Vous êtes sur la page 1sur 266

TUTORAT DE MEDECINE PURPAN ANNEE UNIVERSITAIRE 2006-2007 PCEM1

QCM supplmentaires
Raliss par lensemble de lquipe des Tuteurs Purpannais
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

En aucun cas les QCM de ce polycopi ne pourront engager la responsabilit de la facult de mdecine ou de mesdames ou messieurs les professeurs...

Partenaire du Tutorat Associatif Toulousain

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

PARTIE I CHIMIE

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 1 : A. La charge du neutron est comme celle du proton gale 1,602.10-19C. B. Latome est constitu de nuclons : les neutrons et les protons. C. Un atome est form dun noyau lectriquement neutre et des lectrons qui gravitent autour. D. Un cation est un atome qui a perdu un ou plusieurs lectron(s). E. Un nuclide est caractris par le nombre de masse A, par le numro atomique ou nombre de nuclons Z et par X reprsentant llment. QCM 2 : A. Deux isotopes dun mme lment se diffrencient par le nombre de masse A. B. Parmi les trois isotopes de lhydrogne, seul le tritium est radioactif. C. Le 31P est utilis comme marqueur radioactif pour les techniques dhybridation. D. Tous les isotopes dun mme lment sont stables E. La masse des lectrons au sein de latome est aussi importante que celle du noyau. QCM 3 : A. Selon la loi des gaz parfaits : PV=NRT, avec une P=1atm, une temprature 0C, une mole occupe un volume de 22,4 litres. B. La mole dfinit la quantit de matire contenant le mme nombre datomes, de molcules ou dions que 12g de 12C. C. La molaire M : correspond une unit de concentration et on peut dire que 1M=1mol/L. D. Lunit de masse atomique ou Dalton correspond au 1/12 de la masse de latome 13C. E. Dans une mole de 12C, il y a 6,22 .1023 atomes de Carbone et cela reprsente une masse de 12g. QCM 4: A. Pour obtenir la masse atomique dun lment, on prend son nombre de masse car ces deux valeurs sont identiques. B. Les proprits chimiques dun lment sont dues sa structure lectronique. C. Tous les isotopes dun mme lment nont pas les mmes proprits chimiques car ils ont un nombre dlectrons diffrents. D. Soit un noyau compos de 34 nuclons :17 protons et 17 neutrons, latome correspondant possde 34 lectrons. E. Tous les isotopes artificiels produits par bombardement sont radioactifs. QCM 5 : A. Soit un nuclide X ayant un Z gal 19 et un nombre de masse gal 40 : son nombre de neutrons est de 21. B. Dans le 4020Ca2+ le nombre dlectrons est de 22. C. La masse de latome dhydrogne est suprieure 1uma. D. Le Carbone a pour masse atomique moyenne 12. E. Lisotope 136C possde 13 protons. QCM 6 : Concernant la composition de latome : A. La masse des protons est pratiquement quivalente celle des neutrons. B. La charge des protons est pratiquement quivalente celle des neutrons. C. La charge dun lectron est linverse exact de la charge dun neutron. D. La masse dun proton est pratiquement quivalente la masse de deux lectrons. E. Il existe des atomes chargs lectriquement.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 7 : Concernant la composition de latome : A. La charge lmentaire q na pas la mme unit selon que lon parle des protons ou des lectrons. B. La charge lmentaire q a pour unit le volt. C. Un atome est constitu dun noyau (proton(s) + ventuellement neutron(s)) autour duquel gravite(nt) un(des) lectrons(s). D. Latome 12C a un numro atomique gal 12. E. Latome 1H possde un seul neutron. QCM 8 : Concernant la composition de latome : A. Un atome possde autant dlectrons que de protons. B. Un atome possde autant de neutrons que de protons. C. Certains isotopes dun mme lment peuvent tre radioactifs. D. Tous les lments de la table de classification sont stables. E. Tous les isotopes dun lment dont le nuclide majoritaire est stable sont forcment stables. QCM 9: Concernant la composition de latome : A. Les isotopes dun lment possdent le mme nombre de protons. B. Les isotopes dun lment possdent le mme nombre dlectrons. C. Les isotopes dun lment possdent le mme nombre de neutrons. D. Le nombre d Avogadro est gal : N = 6,023.1022. E. Lunit utilise par les biologistes et biochimistes pour mesurer le poids dune molcule ou protine est luma (unit de masse atomique). QCM 10 : Concernant la quantification : A. Une mole dun atome correspond 6,022.1023 atomes. B. Une mole de 12C correspond 1 g de 12C. C. Une mole de 1H correspond 1 g de 1H. D. Le molaire (M) est une unit de concentration. E. 1mM = 10-3 M, soit 1mM correspond 6,022.1020 atomes/l. QCM 11 : A propos de latome dazote il est exact que : A. Il possde 5 isotopes. B. 2 de ses isotopes sont stables. C. Tous ses isotopes sont stables. D. Tous ses isotopes sont des radio isotopes. E. Certains de ses isotopes ne contribuent en rien dans la teneur en azote que lon retrouve dans la nature. QCM 12 : A propos de lazote trouv dans la nature : A. Sa masse atomique moyenne est trs proche de 14. B. Sa masse atomique moyenne est exactement de 14.0067. C. Sa masse atomique moyenne est exactement de 14.0031. D. Les radio isotopes de lazote sont pris en compte dans le calcul de la masse atomique moyenne. E. Seul le 14N est prsent dans la nature. On donne : 13N : 0% M = 13 ;14N : 99,635% M = 14 ,0031; 15N : 0.365% M = 15.0001 ; 16N : 0% M =16.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 13 : Soient les lments suivants, H ( M=1), P (M=31), O (M=16) A. La masse molculaire moyenne de H3PO4 est gal a 98. B. On doit peser 490mg de H3PO4 pour prparer 10ml dune solution 500mM. Dans la solution prpare litem B : C. Sachant que H3PO4 se dissocie en ions H+ et PO4- - -, la concentration en ions PO4--- est de 500mM. D. Sachant que H3PO4 se dissocie en ions H+ et PO4- - -, la concentration en ions PO4--- est denviron 167mM. E. Sachant que H3PO4 se dissocie en ions H+ et PO4-- -, il y a 3,011x1023 ions PO4--- dans 1 ml de cette solution. QCM 14: A propos de la structure de latome : A. Le modle de Rutherford constitue le modle datome le plus abouti. B. Les lectrons sont de petites particules qui gravitent autour de latome. C. Les lectrons sont attirs par les charges ngatives du noyau. D. Le modle de Bohr est exact pour lensemble des atomes. E. Le modle de Bohr est adapt aux atomes poly lectroniques. QCM 15 : A propos de la structure de latome : A. Latome est extrmement plus petit que le noyau. B. La couche M peut contenir 18 lectrons. C. Lorbite ltat fondamental est celle la plus proche du noyau. D. A propos de la spectrophotomtrie de flamme, lexcitation de latome provoque la dissipation des particules. E. Cest lors du retour ltat excit quil se produit une mission lumineuse. QCM 16 : Soit les atomes d'hydrogne H, de deutrium D et de tritium T avec respectivement un nombre de masse A gal 1, 2 et 3 : A. Ces trois atomes sont des lments diffrents de la classification priodique. B. Le deutrium est un radio isotope de l'hydrogne. C. Pour pouvoir calculer la masse atomique moyenne de la famille isotopique de l'lment hydrogne forme par H, D et T rencontre dans la nature, il nous faudrait plus de donnes. D. Deux atomes ne possdant pas le mme nombre de protons peuvent tre des isotopes. E. Deux atomes possdant le mme nombre de neutrons peuvent tre des isotopes. QCM 17 : A propos de la spectrophotomtrie de flamme A. Elle est base sur les proprits quantiques des atomes. B. On pourra la mettre en oeuvre si on possde uniquement un chantillon, une flamme, une fente et un prisme. C. Le prisme va diviser la lumire, nous permettant ainsi d'en calculer sa longueur d'onde. D. C'est une technique rgulire de dosage de certains mdicaments. E. Elle est la base de la mise en place du modle atomique de Rutherford. QCM 18 : A propos du modle de Bohr A. Celui-ci, tabli grce la spectrophotomtrie de flamme, montre que l'atome est compos d'un noyau et d'lectrons gravitant autour de ce dernier selon des niveaux prcis d'nergie. B. Il a pu tre tabli partir de travaux sur l'hydrogne grce sa structure lectronique particulire. C. C'est un modle de l'atome apportant une foule d'informations, avec de nombreuses applications et valable pour la plupart des atomes. D. Les couches K, L, M, etc... du modle de Bohr correspondent aux diffrentes valeurs que peut prendre le nombre quantique principal n. E. La gnralisation du modle de Bohr montre que la matire est essentiellement lacunaire (faite de vide) avec un noyau environ 100 fois plus petit que l'atome. Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 8
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 19 : A propos du modle de Bohr pour l'atome d'hydrogne A. La flamme va provoquer le saut quantique de l'lectron unique de l'atome d'hydrogne d'un tat dit fondamental vers un tat dit excit. B. La diffrence entre deux niveaux d'nergie est appele quantum d'nergie. C. Cette diffrence est la mme quelles que soient les couches considres. D. En tudiant le retour l'tat fondamental de l'lectron excit, ce dernier mettant une mission lumineuse caractristique, on pourra connatre la diffrence d'nergie entre les deux tats. E. Ralisant ceci pour toute les couches de l'atome d'hydrogne, c'est ainsi que Bohr a tabli son fameux modle. QCM 20 : A propos des orbitales... A. L'orbitale s dcrit une symtrie sphrique. B. Les orbitales de type d sont trois par niveau d'nergie o elles sont reprsentes. C. L'orbitale s est spare en 2 par le plan nodal. D. Le plan nodal spare une orbitale p en 2 lobes positifs. E. Les orbitales de type p forment des angles de 90 entre elles. QCM 21 : Les orbitales suivantes peuvent elles exister? A .n: 1, l: 0, m: 1. B. n: 2, l: 1, m: -1. C. n: 3, l: -2, m: 2. D. n: 3, l: 2, m: 2. E. n: 4, l: 4, m: 3. QCM 22 : Les atomes et leurs orbitales. A. l'tat fondamental un atome est toujours son niveau nergtique le plus bas. B. Pour des orbitales atomiques ayant la mme nergie, les lectrons se repartissent avec un nombre minimum de spins parallles. C. Les orbitales d' 8O se remplissent de la faon suivante: 1s2 ; 2s2 2p4. D. Les orbitales de 15P se remplissent de la faon suivante: 1s2 ; 2s2 2p6 2d5. E. Le remplissage des orbitales d'un atome se fait par ordre croissant d'nergie. QCM 23: A propos de l'lectron... A. Les nombres quantiques n, l et m dfinissent un lectron. B. En connaissant le niveau d'nergie d'un lectron on ne peut jamais connatre prcisment la localisation de l'lectron. C. Deux lectrons sur la mme orbitale n'ont jamais le mme spin, il est oppos: +1 ou-1. D. Les lectrons d'un atome dcrivent un mouvement de nature ondulatoire. E. La racine carre de la fonction d'onde qui lui est associe reprsente la probabilit de prsence de cet lectron. QCM 24 : Le(s)quel(s) de ces classement par ordre d'nergie croissante des orbitales est (sont) correct(s)? A.1s < 2s < 2p < 2d < 3s < 3p < 3d < 4s < 4p. B.1s < 2s < 2p < 3s < 3p < 3d < 4s < 4p. C.1s < 2s < 3s < 4s < 2p < 3p < 4p < 3d. D.1s < 2s < 2p < 3s < 3p < 4s < 3d < 4p. E.1s < 2s < 2p < 3s < 3p < 4s < 4p < 4d.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 25 : A. Dans lquation de Schrdinger la valeur || fait intervenir les nombres quantiques s, n et l qui dfinissent les orbitales. B. Le nombre quantique principal n dfinit le niveau dnergie de llectron. C. Le nombre quantique l dfinit lorientation de lorbitale. D. On dfinit le nombre quantique l par n-1. E. Lquation de Schrdinger permet de calculer la position exacte de llectron. QCM 26 : Les propositions suivantes vous sont prsentes comme exactes prcisez si ces affirmations sont vraies ou fausses. A. n = 2 ; l= 0 ; m = -2 B. n = 3 ; l = 1 ; m = 0 C. n = 3 ; l = 2 ; m = 2 D. n = 1 ; l = 1 ; m = -1 E. n = 4 ; l = 3 ; m = 4 QCM 27 : A. Le nombre total dorbitales pour le niveau n = 3 est gal 9. B. Pour lorbitale s lquation de Schrdinger est toujours positive, ce qui nous indique que sa reprsentation est une symtrie axiale. C. Il existe 3 orbitales p pour chaque niveau. D. On ne peut pas reprsenter les orbitales autres que s et p car elles sont trop complexes. E. Le principe dexclusion de Pauli indique que deux lectrons de mme spin ne peuvent pas se trouver dans la mme orbitale. QCM 28: A. Le principe de stabilit permet deffectuer le remplissage des orbitales par ordre dnergie croissante. Dans les items B, C et D on classe les orbitales par niveau dnergie : B. On peut crire : 2p < 3s < 3p < 4s < 3d < 4p. C. On peut crire : 4d < 5s < 5p < 6s. D. On peut crire : 6s < 4f < 5d < 6p. E. La rgle de Hund explique que dans le remplissage des orbitales de mme nergie, les lectrons se rpartissent avec un nombre maximum de spins parallles. QCM 29 : A. 10Ne : 1s2 2s2 B. 16S C. 26Fe : : 1s2 2s2 1s2 2s2 2p6 2p6 2p6 2p6 3s2 4s2 3s2 3s2 3p6 3p6 3p2 3d 6 3d5 4s2 4s1

D. 24Cr : 1s2 2s2

E. 29Cu : 1s2 2s2

2p6

3s2

3p6

4s2

3d 9

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

10

QCM 30 : Les structures lectroniques des lments suivants sont : A : Pour le Ca (Z=20) : 1s ; 2s 2p6 ; 3s 3p6 ; 4s B : Pour le Ru (Z=44) 1s ; 2s 2p6 ; 3s 3p6 3d10 ; 4s 4p6 4d6 ; 5s, C : Pour le Cr(Z=24) 1s ; 2s 2p6 ; 3s 3p6 3d4 ; 4s D : Pour le Zn (Z=30) 1s ; 2s 2p6 ; 3s 3p6 3d10 ; 4s E : Pour le Os (Z=76) 1s; 2s 2p6 ; 3s 3p6 3d10 ; 4s 4p6 4d10 4f14 ; 5s 5p6 5d6 ; 6s QCM 31 : A : Dans la classification priodique des lments, chaque ligne correspond une priode et chaque colonne une famille. B : La classification de Mendeleev classe les lments par leur numro atomique Z. C : Le nombre dlectrons maximum sur une mme couche est de 32. D : Dans la rgle de Klechkowski, le niveau 4f est suprieur au niveau 6s. E : Dans la rgle de Klechkowski, le niveau 6d est suprieur au niveau 7s. QCM 32 : A propos du tableau de la classification priodique A : Les lanthanides contiennent un niveau (n-2)f. B : Les lments de la premire colonne appartiennent la famille des alcalino terreux et peuvent se transformer en ions fondamentaux dans le maintien de la cellule. C : Les lments de la premire colonne perdent facilement 1 lectron et adoptent la structure lectronique du gaz rare de leur priode respective. D : Les lments de transitions possdent des orbitales d ou f incompltes. E : Certains gaz rares ont une structure lectronique comportant des lectrons non apparis. QCM 33 : On considre le nuclide Be (A=9, Z=4) : A : Son noyau renferme 4 neutrons. B : Dans son groupe, il a lnergie de premire ionisation la plus faible. C : Dans sa priode, il a lnergie de deuxime ionisation la plus faible. D : Il peut facilement donner des ions Be2 +. E : Il possde sur sa couche de valence deux lectrons clibataires. QCM 34 : On considre les lments suivants : Na (Z=11), P (Z=15), S (Z=16), Cl (Z=17), Ar (Z=18) A : Largon est le plus susceptible de donner un ion. B : Largon a le rayon atomique le plus grand. C : Le sodium est le plus lectropositif. D : Le chlore est le plus lectrongatif. E : Le sodium a le plus grand rayon atomique. QCM 35: A : La couche lectronique dfinie par n=3 ne concerne que les atomes de la troisime priode de la classification. B : La couche lectronique dfinie par n=3 possde des orbitales de nombre quantique magntique gal 3. C : La couche lectronique dfinie par n=3 peut contenir au maximum 18 lectrons. D : Latome de Titane Ti (Z=22) appartient au bloc des lments de transition. E : Lanion Ti2+ possde, ltat fondamental, deux lectrons clibataires en d.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

11

QCM 36 : Parmi les atomes suivants quels sont ceux qui ont tous leurs lectrons apparis? A : Na (Z=11) B : Cl (Z=17) C : Sc (Z=21) D : Cr (Z=24) E : Cu (Z=29) QCM 37 : Concernant les proprits gnrales des atomes A. Lnergie de 1re ionisation correspond lnergie fournir un atome pour lui arracher un lectron et le transformer en cation. B. Lnergie de 1re ionisation et laffinit lectronique varient dans le mme sens. C. Laffinit lectronique des halognes (ns2 np5) est importante, ils captent facilement un lectron et acquirent ainsi la configuration du gaz rare de leur priode. D. Dans une mme priode, le rayon atomique augmente avec le numro atomique, cest--dire avec le nombre de protons (et donc dlectrons). E. Lnergie fournie pour passer dun atome un cation bivalent est lnergie de 2me ionisation. QCM 38 : Soient les atomes suivants : A ( Z=11 ) ; B ( Z=24 ) ; C ( Z=30 ) ; D ( Z=37 ) ; E ( Z=42 ) A. B et E sont des lments de transition qui appartiennent la mme famille. E a un rayon atomique suprieur B. B. D, qui appartient la famille des alcalins, a une nergie de 1re ionisation infrieure E. C. C a une affinit lectronique suprieure B. D. A a une faible nergie de 1re ionisation et forme facilement un cation monovalent. E. B, C et D appartiennent la mme priode (n=4) et leur rayon atomique est tel que : B>C>D. QCM 39 : Concernant loxygne (8O) A. Sa structure lectronique est : 1s2 ; 2s2 2p4. B. Il appartient la 16me colonne de la classification priodique. C. Il participe la chane respiratoire mitochondriale, et la production dnergie lors de son oxydation par les lectrons. D. La raction suivante : O + e- O- est exothermique, cest--dire quelle libre de lnergie. E. Cependant, la raction O- + e- O2- libre plus dnergie. QCM 40: Concernant limportance biologique de certains lments A. Le fluor participe la structuration des os. B. Zn fait partie de la vitamine B12. C. LIode participe la synthse des hormones thyrodiennes. D. Le manganse est un oligo-lment. E. Le manque de fer provoque une anmie. QCM 41 : Soient les lments suivants : X : 1s2 ; 2s2 2p6 ; 3s2 3p6 ; 4s2 Y : 1s2 ; 2s2 2p6 ; 3s2 3p6 3d5 ; 4s1 Z : 1s2 ; 2s2 2p6 ; 3s2 3p6 3d10 ; 4s1 A. Z a un rayon atomique infrieur X. B. Y a une affinit lectronique infrieure X, mais suprieure Z. C. Ces 3 lments appartiennent la mme priode. D. Ces 3 lments sont des lments de transition. E. Leurs nergies de 1re ionisation sont telles que : X<Y<Z.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

12

QCM 42 : Concernant les proprits gnrales des atomes A. Le 4Be : dans sa famille, il a lnergie de 1ere ionisation la plus faible. B. Dans sa priode il a lnergie de 2me ionisation la plus faible. C. Laffinit lectronique est la capacit qua un lment de librer un e- pour devenir un cation. D. La raction Li Li+ + e- libre plus dnergie que la raction Na Na+ + e-. E. LHlium (2He) est latome qui a le rayon atomique le plus petit. QCM 43 : Soient les lments 5B, 26Fe, 19K, 24Cr, 31Ga, 37Rb A. Le Cr comporte une orbitale externe sphrique contenant 2 lectrons. B. Le Rb a lnergie de 1re ionisation la plus faible de tous ces lments. C. Le Bore et le Gallium appartiennent au mme groupe. D. Le Potassium a le rayon atomique le plus grand. E. Le Fer et le Gallium sont des oligo lments. QCM 44 : Concernant les proprits gnrales des atomes A. Dans une mme priode, plus on se rapproche des gaz rares plus laffinit lectronique est grande et plus lnergie de premire ionisation est leve. B. Le 17Cl a une plus faible affinit lectronique que le 35Br. C. 16O + e- libre de lnergie. D. O- + e- librera plus dnergie afin datteindre la stabilit de la famille des gaz rares. E. Le rayon atomique et lnergie de 1re ionisation varient en sens inverse. QCM 45: Concernant limportance biologique de certains lments A. Le cuivre est indispensable aux enzymes. B. Le Zn intervient dans la traduction. C. Lantimoine Sb est utilis dans le traitement des leishmanioses provoques par des parasites. D. Les sels de Au sont utiliss dans le traitement de la syphilis. E. Les mdicaments comme le Pt ou le Li sont toujours bnfiques. QCM 46 : Soient les lments A, B, C, D et E avec 19A, 11B, 29C, 47D, 12E A. Les composs A, B et E ont un rayon atomique class dans lordre suivant E B A B. Les composs A, B et E ont une affinit lectronique faible C. E est celui qui a lnergie de 2me ionisation la plus forte D. C a comme configuration 1s2 2s2 2p6 3s2 3p6 3d9 4s2 daprs la rgle de Klechkowski. E. D et C appartiennent la mme famille. QCM 47 : Concernant llectrongativit et les liaisons covalentes polarises : A. Dans une priode llectrongativit augmente de droite gauche et dans une colonne elle augmente de bas en haut. B. Le fluor est llment le plus avide dlectrons. C. Le degr de polarisation dune molcule varie en fonction de llectrongativit des atomes lis. D. La combinaison entre un atome trs lectropositif et un atome trs lectrongatif reprsente le cas extrme dune liaison covalente polarise savoir une liaison ionique. E. Dans la molcule dacide chlorhydrique, le doublet est plus proche de latome dhydrogne du fait de son lectrongativit. On donne : 9F

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

13

QCM 48 : Concernant la thorie de Lewis A. Les atomes se lient entre eux pour former des difices molculaires plus stables. B. Lorsque deux atomes dazote se lient, chacun deux acquiert la configuration du gaz rare le plus proche, soit le non, situ dans la mme priode. C. Le trichlorure de phosphore et le pentachlorure de phosphore respectent tous deux la rgle de loctet. D. La rgle de loctet sadapte parfaitement aux lments de la premire et de la deuxime priode de la classification. E. Les halognes ont une forte tendance rcuprer un lectron pour adopter la configuration lectronique du gaz rare qui les prcde dans la classification. On donne : 7N, 10Ne, 17Cl QCM 49 : Concernant les molcules diatomiques A. Dans la molcule de dihydrogne, les 2 lectrons sont mis en commun dans une orbitale molculaire et forment un doublet de liaison. B. La liaison entre deux atomes de fluor est une liaison covalente pure c'est--dire que la densit des lectrons est rpartie de faon htrogne entre les deux atomes. C. Il y a une polarisation de la molcule de dioxygne du fait de la prsence dune double liaison. D. Dans la molcule N2, chaque atome dazote (7N) partage 3 lectrons formant une triple liaison et obissant la rgle de loctet. E. Dans la molcule H2 lnergie de liaison correspond lnergie quil faut fournir la molcule pour rompre la liaison. QCM 50 : Concernant le moment dipolaire A. Le moment dipolaire est gal au produit de la charge par la distance et caractrise toute molcule possdant une charge + et une charge -. B. Plus latome est lectrongatif (donc moins il est avide dlectrons) plus le moment dipolaire est important. C. La molcule de N2 possde un moment dipolaire. D. Les molcules HF et H2O sont polarises. E. Dans la molcule de CO2 les liaisons sont polarises par consquent la molcule est polaire. On donne : 7N, 1H, 9F, 8O, 6C QCM 51 : A. La molcule SCO est polaire du fait de llectrongativit de ses atomes. B. Le fluor est un atome trs lectrongatif, dans une liaison avec un atome diffrent, il va attirer les lectrons vers lui. C. La molcule de CO2 respecte la rgle de loctet. D. Dans la molcule de NH4Cl il y a une liaison ionique. E. Lnergie de liaison est la mme quelque soit le milieu o se trouve la molcule. On donne : 16S, 6C, 8O, 7N, 1H, 9F QCM 52 : La nature des liaisons dans l'acide sulfurique H2SO4 est : on donne : 1H, 16S, 8O A. 4 liaisons covalentes pures,1 liaison dative et 1 ionique. B. 2 liaisons covalentes pures, 2 liaisons datives et 2 liaisons ioniques. C. 2 liaisons covalentes pures, 3 liaisons datives et 1 ionique. D. 6 liaisons covalentes pures. E. 4 liaisons covalentes pures et 2 liaisons datives.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

14

QCM 53 : Soit la raction : NH3 + BF3 x on donne : 7N, 1H, 5B, 9F A. La molcule x comporte 6 liaisons covalentes simples et 1 liaison dative B. Dans la molcule x, N est charg positivement C. x est charg positivement D. BF3 est un acide de Lewis E. NH3 est un acide de Lewis QCM 54 : On donne : 15P, 16S, et 17Cl A. Lors dune liaison dative laccepteur dlectrons est un acide de Lewis. B. Dans une liaison dative le donneur dlectrons est une base de Lewis. C. Dans la molcule PSCl3 latome de soufre est ltat excit. D. Dans la molcule PSCl3 latome de soufre est ltat fondamental. E. Pour former le PSCl3 il faut que le S ait une orbitale 3p vacante. QCM 55 et 56: Soit les molcules suivantes: 1) N2; 2)CO32-; 3)K4Fe(CN)6; 4)BeH2 7N 6C 8O 19K 26Fe 4Be 1H QCM 55: A. La molcule 2 correspond un systme de rsonance. B. Dans la molcule 2 les liaisons C-O sont de mme longueur. C. Dans la molcule 3 lion Fe2+ est ltat excit. D. Dans la molcule 3 les atomes de K sont lis a la molcule par des liaisons datives. E. Dans la molcule 3 les molcules CN- sont lis lion ferreux par des liaisons ioniques. QCM 56 : A. La molcule 1 possde 2 liaisons et 1 liaison . B. La molcule 1 possde 1 liaison et 2 liaisons . C. La molcule 4 respecte la rgle de loctet. D. Dans la molcule 4 les liaisons entre les atomes sont formes par recouvrement axial dorbitales atomiques. E. Seules les orbitales atomiques de type s peuvent donner des orbitales molculaires de type . QCM 57 : Soit la molcule AsCl3 As (Z=33) et Cl (Z=17 A=35) A. Il y a 3 doublets non liants autour de chaque Cl. B. La molcule forme un ttradre. C. Langle entre les liaisons As-Cl est suprieur 109,5. D. Cl a un nombre de masse gal 35. E. As est dans un tat dhybridation sp3. QCM 58 : Formule de Lewis:Vrai ou Faux F (Z=9), S (Z=16), C (Z=6), O (Z=8), H (Z=1) A. B.
F F S S F F

C. O
C D. O O

E. H O H
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

15

QCM 59 : CH2 est plus longue que HC CH : la double liaison est donc plus solide. A. La longueur de H2C B. Les lectrons dune liaison sont plus proches que ceux dune liaison . C. Dans la classification priodique, quand on descend dans une famille, lorbitale molculaire est plus petite. D. La molcule de N2 est polarise. E. En descendant dans le tableau priodique au niveau dune famille, la polarisabilit augmente et la polarisation diminue. QCM 60: Soit la molcule SiCl4 avec Cl (Z=17) et Si (1s2 ; 2s2 2p6 ; 3s2 3p2 et A=28) A. Si a 14 neutrons. B. Dans la molcule, Si est ltat fondamental. C. Si a un doublet non liant dans la molcule. D. Chaque Cl a un doublet liant. E. La molcule a une structure pyramidale. QCM 61 : Polarisation et polarisabilit Br (Z=35), K (Z=19) et I (Z=53) A. Br est un alcalin, K un halogne. B. Dans la molcule KBr, le doublet lectronique joue un rle symtrique lgard des deux atomes. C. Les lectrons vont vers Br. D. Lorbitale de KBr a un plus petit volume que KI. E. Le rapprochement de CH4 vers KBr augmente la dformation de KBr. QCM 62 : propos des orbitales A. La densit dlectrons est plus grande dans une orbitale que dans une orbitale . B. Une liaison simple est plus longue quune double liaison qui elle-mme est plus longue quune triple liaison. C. les orbitales sont parallles entre elles. D. Lorbitale de HBr a un plus grand volume que HF. E. La position dun lectron dans une orbitale est connue avec certitude. QCM 63 : propos de lhybridation A. Lhybridation sp3 est la combinaison entre les orbitales qui fusionnent pour donner au maximum 4 orbitales hybrides. B. Dans la molcule deau H2O, lOxygne est hybrid sp3 C. Dans lhybridation sp3, les 4 orbitales sont diffrentes D. On associe le terme de ttradrique celui de lhybridation sp3. E. Langle entre deux liaisons dans une hybridation sp3 est de 120. QCM 64 : A. Une liaison se cre par recouvrement axial. B. Les liaisons de Pauling permettent de donner une extension la thorie de Lewis. C. Le doublet est plus prs de latome le plus lectrongatif. D. Plus on descend dans le tableau, plus la polarisation augmente mais plus la polarisabilit diminue. E. Chaque orbitale apportant son lectron clibataire peut tablir une liaison covalente avec un atome dH. QCM 65: A. Dans NH3, latome dazote est hybrid sp3 B. Pour former NH3 lazote ne ncessite pas dexcitation puisquil est trivalent ltat fondamental. C. Dans NH3, les angles sont de 1075, cela est d au volume plus important quoccupe le doublet. D. Une liaison donneur-accepteur du doublet de NH3 avec un proton H+ permettrait de former lion NH4+. E. Pour shybrider sp3, le carbone doit rester ltat fondamental.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

16

QCM 66 : concernant les molcules C2H6, C2H4, C2H2 A. La longueur de liaison entre carbones diminue quand on passe de C2H6 C2H4 C2H2. B. L'angle entre liaisons diminue quand on passe de C2H6 C2H4 C2H2. C. Le Carbone de C2H6 est hybrid sp3 D. Dans ces molcules, selon l'tat d'hybridation des atomes de carbone les liaisons viennent dun recouvrement axial ou latral. E. Toutes les liaisons dans toutes ces molcules sont constitues partir d'orbitales atomiques hybrides du carbone QCM 67 : A. Lhybridation sp2 correspond la combinaison dune orbitale s avec deux orbitales p. Lorbitale p vacante reste quant elle perpendiculaire au plan de lhybridation. B. Lhybridation sp2 correspond un ttradre quant la forme gomtrique de la molcule. C. Dans la molcule de trifluorure de bore BF3, celle-ci peut ragir avec NH3 grce une liaison donneuraccepteur. Cette liaison se fait grce un doublet non liant du bore. D. Les molcules suivantes : NOCl, AlCl3, BF3 et NH3 ont une gomtrie plane. E. Dans lhybridation, seules les liaisons et les doublets non liants comptent. On donne : 7N, 8O, 17Cl, 13Al, 5B, 9F, 1H QCM 68 : A. Lhybridation sp entrane lapparition dune structure linaire entre les deux atomes. Langle entre les deux atomes est de 180. B. Une triple liaison signifie forcment quil y a une hybridation sp. C. Les orbitales p vacantes vont donc se recouvrir de manire axiale et permettre lapparition de liaisons . D. La molcule dactylne est constitue dune triple liaison : une liaison et deux liaisons . E. Lalcne C2H4 a une structure linaire et lalcyne C2H2 a une structure plane. QCM 69 : A. Lhybridation sp3d correspond une bipyramide trigonale avec 3 angles de 120 et 6 angles de 180. B. Le phosphore tout comme lazote peut grce lhybridation sp3d donner 5 liaisons (par exemple PCl5 et NCl5). C. Le slnium 34Se lorsquil shybride peut passer dune bivalence une hexavalence. D. Dans la molcule de PCl5, les cinq liaisons sont de mme longueur. E. Lhybridation sert expliquer la gomtrie des molcules. On donne : 15P, 7N, 17Cl QCM 70: A. NH3, BF3, CH4 ont le mme tta dhybridation qui est sp3. B. Dans lacide nitrique HNO3, deux atomes O sont hybrids sp2. C. La molcule N2H2 et la molcule N2H4 sont toutes les deux coplanaires. D. On regarde toujours le groupe fonctionnel dune molcule pour dterminer sa gomtrie. E. La molcule C2H3N a une gomtrie coplanaire. On donne : 7N, 1H, 5B, 6C, 9F, 8O QCM 71 : A. Dans le 1,3 butadine qui comporte 2 doubles liaisons, on a les 4 atomes de carbone hybrids sp2. B. Dans la molcule BeCl2, le bryllium respecte la rgle de loctet. C. Dans la molcule BeCl2, on a deux liaisons donc issues dun recouvrement latral. D. Quand on passe des alcanes aux alcynes, on a les angles entre les molcules qui augmentent. E. Une hybridation sp3d2 que lon trouve dans [Fe(CN)6]4- donne lieu une bipyramide base carre. On donne : 4Be, 17Cl, 26Fe, 6C, 7N 17

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 72 : A propos de lhybridation : A. Dans la molcule deau (H2O) langle entre les liaisons est de 180, car latome dOxygne est hybrid sp. B. Dans la molcule deau, langle entre les liaisons est de 90, car latome doxygne est hybrid sp3. C. Un doublet non liant occupe le mme volume quune liaison entre deux atomes. D. Un atome hybrid sp3 entre toujours dans la formation de 4 liaisons, une et trois . E. La molcule deau possde un seul atome hybrid sp3. QCM 73 : A propos de lhybridation : A. Pour la molcule de BF3, les atomes de Bore possdent une case quantique vide. B. Pour la molcule de BF3, la troisime orbitale p du Bore ne participe pas lhybridation. C. La gomtrie de lhybridation sp2 correspond un ttradre. D. Quand un atome est hybrid sp2, les atomes auxquels il est li sont situs aux sommet dun triangle dont il est le centre. E. Pour la molcule BF3, lorbitale vide se dispose paralllement au plan de la molcule. QCM 74 : A propos de lhybridation : A. Dans lhybridation sp, les atomes sont situs dans le mme plan. B. Un atome hybrid sp2 a toutes ses liaisons dans le mme plan. C. La gomtrie dune hybridation sp3d est une bipyramide ttragonale. D. Dans lhybridation sp3d toutes les liaisons ont la mme longueur. E. Dans la molcule dthylne (C2H4), la dernire orbitale p des carbones possde un lectron clibataire qui va permettre de faire une liaison avec lautre carbone. QCM 75: A propos de lhybridation : A. La molcule PCl5 a la forme dune bipyramide trigonale. B. Lhybridation et lexcitation des atomes permet dexpliquer lexistence des deux molcules PCl5 et PCl3. C. Dans la molcule dactylne (C2H2), lhybridation des deux carbones est sp2 car ces deux atomes sont relis par une liaison et deux liaisons . D. La molcule de PCl3 a une forme de triangle, tous les atomes tant situs dans le mme plan. E. Dans la molcule BLi3, latome de Bore est hybrid sp2. QCM 76 : A propos de lion ferrocyanure. A. Latome de fer est dans un tat excit. B. Latome de fer est ionis en ion ferrique. C. Les liaisons entre le Fe et le CN sont des liaisons covalentes pures. D. Le Fe est hybrid sp3d2. E. Cette molcule a la forme dune bipyramide base triangulaire. QCM 77 : A propos des liaisons. A. Les liaisons rsultent dun recouvrement axial. B. Les liaisons rsultent dun recouvrement latral. C. Les liaisons peuvent rsulter dun recouvrement latral de 2 orbitales s et p. D. Une triple liaison correspond une liaison + 2 liaisons . E. Les recouvrements axiaux peuvent combiner nimporte quelle orbitale pure avec nimporte quelle orbitale hybride.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

18

QCM 78 : A propos de la thorie de VSEPR. A. Dans certains composs, le 14C peut tre hybrid sp. B. Dans certains composs, le 14C peut tre hybrid sp3. C. Le 14C peut prsenter tous les types dhybridation. D. Dans le CO2, tous les atomes sont aligns. E. Dans HCl, le Cl est hybrid sp. QCM 79 : A propos de la thorie de VSEPR. A. Dans lion CO32-, tous les atomes sont dans le mme tat dhybridation. B. Latome 15P peut shybrider sp3d1. C. Dans la molcule NCl5 latome dazote est hybrid sp3d1. D. Le souffre 16S peut tre sp3d2. E. Dans lion ferrocyanure [Fe(CN)6]4- le C est hybrid sp3d2. QCM 80 : A propos de l'hybridation des orbitales molculaires A. Elle ncessite une excitation pralable de l'atome considr du complexe molculaire l'image de l'atome de fer dans l'ion ferrocyanate [Fe(CN)6]4- hybrid sp3d2. B. Elle permet d'expliquer la gomtrie relle des molcules observe l'aide de diffrentes techniques exprimentales (par exemple la cristallographie). C. Elle consiste en une galisation d'nergie entre les orbitales molculaires issues d'un recouvrement latral d'orbitales atomiques d'nergies diffrentes. D. Les recouvrements axiaux () se font uniquement entre 2 orbitales atomiques p alors que les recouvrements latraux () peuvent se faire entre des orbitales atomiques ss, sp, pp. E. Une triple liaison correspond une liaison faite d'un recouvrement axial () et de deux recouvrements latraux (). QCM 81 : A propos de la thorie VSEPR (Valence Shell Electron Pair Repulsion) A. Il s'agit d'une mthode simple, empirique nous permettant de prvoir la gomtrie des molcules selon le nombre de doublets (liants et non liants) dont elles sont composes et le type de liaison quelles contiennent. B. Son principe est de relever le nombre de doublets d'lectrons (ou paires d'lectrons) liants et non liants pour en dduire la gomtrie de la molcule tudie, les liaisons multiples tant considres comme un doublet supplmentaire. C. Si on relve par exemple 2 paires d'lectrons comptant dans une molcule, l'image de la molcule de HCN, tous les atomes sont aligns. D. Si on relve par exemple 3 paires d'lectrons comptant dans une molcule, on aura un placement des atomes priphriques 120 les uns des autres autour de l'atome central, comme dans la molcule de NH3. E. Si on relve par exemple 10 paires d'lectrons dans une molcule, on aura une molcule de gomtrie rectangulaire On donne : 1H, 6C, 7N QCM 82 : Soit la molcule d'acide sulfurique H2SO4, sachant que le soufre est au centre de la molcule et qu'il est situ juste sous l'oxygne dans la classification priodique des lments chimiques, avec 1H et 8O A. Elle est ralise l'aide de 4 liaisons covalentes pures. B. Elle est ralise l'aide de 3 liaisons covalentes pures et d'une liaison dative (donneur-accepteur). C. Elle est ralise l'aide de 2 liaisons covalentes pures et de 2 liaisons datives (donneur-accepteur). D. Le souffre est hybrid sp2. E. Elle a une gomtrie ttradrique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

19

QCM 83: Soit les ions NO2 - et NO2+ ainsi que la molcule de NO, on donne 7N et 8O A. Les ions sont engags chacun dans une double liaison et une liaison dative. B. Ces 3 particules ont toutes un doublet non liant disponible sur lazote. C. NO2+ est hybrid sp donc tous les atomes sont aligns. D. NO2- est hybrid sp2, donc la molcule est plane. E. NO2- et NO2+ sont diamagntiques alors que NO est paramagntique. QCM 84 : Soit les molcules : IF4- et SeF4, sachant que l'iode est le 4me halogne de la classification priodique des lments chimiques, le fluor le 1er, que le slnium est de la famille de l'oxygne et fait partie de la 4me priode. I et Se sont au centre de leur molcule respective. A. Dans (IF4)-, l'iode est hybrid sp3d2. Dans SeF4, le slnium est hybrid sp3d1. B. IF4- a une forme carre. C. Ces deux molcules ont la mme gomtrie en VSEPR. D. Ces deux molcules ont un moment dipolaire nul. E. Le Fluor et l'Iode tant tous deux de la mme famille, par symtrie, on pourra crer la molcule de FI4-. QCM 85 : A propos du dioxygne: A. Pour former le dioxygne on a 12 lectrons de remplissage en jeu, car on ne compte pas les lectrons du niveau 1. B. N= (8-4)= 2 : cette opration permet de trouver le nombre de liaisons entre les deux atomes doxygne. C. Il existe sous deux formes: paramagntique et diamagntique. D.A l'tat fondamental, c'est dire son niveau d'nergie le plus bas, il est paramagntique. E.O2 possde 2 lectrons clibataires dans 2 orbitales liantes dont les spins peuvent tre mesurs: 0, 1 ou -1. QCM 86 : A propos des deux formes du dioxygne: A. O2 est la forme stable du dioxygne, elle a le niveau d'nergie le plus bas. B. O2 et O2 ont les mmes proprits lumineuses. C. O2, forme active de l'O2, a ses deux lectrons clibataires groups sur 1* D. La forme active de l'O2 est appel oxygne singulet et a des proprits chimioluminescentes. E. O2 est un puissant bactricide. QCM 87 : Deux lments X et Y voisins dans lune des priodes de la classification priodique ont la particularit de pouvoir se lier entre eux par une simple liaison , un systme +, ou encore +2. On sait dautre part que la molcule Y2 prsente dans latmosphre terrestre, est diamagntique. A. X = 126C et Y = 147N. B. Pour former la molcule HXY la structure lectronique de X est 1s2; 2s1 2p3. C. La structure lectronique de Y est 1s2; 2s2 2p3 D. En utilisant un atome de X et un atome de Y, et autant datomes dhydrogne que ncessaire, la molcule dans laquelle X et Y sont seulement lis par une liaison est CH3NH2 (N a un doublet non liant). E. En utilisant un atome de X et un atome de Y, et autant datomes dhydrogne que ncessaire, la molcule dans laquelle X et Y sont lis par une liaison +2 est : H-C N (N a un doublet non liant).

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

20

QCM 88 : Concernant la thorie L.C.A.O. : A. Dans cette thorie on utilise des fonctions dondes atomiques pour former des fonctions dondes molculaires. B. La molcule de NO est paramagntique. C. La molcule de CO est paramagntique. D. Le dioxygne singulet est diamagntique. E. N2 est diamagntique. On donne : 6C, 7N, 8O QCM 89: Les deux formes du dioxygne (8O): A. La forme triplet a un seul spin : 0. B. Loxygne sous forme singulet est paramagntique alors que le triplet est diamagntique. C. Le singulet est une espce ractive de loxygne. D. Le triplet comprend en tout : une liaison simple , quatre doublets non liants et deux lectrons clibataires. E. Le singulet est instable alors que le triplet est stable. QCM 90 : Forces de Van der Waals : A. La liaison entre deux molcules de dioxyde de carbone fait intervenir les forces de Keesom. B. Lhydratation dun gaz rare, donc inerte, comme le non fait intervenir les forces de Debye. C. La liaison diple provisoire - diple induit est appele force de dispersion ou force de Debye. D. Deux molcules non polarises peuvent produire une induction lectrostatique lune sur lautre. E. Bien que ce soient deux gaz rares et inertes, le non et lhlium nont pas la mme temprature dbullition : celle du non est suprieure celle de lhlium. QCM 91 : Concernant la liaison hydrogne. A. Elle peut tre intramolculaire ou intermolculaire. B. De manire gnrale, la temprature dbullition augmente avec la masse molculaire. C. HBr a une temprature dbullition suprieure HF. D. Il peut se faire une liaison hydrogne intramolculaire au sein de la molcule suivante.
OH O OH

E. Lortho diphnol a une temprature dbullition infrieure celle du mta diphnol. Ortho diphnol
OH OH

Mta diphnol
OH

OH

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

21

QCM 92 : Concernant la liaison hydrogne. A. Elle concerne les atomes lectropositifs qui sont de petite taille. B. Son nergie de liaison se situe entre celle dune liaison covalente simple et dune liaison covalente double. C. Une augmentation de temprature suffisante dnature les protines en rompant les liaisons hydrogne et ainsi modifient sa structure primaire. D. Dans la molcule dADN, lappariement des bases peut se faire par une ou plusieurs liaisons hydrognes. E. Les liaisons hydrogne sont prsentes au sein des protines, et sont responsables de la structure en hlice . QCM 93 : Concernant les liaisons hydrophobes. A. Elles interviennent dans la reconnaissance spcifique des protines. B. Les alcanes linaires sont des composs hydrophiles. C. Une mme molcule peut engendrer des liaisons hydrophiles et hydrophobes. D. Dans un milieu hydrophile, des molcules hydrophobes vont avoir tendance se regrouper. E. La structure tertiaire de protines hydrophiles peut tre le fait de liaisons hydrophobes. QCM 94 : Concernant la chimie organique. A. Le carbone est llment principal de la chimie organique. B. La chimie organique est prsente uniquement au sein du corps humain. C. La seule connaissance de la formule brute dune molcule ne permet pas de calculer sa masse molculaire ; sa formule dveloppe est ncessaire. D. Le benzne a pour formule brute C6H6. E. Lure est un produit du catabolisme des acides amins de formule brute :
O H2N C NH2

QCM 95 : Soient les composs CH4, H2O, HCl A. Seul H2O peut tablir une liaison hydrogne. B. Seul H2O des proprits nuclophiles. C. Les tempratures dbullition des 3 molcules augmentent dans lordre suivant : HCl CH4 H2O. D. Les molcules deau constituent un rseau o les molcules restent mobiles mais lies grce des liaisons lectrostatiques. E. On nomme galement une liaison hydrogne intermolculaire une chlation. QCM 96 : A. La temprature dbullition de laldhyde salicylique (ortho) est suprieure celle de laldhyde salicylique (para). B. Laldhyde salicylique ortho ne prsente que des liaisons hydrogne intermolculaires. C. Dans l ADN, la conformation en hlice alpha est permise grce aux liaisons covalentes qui existent entre les bases C-G et A-T. D. La temprature dbullition dun brin dADN riche en paires G-C sera plus leve que celle dun brin riche en paires A-T. E. Les 3 liaisons possibles pour lier les bases entre elles sont H-----O, N-----O et N-----H.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

22

QCM 97: A. La liaison hydrogne est lgrement plus forte que la liaison de Van der Waals. B. Lure, le CO2 et le CH3OH sont considrs comme des composs organiques lis la chimie du carbone. C. On peut partir dun compos minral aboutir un compos organique. D. Le taxol est un produit anticancreux issu de la chimie organique qui agit sur la prolifration des microtubules. E. Les molcules dther CH3-CH2-O-CH3 ne peuvent pas sassocier par liaison hydrogne. QCM 98 : A. Il ny a aucune interaction entre les alcanes et les molcules deau. B. Des molcules linaires non polarises peuvent avoir tendance sassocier entre elles par des liaisons de Van der Waals. C. Les rotations successives dune fourchette dans un bol rempli dun mlange dacide olque (huile) et dacide thanoque (vinaigre) permettent de fournir lnergie ncessaire lobtention dun mlange homogne prenne : la vinaigrette. D. Les liaisons hydrophobes et hydrophiles conditionnent les reconnaissances spcifiques entre les protines. E. Dans un milieu hydrophobe, les liaisons hydrophiles sont impossibles. On donne : acide olique C18H34O2 , on le considre hydrophobe pour les besoins de lexercice. QCM 99 : Isomrie A. Des isomres de fonctions correspondent des composs ayant la mme formule brute mais prsentant des fonctions chimiques diffrentes. B. A la formule brute C4H8O2 ne rpondent que des molcules possdant une double liaison ou un cycle. C. Des isomres de position possdent la mme fonction chimique mais cest la position de la fonction sur la chane carbone qui change. D. Le butan-1-ol et le butan-3-ol sont des isomres de position. E. Dans lisomrie dite de squelette, on ne modifie pas la nature de la fonction principale. QCM 100 : Nomenclature CH3 CH3 A. Le compos ci-dessus est le 4isopropyl cyclohex1ne. B. Le compos ci-dessus est le 4isobutyl cyclohex1ne. C. Le compos ci-dessus est le 1isobutyl cyclohex4ne. D. Le compos ci-dessus est le 1isopropyl cyclohex4ne. E. Le compos ci-dessus comprend 1 carbone tertiaire. QCM 101 : Tautomrie A. Les tautomres correspondent des isomres de position capable de se transformer rversiblement lun en lautre. B. Dans le cas de lactone, lquilibre cto-nolique est dplac vers lnol. C. Dans le cadre de la tautomrie cto-nolique, on assiste au dplacement dune double liaison C=O vers C=C. D. Une base pyrimidique telle que luracile peut galement tre le sige de tautomrie : il y a migration des hydrognes (H) vers les atomes dazote (N). E. La tautomrie, isomrie de constitution, peut expliquer la ractivit prfrentielle de certains composs. 23

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 102: Concernant la molcule suivante :


H 3C CH H 3C CH 2 CH CH 2 CH 3

CH 3

A. Le compos ci-dessus est le 1isopropyl 2mthyl butane. B. Le compos ci-dessus est le 2,4dimthyl hexane. C. Ce compos comprend 4 carbones primaires, 2 carbones secondaires et 2 carbones tertiaires. D. Ce compos correspond la formule topologique suivante :

E. Le compos ci-dessus est un hydrocarbure insatur. QCM 103 : Parmi les molcules suivantes, lesquelles possdent au moins un carbone secondaire : A. Le butan-1ol B. Le 2mthyl propan-1ol C. Le 2mthyl propan-2ol D. Le 2amino propane E. Le 3chloro 2,4dihydroxyhexane. QCM 104 : Soit la molcule suivante : CH3-CH=CH-CH=CH-CH3 A. Le compos ci-dessus est le hex-2,4dine. B. Ce compos prsente 4 stroisomres. C. La formule topologique de ce compos est:

D. En rajoutant un Chlore en position 2 la place de lHydrogne, le nouveau compos ainsi form prsente 4 stroisomres. E. Ce nouveau compos est le 2-4 dine hex2chlorure. QCM 105 : Soit la molcule suivante : CH2OH-CH2-CH2-CHO (1) A. Ce compos est le 4formyl butan-1ol. B. Ce compos est le formyl butan-1ol. C. A la formule brute C4H8O2 peuvent correspondre 5 autres fonctions. D. Le 3 hydroxybutanal est un isomre de position de ce compos. E. Le compos CH2OH-CH2-CO-CH3 est un isomre de position du compos (1).

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

24

QCM 106 : Nomenclature A. Le 2mthyl propan-2ol a un radical butyl secondaire. B. Le 2mthyl propan-1ol a un radical isopropyl. H3C C. Le compos suivant est le 2aminopropane ou isopropyl amine. D. La molcule suivante est le 2phnylbutane
H3C CH CH2 CH3

CH NH2

CH3

E. La structure suivante est le radical cyclohexyle.

QCM 107 : Divers A. Parmi les fonctions principales, la fonction carboxylique est trivalente. B. La fonction ctone est prioritaire par rapport la fonction aldhyde car elle est plus oxyde. C. La double liaison est prioritaire sur la triple. D. Les bases puriques et pyrimidiques sont des htrocycles. E. 2 stroisomres ont la mme formule dveloppe plane mais la disposition de leurs atomes dans lespace est diffrente.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

25

QCM 108 : Les molcules suivantes sont-elles chirales ? A.


