure II.11
3 . les PAC
PAC : Chromosomes artificiels dérivés du phage P1
(PAC, P1-derived artificial chromosomes)
Mise au point dans les années 1990 un vecteur dérivé du bactériophage P1. Le vec-
teur pCYPAC1 permet de cloner des fragments qui ont une taille de 130 à 150 kb
avec une efficacité qui est intermédiaire entre celle des cosmides et celle des YACs
(1,5x10+5 colonies/µg insert). Figure II.12
4. Les BAC
Figure II.13
Les BAC (Bacterial Artificial Chromosome) ont pour base le facteur sexuel F de 7 kb
de Escherichia coli. Ce facteur peut contenir de grands fragments d'ADN d'E. coli
sous la forme de dérivés F'. De manière similaire, les BAC peuvent incorporer des
inserts d'ADN étranger pouvant atteindre 300 kb. Le plasmide F porte des gènes qui
sont essentiels pour réguler sa propre réplication et pour contrôler aussi le nombre
de copies du plasmide F. Le plasmide F a aussi la capacité de s'intégrer dans le
chromosome bactérien et de s'en exciser. Un plasmide qui a cette capacité est ap-
pelé un épisome.
Les gènes oriS et repE régissent la réplication unidirectionnelle du plasmide tandis
que les gènes parA et parB maintiennent le nombre de copies de celui-ci à 1 à 2
copies par cellule.
Le vecteur pBeloBAC11 porte ces gènes essentiels ainsi qu'un gène de résistance
au chloramphénicol et la portion lacZa du gène b-galactosidase avec 2 sites de
restriction HindIII et BamHI qui permettent le clonage de fragments d'ADN étranger
Le facteur de fertilité F est utilisé lors de la conjugaison bactérienne.
- Les bactéries qui le possèdent dans leur cytoplasme sont dites F(
+
)
- celles qui ne l'ont pas dans leur cytoplasme sont dites F(
-
)
- Celles qui l'ont intégré dans leur chromosome sont dites Hfr
- Celles qui l'ont perdue, après l'avoir intégré dans leur chromosome sont F'.
Conclusion
Les plasmides sont très utilisés pour le génie génétique. Ils acceptent des fragments
de taille moyenne (jusqu'à 10 kb), par exemple des sous-fragments de l'insert d'un
phage ou d'un cosmide recombinant. La taille des fragments d'ADN étranger qui
peuvent être acceptés par le bactériophage lambda (10 à 20 kb), les cosmides (35 à
45 kb), les PAC (130 à 150 kb), les BAC (160 à 200 kb) et les YAC (250 à 1.500 kb)
en font les vecteurs de choix pour construire et amplifier des banques d'ADN géno-
mique. Les BAC et les PAC sont devenus les vecteurs principaux pour le séquen-
çage du génome humain. Les ADNc (voir plus loin) sont clonés dans des plasmides
ou des phages d'insertion.
21
Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE,
CARTE DE RESTRICTION
I. ENZYMES DE RESTRICTION
1. Définition et origine
Les enzymes de restriction sont des endonucléases qui coupent d’une ma-
nière définie et reproductible l’ADN double-brin quelle que soit son origine. Elles ont
permis de caractériser un génome entier en une série de fragments reproductibles.
Les gènes ou fragments de gènes deviennent ainsi des entités physiques isolables
et non plus de l’information noyée dans la masse du contenu génomique. Ces en-
zymes ont été mis en évidence par le phénomène de la lysogénie.
Les cellules bactériennes contiennent beaucoup d'endonucléases spécifiques
capables de reconnaître l'ADN des autres espèces et l’ADN des virus qui les infec-
tent. Ces enzymes constituent un système de défense de la bactérie surtout contre
l'ADN des virus au cours de leur infection. Ces enzymes de restriction reconnaissent
des sites particuliers sur l'ADN et coupent la molécule double brins soit au niveau du
site de reconnaissance soit quelques nucléotides plus loin. La souche d'Escherichia
coli B possède une endonucléase appelée EcoR1 qui reconnaît spécifiquement la
séquence bicaténaire suivante:
CH3
↓ ↓ |
5’G AATT C3’ 5’G *AATT C3’
3’C TTAA G5’ 3’C TTAA* G5’
↑ | ↑
CH3
Coupure Pas de coupure
L'enzyme catalyse l'hydrolyse d'une liaison phosphodiester dans le site re-
connu au niveau des deux flèches. Cependant, la coupure ne peut avoir lieu que si
les adénines (A) figurées en gras ne sont pas méthylées. Le phénomène de restric-
tion résulte de l’existence dans la bactérie de deux types d’activité enzymatique :
Une activité de restriction qui coupe le DNA lorsqu’il est reconnu comme
étranger à la cellule hôte.
Une activité méthylase qui méthyle une base donnée (A ou C) au niveau
du site de restriction du génome de la cellule bactérienne pour empêcher sa propre
dégradation par l’activité restrictive.
Les souches d’Escherichia coli R possèdent en plus de l’enzyme qui coupe la
séquence reconnue par (EcoR1) une autre qui assure la méthylation (EcoR1 méthy-
lase ou MEcoR1) qui reconnaît la même séquence mais méthyle les deux adénines.
Le système de restriction formé par le couple EcoR1 / MEcoR1 permet aux cellules
bactériennes d'hydrolyser un éventuel ADN étranger, phagique en particulier, tout
en conservant l'intégrité de leur propre génome. Les enzymes de restriction consti-
tuent donc un système de défense de la bactérie.
22
Il existe 3 types d'enzymes de restriction qui diffèrent les unes des autres, par
la localisation de leur activité catalytique.
Enzyme de type I: Ayant reconnu la séquence cible, l'enzyme se déplace
sur l'DNA et coupe de manière aléatoire mille à quatre mille bases plus loin (Sys-
tème de boucles d’ADN ?).
Enzyme de type II: L'enzyme coupe l'ADN au niveau de la séquence re-
connue.
Enzyme de type III : L'enzyme reconnaît la séquence cible et coupe la mo-
lécule de DNA 20 à 25 bases plus loin.
Seules les enzymes de type II qui coupent au niveau du site de reconnais-
sance sont utilisés en génie génétique parce qu’on peut contrôler parfaitement le
site de coupure et donc les extrémités engendrées.
En 1990, on avait recensé plus de mille endonucléases isolées à partir de
867 espèces bactériennes différentes.
2. Nomenclature des enzymes de restriction.
En 1973, Smith et Nathan ont proposé une nomenclature qui est définitive-
ment adoptée. Chaque endonucléase a un nom de code déterminé selon les princi-
pes suivants :
• La première lettre en majuscule est l'initiale du genre de la bactérie.
• Les deux lettres suivantes, en minuscule désignent l'espèces de la bacté-
rie.
• La 4ème lettre en majuscule, (pas toujours présente) désigne la souche
bactérienne.
• Un chiffre romain distingue les enzymes d'une même souche dans l'ordre
de leur découverte.
Exemple : EcoR 1:
E = Escherichia
Co = espèce Coli
R = Souche RY13
I = 1
ère
endonucléase isolée
3. Mécanisme d'action des endonucléases de restriction
a: Caractéristique de l'hydrolyse.
Une endonucléase de restriction se lie à une séquence spécifique qu'elle re-
connaît sur l'ADN: c’est le site de restriction. Elle catalyse ensuite un clivage double
brin au niveau des liaisons phosphodiester spécifiques à l'organisation de la sé-
quence de reconnaissance. L'hydrolyse d'une liaison phosphodiester, entre le
groupe 3' OH et le phosphate génère une extrémité 5' phosphate d'un côté de la
coupure et un groupe 3' OH de l'autre. Figure III.1
23
b: Sites de restriction
La plupart des sites de restriction comporte de 4 à 6 paires de bases. Un
nombre assez restreint d’enzymes de restriction reconnaît des séquences plus com-
plexes. Les séquences de restriction présentent toujours une double symétrique par
rapport à un centre ou à un plan de symétrie. De telle séquence sont dites palin-
dromiques. On observe sur les 2 brins la même séquence (5’→3’) mais en sens
inverse.

Exemple : EcoR 1 : 5’G AATTC3’
3’CTTAA G5’

c: Différents types de coupure
Les enzymes de restriction de type II peuvent donner deux types de coupu-
res :
Les coupures à bouts francs (blunt ends ou flush ends). L’enzyme coupe
exactement au même niveau sur les deux brins de la séquence reconnue soit au
niveau de l’axe ou du centre de symétrie.
↓Hae III
5'  GGCC  3' → 5'GG + CC 3'
3'  CCGG  5' → 3'CC + GG 5'