CH3 H

H CH3

B.
O N H3C H N H O H CH3 H

C.
H3C H3C

H3C

CH3

D.
C2 H5

H HO CH3

E.
H H NH2

H H

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

26

QCM 109 : Soient les molcules suivantes :


CH CH3 3 COOH OH H H H CH3 CH3 OH

COOH

A. Ce sont des reprsentations de Cram. B. Il sagit dune seule molcule avec une seule conformation mais dans des configurations diffrentes. C. Ce sont des nantiomres. D. Elles sont chirales. E. Leur configuration absolue est 2R 3S. QCM 110: Soit la molcule suivante :
CH2Cl H3C C
5 6

H C
2

CH3
1

H C
4

OH

Cl

C
3

H CH2OH

A. Il y a au maximum 16 stereoisomeres. B. Si son pouvoir rotatoire est -5, son nantiomre est dextrogyre. C. Cette molcule est chirale. D. Sa configuration absolue est 2R 3S 4S 5R. E. Sa configuration absolue est 2R 3R 4S 5S. QCM 111 : Soit la molcule suivante : Br avec Si (Z=14) et Cl (Z=17) A. Si est hybrid sp3. 3 H9C 4 C4H7 B. Cl est hybrid sp . C. La molcule est chirale. D. Sa configuration absolue est R. E. Soient les molcules:
Cl
CH3 H Br F CH3 H H3C H H3C Br F H

Si

Un mlange quimolaire de ces deux composs a un pouvoir rotatoire nul.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

27

QCM 112 : A. Une rupture homolytique entrane lapparition dun nuclophile et dun lectrophile. B. Un lectrophile est aussi appel base de Lewis, du fait de la prsence de doublets non liants.
R R C C. Un carbanion est un intermdiaire ractionnel de formule R hybrid sp3 qui est donc considr

comme un nuclophile. D. Quand on fait une htrolyse sur une molcule on obtient obligatoirement une molcule neutre au final. E. Le proton H+ est un acide de Lewis. QCM 113 : A. La molcule suivante est reprsente selon Fisher :
H C HO Cl OH C2 H5 Br OH NH2 CH3 CH3 CH3 COOH

B.La molcule suivante est de configuration SRS :

C. La reprsentation en Newman de cette molcule est la suivante et elle est de configuration R :


CH3 H3C C ClH2C OH ClH2C OH H

D. Un mso ne possde jamais 2 carbones asymtriques de mme configuration (R ou S) cte cte, et il est inactif sur la lumire polarise. E. La molcule reprsente selon la projection de Fisher a pour configuration absolue : RSSS
CHO H OH OH H OH H H OH

CH2OH

QCM 114 : A. Deux nantiomres R et S par exemple, ont mme temprature de fusion, mme temprature dbullition, mme pouvoir rotatoire et mmes proprits chimiques. B. Un compos de configuration S est obligatoirement lvogyre. C. Dans un organisme, si on utilise lnantiomre S la place du R, leffet produit par R sera reproduit par le S. D. RRR et SSS sont des nantiomres. E. Quand on a une molcule avec 4 carbones asymtriques, on a obligatoirement 16 stroisomres.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

28

QCM 115: A. Deux diastroisomres thylniques peuvent tre nomms nantiomres. B. Deux diastroisomres thylniques ont les mmes proprits physiques et chimiques. C. Quand on parle disomrie gomtrique de type Z, cela signifie que les substituants prioritaires selon Cahn Ingold et Prelog sont situs du mme cot. D. Un compos thylnique cis est obligatoirement Z. E. Les diastroisomres thylniques ont une structure fige avec une impossibilit de rotation autour de laxe de la molcule en raison de la prsence des doubles liaisons. QCM 116 : A. Le 2,3dichlorobutane en configuration 2S,3R est lnantiomre du 2,3dichlorobutane en configuration 2R,3S. B. Un mlange quantits gales de deux nantiomres est dit mlange racmique. C. La molcule de configuration 2S,3R du 2,3dichlorobutane a une action sur la lumire polarise qui est linverse de celle du 2R,3S. D. Si on reprsente le 2,3dichlorobutane en configuration 2S,3S, en projection de Newman, aprs rotation, les substituants sclipsent. QCM 117 : Soit la molcule :
H H3C CH3 Cl

A. Elle est de configuration trans. B. Elle est de configuration cis. C. Elle est de configuration E. D. Elle est de configuration Z. E. Elle est de la mme configuration que la molcule :
O Br OH Cl OH Br

QCM 118 : A. Certaines molcules possdent un rapport direct entre configuration et pouvoir rotatoire. B. Deux nantiomres nont pas forcment les mmes proprits physiques, car ils vont avoir des facilits diffrentes faire des liaisons hydrognes du fait de leur conformation. C. Deux nantiomres nont pas forcment les mmes proprits chimiques, car leur configuration va permettre une attaque plus ou moins rapide par des ractifs. D. Les proprits optiques de deux nantiomres sont toujours opposes. E. Les proprits biologiques de deux nantiomres sont souvent diffrentes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

29

QCM 119:
O HO O OH

A. La molcule
H

H O OH

et la molcule

HO O

correspondent en fait une seule et unique molcule puisquil suffit de faire pivoter la double liaison pour retrouver lautre. B. Pour une longue chane carbone, le simple changement de configuration dune double liaison ne va avoir que trs peu de consquences. C. la molcule 4amino,2bromo,3chloro,1iodocyclobutane est lnantiomre de la molcule 1amino,3bromo,4chloro,2iodocyclobutane. D. la molcule 1bromo,2chlorocyclobutane dans sa configuration cis est soit 1R,2R, soit 1S,2S. E. La molcule 1,2dichloroethane dans sa configuration 1R,2S est un compos actif sur la lumire polarise. QCM 120 : A propos du carbocation A. Il peut tre obtenu par dissociation dune molcule organique dans un solvant aprotique. B. Il est hybrid sp2. C. Il subit des attaques nuclophiles. D. On dit que cest un ractif nuclophile. E. Il est aussi bien stabilis par effet inductif que par effet msomre. QCM 121 : A propos du carbanion A. Il est hybrid sp3. B. Il est dapparence plane. C. Il est le sige de ractions strospcifiques. D. Il est aussi bien stabilis par effet inductif (+I) que par effet msomre. E. Cest un ractif nuclophile. QCM 122 : A propos des radicaux libres A. Ils proviennent dune rupture htrolytique dune liaison. B. Ils sont dstabiliss par lencombrement strique. C. Un radical tertiaire est plus stable quun radical secondaire. D. Ils sont stabiliss par effet inductif. E. Ils sont stabiliss par effet msomre. QCM 123 : A propos du buta1,3dine A. Par rfraction aux rayons X on connat parfaitement laspect de la molcule et la longueur de ses liaisons. B. Il possde 3 hybrides de rsonance. C. Il possde un hybride de rsonance avec des charges partielles + et -. D. La liaison entre les carbones 2 et 3 est de longueur intermdiaire entre la double et la simple liaison. E. La msomrie se caractrise par un dplacement dlectrons sur la molcule.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

30

QCM 124 : A propos du carbanion : A. Il est hybrid sp2. B. Cest un compos charg ngativement donc il est lectrophile. C. Il possde au moins un carbone asymtrique D. Bien que possdant une structure plane, il subit une interconversion rapide le rendant statistiquement de forme pyramidale. E. Cest un acide de Brnsted. QCM 125 : A propos du radical C : A. Il peut tre soit pyramidal (sp3) avec inversion rapide soit plan (sp2), ceci dpendant de son tat dhybridation de dpart. B. Il est cr dans un milieu aqueux fortement polaire. C. Leffet msomre le rend trs stable. D. Il donnera des produits racmiques la suite dune raction avec un autre radical libre. E. Il sera dautant plus stable quil est soumis un encombrement strique moindre. QCM 126 : A propos des intermdiaires ractionnels issus de la chimie organique : A. Ils sont tous forms par rupture htrolytique dune liaison mettant en jeu un carbone originellement hybrid sp3. B. Ils sont lintermdiaire dune cintique ractionnelle de type 1. C. Ils sont lorigine de ractions strospcifiques. D. Ils sont essentiellement stabiliss par effets inductifs. E. Ils ont une dure de vie trs brve. QCM 127 : A propos de leffet inductif : A. Cest le rsultat de la polarisabilit des liaisons, en dautres termes, il est le rsultat direct de llectrongativit des diffrents atomes constituants la molcule. B. + I est un effet inductif attracteur. C. Il se fait ressentir sur plusieurs liaisons et sera exacerb par des liaisons . D. Il a un effet majeur sur lacidit des molcules organiques. E. Il nous permet de prvoir que : HCOOH a un pKa suprieur celui de (FCH2)COOH, mais un pKa infrieur a (CH3)3COOH. QCM 128 : A propos de leffet msomre : A. Il sagit du dplacement de doublets dlectrons le long dune molcule donne en prsence dlments ncessaires ce dplacement. B. Le buta-1,2-dine en est lexemple type, Leffet msomre y a t dmontr par la longueur paticulire de ses liaisons, intermdiaires entre la longueur des liaisons simples et doubles. C. Lhybride de rsonance du buta-1,3-dine peut tre reprsent ainsi : + D. Dans CH3CO, le substituant -CO ou est le sige de liaisons conjugues. E. Les formes limites de rsonance nous donnent une bonne ide des structures relles des molcules subissant des conjugaisons.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

31

QCM 129 : A propos de leffet Inductif et de leffet Msomre : A. Un substituant qui a un effet msomre + I aura galement un effet msomre + M et inversement, un substituant avec un effet inductif I aura un effet msomre M. B. Leffet msomre est toujours prioritaire par rapport leffet inductif, c'est--dire que quand ils agissent tous les deux sur une mme liaison, seul leffet msomre se fera ressentir dun point de vue lectronique. C. Leffet inductif est de manire gnrale plus stabilisant pour les intermdiaires ractionnels organiques que leffet msomre. D. Ils permettent, de manire gnrale, dallonger la dure de vie des intermdiaires ractionnels organiques. E. Ces effets nous permettent de prvoir la rgioslectivit des ractions organiques. QCM 130 : Dans la projection de Fisher A. Comme en Cram, la chane carbone principale est reprsente de faon linaire. B. La chane carbone principale est oriente horizontalement. C. Les liaison horizontales se projettent vers l'observateur. D. Si lordre des substituants tourne en sens anti-horaire le carbone est de configuration S. E. Les liaisons verticales se projettent en arrire du plan de reprsentation. QCM 131 : Soit la molcule suivante :

Elle correspond la(les) reprsentation(s) suivante(s) : A.

B.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

32

C.

. D.

E. elle ne correspond aucune des ces reprsentations. QCM 132 : Soit la molcule suivante:

Elle correspond(s) la(les) reprsentation(s) de Fisher suivante: A. B. C.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

33

D. E. Elle ne correspond aucune de ces reprsentations. QCM 133: Parmi les reprsentation ci-dessous qui utilisent la projection de Fisher, quelle(s) est

(sont) celle(s) qui lui correspondent :

A.

B.

C.

D.

E.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

34

QCM 134 : Parmi les reprsentations ci-dessous qui utilisent la projection de Cram, quelle(s) est (sont) celle(s) qui lui correspondent :

B.

C.

D.

E. Cette molcule possde une possibilit de liaison hydrogne intramolculaire. QCM 135 : Laquelle(lesquelles) de ces reprsentations de Newman ne correspond(ent) pas cette molcule?

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

35

A.

B.

C.

D.

E. QCM 136 : Parmi ces diffrentes reprsentations laquelle(lesquelles) correspond(ent) la molcule suivante?

A.

B.

C.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

36

D. E. Soit la molcule suivante :

Sa temprature d'bullition est suprieure celle de la molcule de l'nonc. QCM 137 : A propos des structures cycliques : A. Les configurations chaise sont les plus stables. B. Les configurations bateau sont les plus stables. C. Plus il y a de liaisons axiales, plus la molcule est stable. D. Plus il y a de liaisons quatoriales, moins la molcule est stable. E. Plus les substituants sont proches, plus la molcule est stable. QCM 138 : A propos de la chiralit A. La notion de chiralit illustre le fait que certaines molcules ne sont pas superposables leur image dans un miroir. B. On ne parle pas de chiralit pour les molcules prsentant un carbone asymtrique. C. Lnantiomrie ne senvisage que pour des molcules chirales. D. Les molcules chirales possdent une activit optique. E. Si une molcule chirale possde un seul carbone asymtrique, celui-ci est reli 4 substituants diffrents. QCM 139 : Soit la molcule d'acide lactique selon la reprsentation de Fisher A. Elle possde 2 nantiomres : l'acide L-lactique et l'acide D-lactique. B. L'acide L-lactique a son OH qui se projette gauche. C. L'acide D-lactique dvie la lumire gauche. D. Deux nantiomres possdent un pouvoir rotatoire de signes opposs. E. L'acide lactique possde 2 carbones asymtriques. QCM 140 : A propos de la stroisomrie : A. Dans la formule 2n, n reprsente le nombre de carbones asymtriques. B. Une molcule possdant plusieurs carbones dont seulement 3 sont asymtriques prsente au moins 8 stroisomres. C. Deux nantiomres sont diastroisomres. D. Un compos rythro en reprsentation de Newman a ses substituants qui sclipsent. E. Un compos thro peut tre un mso.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

37

QCM 141 : Soit la molcule suivante : CH3-CHOH-CHOH-CH3 A. Cette molcule possde 4 stroisomres. B. Un mso est un stroisomre avec un plan de symtrie. C. Cette molcule prsente un carbone asymtrique. D. Cette molcule est un mso. E. Cette molcule en configuration RR peut tre le produit dune oxydation douce du but-2-ne. (Z) par le permanganate de potassium dilu, froid. QCM 142 : Soit la molcule CH2Cl-CHOH-CHCl-CHOH-CH2OH : A. Prsente deux carbones asymtriques. B. Prsente 3 stroisomres, un mso et un couple thro. C. Prsente 4 stroisomres, un couple rythro et un couple thro. D. Il n'y a aucune relation entre configuration absolue et activit optique. E. Prsente 8 stroisomres actifs sur la lumire polarise. QCM 143 : A propos des liaisons intermolculaires : A. Les forces de Debye sexercent entre diples permanents et diple induits, et peuvent entraner des modifications du nuage lectronique mme sur une molcule parfaitement symtrique. B. Les forces de London sexercent sur des molcules lgrement polarises au dpart. C. Les forces de Keesom et celles de Debye font partie des forces de Van Der Waals, mais pas les forces de London. D. Les forces de Debye sexercent entre diples permanents et diples induits, celles de London entre diples induits et diples spontans. E. Les liaisons Van Der Waals sexercent obligatoirement sur des molcules polarises au dpart. QCM 144 : A propos des liaisons intermolculaires : A. Les gaz rares peuvent tre mis en jeu dans des liaisons de nature lectrostatique ou forces de Van Der Waals. B. Parmi les nergies dinteraction caractrisant les forces de Van Der Waals, celles concernant les forces de London sont les plus fortes. C. Les forces de dispersion augmentent avec la masse molaire, bien que le nuage lectronique soit plus grand et donc moins dformable. D. De manire gnrale, la temprature dbullition augmente avec la masse molaire. E. La temprature dbullition de la molcule HCl est infrieure celle de la molcule HBr. QCM 145 : A propos des liaisons inter et intramolculaires : A. Les atomes peuvent interagir entre eux soit par des liaisons intermolculaires, soit par des liaisons intramolculaires. B. Le rayon de Van Der Waals de la molcule H2 est la moiti de la distance entre les deux noyaux des atomes dhydrogne rapprochs au maximum avant la formation de la liaison covalente. C. Le rayon de Van Der Waals peut tre calcul pour deux atomes runis par un recouvrement latral. D. Lors de la formation de liaisons covalentes, les deux atomes sinterpntrent. E. Concernant la molcule deau, on peut calculer le rayon de Van Der Waals car il sagit de liaisons lectrostatiques intramolculaires. QCM 146 : A propos des proprits physiques et chimiques des molcules : A. Le modle balles et btonnets est intressant pour nous indiquer les proprits superficielles de la molcule. B. La temprature dbullition dune molcule ramifie est infrieure celle de son isomre linaire. C. La forme dune molcule a une influence importante sur sa temprature dbullition. D. Les molcules linaires tablissent des liaisons Van Der Waals de type London plus fortes que les molcules ramifies. E. Les possibilits dinteraction entre molcules peuvent tre facilement visualises grce au modle balles et btonnets . Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 38
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 147 : Groupements donneurs +M et groupements attracteurs -M: A. Les groupements ayant un effet +M ont aussi un effet +I. B. Les halognes sont des donneurs d'lectrons. C. Les groupements C=O sont le plus souvent attracteurs d'lectrons. D. Dans un systme conjugu le groupement aldhyde possdera une charge ngative la forme limite. E. Le groupement -CN est donneur +M. QCM 148 : Cas lectrons -> lectrons : A. La conjugaison s'effectue sur une succession de liaisons , , . B. Le prop-2-nal est le sige de ce cas de rsonance. C. Son hybride de rsonance est caractris par une dlocalisation des lectrons sur toute la longueur de la molcule. D. La forme limite du prop-2-nal fait apparatre des charges positives et ngatives. E. La propylamine est le sige de ce type de rsonance. QCM 149 : Autres systmes conjugus: A. Cas lectron impair -> lectron : l'lectron clibataire est spar par une liaison de l'lectron . B. Cas lectron impair -> lectron : deux carbones voisins ont la garde partage de llectron clibataire. C. Les lectrons peuvent tre conjugus avec une case vide d'un atome en du Carbone qui porte la double liaison. D. Les lectrons n ne peuvent tre conjugus avec des lectrons . E. Les cases vides peuvent tre conjugues avec les lectrons , n, impairs. QCM 150 : Gnralits sur la rsonance, msomrie, conjugaison: A. La conjugaison modifie un peu la charge globale de la molcule. B. Les atomes concerns par la rsonance doivent tre dans un mme un plan. C. La msomrie abaisse le niveau d'nergie de la molcule. D.CH2=CHCH=CH2 est le sige d'une dlocalisation des lectrons sur la molcule. E. Les noyaux benzniques peuvent tre le sige de rsonance. QCM 151 : A propos du phnol : A. Le phnol admet six formes limites de rsonance. B. 2 formes limites de rsonance ont des charges positives ou ngatives. C. La fonction alcool fait partie des groupements accepteurs dlectrons. D. On trouve une charge ngative en ortho dans deux de ses formes limites de rsonance. E. Le phnomne permettant de passer dune forme limite lautre sappelle relocalisation. QCM 152 : A propos de lacidit et de la basicit : A. Le CH3-COOH est plus acide que HCOOH. B. HO-CHF-COOH est plus acide que H2N-CHF-COOH C. CH3-NH2 est moins acide que CH3-NH-CH3. D. CH3-COO- est plus basique que Cl-CH2-COO-. E. Plus un acide est faible, plus sa base conjugue est forte. QCM 153 : A propos de laromaticit : A. Avoir un cycle plan est une condition daromaticit. B. Avoir des liaisons conjugues nest pas une condition daromaticit. C. La rgle de Hckel est : 4n+2 avec n tant un rel quelconque. D. La caractristique dun systme aromatique est le fait dtre inodore. E. Quand on a affaire un cycle qui obit la rgle de Hckel, le niveau dnergie de la molcule est encore plus bas donc plus stable.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

39

QCM 154 : Soit la molcule suivante : C6H5-CH2+ A. Cette molcule peut tre appele carbanion. B. Ses formes limites de rsonance font toutes apparatre une charge positive. C. Une de ses formes limites de rsonance porte une charge positive en mta. D. Il existe 5 formes limites de rsonance de cette molcule. E. Lhybride de rsonance ne comporte aucune charge ngative. QCM 155 : Concernant les grands types de raction. A. Lhydratation est une raction daddition. B. Si on ne considre pas les intermdiaires ractionnels, dans une raction dlimination, les carbones impliqus changent dhybridation, ce qui nest pas le cas dans la raction de substitution. C. La raction daddition se fait sur un compos satur riche en lectrons . D. Il existe 2 types de ractions dadditions : les additions lectrophiles de 1er ordre, et les additions nuclophiles de 2me ordre. E. Il y a modification du squelette carbon dans la raction de transposition. QCM 156 : Soit la raction non strospcifique suivante.
Br H3C CH H2N CH CH3 HBr + ...

A. Il sagit dune raction dlimination de 2me ordre. B. Elle seffectue en 2 tapes. C. Le carbocation intermdiaire form au cours de la raction est moins stable que le carbocation suivant : CH3-CH2+ D. On obtient majoritairement le 3amino but-1-ne. E. Cette raction est rgioslective. QCM 157 : Soit la raction suivante de 1er ordre.

Cl-

OH-

A. Cette raction de SN1 seffectue en 2 tapes. B. Lintermdiaire ractionnel est un carbocation dont le carbone charg + est hybrid sp2. C. On obtient 2 diastroisomres SR et SS. D. Cl- intervient dans la cintique de la raction. E. Le carbone impliqu dans la substitution ne change jamais dhybridation tout au long de la raction.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

40

QCM 158 : Soit la raction de dshydrohalognation sur le compos suivant (2me ordre).
Br H3C CH2 C CH3 CH CH2 CH3 NH2

A. La raction est strospcifique. B. La raction est rgioslective. C. La raction passe par un tat de transition, o il y a intervention dune base. D. Un des carbones impliqu dans llimination shybridera sp2. E. Cette raction dlimination se droule en 2 temps. QCM 159 : A. La raction : aldhyde + alcool hmiactal, est une addition lectrophile. B. Il existe 3 types de substitutions. C. Dans un rarrangement, on passe dun alcne Z un alcne E (car celui-ci est plus stable) en prsence dune base jouant le rle de catalyseur. D. Un driv halogn donne un alcne par dshydrohalognation. E. Dans une substitution nuclophile, lchange du complment nuclophile avec le groupement partant se fait sur un carbone appauvri en lectron. QCM 160 : Le compos suivant peut subir une raction SN1 en prsence dune base telle que OH-, et une raction E1. Pour chaque raction on obtient deux composs.
H 3C H 5C 2 Cl C CH2 C 6H 5

A. Par mcanisme E1, le produit le plus majoritaire est : daprs la rgle de Markownikov.

CH 3 C C2H5 C

C6H5

B. Si on rajoutait plus de OH-, la vitesse de raction de SN1 serait augmente. C. Lintermdiaire ractionnel est dans les deux cas un carbocation. D. Par SN1, lalcool obtenu est de configuration R uniquement. E. Le carbocation capte llectrophile OH- dans une liaison donneur/accepteur. QCM 161 : Comparaison entre SN1 et SN2 A. Le mcanisme SN1 aboutit une raction non strospcifique B. SN2 passe par un tat de transition sp3sp3d2sp3 C. Linversion de Walden se produit lors dune raction SN1. D. La stabilit du carbocation dtermine la vitesse de la raction SN1. E. Plus un driv halogn a de substituants sur le carbone o se produit la substitution, plus SN2 est favorise.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

41

QCM 162 : A propos de laddition, de llimination et de la substitution. A. Laddition de HCl en prsence de proxyde donne majoritairement :
H2C CH CH3

HCl

H3C

CH Cl

CH3

B. Pour un carbone primaire on a presque exclusivement que de la SN2. C. On peut avoir une comptition entre SN1 et E1 qui se ralisent lune aprs lautre. D. Plus un alcne est substitu plus il est stable. E. Les substituants intressant la raction SN1 se mettent en position antipriplanaire. QCM 163 : Soit lalcne CH3CH=CHCH3 en prsence deau et d acide sulfurique. A. Le compos obtenu est le butan-1-ol. B. Le compos obtenu est le butan-2-ol. C. Le compos obtenu est le butan-3-ol. D. On obtient un mlange racmique. E. Lalcne de dpart a une isomrie Z/E. QCM 164 : Concernant les tempratures dbullition et les liaisons hydrogne. A. HBr a une temprature dbullition plus leve que HF. B. Dans une solution pure dther CH3OCH3, 2 liaisons hydrogne peuvent stablir grce aux 2 doublets de loxygne. C. 4 liaisons hydrogne intermolculaires sont lorigine de la structure ttradrique de leau. D. Le propane a un point dbullition infrieur au propanol. E. Le butanol a un point dbullition suprieur au propanol. QCM 165 : Soit le 3mthylhexane en prsence de dichlore (Cl2), forte temprature. A. Cette raction se droule en 3 phases : initiation, propagation, arrt. B. Dans le mlange on a seulement des composs de configuration R. C. On obtient la fin un mlange racmique. D. Lun des intermdiaires de la raction est un carbanion. E. Dans la phase darrt on peut obtenir plusieurs composs notamment un alcane avec 14 atomes de carbone. QCM 166 : Hydrognation catalytique du 3mthylpent-1-ne. A. Cette addition est une cis addition. B. La molcule obtenue est le 3mthylpentane. C. On obtient un mlange racmique. D. Le compos obtenu est de configuration R. E. On a ralis une addition simultane sur un alcne. QCM 167 : Soit lalcane CH3CH2CH3 en prsence de dibrome (Br2) forte temprature. A. Durant la phase dinitiation on obtient 2 radicaux brome. B. Lun des intermdiaires de la raction est un carbanion. C. Le radical est une molcule stable. D. Comme produit final on obtient entre autres le 2bromopropane. E. Cette raction peut tre qualifie de substitution radicalaire en chane.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

42

QCM 168 : Proprits communes aux hydrocarbures A. Sous le terme dhydrocarbures, on regroupe des composs constitus uniquement par des atomes de C et de H. B. Les hydrocarbures monocycliques saturs sont de forme CnH2n C. En passant des alcanes aux alcnes puis aux alcynes, on augmente le degrs dinsaturation des composs. D. Un vhicule de masse 1340kg contenant un plein dessence de 56 litres sera plus lgre que le mme vhicule avec un plein de gazole. E. Les diffrences dtat physiques des hydrocarbures temprature ambiante sexpliquent par laugmentation des tempratures de fusion et dbullition des alcanes paralllement laugmentation de la longueur de la chane carbone. QCM 169 : Interactions molculaires. Combustion. A. Lapparition dune double liaison dans un compos entrane une diminution des interactions intermolculaires et donc une diminution de leur temprature de fusion et dbullition. B. La temprature dbullition dun oct-1-yne est infrieure celle dun oct-1-ne. C. La combustion dun hydrocarbure correspond loxydation brutale du compos aboutissant la formation de CO2, H2O et dun produit final de raction. D. Pour faire le bilan thermodynamique dune raction de combustion, on soustrait lnergie de liaison (signe -) lnergie libre lors de la combustion (signe +). E. Lnergie dune liaison C=O est trs nettement suprieure celle dune simple liaison C-C. QCM 170 : Alcanes A. En raison de leur longue chane carbone, les alcanes sont des composs trs ractifs. B. Les alcanes sont des composs insaturs de type CnH2n+2 C. Les alcanes peuvent ragir par substitution radicalaire spontane au cours de laquelle un radical instable vient taper un alcane qui son tour devient radicalaire et assure ainsi la propagation de la raction. D. La raction radicalaire sarrte lorsque 2 radicaux ragissent entre eux et redeviennent stables : cest phase de terminaison. E. Les alcanes peuvent galement ragir avec le difluor. QCM 171 : Alcnes A. Lhydrognation des alcnes est une CIS hydrognation cest--dire que les 2H se fixent du mme ct par rapport au plan de la molcule. B. Par leur hydrognation, on passe dun compos insatur un compos satur. C. Soit la molcule suivante soumise une hydrognation, la raction peut tre crite comme suit :
H3C CH3 CH3 H3C H2 H3C H H CH3 CH3

H3C

D. La molcule obtenue est une molcule asymtrique E. Dans ces processus dhydrognation, la prsence du nickel permet ladsorption des atomes dH et ainsi la cis addition. QCM 172 : A propos de lhydrohalognation : A. Il peut sagir dune substitution lectrophile. B. Il peut sagir dune substitution radicalaire. C. Il peut sagir dune addition radicalaire. D. Il peut sagir dune addition lectrophile. E. Il peut sagir dune addition nuclophile.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

43

QCM 173 : A propose de lhydrohalogenation, mcanisme lectrophile : avec HBr. A. Le mcanisme fait intervenir comme intermdiaire ractionnel un carbanion. B. Le mcanisme fait intervenir un carbocation comme intermdiaire ractionnel. C. Le mcanisme fait intervenir un radical comme intermdiaire ractionnel. D. Cest une raction strospecifique : cis-addition. E. Cest une raction rgioselective, cest--dire que laddition de Br sur lun des carbones porteurs de la double liaison se fait prfrentiellement sur le carbone le plus substitu. QCM 174 : A propos de lhydrohalogenation, mcanisme radicalaire : avec HBr. A. Cest une raction qui se droule en une phase. B. Il existe une phase dinitiation faisant intervenir lalcne. C. Lors de linitiation, le peroxyde est chauff pour donner un radical qui attaquera lalcne, qui son tour attaquera le HBr, donnant un driv halogn. D. La phase darrt correspond la rencontre de 2 radicaux prsents dans la raction. E. Br produit grce au peroxyde de benzoyle forte temprature agissant sur HBr, intervient dans la phase de propagation en sadditionnant prfrentiellement au niveau du carbone le moins substitu sur lalcne prsent. QCM 175 : A propos de lhalognation dun alcne par Br2 suivant un mcanisme lectrophile : A. Il sagit dune raction strospcifique trans. B. Elle met en jeu une rupture htrolytique de Br2 aboutissant la libration dun Br- et dun Br+. C. Elle est caractrise par la formation dun anion pont qui sera attaqu par Br+. D. Il sagit dune trans-addition. E. Elle est caractrise par la formation dun cation pont. QCM 176 : A propos de loxydation douce : A. Alcne + Peracide Epoxyde + Acide B. Lepoxyde tant trs stable, il donne des -diols en prsence dH2O seulement chaud. C. Elle peut se faire avec KMnO4 concentr et chaud. D. Loxydation douce utilisant le KMnO4 est une trans-addition. E. Loxydation douce utilisant le peracide est une cis-addition. QCM 177 : A propos de loxydation forte : A. Alcne + O3 Ozonide B. Lozonide est un intermdiaire ractionnel instable. C. Si les carbones intresss par la double liaison sont lis deux radicaux -R loxydation forte entranera la formation de deux ctones condition de le faire en prsence de Zn et en milieu acide. D. En condition rductrice, les aldhydes produits ragissent avec H2O2 pour donner lacide correspondant et de leau. E. LO3 est le seul compos permettant loxydation dure sur un alcne.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

44

QCM 178 : Soit loxydation dure suivante :

A. En condition non rductrice on obtient 1 fonction acide et une fonction ctone. B. En condition rductrice (Zn en milieu acide) les fonctions aldhydes sont protges de loxydation par des molcules dH2O2. C. En condition rductrice on obtient une aldo-ctone et un aldhyde. D. Cette raction se fait en une seule tape. E. Cette raction est une raction complexe avec un ion pont en intermdiaire ractionnel. QCM 179 : A propos des hydrocarbures benzniques : (1) Cl2 + AlCl3 (a) + AlCl4(2) Benzne + (a) (b) (3) (b) (c) + H+ (4) (c) + (a) 1/3 (d) + 2/3 (e) A. (d) a un groupement en para. B. AlCl3 est une base de Lewis. C. Les halognes ont un effet inductif donneur et un effet msomre attracteur. D. Le H+ de la raction 3 est limine sous forme gazeuse. E. (a) reprsente un ractif lectrophile: Cl-. QCM 180 : Soit (a) le benzne: (1) (a) + Br+ (b) (2) (b) (c) + H+ (3) (c) + Mg (d) ,en milieu anhydre et avec de ltheroxyde (4) (d) + (c) (e) + MgBr2 A. Letheroxyde stabilise la molcule (d). B. Dans lair atmosphrique (d) reste stable. C. (e) a pour formule C10H8. D. (e) est un compos hydrophile. E. (c) a un groupement qui orienterait une nouvelle substitution lectrophile en para/ortho. QCM 181 : Soit E le bromure dEthylmagnsium ( on donne les rsultats aprs hydrolyse): E + propanal (a) E + (b) acide propanoque E + propanone (c) A. (a) est le pentan-2-ol. B. (a) est le pentan-3-ol. C. (b) est le HCHO. D. (c) est le 2-mthylbutan-2-ol. E. (c) est le 3-mthylbutan-3-ol.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

45

QCM 182 : Soient les composs suivants: (1) : (C2H5)3C-OH (2) : HCl (3) : (CH3)3-C-OH (4) : CH3OH A. Par ordre de basicit dcroissante, on a: (2), (4), (3), (1). B. (1) est un acide faible cause de son effet msomre: il retient OH. C. Plus le pKa est grand, plus cest un acide fort. D. Un alcool primaire a 3 H autour du C. E. Les alcools et les thers sont solubles dans leau. QCM 183 : propos des ractions avec les hydrocarbures benzniques A. A partir du cyclohxne, on peut avoir trois types ractions. B. En milieu acide et en prsence d'eau, le benzne ragit. C. Le benzne, du fait de son caractre aromatique, possde une plus grande stabilit. D. Cette raction est une hydrohalognation.
Br

HBr

E. L'oxydation douce se fait en prsence de KMnO4 concentr. QCM 184 : A propos de la substitution par le Cl A. Lors de cette raction on utilise un catalyseur qui est un acide de Lewis. B. Cette raction se droule en trois tapes. C. La 2me tape va aboutir la rgnration du catalyseur. D. Cette molcule est un carbanion.
Cl H CH
+

E. Le bilan d'une raction de substitution par le Cl est : C6H5Cl + HCl C6H6 + Cl2 QCM 185 : On considre la molcule de benzaldhyde C6H5-CHO : A. Le groupement CHO est un orienteur mta dsactivants. B. Cette molcule est plane. C. L'action du mlange de Cl2 + AlCl3 sur le benzaldhyde aboutit la formation d'un driv chlor en mta. D. L'action de H2SO4 puis de SO3- sur le benzne aboutit la formation de drivs sulfons ortho et para. E. CHO est un groupement donneur. QCM 186 : A propos des organomagnsiens A. Ils rpondent la formule gnrale : R-MgX o X reprsente un halogne. B. Ils ne se forment qu'en prsence d'un solvant ( theroxyde ) et en milieu anhydre. C. Le Mg porte une charge partielle ngative. D. Le Mg prsente une structure ttradrique et il est hybrid sp3. E. En prsence d'une fonction ctone on observe une raction de substitution.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

46

CORRECTION
QCM 1 : Rponse vraie : D A-F La charge du neutron est nulle mais par contre llectron a la mme valeur de la charge que celle du proton en valeur absolue. B-F Noyau=neutrons + protons=nuclons et on a des lectrons qui gravitent autour du noyau pour former latome. C-F Le noyau est charg positivement cause des protons le constituant. D-V E-F Numro atomique ou nombre de protons: Z . QCM 2 : Rponses vraies : AB A-V B-V Le deutrium et lhydrogne ne sont pas radioactifs. C-F Il nest pas radioactif, on utilise le 32P* et le 33P*. D-F Certains sont radioactifs donc instables. E-F Un lectron est 1000 fois plus lger que chacun des nuclons du noyau. QCM 3 : Rponses vraies : ABCE D-F Tout est vrai sauf que lon parle du 12C. QCM 4 : Rponses vraies : BE A-F Car pour calculer la masse atomique moyenne, il faut tenir compte des diffrents isotopes des lments (voir exemple du cours avec le chlore). B-V Ce sont les lectrons qui permettent dobtenir des ions, de subir diffrentes ractions. C-F Les isotopes ont mme Z donc mme nombre dlectrons. D-F Pour un atome on a autant de charges positives que de charges ngatives donc on a nbre de protons=nbre dlectrons. E-V QCM 5 : Rponses vraies : AC B-F Car on a un atome qui a perdu 2 lectrons, donc un cation, avec 18 lectrons pour 20 protons. C-V Il faut tenir compte des isotopes. D-F Il faut tenir compte des isotopes. E-F Il a 13 nuclons, 6 protons et 7 neutrons (nbre neutrons=A-Z). QCM 6 : A B. Les neutrons sont, daprs leur dnomination, neutres donc nont pas de charge. C. Idem. D. La masse dun lectron est environ mille fois plus faible que celle dun proton. E. Par dfinition un atome est neutre lectriquement au contraire dun ion qui lui est charg (+ ou -). QCM 7 : C A. cf. B B. La charge lmentaire q a pour unit le Coulomb. D. Cest la masse atomique de latome de carbone qui est gale 12. Son numro atomique est gal 6. E. Latome dhydrogne est compos dun proton et dun lectron uniquement. QCM 8 : AC B. cf. tableau de classification D. partir dun certain nombre de nuclons (pour les gros atomes) certains lments sont radioactifs. E. Un lment peut possder des isotopes radioactifs.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

47

QCM 9 : AB C. Par dfinition, les isotopes dun lment diffrent par leur nombre de protons. D. Le nombre dAvogadro est gal 6,022.1023 E. Cest le Dalton (Da) QCM 10 : ACDE B. Une mole de 12C correspond 12g de carbone. QCM 11 : BE A.F Seulement 4. E.V Le 13N et le 16N. QCM 12 : AB B.V 14.0031 x 0.99635+15.0001 x 0.00365. C.F Tenir compte aussi du 15N. D.F Seulement isotope stable dans la nature (pour lazote!). E.F Aussi 15N. QCM 13 : ABC A.V 3x1 + 31 + 16x 4 = 98. B.V m = c.V.M (cf. cours) = 0.5 x 0.01 x 98=0.49g soit 490 mg. E.F n = C .N = 0.2 x 10-3 x 6.022x1023 = 3.011x1020. QCM 14 : E A.F Le modle de Bohr est le plus abouti. B.F Autour du noyau. C.F Positives. D.F Que pour lhydrogne mais adapt aux autres. QCM 15 : CD A.F Cest linverse. B.F 8 seulement. E.F retour ltat fondamental. QCM 16 : C A. F. Mme s'ils ont des noms diffrents, ce sont trois isotopes de la famille isotopique de l'hydrogne. B. F. D est stable c'est donc juste un isotope de H. T par contre est un radio isotope de H. C. V. En effet, il manque le pourcentage de prsence de chacun des isotopes dans la nature pour pouvoir pondrer la moyenne. Ne jamais faire 1+2+3 = 6 ---> 6/3 = 2 qui donnerait une masse atomique moyenne de 2. D. F. Deux atomes sont des isotopes que si leurs Z sont gaux et leur A diffrents. E. F. Il faut un nombre de neutrons diffrent. QCM 17 : ACD B. F. Il faut absolument un cran pour recueillir le spectre de l'lment test. D. V. Notamment les mdicaments base d'iode. E. F. Du modle de Bohr. QCM 18 : ABD C. F. Il est uniquement valable pour l'hydrogne. D. V. Si on se place dans la thorie de la mcanique quantique. E. F. Le noyau est entre 10 000 et 100 000 plus petit que l'atome.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

48

QCM 19 : ABDE QCM 20 : AE B : F ce sont les orbitales p. C : F c'est l'orbitale p qui est spare par le plan nodal. D : F Deux lobes de signes opposs. QCM 21 : BD A : F -l<m<+l C : F l est positif E : F 0<l<n-1 QCM 22 : ACE B : F nombre maximum de spins parallles D : F 1s2 2s2 2p6 3s2 3p3 QCM 23 : BD A : F n, m, l et s C : F + et - E : F Le carr. QCM 24 : D QCM 25 : B A. F : ce sont les nombres quantiques n, l, m. C. F: l dfinit la forme gnrale de lorbitale. D. F: l entier infrieur ou gal a n-1 et suprieur ou gal 0. E. F: cest un calcul de probabilit, ce nest pas une position exacte. QCM 26 : BC QCM 27 : ADE B. F : cest une symtrie sphrique C. F : il nexiste pas dorbitales p pour le niveau n = 1. QCM 28 : ABDE C. F : 5s < 4d < 5p < 6s QCM 29 : ACD B. F : Pour crire on met toujours lorbitale la plus petite (plus petit n) avant, mme si celle-ci a une nergie suprieure la suivante, de toute faon lorbitale 4s nintervient pas ici : 1s2 2s2 2p6 3s2 3p4. E. F : il y a plusieurs erreurs : mme chose que pour la B (ordre dcriture pas respect) ; et il sagit dun cas particulier o on sature la dernire couche afin de donner davantage de symtrie latome (3p6 3d10; 4s1) comme pour 24Cr. QCM 30 : ABDE C : F car ..4s1 3d5, cest une rtrogradation

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

49

QCM 31 : AC B : F : Par leur masse atomique A. D : F voir la rgle de Klechkowski. E : F voir la rgle de Klechkowski. QCM 32 : A A:V B : F Mtaux alcalins C : F De la priode prcdant la leur. D : F Le Zn et le Cd ont une couche d pleine (d10). E : F Tous les lectrons des gaz rares sont apparis. QCM 33 : CD A : F Nombre de neutrons= A-Z. B : F Lnergie de premire ionisation sur une mme ligne varie dans le mme sens que le numro atomique. E : F 1s2 ; 2s2 donc il possde deux lectrons apparis. QCM 34 : CDE A : F Cest le plus stable (gaz rare). B : F le plus petit D : V Largon est stable. QCM 35 : CD A : F: 4 priode B : F: n=3, do l=0 ou l=1 ou l=2, donc m compris entre -2 et +2. C : V Nmax=2n=2x3=2x9=18 E : F car Ti2+ est un Cation!!!!! QCM 36 : Aucune Tout est faux Mthode : il faut crire la structure lectronique de chacun et on se rend compte quils possdent tous au moins un lectron clibataire. QCM 37 : ABC D. Le rayon atomique diminue. E. Cest la somme : nergie de 1re ionisation + nergie de 2me ionisation. QCM 38 : ABCD E. D appartient la 5me priode. QCM 39 : ABD C. LO2 est rduit par les lectrons. E. Elle ncessite de lnergie : elle est endothermique. QCM 40 : ACDE B. Cest le cobalt ( Co ). QCM 41 : ACE B. Infrieure Z et suprieure X. D. X (= Ca) nappartient pas aux mtaux de transition.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

50

QCM 42 : BE A. F plus forte C. F anion D. F ces ractions ne librent pas dnergie mais en absorbent. QCM 43 : BC A. F 1s2 2s2 2p6 3s2 3p6 3d5 4s1 D. F cest le Rb E. F Le Ga nest pas un oligo lment. QCM 44 : ACE B. F Laffinit lectronique diminue en descendant dans la mme colonne. D. F car il y a rpulsion de llectron ; la raction est donc endothermique. QCM 45 : ACD B. F transcription E. F galement toxiques si doses leves QCM 46 : ABE C. F plus faible D. F 1s2 2s2 2p6 3s2 3p6 3d10 4s1 : ne pas oublier la rtrogradation! QCM 47 : BCD A. F Dans une priode llectrongativit augmente de gauche a droite. E. F Dans la molcule dacide chlorhydrique le doublet est plus proche du chlore. QCM 48 : AB C. F Le pentachlorure de phosphore ne respecte pas la rgle de loctet. D. F La premire priode de la classification ne respecte pas la rgle de loctet. E. F Les halognes ont 1 forte tendance rcuprer 1 lectron pour adopter la configuration lectronique du gaz rare qui les suit dans la classification. QCM 49 : ADE B. F Les lectrons sont rpartis de manire homogne entre les 2 atomes. C. F La polarisation dune molcule na rien avoir avec la prsence de double liaison. QCM 50 : AD B. F Plus latome est lectrongatif plus il est avide dlectrons. C. F La molcule de N2 na pas de moment dipolaire ; les deux atomes ont la mme charge. E. F Une molcule polaire liaisons polarises Des liaisons polarises ne signifient pas forcment que la molcule est polaire. QCM 51 : ABCD E. F Pour les liaisons ioniques lnergie de liaison varie en fonction du milieu (cf nergie de liaison dans leau)

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

51

QCM 52 : E

Les 2 O accepteurs sont ltat excit QCM 53 : ABD

Le doublet non liant de N ralise une liaison dative avec lorbitale vacante de B. La molcule est lectriquement neutre ! QCM 54 : ABCE

S est ltat excit comme lO dans la molcule POCl3 du cours (structure lectronique externe identique)

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

52

QCM 55 : ABC

A. D. Liaisons ioniques E. Liaisons datives QCM 56 : D A. 1 liaison et 2 liaisons B. question dattention! C. 2 doublets dlectrons autour de Be (2 orbitales 2p vacantes sur Be) D. liaisons E. pas uniquement s : s+s, s+p ou p+p. QCM 57 : ADE B : F pyramide base triangulaire. C : F est rduit 107. QCM 58 : AC B : F S a 2 valences car 2 lectrons clibataires. D : F C a 4 valences car 4 lectrons clibataires (tat excit). E : F il manque un doublet non liant sur O ! QCM 59 : E A : F le dbut est vrai mais la liaison triple est la plus solide. B : F cest linverse. C : F elle est plus grande car le volume augmente. QCM 60 : ADE B : F il est excit. C : F aucun. D : V et 3 non liants. E : V cest un ttradre : pyramide base triangulaire. QCM 61 : CD A : F inverse. B : F Br tant plus lectrongatif, il attire les lectrons. D : V le volume augmente quand on va vers le bas. E : F CH4 est apolaire et ne peut donc pas dformer KBr. QCM 62 : ABD C. F : Elles sont perpendiculaires entre elles. E. F : La position est incertaine.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

53

QCM 63 : ABD C. F : elles sont identiques. E. F : l'angle est de 1095 ou infrieur si prsence de doublets non liants, 120 est l'angle de l'hybridation sp2. QCM 64 : BCE A. F : c'est la qui se forme par recouvrement axial. D. F : c'est le contraire. QCM 65 : ABCD E. F : il doit passer l'tat excit. QCM 66 : ACE B. F : il augmente. D. F : seulement latral. QCM 67 : AE B. F sp3 : ttradre parfait et sp2 : structure coplanaire. C. F cest le doublet non liant de N qui participe cela. D. F pas le NH3. QCM 68 : AB C. F de manire latrale. D. F une liaison et deux liaisons . E. F alcyne sp linaire, et alcne sp2 plane. QCM 69 : CE A. F 3 de120 et 6 de 90. B. F Seul le P peut dlocaliser des lectrons dans les couches d. N appartenant la priode 2 ne peut pas envoyer des lectrons dans les orbitales d car il nen a pas. D. F Les deux liaisons perpendiculaires sont plus longues que les 3 autres. QCM 70 : DE A. F BF3 est sp2. B. F un seul est sp2 et les deux autres sont sp3. C. F N2H2 seulement est coplanaire. QCM 71 : ADE B. F Ce cas est une exception la rgle de loctet. C. F recouvrement axial. QCM 72 : E A. F dans la molcule deau langle entre les liaisons est de 104,5 et latome doxygne est hybrid sp3 B. F cf A C. F un doublet non liant occupe un volume plus important quune liaison D. F il existe plusieurs possibilits. Exemple : NH3 latome dazote est hybrid sp3 et fait trois liaisons et a un doublet non liant. E. V latome doxygne QCM 73 : ABD C. F cest un triangle dont le centre est latome hybrid sp2 E. F lorbitale vide se dispose perpendiculairement par rapport au plan de la molcule

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

54

QCM 74 : ABE C. F cest une bipyramide trigonale D. F deux liaisons sont plus longues que les trois autres QCM 75 : ABE C. F les carbones sont hybrids sp D. F elle a une forme de ttradre (le Phosphore a un doublet non liant : il est hybrid sp3) QCM 76 : AD B : F Fe ferreux. C : F liaisons datives. E : F bipyramide base carre. QCM 77 : D A. F recouvrement latral. B. F recouvrement axial. C. F uniquement 2p pures. E. F orbitale pure uniquement s et p pas d ni f. QCM 78 : ABD C. F pas sp3d ni sp3d2. E. F sp3 (il faut tenir compte des doublets non liants). QCM 79 : BD A. F attention msomrie le C est sp2 mais les O ne sont ni sp2 ni sp3 (mme sils sont plus proches de sp2). B. V Un des lectrons de la paire dans 3s se dplace vers 3d donc possibilit dhybridation sp3d1. C. F la molcule NCl5 ne peut pas exister. D. V exemple SF6. E. F le C est hybrid sp cest le fer qui est sp3d2. QCM 80 : B A. Absolument pas : par exemple dans NH3 l'atome d'azote n'est pas excit mais est hybrid sp3. B. A noter tout de mme que l'hybridation des orbitales molculaires permet d'expliquer la gomtrie des molcules alors que la thorie VSEPR permet de prvoir cette gomtrie. Elles sont donc complmentaires... C. Recouvrement axial, les hybridations ne sigent que dans les recouvrements de type sigma. Tout le reste est entirement vrai. D. C'est l'inverse. E. Attention aux parenthses !!! L'item est juste l'exception du fait que les recouvrements axiaux sont de type et les latraux de type . QCM 81 : AC A. A noter tout de mme que l'hybridation des orbitales molculaires permet d'expliquer la gomtrie des molcules alors que la thorie VSEPR permet de prvoir cette gomtrie. Elles sont donc complmentaires... B. Les liaisons multiples sont considres comme une seule paire. C. Attention ne pas compter la triple liaison part !!! D. NH3 a 4 paires d'lectrons (3 liantes et 1 non liante appartenant l'azote). E. N'existe pas encore, inventer...

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

55

QCM 82 : CE

A. Le soufre est au centre de deux liaisons covalentes pures avec des complexes hydroxyles (OH) et deux liaisons datives avec des atomes d'oxygnes sous forme excite. B. idem C. idem D. sp3 E. Selon VSEPR, quatre paires d'lectrons entourent le soufre donc l'acide sulfurique a une gomtrie ttradrique. QCM 83 : ACDE

NO2NO2+ NO . A. voir schma B. pas NO2+ qui a son seul doublet engag dans une liaison dative C. voir schma D. voir schma E. voir schma QCM 84 : AB A. voir schma B. Attention, les doublets non liants ne font pas partie de la forme que prend la molcule, quand on voit la molcule d'IF4- on ne les verra pas...la molcule a une gomtrie octadrique mais elle nous apparatra carre !!! C. IF4- aura une gomtrie globale de bipyramide base carre (6 paires d'lectrons entourent I) alors que SeF4 aura une gomtrie globale de bipyramide base triangulaire (5 paires d'lectrons entourent Se) D. IF4- oui cause de sa symtrie, SeF4 non cause de son doublet non liant en quatorial. E. Pour faire une hybridation sp3d2 on a besoin d'orbitales d ce que ne possde pas le fluor. QCM 85 : ABCD E. F: antiliantes. QCM 86 : ACD E. F: c'est l' O2 qui est un bactricide. QCM 87 : ABCDE B. V La structure lectronique correspond au carbone ltat excit, pour quil existe quatre liaisons. QCM 88 : ABDE C. F (voir cours : il nexiste pas dlectrons clibataires) QCM 89 : CDE A. F car spin= -1, 0, 1 (voir cours). B. F le singulet est diamagntique alors que le triplet est paramagntique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

56

QCM 90 : ABDE C. F les forces de dispersion sont aussi appeles forces de London. D. V Cest le cas dans les interactions diple provisoire-diple induit faisant intervenir les forces de London. E. V La temprature dbullition augmente avec la masse molaire. QCM 91 : ABDE C. F : Il sagit dune des exceptions, puisque latome de Fluor peut donner des liaisons hydrogne avec dautres molcules. Il est donc plus difficile de sparer les molcules, do une temprature dbullition suprieure. E. les 2 groupements hydroxyles de lortho diphnol tant proximit, ils vont pouvoir se lier par une liaison hydrogne. Ils se lieront donc moins aux molcules voisines, do une temprature dbullition infrieure par rapport au mta diphnol, qui lui naura pas de liaison hydrogne intramolculaire. QCM 92 : E A. F : Elle concerne les atomes lectrongatifs de petite taille : F, O, N. B. F : Lnergie de liaison dune liaison hydrogne est trs infrieure celle dune liaison covalente. Les liaisons hydrogne sont des liaisons de faible nergie. C. F : Cest la structure secondaire (hlices , feuillets ) de la protine qui est modifie. La structure primaire correspond lenchanement des acides amins. D. F : Lappariement des bases se fait par 2 liaisons hydrogne pour ladnine et la thymine, et par 3 liaisons pour la cytosine et la guanine. QCM 93 : ACDE A. Elles interviennent par exemple dans la reconnaissance Antigne-Anticorps. B. F : Les alcanes linaires sont des composs hydrophobes. C. Une mme molcule peut avoir une partie hydrophile et une partie hydrophobe (exemple : les acides gras), et donc engendrer les 2 types de liaisons. QCM 94 : AD B. F : La chimie organique est omniprsente autour de nous : carburants, textiles synthtiques C. F : La formule brute dune molcule est suffisante pour calculer sa masse molculaire. E. F : Cest vrai, mais la formule donne est une formule semi dveloppe. Formule brute : CH4N2O QCM 95 : AD B. F galement HCl car il a des doublets non liants C. F CH4<HCl<H2O car les liaisons intermolculaires sont plus fortes pour HCl que pour CH4. H2O quant lui est une exception (liaison hydrogne) E. F Chlation = intramolculaire QCM 96 : D A. F le para a des liaisons hydrognes avec dautres molcules, il faut casser les liaisons ; la temprature dbullition sera donc plus leve. B. F intramolculaires C. F liaisons hydrognes, non covalentes. E. F pas de liaisons N-----O seulement des liaisons hydrogne. QCM 97 : ACDE B. F Le CO2 est considr comme un compos minral C. ex : ure partir de cyanate dammonium.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

57

QCM 98 : ABD C. F le mlange est homogne pour un temps seulement : il va avoir tendance redescendre vers un niveau nergtique plus bas en expulsant lacide thanoque (hydrophile). E. F Des molcules hydrophiles peuvent se regrouper en un endroit prcis et dvelopper entre elles des liaisons hydrophiles, limage de ce que fait une goutte deau dans de lhuile. QCM 99 : ABCE D. Attention le butan3ol n existe pas cest le butan2ol (ceci est du la priorit de la fonction alcool). QCM 100 : A B. Le compos est le 4isopropylcyclohex1ne. C. cf rp B D. cf rp B E. Il en contient 2 : le 4 et le 5 QCM 101 : CDE A .Les tautomres correspondent des isomres de constitution . B . Dans le cas de lactone, lquilibre cto-nolique est dplac vers la ctone. QCM 102 : BCD A. Le compos est le 2-4dimthylhexane. E. Le compos est un hydrocarbure satur. QCM 103 : ADE A . Butan1ol CH3CH2CH2CH2OH B. 2mthylpropan1ol CH3CHCH2OH CH3 C. 2mthylpropan2ol CH3 CH3CCH3 OH D. 2Aminopropane CH3CHCH3 NH2

attention le carbone 1 est primaire car li un seul carbone

Aucun carbone secondaire

Un carbone tertiaire Trois carbones primaires

Le carbone central est secondaire

E. 3chloro-2,4-dihydroxyhexane CH3CH2CHCHCHCH3 OH Cl OH

4 Carbones secondaires

QCM 104 : ACD B. Ce compos ne prsente pas 4 stroisomres mais 3 stroisomres (Z /E) du fait de la prsence dans la molcule dun axe de symtrie. E. Le nouveau compos est le 2chlorohex2,4dine. Attention les halognes ne sont jamais en suffixe. De plus la double liaison reste la fonction principale.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

58

QCM 105 : CD A. Le compos est le 4hydroxybutanal. En effet la fonction aldhyde est prioritaire par rapport la fonction alcool. B. le compos est le hydroxybutanal. C. 4 autres isomres de fonction : acides carboxyliques, nediols, esters, ctones et diol cyclique. E. On passe dune fonction aldhyde une fonction ctone le compos est donc un isomre de fonction du compos 1. QCM 106 : BCDE A. Le 2mthyl propan2ol a un radical tertiobutyl. CH3 CH3COH CH3 B. 2mthylpropan1ol a un radical isopropyl CH3CHCH2OH CH3 QCM 107 : ACDE B. La fonction aldhyde est prioritaire par rapport la fonction ctone. QCM 108 : D A. F il y a un plan de symtrie donc achirale. B. F centre de symtrie donc achirale. C. F limage dans un miroir est superposable. E. F pas de C* QCM 109 : DE A. F reprsentation de Newman. B. F de configuration identique mais de conformations diffrentes. Conformation : on ne fait que tourner les liaisons. Configuration : on casse les liaisons pour passer dun R un S par exemple. C. F cest la mme molcule. QCM 110 : ABCD E. F car D vrai. QCM 111 : ABCD E. F ces 2 composs sont diastroisomres. Seul un mlange quimolaire de 2 nantiomres a un pouvoir rotatoire nul. QCM 112 : CE A. F Cest une rupture htrolytique B. F Base de Lewis = nuclophile D. F Il existe trois types de ruptures htrolytiques (Rhe) : -Rhe dune molcule neutre donne un anion et un cation -Rhe dune molcule cationique donne un cation et une molcule neutre -Rhe dune molcule anionique donne un anion et une molcule neutre.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

59

QCM 113 : CD A. F Cest une reprsentation de Cram Avec Fisher on a la fonction la plus oxygne en haut et en bas la chane la plus longue. B. F SRR C1: Cl>OH>NH2>C2 C2: C3>C1>C2H5>CH3 C3: Br>OH> C2 > CH3 E. F RSSR QCM 114 : D A. F Ils nont pas forcment le mme pouvoir rotatoire B. F Il ny pas de lien entre pouvoir rotatoire et configuration absolue. C. F Ces deux nantiomres ont des proprits trs souvent diffrentes. E. F Il peut y avoir un mso avec donc un plan de symtrie ce qui annule un stroisomre (vu que deux stroisomres sont identiques) QCM 115 : CE A. F Ce sont des diastroisomres gomtriques thylniques dnomms selon les lettres Z et E. B. F E a un point de fusion suprieur car elle peut crer des liaisons inter-molculaires alors que le Z lui, fait prfrentiellement des liaisons intra-molculaires. D. F ex :
H3C C Br C H CH3

Ici, la molcule est cis ; les radicaux de la chane carbone sont du mme cot mais les substituants prioritaires sont de part et dautre de la double liaison => E QCM 116 : B A. F forme mso, ces 2 molcules sont identiques. nantiomres : 2 molcules diffrentes. C. F cest une configuration mso = pas daction sur la lumire polarise. D. F car cest une forme thro. QCM 117 : AD A. V On doit changer de ct pour suivre la chane carbone principale. D. V Les deux substituants prioritaires (thyl sur le carbone 3 et chlore sur le carbone 4) sont du mme cot. E. F cette molcule est de configuration trans E. QCM 118 : DE A. F cf cours B. F mme proprits physiques C. F mmes proprits chimiques QCM 119 : A. F on ne peut pas faire pivoter une Double Liaison B. F cela va changer la forme de la molcule par un changement dans langulation. C. F cest la mme molcule D. F soit 1R,2S soit 1S,2R E. F cest un compos mso QCM 120 : BCE A. F solvant protique. D. F ractif lectrophile.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

60

QCM 121 : AE B. F pyramide inversion rapide. C. F non strospcifique D. F Effet inductif - I QCM 122 : CE A. F rupture homolytique B. F stabilis par encombrement strique D. F uniquement par msomrie et encombrement strique QCM 123 : ADE B. F 3 formes limites de rsonances et un hybride de rsonance C. F la somme des 3 formes de rsonance (lhybride et les 2 formes limites) donne un compos stable neutre. QCM 124 : aucune A. sp3. Ne pas oublier le doublet non liant du carbone. B. Il est charg ngativement, donc il attire les composs positifs, il est donc nuclophile. C. Sil possdait au moins un carbone asymtrique, sans autre carbone chiral ce serait celui qui porterait le doublet non liant, or avec seulement 3 substituants, il existe un plan de symtrie et donc ce carbone-l ne peut tre asymtrique.

Exemple : D. Cest linverse ! Du fait de son hybridation sp3 il a une structure pyramidale mais il subit une interconversion rapide le rendant statistiquement plan. E. Cest une base de Lewis... Les acides de Lewis ont une case quantique vide pouvant recevoir, par une liaison dative, un doublet non liant dune base de Lewis...Les acides ou les bases de Brnsted se dfinissent par leur capacit capter (base) ou relarguer (acide) un ion H+. QCM 125 : ACD B. Il est le rsultat dune rupture homolytique donc il est cr dans un milieu fortement apolaire mais en prsence dnergie sous la forme h. D. oui car il est non strospcifique. E. Il est stabilis par un fort encombrement strique. QCM 126 : BE A. Pas le carbone radicalaire. B. Qui se ralise en 2 tapes (ou 3 pour le radical carbon) C. Non strospcifique car lattaque peut se faire de deux cts par exemple : N E

N = Nuclophile, E = lectrophile N E D. Ils sont essentiellement stabiliss par des effets msomres

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

61

QCM 127 : CDE A. Cest le rsultat de la polarisation des liaisons, en dautres termes, il est le rsultat direct de llectrongativit des diffrents atomes constituants la molcule B. + I est un effet inductif donneur, - I est un effet inductif attracteur D. En attirant ou en repoussant le doublet qui lie un atome quelconque avec un atome dhydrogne qui schappera ainsi plus ou moins facilement, influenant donc le pH (teneur en H+) du milieu. E. Le fluor est un puissant attracteur donc le H du COOH partira plus facilement, (FCH2)COOH aura donc une plus grande acidit que HCOOH do un Ka suprieur do un pKa infrieur. A linverse, les 3 CH3 on un effet donneur, ce qui va stabiliser le H du COOH qui partira moins facilement (CH3)3COOH aura donc une plus faible acidit que HCOOH do un Ka infrieur do un pKa suprieur. QCM 128 : A B. Le butadine ou buta-1,3-dine en est lexemple type, Leffet msomre y a t dmontr par la longueur particulire de ses liaisons, intermdiaires entre la longueur des liaisons simples et doubles. C. On peut dcrire la dlocalisation du buta-1,3-dine de la manire suivante laide de ses formes limites de rsonance : Ce qui nous permet den dduire son hybride de rsonance : + D. NON cest le sige dune msomrie tout simplement. Pour quil y ait des conjugaisons, il faut que la dlocalisation dlectrons ou msomrie agisse sur plus dune liaison ce qui nest pas le cas ici (mais qui peut ltre selon la molcule dans laquelle se retrouve le CO). E. Les formes limites de rsonance nexistent pas, elle nous permettent juste de prvoir la structure de lhybride de rsonance, vritable forme dune molcule subissant une ou des msomries. QCM 129 : BE A. Les deux effets ne sont pas lis ! Le meilleur exemple sont les halognes qui ont un effet I et un effet + M. C. Cest linverse. D. F Ils peuvent autant les stabiliser que les dstabiliser QCM 130 : CE A. F Pas en Cram (coude) B. F Verticalement. D. F R QCM 131 : B QCM 132 : AB B. V Mme reprsentation que A avec une rotation de 180 QCM 133 : AC C. V Mme reprsentation que A avec une rotation de 180 QCM 134 : ABC Trois mmes molcules reprsentes diffremment. E. F un seul atome peut tablir des liaisons hydrogne. QCM 135 : BE Ne correspondent pas!

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

62

QCM 136 : ABCDE

E. V La molcule alors que

prsente des possibilit de liaisons hydrogne intermolculaire

la molcule

fait des liaisons hydrogne de type intermolculaire et intramolculaire. Les liaisons intramolculaires gnant des liaisons intermolculaire (concurrence avec celles-ci), sa temprature d'bullition est plus leve. QCM 137 : A QCM 138 : ACDE B. F Le carbone asymtrique implique la chiralit dune molcule, sauf cas particulier (forme meso). QCM 139 : ABD C. F Dvie la lumire droite (dextrogyre) E. F 1 seul . QCM 140 : ABD B. V elle prsente 8 stroisomres dus aux carbones asymtriques (23) et ventuellement une ou plusieurs stroisomries Z/E si il y a une ou plusieurs doubles liaisons sur dautres carbones. C. F 2 diastroisomres sont des stroisomres non nantiomres. E. F Seul un compos rythro peut tre un mso. QCM 141 : B A. F elle en possde 3 car les composs RS et SR sont identiques (mso). C. F Elle en possde 2. D. F Tout dpend de sa configuration, en thro cest un mso. E. F Loxydation de cette molcule de configuration Z (cis dihydroxylation) entranerait la formation dun compos mso, donc RS ou SR. QCM 142 : DE A. F Elle en prsente 3. B. F Elle prsente 8 stroisomres C. F idem.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

63

QCM 143 : A B. F non polarises au dpart C. F toutes appartiennent aux forces de Van Der Waals D. F les forces de London sexercent entre deux molcules non polarises au dpart. Lun deux subit une modification de son nuage lectronique et se polarise spontanment. E. F pas pour les forces de London QCM 144 : ADE B. F les forces de London sont les plus faibles forces de Van der Waals. C. F le nuage lectronique est plus grand et plus dformable. QCM 145 : ABD C. F pour calculer le rayon de Van der Waals, les molcules doivent tablir des liaisons lectrostatiques mais pas de liaison covalente (dont le recouvrement latral est un exemple) E. F il sagit de liaisons covalentes intramolculaires donc calcul du rayon de covalence. QCM 146 : BCD A. F cest le cas du modle rayon de Van Der Waals E. F elles sont mieux visualisables par le modle rayon de Van Der Waals QCM 147 : BCD A. F Pas forcment: exemple des halognes: ils sont +M et I. E. F Groupement M. QCM 148 : BCD A. F . E. F Aucune rsonance sur cette molcule. QCM 149 : AC B. F Les carbones qui partagent le radical sont spars par deux liaisons. D. F Si, ils le peuvent !
X CH Y X CH

+ E. F Pas avec les lectrons impairs.


QCM 150 : BCDE A. F Rgle de conservation de la charge.

Y _

QCM 151 : D A. F Il en a 5 (voir vignette du cours). B. F Les trois formes intermdiaires ont des charges. C. F OH est un donneur dlectrons par effet msomre (il a deux doublets non liants). D. V La deuxime et la quatrime. E. F Dlocalisation. QCM 152 : BDE A. F CH3 : effet inducteur donneur. C. F Mme raison que A. QCM 153 : AE B. F Les doubles liaisons sont ncessaires la conjugaison et donc laromaticit. C. F n est un entier positif ou nul. D. F Au contraire lodeur spcifique est une caractristique de laromaticit.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

64

QCM 154 : BDE A. F Carbocation. C. F Ortho, para ou sur le groupement CH2. QCM 155 : ABE C. F elle se fait sur un compos insatur riche en lectrons . D. F il ny a aucun rapport. Une addition de 1er ordre peut tre lectrophile ou nuclophile. Pareil pour les additions de 2me ordre. QCM 156 : BE A. F on obtient un mlange racmique, donc la raction nest pas strospcifique : cest donc une raction dlimination de 1er ordre. C. F le carbocation form est plus stable : il prsente 2 substituants, alors que lautre nen comporte quun seul. D. F on obtient majoritairement le 2amino but-2-ne (rgle de Zatsev). E. F Attention ne pas confondre rgioslectif et strospcifique. Raction strospcifique : elle privilgie la formation dun stroisomre. Raction rgioslctive : dans lexemple de llimination, plusieurs atomes dhydrogne peuvent tre candidats llimination ; les composs obtenus sont alors compltement diffrents ( la double liaison ne se trouvera pas la mme position ). QCM 157 : ABC. C. V on a un carbocation plan comme intermdiaire : autant de chance que lattaque du chlore se fasse dun ct ou de lautre. La configuration de lautre carbone asymtrique ne change pas. D. F car cest une raction de 1er ordre. E. F le carbone est hybrid sp3, puis il y a formation du carbocation o il est hybrid sp2, puis il redevient sp3. QCM 158 : ABC A. V Il y a une Trans-limination. B. V 3 hydrognes ports par les carbones en sont susceptibles dtre limins : celui du CH3, celui du CH2 et celui du CH. Daprs Zatsev, H est limin du C le moins hydrogn, donc du CH. D. F il y a formation dune double liaison : les 2 carbones vont shybrider sp2. E. F Un seul temps. QCM 159 : BDE A. F nuclophile. B. V nucleophile, electrophile, radicalaire. C. F catalyse par un acide. QCM 160 : C A. F Zatsev. B. F raction de classe 1 dpend de la concentration en substrat et non en ractif. D. F raction non strospcifique donc mi R mi S. E. F OH=nuclophile. QCM 161 : AD B. F sp3d C. F Walden = SN2 E. F SN1 sera favorise si le driv halogn est tertiaire.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

65

QCM 162 : BD A. F ce sera CH2Cl-CH2-CH2I car I attire (donc devient delta -) et CH2 repousse (delta+): mcanisme Anti Markownikov. C. F simultanment. E. F dans la raction SN2. QCM 163 : BDE A. F Le compos obtenu est le butan2ol

CH3CHCH2CH3 OH

La suite ractionnelle est : CH3CH=CHCH3 + H2SO4 CH3CH+CH2CH3 + H2O CH3CHCH2CH3 CH3CHCH2CH3 + HO H OH QCM 164 : CDE A. F Cest HF qui a la temprature dbullition la plus leve cause des liaisons hydrognes intermolculaires. B. F Les liaisons hydrognes stablissent partir dhydrogne ports par des atomes tels que F, O, N. QCM 165 : ACE B. F On obtient un mlange racmique. D. F Radical chlore et radical carbon. E. V On peut obtenir un alcane 14 atomes de carbone par runion de 2 radicaux carbons. Cl Rq : le compos majoritairement obtenu est CH3CH2CCH2CH2CH3 CH3 QCM 166 : ABE C. F On na pas de mlange racmique car le compos nest ni R ni S (pas de carbone asymtrique). D. F Le compos obtenu nest ni R ni S. En effet on a un alcane avec un atome de carbone portant 3 substituants hydrogne, et un autre atome de carbone ayant 2 hydrognes comme substituant. Rq : le produit obtenu est CH3CH2CHCH2CH3 CH3

QCM 167 : ADE B. F Lintermdiaire ractionnel est un radical plan. C. F Le radical est une molcule instable. Rq : le produit majoritairement obtenu est CH3CHCH3. Br
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

66

QCM 168 : ABCDE QCM 169 : AE B. F Loct-1-yne a des tempratures de fusion et dbullition suprieures loct-1-ne. La courbure dans lalcne diminue le nombre dinteractions intermolculaires et donc les tempratures de fusion et dbullition. La triple liaison dun alcyne ne permet pas de courbure et les liaisons intermolculaires peuvent alors se faire, ce qui raugmente les tempratures de fusion et dbullition. C. F CO2 et H2O sont les seuls produits de combustion. D. F Attention lnergie de liaison porte un signe positif et lnergie libre porte un signe ngatif. QCM 170 : DE A. F alcanes sont trs peu ractifs. Liaisons peu polarises. B. F composs saturs. C. F ractions radicalaires ne sont pas spontanes. QCM 171 : ABCE D. F La molcule obtenue est un mso RS ou SR donc pas asymtrique. QCM 172 : CD QCM 173 : BE D. F Cest une raction non strospcifique. E. V Le H+ se fixe sur le C le plus hydrogn (= le moins substitu) pour obtenir le carbocation le plus stable possible. QCM 174 : DE A. F 3 phases : initiation, propagation, arrt B. F Il intervient dans la phase de propagation. C. F Cest Br qui attaque lalcne. E. V Cration dun intermdiaire ractionnel radicalaire le plus substitu possible car plus stable. QCM 175 : ABDE QCM 176 : A B. F Instable donc il nest pas ncessaire de chauffer. C. F KMnO4 concentr et a chaud utilis pour oxydation dure. D. F cis E. F trans QCM 177 : AB C. F Pas besoin imperatif de milieu reducteur. D. F Cest en condition non-rductrice. E . F Aussi avec KMnO4 concentr et chaud. QCM 178 : C A. F Lalcne contient dj une fonction aldhyde donc on obtient 2 fonctions acides. B. F rien voir, en conditions rductrices, on neutralise H2O2 pour ne pas oxyder les aldhydes. E. F intermdiaire ozonide

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

67

QCM 179 : A B. F acide de Lewis. C. F cest linverse: inductif attracteur et msomre donneur. D. F il rgnre le catalyseur. E. F cest le Cl+. (a) = Cl+ (b) = carbocation (c) = chlorobenzne (d) = paradichlorobenzne (e) = orthodichlorobenzne QCM 180 : AE B. F Il ragit avec H2O et CO2. C. F C12H10. D. F Cest un compos hydrophobe (hydrocarbure) (b) = carbocation (c) = bromobenzne (d) = RMgBr avec R : benzne (e) = benzne-benzne QCM 181 : BD A. F car B vrai C. F cest le CO2. E. F cest une question de nomenclature : le D est vrai. QCM 182 : aucune A. F cest croissant dans cet ordre. B. F cest grce leffet inductif. C. F le pKa est faible. D. F au minimum 2H (CH3OH est aussi un alcool primaire mais ce nest pas le seul). E. F pas les thers. QCM 183 : ACD B. F Dans ces conditions, le benzne ne ragit pas. E. F En prsence de KMnO4 dilu. QCM 184 : ABE C. F C'est la troisime tape qui le permet. D. F C'est un carbocation. QCM 185 : ABCD E. F attracteur QCM 186 : ABD C. F Cest le carbone E. F On observe une raction d'addition.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

68

PARTIE II
BIOLOGIE MOLCULAIRE

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

69

QCM 1 : Soient les squences de deux fragments dADN de mme taille dont on ne donne quun seul des deux brins : 1 :(5) ATTGCGATTACATTAGCAATTCATTGGCAT (3) 2 :(5) AGGCTAACGGACTCGACGTGCCGGCATTCG (3) A. La temprature de fusion du brin 2 (considr en double brin) est plus leve que celle du brin 1. B. Si on considre lADN 1 en double brin, on peut affirmer quil y a autant de bases puriques que de bases pyrimidiques. C. Lors de la dnaturation de lADN, laugmentation de la temprature provoque la rupture des liaisons phosphoesters entre les nuclotides. D. La taille de ces deux ADN en double hlice est de 11.52 nm. E. Le dbut de la squence du brin 1 peut tre reprsent de la faon suivante :

QCM 2:
2me lettre

1ere lettre U

U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met Val Val Val Val

C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala

A Tyr Tyr stop stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu

G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly

3me lettre U C A G U C A G U C A G U C A G

On donne la squence dun brin dARNm : 5 AACGAUGGCUAGCCGUUUUGCCACUUAGAACCCGU 3 On prcise que cette squence contient le codon dinitiation de la traduction. A. La squence de la protine traduite partir de cet ARNm est Met-Ala-Ser-Arg-Phe-Ala-Thr B. Le code gntique est dit dgnr car il existe plusieurs acides amins possibles pour le mme codon. C. Cet ARNm peut shybrider avec un brin dADN de squence : ACGGGUUCUAAGUGGCAAAACGGCUAGCCAUCGUU D. Pour un peptide de squence Met-Leu-Pro-Cys-Asp-Leu-Gln, il existe 1152 possibilits de squence. E. Un ADN double brin de 180 pb a une taille de 61.2 nm

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

70

QCM 3 :

A. La squence de ce simple brin dADN est ATGCT. B. La squence complmentaire est TACGA. C. Le P reprsente le phosphate en alpha du dNTP introduit au cours de la synthse du brin dADN. D. Grce la polynuclotide kinase et un [gamma-32P] ATP on peut marquer lextrmit 5du brin dADN afin de le rvler par des techniques radiographiques. E. Si un fragment dADN double brin contient 20% de A, on peut affirmer que le % de C est de 30%. QCM 4 : Structure A. Le ribose est un ose 5 carbones avec un OH absent au niveau du C4. B. Lacide urique est un produit de dgradation des bases pyrimidiques. C. LATP est un nuclotide triphosphate. D. La liaison entre base et sucre seffectue entre N1 et C1 systmatiquement. E. Dans lAMPc, la liaison entre ose et phosphate seffectue par le biais des atomes doxygne du C3 et du C5. QCM 5 : A. LAMPc produit partir de lATP par lintermdiaire de ladenylcyclase active les voies de transduction. B. On nomme Bta le phosphate li par 2 liaisons anhydrides phosphoriques. C. Une kinase est une enzyme qui permet le transfert de groupements phosphoriques. D. En faisant agir une kinase sur du [-32P] ATP, on obtient un ADP radioactif. E. Dans la structure primaire de lADN, le phosphate possde deux liaisons phosphodiesters. QCM 6: A. Dans une squence dADN lue de 5 en 3, le pont phosphate est li de C3 en C5. B. Dans la structure tridimensionnelle de la molcule dADN, bases puriques et pyrimidiques sapparient. C. Il existe trois liaisons H entre A et T, ce qui les rend plus faciles sparer. D. Certaines zones dADN sont plus riches en paires GC donc plus thermo rsistantes. E. Dans une molcule dARN, les deux brins sapparient de faon anti-parallle. QCM 7 : LARNm A. LARNm, monobrin issu de la transcription de lADN, transporte linformation gntique vers les ribosomes, o seffectue la synthse des protines. B. La pose de la coiffe et de la queue polyA sont des modifications post traductionnelles exclusivement prsentes sur les ARNm de type eucaryote. C. Dans la technique de chromatographie daffinit, lutilisation doligo-dT-cellulose permet, grce la queue polyA en 5, lisolement des diffrents ARNm. D. Lutilisation de la haute force ionique permet llution des ARNt et ARNr. E. Lutilisation de la faible force ionique permet laccrochage des ARNm sur loligo-dT-cellulose.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

71

QCM 8 : LARNt A. Soit un ARNm possdant le codon UGC, lanticodon de lARNt correspondant est GCA. B. La saturation de la double liaison en position 5-6 de luridine donne la dihydrouridine. C. LARNt est form de plusieurs boucles rsultant de structures secondaires en pingles linge dues lappariement local de bases. D. Adnosine a pour base : Adnine :6amino purine Cytidine a pour base : Cytosine : 2hydroxy-4-amino pyrimidine Thymidine a pour base : Thymine : 2,4 dihydroxy-5-mthyl pyrimidine Guanosine a pour base : Guanine : 2amino-6- hydroxy purine Inosine a pour base : 6hydroxy purine Linosine rsulte de la dsamination en position 6 de la cytosine. E. La liaison ester entre un acide amin et son ARNt correspondant implique le dsoxyribose de ce mme ARNt. QCM 9: LARNt et lARNr A. la formation de laminoacyl-ARNt est une raction spontane. B. Dans la raction : aa + ATP aa~AMP + 2Pi, pour suivre lacide amin, on pourrait radiomarqu le Phosphate de lATP. C. La liaison de lacide amin lARNt se fait avec la tige acceptrice ACC. D. Les ribosomes procaryotes et eucaryotes possdent respectivement 4 ARNr et 3 ARNr diffrents. E. Les ribosomes procaryotes et eucaryotes sont constitus de 2 sous units dont chacune delle est forme de plusieurs ARNr et protines QCM 10:l'ARN A. Il existe plus de molcules diffrentes d'ARNr que d'ARNt. B. L'ARNsn joue un rle dans la maturation des protines. C. Les ribosomes: ARN reprsentant 82% des ARN totaux d'une cellule eucaryote, sont "l'usine de fabrication des protines". D. L'ARNm porte l'information gntique vers les ribosomes o s'effectue la synthse des protines. E. Dans le noyau, les ARNm eucaryotes et procaryotes ne subissent pas les mme modifications posttranscriptionnelles. QCM 11 : A. La structure en pingle cheveu de l'extrmit 5' non codante des ARNm joue un rle important dans l'efficacit de la transcription. B. La structure en pingle cheveu de l'extrmit 3' non codante des ARNm joue un rle dans la stabilit de l'ADN. C. La topo isomrase permet le passage de la forme relche la forme super enroule de l' ADN. D. Un brin d'ADN contenant 70% de G-C a une temprature de fusion plus leve qu'un ADN contenant 70% de A-T. E. La phosphatase est responsable de la pause de la coiffe de l'ARNm. QCM 12 : Electrophorse A. En lectrophorse, les gros fragments dADN sont ceux qui migrent le plus loin. B. LADN migre vers le ple plus. C. Le bromure dEthidium se fixe lADN mais pas lARN. D. Lutilisation de formaldhyde en plus du gel dagarose est ncessaire dans llectrophorse des ARN totaux. E. le formaldhyde sert rvler lARN.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

72

QCM 13 : LADN polymrase A. LADN polymrase I synthtise lADN de 3 en 5 en partant de lamorce. B. LADN polymrase I comporte une activit 5 exonuclasique et 3 exonuclasique. C. A cause de lactivit 5 exonuclasique de lADN polymrase I, il est plus intressant dutiliser le fragment de Klenow obtenu par digestion enzymatique. D. LADN polymrase I a la particularit de ne pas avoir besoin damorce pour fonctionner. E. LADN polymrase I exerce une activit longase. QCM 14 : Synthse dADN complmentaire A. La premire tape consiste copier lARNm en ADN, ceci en utilisant de la transcriptase inverse et une amorce oligodT seulement. B. Lors de la formation dun hybride ADN-ARNm, le brin dARNm peut tre limin par lutilisation de NaOH. C. A partir de lADN monobrin, il suffit de dabord ajouter de lADN polymrase I, des dNTP puis de la transfrase terminale avec des dCTP pour obtenir de lADN double brin. D. La transfrase terminale est une enzyme capable dajouter des d-nuclotides lextrmit 3de lADN. E. La transcriptase inverse est une enzyme prsente chez les virus ARN comme les rtrovirus. QCM 15: Mthode de marquage A. On peut directement marquer un double brin dADN la polynuclotide kinase. B. La polynuclotide kinase va marquer radioactivement tous les phosphates du brin dADN. C. La mthode damorage au hasard se fait sur de lADN dnatur. D. Dans la mthode du random priming, on utilise des hexadsoxynuclotides, des dNTP, du [32P]dCTP et de lADN polymrase I. E. La mthode damorage au hasard permet de crer des sondes radioactives QCM 16 : Gnralits dlectrophorse A. Une lectrophorse sur gel dagarose permet de sparer des fragments dADN grce un courant lectrique qui va du plus vers le moins. B. Une lectrophorse, permettant de sparer les morceaux dADN selon leur taille, a de multiples applications pratiques comme crer une dltion ou une addition. C. Le bromure dEthidium peut sinsrer dans lhlice dADN et permet de faire un marquage spcifique de lADN. D. Aprs rvlation dlectrophorse, on peut approximer la taille en kpb dun morceau dADN en le comparant un ADN dchantillonnage par exemple un Adn de phage . E. On peut aussi faire une lectrophorse dARN mais on doit en plus rajouter du formaldhyde pour donner une meilleur charge ngative lARN et donc permettre une meilleure migration vers le ple plus. QCM 17 : Quelques questions sur le clonage A. On peut amplifier une squence dADN en le clonant dans un plasmide : petit ADN circulaire pouvant rentrer dans des bactries. B. Pour slectionner les bactries transformes par le plasmide on utilise lampicilline car les bactries du milieu possdent toutes le gne AmpR. C. La phosphatase alcaline, en dphosphorylant les extrmits du plasmide, permet dempcher que ce dernier ne se recircularise. D. En coupant le plasmide au MCS avec une enzyme de restriction on obtient deux fragments auxquels on adjoint les ADNc avant de les insrer tous ensemble dans des bactries pralablement rendues comptentes. E. La ligase est une enzyme capable de catalyser des ractions destrifications autant dans une tape du clonage que dans la cration dune dltion aprs lectrophorse.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

73

QCM 18: Les techniques de marquage A. Lors du marquage la polynuclotide kinase, la phosphatase alcaline dphosphoryle les extrmits de lADN et, ensuite, des phosphates sont rajouts grce la polynuclotide kinase et de l[32P]ATP. B. Le fragment de Klenow ne comprend que 2 des 3 activits de lADN polymrase I et est notamment utilis lors du random priming. C. Lactivit 5 exonuclasique permet notamment lADN polymrase I de corriger ses erreurs ce qui fait de la rplication un des mcanismes les plus fidles quils soient. D. Lors de la synthse de lADN, lADN polymrase I intgre le phosphate du brin. E. La transcription a besoin dune matrice, de dNTP et de lARN polymrase. QCM 19 : Si on considre le fragment dADN de la question prcdente : A.On peut utiliser Eco R1 pour crer une dltion. B.On peut utiliser Bam H1 pour crer une dltion. C.On peut utiliser Bam H1 et Hind III simultanment pour crer une dltion. D. En coupant par Eco R1, on obtiendra entre autre deux fragments de 2 kpb identiques. E. Aprs coupure par lenzyme Eco R1, en labsence de toute autre intervention, on est sur que les fragments vont se rassembler de manire identique la squence dorigine. QCM 20: A propos des endonuclases de restriction :

EcoR1 : Sal1 : BamH1 : Hae III : Hind III :

GAATTC GTCGAC GGATCC GGCC AAGCTT

Not I : Pst I : Pvu II : Sma 1 : Xho1 :

GCGGCCGC CTGCAG CAGCTG CCCGGG CTCGAG

A. Hae III et Sma I produisent des fragments que lon peut rabouter B.Xho I et Hind III donnent des bouts cohsifs C. Pvu II et Sma I donnent des bouts francs D.Xho I et Sal I donnent des extrmits compatibles. E. Eco R1 et Bam H1 produisent des extrmits compatibles. QCM 21 : A propos de lElectrophorse de lADN : A. Le bromure dethidium permet de dcouper lADN en bandes. B. Dans llectrophorse, on compte sur la gravit pour faire migrer les molcules d ADN C.LARN exige moins de prcautions dans sa manipulation que lADN D.Aprs electophorse d ADN simple brin et rvlation au bromure dthidium, on peut rcuprer lADN et linsrer tel quel dans un plasmide E.Le Bromure dethidium, qui na pas de spcificit de squence, permet la rvlation sous infra rouge du brin dADN ou dARN.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

74

QCM 22 : a propos de la synthse de lADN A. Pour synthtiser un ADN simple brin, on a besoin dune matrice , dune amorce, de dNTP et dune enzyme lADN polymrase I. B. Lhydrolyse de la liaison anhydride phosphorique entre le Phosphate et le Phosphate du dNTP fournit lnergie ncessaire llongation du brin C. LADN polymrase I possde 3 activits : une activit polymrase et une activit 5 exonuclase regroupe sous le terme de fragment de Klenow et une activit 3 exonuclase. D.Le fragment de Klenow peut tre gnr par digestion de lADN POL I par la trypsine. E. Si un msappariement apparat lors de la synthse de lADN cest lactivit 3 exonuclasique de lADN POL I qui intervient en librant un nuclotide triphosphate. QCM 23 :

A. lenzyme utilise ltape 1 est la transcriptase terminale. B. Le produit X obtenu lissu de lopration 1 est un hybride ADN-ARNm C. Le produit Y obtenu aprs une action de la soude ou de la Rnase H est un ADN monobrin capable dtre intgr dans un plasmide. D. Lenzyme utilise Ltape 3 est une transfrase inverse. E. Lors de ltape 4, on peut prendre des oligo-dT comme oligodesoxynuclotide.

QCM 24 : Soit les endonuclases de restrictions suivantes : HaeIII GG/CC ET XhoI C/TCGAG, qui agissent sur le brin : 5 GACTCGAGGCCT 3 3 CTGAGCTCCGGA 5 A. HaeIII produit des extrmits franches cohsives B. Le rsultat de laction de Xho I sur un des 2 brins est : CTG + AGCTCCGGA C. XhoI produit des bouts francs D. Laction dune ligase sur les brins dARN obtenus aprs coupure par lenzyme XhoI permet de recoller les diffrents brins. E. Lendonuclase de restriction Hae III a pour action sur 1 des brins : GACTCGAGG + CCT

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

75

QCM 25 :On possde 2 endonuclases ayant les actions suivantes : BamHI G/GATCC et PstI CTGCA/G. On les fait agir sparment sur de lADN chromosomique prsentant entre autre le motif suivant sur lun des deux brins : 5---- ATGGATCCTGCGACGTC----3. A.Ces endonuclases permettent la production dextrmits cohsives B.PstI na pas daction sur la portion dADN considre C.Le rsultat de laction de BamHI sur lun des brins est : 5-----GACGTCGCAG + GATCCAT----3 D.Le brin complmentaire au brin prsent a le motif suivant : 5----TACCTAGGACGCTGCAG---3 E.Ces endonuclases permettent la production dextrmits compatibles QCM 26 : Soit les endonuclases suivantes : XhoI C/TCGAG ; SalI G/TCGAC et SmaI CCC/GGG A.Deux des trois endonuclases permettent la formation de bouts cohsifs B.Laction de XhoI et SmaI sur des brins dADN adquats permet la formation dextrmits compatibles C.Bout franc et extrmit cohsive ont la mme signification D.Bactrie comptente et bactrie transforme sont des termes se reportant au mme type de bactries E.Dans des conditions adquates linsertion de plasmides dans des bactries est un phnomne frquent QCM 27 : L'ajout de bacteries dans un bouillon de culture strile porte le non d'ensemencement. La culture de bactries permet d'obtenir un nombre consquent de bactries qui seront les hotes des manipulation gntiques venir: A. La spectrophotomtrie permet d'valuer la croissance bactrienne B.Plus il y a de bactries, plus l'absorption lumineuse diminue C. plus la DO augmente, plus l'absorption augmente D. plus le tube est trouble plus l'absorption augmente E.Une DO de O traduit une que Io = I1 QCM 28 :Les plasmides sont utilises comme des vecteurs, pour en avoir un nombre consquent on ralise une amplification A.La rplication des plasmides est dpendante de la rplication du chromosome bactrien B. Le Chloramphnicol bloque la rplication du plasmide C. A chaque cycle de rplication, le plasmide se rplique mais pas la bactrie puisqu'on l'a bloque grce au chloramphnicol D. Apres une amplification, tous les plasmides provenant d'une bactrie sont identiques E. les plasmides possdent une origine de rplication et d'autres gnes QCM 29 : On a ajout des plasmides Amp R des bactries comptentes. Apres choc thermique et incubation 37 pendant un temps convenable, on a A.Une trs faible quantit de bactries transformes B.La majorit des bactries sont transformes C.Pour slectionner les bactries effectivement transformes toutes les bactries avant l'ajout des plasmides doivent tre resistantes l'ampicilline D. une colonie, aussi appele clone, et un ensemble de bactries identiques E. La transformation permet dobtenir des bactries possdant les fragments dADN que lon veut tudier.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

76

QCM 30. A propos de la transcription. A.La transcription dun gne dpend du type cellulaire et des conditions. B.Llongation du brin dARN se fait de 5 en 3 et il est identique au brin non sens a lexception que dans lARN se sont des ribonuclotides et les d-thymidines sont remplaces par des Uridines. C.LARN polymrase II est une enzyme qui assure la transcription des gnes codant pour des protines chez les procaryotes. D.Chez les procaryotes linitiation de la transcription ncessite la sous unit omega. E. Uns seul ADN peut tre simultanment transcrit par plusieurs ARN polymrases. QCM 31.On possde un tube A avec des bactries transformes par un plasmide sauvage AmpR avec le promoteur et loprateur de lopron lactose et le gne du lac Z. Dans un tube B on possde des bactries transformes par des plasmides recombinants( ce sont les mmes plasmides du tube A au niveau desquels sur le gne du lac Z se trouvait un site Bam H1 qui a t cliv, et o lon a introduit lADNc codant pour la lucifrase, protine fluorescente, dans le bon cadre de lecture. A.Si lon rajoute de lIPTG, dans le tube A, aucune protine sera produite. B.Si lon rajoute de lIPTG dans le tube B, on aura lexpression dune protine de fusion dont la partie N terminale correspond au dbut de la bta galactosidase et dont la partie C terminale correspond a la lucifrase. C.Si lon rajoute du lactose on aura lexpression dune bta galactosidase active dans les deux tubes . D.Pour slectionner les batteries transformes, on a appliquer de lampicilline. E.Parmi les bactries transformes, pour slectionner les bactries transformes par un plasmide recombinant pourrait tester lactivit de la lucifrase. QCM 32.On a une deux suspension de bactries dans des conditions favorables. Dans le tube A on rajoute du lactose, et dans le tube B on rajoute du glucose. A .Le tube A en absence de glucose, va augmenter la synthse en AMPc cyclique qui va se lier au CAP, ce qui va stimuler lARN polymrase pour la transcription de lopron lactose. B. La prsence du lactose va rendre le rpresseur actif, ce qui va inhiber la transcription de lopron. C. LAMPc change la conformation du rpresseur. D. lAMPc change la conformation du Catabolite Activator Protine (CAP) E. La transcription est rgule au niveau du promoteur par laction du CAP qui interagit avec lARN polymrase et au niveau de loprateur qui interagit avec le rpresseur.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

77

QCM 33 : On ralise plusieurs PCR partir des amorces a, b, c et d. On reprsente un gne codant pour la protine Mosc4.

La protine mosc 4 contient 60 Acides Amins. I = 50pb ; II= 40pb ; III= 70pb ; IV=80pb 1= 60pb ; 2= 30pb ; 3 = 40pb; 4= 20pb ;5= 50pb Si on ralise une PCR ou rt-PCR selon les cas, avec les amorces suivantes (on prcise qu'aucun exon nest limin lors de lpissage ) : A. a et c sur lARNm mature on obtient des fragments de 290pb. B. b et d sur lARNm mature on obtient des fragments de 180 pb environ. C. b et d sur lADN gnomique, on obtient des fragments de 270 pb environ. D. Si lintron 2 est de phase 0 et lintron 3 est de phase 1, alors la dltion de tout lexon 2 entranera forcment un dcalage du cadre de lecture. E. Lamorce b, marque radioactivement, pourrait tre utilise pour un Northern blot ralis sur lARNm de Mosc4. QCM 34: Petites questions de cours A. Pour connatre la position des A lors du squenage dun ADN, il faut incuber cet ADN avec des dCTP, des dTTP, des dGTP, des ddATP mais pas de dATP. B. Si on insre un ADNc dans un phage, il y a une chance sur 6 de produire la bonne protine de fusion. C. Un intron de phase 2 interrompt le dernier codon de lexon prcdant avant le deuxime nuclotide. D. Le fluorophore utilis pour la PCR quantitative se fixe sur lADN simple brin entre les desoxynuclotides. E. Pour raliser une rt-PCR, on a besoin dune transcriptase inverse, rsistante la chaleur

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

78

QCM 35 :

A.

B.

C. Si ce gne code pour une protine Tric3, et que la partie blanche contient une partie de la squence codante, cet individu prsentera un taux anormalement bas de la protine fonctionnelle. D.Cette personne est htrozygote pour le gne concern. E. Si on ralise un Southern Blot avec sonde S sur allle 1, on obtient la rvlation de fragments de 250 pb. QCM 36 : Soit la [3H]d-thymidine ,dans sa forme stable et dans laquelle trois atomes de tritium sont prsents dans le groupement mthyle en position 5. Thymine : 5mthyl 2,4 dihydroxy pyrimidine A.Le cycle pyrimidine(sans tenir compte des liaisons avec les substituants) renferme deux double liaisons B.Lazote N3 est li,entre autre, un atome dhydrogne. C.Le dsoxyribose, dans la molcule de d-thymidine, renferme 7 atomes dhydrogne D.Aprs capture par la cellule, la [3H]d-thymidine est convertie en [3H]dTTP par fixation conscutive de trois groupements Phosphate sur le C5 E.Lorsquil y a synthse dADN dans une cellule ayant capt et mtabolis de la [3H]d-thymidine, celleci devient radioactive car le dTMP incorpor dans lADN conserve le groupement mthyle triti

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

79

QCM 37 : A propos de l invalidation des gnes chez la souris A.Les cellules souches ou cellules ES n ont pas la capacit de se diffrencier en spermatozodes B.Les cellules ES sont pluripotentes et peuvent se diffrencier en cellules de la peau C.La recombinaison homologue ncessite le phnomne de miose D.Le croisement sur plusieurs gnrations des souris chimriques ne donne que des souris htrozygotes E.La transformation est une tape du Knock Out QCM 38: A propos du Northern blot A.La Taq polymrase a un degr maximum daction dlongation 72. B.Pour suivre les variations du taux dun ARNm, le northern blot peut tre remplac par la RT-PCR. C.Le northern blot renseigne seulement sur la quantit de lARNm dtect D.Cette technique ne sapplique quaux eucaryotes ; E. Aprs sparation des ARNm par lectrophorse ,lhybridation est ralise sur le gel par ajout de la sonde radioactive. QCM 39 : A.La 1re tape de la RT-PCR est la transcription inverse de lARNm en ADN double brin. B.La Taq polymrase possde une activit endonuclasique. C.Le C3 dun ddNTP possde deux hydrognes comme le C2 . D.Un intron de phase 0 interrompt la squence codante entre deux codons E.La PCR est une technique qui utilise la radioactivit. QCM 40 : Gnralits sur la rplication A. Chez les eucaryotes, la rplication et la division sont simultans et ont lieu au cours du cycle cellulaire. B. La phase M correspond la phase de multiplication de la quantit dADN dans le noyau. C. La rplication chez les eucaryotes et procaryotes est semi-conservatrice c'est--dire quun seul brin sur les deux sert de brin matrice. D. La sparation des brins lors de la rplication fait apparatre des fourches de rplication. E. La primase et lADN polymrase possdent les mmes substrats. QCM 41: Les protines de la rplication A. LHlicase, comme la ligase, a besoin dnergie pour catalyser sa raction. En effet, ce sont des ATPases. B. LHlicase peut se fixer sur nimporte quelle squence du brin dADN pour sparer le double brin. C. Les protines SSB sopposent la rassociation spontane des 2 monobrins spars aprs laction de lHlicase. D. Les topoisomrases fonctionnent comme des nuclases inverses, elles liminent les supertours accumuls aux extrmits des chromosomes. E. La primase peut synthtiser des monobrins dADN en absence damorces QCM 42: Gnralits sur la rplication A. Lorientation anti-parallle des brins est responsable de la formation du brin indirect. B. LARN polymrase qui synthtise les amorces du brin indirect est la mme que lARN polymrase de la transcription. C. Les fragments dOkasaki sont composs uniquement par de lADN c'est--dire seulement par des dNTP. D. Chez les eucaryotes, lADN polymrase est la seule possder une activit primase. E. LADN polymrase I et la ligase ne sont retrouvs que sur le brin indirect ou prcoce

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

80

QCM 43: A propos des banques de phages : A. Les bactriophages l utiliss pour la constitution de banques dADNc croissent dans les bactries suivant deux modes : le cycle lytique et le cycle lysognique. B. Linsertion du fragment dADNc dans le phage se fait une fois sur deux dans le mauvais sens, il nest alors pas reconnu par la sonde lors dun southern blot. C. De mme que la transcription et la traduction de lADN du phage, son encapsidation ne peut seffectuer que dans le cytoplasme de la bactrie infecte. D. Lorsque lon veut isoler un clone de phage dont lADNc shybride avec une sonde chaude donne, on effectue les oprations suivantes : Infection dune culture de bactries par des quantits minimes de phages ; talement sur la glose ; incubation 37C pendant 6 heures ; Transfert sur un support (filtre de nylon par exemple) ; dnaturation ; fixation ; saturation ; hybridation avec la sonde ; lavage ; autoradiographie ; rcupration dune plage de lyse correspondant une zone radioactive ; rptition deux ou trois fois de toutes les tapes prcdentes de faon sassurer quun seul clone a t slectionn. E. Le fragment dADNc, si on ne prend pas de prcaution particulire, a une chance sur deux davoir t introduit dans la bonne orientation et une chance sur trois dtre dans le bon cadre de lecture, ce qui fait quune bactrie infecte par un clone a une chance sur six de produire une protine recombinante intressante. QCM 44 : A propos de limmunocriblage : A. Il peut servir isoler une squence dADNc codant pour une protine que lon a identifie et purifie. B. Gnralement, on utilise un anticorps ayant une forte affinit pour la protine dintrt et portant un systme de marquage (enzyme, atome radioactif ou molcule fluorescente) son autre extrmit. C. LADN apport par le phage rejoint le noyau de la bactrie o il sera transcrit par la machinerie cellulaire. D. Dans une protine recombinante de fusion, le nouveau fragment se situe au milieu de la protine, les extrmits N et C-terminales tant conserves. E. Dans une protine de fusion, le nouveau fragment se situe du ct N-terminal, lextrmit C-terminale tant conserve. QCM 45 : A propos du Northern blot : A. Il est du W. Northern, prix Nobel de biologie. B. Les premires tapes doivent absolument seffectuer dans un milieu exempt de RN-ases (enzymes dtruisant lARN). C. Il ne ncessite pas de dnaturation pendant ltape de fixation. D. Les sondes utilises contiennent ncssairement des squences transcrites et sont faites dADN monobrin ou dARN. E. Il permet davoir des rsultats quantitatifs et qualitatifs sur lintensit de la traduction des gnes dans un tissu donn, un moment donn et dans un tat donn (malade ou sain par exemple). QCM 46 : LA STABILITE DE L'ARNm A. Les ARNm bactriens sont plus stables que les ARNm eucaryotes. B. La stabilit d'un ARNm peut tre modifie par un raccourcissement de la queue polyA effectu par une endonuclase 3'. C. La rgulation de la stabilit de l'ARNm se fait en 5' de l'ARNm. D. L'action d'une exonuclase 3' sur une queue polyA infrieure 30 rsidus entrane une limination de la coiffe. E. Les ARNm s'adaptent rapidement aux changements d'environnement par leur 1/2 vie variable.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

81

QCM 47 : LA REGULATION DE LA STABILITE DE L'ARNm A. Un lment CIS est une protine qui se fixe sur un lment TRANS de l'ARNm. B. Luc+ est l'exemple d'un gne rapporteur puisque le taux de protine comportant ce gne est ensuite facilement mesurable. C. Les lments CIS sont des squences de rgulation de la transcription trs importants. D. La rgulation de la stabilit de l'ARNm peut passer par l'action de protine qui se fixent sur une structure en pingle cheveux de l'ARNm : c'est le cas pour l'ARNm codant pour le rcepteur de la transferrine dont la stabilit est lie la quantit de fer intra cellulaire. E. Il n'y a qu'un seul facteur cis par ARNm. QCM 48 : A propos de la rplication A. La rplication est semi-conservative, elle dbute au hasard sur le brin d'ADN rpliquer. B. L'hlicase est une enzyme ATP dpendante qui spare les deux brins d'ADN, juste aprs celle-ci, des protines BBS se fixent sur chaque brin pour les maintenir spars. C. Dans la bactrie (e.coli), la rplication fait intervenir 3 types d'ADN polymrase (I, II, III). La I est responsable de l'limination des amorces grce son activit 3' exo nuclase. D. Chez les eucaryotes les chromosomes sont lis par leurs extrmits, ainsi se crent des supertours que la topoisomrase se charge d'enlever. E. La topoisomrase fonctionne comme une nuclase inverse. QCM 49 : A propos du test la [3H]d-Thymidine A. Il permet d'avoir une estimation de la quantit d'ADN produite lors de la transcription. B. Dans la premire tape de ce test, on cultive les cellules avec du srum pour arrter la multiplication des cellules. C. L'une des tapes consiste mettre de la [3H]d Thymidine qui une fois dans la cellule est transforme en TMP*, TDP*, et enfin TTP* . D. Les rsultats suivants peuvent tre retrouvs exprimentalement : radioactivit

srum E. Quand l'exprience est termine, on fait une ultracentrifugation, le prcipit contient les lments dnaturs par le TCA, avec de l'ADN, de l'ARN...etc... radioactifs.
QCM 50 : A propos de la rplication: A. Pour les eucaryotes et les procaryotes la rplication et la division cellulaire sont simultanes. B. Pour les eucaryotes et les procaryotes la rplication est similaire. C. Dans la rplication, l'ADN Pol I se place l'extrmit 3' d'un fragment d'Okasaki et en prsence de dNTP, elle allonge ce fragment jusquau fragment dOkasaki suivant puis continue en "grignotant" l'extrmit 5' de celui-ci, extrmit faite dARN. D. Pendant la rplication, la ligase permet le "raccordement" de 2 fragments d'ADN aprs l'intervention de l'ADN polymrase III. E. La rplication ncessite entre autre des enzymes, de l'ATP, des dNTP, des NTP, et des protines.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

82

QCM 51 : Le gne PCEM1 code pour la protine Lanj1 qui permet de comprendre les QCM de biologie molculaire. Ce gne fait 13kb et prsente plusieurs sites de restriction Quad1. Chez les individus malades, PCEM1 est tronqu du fragment de 1kb. On isole ce gne chez plusieurs personnes et on effectue un Southern Blots avec 3 sondes S1, S2 et S3 comme le montre le schma ci-dessous aprs avoir trait le gne par Quad1. Quad1 Quad1 Quad1 Quad1 Quad 1

S1

S2

S3

2kb

6kb 13kb

1kb

4kb

S1

S2

S3 7kb 6kb

S1

S2

S3 7kb 6kb

S1

S2

S3

4kb 2kb 1kb A B

4kb 2kb 1kb C

A. Un sujet sain a un profil A. B. Un sujet sain a un profil B. C. Un sujet sain a un profil C. D. Si une personne ayant un profil A et une autre ayant un profil C ont un enfant, alors celui-ci aura la profil B. E. On peut penser que le sujet du profil A porte une mutation aboutissant la perte dun site de coupure de lenzyme de restriction Quad 1. QCM 52 : A propos des techniques de marquage A. Dans la mthode damorage au hasard, on utilise le fragment de Klenow de lADN polymrase I. B. Le fragment de Klnow de lADN pol I contient la fois une activit 5-exonuclasique et une activit longase. C. Si on utilise du [ 32P]dNTP lors de la mthode damorage au hasard, alors les fragments dADN synthtiss seront non radioactifs. D. Dans le cadre de la mthode damorage au hasard, on utilise des hexanuclotides comme amorce et des dNTP radioactifs. E. Dans la technique de marquage fluorescent indirect dun ADNc, le marquage de lADNc est dit indirect car on ne marque quun seul brin dADNc.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

83

QCM 53 : On souhaite cribler une banque dADN gnomique construite dans des cosmides. Pour cela, on ralise un Southern Blots avec une sonde dADNc monobrin marque au cyanine3dATP : on effectue dans lordre une lectrophorse des cosmides, une dnaturation aprs dpurination, un transfert sur membrane de nylon. Puis : A. Fixation des doubles brins dADN au nylon par UV, saturation du filtre par du sperme de poisson, incubation avec la sonde, lavage et rvlation. B. Fixation des monobrins dADN au nylon par UV, saturation du filtre par du sperme de poisson, incubation avec la sonde, lavage et rvlation. C. Dans cette exprience, il nest pas ncessaire que la sonde soit dnature avant lincubation. D. Aprs rvlation par autoradiographie, une absence de marquage montre que la sonde ne sest pas hybride car sa squence nexiste pas sur lADN gnomique. E. Aprs rvlation, la slection de plusieurs clones signifie forcment que la squence de la sonde est prsente en plusieurs exemplaires dans le gnome. QCM 54 : Soit le brin dADN 5-AAAGTACCTT-3 A. Son brin complmentaire est : 5-TTTCATGGAA-3 B. La traduction de ce brin dADN donne le brin dARN 3-TTTCATAGGTT-5 C. La transcription de ce brin dADN donne le brin dARN 5UUGGAUCUUU-3 D. LADN polymrase est plus fidle que lADN polymrase E. Il existe plusieurs types dARN polymrase chez les eucaryotes QCM 55 : A. Dans la cellule eucaryote une grande majorit de lADN est transcrit. B. lopron lactose permet la synthse dun ARN polycistronique qui produit 3 protines aprs traduction C. LARN polymrase est constitue de deux parties le cur de lenzyme et lholoenzyme D. LARN polymrase agit dans son entier tout au long de la transcription E. la primase est une ARN polymrase spcialise dans la rplication

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

84

CORRECTION
QCM 1 : ABE A.Vrai. Le fragment 2 est plus riche en base C et G qui sassocient avec le brin complmentaire par 3 liaisons hydrogne, donc plus difficiles rompre, la temprature de fusion est plus leve. B.Vrai Pour chaque base purique il y a une base pyrimidique en face, au niveau du brin complmentaire. Et vice-versa. C. Faux. Rupture des ponts hydrogne. D. Faux. 10.88nm car 10 nuclotides=3.4nm. QCM 2 : ADE A. Vrai le peptide commence par la mthionine et se termine par laa cod par le codon qui prcde le codon stop. B. Faux. Il est dit dgnr car il existe plusieurs codons qui correspondent au mme acide amin. C. Il ny pas dUridine introduit dans la synthse dun ADN. D. Vrai. Met=1possibilit de squence. Leu=6 possibilits. Pro=4. Cys=2. Asp=2. Gln=2. Do 1*6*4*2*2*6*2=1152. E.vrai. 180/10*3.4=61.2nm QCM 3 : BCDE A. Faux. Lorientation des ponts phosphate indique que le cot 5 est au niveau du T donc la squence est TCGTA. E. Vrai car 20% de A donc 20% de T. On a C+G=60% dou C=30%. QCM 4 : E A. Faux. Le OH est prsent mme sil disparait au cours de la cyclisation en ribofuranose. B. faux. Purique C. Faux. Nucloside triphosphate = nuclotide D. Faux. Cest le cas pour les bases pyrimidiques uniquement. QCM 5 : ABCDE QCM 6 : ABD A. B. C. Faux. 2 liaisons H.il y en a 3 entre C et G. D. E. Faux. ARN simple brin ! QCM 7 : AD B. Faux : modifications post transcriptionnelles C. Faux : queue polyA en 3 E. Faux : cest la haute force ionique qui permet laccrochage des ARNm sur la colonne doligo-dTcellulose. QCM 8 : AB C. Faux : structures en pingles cheveu D. Faux : dsamination de ladnosine E. Faux : cette liaison implique le ribose de lARNt.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

85

QCM 9 : B A. Faux : cest une raction en 2 tapes qui ncessite de lnergie, il y a consommation dun ATP. C. Faux : la tige acceptrice est CCA (lecture de 5 vers 3) D. Faux : cest linverse, procaryote : 3 ARNr diffrents ; eucaryote : 4 ARNr diffrents E. Faux : la petite sous unit ne possde quun seul ARNr. QCM 10: D A. faux: 3 4 molcules diffrentes dARNr contre 80 100 dARNt diffrentes. B. faux: dans la maturation de lARNm. C. faux: ribosome= ARNr + protines. E. faux: pas de noyau chez les procaryotes!!!!