Ces types de coupes sont utilisées lorsqu’on désire faire un tailing (allonge-
ment de l’extrémité 3’OH) ou un marquage pour un séquençage.
les coupures décalées donnent des extrémités cohésives. Les extrémités
débordantes résultent d'une coupure décalée et les extrémités obtenues sont auto
complémentaires entre elles. Elles peuvent donc se réapparier spontanément si les
conditions sont favorables. On parle alors d'extrémités cohésives ou de bouts col-
lants "Sticky ends". Ces enzymes sont très utilisées pour fabriquer des ADN recom-
binants, car les fragments de différents ADN coupés par la même enzyme donnent
les mêmes bouts qui peuvent s'associer par leur extrémités cohésives. L'association
est ensuite rendue covalente par l’action d'une ADN ligase.
Coupure décalée du coté 5’ : Ce type de coupure génère des extrémités 5’P
débordantes ou sortantes. Exemple, les coupures de EcoR 1 :
5’ G/AATTC → 5’ G 3’ + 5’AATTC 3’
3’ CTTAA/G 5’ → 3’ CTTAA 5’ + 3’G 5’
Coupure décalée du coté 3’: Ce type de coupure génère des extrémités 3’OH
débordantes ou sortantes. Exemple : les coupures par Pst I :
24
5’ CTGCA/G 3’ → 5’ CTGCA 3’ + 5’ G 3’
3’ G/ACGTC 5’ → 3’ G + 3’ ACGTC 5’
Les coupures franches ; L’enzyme coupe les deux brins de l’ADN au niveau
du centre ou de l’axe de symétrie. On obtient des extrémités franches (blund ends)
qui n’ont pas un grand intérêt en génie génétique sauf pour réaliser des « taillings à
l’extrémité 3’OH). Exemple : Hae III :
5’ GG/CC 3’ → 5’ GG + 5’CC 3’
3’ CC/GG 5’ → 3’ CC + 3’GG 5’
Le tableau II.1 ci-dessous donne la liste de quelques enzymes de restriction
et leur sites de coupure.
Micro-organisme Sigle de l’enzyme Séquence
Thermus aquaticus TaqI 5’...T/CGA...3’
3’...AGC/T...5’
Haemophilus haemolyticus HhaI 5’...GCG/C...3’
3’...C/GCG...5’
Desulfovibrio desulfuricans DdeI 5’...C/TNAG...3’
3’...GANT/C...5’
Escherichia coli EcoRV
EcoRI
5’...GAT/ATC...3’
3’...CTA/TAG...5’
5’...G/AATTC...3’
3’...CTTAA/G...5’
Providencia stuarti PstI 5’...CTGCA/G...3’
3’...GA/CGTC...5’
Microcoleus MstII 5’...CC/TNAGG...3’
3’...GGANT/CC...5’
Nocardia otitidis-caviarum NotI 5’...GC/GGCCGC...3’
3’...CGCCG/GCG...5’
Tableau II.1 : Quelques enzymes de restriction de type II et leur site de coupure
N = Toute base (purine ou pyrimidine)
e: Isoschizomères et enzymes compatibles:
On appelle isoschizomères 2 enzymes différentes qui reconnaissent le
même site de restriction. Exemple :
Msp I: NNC/CGGNN et Hpa II NNC/CGGNN
NNGGC/CNN NNGGC/CNN
Deux enzymes compatibles ont des sites de restriction différents mais don-
nent naissance aux mêmes extrémités cohésives. C'est le cas de BamH I et Sau3AI
qui donnent les même extrémités cohésives car le site de reconnaissance de
Sau3A1 est contenu dans celui de BamH 1.
BamH I NNNG/GATCCNN et Sau 3A I NNN/GATCNNN
25
NNNCCTAG/G NNNCTAG/NNN
Ainsi, BamH I donne les mêmes extrémités cohésives que Sau3A I avec qui
elle est compatible.
4. Carte et fragments de restriction
L'hydrolyse d'un ADN par une endonucléase de restriction conduit à une série
de fragments dits de restriction dont le nombre est fonction du nombre de sites de
restriction présent sur cet ADN. La longueur des fragments est déterminée par la
distance séparant les séquences de restrictions reconnues par cette endonucléase.
On obtient pour un ADN donné, toujours le même nombre de fragments qui donne
ce que l’on appelle RFLP (pour longueur des fragments de restriction polymorphi-
ques ou Restriction Fragments Lengh Polymorphism en Anglais). Une molécule
d'ADN déterminée, donne toujours les mêmes fragments et cette série de fragment
constitue une empreinte caractéristique de l'ADN hydrolysé. On parle alors de carte
d'identité moléculaire.
Exemple : CARACTERISATION DE L’HAPLOTYPE DREPANOCYTAIRE
Des variations de la séquence nucléotidique, sans conséquence pathologique di-
recte, sont fréquentes.
Elles sont désignées sous le terme de polymorphisme.
Lorsque ces modifications portent sur des sites reconnus très spécifiquement par
certaines endonucleases (enzymes de restriction) elles sont faciles à mettre en évi-
dence par les méthodes de cartographie génique (polymorphisme de taille des frag-
ments de restriction) RFLP. L'association de plusieurs de ces polymorphismes défi-
nit un haplotype. L'un des résultats les plus intéressants des études des polymor-
phismes de l'environnement du gène drépanocytaire a été l'observation d'un désé-
quilibre de liaison : les polymorphismes ne sont pas distribués au hasard mais for-
ment un petit nombre d'haplotypes bien définis. Il a été ainsi observé que la mutation
drépanocytaire a été trouvée associée à 5 haplotypes désignées d'après leur épi-
centre. Figure III.2
Figure III.1 : Les haplotypes
E Gγ Αγ ψβ δ β
Haplotype HbS
Bénin - - - - - + - + - - + + - +
Bantou - - + + - + - - - + + + + +
Sénégal - + + + - + + + + - + + + +
Arabo Ind. + + + + - + + + - + + - + -
Cameroun - - + + + + - + + - + - + -
H inc I I XmnI Hi nd I II TaqI Hi ndI I I PvuI I Hi nc I I Hi nf I Rsa I AvaI I Hi nf I Hpa I BamH I
26
Une carte de restriction est une séquence de sites de restriction séparés par
des distances précises sur l'ADN et mesurée en paire de bases (bp). Diverses tech-
niques permettent d'obtenir de telles cartes. Elles passent toutes par une digestion
de l'ADN à analyser par une enzyme de restriction suivie d’une électrophorèse pour
la séparation des fragments et la détermination de leurs tailles.
L'analyse par double digestion est obtenue quand l'ADN est digérée sépa-
rément par 2 enzymes différentes A et B. On obtient un certain nombre de fragments
pour chaque enzyme. Ces fragments sont ensuite analysés par électrophorèse sur
gel d’agarose. Chaque fragment produit par l’enzyme A est d’abord élué du gel et
digéré ensuite par l’enzyme B et inversement. La confrontation des différents résul-
tats permet de situer les sites de coupure les uns par rapports aux autres sur la sé-
quence nucléotidique.
Figure III.3 Exercice et corrigé: Détermination des sites de coupure de deux enzy-
mes de restriction A et B sur un fragment d’ADN .
- L’enzyme A coupe et donne deux fragments : 2 Kb et 8 Kb
- L’enzyme B coupe et donne deux fragments : 3 Kb et 7 Kb
- Les enzymes A et B coupent et donnent trois fragments 2 Kb, 3Kb et 5 Kb
Déterminez les sites de coupures :
2 Kb A 8 Kb
7 Kb
B
2 Kb 5 Kb 3 Kb
A B
10 Kb dADN
3 Kb
27
II. L’ÉLECTROPHORÈSE SUR GEL
Figure III.4.
Les différents types d'électrophorèse utilisés dans les laboratoires de biologie
moléculaire, permettent de séparer les acides nucléiques en fonction de leur taille:
» L'électrophorèse horizontale sur gel d'agarose permet de séparer les
fragments d'ADN de 300 à 10 000 paires de bases en fonction de la concentration
du gel en agarose
» L'électrophorèse verticale sur gel de polyacrilamide permet de séparer les
fragments d'ADN dont les longueurs vont de 1 à 1 000 nucléotides en fonction de la
longueur du gel et de la tension appliquée (de 1 000 à 2000 volts / cm).
» L’électrophorèse sur gel d'agarose en champ pulsé (PFGE) permet de
séparer des fragments d'ADN double brin dont la taille peut varier de 220 000 à 2
500 000 paires de bases. Cette technique est aussi mise à profit pour la séparation
des chromosomes interphasiques. (PFGE pour Pulsed Field Gel Electrophoresis).
1 - Suivi de la migration .
Les échantillons d'ADN, avant d'être déposés dans les puits, sont mélangés
avec une solution de charge qui contient :
» un alourdisseur (glycérol ou saccharose ) pour entraïner l'ADN au fond du
puits
» des marqueurs de mobilité (colorants visibles : bleu de bromophénol et xy-
lène cyanol)
» Des marqueurs de taille pour l’identification (dans le puits de référence)
» un agent dénaturant comme le SDS ou l’urée pour arrêter les réactions en-
zymatiques suivant la nature du gel.
Les deux marqueurs (colorants) migrent à des vitesses différentes. Le bleu de
bromophénol (violet ) migre avec les fragments de petites tailles (donc plus vite )
alors que le xylène cyanol (bleu turquoise ) migre avec les fragments de grande
taille. On peut ainsi suivre indirectement la migration de l'ADN sur le gel.
2 - Etalonnage d'un gel
On étalonne les gels avec des marqueurs de taille. Un marqueur de taille est
un mélange de fragments d'ADN linéaire bicaténaires dont les tailles sont connues.
il existe deux type de marqueurs de tailles :
» Des marqueurs fabriqués à partir d'une molécule d'ADN naturelle digérée
par des enzymes de restriction,
» Des marqueurs composés d'une série de fragments, chacun constitué d'une
à plusieurs répétition d'un même fragment d'ADN de taille connue. Un exemple est
28
l'échelle d'ADN de 1 Kb de GIBCO BRL. Les différents fragments sont formés
de 1 à 12 répétitions d'un même segment de 1018 bp.
3. Révélation :
Les bandes d'ADN sur un gel de polyacrylamide ou d'agarose ne sont pas vi-
sibles si l'ADN n'est pas marqué ou coloré.
» Une méthode sensible de coloration de l'ADN consiste à plonger le gel
après électrophorèse dans du bromure d'éthidium (BET) qui devient cent fois plus
fluorescent sous illumination ultra-violette lorsqu'il est lié à l'ADN. Le BET est une
produit hautement mutagène, donc il doit être manipulé avec beaucoup de soins.
» Une détection encore plus sensible implique l'incorporation d'un radio iso-
tope dans les molécules d'ADN avant électrophorèse. Le
32
P est actuellement utilisé
puisqu'il peut être incorporé dans les phosphates 5' de l'ADN et émet des particules
8 très énergétiques facilement détectées par autoradiographie.
Figure III.5
III. LES ENZYMES UTILES EN GÉNIE GÉNÉTIQUE:
1. La DNA polymérase I.
Cette enzyme extraite d’Escherichia Coli intervient dans les activités de répa-
ration du chromosome bactérien par le phénomène de nick translation. Elle est uti-
lisée sous sa forme de «fragment de Klenow» qui est dépourvu de l’activité exonu-
cléasique (5’→3’) par suite d’un traitement protéasique pour:
> Déterminer les séquences nucléotidiques d’un ADN par la méthode de
Sanger.
> Pour convertir les bouts cohésifs en bouts francs
> Pour le marquage des DNA
> Pour la construction de sondes ou de vecteurs à partir d’un ADN simple ou
double brin.
2. La T4 DNA polymérase.
L’enzyme est produite par les bactéries E. Coli infestées par le bactériophage
T4. Elle possède les mêmes propriétés que le fragment de Klenow et possède les
mêmes utilisation en biologie moléculaire.
3. La Taq polymérase
C’est une enzyme extraite de la bactérie Thermus aquaticus, espèce bacté-
rienne vivant dans les eaux chaudes et qui présente une grande résistance à la dé-
naturation thermique. Elle peut toujours travailler entre 80 et 94°C, d’où son utilisa-
tion en PCR. Il en est de même des polymérases extraites des archéobactéries
comme des bactéries du genre Thermus comme la polymérase de Bacillus steato-
thermophilus. Ces enzymes ne possèdent pas une activité de correction des épreu-
29
ves (proof reading = activité exonucléasique 3’→5’) et de ce fait introduisent
beaucoup d’erreurs au cours de la réplication.
4. La transcriptase inverse.
La transcriptase inverse est un enzyme produite par les rétros virus qui per-
met de recopier un ARN en un DNA. Elle possède aussi une activité RNAase H qui
permet de dégrader le RNA dans un hybride ADN-ARN. Elle est utilisée chaque fois
qu’il est nécessaire de transformer un ARN en un ADN.
> Pour la construction des banques de cDNA
> Pour détermination des séquences nucléotidiques par la méthode
de Sanger
> Pour la PCR sur les RNA messagers (R-PCR).
5. La terminal transférase
C’est une enzyme couramment extraite du thymus de veau qui permet
l’addition de désoxyribonucléotides, sans besoin d’amorce à l’extrémité 3’OH libre
d’un DNA simple ou double brin. Elle permet donc:
> de rajouter une queue (tailing) à l’extrémité 3’ en vue de créer des extrémi-
tés cohésives pour l’insertion d’un ADN
> de marquer l’extrémité 3’OH pour le séquençage des acides nucléiques
par la méthode de Maxam-Gilbert.
6. La polynucléotide phosphorylase
Cette enzyme d’origine bactérienne (E. coli ou M. luteus) catalyse la polymé-
risation de ribonucléotides diphosphates pour donner un ARN. La séquence de
l’ARN résultant dépend de la concentration relative des différents nucléotides pré-
sents dans la solution.
n XDP → (XMP)n + n Pi
Elle a été utilisée pour déchiffrer le code génétique.
Actuellement, elle permet:
> La synthèse de polyribonucléotides froids ou radio-actfs
> La dégradation de la queue polyrA des mARN eucaryotes à cause
de son activité nucléolytique
> Un marquage intensif des extrémité 3’OH des ribonucléotides
> Le marquage sur le phosphore des ribonucléotides diphosphates
à cause de son activité d’échange de phosphate.
7. La poly A polymérase
30
Enzyme eucaryote, elle catalyse l’addition d’une queue polyrA à l’extrémité
3’OH des ARN messagers eucaryotes. Son substrat est spécifiquement l’ATP. Elle
possède donc les mêmes utilisations que la polynucléotide phosphorylase et la ter-
minal transférase.
8. Les ARN polymérases
Les ARN polymérases de tous les organismes transcrivent l’un des deux brins
de la double hélice de l’ADN en un ARN simple brin. La synthèse s’effectue sans
amorce à partir du promoteur (site de fixation et d’initiation de l’enzyme) et nécessite
toujours les ribonucléotides triphosphates et du Mg
2+
comme cofacteur, dans le sens
5’→3’.
Ce sont les polymérases des procaryotes qui sont le plus souvent utilisées en
biologie moléculaire car elle possèdent des promoteurs très spécifiques qui permet-
tent de conditionner et de révéler l’expression des gènes recombinés dans une cel-
lule transfectée.
Les plus utilisées sont: la polymérase de SP6 extraite de Salmonella typhimu-
rium LT2, la T7 RNA polymérase extraite d’E. coli infesté par le phage T7 et la T3
RNA polymérase extraite aussi de E. coli infesté par le phage T3. Ces polymérases
permettent:
> la synthèse de sondes hautement marqués soit par un nucléotide radioactif
soit par un nucléotide biotinylé (marquage froid);
> la détermination de la séquence d’un ADN cloné dans un vecteur possé-
dant, devant le DNA cloné, l’un quelconque des promoteurs SP6, T7 ou T3;
> les études sur les différents RNA résultant de la transcription d’un DNA
cloné.
Ces polymérases permettent aussi de produire, à partir d’un gène cloné, les
quantités de RNA suffisantes pour les études de structure, de régulations et des in-
teractions RNA-DNA, RNA-protéines.
9. Les Ligases
La DNA ligase d’E. Coli. Les ligases assurent la formation d’une liaison
phosphodiester entre une extrémité 3’OH et une extrémité 5’phosphate de deux nu-
cléotides déjà incorporés dans un acide nucléique. L’enzyme d’E. coli n’agit que si
les deux DNA sont associés par des extrémités cohésives ou dans le cas d’une cas-
sure sur un seul brin. Cette enzyme utilise le NAD
+
comme cofacteur. Elle est donc
utilisée pour la soudure des extrémités cohésives lors de la construction des vec-
teurs.
La T4 ligase. Extraite d’E. coli infestée par le phage T4, elle joue le même
rôle que la ligase de E. coli. Cependant, elle présente un avantage sur cette der-
nière car elle utilise l’ATP au lieu du NAD+ comme source d’énergie, ce qui lui per-
met de relier les extrémités cohésives, mais aussi les extrémités à bouts francs en
présence d’éthylène glycol.
La RNA ligase. Extraite d’E. Coli infesté par le phage T4, elle réalise la liga-
tion entre deux RNA en créant entre eux une liaison phosphodiester entre l’extrémité
3’OH libre et l’extrémité 5’phosphate libre de l’autre molécule. Elle utilise aussi l’ATP
31
qui est hydrolysé et AMP et en pyrophosphate. Elle permet donc soit un marquage
des ARN, soit la construction de liaisons inter ou intra - RNA (RNA mixtes).
10. Les nucléases.
La DNase I Cette enzyme extraite du pancréas est une endonucléase qui
coupe le DNA après un base pyrimidique, libérant une extrémité 3’OH et une extré-
mité 5’phosphate. Elle coupe aussi bien les acides nucléiques en simple ou en dou-
ble brins. Elle est utilisée pour analyser les gènes actifs de la chromatine, éliminer le
DNA d’une préparation protéique ou de RNA, pour la création de cassures (nicks)
pour le marquage de l’ADN par nick translation.
La nucléase S1. L’enzyme dégrade spécifiquement les acides nucléiques en
simple brin. Les DNA bicaténaires et les hybrides DNA-RNA ne sont pas attaquées.
Elle permet :
> Une étude des hybrides DNA-RNA
> L’élimination des extrémités simple brin d’un DNA double brin
> Le suppression des boucles dans la synthèse de cDNA
> La détermination des origines de la transcription
L’exonucléase III. Elle catalyse l’hydrolyse séquentielle des nucléotides d’un
ADN dans le sens 3’ ÷ 5 à partir d’une extrémité 3’OH libre. De plus elle possède
une activité 3’ phosphatase. Elle permet donc d’obtenir des ADN simple brin.
11. Les RNases
La RNase A. Cette enzyme très résistante (se maintient après 1 heure à
90°c) hydrolyse spécifiquement les RNA simple brin après une pyrimidine. Elle est
utilisée pour éliminer le RNA dans une préparation protéique ou de DNA. Elle per-
met également de détecter les mismatches dans les hybrides DNA-RNA.
La RNase H : Elle détruit le RNA dans les hybrides DNA-RNA. Elle permet
donc la détection des hybrides DNA-RNA et la destruction de l’ARN dans un hybride
après une transcription inverse pour la synthèse du second brin de cDNA.
32
CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ.
I - LE CLONAGE
Le clonage des micro-organismes est différent de celle des organismes supé-
rieurs comme les mammifères.
1. Le clonage des animaux supérieurs: les mammifères.
Le principe du clonage n'est pas très compliqué en soit. Dans le cas de Dolly
(la première brebis clonée), on a prélevé une cellule dans le pis d'une brebis de race
Finn Set à face blanche. On a prélevé également un ovule sur une autre brebis. Sur
cet ovule, on a enlevé le noyau qui contient le matériel génétique. Pourquoi un
ovule? Pour qu'il devienne éventuellement un embryon.
À l'aide d'un choc électrique, on a fusionné in vitro la cellule du pis qui
contient tous ses gènes et l'ovule vidé de tout son matériel héréditaire. C'est la rai-
son pour laquelle Dolly n'a eu pour tout bagage génétique que celui que contenait la
cellule du pis. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche.
Après s'être divisé un nombre suffisant de fois, l’embryon au stade blastocyte a été
placé dans l'utérus d'une brebis porteuse. Dolly est née de cette technique, identi-
que en tous points à la brebis qui a fourni la cellule du pis.
2. Clonage de l’ADN dans les micro-organismes:
Le but du clonage est d’obtenir un grand nombre de copies absolument pures
d’une séquence donnée d’ADN. Stricto sensu, le clonage est la sélection d’un clone
parmi un ensemble de clones bactériens recombinants qui porte le nom de banque
(library). Il existe 2 types de banques d’ADN : les banques génomiques et les ban-
ques d’ADNc.
33
II - LES BANQUES GÉNOMIQUES
1 - La fragmentation de l’ADN tout entier d’une cellule et son introduction dans
des vecteurs
Construire une banque génomique consiste à fragmenter l’ADN tout entier
d’une cellule (la méthode du shotgun) et à introduire chaque fragment dans un vec-
teur, puis dans un hôte approprié. Si la banque est correctement établie, elle
contiendra, sous une forme morcelée, l’ensemble de l’information d’un individu telle
qu’elle existe dans son génome, d’où le terme de banque génomique.
Une banque génomique ne sera représentative que si elle contient, au moins
une fois, l’ensemble des séquences du génome. Il est donc évident que plus les in-
serts seront longs, plus faible sera le nombre des clones nécessaires. Clarke et Car-
bon ont établi une formule statistique permettant de déterminer le nombre de clones
nécessaires, compte tenu de la longueur des inserts. Cette formule, qui dérive de la
loi de Poisson est :
log ( 1-P )
N =- --------------
log ( 1-1 / n)
P = Probabilité de présence dune séquence donnée
n = ( longueur du génome ) / ( longueur moyenne des fragments insérés ).
Probabilité de présence
d’une séquence donnée
Longueur de l’insert en
(kb)
15 20 30 35 40
0,99 860 640 430 370 320
0,95 560 415 280 240 210
0,90 430 320 215 185 160
0,80 300 225 150 130 115
Tableau IV.1 : Nombre de clones (en milliers) que doit contenir une banque gé-
nomique pour être représentative d’un génome.
2 – Etablissement d’une banque génomique.
Les différentes étapes principales sont les suivantes :
• Extraction de l’ADN nucléaire
• Digestion du génome avec des enzymes de restriction
• Insertion des fragments d’ADN dans des vecteurs (plasmide ou phage ou
YAC). Le vecteur doit être choisi en fonction de la taille des fragments d’ADN à insé-
rer.
• Ligature avec l’ADN ligase
• Transformation (avec des plasmides) ou infection (avec phages) des bacté-
ries
• Culture des bactéries sur des milieux entiers
34
• Toutes les bactéries qui portent une chimère se multiplieront et donneront
des clones.
Figure IV.1: Schéma pour la réalisation pratique d’une banque génomique à partir
de phages.
3. Amplification de la banque
Lorsque la banque n’est pas d’usage unique, mais doit servir à plusieurs clo-
nages successifs, il convient de l’amplifier, c’est à dire, d’augmenter le nombre de
copies de chaque fragment inséré. L’amplification n’est réalisable que lorsqu’on tra-
vaille avec des phages. Avec les cosmides et les YAC, ou les BAC, les pertes de
séquences sont très rapides et on est alors obligé de refaire la banque chaque fois.
4 - Les avantages des banques génomiques:
Les banques génomiques permettent de connaître:
- Les régions non transcrites des exons
- Les séquences de régulation
- Les gènes silencieux
- Les introns
Malheureusement l’ADN génomique est fragmenté au hasard, donc, dans la
plupart des cas, on obtient des gènes fragmentés incapables de coder pour des pro-
téines biologiquement actives.
Pour pallier à cet inconvénient, il faut utiliser les chromosomes artificiels de
levure (YAC) comme vecteur de clonage. Les YAC.peuvent recevoir des fragments
d’ADN de 150kb à 1 000 kb. Ces vecteurs permettent de marcher sur le chromo-
some.
III - LES BANQUES DE CADN
L’ADN complémentaire (ADNc) est la copie sous forme d’ADN d’un ARN mes-
sager (ARNm). Un banque de cDNA doit contenir au moins une copie de tous les
ARNm présents dans la cellule. Ces banques sont essentiellement tissulaires puis-
qu’une cellule d’un tissu donné ne possède pas tous les ARN messagers de
l’individu, mais ceux dont l’état de différentiation cellulaire permet la transcription. Le
processus de formation de l’ADNc comprend deux étapes:
1 - L’isolement de l’ARN poly A
+
(poly adénine):
Dans la cellule eucaryote, il existe plusieurs types d’ARN : l’ARN messager,
l’ARN de transfert et l’ARN ribosomal. La majeure partie des ARN messagers des
eucaryotes possède une queue poly(A) rajoutée après le transcription et avant le
transfert vers le cytoplasme.
ARNm (eucaryote)
35
5’ GGGAUCACUUGCGCAGCGCAUGCU(AAAAAAAAAA)n 3’ queue poly(A)
On utilise les queues poly rA pour purifier l’ARNm en écartant les autres types
d’ARN. Sur une colonne chromatographique, les oligo-désoxythymidine (dT) sont
liés à la cellulose ou à l’agarose par des liaisons covalentes. On fait alors passer
l’ARN cellulaire dans la colonne. Seuls les ARNm qui possèdent les queues poly rA
seront retenus sur la colonne par hybridation par les oligo-thymidilates. Les autres
ARN sont éliminés par un lavage avec le tampon. Les ARNm sont ensuite « élués »
par un agent dissociant. La figure III.3 résume les principales étapes de la purifica-
tion des ARN messagers eucaryotes ayant une queue poly-rA.
Figure IV.2 : Les principales étapes de la purification des ARN messagers eucaryo-
tes ayant une queue poly-rA en utilisant la chromatographie d’affinité.
2 - Le passage de l’ARN à l’ADN
Cette étape est toujours réalisée grâce à la transcriptase reverse isolée d’un
rétrovirus. Plusieurs techniques sont utilisées pour la préparation de l’ADNc :
la transcriptase reverse :
La synthèse de l’ADNc commence en 3’ de l’ARNm. Cependant, la transcrip-
tion par la transcriptase reverse n’est pas parfaite, elle tend à baisser lorsqu’elle
rencontre des obstacles que sont les structures secondaires de l’ARN. Si la molé-
cule de l’ARNm est longue, la transcription peut ne pas aboutir à l’extrémité 5’ à
cause de la boucle formée à cette extrémité par la transcriptase reverse. La boucle
est détruite par l’action de la nucléase S1. Il y a cependant une perte d’information
au niveau de l’extrémité 5’.
Figure IV.3 : La technique de base de la synthèse du cDNA à partir du mRNA par la
reverse transcriptase.
La technique « copie entière » par addition de queues uniformes « tai-
ling »
Après la synthèse du premier brin de cDNA par la reverse transcriptase, une
queue poly dC est créée à l’extrémité 3’ par la terminal transférase en présence de
dCTP. Un poly dG synthétique est alors utilisé pour s’hybrider à la queue poly dC et
servir d’amorce pour la synthèse du brin complémentaire par le fragment de Klenow
de la DNA polymérase I.
La technique « copie entière » par cassure à la RNase H.
Le début de l’opération est identique aux techniques précédentes. Après la
synthèse du premier brin par la reverse transcriptase, le brin de RNA est coupé en
plusieurs endroits par la RNase H. Les courts fragment d’ARN servent alors
d’amorce pour la DNA polymérase I qui synthétise le brin d’ADN par son activité po-
lymérasique 5’ ? 3’ et détruit les restes d’ARN par son activité exonucléasique
36
3’ ? 5’. On peut alors utiliser la T4 DNA polymérase pour parfaire la synthèse au ni-
veau des extrémités. Figure IV.4
La technique du multi-amorçage au hasard : Cette méthode utilise la tech-
nique de synthèse de l’ADNc utilisant un multi-amorçage au hasard avec des oligo-
nucléotides de 6 à 10 nucléotides de long : « Random primer ». la suite est identi-
que à la méthode par la RNase H.
La PCR : Cette technique permet d’obtenir rapidement une grande quantité
de l’ADNc une fois l’ADNc disponible .(Polymerase Chain Reaction pour Réaction de
Polymérisation en Chaîne) Figure IV.5
IV - L’ÉTUDE DE L’ADN CLONÉ
Le criblage ou la recherche du bon clone au sein d’une banque génomique
est toujours un problème difficile à résoudre en fonction des vecteurs utilisés. Beau-
coup de techniques ont été utilisées pour le criblage des colonies, mais les techni-
ques les plus sensibles et les plus utilisées sont:
- Celles qui emploient les oligonucléotides de synthèse,
- Celles qui utilisent les anticorps.
Les autres techniques comme l’hybridation de sélection, l’hybridation différen-
tielle et la complémentation d’un défaut génétique de l’hôte qui ont eu gloire dans
les années 1975-1980 ne sont pratiquement plus utilisées à cause de leur lourdeur.
Le processus général utilisé pour le screening se pratique ainsi :
- Une réplique des clones est réalisée sur un filtre de nitrocellulose ou sur ny-
lon
- On utilise ensuite une sonde spécifique marquée par un radio-isotope (
32
P,
35
S) pour une hybridation. Dans ce cas, la révélation de la séquence insérée
est réalisée par une simple autoradiographie.
- On peut utiliser un anticorps dirigé contre le produit de l’expression de l’ADN
inséré dans le cas d’une banque d’expression.
1. Le criblage par des oligonucléotides de synthèse :
Le principe consiste à utiliser, dans un criblage classique, une sonde oligonu-
cléotidique marquée synthétisée à partir des données de séquençage d’une fraction
de la protéine. Le code génétique permet de déterminer les séquences possibles du
gène correspondant (dégénérescence du code). On utilise généralement un pool
d’oligonucléotides courts de 18 à 25 bases ou quelques oligonucléotides longs de
40 à 45 bases.
Les appareils automatiques permettent actuellement de séquencer une pro-
téine en 24 heures et de synthétiser des oligonucléotides dans le même laps de
temps. Les oligonucléotides purifiés sont marqués au
32
P et utilisés comme sonde
d’hybridation in situ d’une banque génomique.
2. Le criblage par des anticorps :
37
Cette technique ne peut se réaliser que sur une banque d’expression puis-
qu’elle vise à révéler le produit d’expression d’un gène cloné. Il faut pour cela dispo-
ser d’un anticorps, de préférence polyclonal dirigé contre le produit du gène. Le
complexe antigène-anticorps est révélé par un autre complexe protéique possédant
soit une activité enzymatique dont les produits sont colorés (8-galactosidase), soit
marqué à l’iode 125.
Figure IV.6: Criblage d’une bibliothèque d’expression avec une sonde
Figure IV.7 : Criblage d’une bibliothèque d’expression avec les anticorps
3. Electrophorèse (Cf. ci-dessus)
Elle permet de récupérer les fractions d’intérêt pour un séquençage de l’ADN
inséré. La révélation des différentes bandes est faite soit par :
- Une utilisation du bromure d’éthidium et une lecture sous une illumination
ultra-violette.
- Un marquage chimique ou enzymatique des produits obtenus pour le sé-
quençage (utilisation de radio-isotopes,
32
P,
35
S) suivi d’une autoradiographie.
4. Le séquençage :
Il a pour but la détermination de la séquence nucléotidique de l’ADN isolé
pour définir les introns, les exons et les zones de régulation de l’ADN inséré dans le
vecteur. Deux méthodes classiques sont alors utilisées.
a - La méthode de Maxam et Gilbert: la méthode chimique.
L’ADN double brin à séquencer est d’abord marqué au
32
P au niveau du
phosphate en 5’. Il doit ensuite être digéré par une endonucléase de restriction en
deux fragments différents de taille, qui sont séparés par électrophorèse. On obtient
ainsi un fragment dont une seule extrémité 5’ est marquée. Il est séparé en 4 lots et
dans chaque lot, au moyen de réactifs chimiques différents, on réalise une coupure
au niveau d’un type de base différent.
Après électrophorèse sur gel de polyacrylamide des 4 produits de réaction et
autoradiographie, les positions relatives des différentes bases sont déduites de la
comparaison des distances de migration des fragments marqués en 5’.
38
Séquence détectée sur le gel Lecture
3 →-5’
Ordre
des
taches
T C G A Lecture
3’→5’
32
PTGCACTTGAACGCATGCT 18 T
32
P- TGCACTTGAACGCATGC 18 17 C
32
P- TGCACTTGAACGCATG 17 16 G
32
P- TGCACTTGAACGCAT 16 15 T
32
P- TGCACTTGAACGCA 15 14 A
32
P- TGCACTTGAACGC 14 13 C
32
P- TGCACTTGAACG 13 12 G
32
P- TGCACTTGAAC 12 11 C
32
P- TGCACTTGAA 11 10 A
32
P- TGCACTTGA 10 9 A
32
P- TGCACTTG 9 8 G
32
P- TGCACTT 8 7 T
32
P- TGCACT 7 6 T
32
P- TGCAC 6 5 C
32
P- TGCA 5 4 A
32
P- TGC 4 3 C
32
P- TG 3 2 G
32
P- T 2 1 T
32
P- 1 0
Figure IV.8 : La méthode de séquençage des acides nucléiques de Maxam Gilbert :
Un traitement chimique permet de cliver spécifiquement au niveau de chaque base
qui produit alors des fragments radioactifs de tailles différentes.
La séquence de l’ADN, lue directement de bas en haut du gel, est alors :
5’-TGCACTTGAACGCATGCT-3’
b - La méthode de Sanger: la méthode enzymatique.
La méthode de séquençage enzymatique mise au point par Sanger par
l’incorporation de didésoxyribonucléotides terminateurs de chaîne a été universelle-
ment adoptée.
Cette méthode met à profit l’absence d’un hydroxyle en 3’ d’un ddXTP qui ne
permet pas la formation d’une liaison phosphodiester. la conséquence est un arrêt
de l’élongation lorsqu’un didésoxyribonucléotide est incorporé dans un brin d’ADN
en synthèse. Ce phénomène est à la base de la méthode de Sanger.
Figure IV.9 : Séquençage, méthode enzymatique
39
5. Analyse du génome et de ses modifications: Le Southern blot
C’est la méthode d’analyse de l’ADN imaginée par Southern en 1975 pour
visualiser les gènes ou toute séquence d’un ADN génomique, par une hybridation
avec une sonde, marquée et spécifique, avec des fragments de restriction d’ADN,
préalablement séparés par électrophorèse, dénaturés et transférés sur une mem-
brane. Le processus est le suivant:
• L’ADN génomique est d’abord fragmenté par une enzyme de restriction
appropriée
• Les fragments sont ensuite séparés par électrophorèse sur gel d’agarose,
• L’ADN est dénaturé in situ par une solution de soude,
• L’ADN dénaturé (simple brin) est transféré par capillarité sur un support so-
lide (filtre de nitrocellulose ou nylon). Les membranes de nylon sont les plus
utilisées car par un traitement au UV (254 nm), on forme des liaisons covalen-
tes entre le DNA et le nylon de sorte que le support peut être utilisé plusieurs
fois avec d’autres sondes.
• Le support solide est hybridé avec une sonde mono-brin marquée à faible
stringence puis lavé
• Le ou les fragments reconnus par la sonde sont révélés par la technique de
l’autoradiographie.
Figure IV.10 : Southern Blot
Cette technique permet :
• L’établissement des cartes de restriction : Les enzymes de restriction
coupent l’ADN au niveau de séquences bien définie. Il est donc facile d’établir une
carte de restriction par cette méthode.
• La mise en évidence de pseudo-gènes et de gènes apparentés : Une
sonde suffisamment longue peut s’hybrider avec des séquences non totalement
complémentaire : pseudogènes, gènes d’une même famille ou gènes homologues
d’une espèce différente. Ces gènes sont mis en évidence en fonction des conditions
d’hybridation (stringence).
• Les mutations par délétions : Cette technique permettant de visualiser un
gène, il est possible de mettre en évidence une délétion pourvue qu’elle ne soit pas
très grande.
• La détection de mutation ponctuelle : Le remplacement d’une base par
une autre peut se traduire par la disparition ou la création de sites de coupures pour
une enzyme de restriction donnée. Cette variation des sites de coupure se traduit
par la disparition d’une ou de deux bandes (suivant la longueur de la sonde utilisée)
et l’apparition d’une bande de taille supérieur dont la longueur est égale à la somme
des longueurs des deux bandes disparues. La création d’un nouveau site de cou-
pure donne le résultat contraire.
40
• La détection des recombinaisons : L’échange entre chromosomes homo-
logues au cours de la méiose est la recombinaison. Dans certains cas, il est possi-
ble de mettre en évidence ces recombinaisons par cette technique.
Figure IV.11
6. La PCR
Définition:
La PCR (Polymerase Chain Reaction), la réaction de polymérisation en
chaîne consiste à amplifier sélectivement une séquence particulière d’ADN par
l’action répétée d’une ADN polymérase. Le fragment d’ADN à amplifier est compris
entre deux séquences (complémentaires des amorces) qui doivent être connues et
la longueur ne peut excéder 10 kb.
Æ Processus:
Pour faire la PCR, on utilise l’ADN polymérase d’une bactérie: Thermophilus
acquaticus qui vit à 75°C dans les eaux thermales. Cette polymérase (Taq polymé-
rase) est toujours active à 94-96°C. La réaction de la PCR comporte trois étapes qui
constituent un cycle au cours duquel la quantité d’ADN à amplifier est doublée. Ces
cycles sont renouvelés entre 20 et 50 fois en fonction de la quantité d’ADN cible de
départ et du but recherché.
• la dénaturation de l’ADN à amplifier à 94°C,
• l’hybridation avec une amorce, appariement primer, annealing à 64°C
• extension de l’amorce à 70 - 72°C par la Taq polymérase.
L’amplification est effectuée par la répétition des cycles qui assure une dupli-
cation exponentielle de chaque brin.
Æ Les éléments de la PCR:
les réactifs et le matériel:
• l’ADN à amplifier
• 2 amorces: sens et anti sens
• tampon de réaction (Buffer)
• MgCl
2
• dNTP
• Taq polymérase
• L’appareil thermocycleur pour PCR
• H
2
O bi-distillée et stérile
Æ L’intérêt et application de la PCR:
La PCR est la méthode actuelle la plus efficace et la plus rapide
d’amplification d’un ADN cible, c’est pourquoi elle est maintenant largement utilisée.
Elle permet de mettre en oeuvre les techniques habituelles de génie génétique
même si l’on ne dispose au départ que d’une faible quantité d’ADN.
CF Figure IV.5 : Les cycles de la PCR
41
7. Étude des polymorphismes : RFLP, VNTR, SSTR, SSCP
Les RFLP (restriction frament length polymorphism) sont des variations de séquence
de l’ADN révélées par des modifications de la carte de restriction. L’ADN est soumis
à une digestion par une ou plusieurs enzymes de restriction suivie d’un Southern
blot. En d’autres termes : l’hydrolyse d’un ADN par une endonucléase conduit à une
série de fragments, appelés fragments de restriction. La longueur des fragments est
déterminée par la distance séparant les séquences spécifiques reconnues par cette
endonucléase. Nous avons les RFLP (Restriction Fragment Length Polymorphism).
Une molécule d’ADN donnée coupée par une enzyme de restriction donnée produit
toujours les mêmes fragments : cette série de fragments fournit une empreinte ca-
ractéristique de l’ADN hydrolysé, on parle de carte d’identité moléculaire.
Nous avons aussi les polymorphismes de répétition : ce sont les minisatelites
ou VNTR (Variable Number of Tandem Repeats) Les VNTR sont des séquences
particulières. Elles sont répétitives, dispersées et très polymorphes. Elles ont sou-
vent 11 à 16 bp (GGAGGTGGGCAGGA [A/G] G. Elles permettent la réalisation de
l’empreinte genetique (ADN finger printing)
Les microsatelites de type (CA)n sont plus fréquent et les mieux caractérisés :
les SSTR (Short Sequences of Tandem Repeats). Ils sont favorisé par des crossing
over inégales lors de la méiose. La chorée de Hungtington qui est une maladie neu-
rodégénérative est provoquée par des crossing-over inégaux. La technique des
SSTR permettent d’établir des polymorphismes à plus de 99,99%. Cette technique
est utilisée dans les tribunaux pour découvrir le coupable, pour déterminer la pater-
nité ou la maternité et elle est désormais utilisé dans la pharmacogénétique.
La mise en évidence des mutations ponctuelles utilise le système de l’analyse
des polymorphisme de conformation de l’ADN simple-brin : SSCP (single Strand
Conformation Polymorphism). La structure secondaire que prend un segment de
l’ADN simple-brin est fonction de sa séquence. Une mutation ponctuelle au sein de
cette séquence modifie la structure secondaire pour qu’il en résulte une modification
de la migration en électrophorèse. Cette propriété permet de mettre en évidence la
présence d’une mutation ponctuelle.
Processus :
- La séquence où l’on souhaite rechercher une mutation est amplifiée
par PCR.
- Cette séquence ne doit pas dépasser 300 à 500 bp.
- L’ADN est marqué par un iso-radioactif au cours de l’amplification.
On peut introduire un nucléotide α
32
P dCTP ou alors utiliser des pri-
mers marqués.
Technique d’empreintes par didéoxynuclotides ou ddF
Les amplicons de la PCR
Réaction de séquence à l’aide de la Taq DNA polymérase avec un primer interne
42
Migration sur un gel d’acrylamide non dénaturant
Par exemple, on a la séquence suivante avec une mutation C à A
5’ ---- AGTGTTACGTGCTA ----à 3’ Pour l’allèle normal
5’ ---- AGTGTTAAGTGCTA ----à 3’ Pour l’allèle muté
Après PCR, on ajoute un seul didéoxynucléotide (par exemple, ddGTP) et des
dNTPs. Puis, une réaction de séquence utilisant la Taq polymérase est réalisée
(avec une amorce marquée).
5’ ---- AGTGTTACG TGCTA ----à 3’ Pour l’allèle normal
3’ ---- TCACAAT
dd
G
5’ ---- AGTGTTAAGTGC TA ----à 3’ Pour l’allèle muté
3’-----TCACAATTCAC
dd
G
NB. L’altération de la conformation spatiale de l’ADN permet de détecter dans un gel
la mutation (SSCP)
Normal Muté
Fig. IV.12 : d’un gel de polyacrylamide en utilisant la technique
de dideoxyfinger-printing
8 . Puces à ADN (microarray) ou ADN chips
La technologie des puces ADN permet l’analyse de l’expression de milliers de
gènes simultanément. Employer les puces ADN vise à caractériser les relations
gène-fonction ou définir et comparer les profils d’expression des messagers expri-
Normal Muté
Bande de faille normale
Bande de faille anormale correspondant à la mutation
43
més dans des cellules isolées dans différentes conditions (exemple : cellules norma-
les comparées aux cellules tumorales) ou soumises à différents traitements (défini-
tion du profil d’action d’une drogue). Les puces ADN sont un outil de choix dans la
recherche et la caractérisation de nouvelles molécules à visée thérapeutique.
Principe :
Synthétisons une série d’oligonucléotides de 8 bp (octamères) représentant
toutes les combinaisons possibles 4
8
= 65.536 : ces 4
8
oligonucléotides sont fixés de
manière ordonnée sur une plaque de silice. La séquence dont on cherche à déter-
miner la composition est hybridée sur ce filtre. Les conditions de stringence sont
telles que, seules, les appariements strictement homologues se réalisent. Un traite-
ment informatique permet d’analyser les résultats.
1 2 3 4 5 6 7 8 9 10 11 12
A
xxxx B
C
D
xxxx E
F
G
xxxx H
I
xxxx J
K
xxxx L
Figure IV.13 : schéma simplifié d’une puce.
Prenons cette puce sur laquelle sont fixés des octamères de séquences che-
vauchantes différentes et ordonnées. Supposons que nous ayons un ADN de 12 bp
et hybridons-le à cette puce. Dans cet exemple nous avons cinq hybridations de
séquences.
Par exemple, si les ADN fixes sur les cases ci-après ont la séquence décrite :
B9 : C A G C C A A T
44
E4 : A G C C A A T A
H12: G C C A A T A C
J1 : C C A A T A C G
L12 : C A A T A C G A
Figure IV.14
La séquence reconstituée est alors : 5’ – CAGCCAATACGA.
Le support utilisé pour fixer les oligonucléotides peut être une plaque de silice. La
synthèse des oligonucléotides se fait in situ : réactions chimiques avec adresse spé-
cifique sur le verre. Ces puces sont très petites, environ 1,6 cm
2
avec un espace
entre les sondes d’environ 50 µm (65.000 sondes fixées).On peut encore diminuer
leur taille. Ainsi, des puces, avec espacement des sondes de 20 µm, permettent de
fixer plusieurs centaines de milliers de sondes, ont été fabriquées. Les industriels
espèrent pouvoir réaliser des puces de 1 µm et pourquoi pas, comme dans
l’industrie informatique, des puces de 0,3 µm !
Secteurs d’application :
• Dans le séquençage de l’ADN mitochondrial (16,6kb).
• Détection de mutations et de polymorphismes,
• Expression de gènes,
• Pharmacogénétique ou pharmacogénomie.
C A G C C A A T A C G A
45
CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION
DES GÈNES EUCARYOTES DANS LES BACTÉRIES.
La fin des années 1970 et le début des années 1980 ont vu se développer
des techniques qui permettent de modifier des paires de bases bien spécifiques
donc de créer différents types de mutations ponctuelles, de délétions et d’insertions
dans des fragments d’ADN cloné. Les fragments d’ADN ou les gènes ainsi modifiés
peuvent ensuite être réintroduits dans l’organisme d’origine pour observer les effets
des mutations sur le phénotype ou sur la régulation de l’expression génétique.
I - LES MUTAGENÈSES
1. Mutagenèse par délétions
L’un des moyens les plus drastiques pour évaluer le rôle d’une séquence de
DNA donnée est de la supprimer. L’analyse des modifications physiologiques qui
suivent cette excision permet alors de connaître le rôle de la séquence « délétée ».
Pour être pleinement informative, la suppression doit être progressive. On emploi
alors la stratégie suivante :
– Création d’une délétion étendue dans l’ADN considéré afin de connaître le
rôle de la séquence
– Création de délétions de plus en plus courtes pour circonscrire les régions
d’intérêt.
– Insertion de séquences plus ou moins longues en fonction de la carte de
restriction.
– Création de mutations ponctuelles pour connaître le rôle de chaque base
dans les mécanismes de régulation ou dans la séquence peptidique.
Le principe consiste à utiliser les enzymes de restriction soit pour « déléter »,
soit pour insérer des portions plus ou moins grandes de DNA dans le gène cloné
afin d’élucider son rôle dans le génome. On utilise pour cela plusieurs stratégies en
fonction des sites restriction :
– Une coupure par une enzyme de restriction suivie de l’action de la nu-
cléase S1 permet de retirer de 3 à 8 paires de bases suivant le type d’enzyme de
restriction (largeur du site de reconnaissance)
– Une coupure par une enzyme de restriction suivie de l’action de
l’exonucléase III permet également de retirer plus de bases en fonction du temps
d’incubation. La nucléase S1 est toujours utile pour raboter les extrémité 5’.
– Une coupure par une enzyme de restriction suivi de l’activité de la nu-
cléase Bal 31 qui dégrade les deux extrémités de l’ADN à la fois. L’étendue du re-
trait dépend du temps d’incubation. La fermeture des deux extrémités restantes est
toujours réalisée par la T4 ligase qui peut joindre deux molécules de DNA ayant des
bouts francs.
46
2. Mutagenèse par insertion:
L’insertion d’une courte séquence dans un gène permet d’élucider l’effet de
position soit d’une base soit d’une séquence de bases dans les phénomènes de ré-
gulation, ou pour connaître l’influence d’un acide aminé dans le fonctionnement
d’une protéine. Le principe utilise les mêmes méthodes que pour la délétion. Le
fragment que l’on veut insérer ou modifier est, soit une substitution de nucléotides,
soit un fragment de restriction purifié, soit un oligonucléotide de synthèse.
a- Les substitutions de nucléotides
Les substitutions des bases peuvent être introduites dans un segment d’ADN
cloné dans un plasmide, après y avoir créé de courtes régions mono-caténaires.
Ces régions mono-caténaires sont alors utilisées pour substituer des paires de ba-
ses ou pour introduire des nucléotides supplémentaires:
∗ soit par une digestion partielle à l’aide de l’exonucléase III (qui a une action
exonucléasique 3à 5) après une coupure par une enzyme de restriction. On aura
donc des bouts 5’ débordants.
∗ soit en exploitant l’activité exonucléasique de l’ADN polymérase I
d’Escherichia coli (qui a trois activités enzymatiques: 5à 3 polymérisante; 5à 3
exonucléasique; et 3à 5 exonucléasique). En effet, en l’absence des désoxyribo-
nucléotides triphosphates, cette enzyme digère un des brins d’un duplex d’ADN
dans la direction 3’ à 5’. On obtient encore des extrémités 5’ débordants.
Exemple : Pour créer donc un mutant contenant une substitution de base par une
désamination de la cytosine.
Figure V.1 : Mutagenèse, substitutions de nucléotides
On procède alors comme il suit:
à Avec une enzyme de restriction donnée comme Hind II, on ouvre dans
l’ADN un site de restriction: un smal.
à Le site est traité avec l’ADN polymérase I modifiée (appelée fragment de
Klenow). En présence de dTTP, ce fragment enzymatique agit comme une exonu-
cléase en effectuant une digestion simple brin 3’à 5’ jusqu’à ce qu’il rencontre un
résidu T.
à L’addition du bisulfite provoque une désamination des résidus cytosines
(C) des brins exposés pour donner de l’uracile (U).
à Après élimination du bisulfite, la molécule de DNA est réparée par
l’addition des quatre dNTP et du fragment de Klenow de la DNA polymérase.
à Le résultat est une substitution d’une paire de bases G-C par une paire A-T.
47
b - La mutagenèse dirigée au moyen d’oligonucléotides:
Les exemples que nous venons de voir possédaient un site de restriction pro-
pice aux bords de la région à modifier. Mais comment créer une mutation dans une
séquence qui ne bénéficie pas de cette situation favorable ? Pour résoudre ce pro-
blème, Michael Smith a inventé la méthode qui utilise des petits oligonucléotides de
synthèse d’une taille de 15 à 25 bases.
Figure V.2 : mutagenèse dirigée au moyen d’oligonucléotides
Le protocole est le suivant:
1. Le gène que l’on désire muter est cloné de préférence dans un vecteur dé-
rivé d’un phage dont le génome est une molécule d’ADN monocaténaire, comme le
phage M13.
2. Un oligonucléotide synthétique dérivé du gène cloné et portant la mutation
désirée est ajouté dans le milieu pour servir d’amorce (primer) pour la synthèse in
vitro du brin complémentaire du vecteur M13.
3. L’amorce synthétique peut donc contenir n’importe quelle base « erronée »
que l’on désire introduire dans la séquence. Il y aura donc un défaut d’appariement
au niveau de cette base avec l’ADN du vecteur. Cependant, si l’hybridation est réali-
sée à basse température et à faible stringence (faible force ionique), une ou deux
bases mal appariées peuvent être tolérées dans la formation de la double hélice.
4. Le brin complémentaire est alors synthétisé in vitro par le fragment de Klé-
now de la DNA polymérase I qui utilise l’oligonucléotide modifié comme amorce.
5. Les deux brins de l’ADN obtenu sont séparés par simple chauffage suivi
d’un refroidissement rapide et transférés par transformation dans E. coli où il seront
répliqués in vivo et produiront finalement un grand nombre d’exemplaires de la sé-
quence mutée que l’on désire (50% pour la séquence mutée et autant de copies de
l’ADN sauvage 50%).
6. Les bactéries ayant incorporé la séquence mutée sont sélectionnées par
hybridation in situ dans des conditions de forte stringence avec l’oligonucléotide mu-
té marqué comme sonde (pour différencier la molécule non mutée).
48
c - La mutagenèse insertionnelle ciblée par recombinaison homologue
On peut cibler le site de la mutagenèse insertionnelle en introduisant une sé-
quence homologue au gène que l’on veut léser. Celle-ci reconnaît sélectivement le
gène endogène et provoque une recombinaison homologue responsable soit d’une
insertion par addition, soit une insertion par remplacement. Dans le cas d’une inser-
tion par remplacement, le gène cible est inactivé. Dans le cas d’une insertion par
addition, les deux gènes sont présents dans le génome. (Figure V.3)
La première construction réussie a utilisé le protocole suivant:
1 – Le vecteur plasmidique utilisé contenait à la fois un fragment du gène
HPRT (Hypoxanthine-guanine PhosphoRibosyl Transférase) pour cibler ce gène in
vivo et un gène néo (ce gène marquer confère à la cellule une résistance à la néo-
mycine)
2 - Le vecteur est introduit par électroporation dans des cellules embryonnai-
res indifférenciées (ES cells : Embryonic Stem cells : cellules staminales em-
bryonnaires indifférenciées pluripotentes et cultivables in vitro de façon prolongée).
3 - Les cellules ayant intégré l’ADN sont sélectionnées par leur résistance au
G418 (un analogue de la néomycine) conférée par le gène néo.
4 - Celles où l’intégration s’est faite par le truchement d’une recombinaison
homologue ayant inactivé le gène HPRT sont alors sélectionnées par leur résistance
à la thioguanine (sélection des cellule HPRT
-
).
Pour réaliser la même opération sur des gènes non sélectionnables (gènes
de régulation), Mansour a élaboré un système de double sélection : le procédé de
sélection positive et négative dont le principe est le suivant :
– Si l’intégration se fait d’une manière aléatoire, c’est-à-dire par insertion, la
construction utilisée est intégrée en totalité, et le gène cible n’est pas touché. La
cellule est sélectionnée positivement par le G418 (résistance conférer par le gène
néo) et négativement par le ganciclovir (tk
+
. La thymidine kinase du virus de lherpes
confère la sensibilité à une drogue antivirale, le ganciclovir, analogue de la thymine).
– En cas de recombinaison homologue par remplacement, les exons C, D et
E endogènes sont remplacés par ceux de la construction (C, D, néo, D , E) et le
gène tk est éliminé en raison de sa position terminale. En ce moment, le gène ciblé
est inactivé car l’exon D exogène est interrompu par le gène neo. La cellule est sé-
lectionnée positivement par G418 ( neo
+
) et résiste au ganciclovir (tk
-
). Les évè-
nements de recombinaison homologue réussis peuvent être vérifiés par la PCR en
utilisant une amorce correspondant à l’ADN exogène (par exemple une séquence
néo) ou une amorce correspondant à une séquence endogène (comme l’exon F du
gène HPRT).
49
Figure V.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue
A B C D E F
C D NEO D F tk
C D NEO D E tk A C D E F
A B C D E F
C D NEO D E tk
A B C D NEO D E F
Gène ciblé
Construction
Gène ciblé
Construction
Intégration
aléatoire
Recombinaison
homologue
50
Figure V.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue
Figure V.4 : La mutagenèse , mutation d’un site de restriction.
3 . Mutagenèse par PCR
• La création d'une mutation artificielle peut être obtenue dans un gène par le
jeu des amplifications à partir d'amorces modifiées.
• On prépare l'amplification du gène ou du cDNA grâce à deux amorces pla-
cées en amont et en aval de la séquence d'intérêt. On prépare aussi par syn-
thèse des oligonucléotides conformes aux séquences des deux brins du gène
autour du codon qui doit être modifié mais dont les bases sont volontairement
changées pour qu'elles permettent la synthèse d'un brin complémentaire
comprenant la substitution (ou la délétion...) souhaitée.
• On fait une première amplification entre chacune des amorces modifiées et
les amorces des extrémités. En réunissant ces deux amplifications et en dé-
naturant l'ADN, on conduit à une renaturation entre les fragments au niveau
des amorces centrales modifiées. Cette hybridation fait apparaître des extré-
mités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux
extrémités de la séquence d'intérêt. La poursuite des cycles en présence des
amorces amont et aval conduit à l'amplification de cette séquence complète
dans laquelle le codon muté a été inséré.
• La création d'une mutation artificielle peut être obtenue dans un gène par le
jeu des amplifications à partir d'amorces modifiées.
• On prépare l'amplification du gène ou du cDNA grâce à deux amorces pla-
cées en amont et en aval de la séquence d'intérêt. On prépare aussi par syn-
thèse des oligonucléotides conformes aux séquences des deux brins du gène
autour du codon qui doit être modifié mais dont les bases sont volontairement
changées pour qu'elles permettent la synthèse d'un brin complémentaire
comprenant la substitution (ou la délétion...) souhaitée.
• On fait une première amplification entre chacune des amorces modifiées et
les amorces des extrémités. En réunissant ces deux amplifications et en dé-
naturant l'ADN, on conduit à une renaturation entre les fragments au niveau
des amorces centrales modifiées. Cette hybridation fait apparaître des extré-
mités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux
extrémités de la séquence d'intérêt. La poursuite des cycles en présence des
amorces amont et aval conduit à l'amplification de cette séquence complète
dans laquelle le codon muté a été inséré.
II. MISE EN ÉVIDENCE DES EFFETS DE LA MODIFICATION
L’effet des modifications est de suivre l’expression d’un gène soit par une
augmentation ou une diminution de la production d’une protéine soit d’étudier les
modifications structurale de la protéine produite. Dans le cas des changements phé-
notypiques le résultat est visuel, mais dans les autres cas, il faut avoir recours soit à
des gènes reporteurs, soit à des promoteurs inductibles.
La séquence de DNA modifiée est couplée à un gène reporteur que la cellule
d’expression ne possède pas et dont le produit est facilement analysable. Les gènes
51
les plus courants sont : le gène de la Chloramphénicol-acétyl transférase (CAT), de
la β-glucuronidase ‘(8-Glu), de la β-galactosidase (8-Gal) et de la luciférine. (CF
Photocopies)
III. TRANSFERT DE L’ADN MODIFIÉ
Le transfert de l’ADN libre dans les cellules s’effectue par transfection avec
différentes techniques suivant le type cellulaire :
La transfection par le phosphate de calcium fait intervenir une internalisation
du complexe DNA-calcium par phagocytose
La transfection par le complexe DEAE dextran est également une internalisa-
tion par phagocytose
L’électroporation utilise l’effet d’une tension électrique sur des cellules en
suspension qui provoque la formation transitoire de pores permettant au DNA de
pénétrer dans la cellule.
Le DNA peut aussi être introduit par des projections de micro-particules enro-
bées de DNA surtout pour les plantes.
Le DNA peut aussi être introduit dans les cellules par micro-injection surtout
dans le cas des ovocytes fécondés.
La transfert de matériel génétique utilise aussi les vecteurs viraux, rétroviraux
et les plasmides que l’on appelle alors des vecteurs navettes.
52
DEUXIÈME PARTIE :
APPLICATION
DE LA BIOLOGIE
MOLECULAIRE :
LE GÉNIE GENETIQUE
53
CHAPITRE VI: LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES
AUX MICRO-ORGANISMES
Les génomes eucaryotes sont beaucoup plus complexes que les génomes
bactériens et phagiques C’est pourquoi les techniques de manipulation de l’ADN
doivent être adaptées aux différents génomes. Les exemples ci-dessous donnent
une idée de la taille du génome de quelques espèces :
• Plasmides à 2 à 5 kb
• Bactériophage / à 4,8 kb
• Bactériophage M13 à 6,4 kb
• E. coli à 4 Mb
• La levure (Saccharomyces cerevisiae) à 4 Mb
• Neurospora crassa à 27 Mb
• C. elegans à 100 Mb
• Drosophila melanogaster à 165 Mb
• Homo sapiens à 3000 Mb
I. LA TECHNIQUE DE L'ADN RECOMBINANT (ADNR)
La technique de l'ADN recombinant (ADNr) est simple dans son principe:
L’ADN recombinant est formé en réunissant des segments d’ADN de différentes
sources par le processus suivant:
> L'ADN d’intérêt est coupé avec une enzyme de restriction,
> L'ADN exogène contenant la séquence d'intérêt est mis en présence
de l’ADN du vecteur digéré par la même enzyme
> Les deux ADN sont ensuite ligaturés avec une enzyme appelée ligase.
> Le DNA obtenu est transféré dans une cellule d’expression
> On analyse les résultats obtenus grâce à des marqueurs présents
dans l’ADN du vecteur
Figure VI.1
1 - Les organismes transgéniques et la recherche en génie génétique
Un organisme transgénique est défini comme provenant d’une cellule dont le
génome a été modifié par l’introduction d’ADN extrinsèque. Cet ADN extrinsèque
peut être une séquence provenant de la même espèce mais qui a subi des modifica-
tions chimiques ou provenir d’une espèce différente. Le gène d’intérêt dans
l’échantillon d’ADN extrinsèque est le transgène.
L’introduction de cet ADN dans une cellule peut s’effectuer par une série de
manipulation diverses : par l’électroporation, la micro-injection, les liposomes, la co-
précipitation par le phosphate de calcium, par la transformation, par infection virale,
ou par un bombardement avec des micro-projectiles de tungstène enrobés d’ADN
dans le cas des cellules végétales.
54
La construction d’organismes transgéniques constitue un bond en avant pour
la recherche en génie génétique. Une des méthodes les plus importantes consiste
en l’utilisation de gènes indicateurs qui permettent de mesurer l’activité d’un gène
spécifique dans le tissu où il s’exprime normalement, malgré l’absence d’un phéno-
type facilement détectable. La région qui contrôle l’expression du gène en question
(promoteur) est alors rattachée à la région codante d’un gène dont l’activité est faci-
lement mesurable et qui constitue alors le gène indicateur. Chaque fois que le gène
étudié est exprimé, le gène indicateur signale sa présence par son activité indica-
trice dans la cellule ou dans les tissus concernés.
La construction de bactéries, de plantes, de champignons et d’animaux trans-
géniques ouvre donc de nombreux débouchés pratiques. Nous avons déjà vu com-
ment les bactéries transgéniques sont utilisées pour la production de différentes pro-
téines, parfois d’origine humaine, utiles en médecine et en pharmacie. Cet aspect de
la recherche est appelé biotechnologie.
L’ADN recombinant : L’action d’une enzyme permettant de souder deux frag-
ments d ‘ADN , comme l’exemple de l’enzyme EcoRI explique simplement le principe
de l’ADN recombinant.
2. Intérêt de la transgenèse
Sur le plan de la biotechnologie :
- Au plan zootechnique : l’un des intérêts majeurs de la transgenèse est
l’amélioration des caractères phénotypiques des animaux de rente: amélioration de
la croissance des animaux, comme le porc, le saumon, l’acquisition de résistances
aux maladies causes de mortalité dans les élevages de lapins, de truites, de car-
pes….
- Au niveau des plantes : La création de plantes résistantes aux insectes, au
stress hydrique et pour la production de protéines utiles comme les anticorps : (maïs
résistant aux insectes, tomates transgéniques à mûrissement lent, bananes vacci-
nantes….)
>Sur le plan médical :
â Production de protéines d’intérêt pharmaceutique : Certaines protéi-
nes trop complexes (glycosylées, carboxyméthylées…) ne peuvent être synthétisées
complètement par les bactéries in vitro. Il faut donc chercher à en obtenir par un
animal transgénique (dans le lait, le sang, les urines…..). L’obtention de ruminants
transgéniques producteurs de protéines d’intérêt pharmaceutique à haute valeur
ajoutée (facteurs VIII et IX de la coagulation, anti-thrombine III, alpha-1-antitrypsine,
activateur du plasminogène, sérum albumine…) représente aujourd’hui un intérêt
financier énorme.
â Xéno transplantation : Face à l’insuffisance des organes humains dispo-
nibles pour les greffes, la recherche d’organes animaux peut représenter une solu-
55
tion palliative. Le porc, physiologiquement proche de l’homme est à l’heure actuelle
le meilleur candidat, d’autant plus que très peu de maladies sont transmissibles du
porc à l’homme. Pour éviter le rejet d’organes porcins transplantés chez l’homme,
les gènes humains des protéines régulatrices du complément sont transférés au
porc. Les cours et les reins de porcs transgéniques obtenus en Grande Bretagne,
aux Etats Unis et en Australie survivent pendant plusieurs semaines quand ils sont
greffées à des primates.
â Modification de la composition du lait : Elle a pour but de mieux adap-
ter le lait des ruminants à la consommation humaine et d’améliorer sa transformation
par l’industrie laitière. L’expression de la lactoferrine humaine dans le lait de vache a
déjà été réalisée. Il s’agit d’un composé du lait humain qui est absent du lait de va-
che. Elle joue un rôle de transporteur de fer, mais aussi un rôle antibactérien (Elle
assure une protection du tube digestif du nouveau-né contre les infections bacté-
riennes). Le taureau hollandais HERMANN est un mâle fondateur transgénique de
ce gène.
A l’inverse, il est envisagé de diminuer la concentration de la béta-
lactoglobuline qui participe à l’intolérance au lait dont souffre une grande partie de la
population mondiale.
Un lait enrichi en anticorps ou en lysozymes pourrait être protecteur du tube
digestif et pourrait même être utilisé chez les nourrissons. Le lait devient alors un
« alicament », c’est à dire simultanément un aliment et un médicament.
â Création de modèles animaux des maladies humaines : Des souris,
mais aussi des ruminants transgéniques peuvent servir de modèles pour l’étude des
maladies humaines à prions. Les souris de même que les lapins peuvent servir aus-
si pour l’étude du SIDA et pour des tests thérapeutiques.
â Risques liés à la transgenèse : Les applications et les espoirs que font
naître la transgenèse sont très nombreux. Néanmoins, l’utilisation de la transgenèse
chez les végétaux et les animaux fait l’objet de vives réserves et controverses :
_ L’utilisation de l’hormone de croissance humaine chez les animaux per-
turbe leur croissance et leur reproduction. Les moutons qui sur-expriment GH (hor-
mone de croissance humaine) sont diabétiques et meurent avant l’âge d’un an.
_ Les risques liés à la consommation des produits OGM comme les protéines
de la vache folle qui provoque des troubles chez l’homme. Les maïs transgéniques
possèdent aussi des gènes de résistance aux ampicillines. Ces transgènes peuvent
donc s’intégrer dans les bactéries du tube digestif humain et conférer des résistan-
ces bactériennes aux antibiotiques que nous utilisons pour nos traitements.
_ Les risques liés à l’environnement : Ces risques sont liés à la dissémina-
tion des organismes transgéniques. Des bactéries et des souris transgéniques qui
s’échappent d’un laboratoire de recherche ou d’un centre de production, les déchets
des produits transgéniques déversés dans la nature constituent de grands dangers
qui guettent sans cesse notre écosystème.
II - SYNTHÈSE DU FACTEUR VIII HUMAIN PAR L’E. COLI
56
Le vecteur utilisé dans cet exemple est le phage T7. Au début de l’infection,
l’ARN polymérase du phage T7 transcrit les gènes précoces à partir d’un promoteur
dit précoce du phage T7. En fin d’infection, la bactérie synthétise des quantités
énormes des produits des gènes dits tardifs du phage T7 (les protéines de la cap-
side et de la queue). A ce moment, les gènes de la bactérie hôte ne sont plus trans-
crits. Par conséquent seules les protéines du phage sont encore synthétisées. Cette
possibilité est utilisée pour produire de grande quantité des protéines d’intérêt
comme le facteur VIII de la coagulation sanguine qui est défectueux chez les hé-
mophiles.
On insère le gène de l’ARN polymérase de T7 dans le chromosome
d’Escherichia coli sous le contrôle du promoteur de l’opéron lactose. Le gène de
l’ARN polymérase de T7 est transcrit à partir du promoteur lac et se trouve norma-
lement réprimé par le répresseur lac. L’addition de l’inducteur IPTG (analogue du
lactose), inactive le répresseur et autorise alors la synthèse de l’ARN polymérase du
phage T7.
Le gène d’intérêt, en l’occurrence, le gène humain (ADNc) du facteur de coa-
gulation du sang, le facteur VIII, a été inséré dans un plasmide à côté d’un promo-
teur tardif du phage T7. L’ARN polymérase du phage T7 produite alors par la bacté-
rie transcrit abondamment ce gène dans le plasmide. Il en résulte une production de
quantités importantes de facteur VIII par les bactéries contenant le plasmide.
Le schéma représente un système de deux vecteurs pour la production en
deux étapes du facteur VIII humain. Le Chromosome d’E. coli est manipulé pour
contenir le gène de l’ARN polymérase du phage T7 placé sous le contrôle du promo-
teur lac. Lorsque la transcription à partir du promoteur lac est induite par l’addition
d’IPTG, le gène de la polymérase du phage T7 est aussi transcrit et traduit en pro-
téine.
Les RNA polymérase de T7 ainsi produites transcrivent activement à leur tour
le gène du facteur VIII à partir du promoteur tardif du T7 présent sur le plasmide. La
grande quantité de mRNA ainsi produite est traduite pour donner une grande quanti-
té de la protéine facteur VIII.
III - SYNTHÈSE DE L’INSULINE HUMAINE PAR E. COLI:
Expression de l’insuline humaine chez Escherichia. coli : Les deux chaînes
d’insuline sont synthétisées séparément sous forme de protéines fusion avec la 8-
galactosidase. Elles sont ensuite libérées par un traitement chimique puis mélan-
gées. L’insuline active est obtenue par une réaction d’oxydation chimique des cys-
téines. Actuellement l’insuline est produite en grande quantité par E. coli par une
insertion de son gène dans un plasmide. Figure VI.2 : Synthèse de l’insuline
IV - SYNTHÈSE DE L’HORMONE DE CROISSANCE HUMAINE
PAR ESCHERICHIA COLI
57
Le schéma de la figure IV.8 donne le protocole de construction pour la syn-
thèse de l’hormone de croissance humaine dans E. coli :
(a) : Dans la première construction, la séquence signal humaine de l’insuline est éli-
minée pour permettre l’expression de la protéine dans les cellules bactériennes. Il
en résulte une méthionine à l’extrémité N-terminal qu’il faut enlever pour avoir la pro-
téine active.
(b) : Dans cette construction, une séquence signal bactérienne est ajoutée pour fa-
voriser la sécrétion du produit de traduction dans l’espace périplasmique. Dans ce
cas, il n’y a plus de méthionine supplémentaire et le produit excrété est de l’hormone
de croissance pure.
V – PRODUCTION DE VACCINS PAR LA TECHNIQUE DE L’ADN
RECOMBINANT :
1 - Les levures transgéniques
La levure Saccharomyces cerevisiae est devenue l’Escherichia. coli des
eucaryotes. L’une des raisons est que la génétique de cette levure est extrêmement
bien développée.
Les vecteurs de levure les plus simples sont dérivés de plasmides bactériens
dans lesquels un fragment d’ADN de levure a été inséré. Quand ils sont introduits
dans les cellules de levure, ces plasmides peuvent s’intégrer dans les chromosomes
par recombinaison homologue faisant intervenir un seul ou deux crossing-over.
Ces plasmides bactériens ne peuvent cependant pas se répliquer dans la levure.
• Dans le premier cas, le plasmide entier est intégré dans le chromosome.
• Dans le second cas, l’allèle cellulaire est remplacé par celui qui est porté
par le plasmide par recombinaison.
Il est alors possible d’introduire des gènes étrangers dans la levure pour en
étudier l’effet sur le phénotype, puis de re-transférer le plasmide dans Escherichia
coli pour manipuler le gène de la levure, pourvu qu’il contienne une origine de répli-
cation bactérienne et un marqueur sélectionnable dans la bactérie. Ces vecteurs
navettes que sont les chromosome artificiels de levure (YAC) sont extrêmement in-
dispensables pour le clonage de grands fragments de génome humain. Comme
exemple :
• le gène qui code pour le facteur VIII de la coagulation sanguine est long de
190 kb
• le gène responsable de la dystrophie musculaire de Duchenne fait 1000 kb.
On réalise alors, l’importance d’avoir des vecteurs à grande capacité
d’emmagasinage pour étudier les gènes humains ou pour produire des protéines
humaines à intérêt thérapeutique.
2 – L’élaboration du vaccin contre l’hépatite B.
58
Chaque année, le virus de l’hépatite B infecte plusieurs centaines de milliers
de personnes dans le monde. On estime qu’aux Etats-Unis, il y a 150 000 infections
par l’hépatite B chaque année. 16 à 19 % de la population du Burkina Faso sont
aussi atteints par l’infection à l’hépatite B. Le virus de l’hépatite B (HBV) qui infecte
le foie, provoque des lésions et dans certains cas des cancers. La particule virale
est recouverte d’un antigène de surface : HbsAg. Cette protéine se retrouve dans le
sang des personnes infectées sous la forme de gros agrégats protéiques.
La fabrication du vaccin contre l’hépatite B, appelé Engérix-B a utilisé la
technologie de l’ADN recombinant. Pour ce faire, le gène de l’antigène de surface du
virus de l’hépatite B (HbsAg) a été introduit dans Saccharomyces cereviciae par
l’intermédiaire d’un YAC. Dans les cellules de levures transgéniques, le gène est
transcrit et traduit en antigènes viraux. Après purification, ces antigènes injectés à
l’homme provoquent une réponse immunitaire par la production des anticorps anti-
Hbs ou anti HbsAg. Cette protéine est actuellement commercialisée et constitue un
vaccin contre l’hépatite B. Figure VI.3 : Production de l’antigène HbsAg
VI - APPLICATION DU GÉNIE GÉNÉTIQUE À L'AMÉLIORATION DE LA
PRODUCTION DES ANTIBIOTIQUES PAR DES BACTÉRIES
L'apparition de bactéries pathogènes multirésistantes aux antibiotiques pose
un grave problème médical. Par exemple, la vancomycine, qui a longtemps été l'an-
tibiotique de référence contre les infections sévères à bactéries Gram+ (endocardi-
tes, septicémies...) est inopérante dans un nombre croissant de cas. Cela rend né-
cessaire la recherche de nouvelles molécules actives contre ces pathogènes.
La synthèse de la pristinamycine par des Streptomyces pristinaespiralis re-
combinants
Les chercheurs ont eu l’idée de construire une souche génétiquement modi-
fiée de Streptomyces pristinaespiralis, bactérie Gram+ qui produit la pristinamycine.
Cette nouvelle souche bactérienne transgénique est stable dans les conditions in-
dustrielles et l'antibiotique est obtenu dans la forme souhaitée.
Les Streptomyces sont des bactéries du sol à Gram
+
qui appartiennent à la
classe des Actinomycètes. Elles présentent des phénomènes de différenciation uni-
ques chez les procaryotes, tels que la formation de mycélium et de spores. Cette
différenciation morphologique s'accompagne d'une différenciation métabolique et de
la production d'une grande variété de métabolites secondaires, présentant tout un
éventail de structures chimiques et d'activités biologiques. Cela rend la production
industrielle de ces métabolites particulièrement intéressante. On peut trouver des
molécules ayant une activité herbicide, anticancéreuse, antihelminthique, anaboli-
sante, antibiotique. Mais les plus connus restent les antibiotiques. L'abondance et la
diversité structurale des antibiotiques synthétisés par les Streptomyces ne se re-
trouvent dans aucun genre bactérien, au point que les Streptomyces sont à l'origine
de 70 % des antibiotiques produits industriellement. Les Streptomyces étaient donc
tout indiquées pour mettre au point de nouvelles molécules actives. Les antibioti-
ques de la famille des streptogramines, en particulier la nouvelle pristinamycine in-
59
jectable, développée par Rhône-Poulenc-Rorer, peuvent fournir un nouveau moyen
de lutter contre les bactéries pathogènes.
La pristinamycine est utilisée en médecine humaine depuis une vingtaine
d'années, mais à cause de sa faible solubilité, son utilisation était limitée, c'est pour-
quoi une forme injectable de pristinamycine constitue une solution intéressante pour
remplacer la vancomycine. La pristinamycine est produite par Streptomyces pristi-
naespiralis. C'est un mélange de deux composants, la pristinamycine I et la pristina-
mycine II. Ces deux composants agissent de façon synergique pour bloquer la syn-
thèse protéique et possèdent, de plus, un effet post-antibiotique puissant (le blocage
se maintient même après disparition de l'antibiotique). Le composant PII est lui-
même un mélange de deux molécules : la PIIA, produit final de la voie de biosyn-
thèse, et la PIIB, le précurseur de la PIIA. La conversion de PIIB en PIIA est obtenue
par oxydation d'un acide aminé, la proline (Fig.). S. pristinaespiralis produit un mé-
lange de ces deux formes dans les proportions de 80 % de PIIA et de 20 % de PIIB.
L'un des composants de la forme soluble mise au point par Rhône-Poulenc-Rorer
est obtenu par modification chimique de la PIIA. Cependant, les souches actuelles
de S. pristinaespiralis sont incapables de réaliser la bioconversion totale de PIIB en
PIIA et la modification par génie génétique de cette souche a permis de la réaliser.
Pristinamycine IIB Pristinamycine IIA
FMN reductase
NADH + H
+
+ FMN --------------------------à NAD
+
+ FMNH
2
PII
A
sybthase
PII
B
+ FMNH2 + O2 --------------------------à PII
A
+ FMN + 2H
2
O
Figure VI.4
La pristinamycine produite naturellement par S. pristinaespiralis est constituée
d'un mélange de deux composants, la pristinamycine I et la pristinamycine II. Cette
dernière est elle-même un mélange de deux molécules : la PIIA, produit final de la
voie de biosynthèse, et la PIIB, précurseur de la PIIA. L'un des composants de la
forme soluble est obtenu par oxydation chimique de la PIIB. Les souches de S. pris-
tinaespiralis sont incapables de réaliser naturellement la bioconversion totale de
60
PIIB en PIIA. Industriellement parlant, il était souhaitable d'obtenir uniquement le
composé PIIA.
Afin d’obtenir une composition totalement soluble, les chercheurs ont introduit
dans une souche de S. pristinaespiralis, par génie génétique, les gènes snaA et
snaB de S. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la
conversion de PIIB en PIIA). La souche de S. pristinaespiralis, nouvellement cons-
truite, est capable de réaliser complètement cette conversion et ne synthétise que le
dérivé PIIA. L'idée de base était que la surexpression de gènes snaA et snaB de S.
pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de
PIIB en PIIA) permettrait une conversion totale. Cette surexpression pouvait être
obtenue en réintroduisant ces gènes sous contrôle d'un promoteur fort dans une
souche de S. pristinaespiralis. L'équipe de Rhône-Poulenc-Rorer a isolé et caracté-
risé les gènes en question.
Processus :
1 - Utilisation d’éléments intégratifs originaux de S. ambofaciens, pSAM2, généti-
quement propres aux Actinomycètes. Ces éléments sont appelés intégratifs car ils
portent des gènes qui permettent une intégration très efficace à un site spécifique
dans le chromosome de la bactérie hôte. Dans le vecteur pSAM2, on intégra les
transgènes du S. pristinaespiralis dont on souhaite l’expression. Ce chimère est une
construction stable. L'ADN intégré dans le chromosome grâce à ce type de vecteurs
est très stable et est transmis à toutes les cellules filles.
2 – clonage de deux gènes snaA et snaB sous contrôle d'un promoteur de transcrip-
tion fort (ermE promoter) dans des vecteurs intégratifs dérivés de pSAM2
3 – Introduction de la construction contenant les deux gènes snaA et snaB dans S.
pristinaespiralis.
4 - La souche ainsi construite est stable dans les conditions industrielles et synthé-
tise de la pristinamycine qu’on extrait et qu’on purifie en vue d’une utilisation théra-
peutique.
5 - Ces résultats montrent que les vecteurs employés sont maintenus de façon sta-
ble en l'absence de pression de sélection, et qu'ils permettent d'éviter les problèmes
d'instabilité structurelle ou ségrégationnelle souvent rencontrés avec des vecteurs
réplicatifs chez Streptomyces. Ils montrent également que la quantité de PIIA syn-
thétase était bien le seul facteur limitant la conversion totale de PIIA en PIIB et qu'il
est possible de réaliser cette conversion sans affecter le niveau total de production.
Référence :
- Sezonov G., Blanc V., Bamas-Jacques N., Friedmann A., Pernodet J.-L. et Guérineau M., 1997.
Complete conversion of antibiotic precursor to pristinamycin IIA by overexpression of Streptomyces
pristinaespiralis biosynthetic genes. Nature Biotechnology, 15, 349-353, 1997.
61
VII – PRODUCTION DES ALIMENTS FERMENTÉS PAR DES
MICRO-ORGANISMES TRANSGÉNIQUES
Depuis fort longtemps, l’homme consomme des aliments fermentés comme le
pain, le fromage, le yoghourt et aussi des boissons fermentées comme la bière, le
vin, le cidre, le dolo.
Ces fermentations sont le résultat du métabolisme des bactéries fermentaires
comme, Lactobacillus delbruekii, Lactobacillus heveticus, Lactobacillus casei, Lacto-
bacillus acidophilus, Lactobacillus lactis,Pediococcus acidilacticus et des levures
comme Saccharomyces cerevitiae.
1. La production de fromage
La présure est une enzyme produite par la caillette des veaux qui coupe la
caséine pour provoquer la coagulation du lait. La production du lait caillé constitue
la première étape dans la production du fromage. Il faut beaucoup de présure pour
la fabrication du fromage alors que sa production par les veaux n’est pas suffisante.
En appliquant la technique de l’ADN recombinant aux bactéries lactiques ou
aux levures, on a pu améliorer la qualité des aliments fermentés. Pour cela, on a
cloné le gène de la présure de veau dans un vecteur d’expression qu’est Saccharo-
myces cerevisiae qui produit alors de la présure de levure. On peut également utili-
ser une bactérie lactique en fonction de son métabolisme et de la rentabilité.
2. La production de la bière
Le moût du malt (comme de mil rouge) est un mélange de mono, di, tri poly-
saccharides et de dextrines qui proviennent de l’hydrolyse de l’amidon par les amy-
lases. Saccharomyces cerevisiae peut faire fermenter tous les polysaccharides sauf
les dextrines qui constituent cependant 22% des hydrates de carbone des céréales
utilisées (orge, seigle, riz, maïs, mil…) pour la production de la bière. Pour améliorer
le goût et la limpidité de la bière, on peut procéder comme suit :
Amélioration du goût de la bière : Saccharomyces diastaticus possède des
enzymes qui dégradent les dextrines pour donner du glucose fermentescible. C’est
le gène DEX qui code pour l’amidon-q-1,4-glucosidase. Ce gène est cloné dans
Saccharomyces cerevisiae pour augmenter la teneur en glucose et donc en éthanol
par fermentation. Le goût de la bière se trouve ainsi amélioré.
Amélioration du goût et de la limpidité de la bière : Aspergillus abwamori
est un champignon qui produit une enzyme : « la glucoamylase » qui dégrade
l’amidon brut en glucose. En clonant les deux gènes responsables de la formation
de ces enzymes dans Saccharomyces cerevisiae on améliore et le goût par
l’hydrolyse de l’amidon et la limpidité de la bière par l’hydrolyse des protéines.
62
CHAPITRE VII: LE GENIE GENETIQUE APPLIQUE AUX VEGETAUX
Les plantes transgéniques
L’avènement de la technologie de l’ADN recombinant a introduit une dimen-
sion nouvelle dans la recherche, parce qu’elle permet désormais de modifier le gé-
nome presque à volonté. L’amélioration n’est plus limitée à la sélection de variants
au sein d’une espèce par la génétique classique. Il est alors possible d’introduire
dans le génome d’une plante de l’ADN provenant d’autres espèces végétales,
d’animaux ou même de bactéries. Le plasmide Ti constitue l’exemple classique pour
les études des plantes transgéniques. Figure VII.1 : Plasmide Ti
I . LE PLASMIDE TI:
1- Définition et action du plasmide Ti dans la nature :
Le plasmide Ti (Tumor Inducing) dérive d’une bactérie du sol appelée Agro-
bacterium tumefaciens. Cette bactérie provoque chez les plantes qu’elle infecte une
maladie du nom de « gale » du collet.
Figure VII.2: Infection par l’agrobacterium tumefaciens.
Les plantes infectées présentent des lésions constituées de cellules dont la
croissance est incontrôlée (des tumeurs ou gales), généralement localisées à la
base (ou collet) de la plante. La production de la tumeur est déterminée par un
grand plasmide circulaire de 200 kb présent dans la bactérie, le plasmide Ti. Lors-
que le plasmide Ti est inséré dans l’ADN chromosomique de la plante, une partie de
son ADN appelé « ADN-T » inséré dirige alors la synthèse d’hormones végétales
qui perturbent la régulation de la croissance des cellules infectées de la plante (ce
qui donne lieu à la formation d’une tumeur) ainsi que la synthèse de nopaline qui
peut être utilisée comme source de carbone et d’azote par la bactérie (symbiose).
Lors de l’infection, la partie du plasmide, appelée « ADN-T », est transférée
dans la plante et insérée au hasard dans le génome cellulaire. La séquence ADN-T
contient:
> des gènes qui codent pour des hormones de croissance végétales et sont
responsables de la tumorisation des cellules de la plante,
> des gènes qui codent pour des enzymes qui conduisent les cellules tumo-
rales à synthétiser des substances appelées opines (nopaline et octopine).
Les gènes qui contrôlent la synthèse des hormones et des opines (nos, ocs)
sont exprimés dans la plante à partir de séquences régulatrices eucaryotes. Par
contre, ceux qui contrôlent la synthèse des enzymes de dégradation des opines
(noc, occ) se trouvent dans la bactérie sous le contrôle de séquences régulatrices
procaryotiques.
Figure VII.3: Processus d’Infection
63
2. Utilisation du plasmide Ti comme vecteur en génie génétique.
En principe, tout fragment d’ADN cloné au sein de l’ADN-T peut comme lui
s’insérer de façon stable dans le génome de la plante qui le reçoit. Le plasmide Ti
est très grand pour les manipulations. Il faut donc construire des dérivés plus petits
qui contiennent l’essentiel de l’ADN-T et l’ADN d’intérêt. On peut construire un plas-
mide intermédiaire par le processus suivant :
Un vecteur intermédiaire qui contient:
• deux segments d’ADN-T qui portent les fragments L et R de la nopaline,
• un marqueur de sélection bactérien de résistance à la spectinomycine
(spc
R
)
• un marqueur de sélection bactérien de résistance à la kanamycine (kan
R
).
• ce vecteur intermédiaire doit posséder des sites de restriction pour l’étude
de l’ADN cloné. (CF Photocopies)
Construire un vecteur Ti désarmé:
• on retire toute la région droite de l’ADN-T, y compris les gènes inducteurs
de tumeurs qui constituent l’aspect gênant de l’ADN-T.
• Ti désarmé conserve l’extrémité gauche (L) de l’ADN-T qui servira de site
de recombinaison pour l’intégration du vecteur intermédiaire.
Les bactéries qui contiennent le plasmide co-intégrat (qui est le résultat de
la fusion du plasmide désarmé et du vecteur intermédiaire), peuvent être utili-
sées pour inoculer des fragments du tissu végétal comme par exemple de petits dis-
ques de feuille.
Si l’infection par la bactérie réussit, son ADN-T sera transféré aux cellules
végétales et tout l’ADN localisé entre les extrémités droite et gauche de l’ADN-T
s’intégrera dans un chromosome de la plante.
Si on place les disques de feuilles sur un milieu nutritif qui contient de la ka-
namycine, seules les cellules qui contiennent l’ADN-T, pourront se multiplier.
La croissance de ces cellules donne lieu à la formation d’un petit amas ou cal,
qui constitue la preuve que les cellules de plantes ont été transformées. Ces cals
peuvent donner des radicelles et fournir par la suite, des plantes transgéniques.
Figure VII.4: Génération de disques de feuilles
3. Expression de l’ADN intégré.
Qu’en est-il de l’expression de l’ADN intégré en même temps que l’ADN-T? Il
peut s’agir de n’importe quel ADN dont on veut tester l’expression dans la plante
prise comme hôte. Dans tous les cas, il faut utiliser un gène d’expression « gène
indicateur » dans le vecteur pour suivre la manifestation de l’ADN intégré. Un cer-
tain nombre de ces gènes indicateurs sont utilisés actuellement avec succès :
64
> L’enzyme luciférase catalyse la réaction d’une substance appelée lucifé-
rine avec ATP. Cette réaction s’accompagne d’une émission de lumière et c’est ce
qui explique la luminescence de la luciole en vol.
> Une plante de tabac transgénique par exemple qui exprime le gène de la
luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de lucifé-
rine.
> Le gène de la luciférase peut donc être utilisé comme indicateur pour étu-
dier, au cours du développement, la régulation de l’expression de l’un ou l’autre
gène de la plante ou de l’ADN intégré.
Le processus est le suivant:
• On fusionne les séquences régulatrices localisées en amont de n’importe
quel gène intéressant au gène de structure de la luciférase,
• La construction est introduite dans une plante en utilisant l’ADN-T.
• L’expression de la luciférase suivra le schéma d’expression du gène dont on
a utilisé la séquence régulatrice.
• L’expression de la luciférase est alors observable en badigeonnant la plante
avec de la luciférine et en observant la luminescence.
Autres indicateurs utilisés dans les plantes:
• Le gène bactérien « gus » qui code pour la β-glucuronidase. Cette enzyme
produit une coloration bleue par hydrolyse du substrat X-gluc.
• Le gène bactérien « lacZ » qui code pour la β-galactosidase. Cette enzyme
produit une coloration bleue par hydrolyse du composé X-gal.
II – LE TERMINATOR CHEZ LES SEMENCES
Le concept Terminator, auquel correspond un brevet détenu par la compagnie
Monsanto, désigne une technique consistant à introduire un transgène, un gène
exogène tueur qui empêche le développement du germe du grain récolté: la plante
se développe dans les conditions habituelles, donne une récolte normale, mais elle
produit un grain biologiquement stérile.
La technologie fonctionne avec trois gènes et un inducteur chimique:
- Le gène I est un répresseur qui code pour une protéine régulatrice qui se fixe
sur un site opérateur en amont des gènes de structure et inhibe leur trans-
cription. La protéine régulatrice du gène I se fixe sur le « binding site » du
gène II
Gène répresseur
GENE I :
Protéine régulatrice
Répresseur
- Le gène II de l’enzyme recombinase est placé sous le contrôle d’un promo-
teur. Entre le Promoteur et le gène de la recombinase se trouve le « binding
site ». Le gène II produit une enzyme de restriction qui coupe et excise l’ADN
« blocker » du gène III.
Promoteur Binding site gène codant l’enzyme
65
GENE II :
- Le gène III produit une toxine qui est létale pour l’embryon. Ce gène est sous
le contrôle d’un promoteur tardif qui est activé seulement durant le dévelop-
pement de la graine, lors de la croissance de l’embryon. Entre le promoteur
tardif et le gène III se trouve l’ADN « blocker » qui favorise, s’il est excisé, la
transcription et l’expression du gène toxine, produisant la toxine qui tue
l’embryon rendant ainsi stérile les nouvelles semences pour la reproduction.
GENE III :
Promoteur tardif blocker gène de la toxine
- L’inducteur chimique est répandu sur les semis par les compagnies de se-
mences comme Monsanto et Syngeta afin d’activer le gènes II et le gène III.
Une fois ces gènes activés dans ces semences, nous pouvons avoir la pro-
duction mais pas le reproduction.
Processus d’activation du gène terminator dans les semences de vente aux agri-
culteurs :
1 – Introduction de l’inducteur (par exemple du tétracycline) dans les semences,
2 – L’inducteur bloque le « binding site » au niveau du gène II et empêche le
répresseur de se lier,
3 – L’ARN polymérase se lie au promoteur et entame la transcription du gène de
la recombinase
(isomérase) en ARN à synthèse de l’enzyme recombinase.
4 – La recombinase taille et excise la séquence « blocker »,
5 – L’ARN polymérase se lie au « late promoteur » et transcrit le gène de la toxine,
à synthèse de la toxine qui tue les embryons des graines avant les récoltes.
(Schéma) :
66
Inducteur
Graine
Gène répresseur
GENE I :
Protéine régulatrice
Le répresseur se délie
Promoteur gène codant l’enzyme recombinase
GENE II :
Binding site
Synthèse de l’enzyme recombinase
gène de la toxine
GENE III :
Promoteur tardif
blocker
Synthèse de la toxine qui tue l’embryon
Figure VII.5 : Processus d’activation du Terminator
NB. En absence de l’inducteur, le répresseur se lie au « binding site » et empeche la
transcription du gène de la recombinase. Dans ce cas tout est bloqué car il n’y a pas
de recombinase pour exciser la séquence « blocker » et par conséquent, il n’y a pas
de toxine qui puisse tuer les embryons des semences.
67
GENE I :
Protéine régulatrice
Répresseur
Promoteur gène codant l’enzyme recombinase
GENE II :
Binding site
Pas de synthèse de l’enzyme recombinase
gène de la toxine
GENE III :
Promoteur tardif
blocker Pas de production de la toxine
Figure VII.6 : En absence de l’inducteur, le gène codant pour la recombinase
ne transcrit pas.
68
III . L’APPLICATION DU GÉNIE GÉNÉTIQUE À L’AGRICULTURE:
Les applications sont et deviendront de plus en plus nombreuses en fonction
de l’évolution des connaissances des caractéristiques génétiques des plantes et des
réserves humaines contre les OGM. La problématique des OGM est que le gène
TERMINATOR inséré, à travers les techniques du génie génétique, dans le génome
de ces végétaux fait que leurs graines ont seulement une capacité de production et
non de reproduction. L’agriculteur doit toujours dépendre de ces maisons de fabrica-
tion des semences qui ont le brevet. Nous en donnons quelques exemples qui fonc-
tionnent déjà dans ce siècle.
1: L’enzyme luciférase :
L’enzyme luciférase catalyse la réaction de la luciférine avec l’ATP. La réac-
tion s’accompagne d’une émission de lumière et c’est ce qui explique la lumines-
cence de la luciole en vol (la luciole produit cette enzyme d’où son nom). Cette en-
zyme est actuellement utilisée pour suivre la régulation et le génotype du tabac.
Une plante de tabac transgénique qui exprime donc le gène de la luciférase
s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine.
Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier,
au cours du développement, la régulation de l’expression de l’un ou l’autre gène de
la plante ou de l’ADN intégré.
2. Le maïs transgénique
Chaque année les agriculteurs du monde entier perdent 1/10 de leurs récol-
tes de maïs à cause des insectes nuisibles. Le maïs transgénique contient dans son
génome un gène qui code pour une protéine que détestent les insectes et qui en
principe ne doit pas causer de nuisances à l’homme. Cette variété augmente donc le
rendement en éliminant le facteur insecte.
3. Les tomates « flavrsavr »
Ces tomates transgéniques contiennent un gène freinant le mûrissement du
fruit, ce qui leur confère une meilleure résistance au transport et une longue conser-
vation.
Désormais avec l’avènement du génie génétique, non seulement la qualité
des espèces animales et végétales peut être améliorée, mais ces organismes trans-
géniques sont utilisés comme des usines pour produire des protéines « utiles » co-
dées par des gènes d’organismes étrangers.
4. La protection des plantes contre l’infection virale
69
Les virus des plantes représentent un sérieux problème pour l’agriculture car
leurs infections entraînent une diminution de la croissance des plants, du rendement
des récoltes et de leur qualité. Le virus de la mosaïque du tabac (TMV) infecte les
plants de tabac. Une plante transgénique qui exprime la protéine du manteau (coat
Protein : CP) du TMV résiste aux infections par ce virus. La plante transgénique est
déjà produite aux Etats-Unis.
Figure VII.7: production de la protéine CP
5. Lutte contre les insectes ravageurs
Chaque année des milliards de dollars de récoltes sont perdues à cause des
insectes. Les armes les plus utilisées pour lutter contre les insectes sont « les in-
secticides et les pesticides » qui posent actuellement de graves problèmes de
pollution à l’environnement.
_ Le Baccilus thuringensis (Bt), lors de sa sporulation, produit une protéine
cristallisée toxique contre les larves d’un certain nombre d’insectes ravageurs des
cultures et qui ne semble pas être nocive pour les vertébrés. Les plants transgéni-
ques de tabac, de tomates et de coton qui expriment le gène de cette toxine résis-
tent aux larves des insectes.
_ L’utilisation de l’expression transgénique d’inhibiteurs de sérines protéases
des systèmes digestifs des insectes dans les tomates, la pomme de terre, le petit
pois et autres céréales protègent aussi les plantes contre les insectes nuisibles.
Figure VII.8: production de la protéine Bt
6. Eradication des mauvaises herbes et plantes transgéniques tolérantes aux
herbicides
Le glyphosate est la substance active de l’herbicide commercial « Roundup »
beaucoup utilisé à l’heure actuelle. Ce produit tue les plantes en inhibant la 5-
énolpyruvylshikimate-3-phosphate synthétase (EPSPS), une enzyme du chloro-
plaste qui intervient dans la biosynthèse des acides aminés essentiels. Une plante
transgénique qui porte un gène de résistance au glyphosate pousse quatre (4) fois
plus vite en présence de cet herbicide. L’Insertion réussie du gène bactérien de la
résistance au glyphosate a conféré à la plante transgénique une résistance à
l’herbicide et lui permet de survivre à des épandages normaux de glyphosate.
Figure VII.9: résistance aux herbicides
7. Production d’ammoniac (NH
4
) et de nitrate (HNO
3
) par les plantes
Les plantes courantes ne sont pas capables d’assimiler directement l’azote
moléculaire (N
2
). Les paysans américains et européens dépensent chaque année un
peu plus de huit cents milliards des francs CFA pour la fertilisation de leurs champs
par un épandage d’engrais composé essentiellement de sel d’ammonium (NPK). On
peut donc fabriquer des plantes transgéniques capables d’utiliser directement
l’azote moléculaire par le processus théorique suivant :
70
Le gène nif (nitrogen-fixation apparatus) permet à la bactérie Rhizobium des
légumineuse de fixer directement l’azote moléculaire pour donner des sels
d’ammonium (Nitrate, Nitrite, Ammonium). Ce sera le gène d’intérêt.
Le gène nif est inséré dans le plasmide Ti de la bactérie Agrobacterium tume-
faciens
La plante d’intérêt est alors transformée par ce plasmide
Les cellules tumorales de la plante transformée sont prélevées et cultivées in
vitro puis transférées sur différents terrains sous serre.
Les plants capables de pousser rapidement sans un apport d’engrais sont
ceux capables de fixer l’azote moléculaire