QCM 11: D A. faux: de la traduction. B. faux: stabilit de lARNm. C. faux: le contraire. E. faux: la phosphatase dphosphorile et la kinase phosphorile QCM 12 : BD A. Faux. Ce sont les petits fragments qui migrent le plus loin. B. Vrai car il est charg ngativement. C. Faux. Il peut aussi se fixer lARN. D. Vrai. E. Faux. Il protge lARN des RN ases. QCM 13 : BCE A. Faux. Elle synthtise lADN de 5 en 3. B. Vrai. C. Vrai. D. Faux car lamorce est obligatoire pour son fonctionnement. E. Vrai. QCM 14 : BDE A. Faux car il faut aussi des d-NTP. B. Vrai. C. Faux : dabord la transfrase terminale + d-CTP puis ADN polymrase I + dNTP + oligodG. D. Vrai. E. Vrai. QCM 15 : CE A.Faux : il faut dabord dnaturer lADN pour lavoir simple brin puis utiliser une phosphatase alcaline avant de marquer le brin a la polynuclotide kinase. B. Faux : elle incorpore un phosphate radioactif lextrmit 5. C. Vrai. D. Faux, cest de l [32P]dCTP. Attention ceci est un pige courrant. E. Vrai.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

86

QCM 16 : BD A. Faux. Le courant lectrique va du moins au plus. B. Vrai. C. Faux. Le bromure dEthidium permet un marquage non spcifique de lADN. D. Vrai. E. Faux : le formaldhyde permet juste de dtruire le structure secondaire (structure avec ponts hydrognes, en tige boucle) des ARN et est indispensable QCM 17 : ACE A. Vrai. B. Faux. Les bactries dans le tube nont justement pas AmpR. Ce gne est situ dans le plasmide et cest cela qui permet de faire la slection. C. Vrai. D. Faux. Quand on coupe sur le MCS avec une seule enzyme on nobtient quun seul fragment. E. Vrai. QCM 18 : BD A. Faux. Cest du [32P] ATP que lon doit rajouter. B. Vrai. C. Faux. Cette dfinition est celle dune autre activit de lADN polymrase I : lactivit 3 exonuclasique. D. Vrai. E. Faux. La transcription se fait grce lARN polymrase et des NTP et la rplication se fait grce lADN polymrase et des dNTP. (faire vraiment attention si NTP ou dNTP dans un QCM) QCM 19 :A B.Non, il ne coupe quen un pointC.Les extrits ne sont pas compatibles. D.Les fragments ne sont pas identiques E.Non: il pourrait entre autre se produire une dltion QCM 20 : A B C D E. Faux. Les extrmits produites sont cohsives mais non compatibles. QCM 21 : A. Simplement de rvler le rsultat B.Electrophorse : on compte sur les charges electriques. C.LARN est sensible aux RNases omniprsentes dans la nature (salives, sueur, larmes ) D. Un plasmide est un ADN double brin on aura donc besoin dADN double brin, et de plus le Bromure dethidium est un agent intercalant qui altre l ADN. A manipuler avec prcautions, donc. E ; Faux, le bromure dthidium est rvl sous UV. QCM 22 : AD B. Faux, cest la liaison ester monophosphorique entre le P et le P qui fournit lenergie ncessaire. C.Faux, fragment de Klenow = activit polymrase + 3 exonuclase E. Faux, il y a libration dun desoxynuclotide triphosphate. QCM 23 : B A. faux, cest la transcriptase inverse C. faux, pour tre incorpor dans un plasmide lADN doit tre double brin. D. faux, cest la transfrase terminale. E. faux, on a besoin doligo-dG qui vont shybrider lenchainement de d-CTP de la matrice.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

87

QCM 24 : E A.Faux : franche donc non cohsive B.Faux : GAC + TCGAGGCCT ou bien AGGC + TCGAGTC C.Faux : bout cohsif D.Faux : cest un brin dADN QCM 25 :ABC B.Vrai : attention laction de PstI se fait sur le palindrome ---CTGCA/G---D.Faux : 3 --- TACCTAGGACGCTGCAG ---5 E.Faux : extrmits non compatibles QCM 26 : A B.Faux : vrai pour XhoI et SalI C.Faux : bout franc, extrmit franche et bouts non cohsifs ont meme signification D.Faux : les bactries comptentes sont les bactries ayant subit un traitement leur permettant de laisser entrer un plasmide ( mais nayant pas encore incorpor ce plasmide) tandis que les bactries transformes sont les bactries qui ont russi incorporer le plasmide E.Faux : phnomne rare QCM 27 :ACDE B. plus il a de bacteries plus l'absorption lumineuse augmente, donc plus la DO augmente. Plus il y a de bacteries, plus l'intensite de la lumire ayant travers la cuve est faible. QCM 28 : CDE A. la replication du plasmide est indpendante de la rplication du chromosome bactrien B. le chloramphnicol bloque la rplication du chromosome bactrien tout en laissant la possibilit aux plasmides de se multiplier. QCM 29 : ADE B.le rendement est dune bactrie tranforme sur un million C. si je transforme les bactries avec un plasmide Amp Rsistant, il faut que toutes les bacteries soient la base sensibles l'ampiciline, apres la transformation, j'ajoute l'ampiciline et celles qui survivent sont les bacteries transformes car ce sont elles qui ont integr le plasmide qui portait la resistance QCM 30.ADE B. identique au brin sens, le reste vrai C. chez les eucaryotes QCM 31.BDE A . La bta galactosidase. Se rappeler que il existe 3 problmes : -linsertion de lADNc dans le plasmide, -linsertion dans le bon cadre de lecture -la transformation des bactries C. Active que dans le premier tube QCM 32. ADE B. rpresseur inactif C. du CAP

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

88

QCM 33 : BCD A. Faux, Pas dintron dans ARNm mature. B. Vrai, Avec b et d on amplifie la squence codante, or la protine fait 60AA donc 60*3=180 pb, au codon Stop prs. C. on rajoute les introns 2,3 et 4 au fragment codant de180pb trouv prcdemment soit au final 180+ 30 + 40 + 20 = 270pb. E. Loligodesoxynuclotide est complmentaire du brin non-sens, donc pas utilisable pour un Northern blot. QCM 34 : B A. Il faut des dATP aussi. B. Vrai : 1 chance sur 2 quil sinsre dans le bon sens, et 1 chance sur 3 quil soit dans le bon cadre de lecture par rapport au codon dinitiation donc au total 1 chance sur 6. C. faux, APRES le deuxime desoxynuclotide. D. Faux, le fluorophore se fixe sur lADN double brin dans les petits sillons seulement. E. Faux, on utilise la Taq polymrase qui est rsistante la chaleur. QCM 35 : CD A. Faux, on obtiendra une bande de 950 pb B. Faux, la sonde S ne peut pas shybrider lallle 2 puisquil ne contient pas la rgion de 250 pb de base complmentaire de la sonde. C. Vrai car les protines produites par lallle 2 ne seront pas fonctionnelles. E. Faux, le fragment rvl aura une taille de 950 pb. QCM 36 : BDE A.1 double liaison C. faux, 9 atomes dhydrogne. QCM 37 : BC A ; Faux, les cellules ES ont la capacit de se diffrencier en nimporte quel type cellulaire. D. Faux, on aura des souris homozygotes +/+, -/- et des souris htrozygotes. E.Faux, la transfection est une tape du Knock out. QCM 38 : AB C.La taille galement D.procaryote galement E. Faux, il a dabord transfert sur le nylon QCM 39 : CD A.Faux, en ADN monobrin B.Faux, activit exonuclasique E. Faux, cette technique utilise des fluorophores. QCM 40 : D A. faux : Chez les eucaryotes, rplication et division sont spares dans le temps. B. faux : La phase M correspond la Mitose : sparation des chromosomes et division cellulaire, la phase de multiplication de la quantit dADN est pendant la phase S. C. faux : les 2 brins servent de brins matrices D. vrai E. faux : substrats de la primase : NTP ; substrats de lADN polymrase : dNTP

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

89

QCM 41 : ACD A. vrai B. Faux : lHlicase se fixe sur la ou les origine(s) de rplication, pas sur nimporte quelle squence . C. vrai D. vrai E. faux : la primase synthtise des monobrins dARN QCM 42 : AD A. vrai B. faux : LARN polymrase de la rplication est spcialise dans la rplication, cest la Primase C. faux : Fragments dOkasaki = ARN (amorce) et ADN D. vrai E. faux : brin indirect = brin retard. QCM 43 : Rponses vraies D, E A. les phages utiliss suivent uniquement un cycle lytique. B. Le sens ne change strictement rien pour lhybridation avec la sonde par contre la protine produite sera diffrente. C. lencapsidation peut seffectuer in vitro. QCM 44 : Rponses vraies A, C A. B. Gnralement, le systme de marquage est port par un second anticorps. C. les bactries nont pas de noyau D. et E. cest lextrmit N-terminale qui est conserve, et la nouvelle squence, munie de son codon Stop, occupe lextrmit C-terminale QCM 45 : Rponses vraies B, C, D A. Cest le Southern blot qui est du au biologiste Edward Southern. Le Northern et le Western blot sont des extensions lexicales. B. C. Cest de lARN qui est donc naturellement monocatnaire D. E. Faux Pas traduction mais transcription , le reste est juste. QCM 46 : D E A. c'est l'inverse B. par une exonuclase 3'. L'endonuclase 3' limine radicalement la queue polyA C. en 3' de l'ARNm QCM 47 : B C D A. c'est la protine qui est l'lment trans et qui se fixe sur l'lment cis de l'ARNm E. il y en a plusieurs QCM 48 : D E A. faux: pas au hasard, origine de rplication. B. faux: protines SSB. C. faux: 5'exonclasique!!!

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

90

QCM 49 : AUCUNE A. faux: rplication. B. faux: sans srum pas avec! C. faux: dTMP... D. faux: voir cours vignette 135. La courbe crot car il y a synthse d'ADN donc augmentation de la radioactivit car augmentation des dTTP* dans lADN. E. faux: juste ADN radioactif, lARN synthtis ne sera pas radioactif et les lments non incorpors ne seront pas prcipits QCM 50 : B C E A. faux eucaryotes-----> cycle cellulaire : rplication et division cellulaire divis dans le temps. D. faux: ADN polymrase I. QCM 51 : Rponses vraies B, A. Impossible dobtenir une bande de 7kb avec la sonde S2 ! C. Cf B D.Faux E. Faux car dans ce cas l la sonde 3 naurait pas dtecter un fragment de 1kpb mais un fragment de 7kpb en plus du fragment de 4kpb. QCM 52 : Rponses vraies : A, C B. 3-exonuclase C. cest radioactif si on utilise du [-32P]dNTP D. hexadsoxynuclotides E. indirect car marquage en 2 temps : 1par laminoallyl dNTP, et 2par le couplage chimique la cyanine3. QCM 53 : Rponses vraies B, C A. Cf B C. vrai car la sonde est dj monobrin D. on a un marquage fluorescent, donc une autoradiographie ne montrera rien. E. Dans une banque cosmidique, il y a chevauchement des squences dADN, ce qui ne signifie pas quil existe plusieurs copies dune squence dans le genome. QCM 54 : C E A.Faux 5-AAGGTACTTT-3 B.Faux pas de T dans ARN D.Faux cest linverse E.Vrai ADN polymrase I II III QCM 55: BC A. Faux dans la cellule eucaryote seulement 1% environ est transcrit. D. Faux. seul le cur de lenzyme agit aprs le promoteur de gne E. Faux la primase est spcialise dans la transcription

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

91

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

92

PARTIE III BIOPHYSIQUE

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

93

QCM 1 : Concernant les tats de la matire : A. La liaison hydrogne est la plus rsistante des liaisons de Van der Waals qui sont des forces intermolculaires attractives de nature lectrostatique. B. Les nuages lectroniques des atomes ninterviennent pas dans les forces rpulsives intermolculaires. C. Les fluides (solide et gaz) nont pas de forme propre et sont caractriss par une agitation thermique permanente associant des mouvements de translation, vibration et rotation. D. Le covolume est un indicateur de ltat physique : plus il est proportionnellement faible plus on est proche de ltat gazeux. E. Ltat liquide et ltat solide sont tous les deux des tats structurs, mais seul ltat solide est un tat condens. QCM 2 : A propos des changements dtats : A. La vaporisation dun liquide se fait quelque soit la temprature. B. La vaporisation comme tout changement dtat se fait temprature du systme constante. C. Laugmentation de la temprature et de la pression favorisant la vaporisation. D. Lors de la formation dun glaon dans un bac deau liquide, on observe une diminution de la temprature de leau reste liquide. E. La condensation de la vapeur deau sur une surface vitre dpend la fois de la temprature de la vitre et de la temprature de la vapeur deau. QCM 3 : Etats physique de la matire A. Les forces attractives intermolculaires sont efficaces trs courte distance B. Les forces rpulsives intermolculaires sont efficaces courte distance C. En thorie, lagitation thermique peut tre nulle si lon se trouve 0C D. Dans les solides, on ne peut retrouver que des mouvements de vibration E. Ltat solide est incompressible. QCM 4 : Etat physique de la matire A. Plus un tat est condens, plus il est ordonn B. Les changements dtat sont tous rversibles C. Lagitation thermique diminue lorsque la temprature augmente D. Chaque changement de direction dune molcule correspond un choc avec une molcule voisine E. Les forces de Van der Waals sont des forces rpulsives de nature lectrostatique. QCM 5 : Etat physique de la matire A. La liaison hydrogne est la plus solide des liaisons de Van der Walls B. Plus un tat est compressible, plus le volume offert lagitation thermique est grand C. Plus lintensit des forces inter-particulaires attractives est importante et moins lagitation thermique de translation est grande D. Les gaz sont toujours miscibles entre eux et quelques soit leur proportion on obtiendra toujours un mlange homogne E. Si ltat solide est condens, cest parce que lespace disponible pour lagitation thermique des particules est faible

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

94

QCM 6 : Un gaz rel se rapproche dautant plus dun gaz parfait que : A. Il est sous haute pression B. Il se trouve basse temprature C. Il est pressent a forte concentration D. Il a une masse molaire faible. E. Il est chimiquement inerte. QCM 7 : Concernant les gaz rels A. La pression mesure pour un gaz rel est sous-estime par rapport un gaz parfait du fait de la pression interne ; cette pression interne est due aux forces dattraction inter-moleculaires. B. Le volume disponible pour lagitation thermique mesur pour un gaz rel est surestim par rapport un gaz parfait du fait du covolume des molcules du gaz reel. C. La pression totale dun mlange gazeux est la somme arithmtique des pressions partielles constituant le mlange. D. Les gaz reels presents dans la nature qui se rarochent les plus de gaz parfaits sont les gaz rares. E. Il existe des chocs entre leurs molcules, entre les molcules et les parois : ces derniers sont lorigine de la pression mesure. QCM 8 : Soit un mlange de 4 gaz A, B, C, D contenu dans un volume de 1000 cm3 une temprature de 273 K, le nombre total de moles tant 2.On sait que la pression partielle de B est le cinquime de celle de A qui est elle-mme la moiti de la pression partielle de D. La pression partielle de C est 3648 mmHg. A. La pression totale est de 448 mtres deau. B. La fraction molaire de A est le double de celle de D. C. La pression partielle de A est 12,5 atmosphres. D. La fraction molaire de D est de lordre de 0 ,056. E. temprature gale et volume gal, un gaz parfait sera plus compressible quun gaz parfait. QCM 9: Un rcipient contient un mlange gazeux constitu de 10g dun gaz parfait A (M=100g/mol) et 1g dun gaz parfait B (M=20g/mol) sous une pression totale de 1 Atm 0C. A. Il y a 0.10 mole de gaz A B. Il y a 0.05 mole de gaz B C. La fraction molaire de B a une valeur de 0.5 D. Le volume du rcipient est de 3.36 litres E. A 37C la pression dveloppe serait plus faible QCM 10 : Soit un mlange gazeux O2, N2, H2, CO2 de pression totale 760mmHg. La fraction molaire de O2 est gale , la pression partielle de N2 est gale 190mmHg et ce mlange renferme autant de mole de H2 que de O2. A. La fraction molaire de N2 est gale B. La fraction molaire de CO2 est gale 0.25 C. La pression partielle de H2 est gale 190mmHg D. La pression partielle en CO2 est gale 190mmHg E. Ce mlange gazeux renferme autant de moles de N2 que de CO2

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

95

QCM 11: La structure dipolaire de leau est directement responsable de : A. La polylmerisation de molcules deau. B. La dissolution des solides. C. Du rle de volant thermique de leau. D. La capacit de thermolyse de leau. E. Lhydratation de certains soluts. QCM 12 : Concernant leau A. La glace est plus dense que leau liquide B. Linsolubilit dans leau est rare C. La chaleur de dissolution dun gaz est la chaleur de liqufaction D. La dissolution dun gaz lve la temprature de leau E. La dissolution dun solide lve la temprature de leau QCM 13 : Proprits de leau A. Lhydratation des ions est suivie de leurs dissociations. B. Le solvant perd de lnergie lors de la dissolution avec dissociation car son nergie cintique diminue. C. La dissociation de leau est la base du pH. D. La chaleur dhydratation est la somme de la chaleur de changement dtat (positive ou ngative) et de la chaleur de dissociation (toujours positive). E. Si la chaleur de dissolution est positive, la temprature de leau augmente. QCM 14 : Un homme de 100 Kg prsente une temprature de 40C. Afin dy remdier, il dcide de prendre un bain quil remplira sa baignoire de 30 L. Chaleur massique de lhomme=0.83 cal/g et Chaleur massique de leau = 1 cal/g A. Par lintermdiaire de sa chaleur massique leve, leau permet de lvacuation du trop plein de chaleur. B. Afin de redescendre 37C, cet homme devra liminer 300 000 cal. C. Il devra rgler la temprature de son bain 28.7C. D. Sil dcide de remplir sa baignoire de 50 L environ, il devra rgler la temprature de son bain 32C. E. Un corps dshydrat luttera plus difficilement contre les variations de chaleur. QCM 15 : Un homme plonge son doigt (t= 36.8C, m=20g) dans un verre d'eau de 20 cL 20.8C. On sait que la chaleur massique de l'homme est de 0.8 cal/g et que celle de l'eau est de 1 cal/g. La chaleur latente de vaporisation de l'eau est 600 cal/g. A. Au bout d'un moment, le doigt et l'eau seront tous les deux la temprature de 28.8C. B. Si on laisse le doigt trs longtemps dans le verre, la temprature du verre d'eau atteindra 36.8C. C. Pour atteindre une temprature de 25.8C, l'eau du verre doit recevoir 100 cal. D. Pour atteindra une temprature de 25.8C, l'eau du verre doit recevoir 12.000 cal. E. Sachant que le tissu humain contient 60% d'eau, le doigt aura perdu 7.200 cal quand il aura atteint une temprature de 33.8C.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

96

QCM 16 : Soit la dissolution du CO2 gazeux dans 1l d'eau l'tat liquide. La chaleur de liqufaction une valeur absolue de 145KCal et la chaleur d'hydratation une valeur absolue de 145KCal. Chaleur massique de l'eau: 1cal/g A. La chaleur de dissolution (hydratation+ liqufaction) est nulle. B. L'eau va gagner 290 Kcal soit 0,29C. C. La chaleur d'hydratation (ou solvatation) est toujours positive. D. Gnralement les chaleurs molaires de dissolution des solutions sont ngatives. E. La chaleur d'hydratation correspond un gain d'nergie (donc de chaleur) d la perte d'nergie cintique de l'eau QCM 17 : Soit une solution aqueuse de 1L de : -NaCl (M=58,5) 5,85g/L -CH3COOH (M=60) 15g/L =0.5 A. Losmolarit dveloppe par le NaCl dans cette solution est de 0,1osm/L B. Il y a rellement dans la solution 0,1mol/L dions Na+. C. Il y a rellement dans la solution lquilibre 250mEq/L dions CH3COO. D. Lacide thanoque (CH3COOH) est un lectrolyte fort. E. Dans la solution, il reste, lquilibre, 0,125mol/L de CH3COOH non dissoci. QCM 18 : On a deux solutions A et B telles que : A=> 1L de solution de Glucose (M=180) 90g/L B=> 500mL de solution de NaCl (M=58,5) 0,6mol/L A. En mlangeant les deux solutions on a 1,5L dune solution de 0,5mol/L de Glucose et 0,6mol/L de NaCl. B. En mlangeant les deux solutions on a 1,5L de solution contenant 0,5 mol de Glucose et 0,3mol de chaque produit de la dissociation de NaCl. C. En mlangeant les deux solutions on a 1,5L de solution dosmolarit totale denviron 0,53333 osm/L. D. En mlangeant les deux solutions on a 1,5L de solution de 0,33mol/L de Glucose et 0,2mol/L de NaCl. E. Pour obtenir environ 1L de solution de 0,1mol/L en Glucose et 0,1mol/L de NaCl, on peut mlanger 0,2L de A environ 0,167L de B et ajouter 630mL deau. QCM 19 : Soit une solution aqueuse dacide actique (CH3COOH) 0,5mol/L, M=60, =0,5. A. Lacide actique est un lectrolyte fort qui apporte donc un nombre trs important dions H+ dans la solution, ce qui explique son fort caractre acide. B. Losmolarit de la solution est de 1osm/L. C. Selon la loi dOstwald, K=0,5. D. Un K trs grand caractrise un lectrolyte trs faible. E. Le coefficient dionisation i=1,5 QCM 20: Pour un lectrolyte binaire trs faible, cest dire AC A + C+.

A. Le coefficient de dissociation de cet lectrolyte est suprieur ou gal 1. B. Son coefficient dionisation est infrieur 2. C. Sa constante de dissociation est trs grande. D. i=1+ E. i tend vers 1

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

97

QCM 21: 35,5g de Na2SO4 (M=142) sont en solution dans 500cm3 deau. Le coefficient de dissociation est de 0,8. A. Losmolarit de la solution est de 1,3osm/L B. Pour le calcul de losmolarit de la solution, on prend un coefficient dionisation de 1,8. C. La constante de dissociation vaut 1,6. D. Dans la solution, on a rellement 0,8Eq/L de Na+. E. La molarit de la solution est de 0,25mol/L. QCM 22 : Soit une solution aqueuse de HNO3 m= 0.3 avec = 0.2 A. Il y a 0.6 mol/l dion H+ et 0.6 mol dion NO3B. Il y a 0.36 osmoles/l dans cette solution C. La valeur approche de K est de 0.012 D. La solution est lectriquement neutre E. K dpend de la T et de la concentration en lectrolytes QCM 23: Soit une solution A de NaCl de molarit 0.02 mol/L et une solution B de NaOH de molarit 0.01. On mlange 300mL de A 700mL de B pour former une solution C. M (Na)= 23g/mol et M (Cl)= 35.5g/mol. A. La molarit de la solution C est gale 0.03 mol/L. B. L'omolarit de la solution C est gale 0.026 Osm/L C. La solution C contient 0.013 mEq/L d'ions Na+ D. La molalit de cette solution est sensiblement gale la molarit. E. La solution C dveloppe une pression d'environ 58m d'eau face une membrane thorique qui ne laisserait passer ni NaCl, ni NaOH (mais qui laisse passer le solvant). QCM 24 : Gels et solutions collodales : A. Un gel liaisons de Van der Waals en prsence dexcs de solvant gonfle plus quun gel liaisons hydrogne car ces derniers se liqufient trs facilement dans ces conditions. B. Un choc peut suffire faire floculer une solution de collodes lyophiles. C. Dans les solutions collodales un solide est dispers au sein dun liquide. D. La thixotropie est la sparation en deux phases dune solution collodale et la floculation est le passage rapide dun gel ltat liquide. E. Gels utiliss en biotechnologies : pour la diffusion dans les gels les plus grosses molcules arrivent en premier en bas du gel. Dans llectrophorse, la migration dpend de la charge (et de la masse et lencombrement). QCM 25 : La partie du plasma qui contient lure, les gaz, le glucose, les lectrolytes : A. est un collode lyophobe. B. est caractrise par un nombre de 103 109 atomes contenus dans une particule. C. peut floculer par limination de molcules deau dhydratation : ajout dun alcool ou dun lectrolyte. D. peut floculer lors de faibles modifications du milieu (pH, temprature), ce qui explique limportance de lhomostasie. E. peut tre analyse par lectrophorse du fait des proprits des solutions collodales.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

98

Interfaces
QCM 26: Soit 2 populations de molcules dont les forces de rpulsion l'emportent sur celles d'attraction: A. On obtient 2 milieux diffrents que les molcules soit l'tat liquide, solide ou gazeux. B. Pour 2 liquides, l'interface tendra tre la plus petite possible, c'est--dire qu'elle pourra prendre une forme sphrique. C. Pour 2 liquides, l'interface tendra tre la plus petite possible, c'est--dire qu'elle sera toujours plane. (Sauf au contact du rcipient) D. On peut augmenter l'interface entre deux liquides, en apportant de l'nergie, mais jamais de faon dfinitive. E. Pour 2 liquides, leur rpartition est en fonction de leur proportion dans le mlange. QCM 27 : Soit une bulle de type eau savonneuse a lair libre : A/ Plus une bulle est grande et plus la diffrence de pression avec l'extrieur est importante. B/ Plus une bulle est de petit diamtre, plus vite elle disparat. C/ Lorsque la pression extrieure diminue, la diamtre de la bulle augmente. D/ Lorsque la pression extrieure diminue, la pression de l'intrieur de la bulle diminue aussi. E/ Si on ajoute du sucre dans la paroi de la bulle (qui est constitue d'eau), la tension superficielle de la paroi aura tendance diminuer. QCM 28 : Interface Liquide-Gaz : A. La temprature n'influence pas la tension superficielle. B. D'aprs la loi de Laplace, la surpression dans une bulle est reprsente par l'quation P=4/r. C. Une goutte adopte toujours une forme sphrique. D. Les surfactants diminuent la tension superficielle. E. Lorsque deux gouttes fusionnent il y a libration d'nergie QCM 29 : Le surfactant pulmonaire : A. La surpression rgnant dans une alvole est de P = 4 / r. B. Le surfactant pulmonaire est ncessaire au maintient de ltendue de linterface air/capillaire. C. Le surfactant est trs soluble dans leau, donc il diminue la tension superficielle dans lalvole. D. Lors de linspiration, la surface de lalvole tend augmenter, ce qui entrane la dilution du surfactant, ce qui a tendance faire augmenter la tension superficielle. E. Sil ny avait pas de surfactant les petites alvoles possderaient une surpression suprieure celle des grandes et auraient donc tendance augmenter de taille. QCM 30 : Tension superficielle A. Les soluts diminuant la tension superficielle sont des soluts de faible affinit avec le solvant. B. Le surfactant pulmonaire est un solut tensioactif qui diminue la surpression dans lalvole. C. Les soluts tensioactifs qui diminuent la tension superficielle sont en gnral des molcules bipolaires. D. Une goutte deau dans lair a une surpression dautant plus grande que son rayon est grand. E. La fusion de deux gouttes deau ncessite un apport dnergie.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

99

QCM 31 : Mouillement/Imbibition A. Lors du dpt d'un liquide sur un solide sans affinit l'un pour l'autre, l'angle de contact (angle dans l'ouverture duquel s'inscrit la phase liquide) est de 180. B. La mouillabilit dpend de l'affinit existant entre le liquide et le solide considrs. C. Un liquide donn peut pntrer les interstices d'un corps poreux ou fibreux : c'est le phnomne de mouillement D. La surface de contact d'une goutte liquide sur un solide ne dpend que de l'affinit solide/liquide. E. Les corps tensioactifs sont des agents mouillants. QCM 32 : On utilise un compte-gouttes avec deux solutions A et B A. Si A et B ont la mme affinit pour le compte-gouttes et que A> B ( = tension gaz/liquide), un volume V de la solution A donnera plus de gouttes que le mme volume de B. B. Si A= B et que la solution B est plus affine pour le compte-gouttes que la solution A, un volume V de la solution A donnera plus de gouttes que le mme volume de B. C. Si on augmente la temprature, il se formera plus de gouttes. D. Le volume de chaque goutte dpend, entre autres, des affinits gaz/liquide ; gaz/solide ; solide/liquide. E. Plus laffinit avec le solide sera grande, plus le volume dune goutte sera important. QCM 33: Soit un compte-goutte avec (eau)= 0,073 newton.m-1 (coefficient de tension superficielle) et 1ml d'eau donne 20 gouttes. A. En pratique, le poids (donc le volume) de la goutte dpend uniquement de la valeur de la tension superficielle air-liquide. () B. Soit un liquide avec =0,01 newton.m-1, il fournira moins de 20 gouttes par ml, celles-ci seront donc forcement plus grandes. C .Le liquide doit avoir une forte affinit avec le compte-goutte pour que celui-ci soit prcis. D. Le poids de la goutte ainsi form va tre inversement proportionnel la tension superficielle du liquide. () E. En recherche pharmacologique on peut utiliser un compte-gouttes pour trouver le dun liquide QCM 34 : Les embolies gazeuses : A. Les embolies ont plus de rpercutions dans les capillaires que dans les gros vaisseaux. B. Les bulles saccrochant contre la parois vasculaire, la pression en aval de la bulle peut devenir nulle et donc entraner un arrt de la circulation. C. Les embolies gazeuses sont le plus souvent provoques par laction de bulles disposes les unes la suite des autres. D. Lorsquune bulle est prsente dans un vaisseau, si linterface air/sang en amont est trs aplatie, cela signifie que la diffrence de pression entre lamont et laval de la bulle est trs leve. E. Plus une bulle est accroche la parois vasculaire plus le rayon de la bulle en amont se rapproche de 0. QCM 35 : L'embolie gazeuse: A. L'embolie gazeuse (prsence d'air donc d'O2 dans le sang) permet une meilleure oxygnation tissulaire. Dans certains cas cette hyper oxygnation est telle que l'embolie peut devenir dangereuse. B. Pour son tude on considre une seule interface: air-sang. C. Plus les vaisseaux ont un diamtre petit et plus leurs rpercussions peuvent tre nuisibles. D. Un "chapelet capillaire" est un ensemble de capillaires anastomoss qui sont par mis les premiers tre gns par l'embolie gazeuse. E. Une embolie gazeuse peut arriver de manire trs brutale, sans circonstances particulires.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

100

QCM 36 : Ladsorption Soit une solution A en contact avec un solide. A. Plus la temprature est leve plus le nombre de sites de fixation occup sera important. B. Les variations de concentration ninfluencent pas le nombre de sites de fixation occups. C. La liaison avec les sites de fixation se fait par liaison covalente. D. On peut dtacher les molcules fixes sur le solide en ajoutant un solut plus affin que A. E. Le phnomne dadsorption est la base de techniques de sparation des molcules QCM 37: compte-gouttes A. Le principe du compte-gouttes repose sur une trs forte affinit entre le liquide contenu et la matire constitutive du compte-gouttes. B. l'interface eau/air y est lastique. C. On note la prsence d'un mnisque l'interface liquide/air. D. Toutes les gouttes produites par un compte-gouttes donn et une solution donne ont le mme poids. E. Une mme quantit d'une solution donne des nombres de gouttes inversement proportionnels leur tension superficielle. QCM 38 : Un rfrigrateur maintient lair quil contient 4c. Si cet air se rchauffe, il le ramne 4c. Quand on ouvre la porte, de lair chaud un degr hygromtrique lev sy engouffre. A. Quand on referme la porte, lair lintrieur du frigo sest charg en eau. B. Lorsque le frigo va refroidir cet air, son degr hygromtrique va baisser. C. Lorsque le frigo va refroidir cet air, de leau liquide se forme. D. Lorsque le frigo va refroidir cet air la TV va augmenter. E. Lorsque le frigo va refroidir cet air, la TVS va diminuer. QCM 39 : Petit P1 veut faire cuire son pauvre plat de ptes quotidien. Dans ce but, il met de leau chauffer. Lair de la pice est sec (TV=0) et pression atmosphrique. La pice est bien ventile. A. Sans couvrir la casserole, il la met sur le feu (T leve) : le flux de vaporisation augmente. B. Dans ces conditions, de leau revient dans la casserole par un flux de liqufaction. C. Dans ces conditions, la vitesse dvaporation est trs faible. D. Petit P1 affam pose un couvercle sur la casserole : progressivement, un flux de liqufaction apparat. E. Petit P1 ajoute un solut (du sel) dans la casserole : cela ne change pas du tout le flux de liqufaction. QCM 40 : Pressions partielles : valeurs A. La pression partielle dOxygne atmosphrique est de 100mmHg. B. La pression partielle de CO2 atmosphrique est de 0,2mmHg. C. Lair sortant des poumons est toujours satur en eau. D. La pression partielle dO2 alvolaire est de 13 % E. La pression partielle de N2 atmosphrique est presque la mme que celle de N2 alvolaire (600mmHg) QCM 41: Un plongeur descend 75m de profondeur avec un mlange de 80% de N2 et 20% dO2. A. La pression de lair inspir doit tre de 7,5 atm. B. Sil descend plus profond la concentration plasmatique dO2 se rvle toxique. C. A 65m de profondeur la PO2 plasmatique est de 760mmHg. D. Le plongeur doit respecter des paliers de compression pendant sa descente en profondeur. E. Avec un mlange 1% dO2, il est bien oxygn 75m de profondeur.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

101

QCM 42 : Soit une bouteille de plonge contenant un mlange de 60L de O (20%) et N (80%) 3atm. A. Ce mlange est utilisable une profondeur de 30m, car il n'est pas toxique. B. Si on relchait ce mlange la surface de la terre, il occuperait un espace de 180L. C. La fraction molaire d'O est gale 12. D. La pression partielle en O est de 0.6 atm E. L'air expir par un plongeur respirant ce mlange contient uniquement de l'O, du N et du CO.

Le pH
QCM 43 : Soit une solution aqueuse dlectrolytes forts dont lactivit en ions H+ est A=10Eq/L A. le pH de la solution se situe dans la zone dacidit B. le pH de la solution est gal 0 dans lchelle classique des pH C. le pH rel de la solution a une valeur ngative D. il est impossible pour une solution davoir un pH infrieur 0 ou suprieur 14 E. la solution peut tre une solution dactate de sodium. QCM 44 : Soit une solution A dun monoacide fort de molarit mA = 0,2mol/L, Une solution B dun diacide fort de molarit mB = 0,2mol/L, Une solution C dun monoacide faible (Ka = 10-4.3) de molarit mC = 0,2mol/L. (On donne log 2 = 0,3) A. Le pH de la solution A est de 0,7 B. Le pH de la solution B est de 0,35 C. Le pH de la solution C est de 2 D. Les solutions B et C on la mme acidit totale. E. Si on ajoute 1L deau 1L de solution C le pH est multipli par 2. QCM 45 : Daprs la thorie de Brnsted, considrant les couples suivants H+ + Cl- , Cl- peut tre considr comme une base A. HCl B. H2O H+ + OH-, H2O peut tre considr comme un acide C. CH3COOH CH3COO- + H+, CH3COO- peut tre considr comme un acide D. NH4+ NH3 + H+, NH4+ peut tre considr comme une base H+ + CO32-, HCO3- peut tre considr comme un acide E. HCO3 QCM 46: A propos du pH A. H2SO4 est un monoacide fort B. HCl est un acide fort C. CH3COOH est un diacide faible D. H2CO3 est un diacide fort E. savoir si un acide est faible/fort et si cest un monoacide/diacide est inutile pour le calcul du pH QCM 47 : On considre diffrentes solution aqueuses dlectrolytes forts I, J, K, L, M dont les activits sont : I=1 Eq/L J=10 Eq/L K=102 Eq/L L=103 Eq/L M=104 Eq/L + A. lacidit totale ou titrable dpend de [H ] et est sensiblement quivalente au pH B. lacidit potentielle concerne uniquement les acides faibles C. lacidit relle ou ionique reprsente le nombre de OH- ncessaires pour neutraliser totalement lacide D. la solution M est celle dont lacidit relle est la plus importante E. toutes ces solutions ont manifestement une mme acidit totale ou titrable.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

102

QCM 48 : Soit un volume V = 100ml dune solution dun monoacide faible de molarit m = 2 mol/L et de pka = 4,3. (log 1 = 0 ; log 5 = 0.7) A. Le pH de la solution est de 2,3 B. Le coefficient de dissociation de lacide est de 510-3 C. Lacidit potentielle est de 0.01 D. On ajoute 0.1 mol de NaOH la solution. Le pH est alors gal 3 E. A neutralisation complte le pH sera lgrement acide. QCM 49 :Soit un diacide H2A de Ka1 = 10-3 et de Ka2 = 10-8 On dose une solution de cet acide (m = 0.5 mol/L) avec de la soude. log 5 = 0.7 A. Le pH de la solution avant lajout de soude est de 1,65 B. La neutralisation complte de la premire acidit a lieu pH = 5.5 C. Lorsque le pH est de 4, on peut retrouver des molcules de A- en solution. D. A pH = 8 on retrouve en solution des molcules de H2A, de HA et de AE. Comme cet acide est un diacide, il na aucun pouvoir tampon. QCM 50 : Solutions aqueuses dacides et de bases. A. Le produit ionique de leau est gale au produit de [H+] par [OH-] et est gal 14. B. Le pH de leau est de 7 car [H+] = [OH-] = 7 Eq/L. C. Selon la thorie dArrhenius, une base est un lectrolyte dont la dissociation produit des ions OHD. Selon la thorie de Brnsted, toute substance capable de librer un ou des protons est un acide. E. Selon la thorie de Brnsted, toute substance susceptible de fixer un ou des protons est une base QCM 51 : Neutralisation dun acide par une base. A. A neutralisation complte dun acide fort, on est en prsence dune solution dun sel dacide fort et de base forte, on a donc pH = 7 B. A neutralisation complte dun monoacide faible, on est en prsence dune solution dun sel dacide fort et de base faible. On a donc pH > 7 C. A demi neutralisation dun monoacide faible, lorsque [sel form] = [acide restant], on a lgalit pH = pKa. Ltude de la neutralisation permet donc de mesurer prcisment le Ka et donc de calculer le pKa. D. Dans la zone autour du pKa, le pH varie beaucoup quand on ajoute de la soude. On est trs loin dun systme tampon. E. Lorsque lon neutralise un diacide faible, lors de la neutralisation de la premire fonction acide, le pH est gal ( pKa1 + pKa2 ). QCM 52 : Dsquilibres acido-basiques : A. Dans les dsquilibres gazeux (respiratoires), le pH et la pCO2 varient dans le mme sens. B. Dans les dsquilibres fixes (mtaboliques), le pH et la pCO2 varient dans le mme sens. C. Quelle que soit lorigine du trouble acido-basique (quil soit respiratoire ou mtabolique), les reins corrigent toujours le dsquilibre en augmentant la rabsorption des ions H+ et la scrtion des ions HCO3- en cas dalcalose, ou en augmentant la scrtion des ions H+ et la rabsorption des ions HCO3en cas dacidose. D. Le systme nerveux central et les muscles peuvent tre la cause dun dsquilibre acido-basique. E. Lorganisme doit lutter en permanence contre une tendance lacidose et est bien quip pour cela.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

103

QCM 53 : A propos du systme tampon bicarbonate / acide carbonique : A. Cest le systme tampon le plus important car il neutralise plus de la moiti des ions H+ surnumraires. B. Bien quil ne soit quextracellulaire, il reste le systme tampon le plus performant. C. Cest un systme tampon dit ouvert sur le milieu extrieur, rechargeable et rquilibrable par les poumons et les reins notamment. D. le pH en fonction de ce systme tampon se calcule par pH = 6,1 + log [HCO3-] / [CO2] E. Il est qualitativement le plus efficace des systmes tampons et est quantitativement bien reprsent. QCM 54 : Les organes rgulateurs du pH A.Il interviennent en 1ere ligne de dfense pour liminer les substances gnratrices dun trouble, retenir les substances dont le dfaut provoque un trouble ainsi que pour rtablir un rapport normal [sel]/[acide] des ST B.Au niveau des poumons il existe des chmorecepteurs au CO2 qui permettent une modification reflexe de la ventilation afin dassurer une rgulation de [CO2] C. Une augmentation de la pCO2 plasmatique provoque une hypoventilation qui permet une limination du CO2 D.Les reins ragissent en contrlant les excrtions urinaires des ions H+, HCO3-, Na+, HPO4-E.Le tissu osseux peut remplac ses Ca+ par des H+ QCM 55 : En ce qui concerne lalcalose gazeuse : A. Elle peut survenir lors de la chute de la pCO2 lorsque la pO2 augmente. B. Elle peut trs bien survenir au cours dune pathologie ou dune adaptation physiologique. C. Elle peut survenir lors dun coma ou dune myopathie. D. Elle participe ce que lon appelle le mal des montagnes . E. La correction se fait par les systmes tampons, puis les reins et les poumons.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

104

CORRECTION
QCM 1 : Rponses vraies A D B. Justement elles sont a lorigine des forces de repulsion C.attention:les fluides sont les gaz et les LIQUIDES E.les tats solide ET liquide sont condenss, seul ltat solide est structur. QCM 2 : Rponses vraies A B C.laugmentation de temprature favorise la vaporisation, alors que laugmentation de pression favorise la liqufaction. D.lors de la formation dun glaon, ce sont les molcules de plus faible energie moyenne qui se rapprochent et tablissent des liaisons intermolculaires fortes;pour cela elles doivent se dfaire dune partie de leur energie qui est redistribue au milieu: lenergie moyenne de leau liquide augmente ,de mme que sa temprature. E.la condensation dsigne le changement dtat gaz vers solide, alors que ce qui est dcrit dans la phrase est une liqufaction. QCM 3 : Rponses vraies E A. Les forces attractives intermolculaires sont efficaces courte distance B. Les forces rpulsives intermolculaires sont efficaces trs courte distance C. En thorie, lagitation thermique peut tre nulle si lon se trouve 0K D. Aussi, mouvement de rotation pour les cristaux molculaires QCM 4 : Rponses vraies ABD C. Lagitation thermique augmente lorsque la temprature augmente E. Les forces de Van der Waals sont des forces attractives de nature lectrostatique. QCM 5 : Rponses vraies ABCDE QCM 6 : DE A et B fausses car il se rapproche dautant plus quil est loin de son point de liquefaction donc: haute temperature et basse pression C. Faux: Aucun Rapport QCM7 : ABCDE QCM 8 : Rponses vraies A C E A. On utilise la loi des gaz parfaits PV=nRT, ici ce que lon recherche est PP=nRT/V Savoir par cur que R=22,4/273 comme la temprature est 273K, RT=22,4 V=1 et n=2 donc P=2x22,4=44,8atm, soit comme 1 atm= 10 m deau 448 m deau B. faux, la pression partielle de A(PA) est la moiti de celle de D(PD). Ou PD=2PA Or PA=(nA /ntot)xPtot do PD=2(nA/ntot)xPtot ou encore (2nA/ntot)xPtot, ce qui montre bien que la fraction molaire de D est 2 fois celle de A puisque celle de A est dfinie par nA/ntot C. Daprs lnonc, on en dduit que PA+PB+PC+PD=Ptot=44,8atm Or PD=2PA , et PB=1/5PA do Ptot=3PA+1/5PA+PC soit 16/5PA+PC=44,8atm On sait que PC=3648mmHg soit 3648 /760=4,8 atm16/5PA=44,8-4,8=40, do PA=40x5/16=12,5atm D.P D=2x12,5=25 do fraction molaire de D =25/44,8=0,5580 soit peu prs 0,56. E. Cest vrai car dans un gaz parfait les particules nont pas de volume il ny a donc pas de covolume et donc la compression est plus importante.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

105

QCM 9 : Rponses vraies : ABD A. Vrai : Nb de mole = qtt / masse molaire 10g / 100g.mol = 0.10 mole B. Vrai : 1g / 20g.mol = 0.05 mole C. Faux : Fraction molaire (xi) = nb de mole de X / nb de mole total 0.05 / 0.15 = 0.3333 D. Vrai : PV=nRT 1*V = 0.15*(22.4/273)*273 => V = 0.15*22.4 = 3.36 E. Faux : Si T augmente, n et R eux ne bougent pas, donc forcement P et V doivent augmenter QCM 10 : Rponses vraies : ABCDE A savoir : 1Atm = 760mmHg = 10 mtres deau xi = ni / nt la somme des xi est gal 1 Pp = xi * Pt la pression totale est gale a la somme des pressions partielles QCM 11 : ABE C. Indirectement, travers la chaleur massique D. Indirectement, travers la chaleur latente QCM 12 : Rponses vraies BD A. Faux : Maximum de densit 4C = eau liquide C. Faux :La chaleur de dissolution dun gaz = chaleur de liqufaction + chaleur dhydratation ( encore appele chaleur de solvatation ) !!!! E. Faux : La dissolution dun solide abaisse la temprature de leau QCM 13 : Rponses vraies : BCE A. Faux : Linverse. D. Faux : Cest la chaleur de dissociation qui est la somme de la chaleur de changement dtat et de la chaleur dhydratation. QCM 14 :Rponses vraies : CDE A. Faux :permet lattnuation de variation de temprature B. Faux :Q = m*T*C = 0.83*3*100 000 = 249 000 C. Vrai : Variation de temptature = 249 000/30 000*1 = 8.3; 37-8.3 = 28.7 D. Vrai : Variation de temprature = 249000/ 50 000*1 = 5C QCM 15 :Reponses vraies : BD A. FAUX, le doigt reste 36.8C donc l'eau tend atteindre cette mme temprature. C. VRAI: Q=m.C.delta(TC) donc Q=20x1x5=100 cal. D. FAUX E. FAUX: La temprature du doigt reste constante. QCM 16 : Reponses vraies CDE A: Le resultat sera un surplus pour leau de 290 KCal B: 290C; valeur thorique. Ce sont des KCal et pas des Cal QCM 17 : Rponses vraies BD A. Faux : NaCl=sel donc =1 or i=1+(p1)=2 et m=5,85/58,5=0,1 donc im=0,2osm/L B. Vrai, m=1x0,1 C. Faux : m= 0,5x 15/60=0,5x0,25=0,125mol/L D. Faux : <1 cest dont un lectrolyte faible E. Vrai : mm=0,50,5x0,5=0,525=0,25mol/L 106

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 18 : Rponses vraies BDE A. Faux : Le mlange a entran une dilution, ces concentrations sont les concentrations initiales B. Vrai : Le glucose nest amen que par A, il y en a 1L 90/180=0,5mol/L =>0,5mol Le NaCl nest amen que par B, il y en a 0,5L 0,6mol/L =>0,3mol C. Faux : le glucose ne se dissocie pas (i=1), le NaCl est un sel binaire donc i=2 m(glucose)=0,5/1,5#0,333mol/L ; m(NaCl)=0,3/1,5=0,2mol/L Osmolarit totale= im(glucose) + im(NaCl) donc Osmolarit totale # 0,333+ 2x0,2#0,7333osm/L D. Vrai : (voir C) E. Vrai : c1v1=c2v2 pour NaCl : v1=(1x0,1)/0,6=1/6#0,166L et pour Glc : v1=(1x0,1)/0,5=0,2L QCM 19 : Rponse vrai E A. Faux : Electrolyte faible car <1 B. Faux : i=1,5 donc im=1,5x0,5=0,75osm/L C. Faux : K=m2 / (1-) donc K=0,5x0,25/0,5=0,25 D. Faux : Plus le K est grand plus llectrolyte est fort. E. Vrai : i=1+(2-1) donc i=1,5 QCM 20 : Rponses vraies BDE A. Faux : <1 B. Vrai C. Faux : Faible donc K petit D. Vrai : pour tous les lectrolytes binaires p=2 donc p-1=1 donc i=1+ E. Vrai : on voit sur la relation du D que si tend vers 0 (lectrolyte trs faible) alors i tend vers 1. QCM 21 : Rponse vrai A Un sel est TOUJOURS un lectrolyte FORT = ENTIEREMENT DISSOCIE donc =1 ; si dans un QCM il est donn un <1 pour un sel, il reprsente un coefficient dactivit (nomm dans le poly) qui reprsente le fait que, forte concentration, mme si llectrolyte est entirement dissoci, une seule partie des ions est osmotiquement active. On doit alors considrer : Le <1 pour les calculs dosmolarit-osmolalit MAIS =1 pour tout calcul de concentrations rellement prsentes dans la solution Calcul dosmolarit (A et B) : Na2SO42Na+ + SO42- donc p=3 ; m=(35,5/142)mol /0,5L=0,5mol/L et i=1+0,8x(3-1)=2,6 Donc im=1,3osm/L et K=m2/(1-)=0,5x0,64/0,2=1,6 A. Vrai B. Faux : 2,6 car lectrolyte tertiaire : p=3 C. Faux : car il sagit des concentrations relles en solution, donc =1 car lectrolyte fort donc K+ D. Faux : il sagit toujours de concentrations relles en solution : =1 ; Or la quantit de Na+ form par la dissociation de Na2SO4 est 2m=2x1x0,5=1mol/L ; chaque ion Na+ a une seule charge + donc 1mol/L de Na+1Eq/L de Na+ DONC : on a dans la solution 1Eq/L de Na+. E. Faux : on a les quantits pour 500mL il faut donc multiplier par 2 pour avoir molarit en mol/L QCM 22 : Reponses vraies ABCD B. Vrai: osm= i .m Ici i=1+0.2 (2-1) = 1.2 Osm= 1,2 . 0.3 = 0.36 osm C. Vrai : K vaut a peu prs m. E. Faux : QUE de la temprature QCM 23 : Rponses vraies BDE A. FAUX: molarit de C = (0.02x0.300 + 0.01x0.700)/(0.300+0.700)= 0.013 mol/L B. VRAI: Osm=i.m or ici i=2 car NaCl et NaOH sont entirement dissocis donc osmolarit= 0.026 C. FAUX: Eq/L !!! E. VRAI: 1 Osm = 224m d'eau donc 0.26 Osm = 58.24m d'eau
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

107

QCM 24 : Rponses vraies CE A. Faux : Le gel liaisons Hydrogne ne casse pas par excs de solvant il arrte de gonfler ; les liaisons hydrogne (HN-H, HO-H, HF-H) sont plus fortes que les liaisons de Van Der Waals, cest le gel liaisons de Van Der Waals qui se liqufie facilement par excs de solvant. B. Faux : Les collodes lyophiles sont assez stables, ce sont certains lyophobes qui ont cette proprit. D. Faux : cest le contraire. QCM 25 : Rponses vraies BCE A. Faux : collode lyophile D. Faux : Cela serait le cas pour un collode lyophobe. Il faudrait de grandes variations (empiriquement : une acidose/alcalose ou une fivre nentrane pas la floculation du plasma) E. Vrai : Toutes les particules de mme nature ont la mme charge lectrique (+ ou -). QCM 26 : Reponses vraies CD A. Faux : Cela n'est pas vrai pour l'tat gazeux: mlange toujours homogne. B. Faux : La forme sphrique se retrouve pour l'interface liquide-gaz mais pas pour liquide-liquide. E. Faux : En fonction de leur masse spcifique. QCM 27 : Rponses vraies BCD A. FAUX: au contraire. D. VRAI: car le diamtre de la bulle augmente ... E. FAUX: le sucre augmente la tension superficielle de la paroi. QCM 28 : Reponses vraies BDE A. Faux: La tension superficielle diminue avec la temprature . C. Faux : Lors de la chute d'une goutte, elle prendra la forme d'une poire cause de la pression de l'air due la vitesse de la chute. QCM 29 :Reponses Vraies BD A. FAUX: P = 2 / r. B. VRAI C. FAUX : Le surfactant est trs peu soluble dans leau. E. FAUX : Si il ny avait pas de surfactant la surpression dans les petites alvoles serait superieure celle dans les grandes (P = 2 / r donc si r diminue P augmente). Elles se videraient donc dans les grandes. QCM 30 : Rponses vraies ABC A. Vrai :Si le solut est peu affin avec le solvant, les molcules du solut sont moins attires vers le centre de la solution donc la tension superficielle diminue. C. Vrai : Elles possdent un ple hydrophile et un ple hydrophobe. D. Faux P = 2 / r donc plus r est grand plus la surpression lintrieur de la bulle est faible. E. Faux Quand deux bulles fusionnent la surface totale est plus faible que la somme des surfaces initiales : il y a donc libration dnergie QCM 31 : Reponses vraies AB C. C'est le phnomne d'imbibition . D. Elledpend aussi de l'affinit gaz/solide et gaz/liquide . E. Attention : les agents mouillants sont des corps tensioactifs mais la rciproque est fausse !

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

108

QCM 32 : Reponses vraies BCDE A. FAUX :A> B donc linterface gaz liquide au niveau de la solution A sera plus solide que linterface au niveau de la solution B. Linterface entre lair et le liquide B se rompra donc plus facilement donc les gouttes seront plus petites. Un volume V de solution B donnera donc plus de goutte que le mme volume de solution A. B. VRAI : Si la solution A est plus affine pour le compte-gouttes que la solution B, elle restera plus longtemps accroche la paroi du compte-gouttes, elle formera donc moins de gouttes. C. VRAI : La tension superficielle diminue quand la temprature augmente. La paroi de la bulle se rompra donc plus facilement : il se formera plus de gouttes. QCM 33: Reponses Vraies ABCE D. Faux : C'est proportionnel. QCM 34 : Reponses Vraies ABCD A. Vrai : Diffrence de pression amont aval = 2 / r. donc plus r est petit plus la perte de pression sera importante. D. Vrai : Si linterface est trs aplatie, le rayon est trs leve, donc la diffrence de pression de part et dautre de linterface est importante se qui traduit un fort accrochage de la bulle la parois vasculaire. Il y aura donc une grande diffrence de pression entre lamont et laval. E. Faux : Si la bulle saccroche, linterface air sang sera aplatie donc le rayon sera lev. QCM 35: Reponse Vrai C A. Faux : De l'air dans le sang est nfaste, ca ne permet surtout pas d'oxygner les tissus. B. Faux : Il y a aussi le capillaire prendre en compte. D. Faux : Un chapelet capillaire est une srie de bulles dans un capillaire. E. Faux : Heureusement que non, il faut une grande variation de pression atmosphrique ou une pathologie. QCM 36 : Reponses Vraies DE A. Faux : Plus la temprature est leve, plus lagitation thermique est leve. Les molcules se dtacheront donc plus facilement du support. B. Faux : Plus une solution est concentre plus le solut occupe de sites de fixation. C. Faux D. Vrai : Par comptition, les molcules ajoutes vont prendre la place des molcules initialement prsentes. E. Vrai Exemple : chromatographie dadsorption. QCM 37 : Reponses vraies ABCDE QCM 38 : Rponses vraies AE A. Vrai : lair chaud tait presque satur en eau et a aussi apport de la vapeur deau. (la TVS est infrieur dans frigo car T moins leve.) B. Faux : la diminution de T entrane la diminution de la TVS qui devient facilement infrieure la TV initiale. Leau en trop se liqufie. Lair est satur en eau : degr hygromtrique =TV/TVS=1 : il a augment ! C. Voir B D. Voir B E. Vrai : diminution de T entrane la diminution de la TVS.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

109

QCM 39 : Rponses vraies AD A.Vrai : Flux de vaporisation dpend de (T et de P) P constante, il augmente qd T augmente B .Faux : On est en atmosphre illimite et P=0 donc il ny a pas de flux de liqufaction C. Faux : On n a donc que le flux de vaporisation donc lvaporation est maximale D. Vrai : On passe en atmosphre limite donc la TV augmente au fur et mesure : un flux de liqufaction apparat et augmente en mme temps. E. Faux : lajout dun solut va diminuer le flux de vaporisation et abaisser la TVS donc diminuer le flux de liqufaction QCM 40 : Rponses vraies A. Faux : 160mmHg B. Vrai C. Vrai D. Vrai E. Vrai QCM 41 : Rponses vraies B A. Faux : cest 8,5 atm, car on compte la p atmosphrique= 1atm B. Vrai C. Faux : 65m, PO2 plasma=20%x7,5=1,5atm=1140mmHg D. Faux : paliers de dcompression la remonte. E. Faux : PO2=1%x8,5=0,085atm ce qui est inferieur a la PO2 minimale ncessaire pour respirer (100 mm Hg= 0,76 atm) QCM 42 : Rponse vrai D A/ FAUX: 30m, la pression est de 4atm donc le gaz n'est pas assez pressuris. B/ Faux : Nimporte quoi un gaz en atmosphere libre setend infiniment C/ FAUX: 20% donc 0.2 ... D/ VRAI: 20% de 3 atm E/ FAUX: et de l'eau aussi. QCM 43 : ABC D. Faux : il est possible daller au del de ces limites qui sont juste dordre pratique E. Faux : lactate de sodium = CH3COONa, cest un sel dacide faible et de base forte qui aurait donn un pH alcalin QCM 44: Reponses Vraies ACD A-Vrai: pH dune solution de monoacide fort = log m = log 0,2 = -log (210-1) = log 2 log 10-1 = 0,3 + 1 = 0,7 B-Faux: pH dune solution de diacide fort = log 2m = log 0,4 = 0,4 C-Vrai: pH dune solution de monoacide faible = (pka log m) = (4.3 log 3) = 2 D-Vrai:Les 2 solutions ont la mme molarit, il y a donc autant de H+ (sous forme libre ou sous forme HA) dans les 2 solutions. Elles ont donc la mme acidit totale. E-Faux: En ajoutant 1L deau 1L de solution on divise mC par 2 pH = [ pKa log (mC/2) ] = (4,3 + 1) = 2,65 QCM 45 : A,B,E C. Faux : CH3COO- est capable de capter un proton cest donc une base D. Faux : NH4+ cde un proton cest donc un acide

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

110

QCM 46 : B A. Faux : cest un diacide fort C. Faux : cest un monoacide faible D. Faux : cest un diacide faible E. Faux : cest ncessaire QCM 47 : B, D A. Faux : cette dfinition correspond lacidit relle ou ionique C. Faux : cette dfinition correspond lacidit totale ou titrable E. Faux : lacidit totale ou titrable dpend de la molarit, et ces solutions ont des molarit diffrentes QCM 48 : Reponse Vraie B A.Faux : pH = (pka log m) = 0.5 (4,3 log 2) = 0,5 4 = 2 B. Vrai : [H+] = 10-pH = 10-2 = [H+]/[HA] = 10-2/2 = 0.510-2 C.Faux : Acidit potentiel = m m = 2 20.510-2 = 1.99 D.Faux : X : fraction dacide neutralis = nbre de mol de NaOH ajout . nbre de mol de HA prsentes au dbut = nNaOH / (mHAV) = 0.1/(20.1) = 0.5 pH = pka + log (X/ 1- X) = 4.3 + log (0.5/0.5) = 4.3 E.Faux :A neutralisation complte, toutes les molcules de HA ont t dissocies par laction de la soude. Il ne reste donc que du A- qui est une base. Le pH sera donc lgrement basique. QCM 49 : Reponses Vraies AB A- Vrai : La seconde acidit est ngligeable tant quon na pas neutralis la 1re. Le pH initial est donc : pH = (pka1 log m) = 0,5 (3 + 0.3) = 1.65 B- Vrai : La 1re acidit est entirement neutralise quand pH = (pka1 + pka2) = 0.5 (3 + 8) = 5.5 C- Faux Lorsque le pH est de 4 la 1re acidit nest pas encore neutralise. La 2me acidit ne sexprime donc pas ; le HA ne se dissocie pas en AD.Faux A pH = 8 la 1re acidit est totalement neutralise : il ny a donc plus de H2A en solution. E.Faux Les diacides peuvent servir de systme tampon 2 pH diffrents : lorsque le pH = pka1 ou = pka2. QCM 50 : Reponses Vraies CDE A. faux : il est gal 10 puissance 14. B. faux [H+] = [OH-] = (10 puissance 7) Eq/L QCM 51: Reponses Vraies AE B. faux : A neutralisation complte dun monoacide faible, on est en prsence dune solution dun sel dacide faible et de base forte. On a donc pH > 7 C. faux : on mesure le pKa et on calcule le Ka. D. faux : le pH varie trs peu quand on ajoute de la soude. Une telle solution constitue un systme tampon QCM 52 : Rponses vraies BDE A. Faux ; en sens inverse. C. Faux ; pas toujours, les reins peuvent tre lorigine du trouble acido-basique, (lors dune insuffisance rnale entre autre), ce qui les empche de remplir leur rle. D. Vrai ; lors dun coma, la frquence respiratoire baisse considrablement, ou lorsque les muscles inspirateurs ne remplissent plus correctement leur fonction (lors de myopathie par exemple).

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

111

QCM 53 : Rponses vraies CD A. Faux ; environ 20% des ions H+ surnumraires. B. Faux ; distribution intra et extracellulaire. C. Vrai D. Vrai E. Faux ; qualitativement faible mais le plus efficace par sa trs grande distribution (quantitative) QCM 54 : Rponses vraies BD A. Faux : cest la 2me ligne de dfense C. Faux : hyperventilation E. Faux: los change Na+/H+ QCM 55 : Rponses vraies BD A. Faux ; lorsque la pO2 chute (hypoxmie). B. Vrai ; pour ladaptation physiologique : altitude ou polyglobulie des autochtones. C. Faux ; le coma et la myopathie sont causes entre autre dune acidose respiratoire. D. Vrai ; mal des montagnes du la chute de la pO2 et pCO2. E. Faux ; dans un dsquilibre gazeux, les poumons en tant la cause ne peuvent pas corriger le dsquilibre acido-basique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

112

PARTIE IV ANATOMIE

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

113

Gnralits sur lanatomie (3 QCM)


QCM 1 : Gnralits A. Lanatomie topographique dcrit les rapports que les organes entretiennent entre eux. B. Le diaphragme constitue la limite entre le thorax et labdomen. C. Il existe une limite nette entre labdomen et le pelvis. D. La face suprieure du pied est galement appel dos du pied. E. Le tronc est constitu du cou du thorax et de labdomen. QCM 2 : A propos des gnralits A. En position anatomique de rfrence, le principal axe vertical du corps passe par le vertex et le centre de gravit. B. Il existe plusieurs plans sagittaux mdians mais un seul plan sagittal paramdian. C. Un systme regroupe tous les organes ayant une structure analogue. D. Lappareil locomoteur regroupe les systmes osseux, articulaire et musculaire. E. Deux organes controlatraux sont situs de part et dautre du plan sagittal mdian. QCM 3 : A propos des gnralits A. Laxe du pied passe par le deuxime orteil. B. Le plan coronal divise le corps en deux moitis droite et gauche. C. En coupe scanner, on observe la face infrieure du segment suprieur. D. Tous les organes qui ont une mme fonction se regroupent en appareils. E. Le tronc est divis en trois parties : le thorax, labdomen et le pelvis, le diaphragme constituant la limite entre labdomen et le pelvis.

Gnralits sur larthrologie, la myologie et lostologie (9 QCM)


QCM 1 : A propos d'ostologie A. Les os ssamodes appartiennent aux os surnumraires sauf les os ssamodes du pouce et de l'hallux qui sont constants. B. La tte et le condyle sont deux reliefs articulaires identiques, recouverts de cartilage et spars de la diaphyse par le col. C. Les gouttires et sillons signent le passage de tendons, nerfs et artres alors que les fosses sont des dpressions o s'insrent les muscles. D. Le prioste recouvre toute la surface d'un os alors que le cartilage ne s'insre qu'au niveau des piphyses. E. Les trabecules du tissu compact forment le systme ogival au niveau des piphyses des os longs. QCM 2 : Gnralits sur l'ostogense et l'arthrologie A. partir de la 2 semaine de vie intra-utrine, la matrice cartilagineuse se transforme en os partir d'un premier point d'ossification qui va ensuite se dvelopper de manire centripte pour former la diaphyse. B. Les cartilages de conjugaison, qui disparaissent la fin de la croissance, sont davantage fertiles au niveau de l'extrmit proximale du fmur qu' l'extrmit distale de l'humrus. C. Une articulation se dfinit anatomiquement comme runissant deux pices squelettiques, et physiologiquement comme permettant le mouvement tout en le limitant. D. La libert de mouvement d'une articulation dpend de la forme anatomique des surfaces en prsence mais aussi parfois d'une laxit ligamentaire. E. Anatomiquement, on retrouve trois types d'articulations qui correspondent deux varits physiologiques fonctionnelles.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

114

QCM 3 : Concernant larthrologie et la myologie A. L'articulation fmoro-patellaire est une ginglyme, appele aussi trochode, qui possde un seul degr de libert. B. La morataise talo-crurale ne possde qu'un seul degr de libert mais appartient aux articulations synoviales en gnral. C. Les ligaments intrinsques peuvent tre intra ou extra capsulaires, intra ou extra synoviaux. D. Le disque articulaire ou d'interposition, caractrise l'amphiarthrose du genou par exemple. E. L'arthrologie permet la runion, l'association de 2 structures osseuses proches mais seuls les muscles peuvent les mettrent en mouvement. QCM 4 : Myologie du corps humain A. Le coeur possde un muscle creux stri squelettique particulier: le myocarde, qui se distingue des autres muscles stris de part son caractre involontaire. B. L'ensemble des muscles du tronc et des diffrents appareils reprsentent environ les 2/3 de la totalit des muscles du corps humain. C. Il existe des muscles polygastriques avec plusieurs ventres parallles: ils sont appels muscles multifides ou encore muscles multipenns. D. D'aprs la loi de WEBER et FICK, plus un muscle est long et volumineux plus sont dplacement est ample et puissant. E. Pour valuer la rducation d'un muscle, suite un traumatisme par exemple, on utilise une chelle de rcupration, cote de 0 5: le muscle sera ct 5 si il est non fatigable et contractile suite un stimulus, et ct 1 si on sent la contraction uniquement la palpation. QCM 5 : Concernant ltude des os A. Le nombre dos formant le squelette est constant, et gal 206. B. Le squelette appendiculaire est constitu du crne, de la face, de la colonne vertbrale, du thorax, des ceintures thoraciques et pelviennes, ainsi que de los hyode. C. Les os longs sont constitus dun corps : la diaphyse, reli aux extrmits : piphyses par les mtaphyses. On retrouve du cartilage de conjugaison au niveau de la mtaphyse. D. Les apophyses, tubercules et tubrosits, reliefs articulaires, permettent linsertion des tendons et des muscles. E. Le prioste est une membrane qui recouvre los, sauf au niveau articulaire et au niveau du cartilage de conjugaison. QCM 6 : Concernant lostogense et lembryologie des articulations A. Le cartilage de conjugaison permet la croissance en longueur de los, les cartilages fertiles tant situs prs du coude et loin du genou. B. Lossification se fait partir dune matrice cartilagineuse qui apparat au dbut de la 2m semaine de vie intra-utrine. C. Lorsque le tissu conjonctif persiste au niveau de larticulation, sorganisant en fibro-cartilage, larticulation est appele amphiarthrose et elle ne prsente aucun degr de mobilit. D. Les sutures, articulations immobiles, se divisent en trois groupes : les synarthroses, les synfibroses et les synchondroses. E. On retrouve les amphiarthroses essentiellement au niveau du plan sagittal mdian o elles permettent une mobilit dans les trois plans de lespace.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

115

QCM 7 : Concernant ltude des articulations A. Les articulations sphrodes sont sphriques et prsentent un centre de mouvement et un rayon de courbure ce qui limite leur mouvement dans un plan de lespace. B. Les articulations ellipsodes et en selle sont toutes les deux des articulations deux degrs de libert. C. La trochode qui peut tre reprsente par le systme dune poulie, se retrouve notamment au niveau de la radio-ulnaire proximale. D. Larticulation bi-condylaire rsulte de lassociation de deux ellipsodes, elle ne prsente quun seul degr de libert et est retrouve au niveau de larticulation fmoro-tibiale. E. Les ligaments intrinsques renforcent directement la capsule alors que les ligaments extrinsques sinsrent distance de larticulation bien quils jouent un rle important dans sa stabilit. QCM 8 : Concernant larthrologie A. Il existe parmi les ligaments intrinsques, des ligaments extra-capsulaires (hors de la capsule et de la synoviale) et des ligaments intra-capsulaires (intgrs la capsule et la synoviale). B. Le cartilage est richement vascularis, ce qui explique que lors dun trouble de la circulation son niveau, le cartilage dgnre par manque de nutrition et entrane ainsi lapparition darthrose. C. On trouve une membrane synoviale dans tous les types darticulations. D. Larticulation en selle ou par embotement rciproque est plus mobile que la mortaise. E. Les disques articulaires, mnisques et bourrelets sont caractristiques des amphiarthroses. QCM 9 : Concernant ltude des muscles A. Les muscles lisses ou viscraux sont blanchtres, et innervs par le systme nerveux vgtatif. Ils ont une contraction prolonge et sont rsistants la fatigue. B. On peut estimer quil y a 100 muscles au niveau de chaque membre thoracique, 100 muscles au niveau de chaque membre pelvien, 200 au niveau du tronc, 170 au niveau de la tte et 50 au niveau des diffrents appareils. C. Un muscle est compos de deux parties : un corps volumineux, pais ou ventre et deux extrmits aponvrotiques ou tendineuses qui servent la fixation du muscle sur diffrentes structures. D. Un muscle digastrique est un muscle polygastrique dont les diffrents ventres sont successifs et relis par une aponvrose intermdiaire. E. On caractrise un muscle de fusiforme lorsque les fibres qui convergent vers un tendon, restent parallles laxe du muscle.

Gnralits sur lappareil circulatoire (5 QCM)


QCM 1 : Gnralits sur le cur A. Le cur est situ dans le mdiastin antrieur. B. Le systme lymphatique se termine dans le rseau artriel. C. La base du cur regarde en arrire et droite. D. Des ventricules partent les veines qui sont munies de systmes de valvules tout le long de leur trajet. E. Le systme circulatoire comprend un seul systme : le systme sanguin. QCM 2 : A propos du cur A. Les ventricules se trouvent en arrire des atriums. B. La valve atrio-ventriculaire gauche est compose de deux cuspides. C. Lartre pulmonaire et laorte possdent toutes les deux un systme de valve anti-reflux. D. La ligne de rflexion des deux feuillets de la sreuse du cur, appele picarde , se trouve au niveau des gros vaisseaux. E. Par lintermdiaire du tissu nodal, le myocarde est capable de se contracter un rythme donn.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

116

QCM 3 : Lhmatose A. La petite circulation, ou circulation systmique, est responsable de lhmatose. B. Dans la petite circulation, les artres sont riches en CO2 et les veines en O2. C. Le coeur droit contient du sang riche en oxygne. D. Un systme porte est un systme qui a deux rseaux capillaires veineux, un chacune de ses extrmits. E. Les vascularisations nourricires et fonctionnelles peuvent tre assures par les mmes vaisseaux (exemple : le poumon). QCM 4 : Gnralits sur lappareil circulatoire A. Le diamtre des veines est infrieur celui des artres. B. Laorte se termine au niveau de la quatrime vertbre thoracique. C. Les valvules sont en plus grand nombre au niveau des membres pelviens. D. Le rseau lymphatique droit se jette au niveau du confluent jugulo-sub-clavier droit. E. Les glucides contenus dans la lymphe provenant de lintestin grle (ou chyle) lui donnent un aspect blanchtre. QCM 5 : A propos du systme circulatoire A. La veine cave caudale nat en regard de la cinquime vertbre lombaire et draine la partie supradiaphragmatique du corps. B. Le systme azygos draine la paroi thoraco-abdominale et est donc une collatrale de la veine cave caudale. C. Les veines sont classiquement beaucoup plus nombreuses que les artres et ont un diamtre suprieur lartre correspondante mais une paroi plus fine. D. Laorte se termine au niveau de la quatrime vertbre lombaire en donnant les artres iliaques communes. E. Les artres carotides communes sont les artres destines la tte et au cou.

Gnralits sur lappareil respiratoire (11 QCM)


QCM 1 : Concernant larbre tracho-bronchique A. La trache fait suite au pharynx et entre dans le thorax par son orifice suprieur. B. La trache est une structure souple pour permettre les mouvements de lair. C. La trache se termine au niveau de la carne en C6. D. La bronche principale droite est plus horizontale que la bronche principale gauche. E. Les bronches prsentent la mme structure en anneaux cartilagineux que la trache. QCM 2 : Concernant les poumons A. Les deux poumons en forme de demi cne, sont symtriques. B. Le poumon prsente 3 faces : une face diaphragmatique, une face mdiale mdiastinale et une face priphrique costale. C. Le poumon droit est divis par une scissure oblique et une scissure horizontale dlimitant ainsi 3 lobes pulmonaires : suprieur, moyen et infrieur. D. Les bronches segmentaires se divisent en bronches lobaires au niveau du lobule pulmonaire. E. Au niveau du lobule pulmonaire, la bronchiole terminale perd son squelette cartilagineux.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

117

QCM 3 : Concernant les poumons A. Le canal alvolaire est branch sur une alvole pulmonaire, o se ralisent les changes gazeux. B. Les vaisseaux assurant lhmatose appartiennent la vascularisation nourricire. C. Le sang de lartre pulmonaire, riche en O2 repart vers latrium gauche pour tre redistribu aux tissus priphriques. D. Tous les lments vasculo-nerveux entrent et sortent du poumon par la racine du poumon. E. Le thorax est une structure osseuse, limite en arrire par les vertbres thoraciques, en avant par le sternum et latralement par les ctes. QCM 4 : Concernant la mcanique respiratoire A. Lexpansion des poumons par lentre dair entrane les mouvements de la cage thoracique. B. Le mouvement des poumons est facilit par le pritoine, sreuse double feuillet : un viscral et un parital. C. Linspiration est un mouvement actif dont le principal muscle inspiratoire est le diaphragme. D. Les muscles expiratoires dont les muscles de la paroi abdominale jouent un rle essentiel dans lexpiration. E. La cavit pleurale en situation physiologique est dite virtuelle. QCM 5 : Gnralits sur l'appareil respiratoire A. L'ouverture postrieure des cavits nasales est matrialise par les choanes. B. Les deux parties suprieures du pharynx appartiennent l'appareil respiratoire alors que la troisime partie appartient au systme digestif. C. Le pharynx stend de la base du crne la cinquime vertbre cervicale. D. L'appareil respiratoire est situ exclusivement au niveau de la cage thoracique. E. La trache est compose d'anneaux cartilagineux concaves vers l'arrire. QCM 6 : Les poumons A. Les deux poumons sont entours dune membrane unique, la plvre. B. Leur nutrition et leur fonction sont assures grce l'artre pulmonaire. C. L'artre pulmonaire apporte du sang riche en CO2 aux poumons alors que les veines pulmonaires ramnent du sang riche en O2 l'atrium gauche. D. Il existe 4 scissures au total pour les 2 poumons. E. Linspiration agrandit la taille des alvoles pour permettre l'entre d'air. QCM 7 : Concernant l'appareil respiratoire A. Les cavits nasales rchauffent, humidifient et filtrent l'air expir. B. Le larynx produit des sons quand l'air est expir par vibration des plis vocaux. C. La trache suit le larynx dans le thorax. D. Le lobule pulmonaire est l'unit fonctionnelle du poumon. E. Le voile du palais, entre le naso-pharynx et l'oro-pharynx, ne contient aucun lment osseux. QCM 8 : Gnralits sur lappareil respiratoire A. Les poumons sont entours dune sreuse complexe, la plvre. B. La trache fait suite au larynx en regard de la quatrime vertbre cervicale. C. Lpiglotte est un repli membraneux qui ferme lorifice suprieur du larynx. D. Le poumon gauche est constitu de trois lobes. E. Les bronches principales se divisent en branches segmentaires qui elles mme se divisent en branches lobaires.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

118

QCM 9 : Gnralits sur lappareil respiratoire A. Le feuillet viscral de la plvre est en contact avec les ctes et les vertbres. B. Le rythme respiratoire est de 26 mouvements par minute. C. La trache se divise en deux branches au niveau de la carne en T 5. D. La branche principale droite est plutt verticale tandis que la gauche est plutt horizontale. E. Les bronchioles lobulaires possdent une structure cartilagineuse en forme de fer cheval. QCM 10 : A propos de lappareil respiratoire A. Le pharynx se compose de deux parties : loropharynx en crnial et le nasopharynx en caudal. B. Les cordes vocales sont des replis membraneux de loropharynx et permettent la fonction de phonation par vibration lors du passage de lair expir. C. La trache fait suite au larynx en regard de C8 et se termine au niveau de la carne enT5. D. La bronche souche droite est plus verticale que la bronche souche gauche. E. Le poumon droit se compose de trois lobes, dlimits par les scissures oblique et horizontale. QCM 11 : A propos de lappareil respiratoire A. La trache se termine au niveau de la carne en regard de la 4me vertbre lombaire (L4). B. Les scissures divisent les poumons en lobes : le poumon droit compte deux lobes et le poumon gauche trois lobes. C. Les cavits nasales se situent entre la base du crne et le palais. D. La plvre est constitue de deux feuillets, un feuillet viscral et un feuillet parital (au contact du poumon) qui dlimitent la cavit pleurale, virtuelle. E. Lpiglotte est une structure cartilagineuse qui a pour fonction de fermer lorifice suprieur du pharynx.

Gnralits sur lappareil digestif (7 QCM)


QCM 1 : Appareil digestif A. Le tube digestif fait 6 8 mtres de long. B. Il y a 32 dents chez ladulte : 8 incisives, 4 canines, 8 prmolaires, 8 molaires et 4 dents de sagesse. C. Le vestibule oral est limit lintrieur par larc dentaire et lextrieur par les joues et les lvres. D. La glande sub-mandibulaire est situe en arrire de la branche de la mandibule. E. Le pharynx comprend 3 parties : loro-pharynx , le naso-pharynx et le laryngo-pharynx qui appartiennent toutes les 3 lappareil digestif. QCM 2 : Appareil digestif A. Le fundus correspond la partie caudale de lestomac. B. Lincisure cardiale reprsente la limite entre lsophage et lestomac. C. Le pylore, structure musculaire strie, spare lantre pylorique du duodnum. D. Le duodnum fait une figure en cadre qui stend de la premire vertbre lombaire la troisime vertbre lombaire. E. Lilum fait suite au duodnum. QCM 3 : Appareil digestif A. Le caecum est situ dans la fosse iliaque interne droite. B. Langle colique droit est situ sous la rate. C. Le colon sigmode correspond la limite entre labdomen et le pelvis (petit bassin). D. Lampoule rectale est constitue de deux parties : le rectum et le canal anal. E. Le rectum commence en regard de la troisime vertbre sacre.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

119

QCM 4 : Appareil digestif A. Le foie est un volumineux viscre denviron 1500 grammes. B. Le foie occupe la partie suprieure gauche de labdomen, sous le diaphragme. C. Le pdicule hpatique comprend entre autres lartre nourricire du foie (lartre hpatique) qui est situ en en avant et gauche de la veine porte. D. Le canal cystique rejoint le canal hpatique pour former le canal choldoque. E. Le canal choldoque et le conduit pancratique accessoire ont une terminaison commune : lampoule hpato-pancratique qui souvre dans le duodnum. QCM 5 : Gnralits sur lappareil digestif A. Lappareil digestif correspond un ensemble dorganes qui ont pour fonction principale la transformation et lassimilation des aliments. B. Ladulte possde 32 dents (dont 8 prmolaires) alors que lenfant en possde 20 (dont 4 prmolaires). C. Lors de la dglutition, on assiste une fermeture du naso-pharynx par le voile du palais et du larynx par lpiglotte. D. Lsophage, qui fait suite au pharynx, est un conduit musculaire long de 24 cm. E. Lsophage thoracique traverse le diaphragme en T 12 pour devenir lsophage abdominal. QCM 6 : Lestomac A. Lestomac est une portion dilate du tube digestif constitu dune partie verticale et dune horizontale. B. Il correspond une poche aplatie dans le sens antropostrieure et prsente dcrire deux faces. C. Il est form de trois portions qui sont lantre pylorique, le corps et le fundus (de crnial caudal). D. Le sphincter, situ au niveau de lincisure cardiale, permet de prvenir le reflux du contenu gastrique vers lsophage. E. La petite courbure est situe gauche tandis que la grande courbure est situe droite. QCM 7 : Le pritoine A. Est, avec le pricarde et la plvre, une des trois sreuses complexes de lorganisme. B. Est constitu de deux feuillets qui sont spars lun de lautre par une cavit remplie dune importante quantit de liquide permettant aux deux feuillets de glisser lun sur lautre ltat physiologique. C. Le pritoine viscral est au contact de la paroi abdominale ventro-latrale, du diaphragme ainsi que de laorte, de la veine cave et des reins. D. Le pritoine parital ou feuillet parital entoure les vaisseaux de labdomen. E. Est une structure fibreuse assurant un rle de protection pour les organes quil entoure.

Gnralits sur lappareil uro-gnital (18 QCM)


QCM 1 : A propos des reins A. Le rein est l'organe excrteur du systme urinaire. B. Les reins s'tagent sur la hauteur de 3 vertbres lombaires. C. Le hile du rein est situ sur son bord mdial. D. Les glandes surrnales, qui n'appartiennent pas l'appareil urinaire, sont situes au niveau du ple suprieur du rein. E. Les reins sont situs dans la rgion la plus ventrale et suprieure de la cavit abdominale.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

120

QCM 2 : A propos des reins A. Les reins, qui mesurent 12 cm de long, comprennent 2 parties : le parenchyme rnal (ou tissu rnal) et le sinus rnal. B. Le parenchyme rnal est divis en 2 zones : la corticale, ou cortex rnal, et la mdullaire o se trouvent les nphrons. C. C'est au niveau du sinus rnal que se trouve l'origine des voies excrtrices. D. De chaque pyramide naissent deux calices mineurs qui se regrouperont pour former un calice majeur. E. Le sommet des pyramides est appel "papille". QCM 3 : A propos des voies excrtrices urinaires A. Les 3 calices majeurs se runissent pour former le bassinet, aussi appel pelvis rnal. B. Le bassinet se poursuit par l'uretre au niveau de la jonction pylo-urtrale. C. Les uretres sont des conduits musculaires de 25cm de long. D. Les uretres font suite au bassinet et s'abouchent dans la rgion du trigone vsical, face antrieure de la vessie. E. Les uretres sont diviss en 3 parties qui sont, depuis la rgion lombaire : uretre lombaire, iliaque, puis pelvien. QCM 4: L'appareil urinaire A. L'uretre lombaire croise le dtroit suprieur en entrant dans le petit bassin. B. La vessie est situe dans la partie ventrale du petit bassin, en arrire de l'utrus chez la femme. C. La vessie est sous pritonale car sa face suprieure est recouverte par le pritoine. D. Quand la vessie se remplit, sa face dorsale, o se trouve le trigone, se distend et forme ainsi le dme vsical. E. Les urtres dbutent au niveau du col vsical qui est la runion des faces ventro-infrieures et dorsale de la vessie. QCM 5 : A propos de la vessie A. Le trigone vsical est dlimit par l'abouchement des 2 uretres et par celui de l'urtre. B. Le dtrusor, muscle vsical, est un muscle stri. C. Le trigone est situ en crnial par rapport au col vsical et a un rle important dans les mcanismes de continence. D. On dnombre au total 3 orifices au niveau de la vessie. E. Quand la vessie se remplit, seule la face suprieure se distend. QCM 6 : A propos de lurtre A. Chez lhomme, lurtre est trs court : il fait environ 3 cm. B. Lurtre est oblique en bas et en arrire. C. Il souvre par lostium externe encore appel mat urtral. D. Il est entour par un sphincter qui participe au mcanisme de continence. E. Chez la femme, il est commun avec les voies gnitales. QCM 7 : A propos de lappareil gnital mle A. Les vaisseaux testiculaires forment au dessous du testicule un pdicule testiculaire constitu dartres, de
vaisseaux, et de nerfs.

B. Le pdicule testiculaire participe la constitution du cordon spermatique. C. Lpididyme correspond la fin des voies gnitales. D. Lpididyme est un organe situ au niveau du ple infrieur et sur le bord dorsal du testiculaire. E. La partie suprieure et dorsale de lpididyme correspond sa tte.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

121

QCM 8: A propos des voies gnitales mles A. La portion de lpididyme qui longe le bord ventral du testicule correspond son corps. B. Le conduit dfrent est un conduit trs long qui traverse de nombreuses rgions. C. Le conduit dfrent est un conduit musculaire paroi trs paisse. D. Le conduit dfrent est palpable. E. Le conduit dfrent commence juste aprs la queue de lpididyme et chemine sur la face latrale du testicule. QCM 9 : A propos du conduit dfrent A. Il croise la face mdiale de lpididyme. B. Il traverse la rgion inguinale (la partie la plus basse de la rgion abdominale) dans le canal inguinal. C. Le canal inguinal participe la formation du cordon spermatique durant ce trajet. D. Le conduit dfrent longe ventralement la vessie. E. Au niveau de la face dorsale de la vessie, il prsente une dilatation appele ampoule du dfrent. QCM 10 : A propos de la vessie et de lurtre A. La vessie est un organe intra pritonal. B. La vessie vide a trois faces : une face suprieure, une face dorsale et une face ventro-infrieure dans laquelle arrivent les uretres. C. La musculeuse vsicale, ou trigone, est constitue dun muscle lisse. D. Chez la femme, lurtre est trs court (3cm), il est orient vers le bas et lavant. E. Lurtre sabouche au niveau du col vsical, la jonction de la face ventro-infrieure et dorsale de la vessie. QCM 11 : A propos de lappareil gnital masculin A. Les testicules sont de forme ovode. Ils sont entours dune sreuse : lalbugine. B. Il existe au dessus du testicule un pdicule testiculaire qui entre dans la constitution du cordon spermatique. C. Lpididyme est form de trois parties : la tte la partie suprieure et ventrale du testicule, le corps le long du bord dorsal du testicule, et la queue. D. Le conduit dfrent croise la face mdiale de lpididyme la jonction corps/queue. E. Dans son trajet, le conduit dfrent longe latralement la vessie. QCM 12 : A propos des appareils gnitaux de lhomme et de la femme A. Chez lhomme, le canal jaculateur est form de la runion de la vsicule sminale et de lampoule du dfrent. B. Chez lhomme, lurtre antrieur (ou urtre membraneux) est form de deux parties : une fixe et une mobile (la plus distale). C. Les formations rectiles de lhomme sont de deux types : le corps spongieux qui entoure lurtre spongieux et les corps caverneux qui sattachent sur les bords infrieurs des os coxaux. D. Chez la femme, les ovaires sont des organes rtro pritonaux de 3cm. E. Chez la femme, Les trompes utrines sont des conduits musculaires de 10 15cm de long, forms de quatre parties (infundibulum, ampoule, isthme et cornes utrines). QCM 13 : A propos de lappareil gnital fminin A. Lutrus est un muscle creux, sous pritonal, de 6 7cm de long. B. Lutrus est compos de trois parties : le corps, lampoule et le col. C. Le vagin est orient vers le haut et lavant. D. Chez la femme, les bulbes sont lquivalent du corps spongieux de lhomme, et les clitoris sont lquivalent des corps caverneux de lhomme. E. Dans le vestibule se fait labouchement de lurtre en arrire et du vagin en avant.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

122

QCM 14 : Appareil gnital fminin A. Le vagin, long de 7 cm, est entour par lurtre et la vessie en avant, et le rectum en arrire. B. Le vagin sinsert sur le col de lutrus. C. Le vagin est oblique vers le haut et lavant. D. Le vestibule est une cavit de la vulve : il appartient aux organes gnitaux externes. E. Les grandes lvres et les bulbes sont respectivement lquivalent fminin des bourses et des corps spongieux chez lhomme. QCM 15 : Appareil gnital fminin A. La partie dorsale du clitoris sinsert sur la branche ilo-pubienne. B. Lutrus est oblique en bas et en avant. C. Lutrus se compose dune paroi musculaire paisse : le myomtre et dune muqueuse : lendomtre. D. Les ovaires sont des organes intra-pritonaux, situs au centre de la cavit pelvienne. E. Lovaire libre les ovules dans linfundibulum tubaire. QCM 16 : Appareil gnital masculin A. La prostate est une glande exclusivement masculine. B. La prostate est un cne base infrieure et sommet suprieur. C. La prostate entoure les lments du carrefour uro-gnital. D. Le pnis comprend lurtre et les formations rectiles. E. Les formations rectiles ont une portion fixe dans le prine antrieur et une portion mobile. QCM 17 : Appareil gnital masculin A. La tte de lpididyme a des connexions avec le testicule. B. La rgion inguinale est la rgion la plus mdiale et la plus basse de la rgion abdominale. C. Le canal dfrent traverse la rgion inguinale dans le canal inguinal. D. Dans la partie basse de labdomen le canal dfrent passe dans la cavit pelvienne et croise le dtroit infrieur. E. Lampoule du dfrent est un petit segment dilat la face dorsale de la vessie. QCM 18 : Appareil gnital masculin A. Le canal jaculateur se termine dans lurtre. B. Lurtre masculin est spcifique des voies urinaires. C. Lurtre spongieux traverse le plan aponvrotique du prine profond. D. Le sphincter de lurtre appartient lurtre membraneux. E. Les urtres membraneux et spongieux sont aussi appels urtre antrieur.

Gnralits sur lappareil de linnervation (18 QCM)


QCM 1 : Gnralits sur lappareil de linnervation A. Sur le plan anatomique, lappareil de linnervation est constitu du systme nerveux central (contenu exclusivement dans le crne) et du systme nerveux priphrique (constitu par les nerfs). B. Le systme nerveux somatique (ou de la vie de relation) a sous sa dpendance le fonctionnement des muscles lisses. C. Le systme nerveux somatique assure ladaptation du corps humain au milieu extrieur alors que le systme nerveux vgtatif permet lquilibre du milieu intrieur. D. On trouve dans le systme nerveux deux types de cellules : les neurones (unit fonctionnelle du systme nerveux) et les cellules gliales (qui constituent le tissu de soutien et de nutrition des neurones). E. Le sens de linflux nerveux est toujours le mme : il dbute au niveau des dendrites, passe par le corps cellulaire du neurone puis se propage le long de laxone.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

123

QCM 2 : Gnralits sur lappareil de linnervation A. On distingue deux types de neurones : les neurones moteurs dit effrents et les neurones sensitifs dits affrents. B. Lencphale, contenu dans le crne, est constitu seulement par deux lments : le cerveau et le tronc crbral. C. Le cerveau, form du diencphale et du tlencphale, est le sige des fonctions suprieures. D. Les deux hmisphres qui composent le diencphale prsentent des sillons : le sillon latral et le sillon central. E. Les sillons prsents sur les hmisphres crbraux dlimitent des lobes. Dans chaque lobe, dautres sillons dlimitent des circonvolutions ou gyrus. QCM 3 : Gnralits sur lappareil de linnervation A. Le tronc crbral, qui fait suite au diencphale, est compos par le msencphale, le pont et la moelle pinire. B. Dans le cervelet, on distingue une partie centrale : le vermis, et deux lobes de chaque ct : les hmisphres crbraux. C. La moelle pinire (ou moelle spinale) noccupe pas toute la hauteur du canal vertbral, elle sarrte en regard de L4 ; au-del elle constitue la queue de cheval. D. Le systme nerveux central est divis en deux parties : lencphale et la moelle pinire. E. Le systme nerveux central est entour par 3 enveloppes qui constituent les mninges. QCM 4: Gnralits sur lappareil de linnervation A. On distingue trois mninges de lintrieur vers lextrieur : la dure-mre, larachnode et la pie-mre. B. La dure-mre qui assure la protection du systme nerveux central du fait de son paisseur est adhrente los au niveau du crne. C. La dure-mre est spare de los par lespace pidural au niveau du canal vertbral et se termine en regard de L2. D. Larachnode suit les contours du tissu nerveux et enveloppe les vaisseaux qui sy destinent. E. Le diencphale contient le 3me ventricule qui communique avec les ventricules latraux droit et gauche situs dans les hmisphres crbraux. QCM 5 : Gnralits sur lappareil de linnervation A. Au niveau du tronc crbral, le 4me ventricule se situe au niveau du pont et du 1/3 suprieur de la moelle allonge. B. Chez ladulte, le canal central est impermable. C. Le liquide crbro-spinal est fabriqu partir du sang veineux dans les ventricules. D. Le liquide crbro-spinal est situ entre la pie-mre et larachnode dans lespace sub-arachnodien. E. Le liquide crbro-spinal est rsorb dans le sang veineux par les granulations arachnodiennes la face interne de la calvaria le long du sinus sagittal suprieur. QCM 6 : A propos de lappareil de linnervation A. Cest un ensemble de structures assurant la sensibilit et la motricit du corps. B. Le fonctionnement des viscres est assur par les fibres musculaires stries. C. Il est constitu de deux systmes indpendants : systme nerveux central et systme nerveux priphrique. D. Sur le plan anatomique, on distingue le SN somatique et le SN vgtatif. E. Il est constitu de deux types de cellules : les neurones et les cellules gliales. QCM 7 : A propos de lappareil de linnervation A. Il existe deux types de neurones : moteurs et sensitifs. B. Le SN central comprend deux parties : lencphale et le tronc crbral. C. Le 2me ventricule fait parti du diencphale. D. La moelle spinale se termine au niveau de la 2me vertbre lombaire. E. Les hmisphres crbraux prsentent des sillons dlimitant des lobes.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

124

QCM 8 : A propos de lappareil de linnervation A. Au niveau du crne, la dure-mre est spare de los par un espace appel espace pridural. B. Le 4me ventricule est situ au niveau du pont et des 2/3 suprieurs de la moelle spinale. C. Le 3me et 4me ventricule communiquent par laqueduc du msencphale. D. Le liquide cphalo-rachidien est fabriqu dans les ventricules partir du sang artriel et est rabsorb dans la circulation veineuse. E. Le liquide cphalo-rachidien se retrouve dans le canal central. QCM 9 : A propos de lappareil de linnervation A. Le SN priphrique contient deux types de substances : substance grise et substance blanche. B. Le SN central comprend deux moitis symtriques sur le plan fonctionnel. C. La substance grise, qui contient les corps cellulaires de neurones, a une disposition centrale dans la moelle formant ainsi une colonne continue de 31 segments. D. La substance blanche se distribue en priphrie au niveau de la moelle formant des cordons. E. La substance blanche est constitue de tractus : ensemble de fibres nerveuses qui ont la mme origine mais une terminaison diffrente. QCM 10 : A propos de lappareil de linnervation A. Il existe 31 paires de nerfs craniens. B. Sur le plan fonctionnel, tous les nerfs craniens sont des nerfs mixtes. C. Le nerf optique traverse la lame crible de l'ethmode par ses diffrents filets. D. Le nerf IV est le nerf oculomoteur. E. Le nerf trijumeau (V) est essentiellement dvolu la motricit faciale. QCM 11 : A propos de lappareil de linnervation A. Le VII, nerf facial est essentiellement moteur. B. Le systme nerveux vgtatif (SNV) rgule la fonction viscrale. C. L'hypothalamus est un des centres suprieurs du SNV. D. Le grand nerf parasympathique crnien est le nerf vague (X). E. La chane sympathique est situe de chaque ct de la colonne vertbrale. QCM 12 : A propos de lappareil de linnervation A. Le systme nerveux vgtatif a la particularit de ne pas possder de contingent somatique. B. Le contingent viscral du SNV a ses axones qui traversent le ganglion sympathique sans relais. C. Dans le SNV parasympathique, le relais se fera dans un ganglion ou plexus vgtatif. D. Il sera possible de parler d'un nerf moteur pur, crnien, naissant du tronc crbral. E. Les 2 premiers nerfs craniens peuvent tre des expansions tissulaires dans certaines pathologies. QCM 13 : A propos de lappareil de linnervation A. Le nerf spinal est une runion de 2 racines. B. Le rameau ventral du nerf spinal se dirigera notamment vers les membres. C. L'origine du nerf spinal se place toujours en face du foramen correspondant. D. A propos des nerfs craniens, les nerfs III, IV, VI assurent la motricit du globe oculaire. E. Le VII chemine au sein de l'os temporal. QCM 14 : A propos de lappareil de linnervation A. Tous les nerfs spinaux ont la mme structure gnrale. B. La 2me paire de nerfs spinaux passe dans le foramen intervertbral entre C2 et C3. C. La racine ventrale des nerfs spinaux est appele racine sensitive. D. Chaque nerf spinal quitte la colonne vertbrale par le foramen qui lui correspond. E. Le rameau dorsal du nerf spinal contient le ganglion spinal.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

125

QCM 15 : A propos de lappareil de linnervation A. Tous les nerfs crniens naissent de lencphale. B. Le nerf ophtalmique quitte le crne par le canal optique. C. Le nerf trijumeau (V) est sensitif pur. D. Le nerf vestibulo-cochlaire possde deux contingents. E. Les nerfs IX, X, XI quittent la base du crne par le mme orifice. QCM 16 : A propos de lappareil de linnervation A. Les voies du systme nerveux somatique sont des voies un seul neurone. B. La trophicit des organes est sous la dpendance du systme nerveux somatique. C. Le systme nerveux vgtatif est divis en un systme sympathique et un systme parasympathique. D. Le systme nerveux vgtatif sympathique est divis en un contingent somatique et un contingent viscral. E. Le centre primaire du systme nerveux vgtatif est lhypothalamus. QCM 17 : A propos de lappareil de linnervation A. Le relais entre les deux neurones du systme nerveux vgtatif se fait au niveau de structures bien individualises : les plexus. B. Les voies du systme nerveux vgtatif parasympathique naissent de la corne latrale de la moelle. C. Les voies du contingent somatique du systme nerveux vgtatif sympathique traversent la chane sympathique sans sy arrter. D. Les fibres du rameau communiquant gris ne sont pas mylinises. E. Dans le systme nerveux vgtatif parasympathique, le relais entre les deux neurones se fait trs prs de lorgane effecteur. QCM 18 : A propos de lappareil de linnervation A. Le nerf accessoire (X) est le grand nerf parasympathique crnien. B. La corne latrale de la moelle est retrouve au niveau des segments de moelle de C8 L2. C. Les voies du systme nerveux vgtatif ne sont pas retrouves dans les segments de moelle de L3 S1. D. Le nerf splanchnique va de la corne latrale de la moelle au ganglion vgtatif. E. La chane sympathique est une succession de ganglions runis entre eux par des cordons.