Un gène marqueur permet de sélectionner les plants ayant intégré le plas-
mide avec le gène nif.
8. Production d’anticorps monoclonaux par les plantes
Les plantes peuvent aussi servir de bio-réacteurs pour la production
d’anticorps. Cet aspect représente un intérêt commercial pour la production de pro-
téines parmi lesquelles les anticorps monoclonaux. L’expérience réussie a utilisé
une chaîne lourde (H) et une chaîne légère (L) dans deux expériences séparées
pour transférer les gènes des anticorps par l’intermédiaire de l’ADN-T dans deux
plants de tabac. Les plantes transgéniques contenant les gènes des chaînes lourde
et légère ont été croisées afin de produire une descendance contenant les deux gè-
nes. Les feuilles de ces plantes produisent l’anticorps monoclonal inséré (environ
1,5% des protéines traduites).
Figure VII.10: Production d’anticorps monoclonaux
9. La production de la taumatine
La taumatine est un aliment très sucré et même plus doux que le saccharose.
elle est produite par une plante : « Thaumatococcus danielli » qui pousse en Afrique
occidentale. Ce peptide, composé de 207 acides aminés constitue une source im-
portante pour l’apport en acides aminés dans l’alimentation en plus de sa saveur.
Elle est actuellement produite par des bactéries suivant le protocole ci-après :
Il a été construit une molécule chimère ayant des séquences des plasmides
pCI62-8, pBS42, pCI72 et qui porte le gène « tau ».
Cette construction chimère est utilisée pour transformer Bacillus subtilis.
Bacillus subtilis transformé synthétise la taumatine.
Une extraction, suivie d’une purification donne de la taumatine pure
71
CHAPITRE VIII: LE GENIE GENETIQUE APPLIQUE AUX ANIMAUX
I - LES INSECTES TRANSGÉNIQUES
1. Les drosophiles transgéniques.
Dans la drosophile, on a trouvé trois catégories de séquences d’ADN qui ont
la faculté de se transposer, c’est à dire de se déplacer dans le génome d’un chro-
mosome à l’autre. Ce sont des transposons. Les mieux étudiés sont :
• les éléments du type copia : Il existe au moins sept (7) familles d’éléments
de type copia dont la longueur varie de 5 à 8,5 kb. Les membres de ces différentes
familles sont au nombre de 10 à 100 exemplaires par génome. Les éléments de type
copia contiennent deux longues séquences terminales en répétition directe et de
courtes séquences répétées de manière inverse et imparfaite.
• les éléments à rabat ou type FB (pour fold-back) : Ces éléments sont
longs de quelque centaines à quelques milliers de paires de bases. Ils contiennent
tous de longues extrémités en répétition inverse. L’élément peut se rabattre sur lui-
même lors des expériences de renaturation thermique d’ou son nom de rabat. Ce
type d’élément provoque des réarrangements chromosomiques lors de son insertion
et de son excision.
• les éléments P : D’une longueur égale à environ 2,90 kb, Ils portent à leurs
extrémités une séquence répétée inversée de 31 paires de bases. La partie centrale
possède trois cadres ouverts de lecture et peut coder pour au moins trois protéines
dont la transposase et le répresseur de la transposase.
â Les éléments P permettent d’avoir des drosophiles transgéniques
Les éléments P sont des transposons qui sont capables de changer de locali-
sation dans le génome. L’élément P peut donc être facilement utilisé en génie géné-
tique. Ils codent pour une enzyme nommé « transposase », responsable des dépla-
cements de cet ADN dans tout le génome. Ils peuvent donc être utilisés pour :
• effectuer des mutagenèses,
• transférer des gènes spécifiques dans des mouches d’un génotype donné.
Le processus suivant permet d’étudier la génétique moléculaire des mouches
72
a - On injecte dans un embryon de drosophile l’ADN d’un plasmide bactérien
qui contient un élément P dans lequel on a cloné un gène ry
+
de la drosophile (ce
gène donne la coloration rose de l’oil) mais ayant subi une délétion partielle. Cet
élément P modifié ne peut plus se transposer à cause de la délétion.
b - On injecte dans le même embryon (co-injection) de l’ADN qui contient
l’élément P normal qui pourra fournir la « transposase » à la copie du transposon P
contenant la délétion.
Les mouches issues de cet embryon ont toujours le phénotype ry
-
, mais dans
leur descendance, on retrouve une grande proportion d’individu ry
+
. Le gène ry
+
nouvellement acquis montre une hérédité mendélienne et stable, ce qui suggère
qu’il est bien localisé sur un chromosome. L’hybridation in situ montre que le gène
ry
+
(P modifié) et l’élément P normal se retrouvent en différentes positions sur diffé-
rents chromosomes et non à la position normale du locus rosy. Le transposon nor-
mal P a donc fourni la transposase pour permettre l’insertion du transposon anormal
contenant le gène ry
+
.
2. Bio-insecticide et lutte contre le paludisme
En 1976, un entomologiste israélien remarqua une grande quantité de larves
d’insectes mortes dans le désert de Negev au demeurant très infesté par les mousti-
ques et les mouches responsables de deux grands fléaux. Après une étude appro-
fondie au laboratoire, il s’aperçut que les bactéries du genre Bacillus thuringiensis
subsp. israelensis présentes dans les lacs de ce désert tuaient systématiquement
les larves des moustiques et des mouches. A partir de cette découverte, une nou-
velle stratégie de lutte contre l’anophèle et la glossine vecteurs du plasmodium et du
trypanosome a débuté en utilisant la stratégie suivante :
Une production de bio-insecticides par Bacillus thuringiensis capables de tuer
les larves des mouches et des moustiques
Une utilisation des moyens de transport aérien (hélicoptères) pour la pulvéri-
sation de ces bio-insecticides au niveau des fleuves et des plans d’eau infestés par
ces insectes vecteurs.
II - LES ANIMAUX TRANSGÉNIQUES :
1. Les souris transgéniques
Figure. VIII.1
On peut actuellement insérer n’importe quel gène dans la souris afin d’obtenir
l’expression génique de ce transgène. Dans cette transgenèse, la souris qui intègre
par exemple le gène de l’hormone de croissance humaine (GH) acquiert une masse
énorme double ou triple par rapport à ses sours jumelles. Ce type de démarche
peut être appliqué à tous les mammifères pour accroître leur rendement en poids et
donc en intérêt économique.
73
Les organismes transgéniques peuvent être produits par l’injection de vec-
teurs dans des oufs fécondés et réimplantés dans les femelles. Au cours de
l’embryogenèse l’ADN exogène se fraie son chemin jusqu’aux cellules germinales et
se comporte désormais comme un gène endogène. Il passe donc à la descendance
comme un gène nucléaire normal.
On peut aussi transférer l’embryon possédant le transgène dans l’utérus
d’une souris saine pseudo-gestante. La souris qui sera mise bas portera les caractè-
res du transgène mais pas les autres sours.
2. Les bovins transgéniques
La trypanosomiase est causée par un protozoaire parasite qui est transmis
par un insecte vecteur « la glossine hématophage » ou encore « mouche tsé-tsé ».
Le trypanosome empêche la majeure partie des races bovines d’habiter une superfi-
cie de près de dix millions de Km
2
en Afrique. Cette zone qui est la plus fertile du
continent est plus vaste que les Etats-Unis d’Amérique. Le trypanosome possède
des antigènes de surfaces VSGs (glycoprotéines superficielles variables) dont les
gènes mutent à chaque phase de son développement. C’est pour cette raison que
les bovins n’arrivent pas à élaborer des anticorps contre ces types d’antigènes qui
changent constamment de conformation tridimensionnelle par mutation génétique du
protozoaire. (Colonisation du milieu ou Evolution ?).
> Lorsque la mouche tsé-tsé inocule le trypanosome dans un bovin,
l’organisme de ce dernier réagit et synthétise les premiers anticorps pouvant réagir
avec les antigènes présents sur la membrane du trypanosome (VSGs).
> Lorsque le système immunitaire du bovin est en mesure d’éliminer totale-
ment les trypanosomes, les dernières cellules qui survivent changent leurs man-
teaux protéiques antigéniques et se transforment en un second type de parasite.
> L’organisme du bovin se prépare alors de nouveau pour combattre le nou-
veau parasite en secrétant de nouveaux anticorps. Mais dès que le parasite
s’aperçoit qu’il est en train d’être totalement exterminé, il se transforme de nouveau
en un second parasite.
> De cette manière, le trypanosome échappe à la défense immunitaire de
son hôte par des mutations et recombinaisons successives.
Beaucoup d’études récentes ont montré que certaines races bovines résistent
bien à l’infection par le trypanosome. Ce type de résistance, appelée « trypano-
tolérance », se rencontre dans les populations bovines d’espèce Bos taurus, locali-
sée en Afrique occidentale. La race N’Dama, caractérisée par de longues cornes et
une absence de bosse en est un exemple.
Ce type de bovin domestique et d’autres animaux sauvages comme le « buf-
fle » qui ont vécu en Afrique depuis plus de 5 000 ans a.C. ont développé des résis-
tances contre les attaques du trypanosome et sont par conséquent adaptés au mi-
lieu infesté par le parasite.
74
L’espèce bovine comme Bos indicus qui est actuellement très répandue en
Afrique, est arrivée dans ce continent avec l’invasion arabe vers les années 660 p.C.
Elle n’est pas « trypano-résistante »
Cependant, l’économie de plusieurs pays africains est actuellement fondée
sur l’élevage de ces bovins qui ne sont plus trypano-tolérants. Pour leur conférer
cette résistance, on peut employer deux stratégies :
Stratégie I. :
> Identifier le gène qui confère la résistance aux trypanosomes chez les bo-
vins de la race D’Dama
> Cloner ce gène dans un vecteur
> Transférer le vecteur dans des cellules bovines de l’espèce Bos indicus
pour leur conférer la trypano-tolérance.
Stratégie II :
> Importer des embryons de la race N’Dama trypano-tolérante
> Les implanter dans les utérus de femelles de la race Bos indicus sensible à
l’infection
> Réaliser ensuite des croisements des descendances pour disséminer les
gènes de tolérance.
3. Les moutons transgéniques.
On peut manipuler les animaux domestiques non seulement pour améliorer
leurs qualités intrinsèques mais aussi pour produire des protéines étrangères.
Une protéine dont les propriétés thérapeutiques intéressent l’industrie phar-
maceutique est produite dans le lait de moutons transgéniques. Le gène en question
code pour l’activateur tissulaire du plasminogène qui sert à dissoudre les caillots
sanguins chez l’être humain.
Figure VIII.2: Production du plasminogène
La démarche technologique utilisée et réussie est la suivante :
1 - On a placé le gène dans un plasmide, sous le contrôle du promoteur de la
β-lactoglobuline, qui n’est exprimée que dans les tissus mammaires.
2 - Le vecteur d’expression est micro-injecté dans le pronoyau des ovules de
mouton.
3 - Les ovules injectés sont implantées dans des mères porteuses.
4 - Les descendances qui expriment le transgène sont identifiés par amplifica-
tion PCR d’un segment d’ADN chromosomique en utilisant des amorces correspon-
dants à des séquence interne du gène d’intérêt.
5 - Les moutons transgéniques n’expriment ce gène que dans leurs tissus
mammaires et sécrètent alors des quantités importantes de la protéine correspon-
dante dans leur lait à partir duquel la protéine d’intérêt est purifiée.
4 – Le porc transgénique
75
Pour pallier le manque d'organes: xénotransplantation avec le porc.
Le problème majeur qui empêche la réalisation des xénogreffes d'organes aujour-
d'hui est l'existence du rejet hyper aigu qui survient entre les espèces animales phy-
logéniquement distantes. En effet, il serait tout à fait possible de réaliser des xéno-
greffes d'organes à partir de primates supérieurs (chimpanzés) mais cette possibilité
semble peu réalisable car ces espèces animales sont protégées et représentent une
source incontrôlable de transmission de virus à l'homme (Ebola, SIV…) La protéine
DAF (Decay Accelerating Factor) neutralise le complément des primates et favorise
les greffes d’organes.Tandis que dans les greffes allogéniques on utilise surtout
les médicaments immunosuppresseurs comme la cyclosporine pour lutter contre le
phénomène de rejet.
Figure VIII.3 : LE PORC TRANSGéNIQUE.
76
CHAPITRE IX:
CLONAGE DES MAMMIFÈRES, PARTHÉNOGENÈSE, CELLULES SOUCHES
EMBRYONNAIRES (EMBRYONIC STEM CELLS) ET THÉRAPIE GÉNIQUE.
I. - LE CLONAGE DES ORGANISMES ENTIERS:
Un clone de mammifère est une copie génétique d'un organisme entier. Dolly
(première brebis clonée en Angleterre), est un clone de sa mère, ou de ses gènes.
Comme les brebis, les hommes vont-ils eux aussi passer à la "photocopieuse
La technique du clonage est relativement simple dans son principe. Dans le
cas de la brebis Dolly, on a prélevé une cellule dans le pis d'une brebis de race Finn
Set à face blanche. On a prélevé également un ovule sur une autre brebis et on lui a
enlevé le noyau qui contient le bagage génétique. Pourquoi un ovule? Pour qu'il de-
vienne éventuellement un embryon. À l'aide d'un choc électrique, on a fusionné in
vitro la cellule du pis qui contient tous ses gènes et l'ovule vidée de tout matériel
héréditaire.
C'est la raison pour laquelle Dolly n'aura pour tout bagage génétique que ce-
lui que contenait la cellule du pis. L'ovule ainsi " électrisé " se divise et le processus
de vie s'enclenche. Après s'être divisée un nombre suffisant de fois, l'embryon
(stade blastula) est placée dans l'utérus d'une brebis porteuse. Dolly est née de
cette technique, identique en tous points à la brebis qui a fourni la cellule du pis.
Le processus du clonage d'un organisme entier est simple:
a - On prend une cellule ouf et on la vide de son noyau.
b - On prélève le noyau d'une cellule que l’on veut cloner et on le met dans
l'ouf privé du noyau
c - implantation dans l’utérus d’une porteuse
d - L’organisme qui naît porte les caractères du noyau transféré donc de
l’organisme cloné. Cependant certains caractères de l’ouf restent présents à cause
du matériel génétique contenu dans les mitochondries.
Figure IX. 1 : Clonage de Dolly
77
II. LES CELLULES ES (EMBRIONIC STEM CELLS)
OU CELLULES EMBRYONNAIRES PLURIPOTENTES).
Le 6 novembre 1998, le New York Times titrait : « Des scientifiques isolent les cellu-
les à lorigine de la vie ». En effet, en fin 1998, deux équipes de recherches différentes
découvraient presque simultanément avec des méthodes distinctes les cellules souches
embryonnaires, « Embryonic Stem » (ES). L’une travaillait sur des blastocystes des
embryons précoces de moins de sept jours () et l’autre équipe sur des cellules germina-
les primitives ovogonies et spermatogonies (). Chacune de ces cellules ES a la potentiali-
té de devenir n'importe quel tissu du corps humain: cour, muscles, sang, os, cheveux,
nerfs (). D'où leur mystère, leur importance biomédicale et la fascination des biologistes.
Ce sera une technique de photocopie magique pour reproduire un individu à volonté et
en plus, ce système offrira un fond inestimable de pièces de rechange d’organes
humains !
A – Qu’est-ce qu’une cellule souche ?
Une cellule souche est une cellule indifférenciée qui reste capable de se divi-
ser de façon autonome tout au long de la vie, assurant le renouvellement des cellu-
les d’un individu. La division d’une cellule souche produit deux nouvelles cellules :
une cellule souche de « réserve » et une cellule s’engageant dans un processus de
différenciation qui la conduira à remplir une fonction précise.
Tous les êtres vivants pluricellulaires possèdent des cellules souches. Elles
sont à l’origine de tous les tissus et en assurent le renouvellement (remplacement
des cellules disparaissant par vieillissement ou par lésion). Les cellules souches
sont à l’origine de la régénération des membres chez certains animaux (lézards, tri-
tons, etc.). Chez les plantes, elles favorisent le processus du bouturage. Ainsi à
partir d’une seule cellule peut être créée une plante entière.
Nous distinguons quatre catégories de cellules souches en fonction de la diversité
des types cellulaires auxquels elles peuvent donner naissance :
1 - Les cellules souches totipotentes : A elles seules, elles peuvent conduire au
développement d’un être humain. Il s’agit de l’ouf fécondé et des cellules de
l’embryon des premiers jours de sa croissance (morula de 2 à 8 cellules). Avant le
septième jour, cet embryon qui est un blastocyste a au plus 8 blastomères. Il est dé-
jà composé de trois parties : le trophoblaste constitué de blastomères périphériques
(grosses cellules résultant des premières divisions de l’ouf fécondé), la masse cel-
lulaire interne (MCI) constituée d’autres blastomères plus centraux, et le blastocèle
qui est une grande cavité remplie de liquide à l’intérieur de l’embryon. Le tropho-
blaste et la masse cellulaire interne donneront respectivement : le placenta et
l’ensemble de l’embryon. Quant au blastocèle, il est appelé à régresser lors de
l’embryogenèse par l’agrandissement de la cavité amniotique de l’embryon. Spéci-
fions que c’est au stade de cellules souches totipotentes que l’on peut pratiquer le
clonage reproductif par scission embryonnaire.
78
2 - Les cellules souches pluripotentes : Précisons tout de suite quelque chose
d’absolument essentiel qui doit être en permanence dans l’esprit : les cellules sou-
ches pluripotentes qui constituent la masse interne sont destinées à former tous les
tissus de l’organisme mais ne peuvent à elles seules aboutir à la formation d’un indi-
vidu complet car elles ont perdu, à ce stade, la faculté de produire le trophoblaste,
précurseur du placenta. Le placenta a pour fonction de nourrir l’embryon et de le
protéger de tout rejet par le système immunitaire. Les cellules de la masse cellulaire
interne, bien que pouvant donner toutes les cellules de l’organisme, sont incapa-
bles, si on les réimplante dans un utérus, de donner un embryon puis un fotus. Cer-
tes, ces cellules pluripotentes ne peuvent pas évoluer pour former une person-
nes mais de multiples questions se posent : comment peut-on les obtenir tout en
respectant les règles d’éthique ? Peut-on les utiliser dans les recherches du clonage
thérapeutique ?
3 - Les cellules souches multipotentes : Elles sont des cellules souches capables
de donner naissance à un ou plusieurs groupes de cellules ayant une fonction par-
ticulière. Par exemple, les cellules souches présentes dans la moelle osseuse pro-
duisent les globules rouges, les globules blancs et les plaquettes. Elles jouent un
rôle essentiel en assurant le renouvellement des cellules. Elles sont appelées aussi
cellules souches adultes ou cellules souches somatiques. Les cellules souches
adultes peuvent être extraites de la plupart des tissus, y compris du cerveau et de la
moelle épinière. Cependant, elles sont rares et par conséquent très difficiles à
identifier (une cellule souche pour dix ou quinze mille autres cellules dans la moelle
osseuse. La moelle osseuse et le sang du cordon ombilical sont particulièrement
riches en cellules souches adultes. Les cellules souches du sang de cordon
ombilical peuvent être prélevées à la naissance et conservées pour un usage
ultérieur (un tel service est proposé par certaines fondations aux Etats-Unis). Les
cellules souches issues de la moelle ou du cordon peuvent être utilisées pour une
thérapie cellulaire bénéficiant à l’individu ou à ses frères et sours.
4 - Les cellules souches unipotentes : elles ne donnent qu’un seul type de cellu-
les différenciées (peau, foie, muqueuse intestinale, testicule…). Dans certains orga-
nes, tels que le cour et le pancréas, les chercheurs n’ont pas encore découvert de
cellules souches ; par conséquent ils pensent que ces organes n’ont aucune possi-
bilité de régénération en cas de lésion.
B – Recherche sur les cellules souches et l’embryon ?
1 – Les processus génétiques de l’embryogenèse de la fécondation au clivage.
Nous avons choisi délibérément la section fécondation-clivage pour étudier
sommairement les régulations génétiques car c’est à ce stade que nous avons les
différentes manipulations des cellules souches embryonnaires.
Le développement embryonnaire des métazoaires est classiquement subdivi-
sé en quatre phases, essentiellement définies suivant des critères morphologiques :
la fécondation, la segmentation (clivage), la gastrulation et l’organogenèse. On en-
tend par gène de développement ceux qui interviennent précocement au cours du
développement embryonnaire et sont responsables de l’établissement des polarités
(antéro-postérieure, dorso-ventrale) de l’embryon, de la mise en place du plan de
79
base du corps et de la spécification des cellules et des territoires devant donner les
différents organes.
A l’échelle de la cellule, il existe différents niveaux de contrôle du développe-
ment : prolifération cellulaire, migrations, engagement dans une voie de différencia-
tion. Le développement embryonnaire étant un processus continu et progressif, les
différents gènes impliqués ne peuvent être considérés isolément ; au contraire, leur
séquence spatio-temporelle d’expression est largement hiérarchisée et interdépen-
dante. La multiplication cellulaire, régulée par les oncogènes et les facteurs de
croissance, les migrations cellulaires et l’engagement d’une cellule dans une voie de
différentiation constituent en effet des choix de développement non indépendants.
Ils peuvent par ailleurs être autonomes-cellulaires, c’est-à-dire ne dépendre que de
l’information contenue dans la cellule considérée ou être non autonomes, c’est-à-
dire permis par des interactions avec les cellules voisines.
- Des gènes maternels contrôlent les premières divisions de l'ouf
Les premières divisions de l’ouf fécondé s'effectuent sans que les premiers gènes
zygotiques ne soient exprimés. Cela est parfaitement vérifié chez des espèces infé-
rieures (batraciens). La mise en route du génome embryonnaire s'effectue cepen-
dant à un stade précoce, mais très probablement seulement au stade 8 cellules chez
l'homme. En effet, notons qu'il n'y a pas de régionalisation de l'information dans le
cytoplasme du zygote des mammifères jusqu'au stade 8 cellules, contrairement à
d'autres classes de vertébrés : chaque blastomère peut donc être considéré comme
équivalent aux autres.
L'étude des gènes maternels dans le développement embryonnaire pré-
coce est cependant rendue difficile par la très faible quantité de matériel génétique
disponible. Nos connaissances sont donc encore rudimentaires chez les mammifè-
res, encore plus chez l'homme. La distinction entre une information seulement ap-
portée par des ARNm provenant de l'ovule, et celle qui serait apportée par une
transcription persistant selon un patron transcriptionnel conservant le profil d'ex-
pression maternel, est loin d'être résolu (eu égard à la durée de vie des messagers
de la première hypothèse n'est plausible que chez des espèces où les premiers cli-
vages se font dans un espace de temps excessivement court ; c'est le cas des oeufs
de batraciens. Néanmoins, on sait que la durée de vie des ARNm est beaucoup plus
longue dans l’ouf fécondé).
Chez les mammifères il existe le phénomène de imprinting : les génomes pa-
ternel et maternel apportés par les gamètes ne sont pas transcrits de façon équiva-
lente par le zygote, l’origine paternelle ou maternelle de certains gènes entraîne leur
inactivation. L’analyse d’anomalies de ségrégation chromosomique ou d’expériences
de transplantation de pronucléus montre que cette inactivation est nécessaire à un
développement embryonnaire normal. Elle concerne un nombre relativement res-
treint de gènes, impliqués généralement très précocement au cours du développe-
ment, et pourrait être due à une méthylation différentielle des copies paternelle et
maternelle de ces gènes. La méthylation différentielle semble être le processus per-
mettant l’inactivation transcriptionnelle d’un des chromosomes X chez le mammifère
femelle et rétablissant une dose identique à celle du mâle, des facteurs issus de la
transcription de ce chromosome. Le contrôle de l’initiation et du taux de traduction
des ARNm maternels « dormants » dans l’ovocyte est le principal niveau de régula-
tion d’expression génique aux stades de développement précédant la transcription
zygotique. Ce mécanisme permet de contrôler la production de facteurs impliqués
80
dans l’établissement des polarités et dans la régulation du cycle cellulaire.
Des données récentes attribuent à l'ARN maternel oct-3 un rôle dans la première
division de l’ouf et au PDGF-alpha (platelet-derived growth factor) codé par un ARN
maternel un effet autocrine activateur de la division cellulaire.
Le début de l'expression génique embryonnaire n'est donc effective qu'après le
stade 8 blastomères. Elle est concomitante de l'expression sur la membrane plasmi-
que de Cadhérines E, aboutissant à la mise en place de jonctions inter-cellulaires :
c'est l'initiation de la compaction et des phénomènes de polarisation. Ultérieurement
s'exprimeront dans la morula des cadhérines E (épithéliales) et P (dans le tropho-
blaste, futur Placenta), ce qui contribuera largement à la ségrégation cellulaire entre
embryoblaste et trophoblaste.
De la gastrulation à l’organogenèse, d’autres gènes s’activeront et par consé-
quent de nouvelles protéines seront synthétisées afin d’assurer différents contrôles
génétiques. Ainsi aurons-nous un contrôle génétique de la mise en place des polari-
tés embryonnaires, un contrôle génétique de l’établissement du plan de base de
l’organisme et une acquisition d’une identité positionnelle au sein des différents tis-
sus ou champs d’organisation.
2 – Recherche sur l’embryon et manipulation des cellules souches :
La possibilité de cultiver et de manipuler l'embryon préimplantatoire de mam-
mifère requiert une haute technologie et par conséquent un laboratoire de recherche
bien spécialisé. De nombreuses méthodes sont utilisées en recherche fondamentale
pour étudier l’embryogenèse :
a – le clonage
- Le clonage par transfert de noyau
Transfert du noyau dune cellule dun sujet donné dans un oocyte humain énu-
cléé, suivi d’un développement embryonnaire jusqu’au stade de blastocyste et de
l’utilisation des cellules de la masse cellulaire interne (ICM), en vue d’obtenir les ES
et, à partir d’elles, les cellules différenciées souhaitées. La technique de transfert
nucléaire, dérivée d'expériences menées chez les batraciens dans les années 60
consiste d'abord à retirer la métaphase II et le premier globule polaire d'un ovocyte II
maturé. Ensuite, une cellule diploïde est insérée dans la zone pellucide, à côté de
l'ovocyte énucléé. Un choc électrique est appliqué. Il engendre à la fois la fusion
des deux membranes plasmiques et l'activation de l'ovocyte. Le noyau de la cellule
diploïde se retrouve ainsi au sein du cytoplasme ovocytaire. A ce stade, on parle de
zygote ou d'embryon reconstitué, ou encore d'équivalent d’une cellule. L'embryon
reconstitué entame son clivage et, au stade 8-16 cellules chez le bovin, le noyau
transféré prend le contrôle du développement. Au stade blastocyste, l'embryon est
transféré en mère porteuse. L'affinement de la technique a permis à une équipe
écossaise de produire des agneaux en utilisant le noyau de cellules fotales (fibro-
blastes) et même de cellules mammaires d'une brebis adulte. Ces résultats mon-
trent qu'au moins certains types de cellules conservent intact leur potentiel nucléaire
de différenciation malgré leur état de cellule différenciée. Notons cependant que le
taux de succès est, à l'heure actuelle, inversement proportionnel à l'état de différen-
ciation de la cellule diploïde donneuse de noyau. De plus, l’analyse des télomères
des clones obtenus semble montrer que l’ADN des cellules diploïdes donneuses de
81
noyau n’est pas “ rajeuni ” par le transfert nucléaire. Ceci signifie qu‘un clone serait
constitué de cellules dont l’âge correspond à celui de l’organisme d’origine. La
conséquence serait un vieillissement prématuré de ces clones.
Transfert du noyau dune cellule dun sujet donné vers un oocyte dun autre
animal. Un éventuel succès devrait conduire - comme on le suppose - au dévelop-
pement d’un embryon humain, qu’on pourrait utiliser comme dans le cas précédent.
Reprogrammation du noyau dune cellule dun sujet donné en le fusionnant
avec le cytoplasme des ES, obtenant ainsi les “cybrides”: une telle possibilité est
encore à l’étude. De toute façon, même cette voie semblerait exiger une préparation
préalable des ES d’embryons humains.
- Le clonage par séparation des blastomères
Cette technique fut mise au point pour l'étude de la totipotence de différencia-
tion des blastomères. Le zygote est, par définition, une cellule totipotente à la fois
sur le plan cellulaire et sur le plan nucléaire. Qu'en est-il des deux premiers blasto-
mères? A quel stade du développement chaque cellule de l'embryon devient-elle
incapable de se développer en un fotus normal? Willadsen a réalisé une série
d'expériences à l'issue desquelles il montra que chez le mouton, les blastomères
perdent leur totipotence cellulaire en passant au stade 8 cellules (3ème mitose).
Cette technique lui permit également de produire les premiers clones de mouton en
obtenant des paires et des triplés d'agneaux à partir des blastomères d'un même
embryon de stade 2 ou 4 cellules. Un seul agneau fut obtenu à partir d'un blasto-
mère de stade 8 cellules.
En fait, il semble qu'une horloge biologique compte le nombre de mitoses
pour déclencher le processus de blastulation au stade de ± 64 cellules (6-7ème mi-
tose). Un blastomère de stade 8 cellules, isolé, poursuit son développement et dé-
clenchera ce processus de cavitation après 3-4 mitoses, c. à d. lorsqu'il aura donné
naissance à un embryon composé de 8-16 cellules. Ce nombre est trop restreint
pour former un blastocyste capable de s'implanter et sa masse cellulaire interne est
trop réduite pour qu'il poursuive un développement embryonnaire harmonieux.
Cette technique est très délicate et ne fut jamais adoptée pour produire des
clones en série.
- Le clonage chimérique par association
Cette autre technique, développée également par Willadsen, est fondée sur
une observation faite chez l'embryon de souris par Mulnard. Ce dernier a décrit que
les premiers blastomères d'un stade 4 cellules qui subissent leur 3ème mitose four-
nissent par la suite la masse cellulaire interne du futur blastocyste. Les derniers
blastomères du stade 4 cellules qui se divisent donnent le trophectoderme. En as-
sociant un blastomère isolé d'un stade 8 cellules d'une souche A avec un blasto-
mère isolé d'un stade 4 cellules d'une souche B, Willadsen a effectivement montré
que l'agneau obtenu après transfert en mère porteuse était constitué de cellules
descendantes du blastomère de stade 8 cellules. En reconstituant 8 embryons chi-
mériques en associant par paire les cellules d'un embryon 8 cellules de souche A et
de deux embryons 4 cellules de souche B, il obtint un maximum de 5 agneaux de
phénotype A. Comme tous les agneaux d'un groupe proviennent d'un blastomère
d'un même stade 8 cellules, ils constituent un clone.
82
Cette technique est également très délicate et n'a jamais été utilisée pour la
production de clones en série. Elle a cependant permis de préciser que le premier
processus de différenciation cellulaire, l'apparition du trophectoderme, débute au
stade 4-8 cellules, bien avant la cavitation.
III - LA PARTHÉNOGENÈSE:
Du grec ¬qpθsvoç = vierge ;vsvsoiç = engendrer): Une ovule non féconder
d’une lapine peut être stimulée et emprunter la voie de l’embryogenèse pour obtenir
une lapine. La technique est simple:
a - On prend une ovule non fécondée d'une lapine.
b - On stimule l'ovule.
c - L'ovule stimulée commence à se développer et est réimplanté dans
l’utérus de la lapine. Le produit sera une lapine identique à sa mère lapine.
IV - LA THÉRAPIE GÉNIQUE:
De nos jours, plus de trois mille types de maladies héréditaires ont été identi-
fiées. Chaque année, la population mondiale paie un lourd tribut à cause de ces ma-
ladies génétiques cause de mortalité infantile ou de déficience caractérisée.
¢ Dans le monde actuel on estime à cent millions (100 000 000), les person-
nes qui sont atteintes de la mutation du gène qui code pour la glucose-6-phosphate
déshydrogénase qui conduit au favisme
¢ Environ deux cent cinquante millions (250 000 000) de personnes souffrent
de plusieurs types d’anémies liées aux mutations génétiques
¢ Dans les pays développés, le tiers des hospitalisations en pédiatrie sont
liées aux désordres génétiques.
¢ La mucoviscidose, cause de la fibrose cystique, touche environ un enfant
sur 2 500 dans la population caucasienne. Quatre pour cent (4%) de cette popula-
tion portent le gène muté de la mucoviscidose (FC).
¢ En Afrique et en Amérique, la drépanocytose tue à elle seule près de cent
mille enfants noirs par an sans compter les pathologies génétiques multi-factorielles
et cystogéniques
¢ Au Burkina Faso, environ 30% de la population présentent une mutation de
la chaine ß de l’hémoglobine (ßS ou ßC). Près de 5% des enfants sont atteints de la
drépanocytose sous ces diverses formes pathologiques (Hb SS ou Hb SC).
1. La thérapie génique germinale.
83
L’objectif de la thérapie génique germinale consiste à introduire des cellules
transgéniques dans la lignée germinale et donc dans l’individu entier. Cela doit per-
mettre non seulement de corriger l’individu traité, mais aussi de lui faire produire des
gamètes porteurs du génotype corrigé qui seront transmis à la descendance. La cor-
rection doit se faire dans une cellule germinale ou de l’embryon précoce ou les cel-
lules sont totipotentes
La première expérience de thérapie génique ciblée et réussie concerne la
correction d'une délétion du gène HPRT (Hypoxanthine PhosphoRibosyl-
Transférase, un produit d'un gène du chromosome X) dans des cellules embryonnai-
res pluripotentes de souris. Le gène HPRT code pour l'enzyme HPRT qui intervient
dans le métabolisme des nucléotides. Grâce à une recombinaison homologue, une
restauration de l'intégrité du gène anormal a pu être obtenue. Ce succès démontre
que la voie du ciblage génétique, inaugurée pour créer des modèles animaux est
prometteuse. Plusieurs procédés sont utilisés à cette fin
a : La micro-injection d’un gène d’intérêt dans le pronoyau
Figure IX.2: micro-injection d’un gène d’intérêt dans le pro-noyau
¢ La première étape consiste en une fécondation d’un ovule de souris
¢ On injecte alors l’ADN étranger dans le pro-nucléi mâle de l’ovocyte fé-
condé
¢ L’ovocyte est alors implanté dans une mère porteuse
¢ La descendance transgénique est identifiée par la PCR et l’électrophorèse
De nos jours, de nombreux essais géniques se font chez les animaux dans le
but de les transposer un jour chez l’homme. Dans le cas des souris, 10 à 30% des
oufs manipulés donnent des souris vivantes. 40% de ces souris ont reçu le gène
d’intérêt injecté. Le problème à résoudre est que l’ADN injecté s’intègre au hasard,
parfois de manière ectopique dans les chromosomes.
b : La micro-injection du gène dans les cellules embryonnaires
Le processus est le suivant :
¢ On prélève au stade blastocyste des cellules embryonnaires porteuses
d’un génotype muté
¢ On insère dans ces cellules le gène sauvage en culture
¢ Les cellules transgéniques sont de nouveau ré-implantées dans l’embryon
qui se trouve dans le blastocyste.
¢ Les cellules qui portent le gène sauvage vont se retrouver dans les diffé-
rents tissus de l’organisme, y compris dans les cellules germinales qui vont consti-
tuer les gonades. Le transgène peut donc être transmis à la descendance par des
croisements entres les souris transgéniques de la descendance portant le transgène
dans leurs gonades.
De nos jours, aucune thérapie génique germinale n’a encore été entreprise
chez l’homme. La plupart des fragments d’ADN s’intègrent de façon ectopique dans
tout le génome, ce qui constitue un sérieux handicap pour la thérapie humaine, non
84
seulement à cause des possibles interruptions des gènes, mais aussi parce que
l’allèle muté sera toujours présent dans le génome et pourra ségréguer du transgène
dans les générations futures. Il faudrait mettre au point un système de ciblage grâce
auquel le transgène de type sauvage se substitue au gène défectueux par une re-
combinaison en faisant intervenir un double crossing-over.
Figure IX.3 :La micro-injection du gène dans les cellules embryonnaires
2. La génothérapie somatique
La thérapie génique somatique s’attaque uniquement aux cellules du soma et
tente d’éliminer le phénotype pathologique. Il est alors possible de rendre transgéni-
que le corps entier d’un individu. Un certain pourcentage de cellules « guéries »
peuvent atténuer la maladie en codant pour la protéine normale.
La génothérapie somatique consiste en une utilisation des rétrovirus désar-
més (délétions des gènes gag, pol et env) pour l’insertion du gène exogène dans
un organisme. Les premiers vecteurs utilisés ont été des rétrovirus désarmés que
l’on a rendu amphotropes pour permettre leur utilisation dans différentes espèces
et défectifs pour contrôler leur dissémination. Les problèmes liés à la l’insertion des
rétrovirus sont énormes :
Les figures qui suivent illustrent quelques exemples de thérapie somatique dans
différents mammifères
¢ Ils peuvent provoquer des inversions, des délétions, des mutations chez
l’individu traité.
¢ Ils peuvent aussi rencontrer un autre virus dans l’individu traité, se recom-
biner avec ce dernier et devenir pathogènes
¢ Il se pose également le problème de l’immunogénicité de l’organisme (non
reconnaissance du soi).
Figure IX.4 : Thérapie génique somatique : Utilisation de rétrovirus pour un transfert de
gène
Le procédé simple est le suivant :
¢ On prélève quelques cellules somatiques du patient, qu’on cultive
¢ On y introduit des exemplaires du gène sauvage cloné dans un vecteur
désarmé
¢ On réimplante ces cellules transformées dans le corps du patient ou elles
pourront remplir la fonction attendue.
¢ Les figures qui suivent illustrent quelques exemples de thérapie somatique
dans différents mammifères
85
3. Vers la génothérapie avec de l'ADN médicament.
La maîtrise de la méthodologie de transfert des gènes, alliée à une compré-
hension de plus en plus poussée du fonctionnement des gènes, permettent d'envi-
sager leur utilisation dans la lutte contre les maladies acquises. "Le principe consiste
à munir certaines cellules d'une construction génique permettant la production locale
(autocrine), régionale (paracrine), voire générale (endocrine) de facteurs protéiques
(ou nucléiques) ayant un intérêt thérapeutique". Les cancers et les maladies virales
sont candidats à ce type de thérapie.
En effet, dans la thérapie des cancers les premières expériences effectuées
avec les TIL montrent que l'on peut armer des cellules avec des facteurs cytotoxi-
ques (TNF = Tumor Necrosis Factor) ou les doper avec des cytokines.
Dans la thérapie anti-virale, l'idée est de fournir à la cellule les moyens de se
défendre spécifiquement contre le virus par une stratégie adaptée à la biologie du
virus considéré. Il s’agit de mettre à profit la masse de connaissances accumulées
sur sa biologie. Dans le cas du VIH, cet démarche consiste à munir les cellules T de
constructions contenant des gènes mutants transdominants codant pour des pro-
téines virales structurales ou régulatrices anormales ou modifiées.
On peut aussi fabriquer des leurres pour le virus comme la protéine CD4 so-
luble comportant un signal de rétention intracellulaire pour piéger la protéine gp120
du virus ou même un leurre du RNA viral comportant une pseudo séquence TAR.
Une autre approche consiste à éliminer le virus de la cellule infestée par une
toxine protéique (toxine diphtérique, ricine) dont le gène est placé dans une cons-
truction qui en assure l’expression conditionnelle. Il s’agit dans ce cas d’une bombe
à retardement que le virus active lui même (Une protéine régulatrice TAT).
Une autre variante de cette toxigénétique conditionnelle, "consiste à com-
battre le virus HIV en lui apportant le gène de la thymidine kinase (TK) sous
contrôle du LTR du HIV, cette construction étant elle-même incluse dans un
adénovirus recombinant qui en assure la transduction" Dans ce cas, seules les
cellules infectées produisent les signaux transactivateurs du LTR, ce qui entraîne
l'expression du gène TK, rendant les cellules sensibles au gancyclovir, (un analogue
pyrimidique cytotoxique) administré comme médicament.
Ces essais préliminaires ouvrent la voie à une ère de thérapeutique nouvelle,
permettant de s’attaquer à des maladies incurables ou héréditaires et aux maladies
virales comme le SIDA.
86
CHAPITRE X :
LES TECHNIQUES DE LA BIOLOGIE MOLÉCULAIRE APPLIQUÉES DANS LA
RECHERCHE THERAPEUTIQUE DU VIH/SIDA
I – STRUCTURE DU VIH
Figure X.1 : Structure du VIH
L'étude de la structure génétique du VIH permet de comprendre la complexité
de ce virus, certaines de ses manifestations cliniques et biologiques, et d'envisager
des stratégies pour la recherche thérapeutique.
Le VIH, Virus de l’Immunodéficience Humaine, est un rétrovirus de 0,1 µm de
diamètre, du sous-groupe des Lentiviridae, qui a un génome à ARN.
Il a été isolé pour la première fois à l’Institut Pasteur de Paris en 1983. Le VIH-1 est
répandu dans le monde entier tandis que le VIH-2 est essentiellement localisé en Afri-
que. En Afrique subsaharienne on peut trouver chez le même individu une co-
infection : le VIH-1 et le VIH-2 ensemble.
Figure X.2 : Origine du VIH
Structure du VIH : De l’extérieur vers l’intérieur du virus, nous avons :
> L’enveloppe du virion : les glycoprotéines p 120, p 41 et une double couche de
phospholipides.
> La matrice est constituée glycoprotéines p 17.
> La capside, formée par des glycoprotéines p 24 contient : deux filaments d’ARN
de 9200 bp environ enveloppés par la nucléocapside (protéine p 7), la transcriptase
inverse, l’intégrase, la protéase et la ribonucléase.
Le VIH possède 3 gènes rétro-viraux codant pour différentes protéines virales :
> gag (groupe antigène) code pour des protéines internes ("core") : p50 et
p40 qui se cliveront en p13, p18 et p24.
> pol (polymérase) code pour des enzymes nécessaires à sa réplication :
notamment p68 (reverse transcriptase) et p34 (intégrase).
87
> env (enveloppe) code pour des glycoprotéines (gp110 et gp41 issues de
gp 160). La gp 110 est une partie de l'enveloppe responsable de l'interaction avec la
membrane de la cellule cible au niveau du récepteur CD4, permettant la pénétration
du virus. Une autre propriété de l'enveloppe (gp41) est de pouvoir induire la fusion
cellulaire (syncitium) qui est un des éléments cytopathogènes du VIH.
Figure X.3 :gène gag, pol, env
Le VIH possède d’autres gènes codant pour différentes protéines virales
Contrairement aux autres rétrovirus, le VIH possède d'autres gènes intervenant dans
sa réplication. Cette complexité qui lui est caractéristique explique probablement son
haut pouvoir pathogène. Il y a des gènes régulateurs :
> tat (favorise l'augmentation du niveau de la synthèse des protéines vira-
les),
> rev favorise l'augmentation des ARN messagers correspondant aux protéi-
nes de gag, pol et env.
Il y a aussi d'autres gènes, comme vif, qui permet d'augmenter l'infectiosité,
nef (rôle mal connu) et vpu, vpr (vpx pour VIH2). La séquence LTR (Long Terminal
Repeat) peut être considérée comme un promoteur fort et une région régulatrice
pour la production de nouveau virus.
Figure X.4 Mécanisme d’infection
II - LES NOUVELLES MOLÉCULES ANTIVIRALES EN DÉVELOPPEMENT:
1 - Les inhibiteurs de l'entrée du virus :
Il existe 3 types de médicaments qui sont en cours de développement à
l'heure actuelle :
> Inhibiteurs de l'entrée du virus dans les lymphocytes CD4 ;
> Antagonistes des co-récepteurs, ces molécules se fixent sur des récep-
teurs nécessaires à la pénétration du virus dans les cellules ;
> Inhibiteurs de la fusion du VIH : ils empêchent le virus de fusionner avec
la cellule qu'il attaque.
2.- Les INTI et les INNTI sont des inhibiteurs de la transcriptase inverse
Des essais cliniques ont été réalisés sur de nouveaux inhibiteurs de la trans-
criptase reverse : Inhibiteur Nucléosidique de la Transcriptase Inverse (INTI) et Inhi-
biteur Non Nucléosidiques de la Transcriptase Inverse (INNTI). Les premiers essais
ont montré des résultats intéressants en terme d'efficacité sur la charge virale ou sur
des virus présentant des mutations.
3. - Les IP sont des inhibiteurs de la protéase acide virale:
De nouveaux inhibiteurs de la protéase sont en cours de développement à un stade
avancé.
88
4 – classification de quelques molécules antivirales :
Nucléosides : Rétrovir (AZT), Videx (ddI), Hivid (ddC), Epivir (3TC), Zérit (D4T),
Combivir (AZT + 3TC), Ziagen (abacavir).
Non-nucléosides : Viramune (névirapine), Sustiva (efavirenz), Rescriptor
(delavirdine).
Antiprotéases : Invirase ou Fortovase (saquinavir), Crixivan (indinavir), Norvir (rito-
navir), Viracept (nelfinavir), Agénérase (amprénavir), ABT-378/r (voir : Pétition Re-
maides).
Nucléotide : Prévéon (adéfovir).
III. VERS L’ESPOIR D’OBTENIR UN JOUR UN VACCIN ANTI-VIH.
La recherche d'un vaccin contre le VIH a continué de progresser, même si
elle n'a pas accompli de progrès spectaculaire au cours des dernières années écou-
lées. Près de trente essais ont été menés ou sont en cours chez l'homme, en phase
I et II (étude de la tolérance et des réactions immunitaires chez quelques dizaines
de volontaires en phase I et plusieurs centaines en phase II).
De nouvelles approches sont explorées. L'utilisation de virus atténués,
comme cela se pratique pour de nombreux vaccins et qui est évoquée et repoussée
depuis longtemps pour le VIH, fait actuellement grand bruit aux États-Unis où elle
est proposée avec force par un groupe de médecins-chercheurs et bien autres types
de vaccins.
1 - Les deux objectifs d'un vaccin contre le VIH demeurent :
> L'induction d'anticorps capables de neutraliser le virus, dirigés contre les
protéines d'enveloppe (réponse humorale).
> L'induction de cellules T cytotoxiques, CTL, qui détruisent les cellules in-
fectées. Cette induction nécessite que la préparation vaccinale se réplique à l'inté-
rieur des cellules pour que l'antigène du VIH soit présenté au système immunitaire
(réponse cellulaire).
La majorité des résultats obtenus depuis deux ans soulignent l'intérêt de stra-
tégies vaccinales utilisant des combinaisons d'antigènes de plus en plus complexes,
afin de stimuler les différentes composantes du système immunitaire. Un des pro-
blèmes posés par l'obtention vaccinale de réponses immunitaires contre le VIH est
que ces réponses doivent être dirigées contre des souches de virus très variables.
2 - Vaccins sous-unitaires et vaccins synthétiques
Les premiers vaccins sous-unitaires (immunisation par des protéines d'enve-
loppe recombinantes du virus) se sont révélés incapables d'induire des anticorps
neutralisants actifs contre les souches de virus sauvages que l'on trouve chez les
malades et qui sont différentes de celles, longtemps cultivées en laboratoire, utili-
89
sées pour les vaccins (Lemoine FM et al,1999). Certains vaccins sous-unitaires VIH
induisent cependant une protection chez des chimpanzés et des macaques (Le-
moine FM et al,1999). Ils sont utilisés chez l'homme en rappel (boost), après l'injec-
tion d'un vaccin recombinant vivant (prime, d'où le concept de «prime-boost»).
En parallèle, on étudie l'immunogénicité de peptides et antigènes incorporés
dans des liposomes (vésicules d'acides gras qui ont la propriété de pénétrer dans
les cellules) ou des ISCOMS (complexes immuno-stimulateurs). Ces méthodes sem-
blent capables d'induire des réponses immunitaires anti-VIH chez l'homme et anti-
SIV chez le singe, mais sans qu'on sache aujourd'hui si cela procure une protection.
3 - Les virus vivants atténués
Ce sont des virus VIH, ou SIV chez le singe, toujours infectieux mais dont le
pouvoir pathogène est diminué. Cette approche, généralement considérée comme
trop dangereuse chez l'homme, suscite beaucoup d'intérêt depuis que plusieurs di-
zaines de médecins américains ont annoncé qu'ils se portaient volontaires pour un
essai de vaccination par un VIH atténué (Lemoine FM et al,1999).
4 - Vaccins vivants recombinants produit par la biotechnologie
C'est avec des vaccins vivants recombinants (un virus inoffensif auquel on a
ajouté des gènes du VIH) que les essais chez l'homme sont le plus avancés, puis-
qu'un essai de phase II vient de commencer aux États-Unis chez 420 volontaires,
avec une préparation de Pasteur-Mérieux-Connaught. Les vaccins recombinants
utilisent la vaccine ou le canarypox (virus de la variole du canari) exprimant des pro-
téines du VIH. Les premiers vaccins recombinants exprimaient seulement une pro-
téine d'enveloppe. Les préparations actuelles sont porteuses de gènes de plusieurs
protéines d'enveloppe et de protéines internes.
5 - Pseudo-particules (virus-like particles)
Ces vaccins sont constitués de différentes combinaisons de protéines virales
sous forme de particules. L'absence de génome viral les empêche de se répliquer
(Lemoine FM et al,1999).
6. ADN nu
L'administration d'un ADN purifié codant pour une ou plusieurs protéines du
VIH et portant un signal pour la transcription dans la cellule présente deux avanta-
ges, la simplicité et la stabilité du vaccin. Les premiers essais chez l'animal ont mon-
tré que ces vecteurs induisent des CTL et des anticorps neutralisants (Lemoine FM
et al,1999).
Une approche originale utilise des «cochléats» (phosphatidylsérine, choles-
térol et calcium) comme vecteurs de protéines et d'ADN.
90
Au-delà de ces vaccins en perspectives et ces nouveaux médicaments, dont
certains seront prochainement disponibles, les recherches continuent également
dans la direction de la thérapie génique.
IV. LE GÉNIE GÉNÉTIQUE ET LA LUTTE CONTRE LE VIH.
Aujourd'hui, la thérapie génique, instrument du génie génétique, qui consiste
à intervenir sur les gènes d'une cellule pour modifier certaines de ces fonctions ou
capacités, est très avancée dans la thérapie des cancers et de nombreuses patho-
logies génétiques. Pour ce qui concerne le traitement de l'infection par le VIH, les
pistes de recherches sont déjà nombreuses, quelques protocoles d'essais chez
l'homme ont été approuvés et certains sont même en cours d'évaluation.
1 - Comment modifier les gènes d'une cellule ?
Deux approches thérapeutiques sont aujourd'hui utilisées pour combattre le VIH :
La modification directe des gènes des cellules du malade :
On injecte au malade un virus porteur du gène que l'on veut modifier. Ce virus
va s'intégrer au niveau de l'ADN des cellules et insérer le transgène. Les cellules
acquièrent ainsi les nouvelles propriétés conférées par ce gène, par exemple, en
produisant une toxine contre le virus du SIDA.
L'utilisation de cellules déjà modifiées :
On injecte au malade des cellules humaines, par exemple, des cellules immu-
nitaires comme les lymphocytes CD4, qui ont été génétiquement modifiées par la
méthode décrite ci-dessus en laboratoire. Ces cellules chimères agissent comme un
médicament en luttant contre la maladie. Elles sont désormais capables de résister
au virus du SIDA et peuvent apporter au malade une immunité contre les infections.
2 - Mais comment, concrètement, le génie génétique peut-il développer des
stratégies de combat contre le VIH ?
A travers Cinq voies de recherches :
- L'immunisation intracellulaire,
- La destruction sélective des cellules infectées,
- La sécrétion de protéines inhibitrices,
- La pharmacomodulation génétique,
- L'immunothérapie génétique,
a - L'immunisation intracellulaire :
Tandis que la vaccination protège les sujets non infectés de l'infection, l'im-
munisation intracellulaire confère une protection contre un virus à l'échelon cellulaire
chez des sujets infectés. Le principe est simple : il s'agit de modifier la structure gé-
nétique des cellules cibles du VIH (les lymphocytes CD4) afin que celles-ci soient
91
protégées du virus. Plusieurs techniques sont utilisées. La cellules modifiée se met
alors à produire des mutants « transdominants » de protéines virales, des « leurres
ARN » qui miment l’ARN viral, des « molécules antisens » de séquences nucléotidi-
ques. Tous ces éléments générés par la biotechnologie peuvent tromper le VIH ou le
bloquer ou alors rivaliser avec lui dans la recherche des substrats. L'intérêt de l'im-
munisation intracellulaire est qu'elle bloque bien la réplication du virus à l'intérieur
de la cellule.
b - La destruction sélective des cellules infectées :
Une autre approche de la thérapie génique de l'infection par le VIH vise à dé-
truire spécifiquement les cellules infectées à l'aide d'un gène codant pour une
toxine. Un gène « suicide » est placé sous le contrôle transcriptionnel du promoteur
LTR du VIH afin d'entraîner la destruction cellulaire au moment de la synthèse de la
molécule tat, produite lors de la réplication du VIH (Caruso M et al. 1992). Cette
stratégie est difficile à mettre au point et n'apporte aucun avantage sélectif aux cellu-
les transduites, car les lymphocytes sont détruits dès qu'ils sont infectés.
c- La sécrétion de protéines inhibitrices :
Certaines protéines sécrétées naturellement par les lymphocytes ont des pro-
priétés anti-VIH. L'opération consiste à introduire dans l'organisme un gène qui va
produire une quantité élevée de ces protéines. Ce gène peut être implanté de ma-
nière ectopique dans les hépatocytes, via un virus modifié qui est capable d'implan-
ter le transgène. Les chercheurs peuvent aussi utiliser d’autres méthodes comme
"cultiver" des cellules modifiées génétiquement, des fibroblastes de souris, les en-
tourer d'une membrane inerte de collagène pour qu'elles soient "invisibles" par le
système de défense immunitaire du patient, puis les transférer chez le patient atteint
par le VIH. Ces cellules enveloppées et protégées se mettent alors à produire les
protéines anti-VIH (Moullier P, et al. 1993).
d - La pharmacomodulation génétique :
Les médicaments antiviraux actuels agissent pour la plupart à l'intérieur de la
cellule infectée au niveau de laquelle ils pénètrent. C’est ainsi que l’action de la zi-
dovudine est limitée du fait de ses effets toxiques et de l'apparition de souches mu-
tantes résistantes. Le mécanisme cellulaire qui permet de rendre ces médicaments
actifs n'a pas toujours un rendement idéal puisqu’une partie du médicament est éli-
miné de la cellule avant d'avoir été rendu actif. Le principe de la "pharmacomodula-
tion génétique" est d'introduire un gène qui va accélérer l'activation de l'antiviral à
l'intérieur de la cellule. Cette méthode est très intéressante, car elle permettrait ain-
si, à dose d'antiviral identique, d'avoir une efficacité 3 à 10 fois plus importante. Elle
peut également être appliquée pour diminuer les effets indésirables d'autres antivi-
raux qui sont mal tolérés, et dont on pourrait diminuer les doses pour le patient (Ca-
ruso M et al. 1994).
e - L'immunothérapie génétique :
L'immunothérapie génétique correspond à l'utilisation, à des fins thérapeuti-
ques, de cellules immunocompétentes génétiquement modifiées (Lemoine FM et al.
1999). En effet, cette dernière voie de recherche, en plein essor, consiste en l'intro-
92
duction dans l'organisme de cellules génétiquement modifiées, des cellules dendriti-
ques (DC) ou autres qui sont capables de "mimer" le virus du SIDA pour activer une
réponse du système de défense immunitaire de l'organisme. En effet, les DC sont
capables d'apprêter les protéines sous forme de peptides antigéniques et de les pré-
senter soit aux lymphocytes T CD4
+
par le complexe majeur d'histocompatibilité de
classe II (CMH II), soit aux lymphocytes T CD8
+
via le CMH I (Lemoine FM et al.
1999). Lors de l'infection par le VIH, l'organisme n'est pas capable de se défendre
tout seul car le virus n'est pas reconnaissable suffisamment longtemps pour que des
anticorps efficaces puissent être produits. L'immunothérapie génétique permet de
présenter aux lymphocytes des "morceaux du virus" facilement reconnaissables pour
que, en s'attaquant à ces "morceaux", les lymphocytes détruisent les virus. Il s'agit
là, bel et bien, d'une sorte de "vaccination" avec des cellules génétiquement modi-
fiées.
3 . Recherche sur un vaccin contre le VIH/SIDA
Processus et défi de la conception et de la sélection des épitopes: Qu’est-ce qu’un
épitope ?
Comment pouvons-nous induire dans toutes les personnes une réponse immunitaire
spécifique contre un grand nombres d’épitopes VIH peptides des Lymphocytes T
Cytotoxiques (CTL) et des lymphocyte T helper ?
Immunogénétique Reverse
Nous avons :
- la génétique directe:
du phénotype, à partir de la configuration de la protéine, on remonte au gène qui a
spécifiée cette séquence peptidique.
- la génétique reverse:
De l’ADN, du gènes spécifique on cherche à découvrir la protéine codée, synthéti-
sée.
* Sélection des peptides à travers la technique de l’immunogénétique Reverse.
Fondement: rechercher les gènes qui spécifient les protéines du système immuni-
taire.
A partir de la technique de l’immunogénétique reverse: trouver des peptides des
allèles des classes HLA I et II capable de couvrir plus de 90% des haplotypes HLA
de diverses populations ciblées.
A partir de la technique de l’immunogénétique reverse: Acquérir une grande in-
formation sur les séquences des acides aminés des protéines du VIH de divers cla-
des du VIH.
* Les défis d’élaboration des épitopes CTL du VIH spécifique par la technique de
l’immunogénétique reverse:
- variabilité génétique du VIH,
- polymorphismes alléliques des populations ciblées,
Défis d’élaboration des épitopes CTL du VIH spécifique Nécessité d’informations
sur:
93
1) La variabilité génétique du VIH,
2) La base génétique humaine de la distribution des allèles du système HLA de la
population ciblée
Nous trouvons des donnés sur la variabilité génétiques et la distribution des allèles
du systèmes HLA des populations de l’Afrique de l’Ouest dans le dépôt du Gene
Bank. Connaissance des fréquences des allèles du système HLA de classe I et de
classe II au sein des populations ciblées ( Burkina Faso).
Utilisation des épitopes promiscuous du système HLA de la classe I et II pour la po-
pulation ciblée. Concevoir les épitopes peptidiques par la technique de
l’Immunogénétique Reverse.
Tester les épitopes du VIH sélectionnés pour établir la capacité d’être identifié par
un Lymphocyte T Cytotoxique (CTL) VIH-spécifique et pour recueillir la réponse du
lymphocyte T helper. Figure VIII.7
CHAPITRE XI : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE
I - GÉNÉRALITÉ : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE
A - Historique :
En 1902 Archibald Garrod, médecin anglais appliquait pour la première fois
les lois de Grégoire Mendel à la transmission des maladies héréditaires de l’homme.
Il émit comme hypothèse selon laquelle les facteurs héréditaires (les gènes) contrô-
leraient certaines réactions métaboliques. Successivement il théorisait la nature in-
dividuelle (due à la variabilité et à la spécificité chimique des processus
métaboliques) de toutes les réponses de l’organisme au regard des éléments
étrangers, les agents pathologiques, les aliments ou les médicaments.
Au moment où les recherches fondamentales explicitaient les mécanismes
biochimiques et genetico-moléculaires associés aux pathologies héréditaires, Linus
Pauling en 1949 démontrait que l’anémie falciforme, la drépanocytose, « sick cell »
est une maladie due à une anomalie structurale de la molécule de l’hémoglobine.
Par la suite les chercheurs démontrèrent que cette anomalie structurelle protéique
correspondait à une altération de l’information génétique codée dans l’ADN. C’est à
ce moment qu’ils découvrirent aussi les premiers exemples d’hérédité de certaines
réactions anormales aux médicaments. Le premier exemple est la réaction d’anémie
hémolytique inattendue des soldats américains d’origine africaine, après la prise de
la primaquine, un médicament antimalarique. L’étude moléculaire permit de décou-
vrir chez les personnes qui ne tolèrent pas la primaquine le déficit enzymatique de la
G6PD (Glucose 6 phosphate déshydrogénase). L’étude fondamentale génétique de
94
la susceptibilité individuelle à réagir de manière anormale avec des conséquences
destructives après l’absorption de médicaments, fut appelée, en 1959, pharmacogé-
nétique.
A partir des années 70, les études de pharmacogénétique commencèrent à
montrer que la variabilité individuelle dans le métabolisme des médicaments peut
dépendre non seulement de variations d’un seul gène avec ses allèles mais aussi
de l’interaction de plusieurs gènes mutés dans l’organisme. C’est ainsi qu’à partir
des année 90, les chercheurs émirent le concept de pharmacogénomique pour ex-
pliquer la variabilité individuelle dans la réponse aux médicaments utilisant des
techniques qui permettent d’évaluer l’expression et l’action de plusieurs gènes.
B - Qu'est-ce que la pharmacogénétique ?
La pharmacogénétique est définie comme l’étude des variations génétique-
ment contrôlées de la réponse à un médicament. Elle étudie les mécanismes de
fonctionnement utilisés par la cellule-cible ou la cellule de détoxication, vis-à-vis
d'un médicament administré. La pharmacogénétique a connu un grand développe-
ment en ces dernières années grâce à l’utilisation des techniques de biologie molé-
culaire comme l’analyse des polymorphismes de restriction (RFLP), SSTR,
l’amplification en chaîne par la polymérase (PCR), les méthodes de transfection et le
développement des chips.
La pharmacogénétique qui permet d’établir un lien entre le polymorphisme de
la structure génique et la variabilité de la réponse à l’effet d’un médicament a
comme objectifs :
1 - Rechercher les gènes qui codent pour les enzymes de transformation des médi-
caments.
2 - Élaborer des tests qui montrent que le patient qui doit prendre tel médicament
possède les enzymes de transformation nécessaires.
3 - Tester directement l'activité des enzymes de transformation des médicaments :
des tests devraient se développer de plus en plus pour étudier, à l'avance, la façon
dont chaque individu va transformer puis éliminer tel ou tel médicament.
4 - Déterminer les doses de médicaments à utiliser chez les enfants ou les person-
nes âgées. En effet, la synthèse des enzymes de transformation des médicaments et
leur activité évoluent en fonction de l'âge. Certaines de ces enzymes ne sont pas
encore "matures" chez des enfants ; par contre, chez les personnes âgées, certai-
nes enzymes peuvent avoir une activité réduite.
5 - Identifier pour tous les nouveaux médicaments, les enzymes de transformation
impliquées. La pharmacogénétique représente donc aujourd'hui une composante
importante dans le développement d'un nouveau médicament.
La pharmacogénomie ou la pharmacogénomique est plus difficile à définir. Il
s'agit d'étudier simultanément les modulations, positives ou négatives, de l'expres-
sion des gènes, induites par les composés pharmacologiques analysés. Quelle mo-
dification de l'expression d'un ou de plusieurs gènes induit une molécule donnée?
Autrement dit, à côté de l'effet thérapeutique principal recherché, quelles autres mo-
difications du génome ou du protéome (dans le cadre de ce qu'il est convenu d'ap-
peler la protéomique) peut-on observer, et quelles conséquences directes ou indi-
rectes faut-il en déduire, pour le développement d'une molécule a priori sélectionnée
pour devenir un médicament?
95
C - Pharmacogénétique : Les liens entre les enzymes de transformation
des médicaments et les cancers ?
Les enzymes ont des conséquences multiples dépendant :
* de leur fonction ;
* de la vitesse à laquelle ils agissent ;
* des vertus pharmacologiques de la substance qu'ils détruisent ;
* des propriétés toxicologiques de la substance qu'ils créent.
- Rendre les médicaments efficaces.
Pour qu'un médicament soit efficace, il faut plusieurs conditions : avoir des enzymes
qui transforment le médicament en une substance active (parfois les médicaments
sont directement actifs et n’ont pas besoin de cette étape d'activation), et d'autres
enzymes qui ne dégradent pas trop rapidement cette substance active (pour que le
médicament reste efficace plus longtemps). A l'inverse, les personnes qui n'ont pas
d'enzymes adéquates ne pourront pas utiliser un médicament donné et donc ne tire-
ront pas le bénéfice thérapeutique attendu. L'efficacité d'un traitement dépend donc
directement de la présence et du fonctionnement de certaines enzymes.
- Éliminer les toxiques.
Les enzymes agissent d'une autre façon : certains créent des produits toxiques,
d'autres permettent d'éliminer ces agents toxiques. Ainsi, certaines personnes vont
fabriquer plus de molécules toxiques que d'autres sujets suite à la prise d'un médi-
cament donné. Ces personnes risquent alors de développer plus d'effets indésira-
bles (effets secondaires). Inversement, certaines personnes éliminent plus rapide-
ment ou plus efficacement certains produits toxiques. Ce caractère leur permet
d'être protégées contre l'action de ces toxiques. Ainsi, on sait que certains fumeurs
risquent, plus que d'autres, de développer un cancer du poumon après activation
des produits contenus dans la fumée de tabac par leur transformation enzymatique
en produits cancérigènes.
Afin de mieux combiner les médicaments les uns avec les autres, les personnes
sous traitement peuvent prendre plusieurs médicaments en même temps, pour trai-
ter différentes maladies. Parfois, certaines enzymes de transformation modifient plu-
sieurs médicaments et il peut alors se poser des problèmes de compétition,
d’inhibition ou d’interaction médicamenteuse. Il est important de connaître quels sont
les médicaments qui interagissent les uns avec les autres pour éviter de les combi-
ner.
- Quelques exemples pratiques.
* Une personne sur 300 ne possède par une enzyme nécessaire pour la dégradation
du 5-fluoro-uracile, un médicament utilisé pour le traitement du cancer du côlon. La
conséquence de cette absence est que la personne ne pourra pas éliminer le médi-
cament, qui va alors s'accumuler dans le corps et créer des effets toxiques. D'ores et
déjà, des tests sont disponibles pour vérifier la présence de cette enzyme et pour
mesurer son activité avant de débuter un traitement.
* De même, une personne sur 300 possède une enzyme de transformation de cer-
tains médicaments (l'AZT, le mercaptopurine et la thioguanine) trop performante :
elle modifie trop rapidement ces médicaments qui ne pourront alors pas agir sur les
96
cellules cibles.
* On peut encore citer des enzymes de détoxication (appelées transférases) qui sont
présentes en quantité variable d'une personne à l'autre. Elles agissent principale-
ment en rendant solubles certaines substances chimiques pour qu'elles soient en-
suite éliminées par le foie et/ou les reins.
D – L’épidémiologie des réponses idiosyncrasiques
L’idiosyncrasie idios (ιδιος) en grec = particulier ; sunkrasis (συνκρασις)= mélange).
C’est la manière d’être particulière à chaque individu, qui l’amène à avoir des réac-
tions, des comportements qui lui sont propres.
Les réponses idiosyncrasiques ont une corrélation, au sein de la population, avec
les mutations génétiques et les facteurs variés comme le sexe, l’âge, l’aire géogra-
phique et le groupe ethnique.
La pathologie transmise par les chromosomes sexuels peuvent toucher un
sexe plus que l’autre.
- Une altération transmise en mode récessif avec le chromosome X se manifeste
chez les sujets de sexe masculin, en tant que hémizygote.
L’âge joue dans la pathogenèse dans la mesure où certaines altérations génétiques
peuvent se manifester non à la naissance, mais en âge juvénile ou adulte.
- L’aire géographique est importante quand l’environnement exerce une pres-
sion sélective et favorise l’affirmation d’un profil génétique déterminant. Par
exemple, la présence du gène pour la variante A- de l’enzyme G6PD. La
G6PD tend à se manifester surtout dans les zones endémiques du paludisme.
- Les différences génétiques entre les diverses ethnies sont responsables de la
variation dans la réponse aux médicaments. L’incidence de l’anémie hémoly-
tique induite par les médicaments est mineure chez les caucasiens par rap-
port aux autres populations, tandis que le gène muté qui code une enzyme
pseudo-cholinestérase s’exprime plus chez les européens avec une fré-
quence de 2%.
E - Les critères d’étude en pharmacogénétique
En face d’une réponse pharmacologique atypique, il faudrait suspecter une
base génétique. Mais pour que cela soit accepté, il faudrait des recherches docu-
mentées, appropriées.
L’examen clinique est de par soi-même insuffisant, cependant le cadre clini-
que symptomatique est parfois évident et suggestif, comme dans le cas d’une ap-
née prolongée par suite de l’absorption d’un médicament.
L’information plus certaine est l’étude des familles et des groupes de ju-
meaux. Les études familiales ont permis d’établir , par exemple, que la bio-
transformation de certains médicaments, comme la dicoumarole et la phénylbuta-
zone, dépend des enzymes qui, du point de vue génétique, s’expriment d’une ma-
nière polygénique. Les effets de plusieurs produits comme l’isoniazide, la phénylbu-
tazone et l’halothane, sont évalués en utilisant les jumeaux homozygotes.
97
Les études au niveau des jumeaux comparent les réactions à l’intérieur des
groupes de jumeaux homozygotes et des jumeaux hétérozygotes. Les jumeaux ho-
mozygotes tendent à avoir un profil pharmacogénétique très similaires par rapport à
un type de médicament ; tandis que les jumeaux hétérozygotes présentent des va-
riations énormes comparables aux individus consanguins. Au niveau des jumeaux,
le paramètre qui détermine la pharmacocinétique d’un médicament déterminé, la
demie-vie plasmatique et la contribution de l’hérédité est le coefficient de l’Hérédité
qui s’exprime par l’équation :
h
2
= (V
d
-V
m
)
-----------
V
d
h = Coefficient d’hérédité ; Vd = variance calculée à l’intérieur de jumeaux hétérozy-
gotes et Vm est la variance calculé à l’intérieur des jumeaux homozygotes.
La valeur de h peut varier entre 0 (dans le cas où la contribution génétique est insuf-
fisante ou nulle) à un (dans le cas où l’influence génétique est déterminante).
Dans le cas de la dicoumarole, la phénylbutazone, l’halothane et la nortriptyline, le
coefficient d’hérédité varie entre 0,88 et 0,98.
Exemples de désordres pharmacogénétiques :
Tableau IX.I : Désordres pharmacogénétiques
Altération génétique Médicament Manifestation pathologique
Désordres pharmacogénétiques avec apparition de phénomènes toxiques ou
imprévisibles
G6PD Antimalariques, sulfami-
des, nitrofuranes
Anémie hémolytique
NADH-méta-hémoglobine
réductase
Nitrite, sulfonamides Méta-hémoglobinémie
Pseudo-cholinestérase Succinylcholine Apnée
Polymorphisme de la
N-acetyltransferase
Isoniazide, procaïnamide,
clonazepam
Apparaît la toxicité du mé-
dicament
Transferrine Fer hémochromatose
Désordres pharmacogénétiques avec absence d’effet pharmacologique atten-
du (résistance à l’action des médicaments)
Altération génétique Médicament Effet thérapeutique attendu
Absence du facteur intrin-
sèque
Vit. B12 Absence
Activité antianémique
Réduction des récepteurs
beta2 adrénergique
Beta2 stimulants Absence
Activité antiasthmatique
Altération des récepteurs Insuline Absence
98
de l’insuline Activité antidiabétique
Réduction de la synthèse
du HGPRT
6-mercaptopurine azathio-
prine
Absence
Activité antitumorale
Activité immunosupressive
II - LES DÉSORDRES PHARMACOGÉNÉTIQUES
Les désordres pharmacogénétiques peuvent être classés selon la base des caracté-
ristiques cliniques des réponses idiosyncrasiques et aux altérations génétiques qui
sont à leur origine. Selon ce critère, les réactions idiosyncrasiques peuvent consis-
ter dans l’apparition des effets toxiques ou imprévisibles, ou alors en un manque
d’effet thérapeutique attendu.
La pharmacogénétique est la discipline qui décrit les réponses inusuelles aux
médicaments (idiosyncrasie) sur la base de mécanismes héréditaires. Les variations
interindividuelles de la réponse aux médicaments sont d'observation fréquente, cer-
tains malades ne répondant pas à des doses habituelles, voire élevées, de médica-
ments, tandis que d'autres présentent des accidents de surdosage. De nombreux
facteurs sont connus pour retentir sur la susceptibilité individuelle ; sans compter de
l'observance et des variations liées à l'observateur, ils peuvent être en rapport avec
le malade lui-même (facteurs intrinsèques) : âge, pathologie(s), statut hormonal,
compétence immunologique, génotype, enzymes, ou dépendre de conditions exté-
rieures (facteurs extrinsèques) : variations nycthémérales, facteurs environnemen-
taux, état nutritionnel, consommation d'alcool ou de tabac, stress, activité physique,
en représentent des exemples. Enfin lors d'administrations concomitantes, les inte-
ractions médicamenteuses constituent un dernier volet. La connaissance de ces fac-
teurs de variation peut aider à corriger un schéma posologique pour l'adapter à cha-
que sujet afin d’éviter les phénomènes toxiques et imprévisibles.
A. Variations d'ordre pharmacocinétique
1 - Au niveau de la résorption
Les patients atteints d'anémie pernicieuse juvénile souffrent d'une malabsorp-
tion de la vitamine B12 d'origine génétique. Il existe également une perturbation
congénitale de la résorption de l'acide folique accompagnée de modifications de son
métabolisme qui conduisent à des réponses atypiques en cas d'administration de
folates ou d'analogues tel le méthotrexate.
2 - Au niveau de la métabolisation
Le polymorphisme d'acétylation. L'exemple le plus connu concerne l'iso-
niazide (Rimifon®). Sa biotransformation est catalysée par une N-acétyl transférase
à localisation hépatique préférentielle. Dans une population, il existe une répartition
bimodale de la capacité d'acétylation définissant les acétylateurs rapides (demi-vie
d'environ 2 h) et les acétylateurs lents (demi-vie d'environ 6 h) (figure 5). La réparti-
tion varie selon les ethnies. Environ 45% des Européens sont acétylateurs rapides
contre 80-90% des Asiatiques et la quasi totalité des Esquimaux. Ils ne sont par
contre que 17% parmi les Égyptiens. Le caractère acétylateur lent se transmet selon
99
le mode autosomique récessif. Pour une posologie standard les risques d'apparition
d'effets indésirables par surdosage, en particulier neurologiques, sont plus élevés
chez les acétylateurs lents ; mais en revanche chez les acétylateurs rapides la pro-
duction plus importante, in situ, d'un métabolite hépatotoxique majorerait le risque
d'hépatite.
L'adaptation posologique chez le sujet à risque, et en particulier chez l'enfant,
peut se faire à partir de l'administration d'une dose test et du dosage de l'isoniazide
plasmatique 3 h après. L'application de la formule ci-dessous permet de déterminer
l'indice d'acétylation:
Isoniazidémie à la 3
è
H + 0,6
--------------------------------------
Dose administrée (mg/kg/j)
Fréq.
24
20
16
12
8
4
0
Rapides (R/R ou R/r)
Leats (r/r)
100
Concentrations plasmatiques de lisoniazide mesurées 6 heures après
administration dune dose moyenne de 9,8 mg/kg à 267 membres de 53 familles
(daprès Evans)
En dehors de l'isoniazide, des tests basés sur l'acétylation d'autres molécules
ont également été standardisés : procaïnamide et son métabolite acétylé le NAPA
ou métabolites de la caféine entre autre. L'avantage du test à la caféine est qu'il
peut être réalisé après la simple prise d'un café, sans ingestion de molécule médi-
camenteuse.
L'intérêt du phénotypage d'acétylation dépasse l'adaptation posologique de
l'isoniazide puisqu'il permet également de prévoir le comportement vis-à-vis d'autres
médicaments qui suivent cette voie de métabolisation (hydralazine, procaïnamide,
dapsone, certains sulfamides, aminogluthétimide, caféine, nitrazépam, par exemple).
Le lupus érythémateux induit par l'hydralazine ou la procaïnamide se ren-
contre préférentiellement chez les acétylateurs lents, encore que d'autres facteurs
de prédisposition (typage HLA-DR4 par exemple) soient connus. Enfin, le phénotype
d'acétylation détermine également le métabolisme des amines aromatiques cancéri-
gènes ; ainsi le cancer de la vessie provoqué par les amines est plus fréquent chez
les acétylateurs lents exposés. D'autres pathologies associées au polymorphisme
d'acétylation sont également suspectées.
Le polymorphisme d'oxydation. L'oxydation est impliquée dans la métabolisation
d'un grand nombre de médicaments. Ils suivent la voie des mono-oxygénases hépa-
tiques sous la dépendance d'isoenzymes des cytochromes P450. Ce polymorphisme
a primitivement été mis en évidence avec la débrisoquine, une molécule antihyper-
tensive. Les fortes variations de sa posologie nécessaire pour contrôler l'hyperten-
sion a conduit à la mise en évidence d'un déficit en débrisoquine 4-hydroxylase chez
certains patients. C'est le cytochrome P450 II D6 qui est responsable de ce déficit
qui concerne 5-10% de la population de race blanche mais varie selon les ethnies ;
il se transmet sur le mode autosomique dominant. Pour dépister les métabolisateurs
lents, un test dit à la débrisoquine s'est diffusé. Après administration d'une dose test
de 10 mg, la molécule mère et son métabolite sont dosés dans les urines recueillies
pendant 8 heures. On calcule alors un quotient métabolique qui est compris entre
0,01 et 10 chez les métaboliseurs rapides mais entre 20 et 200 pour les métaboli-
seurs lents. Une vingtaine de médicaments sont métabolisés par le cytochrome
0 2 4 6 8 10 12
Concentration plasmatique de l’isoniazide µg/ml
101
P450 II D6 ; en particulier ce polymorphisme est observé pour les bêta-bloquants,
les antiarythmiques, les neuroleptiques, la plupart des antidépresseurs tricycliques
et les inhibiteurs de la recapture de la sérotonine. Ce test a servi dans de nombreu-
ses études visant à rechercher une susceptibilité particulière à des médicaments ou
des toxiques pouvant servir de support à l'apparition d'effets indésirables ou de cer-
taines pathologies d'étiologie mal connues. Différents autres tests se sont dévelop-
pés, tests au dextrométhorphan, à la sparteïne, à la caféine pour explorer cette
même voie métabolique. Mais il existe également d'autres polymorphismes d'oxyda-
tion indépendants de la voie suivie par la débrisoquine.
Les butyrylcholinestérases atypiques. Certains sujets (1 % de la population eu-
ropéenne) présentent une curarisation prolongée après administration de
succinylcholine. Chez ces personnes l'hydrolyse de la succinylcholine par les
pseudo-cholinestérases plasmatiques et hépatiques se fait très lentement, l'affinité
pour le substrat étant très diminuée par rapport à des sujets normaux. Les sujets
hypersensibles sont homozygotes pour le gène anormal, la fréquence étant évaluée
à 1/2 500. Il existe un moyen, le test à la dibucaïne, pour dépister les patients
porteurs. Cet anesthésique local inhibe in vitro les pseudocholinestérases normales,
alors qu'il n'a que peu d'effet sur les enzymes atypiques. Il est défini un Dibucaïne
Number (DN) qui est de l'ordre de 80 (correspondant à 80% d'inhibition) chez les
sujets sains, mais seulement de 20 chez les sujets porteurs de l'anomalie. Les
butyrylcholinestérases sont également impliquées dans l'inactivation d'autres
médicaments et drogues sans que les conséquences cliniques d'un déficit soient
très claires. En revanche, il existe des sujets qui hydrolysent la succinylcholine plus
rapidement que les personnes normales et qui, de ce fait sont résistantes à cette
substance. Beaucoup plus rare que l'hypersensibilité, cette anomalie porte le nom
de Cynthiana, du nom de la ville Américaine où furent caractérisés les premiers cas.
L'hypoxanthine-guanine phosphoribosyl transférase (HGPRT). Chez les pa-
tients souffrant d'un déficit en hypoxanthine-guanine phosphoribosyl transférase
(maladie de Lesch-Nyhan), les analogues des bases puriques (6-mercaptopurine :
Purinéthol®), azathioprine : Imurel®) utilisés comme anticancéreux ou immuno-
suppresseurs ne sont pas métabolisés. Ces molécules étant en fait des prodrogues
devant être transformées en nucléotides pour être actives, l'absence de métabolisa-
tion les rend inefficaces chez ces malades.
L'uridine diphosphate glucuronosyl transférase. La maladie de Gilbert (5 % de la
population Française) comme la maladie de Crigler-Najjar sont liées à un déficit de
l'uridine diphosphate glucuronosyl transférase. Ce défaut du mécanisme de la glucu-
roconjugaison induit une hyperbilirubinémie mais provoque également une sensibili-
té particulière à des médicaments qui suivent cette voie de métabolisation (paracé-
tamol, salicylés, hydrate de chloral, menthol, morphines, oxazépam, corticostéroïdes
par exemple).
Les enzymes de S- et 0-méthylation. Des déficits des thiopurines méthyltransféra-
ses et thiol méthyltransférases, enzymes respectivement impliquées dans le métabo-
lisme de la 6-mercaptopurine et de l'azathioprine et dans la S-méthylation du capto-
pril (Lopril®) et de la D-pénicillamine (Trolovol®), ont été rapportés. Il existe une
corrélation entre l'activité de la thiopurine méthyltransférase érythrocytaire et la
concentration en 6-thioguanine. Le niveau d'activité de la catéchol-O-méthyl transfé-
rase (COMT) est également contrôlé par le polymorphisme génétique. Où cette acti-
102
vité est impliquée dans le métabolisme de la l-dopa et de l'α-méthyldopa. Des inhibi-
teurs de la COMT sont à l'étude dans le traitement de la maladie de Parkinson.
Les glutathion-S-transférases (GST). Les GST représentent une famille d'enzy-
mes catalysant la conjugaison entre le glutathion réduit et une variété de molécules
électrophiles, y compris des carcinogènes. Elles sont fortement exprimées chez
l'homme dans les hépatocytes. Quatre isoformes sont décrites chez l'homme, l'ex-
pression des GST µ et θ étant soumises à un polymorphisme génétique. Un déficit
en GST µ semble lié à une fréquence accrue de cancers. La sensibilité à
l’hépatotoxicité de la tacrine (Cognex®) des patients souffrant de la maladie d'Alz-
heimer pourrait être liée à l'absence d'expression de GST empêchant la détoxifica-
tion de métabolites réactifs. Ce métabolisme interroge l'activité du cytochrome P450
1A2 qui peut être exploré, là encore, par un test à la caféine.
Alcool et aldéhyde déshydrogénases. L'alcool déshydrogénase (ADH) représente
la principale voie oxydative du métabolisme de l'éthanol ; elle catalyse la réaction
réversible des alcools primaire et secondaire en aldéhyde et cétone. Elle est égale-
ment impliquée dans l'interconversion rétinol-rétinal, le métabolisme des stéroïdes et
des acides biliaires mais aussi des composés digitaliques. Trois grandes classes
d'ADH sont connues ainsi qu'une forme atypique retrouvée chez seulement 5 à 10 %
des Anglais mais 85 % des Chinois et des Japonais. Les différences entre les for-
mes polymorphiques de l'ADH peuvent contribuer à expliquer les variations interin-
dividuelles de vitesse d'élimination de l'alcool. La compétition entre l'alcool et les
glycosides cardiaques pour l'ADH peut augmenter notablement leurs concentrations.
Les formes d'ADH à forte activité catalytique produisent de plus fortes concentra-
tions sanguines d'acétaldéhyde à l'origine des symptômes d'intolérance à l'alcool.
Mais un lien entre alcoolisme et génotype des isoenzymes d'ADH n'a pu être mis en
évidence. La détoxification de l'acétaldéhyde est sous la dépendance de l'aldéhyde
déshydrogénase (ALDH). Au moins quatre isoenzymes sont décrites. Un polymor-
phisme génétique a été mis en évidence pour l'isoenzyme mitochondriale hépatique
ALDH2. 50% des Chinois, des Japonais, des Indiens Sud Américains et des popula-
tions d'origine mongole présentent un déficit d'ALDH2 alors qu'il est totalement ab-
sent des populations de race blanche et noire. Il existe une corrélation positive entre
déficit en ALDH2, taux sanguin d'acétaldéhyde et hypersensibilité à l'alcool. Une
faible incidence de ce déficit est retrouvée chez les alcooliques. Plusieurs enzymes
de cette famille sont inhibées par le disulfiram (Espéral®) ou ses métabolites, expli-
quant son effet antabuse.
B. Variations d'ordre pharmacodynamique
1 - Au niveau d'une protéine
Un déficit ou une hyper-production enzymatique, une modification de la struc-
ture d'une protéine peuvent être responsables de l'apparition d'effets médicamen-
teux inconnus dans la population normale ou au contraire de l'absence de l'action
habituellement observée.
La glucose-6-phosphate-déshydrogénase (G6PD). La G6PD représente la prin-
cipale voie de production du NADPH du globule rouge, cofacteur indispensable au
cycle du glutathion. Le déficit du G6PD est une maladie génétique héréditaire liée
au sexe car le gène qui code cette enzyme se trouve sur le chromosome X. En ab-
103
sence du G6PD et en présence d'un oxydant, l'hémoglobine est dénaturée et préci-
pite sous la forme de corps de Heinz. Les hématies fragilisées sont exposées au
risque de crise hémolytique. Les deux principaux variants (G6PDA
-
et G6PDA
+
) af-
fectent les Noirs Américains, les populations Méditerranéennes et les africains où
l'hémolyse est la plus sévère. Il est à noter que l'activité de la G6PD est toujours
faible chez le nouveau-né, le rendant sensible au risque hémolytique. Ce déficit ne
s'exprime qu'en présence d'un xéno biotique oxydant qui peut être un aliment (fève)
ou un médicament. La transmission est liée au sexe.
Les porteurs hétérozygotes sont plus résistants à l'infection par Plasmodium falcipa-
rum, ce qui expliquerait la conservation du gène dans la population.
De nombreux médicaments provoquent des accidents hémolytiques en particulier
parmi les antipaludéens, les antalgiques et les anti-infectieux (Tableau).
Tableau IX.II: Quelques médicaments pouvant déclencher une hémolyse chez un
sujet atteint de déficit érythrocytaire en G6PD
Médicaments qui provoquent une anémie hémolytique cliniquement significative
chez les sujets avec déficit en G6PD
Antimalariques :
Pamaquine
Primaquine, mepacrine
Analgésiques :
Acide acetylsalicylique, phenacétine
Acetanilide, aminophenazone
Nitofuranes :
nitrofurantoine
nitrofurasone
Sulfones:
diaminodimetylsulfone
thiazolsulfone
Sulfamides:
sulfacetamide,
Autres:
bleu de méthylène
104
sulfamotoxazole
sulfanilamide, sulfapiridine
acide ascorbique
phenylhydrazine
probénécide
Par ailleurs, dans certaines hémoglobinopathies, l'hémoglobine est également ins-
table, facilement dénaturée en corps de Heinz et associée à des crises hémolytiques
induites par des médicaments.
La methémoglobinémie. Plusieurs modifications structurelles de l'hémoglobine ou
de la methémoglobine réductase peuvent être responsables de la methémoglobiné-
mie congénitale. Chez les patients atteints, les substances connues pour être à l'ori-
gine de la formation de methémoglobine doivent être evitées (oxydants directs : ni-
trates, nitrites, chlorates, quinines ou indirects : aniline...) ainsi que tous les médi-
caments contre-indiqués dans le déficit en G6PD.
La delta aminolévulinique synthétase (ALA-synthétase). Les porphyries sont ca-
ractérisées par une anomalie de la régulation de la synthèse de l'hème due à un
déficit enzymatique. Ce déficit entraîne une dérégulation de l'ALA synthétase et
conduit à l'accumulation de grandes quantités de précurseurs de l'hème. Selon le
site primaire d'expression de l'anomalie génétique, différents précurseurs vont s'ac-
cumuler correspondant à des formes différentes de la maladie. Le lien entre l'accu-
mulation de ces précurseurs et les symptômes de la maladie est encore mal appré-
hendé. Les précurseurs sont éliminés dans les urines où ils sont transformés en
porphyrines. Ces maladies se transmettent selon le mode autosomique dominant.
Chez les malades porteurs de cette anomalie, des crises, parfois mortelles, sont dé-
clenchées par les médicaments inducteurs enzymatiques qui, en augmentant encore
l'activité de l'ALA-synthétase, majorent les conséquences de sa dysrégulation. Parmi
les principaux, figurent les barbituriques, la phénytoïne, l'alcool mais aussi la chlo-
roquine, les sulfamides, l'amidopyrine, la griséofulvine, les oestrogènes, liste non
limitative. Les malades porteurs de cette affection doivent être précisément informés
des médicaments et autres substances qui leur sont contre-indiqués.
Certains produits particulièrement puissants, comme par exemple un fongicide
l'hexachlorobenzène, peuvent déclencher des porphyries, d'origine toxique, même
chez des personnes non porteuses d'anomalies héréditaires.
Tableau IX.III: fréquences zygotiques du HbS, HbC, Alpha
-3.7
Thal et G6PDA
-
au Burkina Faso
Groupe Ethnique Fréquences genotypiques
HbS HbC
Alpha
-3.7
Thal G6PDA
-
Mossi (M) 0.024 (8/334) 0.117 (39/334) 0.227 (25/110) 0.195 (51/262)
Rimaibé (R) 0.030 (7/236) 0.127 (30/236) 0.134 (15/112) 0.185 (25/135)
M+R 0.026 (15/570) 0.121 (69/570) 0.180 (40/222) 0.191 (76/397)
Fulani (F) 0.022 (3/136) 0.059 (8/136) 0.103 (12/116) 0.069 (7/101)
2 - Au niveau d'un récepteur
105
Des modifications de l'affinité d'un récepteur peuvent également expliquer
une variabilité de l'action de certaines molécules et en particulier rendre compte de
la résistance à un médicament.
La résistance à la warfarine. Chez quelques rares malades l'administration, même
à forte dose, de warfarine ne s'accompagne pas de modifications du taux de pro-
thrombine. Les anticoagulants coumariniques inhibent la coagulation en bloquant la
synthèse hépatique vitamine K dépendante de quatre protéines impliquées dans le
processus (facteurs II, VII, IX et X). Ils bloquent le cycle de régénération de la vita-
mine K. L'exploration des patients résistants a montré l'absence de modifications
pharmacocinétiques de la warfarine. Il s'agirait en fait d'une modification génétique
du récepteur hépatique.
La résistance aux hormones stéroïdes. La résistance se manifeste à la fois pour
les hormones endogènes et exogènes. Différents syndromes de résistance aux an-
drogènes sont connus. Ils sont liés au chromosome X et correspondent à une modi-
fication de récepteurs intracytoplasmiques. Certains types de résistance à la vita-
mine D sont également reliés à un dysfonctionnement du récepteur tissulaire.
Autres syndromes. Les patients souffrant de mucoviscidose présentent des répon-
ses anormales aux molécules à propriété α-adrénergique, β-adrénergique et choli-
nergique. La trisomie 21 s'accompagne d'une hypersensibilité à l'atropine et aux β-
adrénergiques. La dysautonomie familiale est associée à une hypersensibilité à la
noradrénaline. L'insensibilité à l'amertume de la phénylthiourée ou à l'odeur de cya-
nure sont dues à une anomalie héréditaire des récepteurs sensoriels correspon-
dants.
3 - Variations de mécanisme mal déterminé
L'hypertension oculaire aux corticoïdes. L'administration de collyre aux corticoï-
des provoque dans 5% de la population un glaucome aigu par augmentation de la
pression intra-oculaire. Cette réponse, dont l'éthiopathogénie n'est pas connue, se
transmet selon le mode autosomique récessif.
L'hyperthermie maligne déclenchée par une anesthésie générale. L'incidence
en serait de 1 pour 15 000 anesthésies chez l'enfant et de 1 pour 50 000 à 100 000
chez l'adulte. Le syndrome comprend une très forte hyperthermie, qui peut atteindre
43°, une tachycardie, des arythmies et une rigidité musculaire. L'évolution est le plus
souvent mortelle. Le caractère familial est établi et cette susceptibilité particulière
pourrait être liée à une augmentation idiopathique du calcium sarcoplasmique.
L'anomalie peut être détectée de façon préventive sur une biopsie musculaire, le
muscle des personnes concernées présentant une réponse contractile anormale
quand il est exposé à la caféine ou à l'halothane.
L'anémie aplasique au chloramphénicol. En dehors de l'aplasie réversible dose-
dépendante, dans quelques rares cas, le chloramphénicol peut déclencher une apla-
sie irréversible dose-indépendante chez des sujets génétiquement prédisposés.
Nous venons de passer en revue les principaux facteurs de variation de l'acti-
vité des médicaments. On en retiendra que ces connaissances méritent d'être hié-
rarchisées : certaines relèvent surtout d'une recherche fondamentale tandis que
d'autres présentent une pertinence clinique. Le monitoring médicamenteux comme
106
les différents tests de phénotypages disponsibles représentent une aide spécialisée
à la thérapeutique. Ces notions s'intègrent au développement du médicament ; les
essais cliniques de phase I et II s'efforcent de maîtriser ces facteurs de variation.
BIBLIOGRAPHIE ET REFERENCES
ANTHONY J.F. GRIFFITHS, JEFFREY H. MILLER, DAVID T. SUZUKI, RICHARD C. LEWONTIN,
WILLIAM. M. GELBART, An introduction to genetics analysis, Seventh edition, Freeman, USA 2000.
BENTUÉ-FERRER, REYMANN, les facteurs de variation de l’activité des médicaments, cours
BRUCE A. , Dennis B., Biologie moléculaire de la cellule, Flammarion, Médecine-Sciences, Paris
1995.
CARUSO M, KLATZMANN D. Genetically controlled pharmacomodulation for HIV gene
therapy. CR Acad Sci Paris 1994 ; 317 : 1027-30.
CARUSO M, KLATZMANN D. Selective killing of CD4
+
cells harboring a human immunode-
ficiency virus-inducible suicide gene prevents viral spread in an infected cell population.
Proc Natl Acad Sci USA 1992 ; 89 : 182-6.
107
CHEVALLIER M. D., Rapport sur les applications des biotechnologies à l’agriculture et à l’industrie
agroalimentaire, Office Parlementaire des choix scientifiques et technologiques, Assemblée Natio-
nale Française,
DEFAYE J. , et al. (eds), Risk managementin Biotechnology, Technique DNA tests, n.05200301203,
US Government Printing Office,
ERLICH H.A. –ARNHEIM N., Genetic analysis using the polymerase chain reaction (PCR), « Annu.
Rev. Genet. », 1992, 26 pp. 479-506.
GLICK BERNARD R., PASTERNAK JACK J., Molecular biotechnology, ASM press, second edition,
Washington 1998.
KAPLAN J.C., Biologie moléculaire et médecine, « 2°édition, Médecine-Sciences,
KRIMSKY S., Genetic Alchemy : a social history of the DNA Controversy,
Lemoine F.M.; D. KLATZMANN; S. HERSON; Thérapie génique de l'infection par le VIH,
Virologie. Vol. 3, Numéro 3, Mai - Juin 1999 : 217-26.
LONCLE D., Amaudric M., Génie Génétique, Doin, Paris 1991,
MARGARET W., génétique médicale, médecine-sciences, Paris 1995.
MERTENS T. R. Human genetics : readings on the implications of genetic engeering, John Wiley and
Sons, New York 1975.
NUSSBAUM ROBERT L, Genetics in medicine, Saunders\company, sixth edition, USA 2001.
PAOLETTI R., NICOSIA S., CLEMENTI F., FUMAGALI G., Pharmacologie générale et moléculaire,
Seconde édition, UTET, Turin 2003.
SIMPORE J. , Thérapie génique implications, perspectives et éthique, Camillianum, n° 11, Rome
1995, p. 67-100.
SIMPORE J., Génie génétique : procédés biotechnologies, enjeux thérapeutiques, économiques et
éthiques, imprimerie du MSSRS, Ouagadougou septembre 2000.
WATSON J., Gilman M., DNA Ricombinante, Zanichelli, Bologna 1994 pp. 375-389.
WILLIAMSON B., Gene therapy, « Nature », 1982, 298, pp. 262-264.