Ostologie du membre thoracique (18 QCM)


QCM 1 : Ostologie de la ceinture scapulaire A. La ceinture scapulaire est une rgion anatomique qui rattache le membre thoracique au tronc. B. La ceinture scapulaire est forme de deux os : la scapula en dorsal et la clavicule en ventral. C. La ceinture scapulaire est une rgion de passage pour les vaisseaux, les nerfs et les lymphatiques du membre thoracique. D. La scapula est situe dans la rgion dorso-caudale du thorax ; elle recouvre 6 7 ctes. E. La clavicule est un os long, sous-cutane et situ en ventral du membre thoracique. QCM 2 : Ostologie de la scapula A. La face ventrale de la scapula est lgrement creuse, excave ; elle est concave en dorsal. B. La face dorsale de la scapula prsente un lment qui la divise en deux parties gales : lpine scapulaire. C. Lacromion supporte une facette articulaire sur son bord latral sarticulant avec la clavicule. D. Lpine dtermine avec la face dorsale de la glne de la scapula lchancrure spino-glnodale. E. Le bord mdial de la scapula, ou bord spinal, prsente un angle obtus en regard de lpine.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

126

QCM 3 : Ostologie de la ceinture scapulaire A. Le processus coracode a son extrmit dirige en ventral et latral B. Il existe un ligament pais tendu de lacromion au processus coracode : le ligament coraco-acromial. C. La clavicule, en forme de S italique, est oblique en cranial et latral. D. La face caudale de la clavicule prsente sa partie mdiale la gouttire du muscle sub-clavier. E. Le bord ventral de la clavicule prsente en mdial le tubercule deltodien. QCM 4: Ostologie de lhumrus A. Lhumrus est un os long qui sarticule en proximal avec la scapula et en distal avec le radius et lulna. B. La face dorsale de lhumrus prsente sa partie moyenne le sillon de torsion (oblique en distal et mdial) dans lequel passe le nerf radial. C. Le bord latral de lhumrus prsente sa partie moyenne linsertion du muscle deltodien (V deltodien). D. La tte humrale recouverte de cartilage, a une forme sphrique (2/3 de sphre). E. La tte humrale prsente un angle dinclinaison avec laxe du corps de 130. QCM 5 : A propos de lostologie du membre thoracique A. La ceinture scapulaire est forme de trois os. B. La face ventrale de la scapula prsente deux rgions : fosse supra-pineuse et fosse infra-pineuse. C. Lpine scapulaire se situe au niveau du cranial de la face dorsale de la scapula. D. La clavicule prsente une courbure convexe en ventral prs du sternum et une courbure concave en ventral prs de lacromion en latral. E. Lhumrus sarticule avec la scapula en proximal et avec les deux os de lavant-bras en distal. QCM 6 : A propos de lostologie du membre thoracique A. Le pilier de la scapula correspond au bord latral de la scapula. B. Lpiphyse mdiale de la clavicule prsente une seule surface articulaire pour le sternum. C. La face dorsale de lhumrus prsente un sillon de torsion contenant le nerf ulnaire. D. Le col chirurgical de lhumrus est contourn par le nerf axillaire. E. On appelle palette humrale lpiphyse proximale. QCM 7 : A propos de lostologie du membre thoracique A. La cavit glnodale de la scapula regarde en crnial, latral et ventral. B. La tte humrale nest recouverte de cartilage que sur 1/3 de sphre. C. Le col chirurgical de lhumrus donne insertion la capsule. D. La face ventrale de la scapula est constitue dune partie centrale appele fosse sub-scapulaire. E. La face caudale de la clavicule prsente dans sa partie latrale une empreinte pour les insertions des ligaments coraco-claviculaires. QCM 8 : A propos de lostologie du membre thoracique A. Le bord mdial de la scapula est appel pilier de la scapula. B. La clavicule a une direction oblique en crnial, latral, dorsal. C. Le condyle humral est divis en trois parties, de latral en mdial : le capitatum, le sillon capitulotrochlaire et la trochle humrale. D. Lpicondyle latral de lhumrus donne insertion aux muscles extenseurs. E. La fosse radiale est situe en crnial de la trochle humrale. QCM 9 : A propos de lostologie du membre thoracique A. Le tubercule infra-glnodien de la scapula donne insertion au muscle biceps. B. Le bord ventral de lhumrus participe linsertion du muscle deltode. C. La tte humrale regarde en crnial, mdial et dorsal ; on dit quelle est rtro verse. D. La trochle humrale sarticule avec le radius. E. Lpicondyle mdial prsente une gouttire pour le nerf ulnaire.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

127

QCM 10 : A propos des os de lavant-bras A. Ils sont relis entre eux par une membrane interosseuse. B. Lpiphyse distale du radius prsente une tte avec trois zones articulaires : la fossette articulaire, le biseau radial et la circonfrence articulaire. C. Le radius sarticule en proximal avec deux os et en distal aussi. D. Le bord ventral du radius dbute avec la tubrosit radiale. E. La fossette articulaire radiale, correspondant la zone crniale de la tte radiale, sarticule avec la trochle humrale. QCM 11 : A propos du radius A. Le biseau radial participe larticulation radio-ulnaire. B. La circonfrence articulaire radiale nest pas recouverte de cartilage. C. Le col donne insertion la capsule. D. La tubrosit radiale se situe en latral et en dorsal du col. E. La face dorsale du radius prsente le tubercule dorsal o passent les tendons des flchisseurs. QCM 12 : A propos du radius et de lulna A. La face latrale du radius se poursuit par la stylode radiale. B. La face ventrale du radius participe larticulation radio-ulnaire distale par la prsence de lincisure ulnaire du radius. C. La base distale du radius prsente deux surfaces articulaires : la zone latrale sarticule avec le lunatum. D. Lulna sarticule directement avec les os du carpe par des articulations de type ellipsode. E. La membrane interosseuse sinsre sur la face mdiale de lulna. QCM 13 : A propos de lulna A. Lolcrne est la partie dorsale et proximale de lpiphyse proximale. B. La face proximale de lolcrne donne insertion au tendon du biceps. C. La partie la plus ventrale de lolcrne sappelle le bec de lolcrne. D. La face ventrale de lolcrne est une face articulaire et forme lincisure trochlaire. E. Le bec coronode se situe sur la face mdiale du processus coronode. QCM 14 : A propos de lulna A. Sur la face latrale de lolcrne se trouve lincisure radiale de lulna. B. La tte participe larticulation humro-ulnaire. C. Le versant latral de la tte rpond lincisure ulnaire du radius. D. La stylode ulnaire, sur le versant mdial de la tte, est situe en dorso-mdial par rapport la tte ulnaire. E. La stylode ulnaire descend plus bas que la stylode radiale. QCM 15 : A propos du squelette de la main A. Il est compos de 27 os constants : 8 os du carpe, 5 mtacarpes et 14 phalanges. B. L'ensemble forme une arche concave en dorsal. C. Il existe 1 ssamode au niveau de la face palmaire de chaque articulation mtacarpo-phalangienne du pouce. D. Le carpe s'articule en proximal avec le radius et le disque articulaire radio-ulnaire et en distal avec les 5 mtacarpes. E. Le carpe est compos de 2 ranges osseuses.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

128

QCM 16 : A propos du carpe A. L'hamatum, os le plus mdial de la deuxime range, porte l'hamalus (en ventral) qui ferme le canal carpien. B. Le bord latral du carpe est constitu par le trapzode et le trapze. C. La gouttire que forme le carpe est ferme par le rtinaculum des flchisseurs et contribue ainsi former le canal carpien. D. Le capitatum s'articule avec les 2me, 3me et 4me mtacarpiens. E. Le pisiforme participe la paroi mdiale du canal carpien, tout comme l'hamatum. QCM 17 : A propos des mtacarpiens A. Les mtacarpiens sont des os longs constitus d'un corps et de 2 piphyses : une proximale (la tte) et une distale (la base). B. La base des mtacarpiens prsente 3 surfaces articulaires. C. La surface articulaire porte par la tte des mtacarpiens dborde en dorsal pour limiter l'extension de l'articulation mtacarpo-phalangienne. D. Les mtacarpiens s'articulent avec la range distale des os du carpe en proximal, et avec la phalange proximale de chaque doigt en distal. E. L'axe de la main passe par le 2me mtacarpien. QCM 18 : A propos des phalanges A. Il existe trois phalanges par doigt. B. Les articulations inter phalangiennes sont des trochles, elles n'ont donc qu'un degr de mobilit (flexion/extension). C. La dernire phalange de chaque doigt se termine par une houppe phalangienne qui sert d'assise l'ongle. D. Au niveau de chaque doigt, il existe deux articulations inter phalangiennes : une proximale et une distale. E. Les diaphyses, qui ont des formes de semi cylindres, ont deux bords : un mdial et un latral ou ulnaire.

Arthrologie du membre thoracique (27 QCM)


QCM 1 : A propos de larticulation scapulo-humrale A. La tte humrale est recouverte de cartilage sur 1/3 de sa surface et regarde en crnial, mdial et dorsal : on dit quelle est rtro verse. B. La cavit glnode regarde en latral, crnial et ventral, ce qui lui assure une bonne congruence avec la tte humrale. C. Cette articulation sphrode possde un bourrelet articulaire plein, le labrum, qui augmente la stabilit et la congruence de larticulation. D. On trouve des ligaments crniaux, ventraux et dorsaux mais pas de ligament en caudal, do le risque de luxation leve. E. La capsule, accompagne de sa membrane synoviale, se fixe au niveau du col chirurgical de la tte humrale.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

129

QCM 2 : A propos des ligaments de larticulation scapulo-humrale A. Au nombre de cinq, ils se situent tous proximit de la capsule. B. Le ligament coraco-humral possde son origine sur le processus coracode et se termine en deux faisceaux, sur le tubercule majeur et sur le tubercule mineur, encadrant ainsi le tendon du muscle long biceps. C. Les ligaments glno-humraux sont au nombre de trois et renforcent la capsule en caudal. D. Le ligament glno-humral crnial, plutt vertical, va de la cavit glnode et se termine sur le tubercule mineur. E. le ligament glno-humral caudal, tendu entre la face ventro-caudale de la glne et le col chirurgical, a la forme dun hamac. QCM 3 : A propos de larticulation scapulo-humrale A. Le ligament glno-humral moyen se dispose obliquement entre la partie ventrale de la glne et la partie infrieure du tubercule mineur, il limite ainsi labduction de lpaule. B. Le ligament transverse stabilise le passage du tendon du long biceps. C. Dans le plan frontal, elle ralise 60 de flexion encore appele antpulsion. D. Labduction est nettement suprieure ladduction, cette dernire tant limite par le tronc. E. Dans un plan horizontal, les mouvements de rotation atteignent 125 lorsque seule larticulation scapulo-humrale est mise en jeu. QCM 4: A propos des espaces de glissement de larticulation scapulo-humrale A. Alors que lespace scapulo-humral facilite les mouvements sans les amplifier, la bourse synoviale sous-acromio-deltodienne facilite et amplifie, entre autre, labduction de lpaule. B. Lespace de glissement scapulo-humral est compos de deux sysarcoses spares par le muscle grand dentel. C. Ces deux espaces permettent la scapula de faire des mouvements dans les trois plans de lespace, mouvements que lon tudie en bloquant la scapula sur la cage thoracique. D. Lorsque la scapula fait de la rotation mdiale, lhumrus fait de ladduction. E. Lorsque la scapula fait de la rotation latrale, lhumrus se rapproche de laxe du corps. QCM 5 : A propos de larticulation de lpaule A. Le complexe articulaire de lpaule comprend deux articulations synoviales, une articulation plane et deux fausses articulations appeles espaces de glissement. B. Les trois articulations vraies possdent soit un disque ou mnisque soit un labrum qui viennent stabiliser et amliorer larticulation. C. Larticulation sterno-costo-claviculaire possde trois degrs de libert mais participe peu la rotation mdiale et latrale de lpaule. D. Les ligaments sterno-claviculaires et coraco-claviculaires sont situs en caudal de la clavicule. E. Avec la coopration articulaire des trois articulations et des deux espaces de glissements, larticulation de lpaule peut atteindre 160 dabduction et 180 avec la participation du rachis. QCM 6 : Concernant larthrologie de lpaule A. Larticulation sterno-costo-claviculaire est une articulation vraie de type en selle. B. Le mnisque sinterposant entre les surfaces de la clavicule, du premier cartilage costal et du sternum est prsent seulement dans 1/3 des cas. C. Lextrmit mdiale de la clavicule, appel extrmit sternale, possde deux surfaces articulaires : une pour le sternum et une pour le premier cartilage costal, les deux tant spars par la crte mousse. D. Le mnisque de larticulation sterno-costo-claviculaire donne une laxit supplmentaire qui permet le passage de 2 de libert thorique pour une articulation en selle, 3 de libert. E. La capsule articulaire qui est double dune synoviale, constitue un moyen dunion pour une articulation.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

130

QCM 7 : Concernant larthrologie de lpaule A. Le ligament inter-claviculaire qui va dune clavicule lautre, renforce distance la capsule. B. La capsule est renforce en ventral par le ligament sterno-claviculaire ventral et en dorsal par le ligament sterno-claviculaire dorsal, plus pais que le ventral. C. Le ligament costo-claviculaire, ligament distance, est constitu de deux faisceaux et joue un rle essentiel dans la stabilisation de larticulation. D. Pour ltude des mouvements de larticulation sterno-costo-claviculaire, on dfinit un centre des mouvements : lextrmit mdiale de la clavicule et les mouvements sont analyss au niveau de lextrmit latrale de la clavicule. E. La clavicule peut se dplacer dans un plan frontal o elle effectue 30dantpulsion et 10de rtropulsion. QCM 8 : Concernant larthrologie de lpaule A. Larticulation acromio-claviculaire est une articulation synoviale plane permettant les mouvements dans les trois plans de lespace. B. La surface articulaire de lacromion regarde en crnial et en latral. C. La sensation de la clavicule en touche de piano correspond une dformation vers le haut due une luxation de la clavicule. D. Le mnisque de larticulation acromio-claviculaire qui peut tre entier ou fentr, est constant. E. Le mouvement dadaptation entre la scapula et la clavicule permet le maintient de langle clavicule/scapula constant, 70. Cet angle favorise laction des autres articulations au niveau de lpaule. QCM 9 : Concernant larthrologie de lpaule A. Le ligament acromio-claviculaire entre dans la constitution de la chape delto-trapezienne qui permet la stabilisation de larticulation. B. On trouve partant de lapophyse coracode la surface caudale de la clavicule, trois ligaments coracoclaviculaires renforant directement la capsule. C. Le ligament conode en latral du ligament coraco-claviculaire mdial, se situe dans un plan frontal. D. Le ligament trapzode, le plus volumineux des trois ligaments coraco-claviculaires, est le plus latral et se situe dans un plan frontal par rapport au ligament conode. E. Larticulation sterno-costo-claviculaire et larticulation acromio-claviculaire reprsentent 10 dans les mouvements de lpaule. QCM 10 : Concernant larticulation humro-ulnaire A. La berge mdial de la trochle humrale est moins dveloppe que la berge latrale, ce qui explique que le bras soit dport en latral lors de lextension. B. La capsule de larticulation humro-ulnaire est commune aux articulations humro-radiale et radioulnaire proximal C. Le ligament arciforme renforce (en partie) linsertion terminale du ligament collatral radial du coude. D. Les deux picondyles de lhumrus et lolcrane dessinent un triangle lors de la position anatomique de rfrence. E. Larticulation humro-ulnaire est de type ginglyme, ce qui implique quelle possde un seul degr de libert (140 de flexion en actif et 0 dextension). QCM 11 : Concernant les articulation radio-ulnaire A. Les surfaces en prsence au niveau de larticulation radio-ulnaire distale sont lincisure ulnaire du radius (face mdiale de lpiphyse distale du radius) et la tte ulnaire. B. Le ligament annulaire est de forme conique dont le sommet est distal, il est assimilable un entonnoir dans lequel repose la tte radiale. C. Laxe de prono-supination est variable selon la position de lavant bras par rapport au bras. D. Le ligament carr est stabilisateur, il sinsre sur le bord distal de lincisure ulnaire du radius et se termine sur le col ulnaire. E. Le ligament triangulaire exclue lulna de larticulation du poignet. Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 131
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 12 : Concernant larticulation humro-ulnaire A. Larticulation humro-ulnaire est larticulation directionnelle du coude. B. La capsule articulaire forme de nombreux replis appels cul de sacs synoviaux. C. Lpicondyle mdial de lhumrus donne insertion au ligament collatral radial du coude tandis que lpicondyle latral est lui le lieu dinsertion du ligament collatral ulnaire du coude. D. Les deux ligaments collatraux du coude possde chacun trois faisceaux (ventral, moyen et dorsal). E. Tous les faisceaux du ligament collatral radial du coude se terminent sur lulna. QCM 13 : Gnralits sur larthrologie du membre thoracique A. Larticulation humro-ulnaire est beaucoup moins frquemment luxe que larticulation scapulohumrale car les surfaces en prsence sont mieux adaptes. B. Toutes les articulations du membre thoracique possdent chacune leur propre capsule et leur propres ligaments. C. Les trois principaux os du membre suprieur (humrus, radius et ulna) sont chacun impliqu dans trois articulations. D. Le coude prsente trois types darticulations synoviales : une de type sphrode, une de type ginglyme et une de type trochle. E. Au niveau des articulations synoviales du membre thoracique, on retrouve du cartilage exclusivement sur les surfaces articulaires en prsence. QCM 14 : Concernant larticulation humro-ulnaire A. Cest une articulation trs stable sur le plan osseux, rares sont les luxations ce niveau. B. Comme toute articulation qui travaille en flexion/extension, les ligaments sont surtout ventraux et dorsaux. C. Il existe au niveau du coude, trois repres palpables qui salignent lors de lextension. D. Cette articulation est une trochode, elle ne prsente quun seul degr de libert. E. Cette articulation effectue une flexion active de 160 degrs et une flexion passive de 140 degrs. QCM 15 : Concernant larticulation humro-ulnaire A. Cette articulation tant trs congruente, elle ne prsente que des ligaments comme lments de stabilit. B. Aucun des ligaments collatraux ne se termine sur le radius. C. Le ligament collatral radial du coude sinsre sur lpicondyle mdial de lhumrus. D. les ligaments collatraux radial et ulnaire prsentent tous deux trois faisceaux. E. le faisceau moyen du ligament collatral ulnaire du coude se termine sur la partie distale de lolcrane. QCM 16 : Concernant larticulation humro-ulnaire A. Le faisceau ventral du ligament collatral radial du coude se termine sur la coronode. B. Le faisceau ventral du ligament collatral ulnaire du coude sinsre sur lpicondyle latral de lhumrus et se termine sur la coronode. C. Le faisceau moyen du ligament collatral radial du coude se termine sur le radius, entourant ainsi la tte radiale. D. Lors dune fracture, la position dimmobilisation de cette articulation est 90 degrs. E. Lincisure trochlaire de lulna est uniquement forme par lolcrane. QCM 17 : Concernant les articulations de lavant-bras A. La rotation mdiale du radius autour de lulna est appele mouvement de supination. B. Dans le mouvement de prono-supination, seul le radius est mobile car lulna reste fixe. C. Le ligament carr est le seul ligament de larticulation radio ulnaire proximale se fixer sur le radius. D. Le ligament triangulaire est sommet latral et, est recouvert de cartilage sur ses deux faces. E. Le ligament annulaire est recouvert de cartilage sur sa face mdiale.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

132

QCM 18 : Concernant les articulations de lavant-bras A. La membrane interosseuse atteint en caudal larticulation radio-ulnaire distale. B. La membrane interosseuse est plus rsistante au niveau des 2/3 caudaux. C. Laxe de rotation des articulations radio-ulnaires passe par le 5 me mtacarpien quand le coude est flchi et par le 3me mtacarpien quand le coude est tendu. D. Lors dun mouvement de pronation maximal, la paume de la main regarde vers le ciel. E. Il nexiste pas de ligaments radio-ulnaires ventral et dorsal, seuls le ligament triangulaire et la capsule assurent la stabilit de larticulation radio-ulnaire distale. QCM 19 : A propos de larthrologie du poignet A. Larticulation radio-carpienne est de type bicondylienne. B. Larticulation radio-carpienne unit la surface articulaire distale du radius au scaphode en mdial et au lunatum en latral. C. Le ligament triangulaire est mdial. Sa face distale est recouverte de cartilage. D. Le ligament collatral radial a son origine sur la stilode radiale et se termine sur le tubercule du scaphode, sur le tubercule du trapze et sur le bord latral de ces deux os. E. Le ligament collatral ulnaire se termine sur le pisiforme, le triqutrum, lhamulus de lhamatum et le 5me mtacarpien. Il limite linclinaison ulnaire du poignet. QCM 20 : A propos de larthrologie du poignet A. Les ligaments ventraux dessinent un chevron sur le poignet, ils possdent chacun deux faisceaux qui se terminent lun sur le capitatum et lautre sur le lunatum. B. Le ligament radio-carpien dorsal va du tubercule dorsal du radius jusqu' la face dorsale du triquetrum, de lhamatum et du scaphode. C. Des ligaments se fixent sur la face dorsale de tous les os du carpe. D. Les mouvements de flexion du poignet ont une amplitude denviron 90. Ils se font essentiellement au niveau de la mdio-carpienne. E. Linclinaison radiale est denviron 15. Elle est limite par le ligament collatral ulnaire et par la bute du scaphode au niveau de la stilode du radius. QCM 21 : A propos de larthrologie des doigts A. Il y a quatre types darticulation au niveau des doigts : les carpo-mtacarpiennes, les intermtacarpiennes, les mtacarpo-phalangiennes et les inter-phalangiennes. B. Le capitatum sarticule avec le 3me et le 4me mtacarpien. C. Toutes les articulations carpo-mtacarpiennes sont de type synoviales planes. D. Les ligaments collatraux qui renforcent la capsule articulaire des articulations mtacarpophalangiennes se tendent lors de lextension de la premire phalange. E. Labduction et ladduction des doigts ont une amplitude denviron 30 par rapport laxe de la main. QCM 22 : A propos de larthrologie des doigts A. Les articulations inter-phalangiennes sont de type trochle. B. Les articulations carpo-mtacarpiennes sont plus mobiles au niveau des 2me et 3me mtacarpiens quau niveau des 4me et 5me mtacarpiens. C. Dans les articulations mtacarpo-phalangiennes, la tte du mtacarpien est trs dveloppe en dorsal pour complter la cavit glnodale de la phalange. D. Dans une articulation inter-phalangienne, la tte dune phalange porte la trochle et la base de la phalange suivante porte lincisure trochlaire. E. Les articulations inter-phalangiennes ont un seul degr de libert, ce qui permet le mouvement de flexion/extension.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

133

QCM 23 : A propos de larthrologie du poignet et de la main A. Larticulation du poignet (radio-carpienne et mdio-carpienne) forme une double ellipsode. B. Le mouvement dextension du poignet se fait essentiellement au niveau de la mdio-carpienne. C. Larticulation trapzo-mtacarpienne est de type en selle et possde donc trois degrs de libert. D. Les articulations inter-mtacarpiennes sont des synoviales planes. E. Chaque doigt possde deux articulations inter-phalangiennes : une proximale et une distale. QCM 24 : Arthrologie du poignet A. La mobilit du poignet fait intervenir deux articulations. B. Lulna ne joue quun rle accessoire dans la stabilit de larticulation radio-carpienne car il ne sarticule pas directement avec les os du carpe. C. Les surfaces articulaires du scaphode, lunatum et triquetrum (de latral mdial) forment une ellipse. D. Les ligaments interosseux liants scaphode, lunatum et triquetrum sont recouverts de cartilage et contribuent former la surface articulaire radio-carpienne. E. Les articulations radio-carpienne et mdio-carpienne partagent la mme capsule articulaire. QCM 25 : Arthrologie du poignet A. Lamplitude de flexion du poignet est de 90 environ. B. Lamplitude dextension du poignet est de 45environ. C. Linclinaison radiale du poignet est de 45 environ. D. Linclinaison ulnaire du poignet est de 15 environ car elle est limite par le ligament collatral ulnaire. E. Quelle que soit son inclinaison (radiale ou ulnaire), le poignet est en abduction par rapport laxe de la main. QCM 26 : Arthrologie des doigts A. La mobilit des doigts fait intervenir quatre articulations. B. Larticulation trapzo-mtacarpienne est une articulation ellipsode deux degrs de libert. C. Larticulation trapzo-mtacarpienne a trois degrs de libert. D. Larticulation trapzo-mtacarpienne possde une capsule et des ligaments qui la renforcent en ventral et en dorsal. E. Lhamatum est le seul os du carpe qui sarticule avec deux mtacarpiens. QCM 27 : Arthrologie des doigts A. Les ligaments radio-carpien palmaire et ulno-carpien palmaire sont symtriques sur la face ventrale du poignet. B. Les articulations inter-mtacarpiennes sont des synoviales en selle qui favorisent les mouvements de mtacarpiens. C. La flexion de larticulation inter-phalangienne proximale est suprieure celle de linter-phalangienne distale. D. Larticulation inter-phalangienne proximale peut prsenter une hyper-extension de 5 10. E. Les articulations inter-phalangiennes sont congruentes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

134

Ostologie crnio-faciale (34 QCM)


QCM 1 : A propos des os du crne A. La bote crnienne est divise en deux parties : la vote ou calvaria et la base, elle-mme divise en trois tages (antrieur, moyen et postrieur). B. En vue exocrnienne, on trouve sur lcaille de los frontal la crte frontale qui se divise en deux lvres pour former la gouttire du sinus sagittal suprieur. C. En vue endocrnienne, on trouve sur la base de los frontal le foramen caecum, zone dinsertion mninge. D. Le nerf frontal merge du foramen supra-orbitaire de los frontal. E. Le sinus frontal se draine par le canal naso-frontal qui traverse lethmode et aboutit dans le mat suprieur. QCM 2 : A propos des gnralits sur le crne A. Le crne constitue une cavit ovode grosse extrmit antrieure. B. La vote et la base (calvaria) sont les deux parties constituant le crne. C. On distingue la base du crne, trois tages : antrieur, moyen et postrieur. D. Le crne se compose de huit os. E. Lethmode est un os pair et latral. QCM 3: A propos du crne A. Le sinus frontal est une cavit arique de lcaille de los frontal. B. Les fossettes granulaires sont visibles sur la face exocrniale du frontal, de part et dautre de la crte frontale. C. Tous les sinus se drainent dans les fosses nasales. D. La lame crible de lethmode laisse passer les filets nerveux du nerf I (nerf optique). E. La crte orbito-nasale est marque par la prsence dune incisure et dlimite le bord infrieur des cavits orbitaires. QCM 4 : A propos de los frontal A. En vue endocranienne, lcaille est globalement concave. B. Lincisure infra-orbitaire est traverse par le nerf frontal. C. La fossette trochlaire se situe mdialement par rapport la fossette lacrymale. D. Le canal naso-frontal se jette dans le mat infrieur. E. Le foramen caecum donne insertion la dure-mre. QCM 5 : Los frontal A. Os impair et mdian qui appartient ltage antrieur. B. Il sarticule avec les paritaux, le sphnode, lethmode, les maxillaires, les os du nez et les zygomatiques. C. Il a la forme dune coquille avec une partie verticale quon appelle lcaille, et une partie orbitaire ; ces deux parties sont spars par les arcs supra-ciliaires. D. Lcaille prsente dans sa partie mdiane endocranienne une saillie : la glabelle. E. Lcaille saplatit latralement (rgion temporale) et sarticule avec los temporal.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

135

QCM 6 : Los frontal A. Au niveau de la crte orbito-nasale, on trouve des zones de jonction : le processus maxillaire en latral et le processus zygomatique en mdial. B. Au niveau de la partie orbitaire, lincisure ethmodale situe en mdial est ferme par la lame crible de lethmode. C. Au niveau de la partie orbitaire, on trouve deux petites dpressions en endocranien : la fossette trochlaire en latral et la fossette lacrymale en mdial. D. En vue endocranienne, au niveau de la base, on distingue des impressions digites (surface concave) et des jugums crbraux (saillies en relief). E. Le foramen coecum, situ en arrire de lincisure ethmodale, est une zone dinsertion mninge de la dure-mre (faux du cerveau). QCM 7 : A propos de l'os frontal A. Il n'appartient qu' la vote du crne. B. Il appartient l'tage antrieur de la base du crne. C. La suture mtopique, observable sur une vue endocrnienne, disparat aprs 6 ans. D. Le nerf frontal, nerf mixte, est une branche du nerf trijumeau et merge du foramen supra-orbitaire sur une vue exocrnienne de l'os. E. Le foramen coecum est une zone d'insertion mninge. QCM 8 : A propos de l'os frontal A. Il constitue le relief du front. B. Il s'articule avec les os zygomatiques. C. La gouttire du sinus sagittal suprieur provient de la division de la crte frontale, observable sur l'caille en vue exocrnienne. D. Le foramen coecum, zone d'insertion mninge, se trouve en arrire de l'incisure ethmodienne. E. Tous les sinus ariens se drainent dans les fosses nasales. QCM 9 : A propos de los frontal A. Une partie de la base appartient ltage moyen de la base du crne. B. Il sarticule avec les deux os nasaux. C. Langle, ou caille du frontal, spare la partie calvariale de la partie basilaire. D. Sa partie verticale saplatie latralement pour former la rgion infra-temporale. E. Il sarticule latralement avec los maxillaire. QCM 10 : A propos de los frontal A. Lincisure nasale donne appui aux os nasaux. B. Le foramen coecum laisse passer le nerf frontal, branche terminale du V1. C. La fossette trochlaire est plus mdiale que la fossette lacrymale. D. Les fossettes granulaires sont les empreintes de structures qui scrtent le liquide crbro-spinal. E. Le sinus frontal se draine dans le mat moyen par le canal naso-frontal. QCM 11 : Los ethmode A. Os centro-facial qui nappartient qu la base. B. La lame crible est perce dorifices laissant passer les filets nerveux du nerf olfactif (IIme paire de nerf cranien). C. Une fracture de la lame cible entrane un panchement du liquide crbro-spinal dans les fosses nasales (rhinore crbro-spinale). D. La partie endocranienne de la lame verticale constitue le processus crista galli (comme le foramen caecum, il sagit dune zone dinsertion de la faux du cerveau). E. La lame perpendiculaire de lethmode cloisonne les fosses nasales en deux parties et contribue la formation du septum nasal.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

136

QCM 12 : A propos de los ethmode A. Cest un os qui nappartient qu la base du crne (tage postrieur). B. La lame crible de lethmode laisse passer les filets nerveux du nerf I (nerf olfactif). C. Le vomer et la lame verticale, dite perpendiculaire, constitue eux seuls la cloison nasale. D. Los planum correspond la face mdiale des masses latrales. E. Le processus Crista Galli appartient la partie suprieure de la lame verticale. QCM 13 : A propos de los ethmode A. La lame des cornets est constitue du cornet suprieur, cornet moyen et infrieur. B. Chaque cornet surmonte une rgion, appele mat, dans lequel souvrent les orifices de drainage des sinus ethmodien. C. Le bord suprieur de los ethmode sarticule avec le maxillaire. D. On dcrit los ethmode deux faces et deux bords. E. Le processus Crista Galli donne insertion un repli de la pie-mre. QCM 14 : A propos de lethmode A. Cest un os centro-facial. B. Les masses latrales dlimitent en partie les parois latrales des cavits nasales. C. La lame crible appartient ltage antrieur de la base du crne. D. Le processus Crista-Galli donne insertion une structure mninge : la faux du cerveau. E. La lame verticale sarticule avec le sphnode. QCM 15 : A propos de lethmode A. La cloison nasale est uniquement constitue par la lame perpendiculaire, le cartilage septal et le vomer. B. Los planum porte les cornets. C. Le cornet suprieur est la limite crniale du mat suprieur. D. Le rle des cornets est de crer des turbulences ariennes dans les fosses nasales. E. Lensemble des cellules ethmodales communiquent et forment le sinus ethmodal. QCM 16 : A propos de lethmode A. Il entre dans la constitution de la base du crne et de la vote. B. La lame crible, verticale, est perce d'orifices dont le rle est de laisser passer les filets nerveux du nerf 1 (olfactif). C. La lame crible ferme l'incisure ethmodale de l'os frontal. D. La fracture de la lame crible, bien que douloureuse, n'a que peu de rpercussion sur l'intgrit mninge. E. La lame perpendiculaire cloisonne les fosses nasales en fosse nasale droite et gauche. QCM 17 : A propos de l'ethmode A. La lame verticale s'appuie en arrire sur le vomer. B. La cloison nasale est compose du vomer, de la lame crible et du cartilage septal. C. Ses masses latrales sparent la cavit orbitaire des fosses nasales. D. On trouve le mat suprieur au dessus du cornet suprieur. E. On trouve le mat moyen au dessous du cornet moyen. QCM 18 : A propos de los frontal et de lethmode A. Le sinus ethmodal se draine dans les trois mats. B. Les bords antrieurs et infrieurs des masses latrales sarticulent avec le maxillaire. C. Lcaille du frontal sarticule avec la partie calvariale du temporal. D. Les arcades supra-ciliaires sont des saillies osseuses visibles sur face exocrnienne. E. La crte frontale est visible sur une vue exocrnienne.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

137

QCM 19 : A propos de l'os frontal et de lethmode A. Ce sont 2 os impairs et mdians appartenant la base et la vote du crne. B. La lame crible de l'ethmode est encastre dans l'incisure ethmodale de l'os frontal. C. Ils possdent tous deux des sinus. D. Ils s'articulent tous deux avec le sphnode. E. L'empreinte de la glande lacrymale est retrouve sur la face mdiale des masses latrales de l'ethmode. QCM 20 : Los temporal A. La partie squameuse (ou lcaille) entre uniquement dans la constitution de la calvaria. B. Le processus zygomatique possde deux racines : une racine transversale concave dans tous les sens, et une racine longitudinale convexe dans tous les sens. C. La racine transversale du processus zygomatique, appele minence articulaire du temporal , prsente un axe tangent au bord antrieur du foramen magnum. D. Los temporal sarticule avec le frontal. E. La fosse mandibulaire est une cavit glnode limite en arrire par la suture tympano-squameuse. QCM 21 : Los temporal A. La face crbrale du rocher prsente une minence arque, empreinte du canal semi-circulaire suprieur qui appartient au systme de lquilibration. B. La face crbelleuse du rocher prsente, de mdial latral, le mat acoustique interne et lempreinte du sinus sigmode. C. Le processus mastode constituant la base de la pyramide ptreuse est situ sur la face occipital du rocher. D. Sur la face occipitale du rocher, on retrouve le foramen stylo-mastodien par lequel sortent le nerf facial et le nerf cochlo-vestibulaire. E. Sur la face crbelleuse du rocher, la fosse trigminale laisse passer les trois branches du nerf trijumeau. QCM 22 : Los temporal A. Lapex du rocher sunit compltement avec le sphnode et laisse passer lartre carotide interne. B. Le foramen jugulaire laisse passer en antro-mdial les nerfs IX, X, XI, et en postro-latral la veine jugulaire interne. C. Le bord antrieur du rocher sarticule un peu avec lcaille et un peu avec le sphnode. D. Le temporal sarticule avec le parital, loccipital, lethmode et los zygomatique. E. Los tympanal simplante sur la face exocrnienne ventral du rocher. QCM 23 : Concernant los temporal A. Le champ temporal et le champ basilaire sont spars par une tige osseuse qui se dirige en avant et en dedans : le processus zygomatique. B. La face antro-suprieure du rocher (ou face crbelleuse) et la face postro-suprieure du rocher (ou face crbrale) sont les deux faces endocrniennes. C. Le bord postrieur du rocher sunit avec loccipital de manire incomplte laissant persister un orifice double : le foramen jugulaire. D. La partie antrieur du foramen jugulaire est le lieu de passage de la veine jugulaire interne. E. Le bord suprieur de la pyramide ptreuse constitue la limite entre ltage moyen et ltage postrieur de la base du crne.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

138

QCM 24 : Concernant los temporal A. Larcade zygomatique (forme de lunion entre le processus zygomatique et los zygomatique) scarte du crne pour former le dfil zygomatique, lieu de passage du muscle zygomatique. B. La partie antrieure du foramen jugulaire permet le passage des nerfs XI, IX et du nerf vague. C. Le processus mastode est une zone pneumatise constituant la base de la pyramide ptreuse. D. Les nerfs crniaux VI et VII sengagent dans le mat acoustique interne ou pore acoustique interne. E. Lincisure mastodienne est la zone dinsertion du muscle digastrique (ventre postrieur), au niveau de la face crbrale du rocher. QCM 25 : Concernant los temporal A. On retrouve sur la face crbrale du rocher, de dedans en dehors et darrire en avant : la fosse trigminale, le foramen des nerfs ptreux, lminence arqu et le toit de la caisse du tympan. B. Los tympanal occupe la plus grande partie de la face antro-suprieure du rocher. C. Lapex du rocher sunit incompltement avec le sphnode en avant et loccipital en arrire formant ainsi le foramen dchir, lieu de passage dlments destins au cortex crbral. D. Le sinus sigmode draine le sang vers la veine jugulaire interne, il laisse une empreinte sur la face postro-suprieure du rocher. E. On observe sur le versant exocrnien de lcaille le passage de lartre mning moyenne. QCM 26 : Concernant los occipital A. Lcaille est marque dans sa partie sagittale mdiane (en endocrnien) par lempreinte du sinus sagittal suprieur. B. Les condyles occipitaux entre dans la constitution de larticulation bicondylienne entre la premire vertbre (latlas) et loccipital. C. La limite postrieur de ltage postrieure de la base du crne est reprsente par le sillon du sinus sagittal suprieur. D. Le canal de lhypoglosse est prsent la fois sur les faces endocrnienne et exocrnienne de loccipital, il est le lieu de passage du nerf XII. E. Les lignes nucales sont situes de part et dautre de la protubrance occipitale interne. QCM 27 : Gnralits sur la face A. Le massif facial fixe est compos de 14 os, plus un cartilage quest le cartilage septal. B. Le vomer est un os et non un cartilage, ce titre il fait partie des 13 os qui constituent le massif facial fixe. C. Le massif facial fixe est constitu de 6 paires dos, dun os impair et mdian et dun cartilage. D. Les pommettes sont des reliefs osseux, ce sont les maxillaires qui les constituent. E. La mandibule est un os mobile et elle appartient au massif facial fixe. QCM 28 : Maxillaire A. Le maxillaire participe la constitution des cavits orbitaires, nasale mais pas orale puisque ce sont les deux os palatins qui constituent entirement la partie suprieure de la cavit orale. B. Les deux os maxillaires forment larcade dentaire suprieure par lintermdiaire de los alvolaire (chez un adulte possdant toutes ses dents). C. Cet os possde un processus frontal dans sa partie suprieure, un processus palatin horizontal qui spare la fosse nasale de la cavit orale et un processus alvolaire qui nexiste que par labsence de dents. D. La face jugale est marque par la prsence dun foramen infra-orbitaire par lequel merge le nerf infraorbitaire. E. Il existe deux tubrosits maxillaires, au total, qui regardent vers la fosse infra-temporale et sur lesquelles sappuient les processus ptrygodes du sphnode.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

139

QCM 29 : Lacrymaux, nasaux, cornets infrieurs A. Il existe 2 sulcus lacrymaux transforms en canaux lacrymo-nasaux par les os lacrymaux, ces canaux dbouchent dans le mat moyen. B. Les canaux lacrymo-nasaux permettent une communication entre les cavits orbitaires et la fosse nasale. C. Il existe un seul os nasal qui sarticule avec le frontal et le maxillaire entre autres. D. Le cornet infrieur est un os pair, il dlimite la partie infrieure du mat infrieur. E. Le cornet infrieur est un os faisant partie de lethmode, au mme titre que les cornets suprieur et moyen. QCM 30 : La mandibule A. Cest le seul os mobile de la face, elle sarticule avec les temporaux. B. La mandibule ne participe qu une seule articulation : larticulation temporo-mandibulaire. C. Le masseter est un muscle lvateur de la mandibule et sinsre au niveau de langle mandibulaire (face interne). D. Le condyle mandibulaire est directement attach au ramus de la mandibule. E. La fova ptrygodienne donne insertion au ptrygodien mdial qui est un lvateur de la mandibule. QCM 31 : A propos du maxillaire et du palatin A. Le sinus maxillaire se dveloppe partir de 2 ans B. Lincisure sphno-palatine fait communiquer la cavit nasale avec la cavit buccale. C. La lame palatine horizontale sunit avec le processus palatin du maxillaire. D. Le processus pyramidal sinterpose entre le maxillaire et la ptrygode. E. Le palatin est constitu de 2 lames osseuses : une verticale et une horizontale. QCM 32 : A propos du zygomatique A. Le zygomatique est triangulaire et possde 3 faces. B. Sa face suprieure participe la constitution de la paroi suprieure de lorbite. C. Il entre dans la constitution de la paroi latrale des fosses nasales. D. Le sommet suprieur est articul avec le processus frontal. E. Il ferme en mdial la fosse infra-temporale. QCM 33 : A propos de la mandibule A. Langle de la mandibule donne insertion au muscle masster qui est un muscle masticateur. B. Son processus coronode sarticule avec le temporal par lintermdiaire dun disque biconcave. C. Cest le seul os mobile de la face avec los nasal. D. Le foramen mandibulaire est protg en avant par une pine osseuse : la lingula. E. Louverture buccale se caractrise par un mouvement de rotation suivit dun mouvement de translation. QCM 34 : A propos de la face A. Le sinus maxillaire souvre en dessous du cornet moyen. B. Le plancher des fosses nasales est form par le processus palatin du maxillaire et la lame verticale du palatin. C. Le vomer, situ en avant de la lame perpendiculaire de lethmode participe la cloison des fosses nasales. D. Los zygomatique sarticule avec le maxillaire, le frontal et le temporal. E. La ligne oblique externe de la mandibule se termine par le foramen mentonnier qui laisse passer le nerf mentonnier. Ostologie du crne (5 QCM)

QCM 1 : Ostologie du crne A. Les fossettes granulaires sont retrouves de part et dautres du sinus sagittal suprieur. B. Le tubercule de la selle contribue dlimiter ltage antrieur de ltage moyen de la base du crne. Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 140
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

C. La runion entre los occipital et les deux os paritaux est matrialise par la suture lambdode. D. Lartre carotide interne traverse le foramen pineux. E. La suture sagittale relie la suture coronale la suture lambdode. QCM 2 : Concernant les fontanelles crnienne A. Chez le nouveau n, la partie latral du crne prsente dcrire deux fontanelles : la fontanelle bregmatique et la fontanelle lambdatique. B. Une fontanelle ptrique est dlimite par los frontal, un os parital, un os temporal, et los sphnode. C. La fontanelle bregmatique permet de raliser chez ladulte une cographie transfontanellaire. D. La fontanelle lambdatique est dlimite par los frontal et les deux os paritaux. E. Les diffrentes fontanelles du crne vont progressivement sossifier pour devenir des sutures lge adulte. QCM 3 : Concernant les orifices crnien A. Le nerf facial pntre dans ltage postrieur de la base du crne par le mat acoustique interne et en ressort par le foramen stylo-mastodien. B. Ltage moyen de la base du crne est travers (entre autre) par le nerf mandibulaire. C. Le canal carotidien, le mat acoustique interne et le foramen stylo-mastodien sont exclusivement retrouvs en exocrnien. D. La fissure orbitaire suprieur est le lieu de passage des nerfs occulo-moteur, trochlaire, abducens et ophtalmique. E. La lame crible de lethmode laisse passer le nerf optique. QCM 4 : Orifices et communication crniens A. Ltage antrieur et ltage moyen communiquent avec la cavit orbitaire. B. Ltage antrieur communique avec les fosses nasales par lintermdiaire de la lame crible de lethmode. C. Il nexiste aucun orifice en exocrnien pour ltage antrieur. D. Le nerf cochlo-vestibulaire (VIII) traverse le mat acoustique externe au niveau de ltage postrieur de la base du crne. E. Le nerf mandibulaire (V,3) traverse le foramen rond tandis que le nerf maxillaire (V,2) traverse le foramen ovale. QCM 5 : Ostologie du crne A. Lvolution de la fontanelle lambdatique correspond au point dintersection de la suture coronale et de la suture sagittale. B. Lartre mninge moyenne laisse des empreintes sur la base de los temporal. C. La limite entre ltage moyen et ltage postrieur de la base du crne est en partie constitue par le bord suprieur du clivus. D. Les nerfs glosso-pharyngien, vague et hypoglosse traversent le foramen jugulaire dans sa partie antrieure. E. Lethmode est un lment de ltage moyen de la base du crne.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

141

Myologie de lpaule (17 QCM)


QCM 1 : A propos du muscle coraco-brachial A. Il appartient au groupe ventral des muscles qui vont de la ceinture scapulaire vers lhumrus, comme le grand pectoral. B. Il a son origine sur lacromion de la scapula. C. Ce muscle est oblique en distal et en mdial. D. Il se termine sur la face ventro-latrale de lhumrus. E. Comme le deltode, il est innerv par le nerf axillaire. QCM 2 : A propos du muscle coraco-brachial A. Il fait la rotation latrale et la flexion de lhumrus. B. Il est innerv par le nerf musculo-cutan qui perfore ce muscle. C. Il prend son origine par 2 faisceaux : le faisceau coracodien et le faisceau humral. D. Ce muscle runit lapophyse coracode de la scapula au bras. E. Ce muscle passe en dorsal de larticulation scapulo-humrale pour se terminer sur la face ventrolatrale de lhumrus, et ainsi participer la rotation latrale du bras. QCM 3 : A propos des muscles de lpaule A. Le sillon delto-pectoral se trouve entre le deltode et le grand pectoral, laissant passer la grande veine lymphatique. B. Les 2 muscles du plan ventral allant de la ceinture scapulaire lhumrus sont innervs par le mme nerf. C. Le coraco-brachial est innerv par une branche terminale du plexus brachial, tout comme le deltode. D. Quand le faisceau dorsal du deltode se contracte, il participe lextension et la rotation latrale du lhumrus, comme le coraco-brachial. E. Le grand pectoral et le deltode sont dits agonistes quant aux actions dans le plan frontal. QCM 4: A propos des muscles de lpaule A. Le deltode et le grand pectoral prennent leur origine par plusieurs faisceaux qui sinsrent soit sur la scapula, soit sur la clavicule. B. Le coraco-brachial, tout comme le grand pectoral, ralise la flexion humrale. C. Le deltode fait partie des muscles adducteurs du bras. D. Le coraco-brachial et le faisceau dorsal du deltode nont pas la mme innervation, mais font tous les 2 de la rotation latrale du lhumrus. E. Dans le sillon delto-pectoral passe lartre cphalique. QCM 5 : A propos du deltode A. Cest le muscle principal de ladduction de lpaule. B. Cest lui qui donne le galbe de lpaule. C. Ses terminaisons correspondent aux insertions du muscle trapze. D. Il prsente trois faisceaux : claviculaire ou ventral, acromial ou dorsal, et pineux ou moyen. E. Le faisceau pineux est multipenn, ce qui lui permet daugmenter sa force. QCM 6 : A propos du deltode A. Ses trois faisceaux se runissent pour donner au muscle un aspect de demi cne sommet proximal. B. Il se termine au niveau du V deltodien de lhumrus, cest--dire sur sa face ventro-mdiale. C. Il est innerv par le nerf XI. D. Le faisceau ventral permet une flexion du bras et une rotation latrale. E. Le faisceau moyen permet le mouvement dabduction.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

142

QCM 7 : A propos du grand pectoral A. Cest le principal muscle de ladduction de lpaule. B. Le faisceau claviculaire prend son origine sur les 2/3 mdiaux de la face caudale de la clavicule. C. Le faisceau sterno-chondro-costal sinsre sur le sternum, les cartilages costaux et les ctes correspondantes. D. Le faisceau claviculaire est lui-mme divis en 2 faisceau : crnial et caudal. E. Le faisceau abdominal ne sinsre pas sur des os comme les autres faisceaux mais sur laponvrose des muscles droits de labdomen. QCM 8: A propos du grand pectoral A. Il se termine sur la berge mdiale du sillon inter-tuberculaire. B. Son tendon crnial est form par la runion du faisceau claviculaire et de la partie crniale du faisceau sterno-chondro-costal. C. Son tendon profond est form par la runion de la partie caudale du faisceau sterno-chondro-costal et du faisceau abdominal. D. Comme le deltode il est innerv par le nerf XI. E. Il permet les mouvements dadduction et de rotation mdiale de lhumrus. QCM 9 : A propos des muscles de lpaule A. Le trapze prsente trois faisceaux : cranial, moyen, caudal. B. Le trapze va du tronc la ceinture scapulaire ; il fait partie du groupe dorsal. C. Lorsque le muscle lvateur de la scapula se contracte, il permet de rapprocher les deux scapula. D. Les 2 rhombodes (petit et grand) sinsrent au moins sur un processus pineux cervical. E. Le grand rhombode permet de rapprocher la scapula du tronc ; il est donc adducteur. QCM 10 : A propos des muscles de lpaule A. Le muscle lvateur de la scapula est un muscle superficiel. B. Les muscles rhombodes (petit et grand) sont innervs par une branche terminale du plexus brachial. C. Le muscle lvateur de la scapula sinsre sur des processus transverses de C1 C4. D. Le faisceau cranial du trapze se termine au niveau des 2/3 latraux de la clavicule. E. Le petit pectoral fait partie du groupe mdial reliant le tronc la ceinture scapulaire. QCM 11 : A propos des muscles de lpaule A. Le petit rhombode se termine en dessous de lorigine de lpine. B. Les deux rhombodes (petit et grand) ont tous les 2 une mme direction en cranial, latral. C. Le muscle lvateur de la scapula se termine sur le bord latral de la scapula. D. Le trapze possde 3 faisceaux dont le faisceau moyen appel aussi faisceau scapulaire. E. Le trapze innerv par le nerf accessoire permet de rapprocher les 2 paules en approchant la scapula de la ligne mdiane. QCM 12 : A propos des muscles de lpaule A. Le trapze est innerv par une branche du plexus brachial. B. Le muscle lvateur de la scapula sinsre son origine par 4 tendons au niveau des processus pineux de la 1re vertbre cervicale la 4me vertbre cervicale. C. Un muscle est dit adducteur lorsque par exemple il permet de rapprocher la scapula du tronc, comme le trapze. D. Les muscles rhombodes sont innervs par le nerf dorsal de la scapula. E. Le trapze se contracte en synergie avec le muscle grand dentel.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

143

QCM 13 : Muscle de lpaule A. Le muscle sub-clavier et petit pectoral appartiennent au groupe ventral des muscles qui relient le tronc la ceinture scapulaire. B. Le muscle trapze est un muscle sous-cutan, cest le plus superficiel des muscles du groupe dorsal. C. En se contractant, le trapze approche la scapula de la ligne mdiane, il fait une adduction. D. Le muscle lvateur de la scapula est un muscle profond contrairement au muscle trapze qui est superficiel. E. Le petit rhombode sinsre au niveau des apophyses transverses de C7 T1, et au niveau des ligaments inter-pineux. QCM 14 : Muscle de lpaule A. Le petit rhombode se termine sur le bord spinal de la scapula en regard de lorigine de lpine. B. Le muscle lvateur de la scapula sinsre sur les tubercules ventraux des apophyses transverses de C1 C4. C. Lorsque le faisceau cranial du muscle trapze se contracte, il provoque une rotation latrale et un abaissement de la scapula. D. Le muscle trapze est constitu de 3 faisceaux : le faisceau cranial prend son origine sur le septum nucal. E. Au niveau de lpaule, il existe 7 muscles qui relient le tronc lhumrus. QCM 15 : Muscle de lpaule A. Les muscles de lpaule sont au nombre de 16. B. Le faisceau cranial du muscle trapze se termine au niveau de lacromion. C. Le muscle trapze se contracte en synergie avec le muscle grand rhombode. D. Le muscle lvateur de la scapula est oblique en latral et distal et se termine au niveau du bord spinal de la scapula, au dessus de lorigine de lpine. E. Le grand rhombode sinsre sur les apophyses pineuses de T1 T4 et sur les ligaments inter-pineux. QCM 16 : Muscle de lpaule A. Le grand dentel est un muscle du groupe dorsal qui relie le tronc la ceinture scapulaire. B. Le faisceau caudal du muscle trapze est aussi appel le faisceau pineux. C. Le trapze est innerv par le nerf accessoire. D. Quand il se contracte, il abaisse la scapula. E. Le petit et le grand rhombode ont des actions diffrentes : le grand rhombode fait de ladduction et de la rotation mdiale alors que le petit rhombode fait de labduction et de la rotation latrale. QCM 17 : Muscle de lpaule A. Le groupe dorsal des muscles qui relient le tronc la ceinture scapulaire est compos de 4 muscles. B. Le muscle trapze est innerv par le nerf dorsal de la scapula. C. Le trapze favorise les mouvements du bras car il stabilise la scapula contre la cage thoracique. D. Le muscle lvateur de la scapula fait de la rotation mdiale. E. Le muscle lvateur de la scapula, le petit rhombode et le grand rhombode sont innervs par une branche collatrale du plexus brachial : le nerf dorsal de la scapula.

Myologie du coude (10 QCM)


QCM 1 : A propos du coude A. Il y a trois muscles extenseurs et deux muscles flchisseurs au niveau du coude. B. Le biceps brachial est un flchisseur du coude. C. Lancon est un flchisseur du coude. D. Biceps brachial, brachial et bracho-radial forment le groupe flchisseur du coude. E. La rsultante de larticulation du coude est la flexion/extension.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

144

QCM 2 : A propos du biceps brachial A. Le biceps brachial a deux chefs. B. La longue portion du biceps brachial sinsert sur le tubercule infra-glnodien. C. Le tendon de la longue portion du biceps brachial a un trajet intra-capsulaire mais extra-synovial. D. La courte portion du biceps brachial prend son origine en latral du muscle coraco-brachial. E. Le biceps brachial est innerv par lanse des pectoraux. QCM 3 : A propos du brachial A. Le brachial prend son origine sur la moiti distale des faces ventro-mdiale et ventro-latrale de lhumrus ainsi que sur les septums intermusculaires mdiaux et latraux. B. Le brachial spare le biceps de lhumrus. C. Le brachial se termine par un tendon au niveau de la tubrosit radiale. D. Le brachial ralise de lextension du coude. E. Le brachial est perfor par le nerf musculo-cutan qui linnerve. QCM 4: A propos du brachio-radial A. Le brachio-radial longe la face mdiale du coude et de lavant-bras. B. Le brachio-radial prend son origine au tiers distal du bord latral de lhumrus et sur la partie suprieure de lpicondyle latral. C. Le tendon du brachio-radial nat la moiti distale de lavant-bras D. Le brachio-radial est le muscle de la position intermdiaire. E. Le tendon du brachio-radial dlimite en mdial la gouttire du pouls. QCM 5 : A propos du triceps A. Les trois chefs du triceps ont une fixation musculaire direct sans tendon. B. La longue portion du triceps prend son origine sur le tubercule supra-glnode. C. Le vaste latral du triceps prend son origine sur la face latrale de lhumrus. D. Le septum intermusculaire donne insertion aux vaste mdial et latral du triceps. E. Le tendon du triceps se termine sur la face dorsale et caudale de lolcrane. QCM 6 : A propos de la myologie du coude A. Le coude possde deux extenseurs et trois flchisseurs. B. Le biceps brachial possde deux chefs qui ont des origines et des terminaisons diffrentes C. La longue portion du biceps brachial est intra-articulaire mais extra-synoviale. D. La courte portion du biceps brachial stabilise la tte humrale. E. Le nerf musculocutann innerve deux muscles du coude. QCM 7 : A propos de la myologie du coude A. Le muscle anconn a son origine la face dorsale de lpicondyle mdial. B. La portion vaste latral du triceps a son origine en caudal du sillon du nerf radial. C. Le triceps se termine par un tendon la face dorsale et crniale de lolcrane. D. Le muscle brachial spare le biceps de lhumrus. Il est innerv par le nerf radial. E. Le muscle brachial se termine par un tendon au niveau de lapophyse coracode de lulna. QCM 8 : A propos de la myologie du coude A. La longue portion du biceps chemine dans le sillon intertubrositaire, tenu par le ligament transverse de lhumrus. B. Le muscle brachio radial se termine par un tendon la face latrale de la stylode radiale. C. Le tendon du brachio radial la partie distale du bras dlimite en latral la goutire du pouls, o passe lartre radiale. D. La longue portion du triceps a son origine sur la tubrosit supraglnodale. E. Le muscle anconn est triangulaire. Il est orient en latral et en distal.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

145

QCM 9: A propos de la myologie du coude A. Le muscle brachio radial a son origine au quart distal du bord latral de lhumrus, sur le septum intermusculaire latral et la partie suprieure de lpicondyle latral. B. Le triceps a une fixation musculaire directe par les corps charnus. C. Lanconn se termine sur lolcrne et le tiers suprieur du bord ventral de lulna. D. Les deux chefs du biceps brachial sont indpendants sur tout le trajet du muscle. E. Le muscle brachial est un extenseur du coude innerv par le nerf musculo-cutann. QCM 10 : A propos de la myologie du coude A. Dans son trajet, le biceps brachial est sous cutan. B. Le biceps brachial a sa terminaison donne une expansion aponvrotique aux muscles picondyliens mdiaux. C. Le nerf radial ne sert qua lextension. D. Aprs fusion des corps musculaires du triceps, la longue portion est plus profonde que le vaste latral et le vaste mdial. E. Lanconn ralise une extension minime du coude. Il est innerv par le nerf radial.

Myologie de lavant bras et du poignet (10 QCM)


QCM 1 : Myologie de lavant-bras et du poignet A. Le flchisseur radial du carpe a son origine situe sur lpicondyle mdial de lhumrus. B. Le long palmaire est un muscle inconstant. C. Le long extenseur radial du carpe se termine sur la face dorsale de la base du 3me mtacarpien. D. Le muscle extenseur ulnaire du carpe possde deux origines. E. Le nerf radial innerve les trois muscles extenseurs du poignet ; cest donc le nerf de lextension. QCM 2 : Myologie de lavant-bras et du poignet A. Lorigine du flchisseur radial du carpe se situe en latral par rapport celle du rond pronateur. B. Le flchisseur radial du carpe passe dans un ddoublement latral du rtinaculum des flchisseurs. C. Le long extenseur radial du carpe permet par sa contraction une extension du poignet et une inclinaison radiale. D. Le long palmaire est un muscle extenseur. E. Le flchisseur ulnaire du carpe se termine sur le pisiforme et sur le bord ulnaire de la main. QCM 3 : Myologie de lavant-bras et du poignet A. Le long palmaire est innerv par le nerf mdian comme le flchisseur radial du carpe. B. Le muscle extenseur ulnaire du carpe nat au niveau de lpicondyle mdial et sinsre aussi sur le bord dorsal de lulna. C. Le flchisseur radial du carpe permet de faire un mouvement de supination. D. Le flchisseur ulnaire du carpe possde deux chefs : un chef humral qui nat au niveau de lpicondyle mdial et un chef ulnaire qui nat au niveau de lolcrne et du bord dorsal de lulna. E. Le court extenseur radial du carpe se termine sur la face dorsale de la base du 2me mtacarpien. QCM 4: Myologie de lavant-bras et du poignet A. Le flchisseur ulnaire du carpe est innerv par le nerf mdian. B. Le long palmaire se termine au niveau du rtinaculum des extenseurs en se divisant au niveau du poignet en 4 bandelettes. C. Le court extenseur radial du carpe donne un tendon dans la partie distale de lavant bras qui passe dans le rtinaculum des extenseurs. D. Le muscle extenseur ulnaire du carpe stabilise larticulation radio-ulnaire proximale. E. Le long extenseur radial du carpe longe le bord latral de lavant-bras.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

146

QCM 5 : Myologie de lavant-bras et du poignet A. Le long palmaire permet la tension du rtinaculum des flchisseurs. B. Seul le nerf mdian permet de raliser une inclinaison radiale. C. Le long palmaire possde un corps musculaire large avec de trs courts tendons. D. Lextenseur ulnaire du carpe renforce le ligament collatral ulnaire du carpe. E. Le flchisseur ulnaire du carpe est innerv par le nerf ulnaire. QCM 6 : Muscles de lavant-bras A. Les muscles de lavant bras exercent deux types daction : la pronation et la supination. B. Le biceps brachial est le principal muscle de la supination. C. Le muscle carr pronateur sinsre sa terminaison sur le 1/3 distal du radius. D. Le muscle rond pronateur est innerv par le nerf mdian qui le perfore par la boutonnire du rond pronateur. E. Deux nerfs sont impliqus dans la pronation : le nerf ulnaire et le nerf radial. QCM 7 : Muscles de lavant-bras A. Les muscles de lavant-bras qui ont une action pronatrice sont le biceps brachial, le brachio-radial et le rond pronateur. B. Le faisceau superficiel du muscle supinateur se termine au niveau de la partie craniale du bord ventral du radius en dorsal de la terminaison du faisceau profond. C. Le muscle carr pronateur est innerv par une branche du nerf mdian : le nerf interosseux ventral. D. Le muscle rond pronateur est le principal muscle de la pronation. E. Deux nerfs sont impliqus dans la supination : le nerf radial et le nerf musculo-cutan. QCM 8 : Muscles de lavant-bras et du poignet A. Le muscle supinateur possde deux faisceaux entre lesquels passe la branche ventrale du nerf radial. B. Comme le muscle rond pronateur, le muscle supinateur est innerv par le nerf radial. C. Le muscle rond pronateur possde deux faisceaux : un faisceau humral le plus volumineux qui sinsre sur lpicondyle mdial et un faisceau coronodien qui sinsre sur lapophyse coronode. D. Les muscles picondyliens mdiaux ont une direction parallle au rond pronateur, de ce fait en plus de leurs fonctions principales, ces muscles seront plus ou moins pronateurs. E. Les muscles du poignet font de la flexion/extension ainsi que de linclinaison radiale/inclinaison ulnaire. QCM 9 : Muscles de lavant-bras et du poignet A. Le faisceau superficiel du muscle supinateur possde plusieurs origines : lpicondyle latral, le ligament collatral radial du coude et lulna. B. Le muscle carr pronateur sinsre son origine sur le distal de lulna. C. Le muscle rond pronateur est oblique en latral et en distal. D. Les muscles flchisseurs du poignet sont : le flchisseur radial du carpe, le long palmaire et le flchisseur ulnaire du carpe ; ils sont tous innervs par le nerf mdian. E. Les muscles extenseurs du poignet sont innervs par le nerf radial. QCM 10 : Muscles de lavant-bras et du poignet A. Le faisceau profond du muscle supinateur prend son origine au niveau de la crte supinatrice de lulna en ventral de lorigine du faisceau superficiel. B. Le muscle carr pronateur possde des fibres musculaires transversales. C. Le muscle rond pronateur se termine par un tendon sur le 1/3 moyen de la face mdiale du radius. D. Linclinaison ulnaire du poignet teste le nerf ulnaire par lintermdiaire du flchisseur ulnaire du carpe. E. Linclinaison radiale du carpe teste le nerf radial par lintermdiaire du muscle long extenseur radial du carpe.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

147

Myologie de la main et des doigts (15 QCM)


QCM 1 : A propos de la myologie de la main et des doigts A. Les muscles dits extrinsques sont reprsents par les muscles lombricaux et interosseux. B. Le faisceau humro-ulnaire du flchisseur superficiel des doigts est innerv par le nerf ulnaire. C. Le faisceau radial du flchisseur superficiel des doigts est innerv par le nerf radial. D. Les 2 faisceaux du flchisseur superficiel des doigts perforent le flchisseur profond des doigts. E. Le tendon du flchisseur superficiel des doigts passe l'extrieur du canal carpien. QCM 2 : A propos de la myologie de la main et des doigts A. Le flchisseur profond des doigts est innerv par deux nerfs. B. Le flchisseur profond des doigts a une action sur le poignet. C. Le tendon distal du flchisseur profond des doigts n'a une action que sur la premire phalange. D. Le rtinaculum des flchisseurs est considr comme une gaine osto-fibreuse. E. Les gaines synoviales empchent la propagation des infections tendineuses. QCM 3 : A propos de la myologie de la main et des doigts A. L'index ayant un extenseur propre, le tendon de l'extenseur commun des doigts a une action ngligeable sur ce doigt. B. Les muscles extenseurs des doigts (extrinsques) sont tous des picondyliens latraux. C. Tous les muscles extenseurs extrinsques des doigts sont innervs par le nerf radial. D. Une section haute de l'extenseur commun des doigts pourra tre objective notamment par un test sur l'extension de l'auriculaire. E. Les flchisseurs des doigts sont innervs par le nerf mdian alors que les extenseurs le sont par le nerf radial. QCM 4: A propos de la myologie de la main et des doigts A. L'extenseur commun des doigts se situe en latral de l'extenseur ulnaire du carpe. B. Les tendons distaux de l'extenseur commun des doigts possdent des anastomoses. C. L'extenseur propre de l'auriculaire est un picondylien latral. D. L'extenseur propre de l'index est un muscle intrinsque. E. Tous les muscles extenseurs passent dans le canal carpien. QCM 5 : A propos de la myologie de la main et des doigts A. Le nerf mdian est impliqu lors dune compression du canal carpien. B. Les gaines synoviales sont des gaines osto-fibreuses. C. Les gaines osto-fibreuses sont des poulies . D. Les gaines synoviales permettent au tendon de coulisser lors des mouvements. E. On parle de gaine digito-carpienne pour les gaines synoviales du pouce et de l'auriculaire. QCM 6 : A propos de la myologie de la main et des doigts A. Les muscles dits intrinsques sinsrent et se terminent tous au niveau de la main. B. Le flchisseur superficiel des doigts est plus profond que le rond pronateur et plus superficiel que le flchisseur ulnaire du carpe. C. Le flchisseur superficiel des doigts est innerv par les fibres de deux nerfs. D. Le flchisseur profond des doigts ne sinsre pas sur le radius. E. Le faisceau humro-ulnaire du flchisseur superficiel des doigts est innerv par le nerf mdian et se destine au majeur et lannulaire.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

148

QCM 7 : A propos de la myologie de la main et des doigts A. Les tendons terminaux du flchisseur superficiel des doigts sont dits perforants . B. Le flchisseur superficiel des doigts flchit dabord la 3me phalange, puis la 2me, etc C. Les deux flchisseurs des doigts longs sinsrent sur la membrane interosseuse. D. La portion du flchisseur profond des doigts innerve par le nerf ulnaire se destine lannulaire et lauriculaire. E. Des gaines osto-fibreuses maintiennent les tendons des muscles flchisseurs des doigts au contact des structures osseuses et favorisent leur glissement. QCM 8 : A propos de la myologie de la main et des doigts A. Les gaines synoviales du pouce et de lindex sont disposition digito-carpienne. B. Une plaie infecte au niveau de lindex peut entrainer des complications au niveau du canal carpien. C. Il y a trois muscles extenseurs au niveau des doigts longs. D. Les tendons de lextenseur commun des doigts possdent des interconnexions. E. Laction la plus importante de lextenseur commun des doigts se situe au niveau de la 3me phalange. QCM 9 : A propos de la myologie de la main et des doigts A. Lextenseur propre de lindex est le seul extenseur des doigts longs qui sinsre sur lulna. B. Lextenseur propre de lauriculaire se termine sur la face dorsale de la base de la 1re phalange. C. Les bandelettes latrales de lextenseur commun des doigts se terminent sur la 3me phalange. D. Lextenseur propre de lindex est le plus distal des quatre muscles qui sinsrent sur la face dorsale de lulna. E. Lextenseur propre de lindex se termine sur le tendon de lextenseur commun des doigts. QCM 10 : A propos de la myologie de la main et des doigts A. Il y a 8 tendons et un nerf qui passent dans le canal carpien. B. Des gaines synoviales permettent aux tendons des flchisseurs de rester plaqus contre les structures osseuses lors de mouvements de prhension. C. Le flchisseur profond des doigts sinsre sur les os du bras et de lavant bras. D. La 3me phalange des doigts longs nest flchie que par le flchisseur superficiel des doigts. E. Lextenseur commun des doigts possde trois terminaisons osseuses sur les doigts. QCM 11 : A propos de la myologie de la main et des doigts A. Les 1er et 2me interosseux dorsaux sont de type unipnn. B. Le 1er interosseux dorsal se situe dans le 2me espace interdigital. C. Le faisceau accessoire du 3me interosseux dorsal sinsre sur la face mdiale du 3me mtacarpien. D. Les interosseux ont 3 terminaisons : une osseuse, une ligamentaire, une fibreuse. E. Chaque dossire des interosseux est forme par un interosseux dorsal et un palmaire. QCM 12 : A propos de la myologie de la main et des doigts A. Les interosseux flchissent larticulation mtacarpo-phalangienne par le systme de la dossire. B. Les interosseux tendent la 3me phalange par leur terminaison ligamentaire sur lextenseur commun des doigts. C. La rsultante de laction des interosseux est la position intrinsque positive . D. Les muscles lombricaux sinsrent tous sur un ou plusieurs tendons terminaux du flchisseur superficiel des doigts. E. Les muscles lombricaux nont aucune terminaison osseuse directe. QCM 13 : A propos de la myologie de la main et des doigts A. Le nerf ulnaire ralise lextension des articulations inter-phalangiennes. B. Les interosseux ont un rle de transfert de force entre le systme extenseur et le systme flchisseur. C. Tous les lombricaux sont innervs par le nerf ulnaire. D. Les interosseux dorsaux ralisent labduction des doigts. E. Le muscle court extenseur du pouce est un muscle intrinsque. Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 149
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 14: A propos de la myologie de la main et des doigts A. Le tendon du long flchisseur du pouce passe dans le canal carpien. B. Les muscles de lminence thnar assurent en partie la motricit du pouce. C. Le muscle court flchisseur du pouce se termine sur la 2me phalange. D. Le long abducteur du pouce dlimite en latral la tabatire anatomique. E. Tous les muscles extrinsques du pouce sont innervs par le nerf radial. QCM 15 : A propos de la myologie de la main et des doigts A. Aucun muscle de lminence thnar ne se termine sur la 2me phalange. B. Les deux faisceaux de ladducteur du pouce sinsrent sur un mtacarpien. C. Tous les muscles de lminence hypothnar sont innervs par le nerf ulnaire. D. Le court flchisseur de lauriculaire a la mme origine que lopposant de lauriculaire, et la mme terminaison que labducteur de lauriculaire. E. On peut assister une perte de relief de lminence hypothnar en cas de syndrome du canal carpien.

Ostologie du membre pelvien (8 QCM)


QCM 1 : Concernant lostologie de los coxal A. Los coxal, os plat en forme dhlice deux ples, est form de trois parties : lilium, lischium et le pubis. A la jonction de ces trois parties, on trouve lactabulum. B. Los coxal est constitu dune partie suprieure : laile iliaque, oblique en ventral et mdial, et dune partie infrieure ischio-pubienne, oblique en ventral et latral. C. La face latrale de los coxal est constitue de trois parties : une moyenne o lon trouve lactabulum, une supra-actabulaire et une infra-actabulaire galement appele face glutale. D. Lactabulum est une excavation sphrode, oriente en caudal-ventral-latral et dont le limbus actabulaire est interrompu en cranial par incisure actabulaire. E. Lactabulum prsente une surface articulaire semi-lunaire avec deux cornes, une ventrale et une dorsale. Au centre, la fosse articulaire actabulaire permet la fixation du ligament de la tte. QCM 2 : Concernant lostologie de los coxal A. La face glutale prsente trois lignes glutales, convexes en caudal et ventral. B. La ligne glutale dorsale nat au niveau du tubercule iliaque alors que la ligne glutale ventrale nat 5cm en avant de lpine iliaque dorso-craniale. Elle se termine toutes les deux au niveau de la grande incisure ischiatique. C. Le pourtour du foramen obtur est limit en ventral par le pubis, en dorsal par lilium et en caudal par la branche ischio-pubienne. D. La tubrosit ischiatique se situe sur la face latrale du corps de lischium. E. On trouve la crte pubienne et le tubercule pubien sur la face latrale du corps du pubis. QCM 3 : Concernant lostologie de los coxal A. La face mdiale de los coxal est divise en deux par une crte oblique en ventral et caudal : la ligne arque. B. En cranial de la ligne arque, la fosse iliaque regarde en dorsal, cranial et mdial. C. En dorsal de la ligne arque, on trouve la surface auriculaire, en forme de croissant concave en dorsocranial. D. On trouve en cranial du foramen obtur : la surface quadrilatre et en caudal du foramen obtur : la surface mdiale du corps du pubis ainsi que la surface mdiale de la branche ischio-pubienne. E. Le bord cranial de los coxal comprend la crte iliaque qui a la forme dun S italique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

150

QCM 4: Concernant lostologie de los coxal A. On trouve, entre autres, au niveau du bord ventral de los coxal : les deux pines ventrales craniale et caudale, lminence ilio-pubienne, lpine ischiatique et les petite et grande incisures ischiatiques. B. Le bord dorsal de los coxal prsente une surface symphysaire ovalaire, qui sarticule avec la surface contro-latrale pour former la symphyse pubienne. C. Les pines iliaques ventro-craniale et dorso-craniale reprsentent deux des quatre angles de los coxal, les deux autres angles tant forms par langle du pubis et la tubrosit ischiatique. D. Le foramen obtur est circonscrit par le pubis et lischium. Il est ferm par la membrane obturatrice. E. Le foramen obtur prsente une forme triangulaire chez la femme et ovalaire chez lhomme. QCM 5 : Concernant lostologie du fmur A. Le fmur est un os long qui sarticule en proximal avec los coxal et en distal avec le tibia et la patella. B. Le fmur prsente un corps triangulaire la coupe et une courbure sagittale incurve en ventral. C. Le fmur prsente trois faces : une ventro-mdiale, une ventro-latral et une dorsale. D. Le fmur prsente trois bords : un latral, un mdial et un dorsal o se trouve la ligne pre qui est faite de deux lvres (mdiane et latrale) qui bifurquent en distal o elles dlimitent la surface poplite. E. En proximal, la ligne pre trifurque : la ligne spirale prolongeant la lvre latrale, la ligne pectine rejoignant le petit trochanter et la tubrosit glutale prolongeant la lvre mdiane. QCM 6 : Concernant lostologie du fmur A. La tte fmorale est un 1/3 de sphre denviron 25mm de rayon, oriente en cranial, mdial et ventral. B. Dans le quadrant dorso-caudal de la tte fmorale se situe une dpression recouverte de cartilage permettant linsertion du ligament de la tte fmorale : la fovea capitis. C. Le col fmoral permet la fixation de la capsule. D. Le fmur prsente deux angles remarquables : langle dinclinaison =15 30 et langle dantversion =125 130. E. Le col fmoral prsente sur sa face dorsale la gouttire du muscle obturateur externe et est limit en caudal par la crte intertrochantrique. QCM 7 : Concernant lostologie du fmur A. Le grand trochanter, dveloppement dorso-latral, prsente sur sa face mdiale la fosse trochantrique avec la fossette digitiforme. B. Le petit trochanter est situ en dorsal, mdial et caudal. C. Lpiphyse distale prsente deux condyles : un mdial et un latral, spars en ventral par la fosse intercondylaire. D. Au niveau de lpiphyse distale, le condyle mdial est plus troit que le latral. E. Le condyle mdial est plus bas que le condyle latral. QCM 8 : Concernant lostologie du fmur et de la patella A. Le tubercule du grand adducteur se situe au-dessus de lpicondyle mdial du fmur. B. Lpiphyse proximale du fmur est constitue dos compact et dos spongieux. C. La patella, os ssamode et aplatie, est triangulaire base infrieure. D. La patella prsente deux faces : une face ventrale qui est convexe et sous-cutane et une face dorsale articulaire. E. La face dorsale de patella prsente une crte mousse la divisant en deux facettes : une mdiale plus large que la latrale.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

151

Arthrologie de la hanche (10 QCM)

QCM 1 : Articulation de la hanche A. Lactabulum est une surface creuse possdant une ouverture angulaire de 240. B. Lorientation de lactabulum se fait en dorsal, latral et caudal. C. La tte du fmur a une forme de sphre avec une ouverture angulaire de 240. D. Le seul moyen dunion existant au niveau de cette articulation est reprsent par les ligaments. E. Le labrum est une formation triangulaire la coupe et uniquement fibreuse. QCM 2 : Articulation de la hanche A. Cette articulation est solide, stable, mobile et de type narthrose. B. Cest dans le cadrant antro-caudal de la tte fmorale que se situe la fova capitis donnant insertion au ligament de la tte fmorale. C. Le labrum possde 3 faces, linterne et la mdiale sont recouvertes de cartilage tandis que la priphrique ne lest pas car faisant face a la capsule. D. Il existe en tout 4 ligaments ; 3 sont extracapsulaires : il sagit de lischio-fmoral, du pubo-fmoral tous deux ventraux et de lilio-fmoral qui est lui dorsal. Le dernier ligament est intracapsulaire, cest le ligament de la tte fmorale qui a son origine dans la fova capitis et qui se termine par 3 languettes. E. Le ligament de la tte fmorale est peu ou pas tendu. QCM 3 : Articulation de la hanche A. Il existe un labrum fibro-cartilagineux augmentant ainsi la congruence de larticulation. B. La capsule en ventral recouvre la tte et le col, elle sinsre sur la ligne intertrochantrienne, le limbus, le ligament transverse et le labrum. C. En dorsal la capsule ne recouvre que le 1/3 mdial du col, en effet son insertion se fait au niveau de la lvre mdiale de la gouttire du muscle obturateur interne. D. La synoviale tapisse lintrieur de la cavit articulaire sauf les endroits ou se trouve le cartilage, elle scrte le liquide synovial qui est un lubrifiant. E. Langle dinclinaison de la tte et du col par rapport lhorizontale est de 125. QCM 4: Articulation de la hanche A. Une usure de cette articulation donne la coxarthrose. B. La capsule est paisse, elle possde des fibres longitudinales, circulaires et rcurrentes. C. Les fibres rcurrentes ou freins de la capsule maintiennent la capsule en tension quelque soit la position de la hanche. D. Le ligament de la tte fmorale est extracapsulaire. E. Les 2 ligaments extracapsulaires dorsaux forment un plan de renforcement en Z de la capsule. QCM 5 : Articulation de la hanche A. La tte fmorale a un rayon de 25 mm environ soit un diamtre de 40 60 cm environ. B. Certaines fibres circulaires de la capsule se concentrent dans la partie moyenne de la capsule pour y former la zone orbiculaire. C. Le ligament ilio-fmoral possde 2 faisceaux se terminant tous deux sur la ligne intertrochantrienne. D. Les mouvements entrainant une meilleure stabilit sont lextension, labduction et la rotation mdiale. E. La flexion peut monter jusqu 120 maximum lorsquelle est active.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

152

QCM 6 : A propos de larticulation de la hanche A. Cette articulation est solide, stable et mobile. B. Elle se dtriore au cours du temps, son usure est appele coxarthrose. C. Cest une articulation sphrode 3 degrs de libert. D. Le bourrelet actabulaire ou labrum sinterpose entre lactabulum et la tte fmorale. E. Lactabulum est une demie sphre creuse entirement recouverte de cartilage. QCM 7 : A propos de larticulation de la hanche A. Lactabulum a une orientation ventrale-latrale-caudale. B. La tte fmorale regarde en cranial, mdial et dorsal. C. Le limbus est triangulaire la coupe. D. La capsule sinsre en ventral sur la ligne inter-trochantrienne du fmur. E. La tte fmorale correspond une demi-sphre denvirons 25 mm de diamtre. QCM 8 : A propos de larticulation de la hanche A. Le labrum, triangulaire la coupe une forme danneau incomplet. B. Le ligament de la tte fmorale est intra-capsulaire mais extra synovial. C. Les ligaments ilio-fmoral et pubo-fmoral sont ventraux et le ligament ischio-fmoral est dorsal. D. Le ligament pubo-fmoral un trajet quasi horizontal. E. Le ligament de la tte fmorale est aplati de cranial caudal et prend son origine dans la fova capitis. QCM 9 : A propos de larticulation de la hanche A. Le ligament de la tte fmorale a peu de rle sur le maintient de la tte fmorale dans lactabulum. B. Un angle dinclinaison suprieur 125 correspond une coxa vara. C. La congruence maximale de cette articulation ncessite une rotation mdiale de la tte fmorale. D. Les pressions ngatives lintrieur de cette articulation augmentent sa stabilit. E. La flexion de 15 suffit pour marcher sur un sol plat. QCM 10 : A propos de larticulation de la hanche A. Labduction est limite par un contact osseux entre le col et le limbus. B. La rotation mdiale peut aller jusqu 60, elle augmente la stabilit de la hanche. C. Le ligament de la tte fmorale est dtendu lors de labduction. D. Une coxa valga allonge dun cot le fmur et entraine une boiterie. E. La rotation latrale est une position dinstabilit.

Arthrologie du genou (10 QCM)

QCM 1 : A propos de l'articulation du genou A. Elle est renforce par deux plans, un dorsal et un ventral qui bloquent et renforcent le genou en extension. B. En ventral, les expansions directes et croises des muscles vastes, le tendon quadricipital et le rtinaculum patellaire renforcent l'articulation. C. En dorsal, les coques condylaires, le muscle poplit, les ligaments patellaire, poplit arqu et poplit oblique renforcent le genou et le stabilisent. D. Les ligaments collatraux stabilisent le genou dans un plan frontal. E. L'axe du fmur, dsax de 9 par rapport l'horizontale, induit une angulation physiologique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

153

QCM 2 : Concernant la stabilit du genou A. La stabilit sagittale en flexion est assure par les ligaments croiss, tendus en flexion et relchs en extension. B. La stabilit sagittale autorise des mouvements de rotation en flexion. C. La patella se luxe le plus souvent en latral du fait de la force de traction du quadriceps: le rtinaculum patellaire, entre autre, tend viter cette tendance. D. Les condyles fmoraux roulent sur les glnes tibiales de ventral dorsal durant les 40 premiers degrs puis glissent de ventral dorsal de 40 120 . E. La monte des escaliers sollicite la fois les mouvements de roulement et de glissement alors que la marche implique un mouvement de roulement pur. QCM 3 : A propos des mouvements de l'articulation du genou A. Lors de la flexion, le mnisque latral se dplace vers l'arrire, comme lors de la rotation latrale. B. Il existe une rotation latrale automatique lors de l'extension de la jambe en position assise: elle est due la configuration diffrente des deux glnes tibiales mdiale et latrale. C. Lors de la rotation volontaire, les mnisques latral et mdial effectuent des dplacements contraires. D. Les mouvements de flexion-extension s'effectuent dans un plan horizontal qui passe par l'picondyle mdial et la tubrosit latrale. E. On peut observer une extension de -10 -15 c'est ce que lon appelle un rcurvatum pathologique. QCM 4: Gnralits sur l'articulation du genou A. Le ligament collatral tibial est un ligament extracapsulaire. B. Le ligament transverse du genou unit les cornes dorsales des deux mnisques. C. Un mouvement de tiroir antrieur traduit une lsion du ligament collatral tibial. D. On parle de genu valgum quand l'angle qui caractrise le valgus physiologique du genou est infrieur 175. E. La patella effectue lors de la flexion du genou un mouvement de translation circonfrentielle. QCM 5 : Gnralits sur l'articulation du genou A. Le ligament crois antrieur se situe prs de la corne ventrale du mnisque mdial son origine. B. Le rayon de courbure des condyles fmoraux crot de dorsal ventral. C. La berge mdiale de la surface patellaire est plus large que la berge latrale. D. La rotation latrale volontaire largit le polygone de sustentation qui dfinit la surface comprise entre les deux pieds au sol. E. Lors de la flexion, les ligaments collatraux se dtendent et permettent ainsi le roulement puis le glissement des condyles fmoraux. QCM 6 : A propos de l'articulation du genou A. Elle associe deux articulations, fmoro-tibiale et fmoro-patellaire, donc deux systmes capsulaires et ligamentaires. B. Elle prsente une grande mobilit, compare l'articulation de la hanche mais galement une grande fragilit, due la faible congruence des surfaces articulaires. C. Les deux articulations du genou, possdent chacune un seul degrs de libert. D. Les condyles fmoraux s'articulent en avant avec la patella, en arrire portent l'insertion des ligaments croiss et leurs pourtours s'articulent avec les plateaux fibullaires. E. En flexion extrme du genou, la face postrieure de la patella vient s'articuler avec les pourtours condylaires.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

154

QCM 7 : Concernant les surfaces articulaires du genou A. Les condyles fmoraux ont une orientation particulire : ils convergent vers lavant. B. La tubrosit tibiale est rendue saillante par la djection en avant des deux cartilages tibiaux, d'un angle de 15. C. La configuration des deux condyles tibiaux est diffrente horizontalement, le condyle mdial tant concave alors que le latral est convexe. D. Il existe au niveau de cette articulation, des fibro-cartilages articulaires. E. Le mnisque mdial, en forme de C insre ses cornes prs de l'minence intercondylaire. QCM 8 : A propos de l'articulation du genou A. Les mnisques s'insrent sur le tibia par leurs cornes et leur corps, leur face priphrique s'insre sur la capsule, et leur bord libre est souvent le sige de fractures. B. La capsule articulaire fait dfaut au niveau de la face dorsale de la patella. C. La capsule s'paissit en dorsal et forme les coques condylaires qui participent au renforcement dorsal de l'articulation. D. Les ligaments croiss sont extra-capsulaires puisque la capsule s'insre prs des glnes tibiales. E. La synoviale forme en dorsal de la patella et en avant du tendon quadricipital la bourse suprapatellaire, cul de sac o se collecte du liquide synovial en cas d'hydrarthrose. QCM 9: Concernant les ligaments du genou A. On trouve des ligaments intra-capsulaires et extra-capsulaires, mais ils sont tous extra-synoviaux. B. Le ligament collatral tibial, extra-capsulaire, adhre totalement la capsule alors que son homologue fibulaire, s'en spare par le passage du muscle poplit. C. Le ligament collatral fibulaire est oblique en dorsal et caudal, il est donc parallle au ligament crois antrieur, et crois avec le ligament collatral tibial. D. La fibula participe de faon active au systme articulaire du genou non seulement par le ligament collatral fibulaire mais galement par le ligament poplit oblique, tendon rcurrent du muscle semimembraneux. E. Le ligament collatral tibial se termine dans la rgion mtaphysaire du tibia alors que le ligament collatral fibulaire se termine dans la rgion piphysaire de la fibula. QCM 10 : A propos des ligaments intra-capsulaires du genou A. Au nombre de deux, ils sont logs dans la fosse inter-condylaire; ils se croisent entre eux mais chacun est parallle un des ligaments collatraux extra-capsulaires. B. Le ligament crois antro-externe se dirige en dorsal et latral pour se terminer sur la face latrale du condyle mdial. C. Le ligament crois postro-interne possde un trajet plus horizontal, en ventral, cranial et mdial. D. Ils sparent le genou en deux compartiments, dorsal et ventral qui ne communiquent qu'en ventral, au niveau de la surface patellaire. E. Ils assurent la stabilit sagittale du genou en extension.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

155

Arthrologie de la cheville et du pied (19 QCM)


QCM 1 : A propos des moyens d'union de l'articulation talo-crurale A. La capsule est un moyen d'union peu important de cette articulation, car elle est peu rsistante. B. La capsule s'insre sur le talus au niveau des bords cartilagineux de la trochle, sauf en dorsal o elle s'insre sur le col. C. La capsule est tapisse l'extrieur par 2 groupes de ligaments : un groupe latral et un groupe mdial qui comprend le ligament deltode. D. Le deltode a une forme triangulaire dont le sommet rpond la mallole fibulaire. E. La base du ligament deltode concerne l'os naviculaire, le talus et le cuniforme mdial. QCM 2 : A propos de l'appareil ligamentaire de l'articulation talo-crurale A. Le ligament deltode a une forme de triangle sommet crnial et base caudale. B. Le plan superficiel du ligament deltode est constitu de 2 ligaments : le talo-naviculaire et le tibiotalaire. C. Les 2 ligaments du plan profond du deltode prennent leur origine sur la mallole tibiale. D. Le ligament tibio-talaire ventral se termine au niveau du col du talus, alors que le tibio-talaire dorsal se termine au niveau du corps du talus. E. Le deltode est trs rsistant et n'adhre pas la capsule. QCM 3 : A propos de l'appareil ligamentaire de l'articulation talo-crurale A. De par son paisseur, le ligament deltode permet de rpondre aux sollicitations en distension sur la partie mdiale de la cheville. B. Au niveau de la cheville, le plan ligamentaire mdial est accessoire, contrairement au plan latral. C. Les 3 principaux ligaments latraux sont le talo-fibulaires dorsal, le talo-fibulaire ventral et le calcano-talaire. D. Le ligament talo-fibulaire ventral s'insre au niveau de l'apex de la mallole fibulaire, alors que le dorsal nait au niveau de la fosse mallolaire. E. Le ligament calcano-fibulaire est le seul des 3 principaux ligaments latraux ne pas se terminer sur le talus. QCM 4: A propos des ligaments latraux de l'articulation talo-crurale A. Ils ont leur origine sur le mme os, mais se terminent sur des os diffrents : le calcanus ou le talus. B. Le ligament talo-fibulaire ventral se termine au niveau du col du talus, alors que le dorsal se termine sur la tubrosit latrale du corps du talus. C. Le ligament calcano-fibulaire a un trajet transversal, tout comme le ligament talo-fibulaire dorsal. D. Le ligament talo-fibulaire dorsal est globalement parallle au ligament tibio-fibulaire dorsal et renforce, en dorsal, la capsule articulaire. E. Les ligaments mdiaux tant plus rsistants que les ligaments latraux, la plupart des entorses sont dues leur dchirement. QCM 5 : Anatomie fonctionnelle de l'articulation talo-crurale A. La stabilit de l'articulation est assure par l'encadrement du talus par la mortaise, ainsi que par les ligaments, surtout les ligaments latraux. B. La bute du talus sur la mortaise tibio-fibulaire assure la stabilit sagittale de l'articulation. C. Pour permettre la marche, le bord ventral de la mortaise est plus bas que le bord dorsal. D. Le valgus de la cheville augmente la tension du deltode et amne la tubrosit du calcanus en dedans. E. La flexion dorsale est plus limite que la plantaire, cause du contact entre la plus grande largeur de la poulie du talus et de la plus petite largeur de la mortaise.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

156

QCM 6 : A propos de larticulation tibio-fibulaire proximale A. Cest une articulation synoviale plane. B. Elle ne communique jamais avec la cavit articulaire du genou. C. Lpiphyse proximale de la fibula ne participe pas larticulation du genou, cest une articulation part. D. Elle permet des mouvements de glissement vertical avec une amplitude importante. E. La membrane inter-osseuse a des fibres obliques en mdial et caudal : elle permet le maintien des pices osseuses et cest une zone dinsertion musculaire importante. QCM 7 : A propos de larticulation tibio-fibulaire distale A. Cest une syndesmose : elle ne prsente pas de mobilit relle. B. Comme larticulation tibio-fibulaire proximale, elle prsente une membrane synoviale et une capsule articulaire. C. Le ligament tibio-fibulaire ventral va de la mallole tibiale la mallole fibulaire D. Le ligament inter-osseux participe la formation de la mortaise tibio-fibulaire. E. Elle unit lincisure fibulaire du tibia avec la surface articulaire correspondante de la fibula. QCM 8 : A propos de larticulation talo-crurale A. Cest une articulation 1 degr de libert qui permet les mouvements de rotation mdiale et latrale. B. Elle est de type gynglime. C. Le pilon tibial participe cette articulation. D. La syndesmose tibio-fibulaire appartient cette articulation. E. La facette articulaire tibiale se prolonge sur la mallole tibiale par la facette mallolaire. QCM 9: A propos de larticulation talo-crurale A. La zone craniale de la mallole fibulaire rentre en contact avec lincisure fibulaire du tibia : elle appartient larticulation tibio-fibulaire distale et non pas larticulation talo-crurale. B. La fosse mallolaire de la fibula est situe en ventral de la surface articulaire mallolaire. C. La surface articulaire mallolaire de la fibula participe la formation de la mortaise tibio-fibulaire. D. La mortaise est plus large en dorsal quen ventral. E. Laxe qui passe par les deux malloles fait un angle de 20 avec le plan frontal. QCM 10 : A propos de la mortaise tibio-fibulaire et du tenon du talus A. La mallole latrale est la plus dorsale, la plus grosse et cest celle qui descend le moins bas. B. Le bord dorsal de la surface articulaire tibiale descend plus bas que le bord ventral. C. La face mdiale du talus sappelle la trochle talaire. D. La facette articulaire latrale du talus rpond la mallole tibiale. E. La surface articulaire craniale du talus prsente une gorge, la sparant en deux berges, qui lui permet de sarticuler avec la crte de la surface articulaire tibiale caudale. QCM 11 : Concernant larticulation sub-talaire A. Cette articulation est un modle articulaire particulier : une double trochode inverse. B. La surface talaire ventrale est convexe en cranial et rpond la surface calcanenne ventrale. C. Le ligament interosseux est oblique en ventral et latral. D. Cette articulation effectue de la flexion et de lextension autour dun axe transversal. E. Le ligament interosseux est le seul lment de stabilit de cette articulation. QCM 12 : Concernant larticulation transverse du tarse A. Larticulation talo-calcano-naviculaire est une articulation en selle. B. Cette articulation effectue des mouvements de rotation interne de 50 C. C. Linversion associe en gnral un mouvement dadduction, une rotation mdiale et une flexion plantaire. D. Larticulation transverse du tarse est indissociable de la sub-talaire et confre au pied une dynamique globale. E. Le ligament calcano-naviculaire plantaire est recouvert de cartilage sur sa face infrieure. Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) 157
Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 13 : Concernant les articulations du Tarse distal et les articulations tarso-mtatarsiennes A. Larticulation du tarse distal ne comprend que des synoviales planes. B. Les articulations inter-cuniformes gnrent peu de mouvements. C. Les articulations tarso-mtatarsiennes forment une ligne brise appele : ligne de LisFranc qui correspond une zone damputation. D. Le 1er mtatarsien sarticule avec le cuniforme mdial, le cuniforme intermdiaire et avec le 2me mtatarsien. E. Le 2me mtatarsien sarticule avec 5 os diffrents. QCM 14: Concernant les articulations inter phalangiennes et mtatarso-phalangiennes A. Les articulations mtatarso-phalangiennes sont des ginglymes et les articulations inter phalangiennes des ellipsodes. B. Les articulations inter phalangiennes neffectuent que des mouvements de flexion. C. Les articulations inter phalangiennes proximales effectuent une flexion denviron 45. D. Les articulations mtatarso-phalangiennes et inter phalangiennes prsentent une capsule, une synoviale et des ligaments collatraux comme lments de stabilit. E. Les articulations mtatarso-phalangiennes effectuent une extension denviron 50, dont lamplitude augmente du 5me au 1er orteil. QCM 15 : Concernant larthrologie du membre pelvien A. Les articulations du Tarse possdent toutes du cartilage. B. Il existe 3 syndesmoses dans le membre pelvien dont 2 au niveau du pied. C. Au niveau des articulations mtatarso-phalangiennes, cest la tte du mtatarsien qui porte la cavit glnode. D. Larticulation sub-talaire effectue une abduction de 20 et une adduction de 30. E. Les mtatarsiens 4 et 5 sarticulent tous deux avec le cuniforme mdial. QCM 16 : Concernant les articulations du pied A. Larticulation calcano-cubodienne est une articulation en selle. B. Larticulation sub-talaire est une double trochode inverse. C. Larticulation cubodo-naviculaire est une synoviale plane. D. Les articulations mtatarso-phalangiennes sont des ellipsodes. E. Les articulations inter phalangiennes sont des synoviales planes. QCM 17 : Concernant les articulations du pied A. Larticulation sub-talaire prsente une abduction et une adduction dont lamplitude globale avoisine les 35. B. Larticulation transverse du Tarse prsente une rotation externe de 50. C. La flexion des articulations mtatarso-phalangiennes est de 50. D. Le valgus du pied est de 25. E. Les articulations inter phalangiennes prsentent toutes une amplitude globale de 90. QCM 18 : Concernant les articulations du pied A. Ces articulations possdent toutes du cartilage. B. Linversion est facilite par la flexion plantaire. C. Lversion porte la pointe du pied vers lextrieur. D. La ligne brise de Lisfranc correspond larticulation mtatarso-phalangienne. E. Les articulations inter phalangiennes ne possdent jamais dextension.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

158

QCM 19 : Concernant les articulations du pied A. Le ligament bifurqu sinsre sur la face plantaire du calcanus, du cubode et du naviculaire. B. Le ligament calcano-naviculaire plantaire sinsre entre la face dorsale du naviculaire et la face ventrale du calcanus. C. La surface articulaire entre larticulation talo-calcano-naviculaire et larticulation calcanocuboidienne est appele interligne de Chopart D. Le ligament glnodien augmente la surface articulaire de la cavit rceptrice de larticulation talocalcano-naviculaire. E. Les articulations des os du tarse sont toutes des synoviales planes.

Ostologie des vertbres (12 QCM)

QCM 1 : A propos des vertbres A. Il existe 32 34 vertbres formant la colonne dite mobile. B. Les courbures physiologiques de la colonne vertbrale sont des courbures sagittales. C. La vertbre type est reprsente par atlas ou C1. D. Le processus pineux nat de la jonction des 2 lames dans la vertbre type. E. Le processus transverse nat de la jonction pdicule lame dans la vertbre type. QCM 2 : A propos des vertbres cervicales types A. Le foramen vertbral est petit et triangulaire. B. Le foramen vertbral est triangulaire et base dorsale. C. Les pdicules, courts, sont implants la partie postro-latrale du corps. D. Le processus pineux est court, horizontal et bitubercul. E. Les processus articulaires suprieurs regardent en haut et en arrire. QCM 3 : A propos de l'atlas A. La face suprieure des masses latrales s'articule avec le condyle occipital. B. La face latrale des masses latrales prsente le tubercule du ligament transverse. C. L'arc antrieur prsente, en arrire, la surface articulaire de la dent de l'axis. D. Le sillon de l'artre vertbrale est retrouv sur l'arc postrieur. E. Le foramen vertbral est divis par le ligament transverse en deux espaces, l'espace postrieur comprendra la dent de l'axis. QCM 4: A propos des vertbres thoraciques A. T11 et T12 n'ont que 2 fossettes costales. B. Leur corps vertbral est rniforme. C. Leur plateau suprieur porte les surfaces semi-lunaires. D. Les processus articulaires suprieurs regardent en haut et en arrire. E. T1 porte les fossettes costales pour la 1re cte. QCM 5 : A propos des vertbres thoraciques A. Le processus pineux est pais et horizontal. B. Elles s'articulent toutes avec les ctes. C. Le foramen vertbral est circulaire. D. T12 repose sur le sacrum et a tendance glisser vers l'avant. E. T1, T10, T11 et T12 s'cartent de la vertbre thoracique type.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

159

QCM 6 : A propos des vertbres A. Le corps humain compte en moyenne 32 34 vertbres. B. La cyphose cervicale est concave en dorsal. C. Les plateaux vertbraux ne sont pas recouverts de cartilage. D. Le foramen inter vertbral laisse passer la moelle pinire. E. Le processus transverse est retrouv la runion des lames. QCM 7 : A propos des vertbres cervicales A. Les processus semi-lunaires sinsrent dans les encoches de la vertbre sous-jacente. B. Le foramen vertbral est de forme triangulaire pour les vertbres type. C. Latlas est travers par les artres intervertbrales au niveau des racines des processus transverses. D. Le corps de latlas sarticule avec los occipital. E. Le processus pineux des vertbres cervicales type est uni-tubercul. QCM 8 : A propos des vertbres cervicales A. Les masses latrales de C1 portent un processus transverse uni-tubercul. B. Le tubercule du ligament transverse est port par la face mdiale des masses latrales. C. La dent sarticule avec des structures ligamentaires recouvertes de cartilage. D. Le processus articulaire caudal et le processus articulaire crnial de laxis sont dans un mme plan sagittal. E. Le tubercule ventral du processus transverse de C7 est appel tubercule carotidien. QCM 9 : A propos des vertbres thoraciques A. La fossette articulaire costale crniale regarde en crnial et latral. B. Une cte sarticule deux fois avec les vertbres. C. Le processus pineux est long et oblique en caudal et dorsal. D. Une vertbre thoracique type possde en tout 4 fossettes articulaires costales. E. Les processus articulaires sont verticaliss dans un plan sagittal. QCM 10 : A propos des vertbres thoraciques A. Le foramen vertbral est triangulaire. B. Les processus transverses sont dans un plan frontal. C. La premire cte ne sarticule quavec T1. D. Les ctes flottantes (11me et 12me) ne sarticulent quune seule fois avec la colonne vertbrale. E. Lincisure vertbrale crniale est trs marque. QCM 11 : A propos des vertbres Lombaires. A. Les vertbres lombaires, au nombre de 5, prsentent toutes un corps volumineux et rniforme. B. En raison de la lordose lombaire, on observe une direction en bas et en arrire des processus pineux. C. Les processus transverses sont volumineux et comparables des cotes atrophies. D. Les processus articulaires sont situs dans un plan sagittal, le crnial regardant en latral et le caudal en mdial. E. Le foramen vertbral est volumineux et circulaire QCM 12 : Les vertbres lombaires. A. Le sacrum, fortement inclin en bas et en avant provoquerait un glissement de L5 si les processus articulaires crniaux de cette dernire, situs dans un plan frontal ne crochetaient pas les processus articulaires de S1. B. La ponction lombaire est ralisable dans cette zone en raison de lorientation des processus pineux. C. Du fait de la morphologie massive et trapue des vertbres qui le compose, le segment rachidien lombaire prsente peu de mobilit. D. Les processus transverses ou processus costiformes prsentent des surfaces articulaires avec les cotes. E. Larc neural prsente des pdicules et des lames volumineuses peu chancres.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

160

CORRECTION
Gnralits sur lanatomie, ce quil fallait rpondre
QCM 1 : ABD C. Pas de limite nette. E. Le tronc est constitu du thorax, de labdomen et du pelvis. QCM 2 : ACDE B. Cest linverse : le plan sagittal mdian est unique, les plans sagittaux paramdians sont tous les plans qui lui sont parallles. QCM 3 : ACD B. Deux moitis : antrieure et postrieure. E. Le diaphragme spare labdomen du thorax. Le reste de la proposition est vraie.

Gnralits sur larthrologie, la myologie et lostologie, ce quil fallait rpondre


QCM 1 : AC B. La tte se diffrencie du condyle par la prsence d'un col. L'articulation temporo-mandibulaire est une exception puisque le condyle prsente un col. D. Le prioste est absent du cartilage de conjugaison pendant la croissance et le cartilage s'insre aussi au niveau des mtaphyses o il constitue ce cartilage de conjugaison. E. Les trabecules du tissu SPONGIEUX........... QCM 2 : CDE A. A partir du 2 MOIS de vie intra-utrine....... B. Les cartilages de conjugaison les plus fertiles se situent prs du genou et loin du coude donc c'est l'extrmit distale du fmur (prs de la patella) et l'extrmit proximale de l'humrus (loin du coude) qui seront les plus fertiles. QCM 3 : E A. L'articulation fmoro-patellaire est bien une ginglyme mais ginglyme est synonyme de trochle et non de trochode. B. La mortaise talo-crurale appartient aux articulations synoviales car elle possde une capsule des ligaments etc.....les articulations sont qualifies de synoviales lorsqu'elles rpondent entre autre ces critres et ensuite sont divises en 3 groupe selon leur degrs de mobilit; le "mais" n'est pas justifi ici. C. Les ligaments intrinsques peuvent tre intra ou extra capsulaires mais sont toujours extra synoviaux D. L'articulation du genou est une articulation synoviale et le disque articulaire n'est pas synonyme de disque d'interposition, fibro-cartilagneux, retrouv dans les amphiarthroses QCM 4 : BE A. Le myocarde est un muscle stri mais non squelettique. il est en effet involontaire car dou d'un automatisme propre, rgul par le systme nerveux vgtatif. C. Un muscle multifide possde plusieurs corps musculaires en parallle alors qu'un muscle multipenns comme le deltode possde plusieurs faisceaux de fibres convergents vers un seul tendon. D. La loi de WEBER et FICK rend compte de la relation entre la longueur des fibres et la possibilit de dplacement mais c'est la loi de STRESSER qui explique la proportionnalit entre le volume du muscle et sa puissance.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

161

QCM 5 : CE A. Le nombre dos est inconstant, car prsence dos surnumraires notamment au niveau des mains et des pieds. B. Le squelette axial est constitu du crne, de la face, de la colonne vertbrale, du thorax, ainsi que de los hyode. Les ceintures thoraciques et pelviennes appartiennent au squelette appendiculaire. D. Les apophyses, tubercules et tubrosits sont des reliefs non articulaires, ils ne sont pas recouverts de cartilage. QCM 6 : E A. Les deux cartilages de croissance au niveau dun mme os nont pas la mme efficacit : les cartilages fertiles tant loin du coude et prs du genou. B. Apparition de la matrice cartilagineuse au 2m mois de vie intra utrine. C. Les amphiarthroses, comme les articulations synoviales sont doues de mobilit. D. Les sutures ou synarthroses, se divisent en deux groupes: les synfibroses (interposition dun tissu fibreux) et les synchondroses (interposition dun tissu cartilagineux). QCM 7 : BDE A. Les articulations sphrodes sont les plus mobiles, elles se dplacent dans les trois plans de lespace. C. La trochode se reprsente sous forme dun cylindre plein qui tourne dans un cylindre creux. Le systme de la poulie voque la ginglyme ou trochle. QCM 8 : D A. Les ligaments intra-capsulaires sont effectivement intgrs la capsule mais ils sont toujours extrasynoviaux. B. Le cartilage nest pas vascularis, il ne peut donc pas se reconstruire lorsquil est dtruit. Sa nutrition se fait par imbibition partir du liquide synovial. C. On retrouve la membrane synoviale au niveau des articulations synoviales. E. On trouve les disques dinterposition, mnisques et bourrelets au niveau des articulations synoviales o ils jouent un rle dans la stabilisation de larticulation. QCM 9 : ACDE B. Cest 100 muscles pour les 2 membres thoraciques et 100 muscles pour les 2 membres pelviens, se qui fait un total denviron 620 muscles.