Le Serment éthique pour les chercheurs en sciences de la vie, adapté et inspiré du Serment d'Hippocrate médical,
(Science Vol. 286, 19 Nov. 1999, p.1475).

« Je jure d'être fidèle à l'éthique du respect des personnes et des vies humaines et de contribuer au développement de la connaissance et à la plus large diffusion du savoir.

Je respecterai toutes les espèces dans leur biodiversité : ce respect inspirera
mes actes et mes projets, notamment au cours de mes expérimentations sur les animaux ou les tissus humains.

Je m'efforcerai de soulager les souffrances de tous les êtres vivants. Admis(e) à avoir accès à l'intimité tissulaire ou génétique des personnes, je
tairai leur identité et m'astreindrai au secret médical.

Même sous la contrainte, je ne ferai pas usage de mes connaissances contre
les lois de l'humanité.

Je préserverai l'indépendance nécessaire à l'accomplissement de ma mission. Je m'informerai et réfléchirai au sens de mes expérimentations et à leurs
conséquences.

Je veillerai à ce que mes travaux et recherches ne soient pas utilisés à des
fins de destruction ou de manipulation.

Je respecterai les savoirs des ethnies et des sociétés traditionnelles. Je n'aurai garde d'oublier mes responsabilités à l'égard des générations présentes et futures.

Je n'accepterai pas que des considérations de nationalité, de culture, de politique ou d'avantages matériels me détournent de mes devoirs.

J'interviendrai pour défendre, s'il m'en est donné l'occasion, l'ensemble de ces
règles.

Que les hommes et mes confrères m'accordent leur estime si je suis fidèle à
mes promesses.

Que je sois déshonoré (e) et méprisé (e) si j’y manque ».

2

Pages SERMENT POUR LES CHERCHEURS EN SCIENCES DE LA VIE INTRODUCTION 02 05

PREMIERE PARTIE: LES OUTILS DE LA BIOLOGIE MOLECULAIRE
CHAPITRE I : TECHNIQUES D’EXTRACTION, DE CONTRÔLE DE PURETE ET DE QUANTIFICATION DES ACIDES NUCLEIQUES, I. Extraction, précipitation de L’ADN des eucaryotes et des procaryotes II. Contrôle de la pureté de l'ADN extrait III: Quantification de l'ADN 10 CHAPITRE II : LES VECTEURS : PLASMIDES, PHAGES, COSMIDES, YAC, BAC, VIRUS

07

08

08 10

13

I- Les vecteurs en génie génétique : l'ADN plasmidique II- L'ADN phagique III. Cosmides, YAC et BAC

13 17 20

Chapitre III: ENZYME DE RESTRICTION, ÉLECTROPHORÈSE, CARTE DE RESTRICTION I. Enzymes de restriction II. L’électrophorèse sur gel III. Les enzymes utiles en génie génétique: CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. I - Le clonage II - Les banques génomiques III - Les banques de cADN IV - L’étude de l’ADN cloné CHAPITRE V: MUTAGENÈSE IN VITRO, EXPRESSION DES GÈNES EUCARYOTES DANS LES BACTÉRIES. I - Les mutagenèses II. Mise en évidence des effets de la modification III. Transfert de l’ADN modifié

24

24 30 31 36 36 36 38 40 51

51 56 57

3

Vers l’espoir d’obtenir un jour un vaccin anti-VIH.Les nouvelles molécules antivirales en développement: III. PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE I .DEUXIEME PARTIE : APPLICTION DE LA BIOLOGIE MOLECULAIRE : LE GENIE GENETIQUE 59 CHAPITRE VI: LES TECHNOLOGIE DU GENIE GENETIQUE APPLIQUEES AUX MICRO-ORGANISMES I. CELLULES SOUCHES EMBRYONNAIRES. – Le plasmide Ti II – Le Terminator III – Application des techniques du génie génétique à l’agriculture CHAPITRE VIII : LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX ANIMAUX I – Les insectes transgéniques II – Les animaux transgéniques CHAPITRE IX : CLONAGE DES MAMMIFERES.Les désordres pharmacogénétiques 60 60 63 63 64 64 65 68 71 71 73 77 82 82 83 87 87 88 93 93 98 98 99 100 101 107 107 111 4 . THERAPIE GENIQUE I – Clonage des organismes entiers II – Les cellules souches embryonnaires III .La thérapie génique: CHAPITRE X : LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES DANS LA RECHERCHE SUR LE VIH/SIDA I – Structure du VIH II . PARTHENOGENESE.Synthèse de l’hormone de croissance (GH) V – Production de vaccins VI .Production de nouvelles antibiotiques VII – Production d’aliments fermentées CHAPITRE VII: LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX VEGETAUX I.La parthénogenèse: IV . IV. La technique de l'ADN recombinant (ADNr) II – Synthèse du facteur VIII humain III – Synthèse de l’insuline humaine IV . Le génie génétique et la lutte contre le VIH.Généralité : Pharmacogénétique et pharmacogénomie II .

aux applications très variées qui permet d’intervenir avec une grande précision sur le patrimoine génétique de tous les organisme vivants. de le découper et de l’isoler ensuite des autres molécules d’ADN. Le résultat obtenu au cours de cette manipulation est la protéine originelle du premier organisme. de l’amplifier afin qu’il soit plus facile d’accès. Cette technique permet d’identifier un gène spécifique parmi les 30. • de cloner et d’amplifier. Le génie génétique permet : • d’identifier et d’isoler. pour séquencer. Les applications directes de la biologie moléculaire: • En biotechnologie: le génie génétique permet de faire produire par des micro-organismes recombinants des protéines eucaryotes comme des hormones. dont il code et détermine la structure (Projet Séquençage génome humain février 2001).BIBLIOGRAPHIE INTRODUCTION 120 Les méthodes et les techniques de biologie moléculaire développées durant ces dernières décennies. transférer et analyser les produits de l’expression du matériel génétique des diverses espèces vivantes ont donné lieu à une application sous le nom de « génie génétique ». Ces techniques doivent permettre une meilleure compréhension génétique et fonctionnelle des organismes vivants. Cependant. • de modifier et de transférer. des anticorps monoclonaux et il offre des perspectives nouvelles dans 5 . • de contrôler l’expression d’un gène ou d’un transgène dans le matériel biologique. Il s’agit donc d’un outil. être réinséré dans une molécule d’ADN d’origine différente. Le gène isolé peut. cosmides etc. Le transfert transitoire ou stable d’un DNA étranger dans une cellule procaryote ou eucaryote s’opère grâce à des vecteurs naturels et à de nouveaux vecteurs issus des constructions: plasmides. ce qui permet de transférer de l’information génétique d’une cellule vers une autre dans laquelle il pourra diriger la production d’une protéine particulière. des vaccins. virus. à la fin. le génie génétique permet également d’apporter des modifications à des gènes par une mutagenèse dirigée qui par conséquent produiront des protéines modifiées ou recombinantes. « recombiner ».000 gènes environ que compte l’être humain. bactériophages.

consiste à transférer certains gènes dans les cellules du patient pour prévenir l’apparition d’une maladie ou en ralentir l’évolution. Plusieurs gènes doivent donc s’associer dans ce processus. parfois ectopique. Cependant. • Perspective pour demain: avec le projet du génome humain et la technique du clonage positionnel.l’industrie agroalimentaire.000 à 30. Aujourd’hui. le champ d’application du génie génétique. • En médecine: le but du génie génétique est la prédiction. Ainsi. le diagnostic des maladies héréditaires et leur soin à travers la thérapie génique et la pharmacogénétique. Ces informations plus complexes et plus complètes peuvent amener un gène à produire de façon différente une même protéine selon l’état physiologique de la cellule. cellules épithéliales. cellules osseuses ou simplement quelques boucles de cheveux). Si la technologie génétique sait parfaitement identifier. sans doute. Ce type de génothérapie suscite de très grands espoirs. pour l’instant. les génies généticiens cherchent à localiser et à séquencer non seulement les gènes responsables des maladies héréditaires mais aussi la totalité du génome humain pour créer la cartographie génique de l’homme. 6 . elle a beaucoup plus de difficultés à l’heure actuelle pour déterminer les liens existant entre les différents gènes. aujourd’hui un champ d’application très large et nous ouvre des perspectives nouvelles. posent encore des problèmes qui restreignent. isoler et modifier un gène particulier. Leur transfert et leur expression. Il s'agit incontestablement d’une technologie clé pour ce troisième millénaire. la production d’une protéine de nature et de fonction données peut nécessiter des informations présentes à plusieurs endroits de l’ADN. mais une nouvelle problématique se pose: comment déterminer les interactions existantes entre les 20. afin de fournir à l’organisme les quantités et les qualités précises de cette protéine en fonction de son rôle biologique. La thérapie génique somatique qui est différente de la thérapie génique germinale. de son stade de développement ou de différenciation. le génome humain a été entièrement séquencé . des micro chips.000 gènes de l’organisme humain ? Le génie génétique possède. dans l’amélioration génétique des espèces animales et végétales. le génie génétique a ses limites. dans un organisme vivant. • Protection sociale et législation: La médecine «légale» à travers la technique de l'ADN «finger printing» peut individualiser une personne humaine sans équivoque car cette technique ne requiert que quelques cellules de la personne concernée (cellules sanguines. comme toute technique.

PREMIÈRE PARTIE : LES OUTILS DE LA BIOLOGIE MOLECULAIRE 7 .

il faut d’abord séparer les noyaux du contenu cytoplasmique et de ces organites cellulaires. Le mélange phénol-chloroforme permet de dénaturer les protéines car non miscible à l’eau et de densité supérieure à cette dernière. Un prélèvement de 5 à 10 ml de sang recueilli sur un anticoagulant comme l'EDTA. PRÉCIPITATION DE L’ADN DES EUCARYOTES ET DES PROCARYOTES Toutes les méthodes biochimiques qui permettent d’extraire l’ADN dans les différents tissus peuvent être utilisées en fonction des espèces. Pour ce qui concerne le génome humain comme pour tous les mammifères. Les leucocytes sont alors récupérés par centrifugation suivie d’un lavage avec la même solution hypotonique. Ils sont ensuite traités par un mélange de détergent. en l’occurrence les cellules sanguines qui sont très accessibles compte tenu de la moralité et du bénéfice du doute. Nous prendrons comme exemple. et en tenant compte de la structure anatomique des cellules. permet d’obtenir quelques centaines de microgrammes de DNA sous la forme de fragments de taille supérieure à 20 kbases. Un traitement par la protéinase K (une protéase) permet de libérer le DNA nucléaire en digérant les histones qui lui sont associées dans les chromosomes eucaryotes. La lyse des cellules eucaryotes. L'élimination des protéines non digérées et des lipides se réalise par des précipitions et des extractions sélectives. les leucocytes sanguins constituent une source simple de DNA pour les études de biologie moléculaire. 1. Le sang fraîchement recueilli (avec un anticoagulant comme l’EDTA) ou décongelé est vigoureusement mélangé à une solution hypotonique pour faire éclater les hématies dépourvues de noyaux. comme le SDS (Sodium DodécylSulfate) qui permet de désagréger les membranes cellulaires et de libérer les contenus cytoplasmiques et nucléaires. Cette quantité est suffisante pour entreprendre une expérience d’application en génie génétique. EXTRACTION. 8 . DE CONTRÔLE DE PURETE ET DE QUANTIFICATION DES ACIDES NUCLEIQUES.CHAPITRE I : TECHNIQUES D’EXTRACTION. les cellules eucaryotes humaines. La lyse des cellules sanguines met en jeu l’intervention de détergents ioniques qui désorganisent la double couche de phospholipides des membranes cellulaires. Les acides nucléiques n'y sont pas non plus solubles et restent dans le surnageant aqueux. I. En biochimie classique et pour d’autres applications.

2. Les acides nucléiques sont alors à récupérer de la phase aqueuse par des précipitations à l’alcool éthylique ou à l’isopropanol en fonction des besoins. Pour les analyses génétiques (application des diagnostics de routine).Pour les tissus. Pour des études biochimiques fines de structure. la bactérie la plus utilisée pour les analyses en biologie moléculaire. La lyse cellulaire utilise ici une enzyme : le lysozyme qui permet de dégrader la membrane cellulaire. L’extraction de l’ADN par le mélange phénol / chloroforme. L’ADN récupéré sous forme de fibres peut être conservé sous la forme solide pendant des temps très longs. 3. Le mélange phénol-chloroforme non miscible à l’eau permet de transférer les protéines dans la phase organique alors que les acides nucléiques restent dans la phase aqueuse. Il peut aussi être re-dissout dans un tampon stérile de force ionique moyenne contenant de l'EDTA et dont le pH est compris entre 7 et 8 Figure I. La phase aqueuse résultante peut subir plusieurs extractions par un mélange chloroforme-éther pour éliminer les peptides restants. L'élimination de l'ARN peut être effectuée à la fin ou avant l'étape phénolique. le DNA obtenu est de qualité suffisante et peut être quantifié par simple pesée.1 : Méthode classique de l’extraction et de la purification de l’ADN Figure I. Pour cela. L’extraction et la purification suivent alors le même protocole. Une congélation préalable permet de transformer les tissus en une masse solide qui se prête alors à un concassage par les techniques courantes de broyage.3 : Organigrammes de l’extraction et de la purification de l‘ADN des procaryotes 9 .2/I. L’ADN des procaryotes Le schéma de la figure I. On obtient alors les acides nucléiques sous la forme de fibres solides que l’on récupère par centrifugation. il convient de procéder à d’autres purifications. dépourvue d'activité DNAase. il est conseiller de les désagréger par les techniques courantes de biochimie comme le broyage ou les ultrasons. on utilise une RNAase pure ou "DNAase free".2 résume les différents étapes de l’extraction et de la purification de l’ADN d’Escherischia coli. les traces de phénol et des composés organiques qui y sont solubles. La purification suit le même schéma que pour celle de l’ADN des eucaryotes. c'est à dire.

8 < R < 2 R < 1. -Un épaulement à 270 nm indique une contamination par phénol. l’extraction. Les protéines. -Un épaulement à 280 nm indique une contamination protéique.Un détergent puissant (SDS ou sarcosyl) . principaux contaminant des préparations absorbent aussi à 260 nm.4. le coefficient moyen d’absorption d’un nucléotide est supérieur à celui du même nucléotide dans la double hélice à cause de l’hypochromisme. Extraction des ARN Les ARN sont plus difficiles à étudier parce qu’ils sont très sensibles aux ribonucléases (RNase A) qui sont très actives et présentes même sur les doigts du manipulateur. Après une centrifugation pour éliminer les débris cellulaires. les tissus ou les cellules sont homogénéisés dans un tamPour pon acétate contenant : . Le rapport R= A260nm / A280nm constitue alors un bon moyen pour apprécier une éventuelle contamination de la préparation d'ADN par les protéines ou par les RNA. Il peut se conserver congelé à –70°C pendant un an. 10 . L’apparition d’épaulements donne une idée des différents contaminant. CONTRÔLE DE LA PURETÉ DE L'ADN EXTRAIT Le maximum d'absorption des acides nucléiques se situe à 260 nm. de dénaturer les acides nucléiques et de dissocier les protéines. On peut également utiliser l’ultracentrifugation. II. *R = A260nm/A280nm * ADN pur: * ADN contaminé par les protéines: * ADN contaminé par les ARN: 1. Le culot est récupéré. lavé avec le tampon acétate et précipité à l’éthanol. Il faut donc des conditions de stérilité parfaite pour travailler avec ces acides nucléiques. Les ARN étant en simple brin. permet également d’estimer les contaminations éventuelles et permet aussi de quantifier l’ADN de la préparation.V. les RNA sont extraits suivant plusieurs techniques.Un agent réducteur (DTT ou 2-mercaptoéthanol) Ce type de tampon permet d’inhiber les RNases endogènes. Une contamination par les ARN se traduit par une augmentation du rapport R. mais avec maximum d'absorption qui se situe vers 280 nm à cause des acides aminés aromatiques.7 R>2 Le spectre d'absorption U.Un agent dissociant (thiocyanate ou guanidine) . La technique par précipitation différentielle du RNA et du DNA en fonction du pH et de la concentration en éthanol donne de très bons rendements. Elles peuvent résister à un traitement à 90°C pendant une heure.

de la concentration en ADN A 260 avec un trajet optique de 1 cm. -En absence d'impuretés l'absorbance de la solution d’ADN à 320 nm doit être autour de zéro.l = Une unité d’absorbance correspond à 25 g/ml de RNA ou d’ADN simple brin. cette méthode est peu sensible pour manipuler des concentrations d'ADN inférieures à 250 ηg/ml c. On utilise un spectrofluorimètre pour mesurer l'intensité de la fluorescence d'une solution d'ADN en présence d'un excès de BET. une unité d'absorbance correspond à une concentration d’ADN double brin de 50 µg / ml. En milieu acide à chaud. Cette méthode permet de mesurer des quantités d’ADN de l’ordre de quelques picogrammes.C. 11 . ou mieux après photographie. Le principe de la quantification consiste à comparer à l’ il nu (estimation). l'intensité de la fluorescence émise par l'ADN sur un gel d’électrophorèse. le rendement de fluorescence du colorant devient cent fois plus important. Par cette méthode on peut déceler des quantités de DNA de l’ordre de 50 ηg/ml.Dosage colorimétrique de l'ADN Il est basé sur la réaction spécifique des 2-désoxypentoses avec la diphénylamine. Dosage fluorimétrique classique de l'ADN. Le BET peut être remplacé par un autre colorant pour augmenter la sensibilité de la mesure. Figure I. . La quantification exacte consiste alors à établir une courbe d’étalonnage donnant l’intensité de fluorescence d’une solution de BET à laquelle on ajoute des quantités croissantes de DNA de concentration connue.-Un épaulement à 230 nm indique une contamination par les glucides. C’est la méthode classique pour mesurer des quantités importantes de DNA (de l’ordre de quelques milligrammes). On compare ensuite les valeurs de ces intensités avec celle d'une solution d'ADN standard (courbe standard). Dosage de l'ADN par fluorescence en présence de BET Le Bromure d'Ethidium (BET) interagit avec l'ADN en s’y intercalant et une fois intercalé. d. La concentration de l’ADN d’une préparation peut être alors calculée par la relation : A= ε. b: Dosage par absorption U. Malheureusement. (Gamme d'étalonnage).4 : Spectre d’absorption de l’ADN III: QUANTIFICATION DE L'ADN a. le 2-désoxyribose des nucléotides puriques peut être libérés et former un composé bleu dont le maximum d'absorption se situe à 595 nm.V.

1. Une bactérie peut posséder un très grand nombre de copies plasmidiques. BAC. Un ou plusieurs sites de restriction (polylinker) qui permettent la linéarisation du plasmide préalable à l'insertion de l'ADN exogène. ce qui permet la sélection des cellules résistantes qui survivent sur un milieu contenant l’antibiotique en question. COSMIDES. b : Caractéristiques des plasmides utilisés en génie génétique La cellule hôte la plus utilisée est Escherichia coli. susceptibles de se répliquer de façon autonome (réplicons). A l'échelle industrielle.LES VECTEURS EN GÉNIE GÉNÉTIQUE : L'ADN PLASMIDIQUE 1. Les plasmides naturels dits de première génération ont été utilisés dans le passé comme vecteur de clonage. extra-chromosomiques.CHAPITRE II : LES VECTEURS : PLASMIDES. 12 . elles sont transférables d’une bactérie à une autre au cours de la conjugaison bactérienne. La plupart des plasmides naturels contiennent des gènes qui confèrent à l'hôte des propriétés supplémentaires comme la résistance aux antibiotiques. Un second gène marqueur phénotypique (soit un deuxième gène de résistance à un second antibiotique ou le gène Lac Z' ) qui permet de reconnaître parmi les colonies transformées celles qui hébergent un plasmide recombinant. Ils sont présents dans le cytoplasme de nombreuses espèces bactériennes. L'étude des mécanismes de l'expression d'une séquence d'ADN exogène. mais les plasmides utilisés actuellement sont modifiés et sont donc des chimères obtenues par des recombinaisons de différents plasmides naturels et de DNA viral. Ils possèdent : Une origine de réplication de type relâché : la séquence ori. Leur ADN comprend au minimum les gènes intervenant dans la réplication et la ségrégation de leur matériel génétique dans les cellules filles à chaque cycle de division cellulaire de la cellule hôte Figure II. Leurs utilisations majeures comme vecteurs en génie génétique sont : Le clonage et l'amplification d'une séquence d'ADN exogène. Ils sont petits de taille pour permettre l'insertion d'une importante quantité d'ADN exogène tout en maintenant une bonne efficacité de transformation. Les plasmides. Le nombre de copies par cellule est très important (plusieurs centaines par cellule) Un gène de résistance à un antibiotique auquel la souche hôte est sensible. circulaires. L'introduction des gènes dans les cellules bactériennes (transformation) ou animales (transfections) ou dans des organismes entiers (animaux transgéniques). PHAGES. YAC. VIRUS I . a : Définition : Les plasmides sont de petites molécules d'ADN bicaténaires. Une bactérie peut posséder en même temps plusieurs plasmides différents sauf si leur co-habitation est incompatible avec la survie de la bactérie. la production des protéines codées par les gènes contenus dans l’ADN inséré.

Une insertion réussie se traduira par l'inactivation de ce gène qui ne sera plus capable de conférer la résistance à la tétracycline à la cellule hôte. L'insertion d’un vecteur dans pUC est détecté par l'inactivation de la fonction galactosidase du gène Z'. Figure II. X-Galactoside → X (colorant bleu) + Galactose En résumé. L'ADN du donneur peut être. Figure II. Ils peuvent porter des gènes de résistances aux antibiotiques. seules celles qui s'avèrent sensibles à la tétracycline contiennent une insertion. en d'autres termes. Chacun de ces gènes contient un site de restriction qui est utilisé pour le clonage. Ces dernières doivent avoir été transformés avec succès par une molécule de plasmide recombinante. les plasmides sont des fragments d'ADN extra-chromosomiques circulaire présents dans les bactéries et susceptibles de se répliquer de façon autonome. tetR et ampR. Parmi les colonies AmpR. L'adaptateur est en phase avec la séquence codant la β-galactosidase mais n'interfère pas avec son fonctionnement. Il contient 2 gènes de résistance aux antibiotiques. 13 .c : Deux vecteurs plasmidiques : pBR 322 et pUC18 Le plasmide pBR322 est très simple dans sa structure. seules les colonies ampR tetS contiennent de l'ADN recombinant (ADN du plasmide et ADN inséré).2 : Le plasmide pBR322 d : Les plasmides pUC Les plasmides de la famille pUC sont des vecteurs plus élaborés dont la structure permet la sélection visuelle directe des colonies contenant l’ADN inséré.3 : plasmides pUC L’origine de réplication ori des plasmides pUC diffère légèrement par mutations de celle de pBR322. Expérimentalement ils sont utilisés comme vecteur pour transporter de l’ADN exogène. indiqué par le phénotype tetS (sensible). L’insertion de l’ADN étranger dans pBR322 est détectée par l’inactivation du gène de résistance (tetR). C'est pourquoi le protocole de clonage consistera à mélanger l’ADN du plasmide et l’ADN du donneur digérés par une même enzyme de restriction suivi d’une ligaturation. inséré dans le gène tetR. par exemple. Cette préparation est alors utilisée pour transformer les bactéries et sélectionner les colonies résistantes à l'ampicilline. L'élément clé est une petite portion du gène de la β-galactosidase d’Escherichia coli. polylinker ou cloning site) contient de nombreux sites de restriction utiles pour l'insertion des fragments de l'ADN du donneur. ce qui explique le très grand nombre de copies des plasmides pUC dans une cellule bactérienne et par suite des vecteurs de troisième génération qui en dérivent. qui se traduit par l'incapacité de la cellule hôte à convertir le substrat artificiel X-Galactoside en un colorant bleu (X= paranitrophénol). Un segment d'ADN synthétique appelé adaptateur (en anglais.

Les plasmides de première génération: ce sont les plasmides rencontrés dans la nature. Les différents plasmides de cette famille diffèrent les uns des autres par la taille de leur polylinker. Xma 1 et Nru 1 dans le gène TcR Cla 1 et Hinh III dans le promoteur du gène TcR Pst 1. la famille pUC: Ce plasmide de 2 600 paires de bases environ dont pUC18 possèdent : un promoteur et un opérateur efficace de transcription. 1 : Quelques caractéristiques des deux plasmides utilisés en génie génétique. La présence de ce polylinker n’interfère pas avec le fonctionnement du gène de la -galatosidase. 11 sont localisés dans les gènes de résistance aux antibiotiques. 14 . et Sca 1 dans le gène AmpR L'insertion d'ADN étranger dans un quelconque de ces sites se traduit par la perte de la résistance à l'antibiotique. Un polylinker est inséré dans le gène lacZ.pique lule 15 à 20 Tétracycline Ampicilline ≈ 500 Ampicilline Lac Z' pPUC18 686 Quelques sites uniques de restriction EcoR I. constitué de 4 363 paires de bases. (pBR312 à 328) obtenus par construction. le gène de résistance à l’ampicilline AmpR et une partie du gène lacZ. Leur petite taille permet l’insertion d’un ADN assez grand et une croissance rapide des plasmides. EcoR V. Le plus utilisé est le plasmide pBR322. Sph 1. Les plasmides de 3ème génération : Ces plasmides ont été construits pour faciliter le travail de sous clonage et pour une sélection des clones recombinants. pSC101. Le gène LacZ permet la sélection des recombinants par la couleur des colonies. Parmi les sites uniques. Il faut donc pour cela utiliser les bactéries lac-. Pvu 1. Ces types de plasmides n'ont pas les propriétés requises pour les manipulations génétiques. BamH 1. Nde I.Vecteurs Taille en bp pBR322 4363 Nombres de Marqueur phénotycopies par cel. RSF2124. Les plasmides de seconde génération: ce sont les plasmides de la famille pBR. Pvu II. Il s'agit des plasmides ColE1. Afl III 13 sites de restriction sur un polylinker Tableau I. Il possède deux gènes de résistance aux antibiotiques : l’un pour la tétracycline TcR et l’autre pour l’ampicilline AmpR et 20 sites uniques pour les enzymes de restriction. Sal 1. Hind III.

Ils possèdent en plus sur le brin complémentaire. L’avantage de ces plasmides est de pouvoir transcrire l’ADN inséré en une grande quantité d’ARN sur les deux brins pour servir de ribosondes ou pour la traduction en protéines. Figure II. 2-Lyse des bactéries pour libérer le plasmide : La lyse des cellules est réalisée dans les conditions permettant d'obtenir l'ADN plasmidique purifié dans une solution ne contenant que très peu d'ADN chromosomique et de protéines: Le traitement des bactéries par le lysozyme suivi d’un traitement avec un détergent (Triton 100 ou SDS) ou d’un traitement basique fait passer les RNA et les plasmides en solution tandis que l’ADN bactérien reste emprisonné dans les fantômes bactériens . plus de 500 exemplaires par cellule.6 : Le plasmide pUC18. Ils sont plus petits que pBR322 (entre 2900 et 3000 bp). Toutes comportent cependant trois (3) étapes principales : 1-Croissance des bactéries hôtes avec éventuellement amplification du plasmide en ajoutant par exemple du chloramphénicol qui bloque la croissance bactérienne sans affecter la réplication de l’ADN plasmidique. Les principales techniques de purification sont : Le lysat clair est soumis à une ultracentrifugation dans du chlorure de césium (CsCl ) en présence de bromure d’éthidium (BET) saturant. 15 . de l’autre côté du polylinker. typhimurium immédiatement adjacent au polylinker. due à sa petite taille. Extraction et purification de l’ADN plasmidique Il existe de nombreuses méthodes d'extraction et de purification des plasmides . Ces types de plasmides offrent un avantage. un promoteur de la RNA polymérase du phage T7. le gène de résistance AmpR et le promoteur de la RNA polymérase du phage SP6 qui provient de Salmonella.4 : Le plasmide Blue-Script II . Chaque fois que ce gène est exprimé. Il possède. l’ADN inséré est aussi exprimé d’ou la production de la protéine correspondante. Figure I. Le plasmide BlueScript® est un petit plasmide de 2961 paires de bases à haut nombre de copies. outre le gène de résistance à l’ampicilline. Les plasmides Blue-Script®. Les plasmides Gemini (1 à 4) dérivent des précédents. Cette solution est appelée lysat clair. Ces plasmides possèdent : un polylinker. car ils permettent de transcrire en ARN la séquence d’ADN qui a été insérée dans le polylinker. le gène lacZ’ (codant pour le peptide de la -galactosidase et contenant les séquences régulatrices de l’opéron lactose) qui permet la sélection des colonies. La haute efficacité de transformation. Ce sont les plasmides les plus complexes car ils combinent tous les avantages des vecteurs précédents.La famille pSP . 2. l’ADN inséré est sous la dépendance du promoteur du gène lacZ’. 3-purification du plasmide à partir du lysat. constitue un intérêt avantageux pour ce vecteur en biotechnologie. De plus.

L'ADN PHAGIQUE Les bactériophages ou phages sont des particules virales qui infectent les bactéries. 5. Les bactéries à prophage intégré sont appelées des bactéries lysogènes. dans les conditions appropriées de force ionique et de pH.502 paires de bases. Figure II. 7 La région centrale du génome du phage λ n'est pas nécessaire pour la réplication ou l'encapsidation des molécules d’ADN de λ dans Escherichia coli et peut donc être excisée par des enzymes de restriction et écartée. Cette propriété permet de sélectionner les particules du phage λ naturel des phages λ contenant des ADN étrangers. l’ADN du phage intégré dans le chromosome bactérien prend immédiatement en charge le système de transcription et de traduction de la cellule hôte qui commence la synthèse des constituants protéiques du phage. 1. agents mutagènes…) Deux types de phages qui infectent Escherichia coli sont d'usage fréquent en génie génétique: le phage λ et le phage M13. II. Ces différents constituants s’assemblent et forment de nouvelles particules phagiques dès que commence la réplication de l’ADN phagique. 16 . La tête du phage λ peut encapsider spécifiquement un ADN chromosomique d’environ 5 kb. 6 Réponse lysogénique : L’ADN du phage est intégré dans le chromosome bactérien. La chromatographie d'échange d'ions. c’est à dire qu’il se réplique en même temps que le chromosome bactérien mais reste intégré à ce chromosome. Lorsque l’ADN du phage pénètre dans une bactérie. deux types de réponses peuvent se produire : Une réponse lytique : Dans ce cas. La lysogénie peut être supprimée par des agents inducteurs de la virulence des phages (rayons X. La bactérie éclate et les nouvelles particules virales infestent les bactéries voisines. permet également à l'ADN plasmidique d’être absorbé sélectivement. Il ne se produit pas de nouveaux virions.Le phage Lambda λ Le phage λ est un bactériophage de 1ère génération. Figure II. Figure II. Il reste à l’état de repos. Les extrémités appelés COS sont constituées par de l'ADN sous forme simple brin sur une longueur de 12 bases.La précipitation différentielle de l'ADN plasmidique par le polyéthylène glycol (PEG ) permet aussi d'éliminer les petits fragments d'ADN et d'ARN non précipités et d’obtenir des plasmides de pureté appréciable. Le métabolisme et la viabilité des bactéries ne sont pas modifiés tant que la bactérie reste dans cet état. Le bactériophage λ est un vecteur de clonage efficace pour plusieurs raisons: Les extrémités cohésives permettent au phage de se concaténer et de se circulariser. Leur multiplication est rapide et le nombre de copies par cellule bactérienne est très important. Il est constitué d'un ADN double brin linéaire de 48. Il se forme alors une plage de lyse sur une boite de Pétri. La circularisation est observée dans la bactérie immédiatement après l’infection.

3. La sélection des recombinants se fait en analysant la coloration bleue ou blanche. lorsque la culture est réalisée sur un milieu contenant le substrat X-gal et l’IPTG. Le phage λ ZAP II est une forme améliorée du précédent qui permet de visualiser l’expression du DNA inséré. ces sites sont souvent localisés dans les régions du génome indispensables pour le cycle lytique du phage. Le phage λgt 11 est utilisé dans la stratégie de l’insertion pour cloner les cDNA dont la longueur varie de 6 à 8 kb. Les molécules d’ADN ainsi obtenues peuvent être introduites dans E. : Les phages EMBL 3 et 4 17 . De plus. on a construit des phages qui n'ont qu'un (pour vecteur d’insertion) ou deux (pour vecteurs de substitution) sites de restrictions situées dans les parties non essentielles du génome de phage λ. 8 Le génome du phage λ : Les gènes AWBCNu3DEFIFII codent pour les protéines de la tête Les gènes ZUVGTHMLKIJ codent pour les protéines de la queue Les gènes att int xis permettent la recombinaison Les gènes cIII N cl cro cII assurent la régulation Les gènes O P assurent la réplication Le gèneQ est également un gène de régulation Les gènes R S permettent la lyse bactérienne La partie centrale peut être délétée pour insérer un ADN exogène 2: Dérivés du phage λ utilisés comme vecteur de clonage Le bactériophage λ sauvage ne peut pas être toujours utilisé pour le clonage car son ADN comporte des sites multiples pour beaucoup d'endonucléases de restriction utilisées dans les différents processus de clonage. A partir des phages sauvages. permettant la recherche du recombinant désiré à l’aide d’un anticorps dirigé contre la protéine synthétisée. si bien que la taille de l'ADN étranger qui pourrait être inséré est très limitée. Il sert de vecteur d’expression car la séquence insérée pourra être exprimée dans la bactérie sous forme de protéine. Figure II. coli par la transformation ou être encapsidées in vitro dans les têtes d’un bactériophage. La longueur de l'ADN pouvant être encapsidé ne peut dépasser 5 kb.Les "deux bras" restants sont ensuite ligaturés avec l'ADN du donneur digéré par les mêmes enzymes de restriction.

Les deux phages ne diffèrent que par l’orientation du polylinker. .Ces deux phages sont très proches du phage λ classique. Les modifications pour en faire un vecteur sont : 18 . : Les phages GEMR 11 et 12 Ces deux phages sont destinés à la réalisation de banques génomiques et sont des versions améliorées des phages EMBL. Ils en diffèrent par la présence d’un polylinker aux deux extrémités de la zone de DNA qui sera délété pour être remplacé par le DNA à cloner. Not dans version 12 car les sites de coupure de ces enzymes sont très rare. La multiplication intracellulaire du phage fait intervenir une forme réplicative (RF) constituée par l'association du brin génomique (+) et d’un brin complémentaire nouvellement synthétisé noté brin (-).Modification du polylinker. Le polylinker de ces phages comporte un plus grand nombre de sites de coupures uniques pour deux enzymes de restriction : Sfi dans la version 11. Ils en diffèrent par deux types d’améliorations : . Les ribosondes sont utilisées pour cribler de nouveau la banque et ainsi isoler les segments adjacents au DNA cloné.. Le matériel génétique de ce phage est constitué d’une molécule d'ADN circulaire monocaténaire de 6407 paires de bases notée brin (+). Ce dernier devient la matrice pour la synthèse de nouveaux brins (+) qui seront encapsidés et relâchés dans le milieu. Ils constituent des phages de choix pour la constitution des banques génomiques. on peut hybrider un oligonucléotide de synthèse qui servira alors d'amorce pour la DNA polymérase. 4. On peut y introduire des fragments de 15 à 20 kb. 5. Ainsi. : Le phage M13 et ses dérivés Figure II.Addition de promoteurs pour des RNA polymérases spécifiques : Un promoteur de la T7 RNA polymérase est ajouté à l’extrémité du bras gauche avant le polylinker et le promoteur de la T3 RNA polymérase à l’extrémité droit. Sur cette séquence connue. Ces deux promoteurs permettent de synthétiser des ribosondes correspondant spécifiquement à chacun des brins de l’ADN cloné. La forme réplicative recombinée peut ensuite être introduite dans une cellule hôte par transformation comme un plasmide de manière a disposer sur le brin (+) d'une séquence connue au voisinage de l'insertion. il est certain de marcher sur le chromosome sans se tromper d’avancer dans le bon sens. La forme réplicative (RF) bicaténaire peut aussi être extraite de la cellule de la même manière que l’ADN d’un plasmide. Le phage M13 a été modifié de manière a pouvoir introduire un ADN étranger dans la forme réplicative au niveau d'un site unique de restriction. La taille de l’ADN à insérer varie de 9 à 23 kb. L’addition d’un site Xho I simplifie la réalisation des banques génomiques. L'ADN phagique (+) peut être extrait à partir des virions de manière analogue à l'ADN du phage λ.9 Le bactériophage M13 qui infecte Escherichia coli (seules les bactéries mâles peuvent être infectées) est un phage filamenteux dont la particularité et l'intérêt résident dans son matériel génétique.

Les cosmides peuvent contenir des insertions d’ADN environ trois fois plus longs que ceux portés par les phages λ (45 kb). on forme des particules virales par encapsidation in vitro en ajoutant les protéines de la capside et de la queue.L’addition d’un polylinker pour faciliter l’insertion des séquences de DNA . Ceci est dû à ce que la majeure partie de la structure du phage a été déletée tandis que les séquences signaux responsables de l'encapsidation subsistent (les sites COS). coli par infection phagique. Les séquences télomériques (Tel). III. Chaque particule virale donne alors naissance à un clone sous la forme d'une plage de lyse sur le tapis bactérien. La possibilité de disposer d'une insertion dans un ADN monocaténaire circulaire fait des dérivés du phage M13 des vecteurs très utilisés en génie génétique pour : • La création de mutations ponctuelles • La synthèse de sondes nucléiques. Les virions se reproduisent ensuite par le cycle lytique.10 2. 6. ce qui permet une bonne amplification de l'ADN recombinant. Les particules virales ainsi formés permettent une introduction très efficace de l'ADN recombinant de la cellule hôte E. Chez la levure. Le génome de la levure Saccharomyces cerevisiae est constitué de 16 chromosomes de taille comprise entre 250 et 2 000 kb.L’addition d’un gène lacZ pour permettre la sélection des recombinants (système des bactéries bleues et blanches en présence d’IPTG et de X-gal). YAC ET BAC 1. Les YAC Le YAC ou chromosome artificiel de levure (Yeast Artificial Chromosome). trois régions chromosomiques sont importantes pour sa réplication. Les cosmides Les cosmides sont des vecteurs hybrides constitués d’un plasmide classique auquel ont été ajoutées les séquences COS du phage λ. 19 . : Infection Avec l'ADN recombiné par insertion ou substitution. Les YAC permettent de cloner de 150 à 1 000 kb de fragments d’ADN.. Leur ADN peut se répliquer au niveau de la cellule hôte comme celui d'un plasmide ou être encapsidé comme celui d'un phage pour faire une infection. on utilise alors comme amorce (primer) un oligonucléotide complémentaire de l'insert mais possédant la modification de séquence souhaitée. et une séquence ARS (Autonomous Replicating Sequence). COSMIDES. Figure II. • Le séquençage de l'ADN par la méthode de Sanger • Dans certaines techniques de mutagenèse dirigée in vitro. centromériques (CEN). L'isolement des clones est obtenu en réalisant l'infection sur un milieu semi-solide.

les PAC PAC : Chromosomes artificiels dérivés du phage P1 (PAC.Les bactéries qui le possèdent dans leur cytoplasme sont dites F(+) . Le plasmide F a aussi la capacité de s'intégrer dans le chromosome bactérien et de s'en exciser.11 3 . Ils acceptent des fragments de taille moyenne (jusqu'à 10 kb).celles qui ne l'ont pas dans leur cytoplasme sont dites F(-) . Le vecteur pCYPAC1 permet de cloner des fragments qui ont une taille de 130 à 150 kb avec une efficacité qui est intermédiaire entre celle des cosmides et celle des YACs (1. Les YAC n'exigent que les cellules de levures comme hôtes. La taille du DNA cloné peut donc atteindre de 1 000 à 2 000 kb.5x10+5 colonies/µg insert). . On peut cependant introduire dans l’ADN cloné des séquence bactérienne pour la sélection.12 4. par exemple des sous-fragments de l'insert d'un phage ou d'un cosmide recombinant. Figure II. Ce facteur peut contenir de grands fragments d'ADN d'E. les PAC (130 à 150 kb). De manière similaire.500 kb) en font les vecteurs de choix pour construire et amplifier des banques d'ADN génomique. P1-derived artificial chromosomes) Mise au point dans les années 1990 un vecteur dérivé du bactériophage P1. Les BAC et les PAC sont devenus les vecteurs principaux pour le séquençage du génome humain.13 Les BAC (Bacterial Artificial Chromosome) ont pour base le facteur sexuel F de 7 kb de Escherichia coli.Celles qui l'ont intégré dans leur chromosome sont dites Hfr . les BAC (160 à 200 kb) et les YAC (250 à 1. Les ADNc (voir plus loin) sont clonés dans des plasmides ou des phages d'insertion. Le vecteur pBeloBAC11 porte ces gènes essentiels ainsi qu'un gène de résistance au chloramphénicol et la portion lacZa du gène b-galactosidase avec 2 sites de restriction HindIII et BamHI qui permettent le clonage de fragments d'ADN étranger Le facteur de fertilité F est utilisé lors de la conjugaison bactérienne. coli sous la forme de dérivés F'. Conclusion Les plasmides sont très utilisés pour le génie génétique. 20 . les BAC peuvent incorporer des inserts d'ADN étranger pouvant atteindre 300 kb. Un plasmide qui a cette capacité est appelé un épisome. Les gènes oriS et repE régissent la réplication unidirectionnelle du plasmide tandis que les gènes parA et parB maintiennent le nombre de copies de celui-ci à 1 à 2 copies par cellule. La taille des fragments d'ADN étranger qui peuvent être acceptés par le bactériophage lambda (10 à 20 kb). après l'avoir intégré dans leur chromosome sont F'. Le plasmide F porte des gènes qui sont essentiels pour réguler sa propre réplication et pour contrôler aussi le nombre de copies du plasmide F. les cosmides (35 à 45 kb). Les BAC Figure II.On a donc construit des chromosomes artificiels contenant ces régions essentielles et du DNA que l’on désire cloner.Celles qui l'ont perdue. Figure II.

Une activité méthylase qui méthyle une base donnée (A ou C) au niveau du site de restriction du génome de la cellule bactérienne pour empêcher sa propre dégradation par l’activité restrictive. la coupure ne peut avoir lieu que si les adénines (A) figurées en gras ne sont pas méthylées. ENZYMES DE RESTRICTION 1. La souche d'Escherichia coli B possède une endonucléase appelée EcoR1 qui reconnaît spécifiquement la séquence bicaténaire suivante: ↓ 5’G AATT C3’ 3’C TTAA G5’ ↑ CH3 ↓ | 5’G *AATT C3’ 3’C TTAA* G5’ | ↑ CH3 Pas de coupure Coupure L'enzyme catalyse l'hydrolyse d'une liaison phosphodiester dans le site reconnu au niveau des deux flèches. 21 . Elles ont permis de caractériser un génome entier en une série de fragments reproductibles. ÉLECTROPHORÈSE. Ces enzymes constituent un système de défense de la bactérie surtout contre l'ADN des virus au cours de leur infection. Cependant. Ces enzymes ont été mis en évidence par le phénomène de la lysogénie. Les souches d’Escherichia coli R possèdent en plus de l’enzyme qui coupe la séquence reconnue par (EcoR1) une autre qui assure la méthylation (EcoR1 méthylase ou MEcoR1) qui reconnaît la même séquence mais méthyle les deux adénines. Le système de restriction formé par le couple EcoR1 / MEcoR1 permet aux cellules bactériennes d'hydrolyser un éventuel ADN étranger. tout en conservant l'intégrité de leur propre génome. Les cellules bactériennes contiennent beaucoup d'endonucléases spécifiques capables de reconnaître l'ADN des autres espèces et l’ADN des virus qui les infectent. CARTE DE RESTRICTION I. Le phénomène de restriction résulte de l’existence dans la bactérie de deux types d’activité enzymatique : Une activité de restriction qui coupe le DNA lorsqu’il est reconnu comme étranger à la cellule hôte.Chapitre III: ENZYME DE RESTRICTION. phagique en particulier. Les gènes ou fragments de gènes deviennent ainsi des entités physiques isolables et non plus de l’information noyée dans la masse du contenu génomique. Ces enzymes de restriction reconnaissent des sites particuliers sur l'ADN et coupent la molécule double brins soit au niveau du site de reconnaissance soit quelques nucléotides plus loin. Les enzymes de restriction constituent donc un système de défense de la bactérie. Définition et origine Les enzymes de restriction sont des endonucléases qui coupent d’une manière définie et reproductible l’ADN double-brin quelle que soit son origine.

Un chiffre romain distingue les enzymes d'une même souche dans l'ordre de leur découverte. Smith et Nathan ont proposé une nomenclature qui est définitivement adoptée. en minuscule désignent l'espèces de la bactérie.1 22 . (pas toujours présente) désigne la souche bactérienne. Elle catalyse ensuite un clivage double brin au niveau des liaisons phosphodiester spécifiques à l'organisation de la séquence de reconnaissance. En 1990. entre le groupe 3' OH et le phosphate génère une extrémité 5' phosphate d'un côté de la coupure et un groupe 3' OH de l'autre. En 1973. l'enzyme se déplace sur l'DNA et coupe de manière aléatoire mille à quatre mille bases plus loin (Système de boucles d’ADN ?). L'hydrolyse d'une liaison phosphodiester. La 4ème lettre en majuscule. Mécanisme d'action des endonucléases de restriction a: Caractéristique de l'hydrolyse. Chaque endonucléase a un nom de code déterminé selon les principes suivants : • • • • La première lettre en majuscule est l'initiale du genre de la bactérie. on avait recensé plus de mille endonucléases isolées à partir de 867 espèces bactériennes différentes. Enzyme de type I: Ayant reconnu la séquence cible. Une endonucléase de restriction se lie à une séquence spécifique qu'elle reconnaît sur l'ADN: c’est le site de restriction. Enzyme de type II: L'enzyme coupe l'ADN au niveau de la séquence reconnue. 2. Enzyme de type III : L'enzyme reconnaît la séquence cible et coupe la molécule de DNA 20 à 25 bases plus loin. par la localisation de leur activité catalytique. Exemple : EcoR 1: E = Escherichia Co = espèce Coli R = Souche RY13 I = 1ère endonucléase isolée 3. Figure III.Il existe 3 types d'enzymes de restriction qui diffèrent les unes des autres. Nomenclature des enzymes de restriction. Seules les enzymes de type II qui coupent au niveau du site de reconnaissance sont utilisés en génie génétique parce qu’on peut contrôler parfaitement le site de coupure et donc les extrémités engendrées. Les deux lettres suivantes.

De telle séquence sont dites palindromiques. les coupures de EcoR 1 : 5’ G/AATTC 3’ CTTAA/G 5’ → → 5’ G 3’ 3’ CTTAA 5’ + + 5’AATTC 3’ 3’G 5’ Coupure décalée du coté 3’: Ce type de coupure génère des extrémités 3’OH débordantes ou sortantes. car les fragments de différents ADN coupés par la même enzyme donnent les mêmes bouts qui peuvent s'associer par leur extrémités cohésives. ↓Hae III 5'  GGCC  3' 3'  CCGG  5' ↑ → → 5'GG 3'CC + + CC 3' GG 5' Ces types de coupes sont utilisées lorsqu’on désire faire un tailing (allongement de l’extrémité 3’OH) ou un marquage pour un séquençage. Exemple. Ces enzymes sont très utilisées pour fabriquer des ADN recombinants. Elles peuvent donc se réapparier spontanément si les conditions sont favorables. Un nombre assez restreint d’enzymes de restriction reconnaît des séquences plus complexes.b: Sites de restriction La plupart des sites de restriction comporte de 4 à 6 paires de bases. L’enzyme coupe exactement au même niveau sur les deux brins de la séquence reconnue soit au niveau de l’axe ou du centre de symétrie. Les extrémités débordantes résultent d'une coupure décalée et les extrémités obtenues sont auto complémentaires entre elles. L'association est ensuite rendue covalente par l’action d'une ADN ligase. Exemple : les coupures par Pst I : 23 . ↓ Exemple : EcoR 1 : 5’G AATTC3’ 3’CTTAA G5’ ↑ c: Différents types de coupure Les enzymes de restriction de type II peuvent donner deux types de coupures : Les coupures à bouts francs (blunt ends ou flush ends). les coupures décalées donnent des extrémités cohésives. On observe sur les 2 brins la même séquence (5’→3’) mais en sens inverse. Les séquences de restriction présentent toujours une double symétrique par rapport à un centre ou à un plan de symétrie. On parle alors d'extrémités cohésives ou de bouts collants "Sticky ends". Coupure décalée du coté 5’ : Ce type de coupure génère des extrémités 5’P débordantes ou sortantes.

CTTAA/G...C/TNAG......5’ 5’..G/AATTC....5’ CTGCA/G 3’ → 5’ CTGCA 3’ + 5’ G 3’ 3’ G/ACGTC 5’ → 3’ G + 3’ ACGTC 5’ Les coupures franches .AGC/T..CGCCG/GCG....5’ 5’.CC/TNAGG...GANT/C.. Exemple : Msp I: NNC/CGGNN NNGGC/CNN et Hpa II NNC/CGGNN NNGGC/CNN Deux enzymes compatibles ont des sites de restriction différents mais donnent naissance aux mêmes extrémités cohésives.GAT/ATC.....3’ 3’. Micro-organisme Thermus aquaticus Haemophilus haemolyticus Desulfovibrio desulfuricans Escherichia coli Sigle de l’enzyme TaqI HhaI DdeI EcoRV Séquence 5’.3’ 3’. L’enzyme coupe les deux brins de l’ADN au niveau du centre ou de l’axe de symétrie...CTGCA/G. C'est le cas de BamH I et Sau3AI qui donnent les même extrémités cohésives car le site de reconnaissance de Sau3A1 est contenu dans celui de BamH 1.GCG/C....3’ 3’.....T/CGA.3’ 3’....1 : Quelques enzymes de restriction de type II et leur site de coupure N = Toute base (purine ou pyrimidine) e: Isoschizomères et enzymes compatibles: On appelle isoschizomères 2 enzymes différentes qui reconnaissent le même site de restriction. On obtient des extrémités franches (blund ends) qui n’ont pas un grand intérêt en génie génétique sauf pour réaliser des « taillings à l’extrémité 3’OH)..5’ 5’.3’ 3’......CTA/TAG..5’ 5’......C/GCG....5’ 5’.GC/GGCCGC.. BamH I NNNG/GATCCNN et Sau 3A I NNN/GATCNNN 24 .GA/CGTC.5’ 5’...GGANT/CC.1 ci-dessous donne la liste de quelques enzymes de restriction et leur sites de coupure....3’ 3’..3’ 3’..5’ EcoRI Providencia stuarti Microcoleus Nocardia otitidis-caviarum PstI MstII NotI Tableau II.3’ 3’.. Exemple : Hae III : 5’ GG/CC 3’ 3’ CC/GG 5’ → → 5’ GG 3’ CC + + 5’CC 3’ 3’GG 5’ Le tableau II......5’ 5’..

On obtient pour un ADN donné. donne toujours les mêmes fragments et cette série de fragment constitue une empreinte caractéristique de l'ADN hydrolysé. + Cameroun - + .1 : Les haplotypes 25 . toujours le même nombre de fragments qui donne ce que l’on appelle RFLP (pour longueur des fragments de restriction polymorphiques ou Restriction Fragments Lengh Polymorphism en Anglais).2 E Gγ Αγ ψβ δ β H inc II XmnI Hind III TaqI HindIII PvuII Hinc II Hinf I Rsa I AvaII HinfI HpaI BamH I Haplotype HbS Bénin Bantou Sénégal + + . L'un des résultats les plus intéressants des études des polymorphismes de l'environnement du gène drépanocytaire a été l'observation d'un déséquilibre de liaison : les polymorphismes ne sont pas distribués au hasard mais forment un petit nombre d'haplotypes bien définis. Exemple : CARACTERISATION DE L’HAPLOTYPE DREPANOCYTAIRE Des variations de la séquence nucléotidique. Une molécule d'ADN déterminée.NNNCCTAG/G NNNCTAG/NNN Ainsi.+ Figure III.+ .+ + . Elles sont désignées sous le terme de polymorphisme. L'association de plusieurs de ces polymorphismes définit un haplotype. 4.+ + + + + + + - Arabo Ind.+ + + + + + + + + . Il a été ainsi observé que la mutation drépanocytaire a été trouvée associée à 5 haplotypes désignées d'après leur épicentre. On parle alors de carte d'identité moléculaire. Carte et fragments de restriction L'hydrolyse d'un ADN par une endonucléase de restriction conduit à une série de fragments dits de restriction dont le nombre est fonction du nombre de sites de restriction présent sur cet ADN. La longueur des fragments est déterminée par la distance séparant les séquences de restrictions reconnues par cette endonucléase. BamH I donne les mêmes extrémités cohésives que Sau3A I avec qui elle est compatible.+ + + + + + + + + + + + + + . Figure III. Lorsque ces modifications portent sur des sites reconnus très spécifiquement par certaines endonucleases (enzymes de restriction) elles sont faciles à mettre en évidence par les méthodes de cartographie génique (polymorphisme de taille des fragments de restriction) RFLP.+ + + + . sont fréquentes. sans conséquence pathologique directe.

Figure III. . 3Kb et 5 Kb Déterminez les sites de coupures : 10 Kb d ADN 2 Kb A 8 Kb 7 Kb 3 Kb B 2 Kb 5 Kb 3 Kb A B 26 .L’enzyme B coupe et donne deux fragments : 3 Kb et 7 Kb . Diverses techniques permettent d'obtenir de telles cartes. Elles passent toutes par une digestion de l'ADN à analyser par une enzyme de restriction suivie d’une électrophorèse pour la séparation des fragments et la détermination de leurs tailles. Ces fragments sont ensuite analysés par électrophorèse sur gel d’agarose. On obtient un certain nombre de fragments pour chaque enzyme.3 Exercice et corrigé: Détermination des sites de coupure de deux enzymes de restriction A et B sur un fragment d’ADN .Une carte de restriction est une séquence de sites de restriction séparés par des distances précises sur l'ADN et mesurée en paire de bases (bp). L'analyse par double digestion est obtenue quand l'ADN est digérée séparément par 2 enzymes différentes A et B.Les enzymes A et B coupent et donnent trois fragments 2 Kb. Chaque fragment produit par l’enzyme A est d’abord élué du gel et digéré ensuite par l’enzyme B et inversement.L’enzyme A coupe et donne deux fragments : 2 Kb et 8 Kb . La confrontation des différents résultats permet de situer les sites de coupure les uns par rapports aux autres sur la séquence nucléotidique.

4. L’électrophorèse sur gel d'agarose en champ pulsé (PFGE) permet de séparer des fragments d'ADN double brin dont la taille peut varier de 220 000 à 2 500 000 paires de bases. On peut ainsi suivre indirectement la migration de l'ADN sur le gel. Un marqueur de taille est un mélange de fragments d'ADN linéaire bicaténaires dont les tailles sont connues. Un exemple est 27 . L’ÉLECTROPHORÈSE SUR GEL Figure III. Les deux marqueurs (colorants) migrent à des vitesses différentes. sont mélangés avec une solution de charge qui contient : un alourdisseur (glycérol ou saccharose ) pour entraïner l'ADN au fond du puits des marqueurs de mobilité (colorants visibles : bleu de bromophénol et xylène cyanol) Des marqueurs de taille pour l’identification (dans le puits de référence) un agent dénaturant comme le SDS ou l’urée pour arrêter les réactions enzymatiques suivant la nature du gel. Des marqueurs composés d'une série de fragments.Suivi de la migration . chacun constitué d'une à plusieurs répétition d'un même fragment d'ADN de taille connue. Les échantillons d'ADN.Etalonnage d'un gel On étalonne les gels avec des marqueurs de taille. il existe deux type de marqueurs de tailles : Des marqueurs fabriqués à partir d'une molécule d'ADN naturelle digérée par des enzymes de restriction. 1 . Les différents types d'électrophorèse utilisés dans les laboratoires de biologie moléculaire. permettent de séparer les acides nucléiques en fonction de leur taille: L'électrophorèse horizontale sur gel d'agarose permet de séparer les fragments d'ADN de 300 à 10 000 paires de bases en fonction de la concentration du gel en agarose L'électrophorèse verticale sur gel de polyacrilamide permet de séparer les fragments d'ADN dont les longueurs vont de 1 à 1 000 nucléotides en fonction de la longueur du gel et de la tension appliquée (de 1 000 à 2000 volts / cm). (PFGE pour Pulsed Field Gel Electrophoresis). Cette technique est aussi mise à profit pour la séparation des chromosomes interphasiques.II. avant d'être déposés dans les puits. Le bleu de bromophénol (violet ) migre avec les fragments de petites tailles (donc plus vite ) alors que le xylène cyanol (bleu turquoise ) migre avec les fragments de grande taille. 2 .

LES ENZYMES UTILES EN GÉNIE GÉNÉTIQUE: 1. Figure III. Pour convertir les bouts cohésifs en bouts francs Pour le marquage des DNA Pour la construction de sondes ou de vecteurs à partir d’un ADN simple ou double brin. Cette enzyme extraite d’Escherichia Coli intervient dans les activités de réparation du chromosome bactérien par le phénomène de nick translation. Ces enzymes ne possèdent pas une activité de correction des épreu- 28 . d’où son utilisation en PCR. La Taq polymérase C’est une enzyme extraite de la bactérie Thermus aquaticus.5 III. Les différents fragments sont formés de 1 à 12 répétitions d'un même segment de 1018 bp. Elle possède les mêmes propriétés que le fragment de Klenow et possède les mêmes utilisation en biologie moléculaire. Coli infestées par le bactériophage T4. Révélation : Les bandes d'ADN sur un gel de polyacrylamide ou d'agarose ne sont pas visibles si l'ADN n'est pas marqué ou coloré. espèce bactérienne vivant dans les eaux chaudes et qui présente une grande résistance à la dénaturation thermique. Le BET est une produit hautement mutagène. Elle peut toujours travailler entre 80 et 94°C. Une méthode sensible de coloration de l'ADN consiste à plonger le gel après électrophorèse dans du bromure d'éthidium (BET) qui devient cent fois plus fluorescent sous illumination ultra-violette lorsqu'il est lié à l'ADN. 3. 3. La T4 DNA polymérase.l'échelle d'ADN de 1 Kb de GIBCO BRL. Une détection encore plus sensible implique l'incorporation d'un radio isotope dans les molécules d'ADN avant électrophorèse. donc il doit être manipulé avec beaucoup de soins. Elle est utilisée sous sa forme de «fragment de Klenow» qui est dépourvu de l’activité exonucléasique (5’→3’) par suite d’un traitement protéasique pour: Déterminer les séquences nucléotidiques d’un ADN par la méthode de Sanger. 2. L’enzyme est produite par les bactéries E. Le 32P est actuellement utilisé puisqu'il peut être incorporé dans les phosphates 5' de l'ADN et émet des particules très énergétiques facilement détectées par autoradiographie. Il en est de même des polymérases extraites des archéobactéries comme des bactéries du genre Thermus comme la polymérase de Bacillus steatothermophilus. La DNA polymérase I.

Elle permet donc: de rajouter une queue (tailing) à l’extrémité 3’ en vue de créer des extrémités cohésives pour l’insertion d’un ADN de marquer l’extrémité 3’OH pour le séquençage des acides nucléiques par la méthode de Maxam-Gilbert. sans besoin d’amorce à l’extrémité 3’OH libre d’un DNA simple ou double brin. La terminal transférase C’est une enzyme couramment extraite du thymus de veau qui permet l’addition de désoxyribonucléotides. La séquence de l’ARN résultant dépend de la concentration relative des différents nucléotides présents dans la solution. La polynucléotide phosphorylase Cette enzyme d’origine bactérienne (E. Actuellement. elle permet: La synthèse de polyribonucléotides froids ou radio-actfs La dégradation de la queue polyrA des mARN eucaryotes à cause de son activité nucléolytique Un marquage intensif des extrémité 3’OH des ribonucléotides Le marquage sur le phosphore des ribonucléotides diphosphates à cause de son activité d’échange de phosphate. Elle est utilisée chaque fois qu’il est nécessaire de transformer un ARN en un ADN. 7. Pour la construction des banques de cDNA Pour détermination des séquences nucléotidiques par la méthode de Sanger Pour la PCR sur les RNA messagers (R-PCR). n XDP → (XMP)n + n Pi Elle a été utilisée pour déchiffrer le code génétique. La transcriptase inverse est un enzyme produite par les rétros virus qui permet de recopier un ARN en un DNA. 6.ves (proof reading = activité exonucléasique 3’→5’) et de ce fait introduisent beaucoup d’erreurs au cours de la réplication. 5. 4. luteus) catalyse la polymérisation de ribonucléotides diphosphates pour donner un ARN. La poly A polymérase 29 . Elle possède aussi une activité RNAase H qui permet de dégrader le RNA dans un hybride ADN-ARN. coli ou M. La transcriptase inverse.

Ce sont les polymérases des procaryotes qui sont le plus souvent utilisées en biologie moléculaire car elle possèdent des promoteurs très spécifiques qui permettent de conditionner et de révéler l’expression des gènes recombinés dans une cellule transfectée. 8. RNA-protéines. de régulations et des interactions RNA-DNA. Ces polymérases permettent aussi de produire. Elle est donc utilisée pour la soudure des extrémités cohésives lors de la construction des vecteurs. Son substrat est spécifiquement l’ATP. dans le sens 5’→3’. coli. les études sur les différents RNA résultant de la transcription d’un DNA cloné. La synthèse s’effectue sans amorce à partir du promoteur (site de fixation et d’initiation de l’enzyme) et nécessite toujours les ribonucléotides triphosphates et du Mg2+ comme cofacteur. Les ligases assurent la formation d’une liaison phosphodiester entre une extrémité 3’OH et une extrémité 5’phosphate de deux nucléotides déjà incorporés dans un acide nucléique. Elle possède donc les mêmes utilisations que la polynucléotide phosphorylase et la terminal transférase. elle présente un avantage sur cette dernière car elle utilise l’ATP au lieu du NAD+ comme source d’énergie. elle joue le même rôle que la ligase de E. Ces polymérases permettent: la synthèse de sondes hautement marqués soit par un nucléotide radioactif soit par un nucléotide biotinylé (marquage froid). Les plus utilisées sont: la polymérase de SP6 extraite de Salmonella typhimurium LT2. Elle utilise aussi l’ATP 30 . Les ARN polymérases Les ARN polymérases de tous les organismes transcrivent l’un des deux brins de la double hélice de l’ADN en un ARN simple brin. Les Ligases La DNA ligase d’E. coli n’agit que si les deux DNA sont associés par des extrémités cohésives ou dans le cas d’une cassure sur un seul brin. Extraite d’E.Enzyme eucaryote. la T7 RNA polymérase extraite d’E. elle catalyse l’addition d’une queue polyrA à l’extrémité 3’OH des ARN messagers eucaryotes. coli infestée par le phage T4. Extraite d’E. devant le DNA cloné. coli infesté par le phage T7 et la T3 RNA polymérase extraite aussi de E. L’enzyme d’E. la détermination de la séquence d’un ADN cloné dans un vecteur possédant. l’un quelconque des promoteurs SP6. Cette enzyme utilise le NAD+ comme cofacteur. à partir d’un gène cloné. coli infesté par le phage T3. T7 ou T3. Coli. 9. elle réalise la ligation entre deux RNA en créant entre eux une liaison phosphodiester entre l’extrémité 3’OH libre et l’extrémité 5’phosphate libre de l’autre molécule. Cependant. mais aussi les extrémités à bouts francs en présence d’éthylène glycol. les quantités de RNA suffisantes pour les études de structure. La RNA ligase. ce qui lui permet de relier les extrémités cohésives. Coli infesté par le phage T4. La T4 ligase.

La RNase H : Elle détruit le RNA dans les hybrides DNA-RNA. Elle est utilisée pour analyser les gènes actifs de la chromatine. Les RNases La RNase A. 31 . Cette enzyme très résistante (se maintient après 1 heure à 90°c) hydrolyse spécifiquement les RNA simple brin après une pyrimidine. Elle est utilisée pour éliminer le RNA dans une préparation protéique ou de DNA. La DNase I Cette enzyme extraite du pancréas est une endonucléase qui coupe le DNA après un base pyrimidique. soit la construction de liaisons inter ou intra . Les nucléases. Elle coupe aussi bien les acides nucléiques en simple ou en double brins. La nucléase S1. Elle permet donc la détection des hybrides DNA-RNA et la destruction de l’ARN dans un hybride après une transcription inverse pour la synthèse du second brin de cDNA.RNA (RNA mixtes). éliminer le DNA d’une préparation protéique ou de RNA. De plus elle possède une activité 3’ phosphatase. Elle permet : Une étude des hybrides DNA-RNA L’élimination des extrémités simple brin d’un DNA double brin Le suppression des boucles dans la synthèse de cDNA La détermination des origines de la transcription L’exonucléase III. Les DNA bicaténaires et les hybrides DNA-RNA ne sont pas attaquées. libérant une extrémité 3’OH et une extrémité 5’phosphate. Elle permet également de détecter les mismatches dans les hybrides DNA-RNA.qui est hydrolysé et AMP et en pyrophosphate. L’enzyme dégrade spécifiquement les acides nucléiques en simple brin. 11. Elle permet donc soit un marquage des ARN. pour la création de cassures (nicks) pour le marquage de l’ADN par nick translation. Elle permet donc d’obtenir des ADN simple brin. Elle catalyse l’hydrolyse séquentielle des nucléotides d’un ADN dans le sens 3’ 5 à partir d’une extrémité 3’OH libre. 10.

Le clonage des animaux supérieurs: les mammifères. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche. le clonage est la sélection d’un clone parmi un ensemble de clones bactériens recombinants qui porte le nom de banque (library). À l'aide d'un choc électrique. 32 . C'est la raison pour laquelle Dolly n'a eu pour tout bagage génétique que celui que contenait la cellule du pis. 2. on a fusionné in vitro la cellule du pis qui contient tous ses gènes et l'ovule vidé de tout son matériel héréditaire. Dans le cas de Dolly (la première brebis clonée). On a prélevé également un ovule sur une autre brebis. identique en tous points à la brebis qui a fourni la cellule du pis. I . Pourquoi un ovule? Pour qu'il devienne éventuellement un embryon. Il existe 2 types de banques d’ADN : les banques génomiques et les banques d’ADNc. on a enlevé le noyau qui contient le matériel génétique. Dolly est née de cette technique. Sur cet ovule. Clonage de l’ADN dans les micro-organismes: Le but du clonage est d’obtenir un grand nombre de copies absolument pures d’une séquence donnée d’ADN. l’embryon au stade blastocyte a été placé dans l'utérus d'une brebis porteuse. Le principe du clonage n'est pas très compliqué en soit. 1.CHAPITRE IV: CLONAGE ET ÉTUDE DE L’ADN CLONÉ. on a prélevé une cellule dans le pis d'une brebis de race Finn Set à face blanche.LE CLONAGE Le clonage des micro-organismes est différent de celle des organismes supérieurs comme les mammifères. Après s'être divisé un nombre suffisant de fois. Stricto sensu.

au moins une fois. puis dans un hôte approprié.-------------log ( 1-1 / n) P = Probabilité de présence d une séquence donnée n = ( longueur du génome ) / ( longueur moyenne des fragments insérés ). qui dérive de la loi de Poisson est : log ( 1-P ) N =.LES BANQUES GÉNOMIQUES 1 . plus faible sera le nombre des clones nécessaires. sous une forme morcelée. Si la banque est correctement établie. Une banque génomique ne sera représentative que si elle contient.90 0. • Ligature avec l’ADN ligase • Transformation (avec des plasmides) ou infection (avec phages) des bactéries • Culture des bactéries sur des milieux entiers 33 . Cette formule.95 0. Clarke et Carbon ont établi une formule statistique permettant de déterminer le nombre de clones nécessaires. Il est donc évident que plus les inserts seront longs.La fragmentation de l’ADN tout entier d’une cellule et son introduction dans des vecteurs Construire une banque génomique consiste à fragmenter l’ADN tout entier d’une cellule (la méthode du shotgun) et à introduire chaque fragment dans un vecteur.1 : Nombre de clones (en milliers) que doit contenir une banque génomique pour être représentative d’un génome. 2 – Etablissement d’une banque génomique.99 0. d’où le terme de banque génomique.II . l’ensemble des séquences du génome. Le vecteur doit être choisi en fonction de la taille des fragments d’ADN à insérer. l’ensemble de l’information d’un individu telle qu’elle existe dans son génome. elle contiendra.80 Longueur de l’insert en (kb) 15 20 30 35 40 860 640 430 370 320 560 415 280 240 210 430 320 215 185 160 300 225 150 130 115 Tableau IV. Les différentes étapes principales sont les suivantes : • Extraction de l’ADN nucléaire • Digestion du génome avec des enzymes de restriction • Insertion des fragments d’ADN dans des vecteurs (plasmide ou phage ou YAC). Probabilité de présence d’une séquence donnée 0. compte tenu de la longueur des inserts.

mais doit servir à plusieurs clonages successifs.L’isolement de l’ARN poly A+ (poly adénine): Dans la cellule eucaryote. 3. il faut utiliser les chromosomes artificiels de levure (YAC) comme vecteur de clonage. ARNm (eucaryote) 34 . Pour pallier à cet inconvénient. ou les BAC. L’amplification n’est réalisable que lorsqu’on travaille avec des phages. il existe plusieurs types d’ARN : l’ARN messager. Avec les cosmides et les YAC. Un banque de cDNA doit contenir au moins une copie de tous les ARNm présents dans la cellule. donc.1: Schéma pour la réalisation pratique d’une banque génomique à partir de phages.Les régions non transcrites des exons . Les YAC.peuvent recevoir des fragments d’ADN de 150kb à 1 000 kb.Les introns Malheureusement l’ADN génomique est fragmenté au hasard. Amplification de la banque Lorsque la banque n’est pas d’usage unique. les pertes de séquences sont très rapides et on est alors obligé de refaire la banque chaque fois. il convient de l’amplifier. III . on obtient des gènes fragmentés incapables de coder pour des protéines biologiquement actives. c’est à dire.• Toutes les bactéries qui portent une chimère se multiplieront et donneront des clones. La majeure partie des ARN messagers des eucaryotes possède une queue poly(A) rajoutée après le transcription et avant le transfert vers le cytoplasme. Ces banques sont essentiellement tissulaires puisqu’une cellule d’un tissu donné ne possède pas tous les ARN messagers de l’individu. Ces vecteurs permettent de marcher sur le chromosome. mais ceux dont l’état de différentiation cellulaire permet la transcription.Les avantages des banques génomiques: Les banques génomiques permettent de connaître: .Les séquences de régulation . d’augmenter le nombre de copies de chaque fragment inséré. l’ARN de transfert et l’ARN ribosomal.Les gènes silencieux . Le processus de formation de l’ADNc comprend deux étapes: 1 .LES BANQUES DE CADN L’ADN complémentaire (ADNc) est la copie sous forme d’ADN d’un ARN messager (ARNm). dans la plupart des cas. Figure IV. 4 .

la transcription par la transcriptase reverse n’est pas parfaite. 2 . Figure IV. la transcription peut ne pas aboutir à l’extrémité 5’ à cause de la boucle formée à cette extrémité par la transcriptase reverse.5’ GGGAUCACUUGCGCAGCGCAUGCU(AAAAAAAAAA)n 3’ queue poly(A) On utilise les queues poly rA pour purifier l’ARNm en écartant les autres types d’ARN. Les courts fragment d’ARN servent alors d’amorce pour la DNA polymérase I qui synthétise le brin d’ADN par son activité polymérasique 5’ ? 3’ et détruit les restes d’ARN par son activité exonucléasique 35 .3 résume les principales étapes de la purification des ARN messagers eucaryotes ayant une queue poly-rA. Plusieurs techniques sont utilisées pour la préparation de l’ADNc : la transcriptase reverse : La synthèse de l’ADNc commence en 3’ de l’ARNm. La technique « copie entière » par addition de queues uniformes « tailing » Après la synthèse du premier brin de cDNA par la reverse transcriptase. une queue poly dC est créée à l’extrémité 3’ par la terminal transférase en présence de dCTP.3 : La technique de base de la synthèse du cDNA à partir du mRNA par la reverse transcriptase. Seuls les ARNm qui possèdent les queues poly rA seront retenus sur la colonne par hybridation par les oligo-thymidilates. le brin de RNA est coupé en plusieurs endroits par la RNase H. La technique « copie entière » par cassure à la RNase H. Cependant. La figure III. les oligo-désoxythymidine (dT) sont liés à la cellulose ou à l’agarose par des liaisons covalentes. Il y a cependant une perte d’information au niveau de l’extrémité 5’.2 : Les principales étapes de la purification des ARN messagers eucaryotes ayant une queue poly-rA en utilisant la chromatographie d’affinité. La boucle est détruite par l’action de la nucléase S1. elle tend à baisser lorsqu’elle rencontre des obstacles que sont les structures secondaires de l’ARN. Les ARNm sont ensuite « élués » par un agent dissociant. Sur une colonne chromatographique. Si la molécule de l’ARNm est longue. Figure IV. Le début de l’opération est identique aux techniques précédentes. On fait alors passer l’ARN cellulaire dans la colonne. Un poly dG synthétique est alors utilisé pour s’hybrider à la queue poly dC et servir d’amorce pour la synthèse du brin complémentaire par le fragment de Klenow de la DNA polymérase I. Après la synthèse du premier brin par la reverse transcriptase.Le passage de l’ARN à l’ADN Cette étape est toujours réalisée grâce à la transcriptase reverse isolée d’un rétrovirus. Les autres ARN sont éliminés par un lavage avec le tampon.

On peut utiliser un anticorps dirigé contre le produit de l’expression de l’ADN inséré dans le cas d’une banque d’expression. La PCR : Cette technique permet d’obtenir rapidement une grande quantité de l’ADNc une fois l’ADNc disponible .L’ÉTUDE DE L’ADN CLONÉ Le criblage ou la recherche du bon clone au sein d’une banque génomique est toujours un problème difficile à résoudre en fonction des vecteurs utilisés.(Polymerase Chain Reaction pour Réaction de Polymérisation en Chaîne) Figure IV. Les oligonucléotides purifiés sont marqués au 32P et utilisés comme sonde d’hybridation in situ d’une banque génomique. 35 S) pour une hybridation. Beaucoup de techniques ont été utilisées pour le criblage des colonies. une sonde oligonucléotidique marquée synthétisée à partir des données de séquençage d’une fraction de la protéine. la révélation de la séquence insérée est réalisée par une simple autoradiographie.Une réplique des clones est réalisée sur un filtre de nitrocellulose ou sur nylon .3’ ? 5’. dans un criblage classique.4 La technique du multi-amorçage au hasard : Cette méthode utilise la technique de synthèse de l’ADNc utilisant un multi-amorçage au hasard avec des oligonucléotides de 6 à 10 nucléotides de long : « Random primer ». Le code génétique permet de déterminer les séquences possibles du gène correspondant (dégénérescence du code). On utilise généralement un pool d’oligonucléotides courts de 18 à 25 bases ou quelques oligonucléotides longs de 40 à 45 bases. Le criblage par des anticorps : 36 . . Figure IV.Celles qui utilisent les anticorps. 1. On peut alors utiliser la T4 DNA polymérase pour parfaire la synthèse au niveau des extrémités.On utilise ensuite une sonde spécifique marquée par un radio-isotope ( 32P. mais les techniques les plus sensibles et les plus utilisées sont: . Les appareils automatiques permettent actuellement de séquencer une protéine en 24 heures et de synthétiser des oligonucléotides dans le même laps de temps. Le processus général utilisé pour le screening se pratique ainsi : . . Les autres techniques comme l’hybridation de sélection.5 IV . Le criblage par des oligonucléotides de synthèse : Le principe consiste à utiliser. la suite est identique à la méthode par la RNase H. 2. Dans ce cas. l’hybridation différentielle et la complémentation d’un défaut génétique de l’hôte qui ont eu gloire dans les années 1975-1980 ne sont pratiquement plus utilisées à cause de leur lourdeur.Celles qui emploient les oligonucléotides de synthèse.

L’ADN double brin à séquencer est d’abord marqué au 32P au niveau du phosphate en 5’. les exons et les zones de régulation de l’ADN inséré dans le vecteur.Un marquage chimique ou enzymatique des produits obtenus pour le séquençage (utilisation de radio-isotopes.Une utilisation du bromure d’éthidium et une lecture sous une illumination ultra-violette. Le séquençage : Il a pour but la détermination de la séquence nucléotidique de l’ADN isolé pour définir les introns. a . 35S) suivi d’une autoradiographie. Il doit ensuite être digéré par une endonucléase de restriction en deux fragments différents de taille. . Il est séparé en 4 lots et dans chaque lot.Cette technique ne peut se réaliser que sur une banque d’expression puisqu’elle vise à révéler le produit d’expression d’un gène cloné. Electrophorèse (Cf. soit marqué à l’iode 125. 32P. La révélation des différentes bandes est faite soit par : .7 : Criblage d’une bibliothèque d’expression avec les anticorps 3. 4. Après électrophorèse sur gel de polyacrylamide des 4 produits de réaction et autoradiographie. de préférence polyclonal dirigé contre le produit du gène. au moyen de réactifs chimiques différents. qui sont séparés par électrophorèse. ci-dessus) Elle permet de récupérer les fractions d’intérêt pour un séquençage de l’ADN inséré. Deux méthodes classiques sont alors utilisées.6: Criblage d’une bibliothèque d’expression avec une sonde Figure IV. Il faut pour cela disposer d’un anticorps. Figure IV. On obtient ainsi un fragment dont une seule extrémité 5’ est marquée. 37 .La méthode de Maxam et Gilbert: la méthode chimique. Le complexe antigène-anticorps est révélé par un autre complexe protéique possédant soit une activité enzymatique dont les produits sont colorés ( -galactosidase). les positions relatives des différentes bases sont déduites de la comparaison des distances de migration des fragments marqués en 5’. on réalise une coupure au niveau d’un type de base différent.

TGCACTTGAACG 32 P.TGCA 32 P.TGCACTTGAA 32 P. Ce phénomène est à la base de la méthode de Sanger.T 32 P- 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 T C G T A C G C A A G T T C A C G T Figure IV.TGCACTTGAACGCAT 32 P.TGCACTTGAACGCATGC 32 P. Cette méthode met à profit l’absence d’un hydroxyle en 3’ d’un ddXTP qui ne permet pas la formation d’une liaison phosphodiester. La séquence de l’ADN.TGCAC 32 P.TGCACTTG 32 P.TGCACTTGAACGCATG 32 P. la conséquence est un arrêt de l’élongation lorsqu’un didésoxyribonucléotide est incorporé dans un brin d’ADN en synthèse.Séquence détectée sur le gel Lecture 3 →-5’ Ordre des taches T C G A Lecture 3’→5’ 32 32 PTGCACTTGAACGCATGCT P.TGCACTT 32 P. Figure IV.TGCACTTGA 32 P.TG 32 P.TGCACTTGAAC 32 P.TGCACT 32 P.9 : Séquençage.TGCACTTGAACGCA 32 P. La méthode de séquençage enzymatique mise au point par Sanger par l’incorporation de didésoxyribonucléotides terminateurs de chaîne a été universellement adoptée.TGC 32 P.8 : La méthode de séquençage des acides nucléiques de Maxam Gilbert : Un traitement chimique permet de cliver spécifiquement au niveau de chaque base qui produit alors des fragments radioactifs de tailles différentes.La méthode de Sanger: la méthode enzymatique. méthode enzymatique 38 . est alors : 5’-TGCACTTGAACGCATGCT-3’ b .TGCACTTGAACGC 32 P. lue directement de bas en haut du gel.

Il est donc facile d’établir une carte de restriction par cette méthode. gènes d’une même famille ou gènes homologues d’une espèce différente. par une hybridation avec une sonde. La création d’un nouveau site de coupure donne le résultat contraire. dénaturés et transférés sur une membrane. Analyse du génome et de ses modifications: Le Southern blot C’est la méthode d’analyse de l’ADN imaginée par Southern en 1975 pour visualiser les gènes ou toute séquence d’un ADN génomique. 39 . • L’ADN est dénaturé in situ par une solution de soude. • Les mutations par délétions : Cette technique permettant de visualiser un gène. il est possible de mettre en évidence une délétion pourvue qu’elle ne soit pas très grande. avec des fragments de restriction d’ADN. on forme des liaisons covalentes entre le DNA et le nylon de sorte que le support peut être utilisé plusieurs fois avec d’autres sondes. Figure IV. Le processus est le suivant: • L’ADN génomique est d’abord fragmenté par une enzyme de restriction appropriée • Les fragments sont ensuite séparés par électrophorèse sur gel d’agarose. Ces gènes sont mis en évidence en fonction des conditions d’hybridation (stringence). Cette variation des sites de coupure se traduit par la disparition d’une ou de deux bandes (suivant la longueur de la sonde utilisée) et l’apparition d’une bande de taille supérieur dont la longueur est égale à la somme des longueurs des deux bandes disparues. • La détection de mutation ponctuelle : Le remplacement d’une base par une autre peut se traduire par la disparition ou la création de sites de coupures pour une enzyme de restriction donnée.5. Les membranes de nylon sont les plus utilisées car par un traitement au UV (254 nm). • L’ADN dénaturé (simple brin) est transféré par capillarité sur un support solide (filtre de nitrocellulose ou nylon). marquée et spécifique. préalablement séparés par électrophorèse. • La mise en évidence de pseudo-gènes et de gènes apparentés : Une sonde suffisamment longue peut s’hybrider avec des séquences non totalement complémentaire : pseudogènes. • Le support solide est hybridé avec une sonde mono-brin marquée à faible stringence puis lavé • Le ou les fragments reconnus par la sonde sont révélés par la technique de l’autoradiographie.10 : Southern Blot Cette technique permet : • L’établissement des cartes de restriction : Les enzymes de restriction coupent l’ADN au niveau de séquences bien définie.

Ces cycles sont renouvelés entre 20 et 50 fois en fonction de la quantité d’ADN cible de départ et du but recherché. la réaction de polymérisation en chaîne consiste à amplifier sélectivement une séquence particulière d’ADN par l’action répétée d’une ADN polymérase. il est possible de mettre en évidence ces recombinaisons par cette technique. Æ Les éléments de la PCR: les réactifs et le matériel: • l’ADN à amplifier • 2 amorces: sens et anti sens • tampon de réaction (Buffer) • MgCl2 • dNTP • Taq polymérase • L’appareil thermocycleur pour PCR • H2O bi-distillée et stérile Æ L’intérêt et application de la PCR: La PCR est la méthode actuelle la plus efficace et la plus rapide d’amplification d’un ADN cible. La PCR Définition: La PCR (Polymerase Chain Reaction).5 : Les cycles de la PCR 40 . • l’hybridation avec une amorce. Le fragment d’ADN à amplifier est compris entre deux séquences (complémentaires des amorces) qui doivent être connues et la longueur ne peut excéder 10 kb. La réaction de la PCR comporte trois étapes qui constituent un cycle au cours duquel la quantité d’ADN à amplifier est doublée.11 6. Æ Processus: Pour faire la PCR. L’amplification est effectuée par la répétition des cycles qui assure une duplication exponentielle de chaque brin. c’est pourquoi elle est maintenant largement utilisée. Cette polymérase (Taq polymérase) est toujours active à 94-96°C. Figure IV. annealing à 64°C • extension de l’amorce à 70 . appariement primer. Elle permet de mettre en oeuvre les techniques habituelles de génie génétique même si l’on ne dispose au départ que d’une faible quantité d’ADN. • la dénaturation de l’ADN à amplifier à 94°C.• La détection des recombinaisons : L’échange entre chromosomes homologues au cours de la méiose est la recombinaison. on utilise l’ADN polymérase d’une bactérie: Thermophilus acquaticus qui vit à 75°C dans les eaux thermales. CF Figure IV.72°C par la Taq polymérase. Dans certains cas.

VNTR. Une molécule d’ADN donnée coupée par une enzyme de restriction donnée produit toujours les mêmes fragments : cette série de fragments fournit une empreinte caractéristique de l’ADN hydrolysé. La mise en évidence des mutations ponctuelles utilise le système de l’analyse des polymorphisme de conformation de l’ADN simple-brin : SSCP (single Strand Conformation Polymorphism). Technique d’empreintes par didéoxynuclotides ou ddF Les amplicons de la PCR Réaction de séquence à l’aide de la Taq DNA polymérase avec un primer interne 41 . La structure secondaire que prend un segment de l’ADN simple-brin est fonction de sa séquence. dispersées et très polymorphes. on parle de carte d’identité moléculaire. La longueur des fragments est déterminée par la distance séparant les séquences spécifiques reconnues par cette endonucléase. Processus : La séquence où l’on souhaite rechercher une mutation est amplifiée par PCR. appelés fragments de restriction. Elles sont répétitives. SSTR. SSCP Les RFLP (restriction frament length polymorphism) sont des variations de séquence de l’ADN révélées par des modifications de la carte de restriction. La chorée de Hungtington qui est une maladie neurodégénérative est provoquée par des crossing-over inégaux. Ils sont favorisé par des crossing over inégales lors de la méiose. Étude des polymorphismes : RFLP. En d’autres termes : l’hydrolyse d’un ADN par une endonucléase conduit à une série de fragments. Une mutation ponctuelle au sein de cette séquence modifie la structure secondaire pour qu’il en résulte une modification de la migration en électrophorèse. Cette technique est utilisée dans les tribunaux pour découvrir le coupable. Elles permettent la réalisation de l’empreinte genetique (ADN finger printing) Les microsatelites de type (CA)n sont plus fréquent et les mieux caractérisés : les SSTR (Short Sequences of Tandem Repeats).7. L’ADN est soumis à une digestion par une ou plusieurs enzymes de restriction suivie d’un Southern blot. L’ADN est marqué par un iso-radioactif au cours de l’amplification. On peut introduire un nucléotide α32P dCTP ou alors utiliser des primers marqués. Elles ont souvent 11 à 16 bp (GGAGGTGGGCAGGA [A/G] G. Cette propriété permet de mettre en évidence la présence d’une mutation ponctuelle. Cette séquence ne doit pas dépasser 300 à 500 bp. pour déterminer la paternité ou la maternité et elle est désormais utilisé dans la pharmacogénétique. Nous avons les RFLP (Restriction Fragment Length Polymorphism).99%. La technique des SSTR permettent d’établir des polymorphismes à plus de 99. Nous avons aussi les polymorphismes de répétition : ce sont les minisatelites ou VNTR (Variable Number of Tandem Repeats) Les VNTR sont des séquences particulières.

IV. on a la séquence suivante avec une mutation C à A 5’ ---.12 : d’un gel de polyacrylamide en utilisant la technique de dideoxyfinger-printing 8 . Puis. ddGTP) et des dNTPs.Migration sur un gel d’acrylamide non dénaturant Par exemple. on ajoute un seul didéoxynucléotide (par exemple.AGTGTTACGTGCTA ----à 3’ Pour l’allèle normal 5’ ---. Employer les puces ADN vise à caractériser les relations gène-fonction ou définir et comparer les profils d’expression des messagers expri- 42 . 5’ ---. Puces à ADN (microarray) ou ADN chips La technologie des puces ADN permet l’analyse de l’expression de milliers de gènes simultanément.AGTGTTAAGTGC TA ----à 3’ Pour l’allèle muté 3’-----TCACAATTCACddG NB.TCACAATddG 5’ ---.AGTGTTAAGTGCTA ----à 3’ Pour l’allèle muté Après PCR. L’altération de la conformation spatiale de l’ADN permet de détecter dans un gel la mutation (SSCP) Normal Muté Muté Normal Bande de faille anormale correspondant à la mutation Bande de faille normale Fig.AGTGTTACG TGCTA ----à 3’ Pour l’allèle normal 3’ ---. une réaction de séquence utilisant la Taq polymérase est réalisée (avec une amorce marquée).

Principe : Synthétisons une série d’oligonucléotides de 8 bp (octamères) représentant toutes les combinaisons possibles 48 = 65. Supposons que nous ayons un ADN de 12 bp et hybridons-le à cette puce. seules. Prenons cette puce sur laquelle sont fixés des octamères de séquences chevauchantes différentes et ordonnées.més dans des cellules isolées dans différentes conditions (exemple : cellules normales comparées aux cellules tumorales) ou soumises à différents traitements (définition du profil d’action d’une drogue). Les puces ADN sont un outil de choix dans la recherche et la caractérisation de nouvelles molécules à visée thérapeutique. Les conditions de stringence sont telles que.536 : ces 48 oligonucléotides sont fixés de manière ordonnée sur une plaque de silice. 1 2 3 4 5 6 7 8 9 10 11 12 A xxxx B C D xxxx E F G xxxx H I xxxx J K xxxx L Figure IV. les appariements strictement homologues se réalisent.13 : schéma simplifié d’une puce. La séquence dont on cherche à déterminer la composition est hybridée sur ce filtre. si les ADN fixes sur les cases ci-après ont la séquence décrite : B9 : C A G C C A A T 43 . Un traitement informatique permet d’analyser les résultats. Par exemple. Dans cet exemple nous avons cinq hybridations de séquences.

Les industriels espèrent pouvoir réaliser des puces de 1 µm et pourquoi pas. environ 1.14 A G G C C C C C C C A A A A A A A A A A T T T T T A A A A A C C C C G G G A A A G C C La séquence reconstituée est alors : 5’ – CAGCCAATACGA. Détection de mutations et de polymorphismes. Ainsi.6kb).000 sondes fixées).On peut encore diminuer leur taille. La synthèse des oligonucléotides se fait in situ : réactions chimiques avec adresse spécifique sur le verre. 44 .3 µm ! Secteurs d’application : • • • • Dans le séquençage de l’ADN mitochondrial (16. permettent de fixer plusieurs centaines de milliers de sondes. des puces de 0.6 cm2 avec un espace entre les sondes d’environ 50 µm (65. comme dans l’industrie informatique. avec espacement des sondes de 20 µm. ont été fabriquées. Ces puces sont très petites. des puces. Pharmacogénétique ou pharmacogénomie.E4 : H12: J1 : L12 : C Figure IV. Expression de gènes. Le support utilisé pour fixer les oligonucléotides peut être une plaque de silice.

CHAPITRE V: MUTAGENÈSE IN VITRO. La fermeture des deux extrémités restantes est toujours réalisée par la T4 ligase qui peut joindre deux molécules de DNA ayant des bouts francs. Mutagenèse par délétions L’un des moyens les plus drastiques pour évaluer le rôle d’une séquence de DNA donnée est de la supprimer. la suppression doit être progressive. – Création de mutations ponctuelles pour connaître le rôle de chaque base dans les mécanismes de régulation ou dans la séquence peptidique. 45 . Pour être pleinement informative. L’étendue du retrait dépend du temps d’incubation. L’analyse des modifications physiologiques qui suivent cette excision permet alors de connaître le rôle de la séquence « délétée ». On utilise pour cela plusieurs stratégies en fonction des sites restriction : – Une coupure par une enzyme de restriction suivie de l’action de la nucléase S1 permet de retirer de 3 à 8 paires de bases suivant le type d’enzyme de restriction (largeur du site de reconnaissance) – Une coupure par une enzyme de restriction suivie de l’action de l’exonucléase III permet également de retirer plus de bases en fonction du temps d’incubation. de délétions et d’insertions dans des fragments d’ADN cloné. I . La nucléase S1 est toujours utile pour raboter les extrémité 5’. – Insertion de séquences plus ou moins longues en fonction de la carte de restriction. Le principe consiste à utiliser les enzymes de restriction soit pour « déléter ». EXPRESSION DES GÈNES EUCARYOTES DANS LES BACTÉRIES.LES MUTAGENÈSES 1. – Une coupure par une enzyme de restriction suivi de l’activité de la nucléase Bal 31 qui dégrade les deux extrémités de l’ADN à la fois. Les fragments d’ADN ou les gènes ainsi modifiés peuvent ensuite être réintroduits dans l’organisme d’origine pour observer les effets des mutations sur le phénotype ou sur la régulation de l’expression génétique. La fin des années 1970 et le début des années 1980 ont vu se développer des techniques qui permettent de modifier des paires de bases bien spécifiques donc de créer différents types de mutations ponctuelles. On emploi alors la stratégie suivante : – Création d’une délétion étendue dans l’ADN considéré afin de connaître le rôle de la séquence – Création de délétions de plus en plus courtes pour circonscrire les régions d’intérêt. soit pour insérer des portions plus ou moins grandes de DNA dans le gène cloné afin d’élucider son rôle dans le génome.

On aura donc des bouts 5’ débordants. Mutagenèse par insertion: L’insertion d’une courte séquence dans un gène permet d’élucider l’effet de position soit d’une base soit d’une séquence de bases dans les phénomènes de régulation. la molécule de DNA est réparée par l’addition des quatre dNTP et du fragment de Klenow de la DNA polymérase. en l’absence des désoxyribonucléotides triphosphates. à Le site est traité avec l’ADN polymérase I modifiée (appelée fragment de Klenow). soit un fragment de restriction purifié.2. soit un oligonucléotide de synthèse. 5 à 3 exonucléasique. ∗ soit en exploitant l’activité exonucléasique de l’ADN polymérase I d’Escherichia coli (qui a trois activités enzymatiques: 5 à 3 polymérisante.1 : Mutagenèse. Le fragment que l’on veut insérer ou modifier est. ou pour connaître l’influence d’un acide aminé dans le fonctionnement d’une protéine. substitutions de nucléotides On procède alors comme il suit: à Avec une enzyme de restriction donnée comme Hind II.Les substitutions de nucléotides Les substitutions des bases peuvent être introduites dans un segment d’ADN cloné dans un plasmide. soit une substitution de nucléotides. à Après élimination du bisulfite. 46 . En effet. En présence de dTTP. Ces régions mono-caténaires sont alors utilisées pour substituer des paires de bases ou pour introduire des nucléotides supplémentaires: ∗ soit par une digestion partielle à l’aide de l’exonucléase III (qui a une action exonucléasique 3 à 5 ) après une coupure par une enzyme de restriction. On obtient encore des extrémités 5’ débordants. à L’addition du bisulfite provoque une désamination des résidus cytosines (C) des brins exposés pour donner de l’uracile (U). Figure V. Exemple : Pour créer donc un mutant contenant une substitution de base par une désamination de la cytosine. après y avoir créé de courtes régions mono-caténaires. à Le résultat est une substitution d’une paire de bases G-C par une paire A-T. cette enzyme digère un des brins d’un duplex d’ADN dans la direction 3’ à 5’. et 3 à 5 exonucléasique). a. ce fragment enzymatique agit comme une exonucléase en effectuant une digestion simple brin 3’à5’ jusqu’à ce qu’il rencontre un résidu T. on ouvre dans l’ADN un site de restriction: un smal. Le principe utilise les mêmes méthodes que pour la délétion.

Michael Smith a inventé la méthode qui utilise des petits oligonucléotides de synthèse d’une taille de 15 à 25 bases. une ou deux bases mal appariées peuvent être tolérées dans la formation de la double hélice. Figure V.La mutagenèse dirigée au moyen d’oligonucléotides: Les exemples que nous venons de voir possédaient un site de restriction propice aux bords de la région à modifier. comme le phage M13. Les bactéries ayant incorporé la séquence mutée sont sélectionnées par hybridation in situ dans des conditions de forte stringence avec l’oligonucléotide muté marqué comme sonde (pour différencier la molécule non mutée). si l’hybridation est réalisée à basse température et à faible stringence (faible force ionique). Les deux brins de l’ADN obtenu sont séparés par simple chauffage suivi d’un refroidissement rapide et transférés par transformation dans E. Il y aura donc un défaut d’appariement au niveau de cette base avec l’ADN du vecteur. 5. Mais comment créer une mutation dans une séquence qui ne bénéficie pas de cette situation favorable ? Pour résoudre ce problème. 6. 4.b .2 : mutagenèse dirigée au moyen d’oligonucléotides Le protocole est le suivant: 1. Cependant. Un oligonucléotide synthétique dérivé du gène cloné et portant la mutation désirée est ajouté dans le milieu pour servir d’amorce (primer) pour la synthèse in vitro du brin complémentaire du vecteur M13. Le gène que l’on désire muter est cloné de préférence dans un vecteur dérivé d’un phage dont le génome est une molécule d’ADN monocaténaire. 47 . 3. 2. Le brin complémentaire est alors synthétisé in vitro par le fragment de Klénow de la DNA polymérase I qui utilise l’oligonucléotide modifié comme amorce. L’amorce synthétique peut donc contenir n’importe quelle base « erronée » que l’on désire introduire dans la séquence. coli où il seront répliqués in vivo et produiront finalement un grand nombre d’exemplaires de la séquence mutée que l’on désire (50% pour la séquence mutée et autant de copies de l’ADN sauvage 50%).

La cellule est sélectionnée positivement par le G418 (résistance conférer par le gène néo) et négativement par le ganciclovir (tk+. c’est-à-dire par insertion. E) et le gène tk est éliminé en raison de sa position terminale. les exons C. D . Celle-ci reconnaît sélectivement le gène endogène et provoque une recombinaison homologue responsable soit d’une insertion par addition.Celles où l’intégration s’est faite par le truchement d’une recombinaison homologue ayant inactivé le gène HPRT sont alors sélectionnées par leur résistance à la thioguanine (sélection des cellule HPRT-). Pour réaliser la même opération sur des gènes non sélectionnables (gènes de régulation). D et E endogènes sont remplacés par ceux de la construction (C.La mutagenèse insertionnelle ciblée par recombinaison homologue On peut cibler le site de la mutagenèse insertionnelle en introduisant une séquence homologue au gène que l’on veut léser. La cellule est sélectionnée positivement par G418 ( neo+ ) et résiste au ganciclovir (tk-). le gène ciblé est inactivé car l’exon D exogène est interrompu par le gène neo. D. (Figure V. 4 . les deux gènes sont présents dans le génome. soit une insertion par remplacement. néo. la construction utilisée est intégrée en totalité. La thymidine kinase du virus de l herpes confère la sensibilité à une drogue antivirale. analogue de la thymine). Dans le cas d’une insertion par addition.3) La première construction réussie a utilisé le protocole suivant: 1 – Le vecteur plasmidique utilisé contenait à la fois un fragment du gène HPRT (Hypoxanthine-guanine PhosphoRibosyl Transférase) pour cibler ce gène in vivo et un gène néo (ce gène marquer confère à la cellule une résistance à la néomycine) 2 . et le gène cible n’est pas touché.Le vecteur est introduit par électroporation dans des cellules embryonnaires indifférenciées (ES cells : Embryonic Stem cells : cellules staminales embryonnaires indifférenciées pluripotentes et cultivables in vitro de façon prolongée).Les cellules ayant intégré l’ADN sont sélectionnées par leur résistance au G418 (un analogue de la néomycine) conférée par le gène néo. 48 .c . Dans le cas d’une insertion par remplacement. – En cas de recombinaison homologue par remplacement. 3 . Les évènements de recombinaison homologue réussis peuvent être vérifiés par la PCR en utilisant une amorce correspondant à l’ADN exogène (par exemple une séquence néo) ou une amorce correspondant à une séquence endogène (comme l’exon F du gène HPRT). le ganciclovir. le gène cible est inactivé. En ce moment. Mansour a élaboré un système de double sélection : le procédé de sélection positive et négative dont le principe est le suivant : – Si l’intégration se fait d’une manière aléatoire.

Figure V.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue A B C D E F Gène ciblé C D NEO D F tk Construction C D NEO D E tk A C D E F Intégration aléatoire A B C D E F Gène ciblé C D NEO D E tk Construction Recombinaison homologue A B C D NEO D E F 49 .

il faut avoir recours soit à des gènes reporteurs. La poursuite des cycles en présence des amorces amont et aval conduit à l'amplification de cette séquence complète dans laquelle le codon muté a été inséré. mais dans les autres cas... On fait une première amplification entre chacune des amorces modifiées et les amorces des extrémités.4 : La mutagenèse . soit à des promoteurs inductibles.3 : La mutagenèse insertionnelle ciblée par recombinaison homologue Figure V. MISE EN ÉVIDENCE DES EFFETS DE LA MODIFICATION L’effet des modifications est de suivre l’expression d’un gène soit par une augmentation ou une diminution de la production d’une protéine soit d’étudier les modifications structurale de la protéine produite. on conduit à une renaturation entre les fragments au niveau des amorces centrales modifiées. La séquence de DNA modifiée est couplée à un gène reporteur que la cellule d’expression ne possède pas et dont le produit est facilement analysable. mutation d’un site de restriction.) souhaitée... Cette hybridation fait apparaître des extrémités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux extrémités de la séquence d'intérêt. on conduit à une renaturation entre les fragments au niveau des amorces centrales modifiées. La création d'une mutation artificielle peut être obtenue dans un gène par le jeu des amplifications à partir d'amorces modifiées.) souhaitée.Figure V. Les gènes 50 . Dans le cas des changements phénotypiques le résultat est visuel. Mutagenèse par PCR • La création d'une mutation artificielle peut être obtenue dans un gène par le jeu des amplifications à partir d'amorces modifiées. Cette hybridation fait apparaître des extrémités 3'OH d'où l'élongation (Taq polymérase) peut se poursuivre jusqu'aux extrémités de la séquence d'intérêt. 3 . On prépare aussi par synthèse des oligonucléotides conformes aux séquences des deux brins du gène autour du codon qui doit être modifié mais dont les bases sont volontairement changées pour qu'elles permettent la synthèse d'un brin complémentaire comprenant la substitution (ou la délétion. En réunissant ces deux amplifications et en dénaturant l'ADN. La poursuite des cycles en présence des amorces amont et aval conduit à l'amplification de cette séquence complète dans laquelle le codon muté a été inséré. On prépare l'amplification du gène ou du cDNA grâce à deux amorces placées en amont et en aval de la séquence d'intérêt. On prépare l'amplification du gène ou du cDNA grâce à deux amorces placées en amont et en aval de la séquence d'intérêt. On fait une première amplification entre chacune des amorces modifiées et les amorces des extrémités. En réunissant ces deux amplifications et en dénaturant l'ADN. On prépare aussi par synthèse des oligonucléotides conformes aux séquences des deux brins du gène autour du codon qui doit être modifié mais dont les bases sont volontairement changées pour qu'elles permettent la synthèse d'un brin complémentaire comprenant la substitution (ou la délétion. • • • • • II.

TRANSFERT DE L’ADN MODIFIÉ Le transfert de l’ADN libre dans les cellules s’effectue par transfection avec différentes techniques suivant le type cellulaire : La transfection par le phosphate de calcium fait intervenir une internalisation du complexe DNA-calcium par phagocytose La transfection par le complexe DEAE dextran est également une internalisation par phagocytose L’électroporation utilise l’effet d’une tension électrique sur des cellules en suspension qui provoque la formation transitoire de pores permettant au DNA de pénétrer dans la cellule. rétroviraux et les plasmides que l’on appelle alors des vecteurs navettes. Le DNA peut aussi être introduit par des projections de micro-particules enrobées de DNA surtout pour les plantes. La transfert de matériel génétique utilise aussi les vecteurs viraux. Le DNA peut aussi être introduit dans les cellules par micro-injection surtout dans le cas des ovocytes fécondés. de la β-galactosidase ( -Gal) et de la luciférine. 51 . de la β-glucuronidase ‘( -Glu). (CF Photocopies) III.les plus courants sont : le gène de la Chloramphénicol-acétyl transférase (CAT).

DEUXIÈME PARTIE : APPLICATION DE LA BIOLOGIE MOLECULAIRE :
LE GÉNIE GENETIQUE
52

CHAPITRE VI:

LES TECHNIQUES DU GENIE GENETIQUE APPLIQUEES AUX MICRO-ORGANISMES

Les génomes eucaryotes sont beaucoup plus complexes que les génomes bactériens et phagiques C’est pourquoi les techniques de manipulation de l’ADN doivent être adaptées aux différents génomes. Les exemples ci-dessous donnent une idée de la taille du génome de quelques espèces : • Plasmides • Bactériophage • Bactériophage M13 • E. coli • La levure (Saccharomyces cerevisiae) • Neurospora crassa • C. elegans • Drosophila melanogaster • Homo sapiens à à à à à à à à à 2 à 5 kb 4,8 kb 6,4 kb 4 Mb 4 Mb 27 Mb 100 Mb 165 Mb 3000 Mb

I. LA TECHNIQUE DE L'ADN RECOMBINANT (ADNR) La technique de l'ADN recombinant (ADNr) est simple dans son principe: L’ADN recombinant est formé en réunissant des segments d’ADN de différentes sources par le processus suivant: L'ADN d’intérêt est coupé avec une enzyme de restriction, L'ADN exogène contenant la séquence d'intérêt est mis en présence de l’ADN du vecteur digéré par la même enzyme Les deux ADN sont ensuite ligaturés avec une enzyme appelée ligase. Le DNA obtenu est transféré dans une cellule d’expression On analyse les résultats obtenus grâce à des marqueurs présents dans l’ADN du vecteur Figure VI.1 1 - Les organismes transgéniques et la recherche en génie génétique Un organisme transgénique est défini comme provenant d’une cellule dont le génome a été modifié par l’introduction d’ADN extrinsèque. Cet ADN extrinsèque peut être une séquence provenant de la même espèce mais qui a subi des modifications chimiques ou provenir d’une espèce différente. Le gène d’intérêt dans l’échantillon d’ADN extrinsèque est le transgène. L’introduction de cet ADN dans une cellule peut s’effectuer par une série de manipulation diverses : par l’électroporation, la micro-injection, les liposomes, la coprécipitation par le phosphate de calcium, par la transformation, par infection virale, ou par un bombardement avec des micro-projectiles de tungstène enrobés d’ADN dans le cas des cellules végétales.

53

La construction d’organismes transgéniques constitue un bond en avant pour la recherche en génie génétique. Une des méthodes les plus importantes consiste en l’utilisation de gènes indicateurs qui permettent de mesurer l’activité d’un gène spécifique dans le tissu où il s’exprime normalement, malgré l’absence d’un phénotype facilement détectable. La région qui contrôle l’expression du gène en question (promoteur) est alors rattachée à la région codante d’un gène dont l’activité est facilement mesurable et qui constitue alors le gène indicateur. Chaque fois que le gène étudié est exprimé, le gène indicateur signale sa présence par son activité indicatrice dans la cellule ou dans les tissus concernés. La construction de bactéries, de plantes, de champignons et d’animaux transgéniques ouvre donc de nombreux débouchés pratiques. Nous avons déjà vu comment les bactéries transgéniques sont utilisées pour la production de différentes protéines, parfois d’origine humaine, utiles en médecine et en pharmacie. Cet aspect de la recherche est appelé biotechnologie. L’ADN recombinant : L’action d’une enzyme permettant de souder deux fragments d ‘ADN , comme l’exemple de l’enzyme EcoRI explique simplement le principe de l’ADN recombinant. 2. Intérêt de la transgenèse Sur le plan de la biotechnologie : - Au plan zootechnique : l’un des intérêts majeurs de la transgenèse est l’amélioration des caractères phénotypiques des animaux de rente: amélioration de la croissance des animaux, comme le porc, le saumon, l’acquisition de résistances aux maladies causes de mortalité dans les élevages de lapins, de truites, de carpes…. - Au niveau des plantes : La création de plantes résistantes aux insectes, au stress hydrique et pour la production de protéines utiles comme les anticorps : (maïs résistant aux insectes, tomates transgéniques à mûrissement lent, bananes vaccinantes….) Sur le plan médical : â Production de protéines d’intérêt pharmaceutique : Certaines protéines trop complexes (glycosylées, carboxyméthylées…) ne peuvent être synthétisées complètement par les bactéries in vitro. Il faut donc chercher à en obtenir par un animal transgénique (dans le lait, le sang, les urines…..). L’obtention de ruminants transgéniques producteurs de protéines d’intérêt pharmaceutique à haute valeur ajoutée (facteurs VIII et IX de la coagulation, anti-thrombine III, alpha-1-antitrypsine, activateur du plasminogène, sérum albumine…) représente aujourd’hui un intérêt financier énorme. â Xéno transplantation : Face à l’insuffisance des organes humains disponibles pour les greffes, la recherche d’organes animaux peut représenter une solu-

54

A l’inverse. _ Les risques liés à l’environnement : Ces risques sont liés à la dissémination des organismes transgéniques. aux Etats Unis et en Australie survivent pendant plusieurs semaines quand ils sont greffées à des primates. Les souris de même que les lapins peuvent servir aussi pour l’étude du SIDA et pour des tests thérapeutiques. Les maïs transgéniques possèdent aussi des gènes de résistance aux ampicillines. Ces transgènes peuvent donc s’intégrer dans les bactéries du tube digestif humain et conférer des résistances bactériennes aux antibiotiques que nous utilisons pour nos traitements. il est envisagé de diminuer la concentration de la bétalactoglobuline qui participe à l’intolérance au lait dont souffre une grande partie de la population mondiale. Le porc. _ Les risques liés à la consommation des produits OGM comme les protéines de la vache folle qui provoque des troubles chez l’homme. les déchets des produits transgéniques déversés dans la nature constituent de grands dangers qui guettent sans cesse notre écosystème. â Création de modèles animaux des maladies humaines : Des souris. Des bactéries et des souris transgéniques qui s’échappent d’un laboratoire de recherche ou d’un centre de production. Le taureau hollandais HERMANN est un mâle fondateur transgénique de ce gène. Les c urs et les reins de porcs transgéniques obtenus en Grande Bretagne. Le lait devient alors un « alicament ». Il s’agit d’un composé du lait humain qui est absent du lait de vache. Un lait enrichi en anticorps ou en lysozymes pourrait être protecteur du tube digestif et pourrait même être utilisé chez les nourrissons. Pour éviter le rejet d’organes porcins transplantés chez l’homme. Les moutons qui sur-expriment GH (hormone de croissance humaine) sont diabétiques et meurent avant l’âge d’un an. les gènes humains des protéines régulatrices du complément sont transférés au porc. II . l’utilisation de la transgenèse chez les végétaux et les animaux fait l’objet de vives réserves et controverses : _ L’utilisation de l’hormone de croissance humaine chez les animaux perturbe leur croissance et leur reproduction. Néanmoins. physiologiquement proche de l’homme est à l’heure actuelle le meilleur candidat. L’expression de la lactoferrine humaine dans le lait de vache a déjà été réalisée. mais aussi un rôle antibactérien (Elle assure une protection du tube digestif du nouveau-né contre les infections bactériennes). â Modification de la composition du lait : Elle a pour but de mieux adapter le lait des ruminants à la consommation humaine et d’améliorer sa transformation par l’industrie laitière. d’autant plus que très peu de maladies sont transmissibles du porc à l’homme. Elle joue un rôle de transporteur de fer. COLI 55 .tion palliative. c’est à dire simultanément un aliment et un médicament. â Risques liés à la transgenèse : Les applications et les espoirs que font naître la transgenèse sont très nombreux. mais aussi des ruminants transgéniques peuvent servir de modèles pour l’étude des maladies humaines à prions.SYNTHÈSE DU FACTEUR VIII HUMAIN PAR L’E.

2 : Synthèse de l’insuline IV .SYNTHÈSE DE L’HORMONE DE CROISSANCE HUMAINE PAR ESCHERICHIA COLI 56 . a été inséré dans un plasmide à côté d’un promoteur tardif du phage T7. III . inactive le répresseur et autorise alors la synthèse de l’ARN polymérase du phage T7. Le schéma représente un système de deux vecteurs pour la production en deux étapes du facteur VIII humain. L’insuline active est obtenue par une réaction d’oxydation chimique des cystéines. Il en résulte une production de quantités importantes de facteur VIII par les bactéries contenant le plasmide. coli : Les deux chaînes d’insuline sont synthétisées séparément sous forme de protéines fusion avec la galactosidase. le gène humain (ADNc) du facteur de coagulation du sang. Par conséquent seules les protéines du phage sont encore synthétisées. Le gène d’intérêt. Au début de l’infection.SYNTHÈSE DE L’INSULINE HUMAINE PAR E.Le vecteur utilisé dans cet exemple est le phage T7. la bactérie synthétise des quantités énormes des produits des gènes dits tardifs du phage T7 (les protéines de la capside et de la queue). le gène de la polymérase du phage T7 est aussi transcrit et traduit en protéine. L’addition de l’inducteur IPTG (analogue du lactose). Le Chromosome d’E. Lorsque la transcription à partir du promoteur lac est induite par l’addition d’IPTG. en l’occurrence. coli est manipulé pour contenir le gène de l’ARN polymérase du phage T7 placé sous le contrôle du promoteur lac. coli par une insertion de son gène dans un plasmide. On insère le gène de l’ARN polymérase de T7 dans le chromosome d’Escherichia coli sous le contrôle du promoteur de l’opéron lactose. Actuellement l’insuline est produite en grande quantité par E. Figure VI. COLI: Expression de l’insuline humaine chez Escherichia. le facteur VIII. En fin d’infection. Cette possibilité est utilisée pour produire de grande quantité des protéines d’intérêt comme le facteur VIII de la coagulation sanguine qui est défectueux chez les hémophiles. Le gène de l’ARN polymérase de T7 est transcrit à partir du promoteur lac et se trouve normalement réprimé par le répresseur lac. L’ARN polymérase du phage T7 produite alors par la bactérie transcrit abondamment ce gène dans le plasmide. Elles sont ensuite libérées par un traitement chimique puis mélangées. l’ARN polymérase du phage T7 transcrit les gènes précoces à partir d’un promoteur dit précoce du phage T7. La grande quantité de mRNA ainsi produite est traduite pour donner une grande quantité de la protéine facteur VIII. A ce moment. Les RNA polymérase de T7 ainsi produites transcrivent activement à leur tour le gène du facteur VIII à partir du promoteur tardif du T7 présent sur le plasmide. les gènes de la bactérie hôte ne sont plus transcrits.

Dans ce cas. Il en résulte une méthionine à l’extrémité N-terminal qu’il faut enlever pour avoir la protéine active. 2 – L’élaboration du vaccin contre l’hépatite B. l’importance d’avoir des vecteurs à grande capacité d’emmagasinage pour étudier les gènes humains ou pour produire des protéines humaines à intérêt thérapeutique. Ces plasmides bactériens ne peuvent cependant pas se répliquer dans la levure. On réalise alors. coli : (a) : Dans la première construction. il n’y a plus de méthionine supplémentaire et le produit excrété est de l’hormone de croissance pure. L’une des raisons est que la génétique de cette levure est extrêmement bien développée.Les levures transgéniques La levure Saccharomyces cerevisiae est devenue l’Escherichia. une séquence signal bactérienne est ajoutée pour favoriser la sécrétion du produit de traduction dans l’espace périplasmique. pourvu qu’il contienne une origine de réplication bactérienne et un marqueur sélectionnable dans la bactérie. V – PRODUCTION DE VACCINS PAR LA TECHNIQUE DE L’ADN RECOMBINANT : 1 . Comme exemple : • le gène qui code pour le facteur VIII de la coagulation sanguine est long de 190 kb • le gène responsable de la dystrophie musculaire de Duchenne fait 1000 kb. 57 . ces plasmides peuvent s’intégrer dans les chromosomes par recombinaison homologue faisant intervenir un seul ou deux crossing-over. (b) : Dans cette construction. le plasmide entier est intégré dans le chromosome.Le schéma de la figure IV.8 donne le protocole de construction pour la synthèse de l’hormone de croissance humaine dans E. Les vecteurs de levure les plus simples sont dérivés de plasmides bactériens dans lesquels un fragment d’ADN de levure a été inséré. Ces vecteurs navettes que sont les chromosome artificiels de levure (YAC) sont extrêmement indispensables pour le clonage de grands fragments de génome humain. la séquence signal humaine de l’insuline est éliminée pour permettre l’expression de la protéine dans les cellules bactériennes. puis de re-transférer le plasmide dans Escherichia coli pour manipuler le gène de la levure. coli des eucaryotes. • Dans le premier cas. Il est alors possible d’introduire des gènes étrangers dans la levure pour en étudier l’effet sur le phénotype. l’allèle cellulaire est remplacé par celui qui est porté par le plasmide par recombinaison. • Dans le second cas. Quand ils sont introduits dans les cellules de levure.

3 : Production de l’antigène HbsAg VI . 16 à 19 % de la population du Burkina Faso sont aussi atteints par l’infection à l’hépatite B. ces antigènes injectés à l’homme provoquent une réponse immunitaire par la production des anticorps antiHbs ou anti HbsAg. Elles présentent des phénomènes de différenciation uniques chez les procaryotes.. le gène est transcrit et traduit en antigènes viraux. qui a longtemps été l'antibiotique de référence contre les infections sévères à bactéries Gram+ (endocardites. Pour ce faire. Le virus de l’hépatite B (HBV) qui infecte le foie. antibiotique. On estime qu’aux Etats-Unis. Cette différenciation morphologique s'accompagne d'une différenciation métabolique et de la production d'une grande variété de métabolites secondaires.APPLICATION DU GÉNIE GÉNÉTIQUE À L'AMÉLIORATION DE LA PRODUCTION DES ANTIBIOTIQUES PAR DES BACTÉRIES L'apparition de bactéries pathogènes multirésistantes aux antibiotiques pose un grave problème médical. Cela rend la production industrielle de ces métabolites particulièrement intéressante. Dans les cellules de levures transgéniques. antihelminthique. Mais les plus connus restent les antibiotiques. Les Streptomyces sont des bactéries du sol à Gram+ qui appartiennent à la classe des Actinomycètes. la vancomycine. L'abondance et la diversité structurale des antibiotiques synthétisés par les Streptomyces ne se retrouvent dans aucun genre bactérien. Les antibiotiques de la famille des streptogramines. La synthèse de la pristinamycine par des Streptomyces pristinaespiralis recombinants Les chercheurs ont eu l’idée de construire une souche génétiquement modifiée de Streptomyces pristinaespiralis. le virus de l’hépatite B infecte plusieurs centaines de milliers de personnes dans le monde. anticancéreuse. provoque des lésions et dans certains cas des cancers. Cette protéine se retrouve dans le sang des personnes infectées sous la forme de gros agrégats protéiques. Après purification. septicémies. anabolisante. La fabrication du vaccin contre l’hépatite B. tels que la formation de mycélium et de spores. bactérie Gram+ qui produit la pristinamycine. Cette nouvelle souche bactérienne transgénique est stable dans les conditions industrielles et l'antibiotique est obtenu dans la forme souhaitée. Les Streptomyces étaient donc tout indiquées pour mettre au point de nouvelles molécules actives. Cela rend nécessaire la recherche de nouvelles molécules actives contre ces pathogènes. appelé Engérix-B a utilisé la technologie de l’ADN recombinant.) est inopérante dans un nombre croissant de cas. au point que les Streptomyces sont à l'origine de 70 % des antibiotiques produits industriellement. il y a 150 000 infections par l’hépatite B chaque année. le gène de l’antigène de surface du virus de l’hépatite B (HbsAg) a été introduit dans Saccharomyces cereviciae par l’intermédiaire d’un YAC. La particule virale est recouverte d’un antigène de surface : HbsAg.. présentant tout un éventail de structures chimiques et d'activités biologiques. Figure VI. On peut trouver des molécules ayant une activité herbicide.Chaque année. en particulier la nouvelle pristinamycine in- 58 . Par exemple. Cette protéine est actuellement commercialisée et constitue un vaccin contre l’hépatite B.

mais à cause de sa faible solubilité. le précurseur de la PIIA. Le composant PII est luimême un mélange de deux molécules : la PIIA. pristinaespiralis est constituée d'un mélange de deux composants. La conversion de PIIB en PIIA est obtenue par oxydation d'un acide aminé. la pristinamycine I et la pristinamycine II. L'un des composants de la forme soluble est obtenu par oxydation chimique de la PIIB. Pristinamycine IIB FMN reductase NADH + H+ + FMN --------------------------à Pristinamycine IIA NAD+ + FMNH2 PIIA sybthase PIIB + FMNH2 + O2 --------------------------à Figure VI. et la PIIB. la proline (Fig. Cette dernière est elle-même un mélange de deux molécules : la PIIA. pristinaespiralis sont incapables de réaliser naturellement la bioconversion totale de PIIA + FMN + 2H2O 59 . produit final de la voie de biosynthèse. de plus. précurseur de la PIIA.4 La pristinamycine produite naturellement par S. C'est un mélange de deux composants. pristinaespiralis produit un mélange de ces deux formes dans les proportions de 80 % de PIIA et de 20 % de PIIB. les souches actuelles de S. développée par Rhône-Poulenc-Rorer.jectable. peuvent fournir un nouveau moyen de lutter contre les bactéries pathogènes. Les souches de S.). La pristinamycine est produite par Streptomyces pristinaespiralis. son utilisation était limitée. c'est pourquoi une forme injectable de pristinamycine constitue une solution intéressante pour remplacer la vancomycine. un effet post-antibiotique puissant (le blocage se maintient même après disparition de l'antibiotique). Cependant. Ces deux composants agissent de façon synergique pour bloquer la synthèse protéique et possèdent. produit final de la voie de biosynthèse. S. la pristinamycine I et la pristinamycine II. pristinaespiralis sont incapables de réaliser la bioconversion totale de PIIB en PIIA et la modification par génie génétique de cette souche a permis de la réaliser. et la PIIB. La pristinamycine est utilisée en médecine humaine depuis une vingtaine d'années. L'un des composants de la forme soluble mise au point par Rhône-Poulenc-Rorer est obtenu par modification chimique de la PIIA.

-L.PIIB en PIIA. Bamas-Jacques N. Blanc V. par génie génétique.. 1997. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de PIIB en PIIA) permettrait une conversion totale. 2 – clonage de deux gènes snaA et snaB sous contrôle d'un promoteur de transcription fort (ermE promoter) dans des vecteurs intégratifs dérivés de pSAM2 3 – Introduction de la construction contenant les deux gènes snaA et snaB dans S. et qu'ils permettent d'éviter les problèmes d'instabilité structurelle ou ségrégationnelle souvent rencontrés avec des vecteurs réplicatifs chez Streptomyces. pristinaespiralis. Complete conversion of antibiotic precursor to pristinamycin IIA by overexpression of Streptomyces pristinaespiralis biosynthetic genes.Ces résultats montrent que les vecteurs employés sont maintenus de façon stable en l'absence de pression de sélection. Processus : 1 . Friedmann A. Dans le vecteur pSAM2. 15. pristinaespiralis codant la PIIA synthétase (enzyme responsable de la conversion de PIIB en PIIA). Ils montrent également que la quantité de PIIA synthétase était bien le seul facteur limitant la conversion totale de PIIA en PIIB et qu'il est possible de réaliser cette conversion sans affecter le niveau total de production.. Ces éléments sont appelés intégratifs car ils portent des gènes qui permettent une intégration très efficace à un site spécifique dans le chromosome de la bactérie hôte. ambofaciens. pristinaespiralis. est capable de réaliser complètement cette conversion et ne synthétise que le dérivé PIIA. 1997. Pernodet J. pristinaespiralis. Nature Biotechnology. génétiquement propres aux Actinomycètes. 349-353. nouvellement construite. L'idée de base était que la surexpression de gènes snaA et snaB de S. Afin d’obtenir une composition totalement soluble. pristinaespiralis. il était souhaitable d'obtenir uniquement le composé PIIA.Utilisation d’éléments intégratifs originaux de S. L'équipe de Rhône-Poulenc-Rorer a isolé et caractérisé les gènes en question.La souche ainsi construite est stable dans les conditions industrielles et synthétise de la pristinamycine qu’on extrait et qu’on purifie en vue d’une utilisation thérapeutique. on intégra les transgènes du S.. 4 . les gènes snaA et snaB de S. Cette surexpression pouvait être obtenue en réintroduisant ces gènes sous contrôle d'un promoteur fort dans une souche de S. Industriellement parlant. les chercheurs ont introduit dans une souche de S. La souche de S. Ce chimère est une construction stable. L'ADN intégré dans le chromosome grâce à ce type de vecteurs est très stable et est transmis à toutes les cellules filles. pristinaespiralis dont on souhaite l’expression.. pSAM2.Sezonov G. 60 . et Guérineau M. 5 . Référence : ..

VII – PRODUCTION DES ALIMENTS FERMENTÉS PAR DES MICRO-ORGANISMES TRANSGÉNIQUES Depuis fort longtemps.Pediococcus acidilacticus et des levures comme Saccharomyces cerevitiae. La production de fromage La présure est une enzyme produite par la caillette des veaux qui coupe la caséine pour provoquer la coagulation du lait. le yoghourt et aussi des boissons fermentées comme la bière. di. Pour améliorer le goût et la limpidité de la bière. riz.-1. Saccharomyces cerevisiae peut faire fermenter tous les polysaccharides sauf les dextrines qui constituent cependant 22% des hydrates de carbone des céréales utilisées (orge.4-glucosidase. Pour cela. En appliquant la technique de l’ADN recombinant aux bactéries lactiques ou aux levures. seigle. Le goût de la bière se trouve ainsi amélioré. le dolo. mil…) pour la production de la bière. tri polysaccharides et de dextrines qui proviennent de l’hydrolyse de l’amidon par les amylases. Lactobacillus acidophilus. La production de la bière Le moût du malt (comme de mil rouge) est un mélange de mono. Ces fermentations sont le résultat du métabolisme des bactéries fermentaires comme. maïs. 1. on a pu améliorer la qualité des aliments fermentés. Lactobacillus heveticus. le vin. le fromage. La production du lait caillé constitue la première étape dans la production du fromage. Lactobacillus casei. Lactobacillus lactis. on a cloné le gène de la présure de veau dans un vecteur d’expression qu’est Saccharomyces cerevisiae qui produit alors de la présure de levure. Il faut beaucoup de présure pour la fabrication du fromage alors que sa production par les veaux n’est pas suffisante. Ce gène est cloné dans Saccharomyces cerevisiae pour augmenter la teneur en glucose et donc en éthanol par fermentation. C’est le gène DEX qui code pour l’amidon. On peut également utiliser une bactérie lactique en fonction de son métabolisme et de la rentabilité. l’homme consomme des aliments fermentés comme le pain. 2. En clonant les deux gènes responsables de la formation de ces enzymes dans Saccharomyces cerevisiae on améliore et le goût par l’hydrolyse de l’amidon et la limpidité de la bière par l’hydrolyse des protéines. Amélioration du goût et de la limpidité de la bière : Aspergillus abwamori est un champignon qui produit une enzyme : « la glucoamylase » qui dégrade l’amidon brut en glucose. le cidre. on peut procéder comme suit : Amélioration du goût de la bière : Saccharomyces diastaticus possède des enzymes qui dégradent les dextrines pour donner du glucose fermentescible. 61 . Lactobacillus delbruekii.

Le plasmide Ti constitue l’exemple classique pour les études des plantes transgéniques. La production de la tumeur est déterminée par un grand plasmide circulaire de 200 kb présent dans la bactérie. Figure VII. Il est alors possible d’introduire dans le génome d’une plante de l’ADN provenant d’autres espèces végétales.2: Infection par l’agrobacterium tumefaciens. parce qu’elle permet désormais de modifier le génome presque à volonté.Définition et action du plasmide Ti dans la nature : Le plasmide Ti (Tumor Inducing) dérive d’une bactérie du sol appelée Agrobacterium tumefaciens. ceux qui contrôlent la synthèse des enzymes de dégradation des opines (noc. L’amélioration n’est plus limitée à la sélection de variants au sein d’une espèce par la génétique classique. appelée « ADN-T ». la partie du plasmide. Lorsque le plasmide Ti est inséré dans l’ADN chromosomique de la plante. occ) se trouvent dans la bactérie sous le contrôle de séquences régulatrices procaryotiques. LE PLASMIDE TI: 1. La séquence ADN-T contient: des gènes qui codent pour des hormones de croissance végétales et sont responsables de la tumorisation des cellules de la plante. ocs) sont exprimés dans la plante à partir de séquences régulatrices eucaryotes. une partie de son ADN appelé « ADN-T » inséré dirige alors la synthèse d’hormones végétales qui perturbent la régulation de la croissance des cellules infectées de la plante (ce qui donne lieu à la formation d’une tumeur) ainsi que la synthèse de nopaline qui peut être utilisée comme source de carbone et d’azote par la bactérie (symbiose). d’animaux ou même de bactéries. Les plantes infectées présentent des lésions constituées de cellules dont la croissance est incontrôlée (des tumeurs ou gales).3: Processus d’Infection 62 . est transférée dans la plante et insérée au hasard dans le génome cellulaire. Les gènes qui contrôlent la synthèse des hormones et des opines (nos. Cette bactérie provoque chez les plantes qu’elle infecte une maladie du nom de « gale » du collet.1 : Plasmide Ti I . généralement localisées à la base (ou collet) de la plante. Par contre. le plasmide Ti. Figure VII. des gènes qui codent pour des enzymes qui conduisent les cellules tumorales à synthétiser des substances appelées opines (nopaline et octopine). Lors de l’infection.CHAPITRE VII: LE GENIE GENETIQUE APPLIQUE AUX VEGETAUX Les plantes transgéniques L’avènement de la technologie de l’ADN recombinant a introduit une dimension nouvelle dans la recherche. Figure VII.

Dans tous les cas. qui constitue la preuve que les cellules de plantes ont été transformées. Figure VII. il faut utiliser un gène d’expression « gène indicateur » dans le vecteur pour suivre la manifestation de l’ADN intégré. tout fragment d’ADN cloné au sein de l’ADN-T peut comme lui s’insérer de façon stable dans le génome de la plante qui le reçoit. Les bactéries qui contiennent le plasmide co-intégrat (qui est le résultat de la fusion du plasmide désarmé et du vecteur intermédiaire). y compris les gènes inducteurs de tumeurs qui constituent l’aspect gênant de l’ADN-T. Expression de l’ADN intégré. • Ti désarmé conserve l’extrémité gauche (L) de l’ADN-T qui servira de site de recombinaison pour l’intégration du vecteur intermédiaire. • un marqueur de sélection bactérien de résistance à la spectinomycine (spcR) • un marqueur de sélection bactérien de résistance à la kanamycine (kanR). (CF Photocopies) Construire un vecteur Ti désarmé: • on retire toute la région droite de l’ADN-T. pourront se multiplier. seules les cellules qui contiennent l’ADN-T. Qu’en est-il de l’expression de l’ADN intégré en même temps que l’ADN-T? Il peut s’agir de n’importe quel ADN dont on veut tester l’expression dans la plante prise comme hôte. • ce vecteur intermédiaire doit posséder des sites de restriction pour l’étude de l’ADN cloné. des plantes transgéniques. Si l’infection par la bactérie réussit.4: Génération de disques de feuilles 3. Il faut donc construire des dérivés plus petits qui contiennent l’essentiel de l’ADN-T et l’ADN d’intérêt. La croissance de ces cellules donne lieu à la formation d’un petit amas ou cal. son ADN-T sera transféré aux cellules végétales et tout l’ADN localisé entre les extrémités droite et gauche de l’ADN-T s’intégrera dans un chromosome de la plante. Utilisation du plasmide Ti comme vecteur en génie génétique. Un certain nombre de ces gènes indicateurs sont utilisés actuellement avec succès : 63 . Ces cals peuvent donner des radicelles et fournir par la suite. peuvent être utilisées pour inoculer des fragments du tissu végétal comme par exemple de petits disques de feuille. En principe. Si on place les disques de feuilles sur un milieu nutritif qui contient de la kanamycine.2. Le plasmide Ti est très grand pour les manipulations. On peut construire un plasmide intermédiaire par le processus suivant : Un vecteur intermédiaire qui contient: • deux segments d’ADN-T qui portent les fragments L et R de la nopaline.

Promoteur Binding site gène codant l’enzyme 64 . mais elle produit un grain biologiquement stérile. la régulation de l’expression de l’un ou l’autre gène de la plante ou de l’ADN intégré. Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier. un gène exogène tueur qui empêche le développement du germe du grain récolté: la plante se développe dans les conditions habituelles. Cette enzyme produit une coloration bleue par hydrolyse du composé X-gal. Cette enzyme produit une coloration bleue par hydrolyse du substrat X-gluc. au cours du développement. auquel correspond un brevet détenu par la compagnie Monsanto. Cette réaction s’accompagne d’une émission de lumière et c’est ce qui explique la luminescence de la luciole en vol. • La construction est introduite dans une plante en utilisant l’ADN-T. Entre le Promoteur et le gène de la recombinase se trouve le « binding site ». Le gène II produit une enzyme de restriction qui coupe et excise l’ADN « blocker » du gène III.Le gène I est un répresseur qui code pour une protéine régulatrice qui se fixe sur un site opérateur en amont des gènes de structure et inhibe leur transcription. La technologie fonctionne avec trois gènes et un inducteur chimique: . II – LE TERMINATOR CHEZ LES SEMENCES Le concept Terminator. Le processus est le suivant: • On fusionne les séquences régulatrices localisées en amont de n’importe quel gène intéressant au gène de structure de la luciférase. • L’expression de la luciférase est alors observable en badigeonnant la plante avec de la luciférine et en observant la luminescence. désigne une technique consistant à introduire un transgène. • Le gène bactérien « lacZ » qui code pour la β-galactosidase. Une plante de tabac transgénique par exemple qui exprime le gène de la luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine. donne une récolte normale. • L’expression de la luciférase suivra le schéma d’expression du gène dont on a utilisé la séquence régulatrice. La protéine régulatrice du gène I se fixe sur le « binding site » du gène II Gène répresseur GENE I : Protéine régulatrice Répresseur - Le gène II de l’enzyme recombinase est placé sous le contrôle d’un promoteur. Autres indicateurs utilisés dans les plantes: • Le gène bactérien « gus » qui code pour la β-glucuronidase.L’enzyme luciférase catalyse la réaction d’une substance appelée luciférine avec ATP.

Ce gène est sous le contrôle d’un promoteur tardif qui est activé seulement durant le développement de la graine. lors de la croissance de l’embryon. à synthèse de la toxine qui tue les embryons des graines avant les récoltes. Processus d’activation du gène terminator dans les semences de vente aux agriculteurs : 1 – Introduction de l’inducteur (par exemple du tétracycline) dans les semences.GENE II : - Le gène III produit une toxine qui est létale pour l’embryon. produisant la toxine qui tue l’embryon rendant ainsi stérile les nouvelles semences pour la reproduction. (Schéma) : 65 . 2 – L’inducteur bloque le « binding site » au niveau du gène II et empêche le répresseur de se lier. Entre le promoteur tardif et le gène III se trouve l’ADN « blocker » qui favorise. la transcription et l’expression du gène toxine. Une fois ces gènes activés dans ces semences. nous pouvons avoir la production mais pas le reproduction. 5 – L’ARN polymérase se lie au « late promoteur » et transcrit le gène de la toxine. 4 – La recombinase taille et excise la séquence « blocker ». s’il est excisé. 3 – L’ARN polymérase se lie au promoteur et entame la transcription du gène de la recombinase (isomérase) en ARN à synthèse de l’enzyme recombinase. GENE III : Promoteur tardif blocker gène de la toxine - L’inducteur chimique est répandu sur les semis par les compagnies de semences comme Monsanto et Syngeta afin d’activer le gènes II et le gène III.

Inducteur

Graine

Gène répresseur GENE I : Protéine régulatrice

Le répresseur se délie Promoteur GENE II : Binding site Synthèse de l’enzyme recombinase gène codant l’enzyme recombinase

gène de la toxine GENE III :

Promoteur tardif blocker Synthèse de la toxine qui tue l’embryon

Figure VII.5 : Processus d’activation du Terminator NB. En absence de l’inducteur, le répresseur se lie au « binding site » et empeche la transcription du gène de la recombinase. Dans ce cas tout est bloqué car il n’y a pas de recombinase pour exciser la séquence « blocker » et par conséquent, il n’y a pas de toxine qui puisse tuer les embryons des semences.

66

GENE I : Protéine régulatrice Répresseur

Promoteur GENE II : Binding site

gène codant l’enzyme recombinase

Pas de synthèse de l’enzyme recombinase gène de la toxine GENE III :

Promoteur tardif blocker Pas de production de la toxine

Figure VII.6 : En absence de l’inducteur, le gène codant pour la recombinase ne transcrit pas.

67

III . L’APPLICATION DU GÉNIE GÉNÉTIQUE À L’AGRICULTURE: Les applications sont et deviendront de plus en plus nombreuses en fonction de l’évolution des connaissances des caractéristiques génétiques des plantes et des réserves humaines contre les OGM. La problématique des OGM est que le gène TERMINATOR inséré, à travers les techniques du génie génétique, dans le génome de ces végétaux fait que leurs graines ont seulement une capacité de production et non de reproduction. L’agriculteur doit toujours dépendre de ces maisons de fabrication des semences qui ont le brevet. Nous en donnons quelques exemples qui fonctionnent déjà dans ce siècle. 1: L’enzyme luciférase : L’enzyme luciférase catalyse la réaction de la luciférine avec l’ATP. La réaction s’accompagne d’une émission de lumière et c’est ce qui explique la luminescence de la luciole en vol (la luciole produit cette enzyme d’où son nom). Cette enzyme est actuellement utilisée pour suivre la régulation et le génotype du tabac. Une plante de tabac transgénique qui exprime donc le gène de la luciférase s’illumine dans l’obscurité si on la badigeonne avec une solution de luciférine. Le gène de la luciférase peut donc être utilisé comme indicateur pour étudier, au cours du développement, la régulation de l’expression de l’un ou l’autre gène de la plante ou de l’ADN intégré. 2. Le maïs transgénique Chaque année les agriculteurs du monde entier perdent 1/10 de leurs récoltes de maïs à cause des insectes nuisibles. Le maïs transgénique contient dans son génome un gène qui code pour une protéine que détestent les insectes et qui en principe ne doit pas causer de nuisances à l’homme. Cette variété augmente donc le rendement en éliminant le facteur insecte. 3. Les tomates « flavrsavr » Ces tomates transgéniques contiennent un gène freinant le mûrissement du fruit, ce qui leur confère une meilleure résistance au transport et une longue conservation. Désormais avec l’avènement du génie génétique, non seulement la qualité des espèces animales et végétales peut être améliorée, mais ces organismes transgéniques sont utilisés comme des usines pour produire des protéines « utiles » codées par des gènes d’organismes étrangers. 4. La protection des plantes contre l’infection virale

68

Une plante transgénique qui exprime la protéine du manteau (coat Protein : CP) du TMV résiste aux infections par ce virus. lors de sa sporulation. La plante transgénique est déjà produite aux Etats-Unis. Une plante transgénique qui porte un gène de résistance au glyphosate pousse quatre (4) fois plus vite en présence de cet herbicide. Les armes les plus utilisées pour lutter contre les insectes sont « les insecticides et les pesticides » qui posent actuellement de graves problèmes de pollution à l’environnement.8: production de la protéine Bt 6.Les virus des plantes représentent un sérieux problème pour l’agriculture car leurs infections entraînent une diminution de la croissance des plants. Le virus de la mosaïque du tabac (TMV) infecte les plants de tabac. produit une protéine cristallisée toxique contre les larves d’un certain nombre d’insectes ravageurs des cultures et qui ne semble pas être nocive pour les vertébrés. Production d’ammoniac (NH4) et de nitrate (HNO3) par les plantes Les plantes courantes ne sont pas capables d’assimiler directement l’azote moléculaire (N2). Figure VII. Lutte contre les insectes ravageurs Chaque année des milliards de dollars de récoltes sont perdues à cause des insectes. la pomme de terre. _ L’utilisation de l’expression transgénique d’inhibiteurs de sérines protéases des systèmes digestifs des insectes dans les tomates. le petit pois et autres céréales protègent aussi les plantes contre les insectes nuisibles. de tomates et de coton qui expriment le gène de cette toxine résistent aux larves des insectes. Eradication des mauvaises herbes et plantes transgéniques tolérantes aux herbicides Le glyphosate est la substance active de l’herbicide commercial « Roundup » beaucoup utilisé à l’heure actuelle. On peut donc fabriquer des plantes transgéniques capables d’utiliser directement l’azote moléculaire par le processus théorique suivant : 69 . Les plants transgéniques de tabac. _ Le Baccilus thuringensis (Bt). Ce produit tue les plantes en inhibant la 5énolpyruvylshikimate-3-phosphate synthétase (EPSPS). Figure VII. du rendement des récoltes et de leur qualité. Les paysans américains et européens dépensent chaque année un peu plus de huit cents milliards des francs CFA pour la fertilisation de leurs champs par un épandage d’engrais composé essentiellement de sel d’ammonium (NPK). Figure VII. une enzyme du chloroplaste qui intervient dans la biosynthèse des acides aminés essentiels.9: résistance aux herbicides 7.7: production de la protéine CP 5. L’Insertion réussie du gène bactérien de la résistance au glyphosate a conféré à la plante transgénique une résistance à l’herbicide et lui permet de survivre à des épandages normaux de glyphosate.

L’expérience réussie a utilisé une chaîne lourde (H) et une chaîne légère (L) dans deux expériences séparées pour transférer les gènes des anticorps par l’intermédiaire de l’ADN-T dans deux plants de tabac. Cette construction chimère est utilisée pour transformer Bacillus subtilis. Nitrite. Ce peptide.5% des protéines traduites). elle est produite par une plante : « Thaumatococcus danielli » qui pousse en Afrique occidentale. Les plants capables de pousser rapidement sans un apport d’engrais sont ceux capables de fixer l’azote moléculaire Un gène marqueur permet de sélectionner les plants ayant intégré le plasmide avec le gène nif. Les feuilles de ces plantes produisent l’anticorps monoclonal inséré (environ 1. Figure VII.Le gène nif (nitrogen-fixation apparatus) permet à la bactérie Rhizobium des légumineuse de fixer directement l’azote moléculaire pour donner des sels d’ammonium (Nitrate. pBS42. Les plantes transgéniques contenant les gènes des chaînes lourde et légère ont été croisées afin de produire une descendance contenant les deux gènes. Bacillus subtilis transformé synthétise la taumatine. La production de la taumatine La taumatine est un aliment très sucré et même plus doux que le saccharose. Ce sera le gène d’intérêt. 8. suivie d’une purification donne de la taumatine pure 70 . Le gène nif est inséré dans le plasmide Ti de la bactérie Agrobacterium tumefaciens La plante d’intérêt est alors transformée par ce plasmide Les cellules tumorales de la plante transformée sont prélevées et cultivées in vitro puis transférées sur différents terrains sous serre. Production d’anticorps monoclonaux par les plantes Les plantes peuvent aussi servir de bio-réacteurs pour la production d’anticorps. Cet aspect représente un intérêt commercial pour la production de protéines parmi lesquelles les anticorps monoclonaux. composé de 207 acides aminés constitue une source importante pour l’apport en acides aminés dans l’alimentation en plus de sa saveur. pCI72 et qui porte le gène « tau ». Ammonium). Elle est actuellement produite par des bactéries suivant le protocole ci-après : Il a été construit une molécule chimère ayant des séquences des plasmides pCI62-8.10: Production d’anticorps monoclonaux 9. Une extraction.

L’élément P peut donc être facilement utilisé en génie génétique.5 kb. Ce sont des transposons.LES INSECTES TRANSGÉNIQUES 1. Ils portent à leurs extrémités une séquence répétée inversée de 31 paires de bases.90 kb. Les mieux étudiés sont : • les éléments du type copia : Il existe au moins sept (7) familles d’éléments de type copia dont la longueur varie de 5 à 8. Les membres de ces différentes familles sont au nombre de 10 à 100 exemplaires par génome. c’est à dire de se déplacer dans le génome d’un chromosome à l’autre. â Les éléments P permettent d’avoir des drosophiles transgéniques Les éléments P sont des transposons qui sont capables de changer de localisation dans le génome. Ils codent pour une enzyme nommé « transposase ». • les éléments P : D’une longueur égale à environ 2. Dans la drosophile. Le processus suivant permet d’étudier la génétique moléculaire des mouches 71 . Les éléments de type copia contiennent deux longues séquences terminales en répétition directe et de courtes séquences répétées de manière inverse et imparfaite. responsable des déplacements de cet ADN dans tout le génome. Ce type d’élément provoque des réarrangements chromosomiques lors de son insertion et de son excision. Ils contiennent tous de longues extrémités en répétition inverse. La partie centrale possède trois cadres ouverts de lecture et peut coder pour au moins trois protéines dont la transposase et le répresseur de la transposase. • les éléments à rabat ou type FB (pour fold-back) : Ces éléments sont longs de quelque centaines à quelques milliers de paires de bases. L’élément peut se rabattre sur luimême lors des expériences de renaturation thermique d’ou son nom de rabat. Ils peuvent donc être utilisés pour : • effectuer des mutagenèses. • transférer des gènes spécifiques dans des mouches d’un génotype donné.CHAPITRE VIII: LE GENIE GENETIQUE APPLIQUE AUX ANIMAUX I . on a trouvé trois catégories de séquences d’ADN qui ont la faculté de se transposer. Les drosophiles transgéniques.

un entomologiste israélien remarqua une grande quantité de larves d’insectes mortes dans le désert de Negev au demeurant très infesté par les moustiques et les mouches responsables de deux grands fléaux. 72 . on retrouve une grande proportion d’individu ry+. ce qui suggère qu’il est bien localisé sur un chromosome. 2. Les mouches issues de cet embryon ont toujours le phénotype ry-. b . une nouvelle stratégie de lutte contre l’anophèle et la glossine vecteurs du plasmodium et du trypanosome a débuté en utilisant la stratégie suivante : Une production de bio-insecticides par Bacillus thuringiensis capables de tuer les larves des mouches et des moustiques Une utilisation des moyens de transport aérien (hélicoptères) pour la pulvérisation de ces bio-insecticides au niveau des fleuves et des plans d’eau infestés par ces insectes vecteurs. il s’aperçut que les bactéries du genre Bacillus thuringiensis subsp. Le transposon normal P a donc fourni la transposase pour permettre l’insertion du transposon anormal contenant le gène ry+. mais dans leur descendance. israelensis présentes dans les lacs de ce désert tuaient systématiquement les larves des moustiques et des mouches. VIII. Ce type de démarche peut être appliqué à tous les mammifères pour accroître leur rendement en poids et donc en intérêt économique. A partir de cette découverte.On injecte dans le même embryon (co-injection) de l’ADN qui contient l’élément P normal qui pourra fournir la « transposase » à la copie du transposon P contenant la délétion.1 On peut actuellement insérer n’importe quel gène dans la souris afin d’obtenir l’expression génique de ce transgène.On injecte dans un embryon de drosophile l’ADN d’un plasmide bactérien qui contient un élément P dans lequel on a cloné un gène ry+ de la drosophile (ce gène donne la coloration rose de l’ il) mais ayant subi une délétion partielle. Cet élément P modifié ne peut plus se transposer à cause de la délétion. Le gène ry+ nouvellement acquis montre une hérédité mendélienne et stable. II .a . Après une étude approfondie au laboratoire. Bio-insecticide et lutte contre le paludisme En 1976. L’hybridation in situ montre que le gène ry+ (P modifié) et l’élément P normal se retrouvent en différentes positions sur différents chromosomes et non à la position normale du locus rosy.LES ANIMAUX TRANSGÉNIQUES : 1. Les souris transgéniques Figure. Dans cette transgenèse. la souris qui intègre par exemple le gène de l’hormone de croissance humaine (GH) acquiert une masse énorme double ou triple par rapport à ses s urs jumelles.

Lorsque le système immunitaire du bovin est en mesure d’éliminer totalement les trypanosomes. Lorsque la mouche tsé-tsé inocule le trypanosome dans un bovin. appelée « trypanotolérance ». les dernières cellules qui survivent changent leurs manteaux protéiques antigéniques et se transforment en un second type de parasite. De cette manière. le trypanosome échappe à la défense immunitaire de son hôte par des mutations et recombinaisons successives. Il passe donc à la descendance comme un gène nucléaire normal. Au cours de l’embryogenèse l’ADN exogène se fraie son chemin jusqu’aux cellules germinales et se comporte désormais comme un gène endogène. Le trypanosome possède des antigènes de surfaces VSGs (glycoprotéines superficielles variables) dont les gènes mutent à chaque phase de son développement. C’est pour cette raison que les bovins n’arrivent pas à élaborer des anticorps contre ces types d’antigènes qui changent constamment de conformation tridimensionnelle par mutation génétique du protozoaire. Les bovins transgéniques La trypanosomiase est causée par un protozoaire parasite qui est transmis par un insecte vecteur « la glossine hématophage » ou encore « mouche tsé-tsé ». La souris qui sera mise bas portera les caractères du transgène mais pas les autres s urs. (Colonisation du milieu ou Evolution ?). L’organisme du bovin se prépare alors de nouveau pour combattre le nouveau parasite en secrétant de nouveaux anticorps. l’organisme de ce dernier réagit et synthétise les premiers anticorps pouvant réagir avec les antigènes présents sur la membrane du trypanosome (VSGs). On peut aussi transférer l’embryon possédant le transgène dans l’utérus d’une souris saine pseudo-gestante. il se transforme de nouveau en un second parasite. Cette zone qui est la plus fertile du continent est plus vaste que les Etats-Unis d’Amérique. Mais dès que le parasite s’aperçoit qu’il est en train d’être totalement exterminé. se rencontre dans les populations bovines d’espèce Bos taurus. Ce type de résistance. caractérisée par de longues cornes et une absence de bosse en est un exemple. 73 . localisée en Afrique occidentale. Ce type de bovin domestique et d’autres animaux sauvages comme le « buffle » qui ont vécu en Afrique depuis plus de 5 000 ans a. Le trypanosome empêche la majeure partie des races bovines d’habiter une superficie de près de dix millions de Km2 en Afrique. Beaucoup d’études récentes ont montré que certaines races bovines résistent bien à l’infection par le trypanosome. ont développé des résistances contre les attaques du trypanosome et sont par conséquent adaptés au milieu infesté par le parasite. La race N’Dama. 2.C.Les organismes transgéniques peuvent être produits par l’injection de vecteurs dans des ufs fécondés et réimplantés dans les femelles.

3 . 5 . est arrivée dans ce continent avec l’invasion arabe vers les années 660 p. Les moutons transgéniques. 2 . l’économie de plusieurs pays africains est actuellement fondée sur l’élevage de ces bovins qui ne sont plus trypano-tolérants. : Identifier le gène qui confère la résistance aux trypanosomes chez les bovins de la race D’Dama Cloner ce gène dans un vecteur Transférer le vecteur dans des cellules bovines de l’espèce Bos indicus pour leur conférer la trypano-tolérance.C.2: Production du plasminogène La démarche technologique utilisée et réussie est la suivante : 1 .Les descendances qui expriment le transgène sont identifiés par amplification PCR d’un segment d’ADN chromosomique en utilisant des amorces correspondants à des séquence interne du gène d’intérêt. Stratégie II : Importer des embryons de la race N’Dama trypano-tolérante Les implanter dans les utérus de femelles de la race Bos indicus sensible à l’infection Réaliser ensuite des croisements des descendances pour disséminer les gènes de tolérance.L’espèce bovine comme Bos indicus qui est actuellement très répandue en Afrique. 4 . Figure VIII. 4 – Le porc transgénique 74 .On a placé le gène dans un plasmide. Elle n’est pas « trypano-résistante » Cependant. on peut employer deux stratégies : Stratégie I. sous le contrôle du promoteur de la β-lactoglobuline.Les moutons transgéniques n’expriment ce gène que dans leurs tissus mammaires et sécrètent alors des quantités importantes de la protéine correspondante dans leur lait à partir duquel la protéine d’intérêt est purifiée. Le gène en question code pour l’activateur tissulaire du plasminogène qui sert à dissoudre les caillots sanguins chez l’être humain. 3. On peut manipuler les animaux domestiques non seulement pour améliorer leurs qualités intrinsèques mais aussi pour produire des protéines étrangères. Une protéine dont les propriétés thérapeutiques intéressent l’industrie pharmaceutique est produite dans le lait de moutons transgéniques.Les ovules injectés sont implantées dans des mères porteuses.Le vecteur d’expression est micro-injecté dans le pronoyau des ovules de mouton. qui n’est exprimée que dans les tissus mammaires. Pour leur conférer cette résistance.

Le problème majeur qui empêche la réalisation des xénogreffes d'organes aujourd'hui est l'existence du rejet hyper aigu qui survient entre les espèces animales phylogéniquement distantes. En effet.3 : LE PORC TRANSGéNIQUE. il serait tout à fait possible de réaliser des xénogreffes d'organes à partir de primates supérieurs (chimpanzés) mais cette possibilité semble peu réalisable car ces espèces animales sont protégées et représentent une source incontrôlable de transmission de virus à l'homme (Ebola. Figure VIII. 75 . SIV…) La protéine DAF (Decay Accelerating Factor) neutralise le complément des primates et favorise les greffes d’organes.Tandis que dans les greffes allogéniques on utilise surtout les médicaments immunosuppresseurs comme la cyclosporine pour lutter contre le phénomène de rejet.Pour pallier le manque d'organes: xénotransplantation avec le porc.

Pourquoi un ovule? Pour qu'il devienne éventuellement un embryon. on a fusionné in vitro la cellule du pis qui contient tous ses gènes et l'ovule vidée de tout matériel héréditaire. Dolly est née de cette technique.CHAPITRE IX: CLONAGE DES MAMMIFÈRES. Dolly (première brebis clonée en Angleterre). Le processus du clonage d'un organisme entier est simple: a . 1 : Clonage de Dolly 76 . . Comme les brebis.On prélève le noyau d'une cellule que l’on veut cloner et on le met dans l' uf privé du noyau c . On a prélevé également un ovule sur une autre brebis et on lui a enlevé le noyau qui contient le bagage génétique. Après s'être divisée un nombre suffisant de fois. Figure IX. À l'aide d'un choc électrique. I. PARTHÉNOGENÈSE.implantation dans l’utérus d’une porteuse d . Dans le cas de la brebis Dolly.L’organisme qui naît porte les caractères du noyau transféré donc de l’organisme cloné. Cependant certains caractères de l’ uf restent présents à cause du matériel génétique contenu dans les mitochondries.On prend une cellule uf et on la vide de son noyau. L'ovule ainsi " électrisé " se divise et le processus de vie s'enclenche. on a prélevé une cellule dans le pis d'une brebis de race Finn Set à face blanche. les hommes vont-ils eux aussi passer à la "photocopieuse La technique du clonage est relativement simple dans son principe.LE CLONAGE DES ORGANISMES ENTIERS: Un clone de mammifère est une copie génétique d'un organisme entier. identique en tous points à la brebis qui a fourni la cellule du pis. CELLULES SOUCHES EMBRYONNAIRES (EMBRYONIC STEM CELLS) ET THÉRAPIE GÉNIQUE. ou de ses gènes. l'embryon (stade blastula) est placée dans l'utérus d'une brebis porteuse. est un clone de sa mère. b . C'est la raison pour laquelle Dolly n'aura pour tout bagage génétique que celui que contenait la cellule du pis.

os. le New York Times titrait : « Des scientifiques isolent les cellules à l origine de la vie ». Il s’agit de l’ uf fécondé et des cellules de l’embryon des premiers jours de sa croissance (morula de 2 à 8 cellules). sang. Spécifions que c’est au stade de cellules souches totipotentes que l’on peut pratiquer le clonage reproductif par scission embryonnaire. Avant le septième jour. Il est déjà composé de trois parties : le trophoblaste constitué de blastomères périphériques (grosses cellules résultant des premières divisions de l’ uf fécondé). cheveux. D'où leur mystère. nerfs (). et le blastocèle qui est une grande cavité remplie de liquide à l’intérieur de l’embryon. Chacune de ces cellules ES a la potentialité de devenir n'importe quel tissu du corps humain: c ur. Les cellules souches sont à l’origine de la régénération des membres chez certains animaux (lézards.). Nous distinguons quatre catégories de cellules souches en fonction de la diversité des types cellulaires auxquels elles peuvent donner naissance : 1 . Le trophoblaste et la masse cellulaire interne donneront respectivement : le placenta et l’ensemble de l’embryon. Ce sera une technique de photocopie magique pour reproduire un individu à volonté et en plus. La division d’une cellule souche produit deux nouvelles cellules : une cellule souche de « réserve » et une cellule s’engageant dans un processus de différenciation qui la conduira à remplir une fonction précise.II. muscles. la masse cellulaire interne (MCI) constituée d’autres blastomères plus centraux. Ainsi à partir d’une seule cellule peut être créée une plante entière. Le 6 novembre 1998. deux équipes de recherches différentes découvraient presque simultanément avec des méthodes distinctes les cellules souches embryonnaires. ce système offrira un fond inestimable de pièces de rechange d’organes humains ! A – Qu’est-ce qu’une cellule souche ? Une cellule souche est une cellule indifférenciée qui reste capable de se diviser de façon autonome tout au long de la vie. elles peuvent conduire au développement d’un être humain. LES CELLULES ES (EMBRIONIC STEM CELLS) OU CELLULES EMBRYONNAIRES PLURIPOTENTES). leur importance biomédicale et la fascination des biologistes. etc. En effet. Elles sont à l’origine de tous les tissus et en assurent le renouvellement (remplacement des cellules disparaissant par vieillissement ou par lésion). Quant au blastocèle. L’une travaillait sur des blastocystes des embryons précoces de moins de sept jours () et l’autre équipe sur des cellules germinales primitives ovogonies et spermatogonies (). elles favorisent le processus du bouturage.Les cellules souches totipotentes : A elles seules. cet embryon qui est un blastocyste a au plus 8 blastomères. Tous les êtres vivants pluricellulaires possèdent des cellules souches. Chez les plantes. tritons. en fin 1998. 77 . « Embryonic Stem » (ES). assurant le renouvellement des cellules d’un individu. il est appelé à régresser lors de l’embryogenèse par l’agrandissement de la cavité amniotique de l’embryon.

Dans certains organes. ces cellules pluripotentes ne peuvent pas évoluer pour former une personnes mais de multiples questions se posent : comment peut-on les obtenir tout en respectant les règles d’éthique ? Peut-on les utiliser dans les recherches du clonage thérapeutique ? 3 . la segmentation (clivage). B – Recherche sur les cellules souches et l’embryon ? 1 – Les processus génétiques de l’embryogenèse de la fécondation au clivage. de la mise en place du plan de 78 . la gastrulation et l’organogenèse. la faculté de produire le trophoblaste. essentiellement définies suivant des critères morphologiques : la fécondation. bien que pouvant donner toutes les cellules de l’organisme. testicule…). tels que le c ur et le pancréas. Cependant. Par exemple. On entend par gène de développement ceux qui interviennent précocement au cours du développement embryonnaire et sont responsables de l’établissement des polarités (antéro-postérieure. La moelle osseuse et le sang du cordon ombilical sont particulièrement riches en cellules souches adultes.Les cellules souches unipotentes : elles ne donnent qu’un seul type de cellules différenciées (peau. les chercheurs n’ont pas encore découvert de cellules souches . y compris du cerveau et de la moelle épinière. les globules blancs et les plaquettes. sont incapables. les cellules souches présentes dans la moelle osseuse produisent les globules rouges. Les cellules souches issues de la moelle ou du cordon peuvent être utilisées pour une thérapie cellulaire bénéficiant à l’individu ou à ses frères et s urs.Les cellules souches multipotentes : Elles sont des cellules souches capables de donner naissance à un ou plusieurs groupes de cellules ayant une fonction particulière.2 . Le placenta a pour fonction de nourrir l’embryon et de le protéger de tout rejet par le système immunitaire. Nous avons choisi délibérément la section fécondation-clivage pour étudier sommairement les régulations génétiques car c’est à ce stade que nous avons les différentes manipulations des cellules souches embryonnaires. précurseur du placenta. Les cellules souches du sang de cordon ombilical peuvent être prélevées à la naissance et conservées pour un usage ultérieur (un tel service est proposé par certaines fondations aux Etats-Unis). par conséquent ils pensent que ces organes n’ont aucune possibilité de régénération en cas de lésion. dorso-ventrale) de l’embryon. elles sont rares et par conséquent très difficiles à identifier (une cellule souche pour dix ou quinze mille autres cellules dans la moelle osseuse. Certes. à ce stade. de donner un embryon puis un f tus. si on les réimplante dans un utérus. Elles sont appelées aussi cellules souches adultes ou cellules souches somatiques.Les cellules souches pluripotentes : Précisons tout de suite quelque chose d’absolument essentiel qui doit être en permanence dans l’esprit : les cellules souches pluripotentes qui constituent la masse interne sont destinées à former tous les tissus de l’organisme mais ne peuvent à elles seules aboutir à la formation d’un individu complet car elles ont perdu. foie. Elles jouent un rôle essentiel en assurant le renouvellement des cellules. Les cellules de la masse cellulaire interne. Les cellules souches adultes peuvent être extraites de la plupart des tissus. muqueuse intestinale. Le développement embryonnaire des métazoaires est classiquement subdivisé en quatre phases. 4 .

Cela est parfaitement vérifié chez des espèces inférieures (batraciens). régulée par les oncogènes et les facteurs de croissance. est loin d'être résolu (eu égard à la durée de vie des messagers de la première hypothèse n'est plausible que chez des espèces où les premiers clivages se font dans un espace de temps excessivement court . A l’échelle de la cellule. Elle concerne un nombre relativement restreint de gènes. Chez les mammifères il existe le phénomène de imprinting : les génomes paternel et maternel apportés par les gamètes ne sont pas transcrits de façon équivalente par le zygote. leur séquence spatio-temporelle d’expression est largement hiérarchisée et interdépendante. au contraire. L’analyse d’anomalies de ségrégation chromosomique ou d’expériences de transplantation de pronucléus montre que cette inactivation est nécessaire à un développement embryonnaire normal. encore plus chez l'homme. La multiplication cellulaire. et celle qui serait apportée par une transcription persistant selon un patron transcriptionnel conservant le profil d'expression maternel. migrations. Le contrôle de l’initiation et du taux de traduction des ARNm maternels « dormants » dans l’ovocyte est le principal niveau de régulation d’expression génique aux stades de développement précédant la transcription zygotique. c’est-à-dire ne dépendre que de l’information contenue dans la cellule considérée ou être non autonomes. Le développement embryonnaire étant un processus continu et progressif. c’est-àdire permis par des interactions avec les cellules voisines. mais très probablement seulement au stade 8 cellules chez l'homme. contrairement à d'autres classes de vertébrés : chaque blastomère peut donc être considéré comme équivalent aux autres. La distinction entre une information seulement apportée par des ARNm provenant de l'ovule. les migrations cellulaires et l’engagement d’une cellule dans une voie de différentiation constituent en effet des choix de développement non indépendants. L'étude des gènes maternels dans le développement embryonnaire précoce est cependant rendue difficile par la très faible quantité de matériel génétique disponible.base du corps et de la spécification des cellules et des territoires devant donner les différents organes. il existe différents niveaux de contrôle du développement : prolifération cellulaire. des facteurs issus de la transcription de ce chromosome. Ce mécanisme permet de contrôler la production de facteurs impliqués 79 . c'est le cas des oeufs de batraciens. Néanmoins. La méthylation différentielle semble être le processus permettant l’inactivation transcriptionnelle d’un des chromosomes X chez le mammifère femelle et rétablissant une dose identique à celle du mâle. Nos connaissances sont donc encore rudimentaires chez les mammifères.Des gènes maternels contrôlent les premières divisions de l' uf Les premières divisions de l’ uf fécondé s'effectuent sans que les premiers gènes zygotiques ne soient exprimés. En effet. engagement dans une voie de différenciation. on sait que la durée de vie des ARNm est beaucoup plus longue dans l’ uf fécondé). . et pourrait être due à une méthylation différentielle des copies paternelle et maternelle de ces gènes. les différents gènes impliqués ne peuvent être considérés isolément . impliqués généralement très précocement au cours du développement. Ils peuvent par ailleurs être autonomes-cellulaires. La mise en route du génome embryonnaire s'effectue cependant à un stade précoce. l’origine paternelle ou maternelle de certains gènes entraîne leur inactivation. notons qu'il n'y a pas de régionalisation de l'information dans le cytoplasme du zygote des mammifères jusqu'au stade 8 cellules.

une cellule diploïde est insérée dans la zone pellucide. d’autres gènes s’activeront et par conséquent de nouvelles protéines seront synthétisées afin d’assurer différents contrôles génétiques. un contrôle génétique de l’établissement du plan de base de l’organisme et une acquisition d’une identité positionnelle au sein des différents tissus ou champs d’organisation. 2 – Recherche sur l’embryon et manipulation des cellules souches : La possibilité de cultiver et de manipuler l'embryon préimplantatoire de mammifère requiert une haute technologie et par conséquent un laboratoire de recherche bien spécialisé. aboutissant à la mise en place de jonctions inter-cellulaires : c'est l'initiation de la compaction et des phénomènes de polarisation. on parle de zygote ou d'embryon reconstitué. A ce stade. à partir d’elles. Ainsi aurons-nous un contrôle génétique de la mise en place des polarités embryonnaires. Elle est concomitante de l'expression sur la membrane plasmique de Cadhérines E. Des données récentes attribuent à l'ARN maternel oct-3 un rôle dans la première division de l’ uf et au PDGF-alpha (platelet-derived growth factor) codé par un ARN maternel un effet autocrine activateur de la division cellulaire. ou encore d'équivalent d’une cellule. L'embryon reconstitué entame son clivage et.dans l’établissement des polarités et dans la régulation du cycle cellulaire. De plus. Le début de l'expression génique embryonnaire n'est donc effective qu'après le stade 8 blastomères. Un choc électrique est appliqué. La technique de transfert nucléaire. futur Placenta). Ces résultats montrent qu'au moins certains types de cellules conservent intact leur potentiel nucléaire de différenciation malgré leur état de cellule différenciée.Le clonage par transfert de noyau Transfert du noyau d une cellule d un sujet donné dans un oocyte humain énucléé. Ultérieurement s'exprimeront dans la morula des cadhérines E (épithéliales) et P (dans le trophoblaste. le noyau transféré prend le contrôle du développement. L'affinement de la technique a permis à une équipe écossaise de produire des agneaux en utilisant le noyau de cellules f tales (fibroblastes) et même de cellules mammaires d'une brebis adulte. inversement proportionnel à l'état de différenciation de la cellule diploïde donneuse de noyau. les cellules différenciées souhaitées. Au stade blastocyste. l’analyse des télomères des clones obtenus semble montrer que l’ADN des cellules diploïdes donneuses de 80 . ce qui contribuera largement à la ségrégation cellulaire entre embryoblaste et trophoblaste. Le noyau de la cellule diploïde se retrouve ainsi au sein du cytoplasme ovocytaire. à côté de l'ovocyte énucléé. à l'heure actuelle. De la gastrulation à l’organogenèse. De nombreuses méthodes sont utilisées en recherche fondamentale pour étudier l’embryogenèse : a – le clonage . Il engendre à la fois la fusion des deux membranes plasmiques et l'activation de l'ovocyte. Ensuite. au stade 8-16 cellules chez le bovin. dérivée d'expériences menées chez les batraciens dans les années 60 consiste d'abord à retirer la métaphase II et le premier globule polaire d'un ovocyte II maturé. l'embryon est transféré en mère porteuse. Notons cependant que le taux de succès est. suivi d’un développement embryonnaire jusqu’au stade de blastocyste et de l’utilisation des cellules de la masse cellulaire interne (ICM). en vue d’obtenir les ES et.

une cellule totipotente à la fois sur le plan cellulaire et sur le plan nucléaire. est fondée sur une observation faite chez l'embryon de souris par Mulnard. il obtint un maximum de 5 agneaux de phénotype A. Les derniers blastomères du stade 4 cellules qui se divisent donnent le trophectoderme. Transfert du noyau d une cellule d un sujet donné vers un oocyte d un autre animal. Un blastomère de stade 8 cellules. Cette technique est très délicate et ne fut jamais adoptée pour produire des clones en série.Le clonage par séparation des blastomères Cette technique fut mise au point pour l'étude de la totipotence de différenciation des blastomères. Un éventuel succès devrait conduire . La conséquence serait un vieillissement prématuré de ces clones. Un seul agneau fut obtenu à partir d'un blastomère de stade 8 cellules. il semble qu'une horloge biologique compte le nombre de mitoses pour déclencher le processus de blastulation au stade de ± 64 cellules (6-7ème mitose). De toute façon. 81 . par définition.Le clonage chimérique par association Cette autre technique. En reconstituant 8 embryons chimériques en associant par paire les cellules d'un embryon 8 cellules de souche A et de deux embryons 4 cellules de souche B. En associant un blastomère isolé d'un stade 8 cellules d'une souche A avec un blastomère isolé d'un stade 4 cellules d'une souche B. c. ils constituent un clone. Ce dernier a décrit que les premiers blastomères d'un stade 4 cellules qui subissent leur 3ème mitose fournissent par la suite la masse cellulaire interne du futur blastocyste. Cette technique lui permit également de produire les premiers clones de mouton en obtenant des paires et des triplés d'agneaux à partir des blastomères d'un même embryon de stade 2 ou 4 cellules. les blastomères perdent leur totipotence cellulaire en passant au stade 8 cellules (3ème mitose). lorsqu'il aura donné naissance à un embryon composé de 8-16 cellules. obtenant ainsi les “cybrides”: une telle possibilité est encore à l’étude. . isolé. Reprogrammation du noyau d une cellule d un sujet donné en le fusionnant avec le cytoplasme des ES. développée également par Willadsen. Le zygote est. Qu'en est-il des deux premiers blastomères? A quel stade du développement chaque cellule de l'embryon devient-elle incapable de se développer en un f tus normal? Willadsen a réalisé une série d'expériences à l'issue desquelles il montra que chez le mouton. En fait.noyau n’est pas “ rajeuni ” par le transfert nucléaire.comme on le suppose .au développement d’un embryon humain. même cette voie semblerait exiger une préparation préalable des ES d’embryons humains. Ce nombre est trop restreint pour former un blastocyste capable de s'implanter et sa masse cellulaire interne est trop réduite pour qu'il poursuive un développement embryonnaire harmonieux. poursuit son développement et déclenchera ce processus de cavitation après 3-4 mitoses. Ceci signifie qu‘un clone serait constitué de cellules dont l’âge correspond à celui de l’organisme d’origine. Comme tous les agneaux d'un groupe proviennent d'un blastomère d'un même stade 8 cellules. à d. Willadsen a effectivement montré que l'agneau obtenu après transfert en mère porteuse était constitué de cellules descendantes du blastomère de stade 8 cellules. qu’on pourrait utiliser comme dans le cas précédent. .

cause de la fibrose cystique.Cette technique est également très délicate et n'a jamais été utilisée pour la production de clones en série. débute au stade 4-8 cellules. Quatre pour cent (4%) de cette population portent le gène muté de la mucoviscidose (FC). = engendrer): Une ovule non féconder d’une lapine peut être stimulée et emprunter la voie de l’embryogenèse pour obtenir une lapine.On stimule l'ovule. ¢ La mucoviscidose. bien avant la cavitation. ¢ Dans le monde actuel on estime à cent millions (100 000 000).LA THÉRAPIE GÉNIQUE: De nos jours. 82 . Elle a cependant permis de préciser que le premier processus de différenciation cellulaire. Chaque année.LA PARTHÉNOGENÈSE: Du grec θ = vierge . le tiers des hospitalisations en pédiatrie sont liées aux désordres génétiques.On prend une ovule non fécondée d'une lapine. ¢ En Afrique et en Amérique. c . la population mondiale paie un lourd tribut à cause de ces maladies génétiques cause de mortalité infantile ou de déficience caractérisée. environ 30% de la population présentent une mutation de la chaine ß de l’hémoglobine (ßS ou ßC). La technique est simple: a . La thérapie génique germinale. l'apparition du trophectoderme. les personnes qui sont atteintes de la mutation du gène qui code pour la glucose-6-phosphate déshydrogénase qui conduit au favisme ¢ Environ deux cent cinquante millions (250 000 000) de personnes souffrent de plusieurs types d’anémies liées aux mutations génétiques ¢ Dans les pays développés. IV . Près de 5% des enfants sont atteints de la drépanocytose sous ces diverses formes pathologiques (Hb SS ou Hb SC). la drépanocytose tue à elle seule près de cent mille enfants noirs par an sans compter les pathologies génétiques multi-factorielles et cystogéniques ¢ Au Burkina Faso. Le produit sera une lapine identique à sa mère lapine. b .L'ovule stimulée commence à se développer et est réimplanté dans l’utérus de la lapine. III . plus de trois mille types de maladies héréditaires ont été identifiées. 1. touche environ un enfant sur 2 500 dans la population caucasienne.

La plupart des fragments d’ADN s’intègrent de façon ectopique dans tout le génome. Grâce à une recombinaison homologue. 10 à 30% des ufs manipulés donnent des souris vivantes. ce qui constitue un sérieux handicap pour la thérapie humaine. Le transgène peut donc être transmis à la descendance par des croisements entres les souris transgéniques de la descendance portant le transgène dans leurs gonades. aucune thérapie génique germinale n’a encore été entreprise chez l’homme. Plusieurs procédés sont utilisés à cette fin a : La micro-injection d’un gène d’intérêt dans le pronoyau Figure IX. ¢ Les cellules qui portent le gène sauvage vont se retrouver dans les différents tissus de l’organisme. b : La micro-injection du gène dans les cellules embryonnaires Le processus est le suivant : ¢ On prélève au stade blastocyste des cellules embryonnaires porteuses d’un génotype muté ¢ On insère dans ces cellules le gène sauvage en culture ¢ Les cellules transgéniques sont de nouveau ré-implantées dans l’embryon qui se trouve dans le blastocyste.L’objectif de la thérapie génique germinale consiste à introduire des cellules transgéniques dans la lignée germinale et donc dans l’individu entier. y compris dans les cellules germinales qui vont constituer les gonades. Le problème à résoudre est que l’ADN injecté s’intègre au hasard. de nombreux essais géniques se font chez les animaux dans le but de les transposer un jour chez l’homme. 40% de ces souris ont reçu le gène d’intérêt injecté. mais aussi de lui faire produire des gamètes porteurs du génotype corrigé qui seront transmis à la descendance.2: micro-injection d’un gène d’intérêt dans le pro-noyau ¢ La première étape consiste en une fécondation d’un ovule de souris ¢ On injecte alors l’ADN étranger dans le pro-nucléi mâle de l’ovocyte fécondé ¢ L’ovocyte est alors implanté dans une mère porteuse ¢ La descendance transgénique est identifiée par la PCR et l’électrophorèse De nos jours. La correction doit se faire dans une cellule germinale ou de l’embryon précoce ou les cellules sont totipotentes La première expérience de thérapie génique ciblée et réussie concerne la correction d'une délétion du gène HPRT (Hypoxanthine PhosphoRibosylTransférase. Dans le cas des souris. parfois de manière ectopique dans les chromosomes. Cela doit permettre non seulement de corriger l’individu traité. De nos jours. Le gène HPRT code pour l'enzyme HPRT qui intervient dans le métabolisme des nucléotides. un produit d'un gène du chromosome X) dans des cellules embryonnaires pluripotentes de souris. une restauration de l'intégrité du gène anormal a pu être obtenue. non 83 . inaugurée pour créer des modèles animaux est prometteuse. Ce succès démontre que la voie du ciblage génétique.

Figure IX. Il faudrait mettre au point un système de ciblage grâce auquel le transgène de type sauvage se substitue au gène défectueux par une recombinaison en faisant intervenir un double crossing-over. qu’on cultive ¢ On y introduit des exemplaires du gène sauvage cloné dans un vecteur désarmé ¢ On réimplante ces cellules transformées dans le corps du patient ou elles pourront remplir la fonction attendue. ¢ Les figures qui suivent illustrent quelques exemples de thérapie somatique dans différents mammifères 84 .seulement à cause des possibles interruptions des gènes. Les premiers vecteurs utilisés ont été des rétrovirus désarmés que l’on a rendu amphotropes pour permettre leur utilisation dans différentes espèces et défectifs pour contrôler leur dissémination.4 : Thérapie génique somatique : Utilisation de rétrovirus pour un transfert de gène Le procédé simple est le suivant : ¢ On prélève quelques cellules somatiques du patient. Un certain pourcentage de cellules « guéries » peuvent atténuer la maladie en codant pour la protéine normale.3 :La micro-injection du gène dans les cellules embryonnaires 2. Les problèmes liés à la l’insertion des rétrovirus sont énormes : Les figures qui suivent illustrent quelques exemples de thérapie somatique dans différents mammifères ¢ Ils peuvent provoquer des inversions. La génothérapie somatique La thérapie génique somatique s’attaque uniquement aux cellules du soma et tente d’éliminer le phénotype pathologique. Il est alors possible de rendre transgénique le corps entier d’un individu. Figure IX. La génothérapie somatique consiste en une utilisation des rétrovirus désarmés (délétions des gènes gag. des délétions. se recombiner avec ce dernier et devenir pathogènes ¢ Il se pose également le problème de l’immunogénicité de l’organisme (non reconnaissance du soi). ¢ Ils peuvent aussi rencontrer un autre virus dans l’individu traité. pol et env) pour l’insertion du gène exogène dans un organisme. mais aussi parce que l’allèle muté sera toujours présent dans le génome et pourra ségréguer du transgène dans les générations futures. des mutations chez l’individu traité.

3. Ces essais préliminaires ouvrent la voie à une ère de thérapeutique nouvelle. La maîtrise de la méthodologie de transfert des gènes. On peut aussi fabriquer des leurres pour le virus comme la protéine CD4 soluble comportant un signal de rétention intracellulaire pour piéger la protéine gp120 du virus ou même un leurre du RNA viral comportant une pseudo séquence TAR. permettent d'envisager leur utilisation dans la lutte contre les maladies acquises. Il s’agit dans ce cas d’une bombe à retardement que le virus active lui même (Une protéine régulatrice TAT). ricine) dont le gène est placé dans une construction qui en assure l’expression conditionnelle. (un analogue pyrimidique cytotoxique) administré comme médicament. Dans la thérapie anti-virale. dans la thérapie des cancers les premières expériences effectuées avec les TIL montrent que l'on peut armer des cellules avec des facteurs cytotoxiques (TNF = Tumor Necrosis Factor) ou les doper avec des cytokines. 85 . voire générale (endocrine) de facteurs protéiques (ou nucléiques) ayant un intérêt thérapeutique". Dans le cas du VIH. alliée à une compréhension de plus en plus poussée du fonctionnement des gènes. cet démarche consiste à munir les cellules T de constructions contenant des gènes mutants transdominants codant pour des protéines virales structurales ou régulatrices anormales ou modifiées. ce qui entraîne l'expression du gène TK. permettant de s’attaquer à des maladies incurables ou héréditaires et aux maladies virales comme le SIDA. "consiste à combattre le virus HIV en lui apportant le gène de la thymidine kinase (TK) sous contrôle du LTR du HIV. Vers la génothérapie avec de l'ADN médicament. régionale (paracrine). l'idée est de fournir à la cellule les moyens de se défendre spécifiquement contre le virus par une stratégie adaptée à la biologie du virus considéré. rendant les cellules sensibles au gancyclovir. Une autre variante de cette toxigénétique conditionnelle. Une autre approche consiste à éliminer le virus de la cellule infestée par une toxine protéique (toxine diphtérique. En effet. Les cancers et les maladies virales sont candidats à ce type de thérapie. seules les cellules infectées produisent les signaux transactivateurs du LTR. "Le principe consiste à munir certaines cellules d'une construction génique permettant la production locale (autocrine). Il s’agit de mettre à profit la masse de connaissances accumulées sur sa biologie. cette construction étant elle-même incluse dans un adénovirus recombinant qui en assure la transduction" Dans ce cas.

est un rétrovirus de 0.1 m de diamètre. En Afrique subsaharienne on peut trouver chez le même individu une coinfection : le VIH-1 et le VIH-2 ensemble. Il a été isolé pour la première fois à l’Institut Pasteur de Paris en 1983. pol (polymérase) code pour des enzymes nécessaires à sa réplication : notamment p68 (reverse transcriptase) et p34 (intégrase). p 41 et une double couche de phospholipides. La capside.1 : Structure du VIH L'étude de la structure génétique du VIH permet de comprendre la complexité de ce virus. 86 . La matrice est constituée glycoprotéines p 17. Le VIH-1 est répandu dans le monde entier tandis que le VIH-2 est essentiellement localisé en Afrique. Le VIH possède 3 gènes rétro-viraux codant pour différentes protéines virales : gag (groupe antigène) code pour des protéines internes ("core") : p50 et p40 qui se cliveront en p13. formée par des glycoprotéines p 24 contient : deux filaments d’ARN de 9200 bp environ enveloppés par la nucléocapside (protéine p 7). Le VIH. certaines de ses manifestations cliniques et biologiques. la transcriptase inverse.2 : Origine du VIH Structure du VIH : De l’extérieur vers l’intérieur du virus. Figure X.CHAPITRE X : LES TECHNIQUES DE LA BIOLOGIE MOLÉCULAIRE APPLIQUÉES DANS LA RECHERCHE THERAPEUTIQUE DU VIH/SIDA I – STRUCTURE DU VIH Figure X. l’intégrase. du sous-groupe des Lentiviridae. Virus de l’Immunodéficience Humaine. la protéase et la ribonucléase. qui a un génome à ARN. et d'envisager des stratégies pour la recherche thérapeutique. nous avons : L’enveloppe du virion : les glycoprotéines p 120. p18 et p24.

Une autre propriété de l'enveloppe (gp41) est de pouvoir induire la fusion cellulaire (syncitium) qui est un des éléments cytopathogènes du VIH. pol et env.. env Le VIH possède d’autres gènes codant pour différentes protéines virales Contrairement aux autres rétrovirus. nef (rôle mal connu) et vpu. rev favorise l'augmentation des ARN messagers correspondant aux protéines de gag.3 :gène gag. 3. . comme vif. Cette complexité qui lui est caractéristique explique probablement son haut pouvoir pathogène. Antagonistes des co-récepteurs.Les IP sont des inhibiteurs de la protéase acide virale: De nouveaux inhibiteurs de la protéase sont en cours de développement à un stade avancé.Les inhibiteurs de l'entrée du virus : Il existe 3 types de médicaments qui sont en cours de développement à l'heure actuelle : Inhibiteurs de l'entrée du virus dans les lymphocytes CD4 . ces molécules se fixent sur des récepteurs nécessaires à la pénétration du virus dans les cellules . Figure X.4 Mécanisme d’infection II . 2. 87 . La gp 110 est une partie de l'enveloppe responsable de l'interaction avec la membrane de la cellule cible au niveau du récepteur CD4. pol. Inhibiteurs de la fusion du VIH : ils empêchent le virus de fusionner avec la cellule qu'il attaque. Il y a des gènes régulateurs : tat (favorise l'augmentation du niveau de la synthèse des protéines virales). Il y a aussi d'autres gènes. Les premiers essais ont montré des résultats intéressants en terme d'efficacité sur la charge virale ou sur des virus présentant des mutations. qui permet d'augmenter l'infectiosité. permettant la pénétration du virus.Les INTI et les INNTI sont des inhibiteurs de la transcriptase inverse Des essais cliniques ont été réalisés sur de nouveaux inhibiteurs de la transcriptase reverse : Inhibiteur Nucléosidique de la Transcriptase Inverse (INTI) et Inhibiteur Non Nucléosidiques de la Transcriptase Inverse (INNTI). Figure X.env (enveloppe) code pour des glycoprotéines (gp110 et gp41 issues de gp 160).LES NOUVELLES MOLÉCULES ANTIVIRALES EN DÉVELOPPEMENT: 1 . vpr (vpx pour VIH2). le VIH possède d'autres gènes intervenant dans sa réplication. La séquence LTR (Long Terminal Repeat) peut être considérée comme un promoteur fort et une région régulatrice pour la production de nouveau virus.

CTL.Vaccins sous-unitaires et vaccins synthétiques Les premiers vaccins sous-unitaires (immunisation par des protéines d'enveloppe recombinantes du virus) se sont révélés incapables d'induire des anticorps neutralisants actifs contre les souches de virus sauvages que l'on trouve chez les malades et qui sont différentes de celles. Videx (ddI). Cette induction nécessite que la préparation vaccinale se réplique à l'intérieur des cellules pour que l'antigène du VIH soit présenté au système immunitaire (réponse cellulaire). ABT-378/r (voir : Pétition Remaides). De nouvelles approches sont explorées. Un des problèmes posés par l'obtention vaccinale de réponses immunitaires contre le VIH est que ces réponses doivent être dirigées contre des souches de virus très variables. comme cela se pratique pour de nombreux vaccins et qui est évoquée et repoussée depuis longtemps pour le VIH. Ziagen (abacavir). Crixivan (indinavir). Près de trente essais ont été menés ou sont en cours chez l'homme. La majorité des résultats obtenus depuis deux ans soulignent l'intérêt de stratégies vaccinales utilisant des combinaisons d'antigènes de plus en plus complexes. Norvir (ritonavir). Hivid (ddC). Rescriptor (delavirdine). VERS L’ESPOIR D’OBTENIR UN JOUR UN VACCIN ANTI-VIH. L'utilisation de virus atténués. longtemps cultivées en laboratoire. qui détruisent les cellules infectées.Les deux objectifs d'un vaccin contre le VIH demeurent : L'induction d'anticorps capables de neutraliser le virus. Antiprotéases : Invirase ou Fortovase (saquinavir). en phase I et II (étude de la tolérance et des réactions immunitaires chez quelques dizaines de volontaires en phase I et plusieurs centaines en phase II). La recherche d'un vaccin contre le VIH a continué de progresser. 1 . Zérit (D4T). Combivir (AZT + 3TC). utili- 88 . L'induction de cellules T cytotoxiques. afin de stimuler les différentes composantes du système immunitaire. Epivir (3TC). Non-nucléosides : Viramune (névirapine). dirigés contre les protéines d'enveloppe (réponse humorale). Agénérase (amprénavir). même si elle n'a pas accompli de progrès spectaculaire au cours des dernières années écoulées. Viracept (nelfinavir). III. Nucléotide : Prévéon (adéfovir). fait actuellement grand bruit aux États-Unis où elle est proposée avec force par un groupe de médecins-chercheurs et bien autres types de vaccins.4 – classification de quelques molécules antivirales : Nucléosides : Rétrovir (AZT). 2 . Sustiva (efavirenz).

d'où le concept de «prime-boost»).1999). En parallèle. après l'injection d'un vaccin recombinant vivant (prime. Les premiers essais chez l'animal ont montré que ces vecteurs induisent des CTL et des anticorps neutralisants (Lemoine FM et al. Les vaccins recombinants utilisent la vaccine ou le canarypox (virus de la variole du canari) exprimant des protéines du VIH. 4 .Vaccins vivants recombinants produit par la biotechnologie C'est avec des vaccins vivants recombinants (un virus inoffensif auquel on a ajouté des gènes du VIH) que les essais chez l'homme sont le plus avancés.1999). Les préparations actuelles sont porteuses de gènes de plusieurs protéines d'enveloppe et de protéines internes. 3 . Certains vaccins sous-unitaires VIH induisent cependant une protection chez des chimpanzés et des macaques (Lemoine FM et al. Cette approche.sées pour les vaccins (Lemoine FM et al. L'absence de génome viral les empêche de se répliquer (Lemoine FM et al. Ces méthodes semblent capables d'induire des réponses immunitaires anti-VIH chez l'homme et antiSIV chez le singe.Pseudo-particules (virus-like particles) Ces vaccins sont constitués de différentes combinaisons de protéines virales sous forme de particules.1999). on étudie l'immunogénicité de peptides et antigènes incorporés dans des liposomes (vésicules d'acides gras qui ont la propriété de pénétrer dans les cellules) ou des ISCOMS (complexes immuno-stimulateurs). Ils sont utilisés chez l'homme en rappel (boost). Les premiers vaccins recombinants exprimaient seulement une protéine d'enveloppe. 6. mais sans qu'on sache aujourd'hui si cela procure une protection. suscite beaucoup d'intérêt depuis que plusieurs dizaines de médecins américains ont annoncé qu'ils se portaient volontaires pour un essai de vaccination par un VIH atténué (Lemoine FM et al. ADN nu L'administration d'un ADN purifié codant pour une ou plusieurs protéines du VIH et portant un signal pour la transcription dans la cellule présente deux avantages. 5 . toujours infectieux mais dont le pouvoir pathogène est diminué.1999).1999). 89 . généralement considérée comme trop dangereuse chez l'homme. la simplicité et la stabilité du vaccin. avec une préparation de Pasteur-Mérieux-Connaught. puisqu'un essai de phase II vient de commencer aux États-Unis chez 420 volontaires. cholestérol et calcium) comme vecteurs de protéines et d'ADN.Les virus vivants atténués Ce sont des virus VIH. ou SIV chez le singe. Une approche originale utilise des «cochléats» (phosphatidylsérine.

. l'immunisation intracellulaire confère une protection contre un virus à l'échelon cellulaire chez des sujets infectés. le génie génétique peut-il développer des stratégies de combat contre le VIH ? A travers Cinq voies de recherches : . par exemple. les recherches continuent également dans la direction de la thérapie génique. .La pharmacomodulation génétique. instrument du génie génétique. par exemple. Le principe est simple : il s'agit de modifier la structure génétique des cellules cibles du VIH (les lymphocytes CD4) afin que celles-ci soient 90 . quelques protocoles d'essais chez l'homme ont été approuvés et certains sont même en cours d'évaluation. . Elles sont désormais capables de résister au virus du SIDA et peuvent apporter au malade une immunité contre les infections. qui consiste à intervenir sur les gènes d'une cellule pour modifier certaines de ces fonctions ou capacités. LE GÉNIE GÉNÉTIQUE ET LA LUTTE CONTRE LE VIH. en produisant une toxine contre le virus du SIDA. L'utilisation de cellules déjà modifiées : On injecte au malade des cellules humaines. Ce virus va s'intégrer au niveau de l'ADN des cellules et insérer le transgène. dont certains seront prochainement disponibles.La sécrétion de protéines inhibitrices.Comment modifier les gènes d'une cellule ? Deux approches thérapeutiques sont aujourd'hui utilisées pour combattre le VIH : La modification directe des gènes des cellules du malade : On injecte au malade un virus porteur du gène que l'on veut modifier. Aujourd'hui.L'immunisation intracellulaire : Tandis que la vaccination protège les sujets non infectés de l'infection. Les cellules acquièrent ainsi les nouvelles propriétés conférées par ce gène.Au-delà de ces vaccins en perspectives et ces nouveaux médicaments. des cellules immunitaires comme les lymphocytes CD4.L'immunothérapie génétique. a .L'immunisation intracellulaire. 1 . concrètement.La destruction sélective des cellules infectées. Pour ce qui concerne le traitement de l'infection par le VIH. Ces cellules chimères agissent comme un médicament en luttant contre la maladie. .Mais comment. est très avancée dans la thérapie des cancers et de nombreuses pathologies génétiques. IV. les pistes de recherches sont déjà nombreuses. la thérapie génique. 2 . qui ont été génétiquement modifiées par la méthode décrite ci-dessus en laboratoire.

protégées du virus. les entourer d'une membrane inerte de collagène pour qu'elles soient "invisibles" par le système de défense immunitaire du patient. Les chercheurs peuvent aussi utiliser d’autres méthodes comme "cultiver" des cellules modifiées génétiquement.La sécrétion de protéines inhibitrices : Certaines protéines sécrétées naturellement par les lymphocytes ont des propriétés anti-VIH. produite lors de la réplication du VIH (Caruso M et al. Tous ces éléments générés par la biotechnologie peuvent tromper le VIH ou le bloquer ou alors rivaliser avec lui dans la recherche des substrats.La pharmacomodulation génétique : Les médicaments antiviraux actuels agissent pour la plupart à l'intérieur de la cellule infectée au niveau de laquelle ils pénètrent. C’est ainsi que l’action de la zidovudine est limitée du fait de ses effets toxiques et de l'apparition de souches mutantes résistantes. d . b . des fibroblastes de souris. Ce gène peut être implanté de manière ectopique dans les hépatocytes. via un virus modifié qui est capable d'implanter le transgène. Plusieurs techniques sont utilisées. d'avoir une efficacité 3 à 10 fois plus importante. Ces cellules enveloppées et protégées se mettent alors à produire les protéines anti-VIH (Moullier P. des « leurres ARN » qui miment l’ARN viral. car elle permettrait ainsi. des « molécules antisens » de séquences nucléotidiques. 1993). et dont on pourrait diminuer les doses pour le patient (Caruso M et al. L'opération consiste à introduire dans l'organisme un gène qui va produire une quantité élevée de ces protéines. En effet. cette dernière voie de recherche. de cellules immunocompétentes génétiquement modifiées (Lemoine FM et al. à des fins thérapeutiques. Un gène « suicide » est placé sous le contrôle transcriptionnel du promoteur LTR du VIH afin d'entraîner la destruction cellulaire au moment de la synthèse de la molécule tat. La cellules modifiée se met alors à produire des mutants « transdominants » de protéines virales. en plein essor. Elle peut également être appliquée pour diminuer les effets indésirables d'autres antiviraux qui sont mal tolérés. puis les transférer chez le patient atteint par le VIH. à dose d'antiviral identique. et al. Cette stratégie est difficile à mettre au point et n'apporte aucun avantage sélectif aux cellules transduites. L'intérêt de l'immunisation intracellulaire est qu'elle bloque bien la réplication du virus à l'intérieur de la cellule. car les lymphocytes sont détruits dès qu'ils sont infectés. consiste en l'intro- 91 . Le principe de la "pharmacomodulation génétique" est d'introduire un gène qui va accélérer l'activation de l'antiviral à l'intérieur de la cellule. e .La destruction sélective des cellules infectées : Une autre approche de la thérapie génique de l'infection par le VIH vise à détruire spécifiquement les cellules infectées à l'aide d'un gène codant pour une toxine. Cette méthode est très intéressante.L'immunothérapie génétique : L'immunothérapie génétique correspond à l'utilisation. 1994). 1999). Le mécanisme cellulaire qui permet de rendre ces médicaments actifs n'a pas toujours un rendement idéal puisqu’une partie du médicament est éliminé de la cellule avant d'avoir été rendu actif. 1992). c.

1999). du gènes spécifique on cherche à découvrir la protéine codée. l'organisme n'est pas capable de se défendre tout seul car le virus n'est pas reconnaissable suffisamment longtemps pour que des anticorps efficaces puissent être produits. soit aux lymphocytes T CD8+ via le CMH I (Lemoine FM et al. d'une sorte de "vaccination" avec des cellules génétiquement modifiées. A partir de la technique de l’immunogénétique reverse: trouver des peptides des allèles des classes HLA I et II capable de couvrir plus de 90% des haplotypes HLA de diverses populations ciblées.polymorphismes alléliques des populations ciblées. à partir de la configuration de la protéine. en s'attaquant à ces "morceaux". L'immunothérapie génétique permet de présenter aux lymphocytes des "morceaux du virus" facilement reconnaissables pour que. synthétisée. on remonte au gène qui a spécifiée cette séquence peptidique. . Lors de l'infection par le VIH.la génétique directe: du phénotype. Fondement: rechercher les gènes qui spécifient les protéines du système immunitaire. * Les défis d’élaboration des épitopes CTL du VIH spécifique par la technique de l’immunogénétique reverse: . Il s'agit là. Défis d’élaboration des épitopes CTL du VIH spécifique Nécessité d’informations sur: 92 . En effet. .duction dans l'organisme de cellules génétiquement modifiées. A partir de la technique de l’immunogénétique reverse: Acquérir une grande information sur les séquences des acides aminés des protéines du VIH de divers clades du VIH. 3 . les DC sont capables d'apprêter les protéines sous forme de peptides antigéniques et de les présenter soit aux lymphocytes T CD4+ par le complexe majeur d'histocompatibilité de classe II (CMH II).la génétique reverse: De l’ADN.variabilité génétique du VIH. Recherche sur un vaccin contre le VIH/SIDA Processus et défi de la conception et de la sélection des épitopes: Qu’est-ce qu’un épitope ? Comment pouvons-nous induire dans toutes les personnes une réponse immunitaire spécifique contre un grand nombres d’épitopes VIH peptides des Lymphocytes T Cytotoxiques (CTL) et des lymphocyte T helper ? Immunogénétique Reverse Nous avons : . * Sélection des peptides à travers la technique de l’immunogénétique Reverse. les lymphocytes détruisent les virus. bel et bien. des cellules dendritiques (DC) ou autres qui sont capables de "mimer" le virus du SIDA pour activer une réponse du système de défense immunitaire de l'organisme.

7 CHAPITRE XI : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE I . les aliments ou les médicaments. Concevoir les épitopes peptidiques par la technique de l’Immunogénétique Reverse. Tester les épitopes du VIH sélectionnés pour établir la capacité d’être identifié par un Lymphocyte T Cytotoxique (CTL) VIH-spécifique et pour recueillir la réponse du lymphocyte T helper. L’étude moléculaire permit de découvrir chez les personnes qui ne tolèrent pas la primaquine le déficit enzymatique de la G6PD (Glucose 6 phosphate déshydrogénase). médecin anglais appliquait pour la première fois les lois de Grégoire Mendel à la transmission des maladies héréditaires de l’homme. Connaissance des fréquences des allèles du système HLA de classe I et de classe II au sein des populations ciblées ( Burkina Faso). Successivement il théorisait la nature individuelle (due à la variabilité et à la spécificité chimique des processus métaboliques) de toutes les réponses de l’organisme au regard des éléments étrangers. après la prise de la primaquine. Au moment où les recherches fondamentales explicitaient les mécanismes biochimiques et genetico-moléculaires associés aux pathologies héréditaires. « sick cell » est une maladie due à une anomalie structurale de la molécule de l’hémoglobine. Figure VIII.Historique : En 1902 Archibald Garrod.GÉNÉRALITÉ : PHARMACOGÉNÉTIQUE ET PHARMACOGÉNOMIE A . un médicament antimalarique. Par la suite les chercheurs démontrèrent que cette anomalie structurelle protéique correspondait à une altération de l’information génétique codée dans l’ADN. Linus Pauling en 1949 démontrait que l’anémie falciforme. les agents pathologiques. C’est à ce moment qu’ils découvrirent aussi les premiers exemples d’hérédité de certaines réactions anormales aux médicaments. la drépanocytose. Il émit comme hypothèse selon laquelle les facteurs héréditaires (les gènes) contrôleraient certaines réactions métaboliques. L’étude fondamentale génétique de 93 . 2) La base génétique humaine de la distribution des allèles du système HLA de la population ciblée Nous trouvons des donnés sur la variabilité génétiques et la distribution des allèles du systèmes HLA des populations de l’Afrique de l’Ouest dans le dépôt du Gene Bank. Le premier exemple est la réaction d’anémie hémolytique inattendue des soldats américains d’origine africaine.1) La variabilité génétique du VIH. Utilisation des épitopes promiscuous du système HLA de la classe I et II pour la population ciblée.

La pharmacogénétique qui permet d’établir un lien entre le polymorphisme de la structure génique et la variabilité de la réponse à l’effet d’un médicament a comme objectifs : 1 . Elle étudie les mécanismes de fonctionnement utilisés par la cellule-cible ou la cellule de détoxication. Quelle modification de l'expression d'un ou de plusieurs gènes induit une molécule donnée? Autrement dit. vis-à-vis d'un médicament administré.Qu'est-ce que la pharmacogénétique ? La pharmacogénétique est définie comme l’étude des variations génétiquement contrôlées de la réponse à un médicament. les études de pharmacogénétique commencèrent à montrer que la variabilité individuelle dans le métabolisme des médicaments peut dépendre non seulement de variations d’un seul gène avec ses allèles mais aussi de l’interaction de plusieurs gènes mutés dans l’organisme. Il s'agit d'étudier simultanément les modulations. positives ou négatives.Élaborer des tests qui montrent que le patient qui doit prendre tel médicament possède les enzymes de transformation nécessaires. C’est ainsi qu’à partir des année 90. à l'avance. A partir des années 70. 5 . à côté de l'effet thérapeutique principal recherché.la susceptibilité individuelle à réagir de manière anormale avec des conséquences destructives après l’absorption de médicaments. pharmacogénétique. chez les personnes âgées.Rechercher les gènes qui codent pour les enzymes de transformation des médicaments. La pharmacogénétique a connu un grand développement en ces dernières années grâce à l’utilisation des techniques de biologie moléculaire comme l’analyse des polymorphismes de restriction (RFLP). induites par les composés pharmacologiques analysés. certaines enzymes peuvent avoir une activité réduite. La pharmacogénomie ou la pharmacogénomique est plus difficile à définir. en 1959. de l'expression des gènes. la façon dont chaque individu va transformer puis éliminer tel ou tel médicament. B .Identifier pour tous les nouveaux médicaments.Tester directement l'activité des enzymes de transformation des médicaments : des tests devraient se développer de plus en plus pour étudier. les chercheurs émirent le concept de pharmacogénomique pour expliquer la variabilité individuelle dans la réponse aux médicaments utilisant des techniques qui permettent d’évaluer l’expression et l’action de plusieurs gènes. les méthodes de transfection et le développement des chips. SSTR. pour le développement d'une molécule a priori sélectionnée pour devenir un médicament? 94 . 4 . l’amplification en chaîne par la polymérase (PCR). Certaines de ces enzymes ne sont pas encore "matures" chez des enfants . fut appelée. 2 . En effet. 3 . par contre. quelles autres modifications du génome ou du protéome (dans le cadre de ce qu'il est convenu d'appeler la protéomique) peut-on observer. et quelles conséquences directes ou indirectes faut-il en déduire. La pharmacogénétique représente donc aujourd'hui une composante importante dans le développement d'un nouveau médicament. la synthèse des enzymes de transformation des médicaments et leur activité évoluent en fonction de l'âge.Déterminer les doses de médicaments à utiliser chez les enfants ou les personnes âgées. les enzymes de transformation impliquées.

. Ainsi. * De même. . L'efficacité d'un traitement dépend donc directement de la présence et du fonctionnement de certaines enzymes. des tests sont disponibles pour vérifier la présence de cette enzyme et pour mesurer son activité avant de débuter un traitement. qui va alors s'accumuler dans le corps et créer des effets toxiques. pour traiter différentes maladies. de développer un cancer du poumon après activation des produits contenus dans la fumée de tabac par leur transformation enzymatique en produits cancérigènes. La conséquence de cette absence est que la personne ne pourra pas éliminer le médicament. * Une personne sur 300 ne possède par une enzyme nécessaire pour la dégradation du 5-fluoro-uracile. les personnes qui n'ont pas d'enzymes adéquates ne pourront pas utiliser un médicament donné et donc ne tireront pas le bénéfice thérapeutique attendu.Pharmacogénétique : Les liens entre les enzymes de transformation des médicaments et les cancers ? Les enzymes ont des conséquences multiples dépendant : * de leur fonction . un médicament utilisé pour le traitement du cancer du côlon. une personne sur 300 possède une enzyme de transformation de certains médicaments (l'AZT.C . Parfois. Les enzymes agissent d'une autre façon : certains créent des produits toxiques. Pour qu'un médicament soit efficace.Éliminer les toxiques. certaines enzymes de transformation modifient plusieurs médicaments et il peut alors se poser des problèmes de compétition. Ainsi. et d'autres enzymes qui ne dégradent pas trop rapidement cette substance active (pour que le médicament reste efficace plus longtemps). A l'inverse.Quelques exemples pratiques. le mercaptopurine et la thioguanine) trop performante : elle modifie trop rapidement ces médicaments qui ne pourront alors pas agir sur les 95 . Afin de mieux combiner les médicaments les uns avec les autres. Ce caractère leur permet d'être protégées contre l'action de ces toxiques. il faut plusieurs conditions : avoir des enzymes qui transforment le médicament en une substance active (parfois les médicaments sont directement actifs et n’ont pas besoin de cette étape d'activation). d’inhibition ou d’interaction médicamenteuse. certaines personnes éliminent plus rapidement ou plus efficacement certains produits toxiques.Rendre les médicaments efficaces. certaines personnes vont fabriquer plus de molécules toxiques que d'autres sujets suite à la prise d'un médicament donné. Il est important de connaître quels sont les médicaments qui interagissent les uns avec les autres pour éviter de les combiner. plus que d'autres. les personnes sous traitement peuvent prendre plusieurs médicaments en même temps. * des propriétés toxicologiques de la substance qu'ils créent. . D'ores et déjà. d'autres permettent d'éliminer ces agents toxiques. on sait que certains fumeurs risquent. Inversement. * de la vitesse à laquelle ils agissent . Ces personnes risquent alors de développer plus d'effets indésirables (effets secondaires). * des vertus pharmacologiques de la substance qu'ils détruisent .

appropriées. La G6PD tend à se manifester surtout dans les zones endémiques du paludisme. L’aire géographique est importante quand l’environnement exerce une pression sélective et favorise l’affirmation d’un profil génétique déterminant. Les effets de plusieurs produits comme l’isoniazide. que la biotransformation de certains médicaments. mais en âge juvénile ou adulte. 96 . avec les mutations génétiques et les facteurs variés comme le sexe. . comme la dicoumarole et la phénylbutazone. en tant que hémizygote. tandis que le gène muté qui code une enzyme pseudo-cholinestérase s’exprime plus chez les européens avec une fréquence de 2%. par exemple.de l’enzyme G6PD.Une altération transmise en mode récessif avec le chromosome X se manifeste chez les sujets de sexe masculin. des comportements qui lui sont propres. D – L’épidémiologie des réponses idiosyncrasiques L’idiosyncrasie idios (ιδιος) en grec = particulier . * On peut encore citer des enzymes de détoxication (appelées transférases) qui sont présentes en quantité variable d'une personne à l'autre. s’expriment d’une manière polygénique. l’aire géographique et le groupe ethnique. Les réponses idiosyncrasiques ont une corrélation. au sein de la population. du point de vue génétique. L’information plus certaine est l’étude des familles et des groupes de jumeaux. - E . Les différences génétiques entre les diverses ethnies sont responsables de la variation dans la réponse aux médicaments. cependant le cadre clinique symptomatique est parfois évident et suggestif. Les études familiales ont permis d’établir . comme dans le cas d’une apnée prolongée par suite de l’absorption d’un médicament. Par exemple. sunkrasis (συνκρασις)= mélange). Mais pour que cela soit accepté. qui l’amène à avoir des réactions. sont évalués en utilisant les jumeaux homozygotes. L’incidence de l’anémie hémolytique induite par les médicaments est mineure chez les caucasiens par rapport aux autres populations. L’âge joue dans la pathogenèse dans la mesure où certaines altérations génétiques peuvent se manifester non à la naissance. L’examen clinique est de par soi-même insuffisant. C’est la manière d’être particulière à chaque individu. l’âge.Les critères d’étude en pharmacogénétique En face d’une réponse pharmacologique atypique. La pathologie transmise par les chromosomes sexuels peuvent toucher un sexe plus que l’autre. il faudrait des recherches documentées. Elles agissent principalement en rendant solubles certaines substances chimiques pour qu'elles soient ensuite éliminées par le foie et/ou les reins. la phénylbutazone et l’halothane. dépend des enzymes qui. il faudrait suspecter une base génétique.cellules cibles. la présence du gène pour la variante A.

procaïnamide. sulfamiAnémie hémolytique des. l’halothane et la nortriptyline. la demie-vie plasmatique et la contribution de l’hérédité est le coefficient de l’Hérédité qui s’exprime par l’équation : h2 = (Vd-Vm) ----------Vd h = Coefficient d’hérédité . le coefficient d’hérédité varie entre 0. Vd = variance calculée à l’intérieur de jumeaux hétérozygotes et Vm est la variance calculé à l’intérieur des jumeaux homozygotes.Vit.Les études au niveau des jumeaux comparent les réactions à l’intérieur des groupes de jumeaux homozygotes et des jumeaux hétérozygotes. Les jumeaux homozygotes tendent à avoir un profil pharmacogénétique très similaires par rapport à un type de médicament . Apparaît la toxicité du méN-acetyltransferase clonazepam dicament Transferrine Fer hémochromatose Désordres pharmacogénétiques avec absence d’effet pharmacologique attendu (résistance à l’action des médicaments) Altération génétique Médicament Effet thérapeutique attendu Absence du facteur intrin.I : Désordres pharmacogénétiques Altération génétique Médicament Manifestation pathologique Désordres pharmacogénétiques avec apparition de phénomènes toxiques ou imprévisibles G6PD Antimalariques.98. B12 Absence sèque Activité antianémique Réduction des récepteurs Beta2 stimulants Absence beta2 adrénergique Activité antiasthmatique Altération des récepteurs Insuline Absence 97 . sulfonamides Méta-hémoglobinémie réductase Pseudo-cholinestérase Succinylcholine Apnée Polymorphisme de la Isoniazide. Au niveau des jumeaux. Dans le cas de la dicoumarole. tandis que les jumeaux hétérozygotes présentent des variations énormes comparables aux individus consanguins. la phénylbutazone.88 et 0. nitrofuranes NADH-méta-hémoglobine Nitrite. le paramètre qui détermine la pharmacocinétique d’un médicament déterminé. La valeur de h peut varier entre 0 (dans le cas où la contribution génétique est insuffisante ou nulle) à un (dans le cas où l’influence génétique est déterminante). Exemples de désordres pharmacogénétiques : Tableau IX.

Variations d'ordre pharmacocinétique 1 . il existe une répartition bimodale de la capacité d'acétylation définissant les acétylateurs rapides (demi-vie d'environ 2 h) et les acétylateurs lents (demi-vie d'environ 6 h) (figure 5).Au niveau de la métabolisation Le polymorphisme d'acétylation. tandis que d'autres présentent des accidents de surdosage. Dans une population. pathologie(s). ils peuvent être en rapport avec le malade lui-même (facteurs intrinsèques) : âge. Selon ce critère. Sa biotransformation est catalysée par une N-acétyl transférase à localisation hépatique préférentielle. De nombreux facteurs sont connus pour retentir sur la susceptibilité individuelle . enzymes. stress. La répartition varie selon les ethnies. voire élevées.de l’insuline Activité antidiabétique Réduction de la synthèse 6-mercaptopurine azathio. Enfin lors d'administrations concomitantes. Il existe également une perturbation congénitale de la résorption de l'acide folique accompagnée de modifications de son métabolisme qui conduisent à des réponses atypiques en cas d'administration de folates ou d'analogues tel le méthotrexate. L'exemple le plus connu concerne l'isoniazide (Rimifon®). facteurs environnementaux.LES DÉSORDRES PHARMACOGÉNÉTIQUES Les désordres pharmacogénétiques peuvent être classés selon la base des caractéristiques cliniques des réponses idiosyncrasiques et aux altérations génétiques qui sont à leur origine. certains malades ne répondant pas à des doses habituelles. compétence immunologique. A. état nutritionnel. les interactions médicamenteuses constituent un dernier volet. ou alors en un manque d’effet thérapeutique attendu. 2 . activité physique. consommation d'alcool ou de tabac. Ils ne sont par contre que 17% parmi les Égyptiens. La connaissance de ces facteurs de variation peut aider à corriger un schéma posologique pour l'adapter à chaque sujet afin d’éviter les phénomènes toxiques et imprévisibles. Environ 45% des Européens sont acétylateurs rapides contre 80-90% des Asiatiques et la quasi totalité des Esquimaux. sans compter de l'observance et des variations liées à l'observateur.Au niveau de la résorption Les patients atteints d'anémie pernicieuse juvénile souffrent d'une malabsorption de la vitamine B12 d'origine génétique. Les variations interindividuelles de la réponse aux médicaments sont d'observation fréquente.Absence du HGPRT prine Activité antitumorale Activité immunosupressive II . génotype. en représentent des exemples. ou dépendre de conditions extérieures (facteurs extrinsèques) : variations nycthémérales. La pharmacogénétique est la discipline qui décrit les réponses inusuelles aux médicaments (idiosyncrasie) sur la base de mécanismes héréditaires. Le caractère acétylateur lent se transmet selon 98 . de médicaments. statut hormonal. les réactions idiosyncrasiques peuvent consister dans l’apparition des effets toxiques ou imprévisibles.

et en particulier chez l'enfant.le mode autosomique récessif. in situ. 24 Leats (r/r) 20 16 12 8 4 99 0 . peut se faire à partir de l'administration d'une dose test et du dosage de l'isoniazide plasmatique 3 h après. Pour une posologie standard les risques d'apparition d'effets indésirables par surdosage. L'application de la formule ci-dessous permet de déterminer l'indice d'acétylation: Isoniazidémie à la 3è H + 0. sont plus élevés chez les acétylateurs lents . L'adaptation posologique chez le sujet à risque. en particulier neurologiques. mais en revanche chez les acétylateurs rapides la production plus importante.6 -------------------------------------Dose administrée (mg/kg/j) Rapides (R/R ou R/r) Fréq. d'un métabolite hépatotoxique majorerait le risque d'hépatite.

L'avantage du test à la caféine est qu'il peut être réalisé après la simple prise d'un café.01 et 10 chez les métaboliseurs rapides mais entre 20 et 200 pour les métaboliseurs lents. aminogluthétimide. Enfin. des tests basés sur l'acétylation d'autres molécules ont également été standardisés : procaïnamide et son métabolite acétylé le NAPA ou métabolites de la caféine entre autre. certains sulfamides. L'oxydation est impliquée dans la métabolisation d'un grand nombre de médicaments. un test dit à la débrisoquine s'est diffusé. sans ingestion de molécule médicamenteuse. C'est le cytochrome P450 II D6 qui est responsable de ce déficit qui concerne 5-10% de la population de race blanche mais varie selon les ethnies . dapsone. Après administration d'une dose test de 10 mg. une molécule antihypertensive. encore que d'autres facteurs de prédisposition (typage HLA-DR4 par exemple) soient connus. Les fortes variations de sa posologie nécessaire pour contrôler l'hypertension a conduit à la mise en évidence d'un déficit en débrisoquine 4-hydroxylase chez certains patients. Ce polymorphisme a primitivement été mis en évidence avec la débrisoquine. L'intérêt du phénotypage d'acétylation dépasse l'adaptation posologique de l'isoniazide puisqu'il permet également de prévoir le comportement vis-à-vis d'autres médicaments qui suivent cette voie de métabolisation (hydralazine. ainsi le cancer de la vessie provoqué par les amines est plus fréquent chez les acétylateurs lents exposés. Le lupus érythémateux induit par l'hydralazine ou la procaïnamide se rencontre préférentiellement chez les acétylateurs lents.0 2 4 6 8 10 12 Concentration plasmatique de l’isoniazide µg/ml Concentrations plasmatiques de l isoniazide mesurées 6 heures après administration d une dose moyenne de 9. Ils suivent la voie des mono-oxygénases hépatiques sous la dépendance d'isoenzymes des cytochromes P450. la molécule mère et son métabolite sont dosés dans les urines recueillies pendant 8 heures. On calcule alors un quotient métabolique qui est compris entre 0. Le polymorphisme d'oxydation. Pour dépister les métabolisateurs lents. nitrazépam. D'autres pathologies associées au polymorphisme d'acétylation sont également suspectées. par exemple). Une vingtaine de médicaments sont métabolisés par le cytochrome 100 .8 mg/kg à 267 membres de 53 familles (d après Evans) En dehors de l'isoniazide. procaïnamide. le phénotype d'acétylation détermine également le métabolisme des amines aromatiques cancérigènes . il se transmet sur le mode autosomique dominant. caféine.

alors qu'il n'a que peu d'effet sur les enzymes atypiques. à la caféine pour explorer cette même voie métabolique.et 0-méthylation. les antiarythmiques. Beaucoup plus rare que l'hypersensibilité. Les butyrylcholinestérases atypiques. Il existe un moyen. l'absence de métabolisation les rend inefficaces chez ces malades. Les enzymes de S. Mais il existe également d'autres polymorphismes d'oxydation indépendants de la voie suivie par la débrisoquine. Le niveau d'activité de la catéchol-O-méthyl transférase (COMT) est également contrôlé par le polymorphisme génétique.P450 II D6 . oxazépam. Chez ces personnes l'hydrolyse de la succinylcholine par les pseudo-cholinestérases plasmatiques et hépatiques se fait très lentement. Il est défini un Dibucaïne Number (DN) qui est de l'ordre de 80 (correspondant à 80% d'inhibition) chez les sujets sains. Où cette acti- 101 . la plupart des antidépresseurs tricycliques et les inhibiteurs de la recapture de la sérotonine. Il existe une corrélation entre l'activité de la thiopurine méthyltransférase érythrocytaire et la concentration en 6-thioguanine. Ces molécules étant en fait des prodrogues devant être transformées en nucléotides pour être actives. Ce test a servi dans de nombreuses études visant à rechercher une susceptibilité particulière à des médicaments ou des toxiques pouvant servir de support à l'apparition d'effets indésirables ou de certaines pathologies d'étiologie mal connues. En revanche. Les sujets hypersensibles sont homozygotes pour le gène anormal. salicylés. tests au dextrométhorphan. de ce fait sont résistantes à cette substance. menthol. Certains sujets (1 % de la population européenne) présentent une curarisation prolongée après administration de succinylcholine. mais seulement de 20 chez les sujets porteurs de l'anomalie. Les butyrylcholinestérases sont également impliquées dans l'inactivation d'autres médicaments et drogues sans que les conséquences cliniques d'un déficit soient très claires. la fréquence étant évaluée à 1/2 500. pour dépister les patients porteurs. hydrate de chloral. le test à la dibucaïne. L'hypoxanthine-guanine phosphoribosyl transférase (HGPRT). Des déficits des thiopurines méthyltransférases et thiol méthyltransférases. les analogues des bases puriques (6-mercaptopurine : Purinéthol®). L'uridine diphosphate glucuronosyl transférase. enzymes respectivement impliquées dans le métabolisme de la 6-mercaptopurine et de l'azathioprine et dans la S-méthylation du captopril (Lopril®) et de la D-pénicillamine (Trolovol®). du nom de la ville Américaine où furent caractérisés les premiers cas. les neuroleptiques. à la sparteïne. cette anomalie porte le nom de Cynthiana. corticostéroïdes par exemple). azathioprine : Imurel®) utilisés comme anticancéreux ou immunosuppresseurs ne sont pas métabolisés. l'affinité pour le substrat étant très diminuée par rapport à des sujets normaux. Cet anesthésique local inhibe in vitro les pseudocholinestérases normales. en particulier ce polymorphisme est observé pour les bêta-bloquants. il existe des sujets qui hydrolysent la succinylcholine plus rapidement que les personnes normales et qui. Chez les patients souffrant d'un déficit en hypoxanthine-guanine phosphoribosyl transférase (maladie de Lesch-Nyhan). Ce défaut du mécanisme de la glucuroconjugaison induit une hyperbilirubinémie mais provoque également une sensibilité particulière à des médicaments qui suivent cette voie de métabolisation (paracétamol. Différents autres tests se sont développés. ont été rapportés. morphines. La maladie de Gilbert (5 % de la population Française) comme la maladie de Crigler-Najjar sont liées à un déficit de l'uridine diphosphate glucuronosyl transférase.

La compétition entre l'alcool et les glycosides cardiaques pour l'ADH peut augmenter notablement leurs concentrations. La détoxification de l'acétaldéhyde est sous la dépendance de l'aldéhyde déshydrogénase (ALDH). une modification de la structure d'une protéine peuvent être responsables de l'apparition d'effets médicamenteux inconnus dans la population normale ou au contraire de l'absence de l'action habituellement observée. Les formes d'ADH à forte activité catalytique produisent de plus fortes concentrations sanguines d'acétaldéhyde à l'origine des symptômes d'intolérance à l'alcool. expliquant son effet antabuse. Des inhibiteurs de la COMT sont à l'étude dans le traitement de la maladie de Parkinson. Une faible incidence de ce déficit est retrouvée chez les alcooliques. y compris des carcinogènes. La glucose-6-phosphate-déshydrogénase (G6PD). Variations d'ordre pharmacodynamique 1 . Les glutathion-S-transférases (GST). Elle est également impliquée dans l'interconversion rétinol-rétinal. Quatre isoformes sont décrites chez l'homme. Au moins quatre isoenzymes sont décrites. Un polymorphisme génétique a été mis en évidence pour l'isoenzyme mitochondriale hépatique ALDH2. La G6PD représente la principale voie de production du NADPH du globule rouge. là encore. L'alcool déshydrogénase (ADH) représente la principale voie oxydative du métabolisme de l'éthanol . cofacteur indispensable au cycle du glutathion. des Indiens Sud Américains et des populations d'origine mongole présentent un déficit d'ALDH2 alors qu'il est totalement absent des populations de race blanche et noire. Ce métabolisme interroge l'activité du cytochrome P450 1A2 qui peut être exploré. elle catalyse la réaction réversible des alcools primaire et secondaire en aldéhyde et cétone. le métabolisme des stéroïdes et des acides biliaires mais aussi des composés digitaliques. Les différences entre les formes polymorphiques de l'ADH peuvent contribuer à expliquer les variations interindividuelles de vitesse d'élimination de l'alcool. Plusieurs enzymes de cette famille sont inhibées par le disulfiram (Espéral®) ou ses métabolites. Alcool et aldéhyde déshydrogénases. Les GST représentent une famille d'enzymes catalysant la conjugaison entre le glutathion réduit et une variété de molécules électrophiles. Il existe une corrélation positive entre déficit en ALDH2. par un test à la caféine. En ab- 102 . B. des Japonais. Un déficit en GST µ semble lié à une fréquence accrue de cancers. Trois grandes classes d'ADH sont connues ainsi qu'une forme atypique retrouvée chez seulement 5 à 10 % des Anglais mais 85 % des Chinois et des Japonais. l'expression des GST µ et θ étant soumises à un polymorphisme génétique. Elles sont fortement exprimées chez l'homme dans les hépatocytes. Mais un lien entre alcoolisme et génotype des isoenzymes d'ADH n'a pu être mis en évidence. La sensibilité à l’hépatotoxicité de la tacrine (Cognex®) des patients souffrant de la maladie d'Alzheimer pourrait être liée à l'absence d'expression de GST empêchant la détoxification de métabolites réactifs.Au niveau d'une protéine Un déficit ou une hyper-production enzymatique. 50% des Chinois.vité est impliquée dans le métabolisme de la l-dopa et de l'α-méthyldopa. Le déficit du G6PD est une maladie génétique héréditaire liée au sexe car le gène qui code cette enzyme se trouve sur le chromosome X. taux sanguin d'acétaldéhyde et hypersensibilité à l'alcool.

Tableau IX.et G6PDA+) affectent les Noirs Américains.sence du G6PD et en présence d'un oxydant. Les hématies fragilisées sont exposées au risque de crise hémolytique. Les porteurs hétérozygotes sont plus résistants à l'infection par Plasmodium falciparum. les antalgiques et les anti-infectieux (Tableau). les populations Méditerranéennes et les africains où l'hémolyse est la plus sévère. Les deux principaux variants (G6PDA. Ce déficit ne s'exprime qu'en présence d'un xéno biotique oxydant qui peut être un aliment (fève) ou un médicament. De nombreux médicaments provoquent des accidents hémolytiques en particulier parmi les antipaludéens. Sulfones: diaminodimetylsulfone thiazolsulfone Autres: bleu de méthylène 103 . ce qui expliquerait la conservation du gène dans la population.II: Quelques médicaments pouvant déclencher une hémolyse chez un sujet atteint de déficit érythrocytaire en G6PD Médicaments qui provoquent une anémie hémolytique cliniquement significative chez les sujets avec déficit en G6PD Antimalariques : Analgésiques : Pamaquine Acide acetylsalicylique. l'hémoglobine est dénaturée et précipite sous la forme de corps de Heinz. La transmission est liée au sexe. aminophenazone Nitofuranes : nitrofurantoine nitrofurasone Sulfamides: sulfacetamide. phenacétine Primaquine. Il est à noter que l'activité de la G6PD est toujours faible chez le nouveau-né. le rendant sensible au risque hémolytique. mepacrine Acetanilide.

) ainsi que tous les médicaments contre-indiqués dans le déficit en G6PD. Parmi les principaux. Les porphyries sont caractérisées par une anomalie de la régulation de la synthèse de l'hème due à un déficit enzymatique.103 (12/116) G6PDA0.227 (25/110) 0.069 (7/101) HbS. les oestrogènes. différents précurseurs vont s'accumuler correspondant à des formes différentes de la maladie. sulfapiridine acide ascorbique phenylhydrazine probénécide Par ailleurs. Ces maladies se transmettent selon le mode autosomique dominant.7 Thal 0. Les précurseurs sont éliminés dans les urines où ils sont transformés en porphyrines. les substances connues pour être à l'origine de la formation de methémoglobine doivent être evitées (oxydants directs : nitrates.III: fréquences zygotiques du au Burkina Faso Groupe Ethnique HbS Mossi (M) Rimaibé (R) M+R Fulani (F) 0. peuvent déclencher des porphyries. comme par exemple un fongicide l'hexachlorobenzène.030 (7/236) 0. Les malades porteurs de cette affection doivent être précisément informés des médicaments et autres substances qui leur sont contre-indiqués. Alpha-3. La methémoglobinémie. Tableau IX.191 (76/397) 0. chlorates.127 (30/236) 0. facilement dénaturée en corps de Heinz et associée à des crises hémolytiques induites par des médicaments.7 Thal et G6PDA- 2 . Selon le site primaire d'expression de l'anomalie génétique. dans certaines hémoglobinopathies. en augmentant encore l'activité de l'ALA-synthétase.024 (8/334) 0.117 (39/334) 0.Au niveau d'un récepteur 104 . sont déclenchées par les médicaments inducteurs enzymatiques qui.121 (69/570) 0. Chez les malades porteurs de cette anomalie.022 (3/136) HbC 0. Le lien entre l'accumulation de ces précurseurs et les symptômes de la maladie est encore mal appréhendé. l'alcool mais aussi la chloroquine.185 (25/135) 0.. la griséofulvine. des crises. quinines ou indirects : aniline. la phénytoïne. HbC. même chez des personnes non porteuses d'anomalies héréditaires. figurent les barbituriques.. les sulfamides.sulfamotoxazole sulfanilamide. majorent les conséquences de sa dysrégulation.180 (40/222) 0.059 (8/136) Fréquences genotypiques Alpha-3. parfois mortelles. l'amidopyrine. nitrites.195 (51/262) 0. Ce déficit entraîne une dérégulation de l'ALA synthétase et conduit à l'accumulation de grandes quantités de précurseurs de l'hème. liste non limitative. La delta aminolévulinique synthétase (ALA-synthétase).026 (15/570) 0. l'hémoglobine est également instable. Plusieurs modifications structurelles de l'hémoglobine ou de la methémoglobine réductase peuvent être responsables de la methémoglobinémie congénitale.134 (15/112) 0. d'origine toxique. Certains produits particulièrement puissants. Chez les patients atteints.

Le caractère familial est établi et cette susceptibilité particulière pourrait être liée à une augmentation idiopathique du calcium sarcoplasmique. le muscle des personnes concernées présentant une réponse contractile anormale quand il est exposé à la caféine ou à l'halothane. Chez quelques rares malades l'administration. L'évolution est le plus souvent mortelle. Cette réponse. Nous venons de passer en revue les principaux facteurs de variation de l'activité des médicaments. de warfarine ne s'accompagne pas de modifications du taux de prothrombine. On en retiendra que ces connaissances méritent d'être hiérarchisées : certaines relèvent surtout d'une recherche fondamentale tandis que d'autres présentent une pertinence clinique. dans quelques rares cas. La résistance se manifeste à la fois pour les hormones endogènes et exogènes. VII. Il s'agirait en fait d'une modification génétique du récepteur hépatique. Les patients souffrant de mucoviscidose présentent des réponses anormales aux molécules à propriété α-adrénergique. Le syndrome comprend une très forte hyperthermie. La trisomie 21 s'accompagne d'une hypersensibilité à l'atropine et aux βadrénergiques. Ils sont liés au chromosome X et correspondent à une modification de récepteurs intracytoplasmiques. β-adrénergique et cholinergique. une tachycardie. Le monitoring médicamenteux comme 105 . qui peut atteindre 43°. Certains types de résistance à la vitamine D sont également reliés à un dysfonctionnement du récepteur tissulaire. En dehors de l'aplasie réversible dosedépendante. des arythmies et une rigidité musculaire. dont l'éthiopathogénie n'est pas connue. Les anticoagulants coumariniques inhibent la coagulation en bloquant la synthèse hépatique vitamine K dépendante de quatre protéines impliquées dans le processus (facteurs II. L'insensibilité à l'amertume de la phénylthiourée ou à l'odeur de cyanure sont dues à une anomalie héréditaire des récepteurs sensoriels correspondants. L'anomalie peut être détectée de façon préventive sur une biopsie musculaire. L'incidence en serait de 1 pour 15 000 anesthésies chez l'enfant et de 1 pour 50 000 à 100 000 chez l'adulte. Différents syndromes de résistance aux androgènes sont connus. L'hyperthermie maligne déclenchée par une anesthésie générale. le chloramphénicol peut déclencher une aplasie irréversible dose-indépendante chez des sujets génétiquement prédisposés. La résistance aux hormones stéroïdes. se transmet selon le mode autosomique récessif. La résistance à la warfarine. 3 . L'exploration des patients résistants a montré l'absence de modifications pharmacocinétiques de la warfarine.Variations de mécanisme mal déterminé L'hypertension oculaire aux corticoïdes. L'administration de collyre aux corticoïdes provoque dans 5% de la population un glaucome aigu par augmentation de la pression intra-oculaire. même à forte dose. Autres syndromes.Des modifications de l'affinité d'un récepteur peuvent également expliquer une variabilité de l'action de certaines molécules et en particulier rendre compte de la résistance à un médicament. La dysautonomie familiale est associée à une hypersensibilité à la noradrénaline. L'anémie aplasique au chloramphénicol. IX et X). Ils bloquent le cycle de régénération de la vitamine K.

Proc Natl Acad Sci USA 1992 . Flammarion. JEFFREY H. SUZUKI.F. KLATZMANN D. Biologie moléculaire de la cellule. Seventh edition. GELBART. CARUSO M. An introduction to genetics analysis. CR Acad Sci Paris 1994 . les essais cliniques de phase I et II s'efforcent de maîtriser ces facteurs de variation. . Genetically controlled pharmacomodulation for HIV gene therapy. M. cours BRUCE A. Ces notions s'intègrent au développement du médicament . KLATZMANN D. Selective killing of CD4+ cells harboring a human immunodeficiency virus-inducible suicide gene prevents viral spread in an infected cell population. RICHARD C. les facteurs de variation de l’activité des médicaments. Freeman. MILLER. Médecine-Sciences. USA 2000. 89 : 182-6. Dennis B. BENTUÉ-FERRER.les différents tests de phénotypages disponsibles représentent une aide spécialisée à la thérapeutique. 317 : 1027-30. LEWONTIN. REYMANN. WILLIAM. 106 . GRIFFITHS. CARUSO M. Paris 1995.. BIBLIOGRAPHIE ET REFERENCES ANTHONY J. DAVID T.

Gene therapy.CHEVALLIER M. Technique DNA tests. Mai . USA 2001.. CLEMENTI F. Génie génétique : procédés biotechnologies. PASTERNAK JACK J.... Molecular biotechnology. NUSSBAUM ROBERT L. Ouagadougou septembre 2000. 479-506. DEFAYE J.. Doin. Gilman M. pp. médecine-sciences. Bologna 1994 pp. p. Genetics in medicine. Saunders\company.. sixth edition. Paris 1991.M. 67-100.. KLATZMANN.05200301203. et al. Thérapie génique de l'infection par le VIH. . Rapport sur les applications des biotechnologies à l’agriculture et à l’industrie agroalimentaire. génétique médicale. Génie Génétique. WILLIAMSON B. 26 pp. Zanichelli. FUMAGALI G. 262-264. Virologie. 375-389.A. MARGARET W. Lemoine F. Genetic analysis using the polymerase chain reaction (PCR).. ». Thérapie génique implications. GLICK BERNARD R. second edition. KRIMSKY S. LONCLE D.C. Risk managementin Biotechnology... MERTENS T. Vol. 107 . perspectives et éthique. 3. Rome 1995.. WATSON J. Turin 2003. PAOLETTI R. n..... Genetic Alchemy : a social history of the DNA Controversy. Washington 1998. enjeux thérapeutiques. US Government Printing Office. « 2° édition. imprimerie du MSSRS. n° 11. Paris 1995. D. Numéro 3. 1982.. . Amaudric M. Seconde édition. New York 1975. Médecine-Sciences. NICOSIA S. ERLICH H. S. Camillianum. Office Parlementaire des choix scientifiques et technologiques. R. 298. D.Juin 1999 : 217-26. HERSON. SIMPORE J. Biologie moléculaire et médecine... Pharmacologie générale et moléculaire. (eds). SIMPORE J. économiques et éthiques. « Nature ». ASM press. Rev. DNA Ricombinante. Genet. Assemblée Nationale Française. Human genetics : readings on the implications of genetic engeering. 1992. –ARNHEIM N. KAPLAN J. John Wiley and Sons. UTET. « Annu.

You're Reading a Free Preview

Télécharger
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->