Gnralits sur lappareil circulatoire, ce quil fallait rpondre


QCM 1 : AC B. Le systme lymphatique se termine dans le rseau veineux (confluent jugulo-sub-clavier). D. Ce sont les artres qui partent des ventricules (gauche : aorte / droit : artres pulmonaires). E. Il comprend aussi le systme lymphatique qui es tun systme part du systme sanguin. QCM 2 : BCE A. Les ventricules sont en avant des atriums. D. Sreuse du cur = PERICARDE. Lpicarde nest que le feuillet viscral du pricarde. QCM 3 : B A. La petite circulation correspond la circulation pulmonaire, et la grande circulation la circulation systmique. C. Cest le cur gauche qui est riche en O2, do le dpart de laorte pour la vascularisation des organes. D. Il existe aussi des systmes portes artriels, donc qui a deux rseaux capillaires veineux : Faux ! E. Litem est juste, mais pas lexemple !
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

162

QCM 4 : CD A. Le diamtre des veines est suprieur. B. Terminaison en L 4. E. Ce sont les lipides qui donnent laspect blanchtre. QCM 5 : CDE A. La veine cave caudale draine la partie infra diaphragmatique du corps. B. Le systme azygos est une collatrale de la veine cave crniale.

Gnralits sur lappareil respiratoire, ce quil fallait rpondre


QCM 1 : E A. La trache fait suite au larynx en regard de C6 et entre dans le thorax par son orifice suprieur. B. La trache est une structure constamment rigide. C. La carne se situe en regard de la cinquime vertbre thoracique. D. La bronche principale droite est plus verticale, alors que la bronche principale gauche est plus horizontale. QCM 2 : BCE A. Les deux poumons sont asymtriques : le poumon gauche tant plus petit que le poumon droit cause du dveloppement du cur. D. Les bronches segmentaires se divisent en bronchioles terminales au niveau du lobule pulmonaire qui est lunit fonctionnelle du poumon. QCM 3 : AE B. La vascularisation nourricire assure la perfusion du poumon, cest la vascularisation fonctionnelle qui assure lhmatose. C. Le sang riche en O2 repart du poumon par les veines pulmonaires. D. Tous les lments vasculo-nerveux forment la racine du poumon (ou pdicule pulmonaire) mais ils entrent et sortent du poumon au niveau du hile. QCM 4 : CE A. Ce sont les mouvements de la cage thoracique qui induisent les mouvements du poumon. B. Les sreuses entourant les poumons sont les plvres. D. Lexpiration est un phnomne passif, les muscles expiratoires ont donc un rle moindre. QCM 5 : AE B. L'oro-pharynx et le naso-pharynx appartiennent l'appareil respiratoire et l'oro-pharynx et le laryngopharynx appartiennent l'appareil digestif. C. Le pharynx stend de la base du crne la sixime vertbre cervicale. D. L'appareil respiratoire est situ dans la cage thoracique (trache, arbre bronchique et poumons) mais aussi au niveau de la tte et du cou ( trache, voies ariennes suprieures). QCM 6 : CE A. Les poumons sont chacun entours d'une plvre. B. La circulation fonctionnelle est assure par l'artre pulmonaire mais la nutrition dpend d'une artre nutritive venant de l'aorte. D. Il existe seulement 3 scissures au niveau des poumons, 2 au poumon droit, 1 seule sur le poumon gauche.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

163

QCM 7 : BDE A. Les cavits nasales rchauffent, humidifient et filtrent l'air INSPIRE. C. La trache suit le larynx en C6 donc au niveau du cou et non du thorax : elle a une partie cervicale et une autre thoracique. QCM 8 : A B. En regard de C6. C. Lpiglotte est un cartilage. D. Deux lobes gauche. E. Branches principales branches lobaires

branches segmentaires.

QCM 9 : CD A. Cest du feuillet parital. B. 16 mouvements par minutes. E. Une fois dans le lobule, les bronchioles ne possdent plus de cartilage. QCM 10 : DE A. Le nasopharynx est en cranial et loropharynx en caudal. B. Les cordes vocales se situent dans le larynx. C. La trache dbute en C6. QCM 11 : C A. En regard de la 5me vertbre thoracique (T5). B. Trois lobes droite et deux lobes gauche. D. Cest le feuillet viscral qui est au contact du poumon. E. Lorifice suprieur du larynx.

Gnralits sur lappareil digestif, ce quil fallait rpondre


QCM 1 : BCE A. Cest lintestin grle qui fait 6 8 mtres alors que le tube digestif fait 10 12 mtres. D. Non elle est sous le corps de la mandibule (sub=sous) cest la glande parotide qui est derrire la branche. E. Pas le naso-pharynx QCM 2 : BD A. Cest la partie craniale. C. Structure musculaire lisse. E. Non cest le jjunum (dailleurs on parle dangle duodno-jjunal. QCM 3 : ACE B. Non cest langle colique gauche. D. Rectum = ampoule rectale + canal anal QCM 4 : ACD B. Partie suprieure droite. E. Non le conduit pancratique accessoire souvre directement dans le duodnum ; cest le canal choldoque et le conduit pancratique principal qui forment lampoule. QCM 5 : ACD B. Pas de prmolaires chez lenfant. E. Traverse en T 10.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

164

QCM 6 : AB C. De caudal crnial. D. Sphincter au niveau du pylore. E. Petite courbure droite, grande courbure gauche. QCM 7 : A B. La cavit est virtuelle, le cas dcrit est pathologique. C. Pritoine ou feuillet parital. D. Pritoine ou feuillet viscral. E. Structure souple, non fibreuse.

Gnralits sur lappareil uro-gnital, ce quil fallait rpondre


QCM 1 : CD A. Les reins sont des organes scrteurs et non excrteurs. B. Les reins s'tagent bien sur une hauteur de 3 vertbres, mais : une thoracique (T12) et deux lombaires (L1 et L2) E. Les reins sont dans la rgion DORSALE et suprieure de la cavit abdominale. On parle de rgion lombaire. QCM 2 : ACE B. Les nphrons (= units de filtration) se trouvent dans le cortex. Ce sont les pyramides qui sont dans la mdullaire. D. Il y a autant de calices mineurs que de pyramides. QCM 3 : ACE B. Au niveau de la jonction pylo-URETERALE ! (Attention diffrence urtre/uretre) D. Le trigone vsical se trouve la face POSTERIEURE de la vessie. QCM 4 : C A. Il s'agit de l'uretre iliaque. B. La vessie est en avant de l'utrus. D. C'est la face suprieure qui se distend et forme le dme vsical. E. Un seul urtre (et 2 uretres) QCM 5 : ACDE B. Le dtrusor est un muscle lisse. QCM 6 : CD A. Il est trs court chez la femme mais pas chez lhomme. B. Oblique en bas et en avant E. Les voies urinaires et gnitales sont communes chez lhomme uniquement. QCM 7 : B A. Le pdicule testiculaire se situe au dessus du testicule. C. Lpididyme dbute les voies gnitales. D. Il est au niveau du ple suprieur. E. La tte est situe dans la partie antrieure et ventrale.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

165

QCM 8 : BCD A. Le corps est la portion qui longe le bord dorsal du testicule. E. Sur la face mdiale. QCM 9 : ABCE D. Latralement QCM 10 : DE A. La vessie est un organe sous pritonal. B. Les uretres arrivent la face dorsale de la vessie. C. La musculeuse vsicale est le dtrusor. QCM 11 : BCE A. La sreuse du testicule est la vaginale. D. A la junction tte/corps. QCM 12 : ACE B. Urtre antrieur = urtre spongieux. D. Les ovaires sont intrapritonaux. QCM 13 : AD B. Corps, ISTHME et col. C. Le vagin est orient vers le bas et vers lavant. E. Urtre en avant et vagin en arrire. QCM 14 : ABDE C. Vers le bas et lavant. QCM 15 : CE A. Sur la branche ischio-pubienne. B. Oblique en haut et en avant. D. Les ovaires sont situs vers la paroi latrale de la cavit pelvienne. QCM 16 : ACDE B. Base suprieure et sommet infrieur. QCM 17 : ACE B. Rgion la plus latrale et la plus basse de la rgion abdominale. D. Croise le dtroit suprieur. QCM 18 : AD B. En grande partie commun aux voies urinaires et gnitales. C. Cest lurtre membraneux. E. Urtre postrieur= urtre prostatique et urtre membraneux / urtre antrieur=urtre spongieux.

Gnralits sur lappareil de linnervation, ce quil fallait rpondre


QCM 1 : CDE A. Le systme nerveux central est contenu dans le crne et la colonne vertbrale. B. Le fonctionnement des muscles stris est sous la dpendance du systme nerveux somatique.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

166

QCM 2 : ACE B. Encphale = cerveau + tronc crbral + cervelet. D. Cest le tlencphale qui est constitu de deux hmisphres. QCM 3 : DE A. tronc crbral = msencphale + pont + moelle allonge. B. hmisphres crbelleux. C. La moelle pinire se termine en regard de L2. QCM 4 : BE A. De lextrieur vers lintrieur : dure-mre, arachnode et pie-mre. C. en regard de S2. D. pie-mre. QCM 5 : BDE A. 2/3 suprieurs. C. partir du sang artriel. QCM 6 : AE B. Le fonctionnement des viscres, des vaisseaux et des glandes est assur par les fibres musculaires lisses. C. Le SN priphrique, reprsent par les nerfs, permet de relier le SN central aux organes ; ces 2 systmes sont donc dpendants. D. Il sagit du plan fonctionnel ; sur le plan anatomique on distingue le SN central et le SN priphrique. QCM 7 : ADE B. Le SN central est constitu de lencphale et de la moelle spinale (ou pinire) ; le tronc crbral est une partie de lencphale. C. Le tlencphale comprend les 2 ventricules latraux, le diencphale est occup par le 3me ventricule. QCM 8 : CD A. Au niveau du crne, la dure-mre est adhrente los. Au niveau du canal vertbral, la dure-mre est spare de los par lespace pidural (ou pridural). B. 4me ventricule : pont et 2/3 suprieurs de la moelle allonge. E. Le LCR se trouve entre la pie-mre et larachnode dans lespace sub-arachnodien. QCM 9 : CD A. Substance grise et substance blanche constituent le SN central. B. Le SN central comprend deux moitis asymtriques sur le plan fonctionnel. E. Un tractus est un ensemble de fibres qui ont mme origine et mme terminaison. QCM 10 : Tout faux A. 31 paires de nerfs spinaux et 12 paires de nerfs craniens. B. Certains sont mixtes, moteurs purs ou sensitifs purs. C. C'est le nerf olfactif. D. IV = Nerf trochlaire. E. Sensibilit faciale. QCM 11 : ABDE C. L'hypothalamus est le centre suprieur. QCM 12 : BCD A. Il y en a un dans le SNV sympathique. E. l'tat physiologique, ce sont des expansions des tissus du SNC
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

167

QCM 13 : ABDE C. Tel quel dans le cours (existence de la queue de cheval). QCM 14 : AD B. Entre C1 et C2. C. Racine dorsale. E. La racine dorsale. QCM 15 : ADE B. Le nerf optique (II). C. Aussi moteur pour les muscles masticateurs. QCM 16 : ACD B. Systme nerveux vgtatif. E. Centre suprieur. QCM 17 : DE A. Ce sont les ganglions qui sont bien individualiss. B. Systme nerveux vgtatif sympathique. C. Contingent viscral. QCM 18 : BCDE A. Le nerf vague (XI).

Ostologie du membre thoracique, ce quil fallait rpondre


QCM 1 : ABCE D. la scapula est situe dans la rgion dorso-crniale du thorax. QCM 2 : DE A. la face ventrale est concave en ventral. B. lpine scapulaire divise la face dorsale de la scapula en deux parties ingales. C. bord mdial. QCM 3 : ABC D. partie moyenne. E. en latral. QCM 4 : AE B. Sillon de torsion oblique en distal et latral. C. Face ventro-latrale. D. 1/3 de sphre. QCM 5 : CDE A. La ceinture scapulaire est forme de deux os seulement : la scapula et la clavicule. B. Les fosses infra et supra-pineuse se trouvent sur la face dorsale de la scapula. QCM 6 : AD B. Lpiphyse mdiale de la clavicule prsente deux surfaces articulaires : une pour le sternum et une pour la 1re cte. C. La face dorsale de lhumrus prsente un sillon de torsion contenant le nerf radial. E. La palette humrale correspond lpiphyse distale.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

168

QCM 7 : ADE B. La tte humrale est compltement recouverte de cartilage. C. Cest le col anatomique. QCM 8 : BD A. Le bord mdial de la scapula est appel bord spinal. C. Le condyle humral est divis en trois partie, de latral en mdial : le capitulum, le sillon capitulotrochlaire et la trochle humrale (le capitatum est un os de la main !). E. La fosse radiale est situe en crnial du capitulum. QCM 9 : BCE A. Le tubercule infra-glnodien donne insertion au muscle triceps. Le tubercule supra glnodien donne insertion au muscle biceps. D. La trochle humrale sarticule avec lulna. QCM 10 : AD B. Cest lpiphyse proximale du radius qui prsente ces lments. C. En distal il sarticule avec trois os E. Elle sarticule avec le capitulum. QCM 11 : C A. Il participe larticulation humro-radiale. B. Si car elle sarticule avec lulna. D. En mdial et en dorsal. E. Ce sont les tendons des extenseurs. QCM 12 : A B. Lincisure ulnaire se trouve sur la face mdiale. C. Cette zone sarticule avec le scaphode. D. Lulna ne sarticule pas directement avec les os du carpe, articulation indirecte E. Face latrale de lulna. QCM 13 : ACD B. Tendon du triceps. E. Il est sur la partie ventrale de la face crniale. QCM 14 : CD A. Lincisure se trouve sur le processus coronode. B. La tte ulnaire est situe sur lpiphyse distale de lulna. E. Cest le contraire. QCM 15 : ACDE B. L'ensemble forme une arche concave en PALMAIRE. QCM 16 : ACDE B. Il ne s'agit pas du trapzode mais du scaphode (et du trapze). QCM 17 : BD A. Au niveau des mtacarpiens : la base est proximale et la tte est distale. C. Le cartilage de la surface articulaire porte par la tte du mtacarpien dborde en palmaire. E. L'axe de la main passe par le 3me mtacarpien.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

169

QCM 18 : Rponses vraies BC A. Il n'y a que 2 phalanges au niveau du pouce. D. Pour le pouce, il n'y a qu'une articulation interphalangienne. E. Au niveau de l'avant bras, du poignet et de la main : mdial = ulnaire et latral = radial.

Arthrologie du membre thoracique, ce quil fallait rpondre


QCM 1 : A B. La cavit glnode regarde en crnial comme la tte humrale, ce qui diminue la congruence articulaire. C. Le labrum est un lment fibro-cartilagineux creux et non plein comme peut ltre le disque. D. On ne trouve aucun ligament en dorsal mais il y en en caudal. E. La capsule se fixe entre autre sur le col anatomique de lhumrus. QCM 2 : ABC D. Il est transversal. E. Il se termine sur le col anatomique. QCM 3 : BDE A. Cest le ligament glno-humral caudal qui limite labduction de lpaule. C. La flexion ou antpulsion se ralise dans un plan sagittal. QCM 4 : BCD A. Cest linverse E. En rotation latrale de la scapula, lhumrus fait de labduction. QCM 5 : BCE A. Le complexe articulaire de lpaule comprend trois articulations synoviales, larticulation plane tant une articulation synoviale. D. Le ligament sterno-claviculaire renforce larticulation sterno-costo-claviculaire en ventral. QCM 6 : ACDE B. Ce mnisque est constant. QCM 7 : BCD A. Le ligament inter-claviculaire renforce directement la capsule. E. Les mouvements de la clavicule sont dans un plan frontal: 30dlvation et 10dabaissement. Les 30dantpulsion et 10de rtropulsion se font dans un plan sagittal. QCM 8 : ACE B. La surface articulaire de lacromion regarde en cranial et en mdial. D. Le mnisque de larticulation acromio-claviculaire qui peut tre entier ou fentr, est prsent dans seulement 1/3 des cas. QCM 9 : CE A. La chape delto-trapezienne est constitue de deux muscles : le deltode et le trapze. Cest cette chape qui renforce le systme ligamentaire et stabilise larticulation. B. Les trois ligaments coraco-claviculaires sont distance par rapport larticulation acromioclaviculaire. D. Le ligament trapzode se situe dans un plan sagittal.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

170

QCM 10 : BE A. La berge mdial de la trochle humrale est plus dveloppe que la berge latrale, ce qui explique que le bras soit dport en latral lors de lextension. C. Le ligament arciforme renforce (en partie) linsertion terminale du ligament collatral ulnaire du coude. D. Les deux picondyles de lhumrus et lolcrane dessinent un triangle lorsque le coude est flchi. QCM 11 : ABCE D. Le ligament carr est stabilisateur, il sinsre sur le bord distal de lincisure radiale de lulna et se termine sur le col radial. QCM 12 : ABD C. Lpicondyle mdial de lhumrus donne insertion au ligament collatral ulnaire tandis que lpicondyle latral est lui le lieu dinsertion du ligament collatral radial. E. Le faisceau moyen se termine sur le ligament annulaire. QCM 13 : AC B. Larticulation humro-ulnaire a une capsule articulaire commune avec les articulations humro-radiale et radio-ulnaire proximale. D. Le coude prsente trois types darticulations synoviales : une de type sphrode (humro-radiale), une de type ginglyme (humro-ulnaire) et une de type trochode (radio-ulnaire proximal). E. Les ligaments en possdent aussi parfois. Exemple : le ligament annulaire et le ligament triangulaire. QCM 14 : AC B. Comme toute articulation qui travaille en flexion/extension, les ligaments sont surtout collatraux. D. Cette articulation est une trochle ou ginglyme. E. La flexion active est de 140 degrs et la flexion passive de 160 degrs. QCM 15 : BD A. La capsule joue galement un rle dans la stabilit de cette articulation. C. Le ligament collatral radial du coude sinsre sur lpicondyle latral de lhumrus. E. Ce faisceau se termine dans la partie proximale de lolcrane. QCM 16 : AD B. Le faisceau ventral du ligament collatral ulnaire sinsre sur lpicondyle mdial de lhumrus. C. ATTENTION, le faisceau moyen du ligament collatral radial se termine sur le ligament annulaire et non sur le radius. E. Lincisure trochlaire de lulna est forme par lolcrane et par la coronode. QCM 17 : BCE A. la rotation latrale=supination et la rotation mdiale=pronation. D. Le ligament triangulaire est a sommet mdial. QCM 18 : tout faux A. La membrane interosseuse natteint pas larticulation. B. La membrane interosseuse est plus rsistance au niveau des 2/3 craniaux. C. Laxe de rotation des articulations radio ulnaires passe par le 3 me mtacarpien quand le coude est flchi et par le 5me mtarcarpien quand le coude est tendu. D. Lors dun mouvement de pronation maximal, la paume de la main regarde vers le sol. E. Il existe des ligaments radio ulnaire ventral et dorsal qui viennent renforcer la capsule.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

171

QCM 19 : CD A. Type ellipsode. B. Scaphode en latral et lunatum en mdial. E. Limite linclinaison radiale du poignet. QCM 20 : AE B. Triquetrum, hamatum et capitatum. C. Aucun ligament ne se fixe sur la face dorsale du lunatum. D. Flexion essentiellement dans la radio-carpienne. QCM 21 : AE B. Le capitatum ne sarticule pas avec le 4me mtacarpien. C. Larticulation trapzo-mtacarpienne est en selle. D. Se tendent lors de lextension. QCM 22 : ADE B. Les carpo-mtacarpiennes sont plus mobiles aux 4me et 5me mtacarpien quaux 2me et 3me. C. Trs dvelopp en ventral. QCM 23 : ABD C. Une articulation en selle possde deux degrs de libert, si larticulation trapzo-mtacarpienne en possde trois, cest grce la laxit ligamentaire. E. Le pouce possde une seule articulation inter-phalangienne. QCM 24 : ACD B. Lulna est important dans la stabilit du poignet car il supporte de nombreux ligaments. E. Capsules articulaires spares. QCM 25 : AE B. Amplitude flexion=amplitude extension=90. C. Inclinaison radiale=15. D. Inclinaison ulnaire=45. QCM 26 : ACDE B. Articulation en selle trois degrs de libert du fait dune importante laxit ligamentaire. QCM 27 : ACE B. Synoviales planes. D. Pas dhyper-extension possible pour linter-phalangienne proximale.

Ostologie crnio-faciale, ce quil fallait rpondre


QCM 1 : ACD B. En vue endocrnienne. E. Le mat moyen. QCM 2 : CD A. Le crne constitue une cavit ovode grosse extrmit postrieure. B. La calvaria correspond la vote et non la base ! E. Lethmode est un os impair, mdian et symtrique.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

172

QCM 3 : Rponses vraies : AC B. Les fossettes granulaires sont sur la face endocrnienne. D. Nerf I = nerf olfactif. E. La crte orbito-nasale dlimite le bord suprieur de lorbite. QCM 4 : ACE B. Cest lincisure supra-orbitaire qui est traverse par le nerf frontal. D. Le canal naso-frontal se jette dans le mat moyen. QCM 5 : AB C. Lcaille et la partie orbitaire sont spares par la crte orbito-nasale. D. En exocranien. E. Attention, le frontal ne sarticule pas avec le temporal ! QCM 6 : BD A. Le processus maxillaire se situe en mdial et le processus zygomatique en latral. C. La fossette trochlaire se situe en mdial et la fossette lacrymale en latral. E. Le foramen coecum est situ en avant de lincisure ethmodale. QCM 7 : BE A. Aussi ltage antrieur de la base. C. Vue exocrnienne. D. Nerf sensitif donc pas mixte. QCM 8 : ABE C. Vue endocrnienne. D. En avant. QCM 9 : B A. La partie basale nappartient qu ltage antrieur. C. Angle caille. D. Rgion temporale. E. Mdialement. QCM 10 : CE A. Epine nasale. B. Le foramen coecum est borgne. D. Structures qui rabsorbent. QCM 11 : ACDE B. Le nerf olfactif est le nerf cranien I. QCM 12 : BE A. Los ethmode appartient ltage antrieur de la base. C. La cloison nasale est forme par : le vomer, la lame verticale de lethmode et le cartilage septal. D. Los planum correspond la face latrale des masses latrales de lethmode. QCM 13 : BCD A. ATTENTION : le cornet infrieur est une structure osseuse part entire. La lame des cornets est constitue par le cornet suprieur et le cornet moyen. E. Le processus Crista Galli donne insertion un repli de la dure mre (faux du cerveau). QCM 14 : ABCDE
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

173

QCM 15 : ACDE B. Los planum appartient lorbite (paroi mdiale). QCM 16 : CE A. Que de la base. B. Horizontale. D. Au contraire elle peut blesser la mninge et entraner une rhinorrhe crbro-spinale. QCM 17 : ACE B. Lame perpendiculaire. D. Au dessous. QCM 18 : BD A. Mat suprieur et moyen seulement. C. Le frontal ne sarticule pas avec le temporal. E. Vue endocrnienne. QCM 19 : BCD A. Lethmode nappartient qua la base. E. Sur la portion orbitaire de la base du frontal (en latral). QCM 20 : CE A. Lcaille participe galement la constitution de ltage moyen de la base du crne (champ basilaire). B. La racine longitudinale est concave dans tous les sens et la transversale est convexe dans tous les sens. D. ATTENTION: Le temporal ne sarticule pas avec le frontal! QCM 21 : ABC D. Seul le nerf facial (VII) sort par le foramen stylo-mastodien. E. La fosse trigminale se trouve sur la face crbrale du rocher. QCM 22 : BCE A. Le temporal sunit INCOMPLTEMENT avec le sphnode. D. Le temporal ne sarticule pas avec lethmode. QCM 23 : CE A. Le champ temporal et le champ basilaire sont spars par une tige osseuse qui se dirige en avant et en dehors : le processus zygomatique. B. La face antro-suprieure du rocher (ou face crbrale) et la face postro-suprieure du rocher (ou face crbelleuse) sont les deux faces endocrniennes. D. La partie postrieure du foramen jugulaire est le lieu de passage de la veine jugulaire interne. QCM 24 : BC A. Larcade zygomatique (forme de lunion entre le processus zygomatique et los zygomatique) scarte du crne pour former le dfil zygomatique, lieu de passage du muscle temporal. D. Les nerfs crniaux VII et VIII sengagent dans le mat acoustique interne ou pore acoustique interne. E. Lincisure mastodienne est la zone dinsertion du muscle digastrique (ventre postrieur), au niveau de la face occipitale du rocher. QCM 25 : BD A. On retrouve sur la face crbrale du rocher, de dedans en dehors et davant en arrire : la fosse trigminale, le foramen des nerfs ptreux, lminence arqu et le toit de la caisse du tympan. C. Aucun lment ne traverse le foramen dchir, il est obtur par une membrane fibreuse. E. On observe sur le versant endocrnien de lcaille le passage de lartre mning moyenne.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

174

QCM 26 : ABD C. La limite postrieur de ltage postrieure de la base du crne est reprsente par le sillon du sinus transverse. E. Les lignes nucales sont situes de part et dautre de la protubrance occipital externe. QCM 27 : BC A. Le massif facial fixe est constitu de 13 os plus un cartilage qui est le cartilage septal. D. Ce sont les zygomatiques qui constituent les pommettes. E. La mandibule est un os mobile et cest bien pour ca quelle nappartient pas au massif facial fixe, elle appartient tout simplement a la face (divise en deux parties: le massif facial fixe et la mandibule). QCM 28 : BDE A. Les processus palatins (diffrents des os palatins) appartiennent aux maxillaires qui constituent donc bien la cavit orale. C. Le processus alvolaire nexiste que par la prsence de dents. QCM 29 : B A. Les canaux lacrymo-nasaux dbouchent dans le mat infrieur. C. Il existe deux os nasaux. D. Le cornet infrieur dlimite la partie suprieure du mat infrieur. E. Le cornet infrieur nest pas un os solidaris lethmode. QCM 30 : AB C. Le masseter sinsre au niveau de la face externe et non interne de langle mandibulaire, ce sont des muscles masticateurs. D. Le condyle est rattach au ramus par un col. E. Cest le ptrygodien latral qui sinsre au niveau de la fova ptrygodienne. QCM 31 : CDE A. 6 ans. B. Avec la rgion infra-temporale. QCM 32 : D A. 2 faces. B. Il nentre pas dans la constitution de la paroi suprieure. C. Il ne touche en aucun cas les fosses nasales. E. En latral. QCM 33 : ADE B. Ce nest pas le processus coronode. C. Le nasal est fixe. QCM 34 : ADE B. Lame horizontale. C. En arrire.

Ostologie du crne, ce quil fallait rpondre


QCM 1 : ABCE D. Lartre mninge moyenne traverse le foramen pineux. Lartre carotide interne est elle retrouve au niveau de lapex du rocher.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

175

QCM 2 : BE A. Chez le nouveau n, la partie latral du crne prsente dcrire deux fontanelles: la fontanelle ptrique et la fontanelle astrique. C. La fontanelle bregmatique permet de raliser chez lenfant une chographie transfontanellaire. (Cf. E.) D. Cas de la fontanelle bregmatique. La fontanelle lambdatique est dlimite par los occipital et les deux os paritaux. QCM 3 : ABD C. Le canal carotidien, le mat acoustique externe et le foramen stylo-mastodien sont exclusivement retrouvs en exocrnien. E. La lame crible de lethmode laisse passer le nerf olfactif (I). QCM 4 : ABC A. Vraie : grce la fissure orbitaire suprieure pour ltage moyen et grce au canal optique pour ltage antrieur. D. Le nerf cochlo-vestibulaire (VIII) traverse le mat acoustique interne au niveau de ltage postrieur de la base du crne. E. Le nerf maxillaire (V,2) traverse le foramen rond tandis que le nerf mandibulaire (V,3) traverse le foramen ovale. QCM 5 : BC A. Lvolution de la fontanelle bregmatique correspond au point dintersection de la suture coronale et de la suture sagittale. D. Les nerfs glosso-pharyngien, vague et accessoire traversent le foramen jugulaire dans sa partie antrieure. E. Lethmode est un lment de ltage antrieur de la base du crne.

Myologie de lpaule, ce quil fallait rpondre


QCM 1 : A B. Origine sur lapophyse coracode de la scapula. C. Muscle oblique en distal et latral. D. Le coraco-brachial se termine au niveau du 1/3 moyen de la face ventro-mdiale humrale. E. Il est innerv par le nerf musculo-cutan (innervation du deltode : nerf axillaire). QCM 2 : ABD C. Origine par un seul tendon sur lapophyse coracode de la scapula. E. Le muscle passe en ventral de larticulation scapulo-humrale, se termine sur la face ventro-mdiale de lhumrus. Il fait bien la rotation latrale. QCM 3 : C A. Cest la veine cphalique qui passe dans le sillon delto-pectoral. B. Le grand pectoral est innerv par la anse des pectoraux alors que le coraco-brachial lest par le nerf musculo-cutan. D. Le coraco-brachial fait la rotation latrale et la FLEXION. Actions vraies pour le deltode. E. Ils sont antagonistes : grand pectoral = ADDucteur / deltode = ABDucteur.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

176

QCM 4 : D A. Serait vrai pour le deltode. Mais le grand pectoral a un faisceau qui sinsre sur la clavicule, un sur les cartilages costaux et un sur laponvrose des muscles droits de labdomen ; aucun faisceau sur la scapula. B. Le grand pectoral fait de ladduction et de la rotation mdiale (pas de flexion). C. Le deltode est un muscle ABDucteur (cest labducteur principal du bras). E. Il sagit de la VEINE cphalique qui passe dans le sillon delto-pectoral. QCM 5 : B A. De labduction C. Ce sont les insertions du deltode qui correspondent aux terminaisons du trapze. D. Le faisceau moyen est le faisceau acromial et le faisceau dorsal est le faisceau pineux. E. Cest le faisceau acromial qui est multipenn. QCM 6 : E A. Cest un demi-cne sommet distal. B. Le V deltodien est sur la face ventro-latrale de lhumrus. C. Nerf axillaire. D. Flexion du bras et rotation mdiale. QCM 7 : ACE B. 2/3 mdiaux de la face crniale de la clavicule. D. Cest le faisceau sterno-chondro-costal qui est divis en 2 faisceaux. QCM 8 : BCE A. Berge latrale. D. Le grand pectoral est innerv par lanse des pectoraux, le deltode est innerv par le nerf axillaire. QCM 9 : ABCE D. Seul le petit rhombode sinsre sur une vertbre cervicale : C7 ; le grand rhombode sinsre sur les processus pineux de T2 T5. QCM 10 : C A. Cest un muscle profond. B. Ils sont innervs par le nerf dorsal de la scapula qui est une branche collatrale du plexus brachial. D. Le faisceau cranial se termine au niveau du 1/3 latral de la clavicule. E. Il fait partie du groupe ventral. QCM 11 : E A. Petit rhombode se termine en regard de lorigine de lpine. B. Ils ont mme direction en caudal, latral. C. Il se termine sur le bord spinal de la scapula, au-dessus de lorigine de lpine. D. Faisceau moyen du trapze=faisceau acromial=faisceau nucal. QCM 12 : CDE A. Le trapze est le seul muscle de lpaule tre innerv par un nerf crnien : 11me paire. B. Il sinsre au niveau des processus transverses de C1 C4. QCM 13 : ABCD E : Apophyses pineuses.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

177

QCM 14 : A B : Tubercules dorsaux. C : Rotation latrale et lvation de la scapula. D. Sur la protubrance occipitale externe. E. 1 seul : le grand dorsal. QCM 15 : AD B. 1/3 latral de la clavicule. C. En synergie avec le muscle grand dentel. E. T2 T5. QCM 16 : BC A : Groupe mdial. D. Elve la scapula. E. Mme action : adduction et rotation mdiale. QCM 17 : ACDE B. XIme paire de nerf cranien.

Myologie du coude, ce quil fallait rpondre


QCM 1 : BDE A. Deux extenseurs et trois flchisseurs. C. Extenseur. QCM 2 : ACD B. Tubercule supra-glnodien. E. Musculo-cutan. QCM 3 : AB C. Apophyse coronode de lulna. D. Flexion. E. Le musculo-cutan innerve le brachial mais perfore uniquement le coraco-brachial. QCM 4 : CD A. Face latrale. B. Quart distal. E. En latral. QCM 5 : D A. Pas la longue portion du triceps : insertion tendineuse. B. Infra-glnode. C. Face dorsale. E. Dorsale et crniale. QCM 6 : ACE B. Origines diffrentes mais mme terminaison. D. Longue portion.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

178

QCM 7 : CE A. Epicondyle latral. B. En crnial du sillon du nerf radial. D. Nerf musculocutann. QCM 8 : ABC D. Tubrosit infraglnodale. E. En medial et en distal. QCM 9 : A B. La longue portion a une origine tendineuse. C. Bord dorsal de lulna. D. Le corps musculaire de la courte portion se soude celui de la longue portion. E. Flchisseur. QCM 10 : ABE C. Cf. le brachio radial, muscle flchisseur du coude, innerv par le nerf radial. D. Plus superficielle.

Myologie de lavant bras et du poignet, ce quil fallait rpondre


QCM 1 : ABDE C. Base de M2. QCM 2 : BCE A. En mdial. D. Flchisseur. QCM 3 : AD B. Epicondyle latral. C. Pronation. E. Base de M3. QCM 4 : CE A. Nerf ulnaire. B. Rtinaculum des flchisseurs. D. Radio-ulnaire distale. QCM 5 : AE B. Le flchisseur radial du carpe permet de raliser le mouvement dinclinaison radiale ; il est innerv par le nerf mdian. Le long extenseur radial du carpe permet lui aussi de raliser le mouvement dinclinaison radiale ; il est innerv par le nerf radial. C. Long palmaire : petit corps musculaire, trs longs tendons. D. Le flchisseur ulnaire du carpe. QCM 6 : ABD C. distal du radius. E. Nerf mdian + nerf radial

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

179

QCM 7 : CDE A. Brachio-radial, rond pronateur et carr pronateur. B. En ventral de la terminaison du faisceau profond. QCM 8 : CDE A. Branche dorsale : branche motrice. B. Le muscle rond pronateur est innerv par le nerf mdian. QCM 9 : ABCE D. Le flchisseur ulnaire du carpe est innerv par le nerf ulnaire. QCM 10 : ABDE C. 1/3 moyen de la face latrale du radius.

Myologie de la main et des doigts, ce quil fallait rpondre


QCM 1 : Tout faux A. Intrinsques. B. Muscle innerv par le nerf mdian. C. Muscle innerv par le nerf mdian. D. Tendons perfors. E. Dans le canal carpien. QCM 2 : ABD C. Sur les 3 phalanges. E. Transmettent. QCM 3 : C A. Extenseur principal de tous les doigts = Extenseur commun. B. Pas l'extenseur propre de l'index. D. Il a un extenseur propre. E. Voir la moiti mdiale du flchisseur profond. QCM 4 : ABC D. Extrinsque. E. Le canal carpien est en ventral. QCM 5 : ACDE B. 2 sortes de gaines diffrentes. QCM 6 : ADE B. Plus profond que les muscles du carpe. C. Quun seul nerf : le nerf mdian. QCM 7 : D A. Tendons perfors . B. Pas daction sur la 3me phalange. C. Que le flchisseur profond des doigts. E. Ce sont les gaines synoviales qui favorisent leur glissement.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

180

QCM 8 : CD A. Pas celle de lindex qui est disposition digitale. B. Que pour le pouce et lauriculaire cause de la disposition digito-carpienne des gaines. E. Action la plus importante au niveau de la 1re phalange. QCM 9 : ACDE B. Pas de terminaison osseuse, fusionne avec le tendon de lextenseur commun. QCM 10 : E A. 9 tendons et un nerf. B. Gaines osto-fibreuses. C. Le flchisseur superficiel des doigts. D. Par le flchisseur profond des doigts. QCM 11 : D A. Tous les interosseux dorsaux sont bipnns. B. 1er interosseux palmaire. C. Faisceau principal. E. Pas celle de lauriculaire. QCM 12 : ABCE D. Flchisseur profond des doigts. QCM 13 : AD B. Ce sont les lombricaux qui ont ce rle. C. Les deux ct ulnaire par le nerf ulnaire, et les deux ct radial par le nerf mdian. E. Muscle extrinsque. QCM 14 : AB C. Long flchisseur du pouce. D. Court extenseur du pouce. E. Pas le long flchisseur du pouce. QCM 15 : ACD B. Seulement le faisceau transverse, sur M2 et M3. E. Eminence thnar seulement, car lhypothnar nest pas innerve par le nerf mdian.

Ostologie du membre pelvien, ce quil fallait rpondre


QCM 1 : A B. Laile iliaque est oblique en ventral et latral, la partie ischio-pubienne est oblique en ventral et mdial. C. La face glutale est la partie supra-actabulaire de la face latrale de los coxal. D. Cest une demi-sphre en forme de croissant, le limbus actabulaire est interrompu en caudal par lincisure actabulaire. E. La fosse actabulaire est non articulaire. QCM 2 : DE A. Les lignes glutales sont concaves en caudal et ventral. B. La ligne glutale dorsale nat 5cm en avant de lpine iliaque dorso-craniale alors que la ligne glutale ventrale nat au niveau du tubercule iliaque. C. Le pourtour du foramen obtur est limit en dorsal par lischium.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

181

QCM 3 : ACDE B. La fosse iliaque regarde en ventral, cranial et mdial. QCM 4 : CD A. Lpine ischiatique et la petite et grande incisure ischiatique appartiennent au bord dorsal de los coxal. B. La surface symphysaire se trouve sur le bord caudal de los coxal. E. Le foramen obtur prsente une forme triangulaire chez lhomme et ovalaire chez la femme. QCM 5 : ABD C. Les trois faces du fmur sont : la face ventrale, la face dorso-mdiale et la face dorso-latrale. E. La ligne spirale est le prolongement de la lvre mdiane et la tubrosit glutale est le prolongement de la lvre latrale. QCM 6 : CE A. La tte fmorale est reprsente par 2/3 de sphre. B La fovea capitis est dnue de cartilage. D.Cest langle dinclinaison, cest--dire langle par rapport laxe du corps, qui est =125 130 et langle dantversion galement dit de torsion qui est =15 30. QCM 7 : BDE A. Le grand trochanter se dveloppe en ventro-latral. C. La fosse intercondylaire spare en dorsal les deux condyles. QCM 8 : ABD C. La patella est base suprieure. E. La facette latrale de la patella est plus large que la mdiale.

Arthrologie de la hanche, ce quil fallait rpondre


QCM 1 : Tout faux A. Louverture angulaire de lactabulum est de 180. B. Lorientation de lactabulum se fait en ventral, caudal et latral. C. La tte du fmur a une forme de 2/3 de sphre. D. Les moyens dunion sont au nombre de trois : ligaments, synoviale et capsule. E. Le labrum est une formation fibro-cartilagineuse. QCM 2 : A B. Il sagit du cadrant dorso-caudal. C. Seule la face interne est recouverte de cartilage. D. Le ligament ilio-fmoral est ventral et lischio-fmoral est lui dorsal dans le groupe des extracapsulaires. E. Il est en tension constante. QCM 3 : ABD C. Il ne sagit pas du muscle obturateur interne mais externe. E. Cest par rapport la verticale que langle dinclinaison de la tte et du col est form. QCM 4 : ABC D. Le ligament de la tte fmorale est intracasulaire. E. Ce sont les deux ligaments intracapsulaires ventraux qui forment le plan de renforcement en Z de la capsule.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

182

QCM 5 : BCDE A. Cest gros quand mme 40 60 cm de diamtre pour la tte fmorale. QCM 6 : ABCD E. La fosse actabulaire nest pas recouverte de cartilage. QCM 7 : AD B. Cranial, mdial et ventral. C. Le labrum. Limbus = bord de lactabulum ! E. 25mm de rayon, 40 60mm de diamtre. QCM 8 : BCD A. Forme danneau complet. E. Aplati de mdial latral. QCM 9 : ACDE B. Coxa valga. QCM 10 : ADE B. Cest la rotation latrale qui peut aller jusqu 60, la rotation mdiale est denviron 40. C. Toujours tendu.

Arthrologie du genou, ce quil fallait rpondre


QCM 1 : ABDE C. Le ligament patellaire participe au plan de renforcement ventral du genou. QCM 2 : BCE A. Les ligaments croiss sont tendus en flexion et en extension. D. Le roulement des condyles s'effectue de ventral dorsal alors que le glissement se fait de dorsal ventral QCM 3 : BCD A. Les deux mnisques se dplacent en dorsal lors des mouvements de flexion mais seul le mnisque mdial se dplace en dorsal lors de la rotation latrale. E. Rcurvatum physiologique. QCM 4 : ADE B. Le ligament transverse du genou unit les cornes ventrales des mnisques. C. Un mouvement de tiroir traduit une lsion d'un ligament crois. QCM 5 : ABE C. La berge LATERALE de la surface patellaire est plus large. D. La rotation automatique du genou largit le polygone de sustentation. QCM 6 : BE A. L'articulation du genou associe deux articulations mais possde un systme ligamentaire et capsulaire commun aux deux articulations. C. L'articulation fmoro-tibiale bicondylienne possde deux degrs de libert de par une laxit ligamentaire qui autorise des mouvements de rotation. D. Les pourtours des condyles fmoraux s'articulent avec les plateaux TIBIAUX.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

183

QCM 7 : ACD B. La djection des condyles est dorsale. E. Le mnsique mdial insre ses cornes loin de l'minence intercondylaire, contrairement au mnisque latral. QCM 8 : BC A. Les mnisques ne s'insrent que par leurs cornes sur le tibia, alors que LEUR FACE CAUDALE est pose sur la glne tibiale. D. Les ligaments croiss sont intra capsulaires. E. La synoviale forme en dorsal de la patella et en arrire du tendon quadricipital..... QCM 9 : ABE C. Le ligament collatral fibullaire est parallle au crois postrieur et crois avec le collatral tibial. D. La fibula participe au systme articulaire du genou uniquement par le ligament collatral fibulaire et stabilise l'articulation en extension par le ligament poplit ARQUE. QCM 10 : AC B. Le ligament antro-externe, comme son nom l'indique dbute sur l'aire intercondylaire ventrale et se termine sur la face MEDIALE du condyle LATERAL= EXTERNE. D. Ils sparent le genou en deux compartiments, mdial et latral. E. Ils assurent la stabilit sagittale du genou en FLEXION.

Arthrologie de la cheville, ce quil fallait rpondre


QCM 1 : AC B. La capsule s'insre sur le pourtour des surfaces articulaires et EN VENTRAL au niveau du col. D. Le sommet du deltode rpond la mallole tibiale. E. sa base, le deltode s'insre sur le naviculaire, le talus et le CALCANEUS. QCM 2 : ACD B. Plan superficiel du deltode : ligaments tibio-naviculaire et tibio-calcanen. E. Le deltode est certes trs rsistant, mais il est aussi adhrent la capsule. QCM 3 : AE B. C'est l'inverse : le plan accessoire est le latral alors qu'en mdial il y a le deltode. C. Les trois ligaments latraux sont : le talo-fibulaire ventral, le talo-fibulaire dorsal, et le calcanofibulaire. D. Le ligament talo-fibulaire ventral n du bord ventral de la mallole fibulaire, et le dorsal de la fosse mallolaire. QCM 4 : ABDE C. Le ligament calcano-fibulaire a un trajet vertical. QCM 5 : BE A. Les ligaments latraux sont moins rsistants que le deltode (en mdial). C'est donc le deltode qui assure majoritairement la stabilit de l'articulation. C. Le bord dorsal de la mortaise descend plus bas que le bord ventral pour assurer la bute du talus lors de la marche (=stabilit sagittale). D. Quand le pied est en valgus, la tubrosit calcanenne est en dehors.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

184

QCM 6 : AC B. Elles communiquent une fois sur six. D. L'amplitude est faible cause de la membrane inter-osseuse. E. Ses fibres sont obliques en latral et en caudal : le reste est vrai. QCM 7 : ACDE B. Il ny a ni synoviale ni capsule QCM 8 : BCE A. Mouvements de flexion dorsale et plantaire. D. Elle ny appartient pas. QCM 9 : ACE B. La fosse mallolaire de la fibula est en dorsal de la surface articulaire. D. Cest le contraire. QCM 10 : BE A. Cest celle qui descend la plus bas. C. La trochle talaire est la face craniale du talus. D. La facette articulaire latrale du talus rpond la mallole fibulaire. QCM 11 : AC B. La surface talaire ventrale est concave en cranial. D. Larticulation sub-talaire effectue uniquement de labduction et de ladduction. E. Le ligament inter-osseux est llment essentiel de la stabilit de cette articulation mais cela ne signifie pas quil est le seul (capsule,synoviale et autres ligaments). QCM 12 : BCD A. Larticulation talo-calcano-naviculaire est une sphrode. E. Le ligament calan-naviculaire est recouvert de cartilage sur sa face suprieure. QCM 13 : BCE A. Larticulation cubodo-naviculaire est une syndesmose. D. Le 1er mtatarsien ne sarticule pas avec le cuniforme intermdiaire. QCM 14 : DE A. Les articulations mtatarso-phalangiennes sont des ellipsodes et les articulations inter phalangiennes des ginglymes. B. Les articulations inter phalangiennes distales effectuent aussi une extension denviron 45. C. Larticulation inter phalangienne proximale effectue une flexion de 90. QCM 15 : B A. Larticulation cubodo-naviculaire est une syndesmose, il ny a donc pas de cartilage. C. Le tte du mtatarsien porte le condyle, la base de la phalange porte la cavit glnode. D. Lamplitude globale de larticulation sub-talaire a une amplitude globale maximale de 35. E. Les mtatarsiens 4 et 5 sarticulent avec le cubode. QCM 16 : ABD C. Larticulation cubodo-naviculaire est une syndesmose. E. Les articulations inter phalangiennes sont des ginglymes. QCM 17 : ADE B. Larticulation transverse prsente une rotation externe de 25. C. La flexion des articulations mtatarso-phalangiennes est de 30.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

185

QCM 18: BC A. Les synchondroses ne possdent pas de cartilage ! D. La ligne brise de Lisfranc correspond larticulation tarso-mtatarsienne. E. Les articulations inter phalangiennes distales possdent une extension de 45. QCM 19: BCD A. Le ligament bifurqu sinsre sur la face dorsale de ces os. E. On trouve de nombreux types darticulation entre tous les os du tarse.

Ostologie des vertbres, ce quil fallait rpondre


QCM 1 : BDE A. 24 vertbres mobiles. C. Aucun rapport. QCM 2 : CDE A. Large et triangulaire. B. Base ventrale. QCM 3 : ACD B. Face mdiale des masses latrales. C. Espace antrieur. QCM 4 : ADE B. Presque cylindrique. C. Dfinition des vertbres cervicales. QCM 5 : BCE A. Long et inclin en caudal. D. L5. QCM 6 : A B. Lordose cervicale. C. Recouverts de cartilage. D. Laisse passer le nerf spinal. E. Le processus pineux. QCM 7 : BC A. Vertbre sus-jacente. D. Latlas na pas de corps, ce sont les masses latrales qui sarticulent avec latlas. E. Bi-tubercul. QCM 8 : ABCD E. De C6. QCM 9 : ABC D. 6 fossettes. E. Dans un plan frontal.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

186

QCM 10 : CD A. Petit et rond. B. Obliques en dorsal et latral. E. Incisure vertbrale caudale. QCM 11 : AC B. Les processus pineux sont horizontaux ce niveau. D. Cest linverse, le cranial regarde en medial et le caudal en latral. E. Il a une forme triangulaire. QCM 12 : BCE A. Cest les processus infrieurs de L5 qui crochtent les processus crniaux de S1. D. Pas de surface articulaire costale ce niveau.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

187

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

188

PARTIE V HISTOLOGIE

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

189

Gnralits (4 QCM)
QCM 1 : Gnralits A. Un organe est constitu de l'assemblage de diffrents tissus. B. La rsolution en microscopie optique est de 0,2 nm. C. La rsolution en microscopie lectronique ou photonique est de 0,2 nm. D. Le chorion est un tissu conjonctif non vascularis. E. Les structures denses arrtent les lectrons, ce qui rend une image sombre. QCM 2 : Gnralits A. Les 3 feuillets du disque embryonnaire se rpartissent comme suit, de la superficie la profondeur : Entoblaste, Msoblaste, Ectoblaste. B. A la 3e semaine de vie intra utrine, on a un disque embryonnaire 3 feuillets. C. Le msoblaste, l'origine du tissu nerveux, est le feuillet intermdiaire du disque 3 feuillets. D. Le tissu conjonctif a pour origine le tissu pithlial msoblastique. E. Le tissu conjonctif et le tissu musculaire ont une origine commune. QCM 3 : Gnralits A. On distingue 4 types de tissus : les tissus pithliaux, les tissus conjonctifs (et drivs), les tissus osseux et les tissus musculaires. B. Le tissu musculaire est un driv du tissu conjonctif. C. Au sein d'un organe, aucun tissu n'est prsent l'tat isol. D. Certains tissus pithliaux et le tissu nerveux ont une origine commune qui est le feuillet intermdiaire du disque embryonnaire. E. Un tissu est un assemblage de cellules troitement juxtaposes, rparties en une ou plusieurs assises. QCM 4 : Embryogense A. Un disque embryonnaire 3 feuillets se met en place le 3e jour de vie intra utrine. B. Le msoblaste est l'origine de tissus pithliaux, conjonctifs et musculaires. C. L'entoblaste est le plus superficiel des 3 feuillets. D. Le tissu nerveux drive exclusivement de l'ectoblaste. E.L' ensemble des voies aro-digestives drive de l'entoblaste.

Le tissu pithlial (50 QCM)


QCM 1 : Gnralits sur le tissu pithlial A .L'pithlium est un tissu non vascularis et non innerv. B. La nutrition d'un tissu pithlial se fait par diffusion de vaisseaux sanguins de la lame basale. C. Les tissus pithliaux se renouvellent uniquement partir de cellules souches indiffrencies. D. L'pithlium est un tissu constitu par des cellules troitement juxtaposes, rparties en une ou plusieurs assises. E. Les pithliums de l'appareil cardio-vasculaire drivent de l'entoblaste.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

190

QCM 2 : A propos des pithliums A. Une prolifration anarchique du tissu pithlial se traduit par la formation de tumeurs qui peuvent tre malignes comme les Adnomes. B. La sreuse est un pithlium qui entre dans la composition dune cavit compltement close. C. La rgnration dun pithlium se fait partir de cellules aussi bien diffrencies quindiffrencies. D. Dans toutes les cellules pithliales on trouve des microfilaments de cytokratine. E. Lintima est lpithlium pavimenteux simple qui tapisse lensemble des vaisseaux. QCM 3 : A propos des pithliums A. La prolifration anarchique dpithlium glandulaire peut tre lorigine de tumeurs bnignes ou malignes respectivement appeles adnomes ou adnocarcinomes. B. On peut classer les pithliums en deux catgories fonctionnelles : pithlium de revtements ou glandulaires. C. On dit que les cellules pithliales sont polarises, elles possdent un ple apical qui est le plus loign de la basale et un ple basal, le plus proche de celle-ci. D. Une muqueuse borde une cavit ayant gard un contact avec lextrieur, par exemple le tube digestif. E. Lectoblaste est lorigine de lpiderme et de ses annexes. QCM 4: A propos des pithliums A. Le tissu pithlial, du fait quil soit vascularis est trs actif. B. La nutrition de ce tissu pithlial se fait par diffusion dlments nutritifs provenant des vaisseaux sanguins du tissu conjonctif sus-jacent. C. Lpithlium du rein et des voies urinaires drive du msoblaste. D. Lendocarde est lensemble pithlium basale chorion directement au contact du sang dans la cavit cardiaque. E. Les papillomes sont des tumeurs malignes des pithliums de revtements. QCM 5 : A propos des pithliums A. Lurothlium est un pithlium polymorphe situ dans la vessie et luretre qui a une forme variable selon que la vessie est en tat de rpltion ou de vacuit. B. Les tubes collecteurs du rein sont tapisss dun pithlium cubique simple et prismatique simple quand le diamtre augmente. C. Le msothliome est lpithlium constitutif dune sreuse. D. La cytokratine et la spectrine forme un rseau terminal lorigine de la stabilit corticale. E. Les strocils visibles en microscopie optique sont assimilables des cils plus longs et plus flexueux disposs de faon irrgulire sur le pole apical. QCM 6 : A propos des pithliums A. Le msothliome est un pithlium pavimenteux simple. B. Les cellules prismatiques sont plus larges que hautes. C. Lendomtre est un pithlium prismatique. D. La lumire des tubes collecteurs du rein est borde par un pithlium cubique ou prismatique selon le calibre. E. Les squames de la couche corne de lpiderme permettent limpermabilit de la peau. QCM 7 : A propos des pithliums A. Une sreuse est forme notamment dun pithlium pavimenteux simple. B. Les trompes contiennent des cellules scrtrices. C. Les noyaux cellulaires des pithliums stratifis sont tous au mme niveau. D. Les pithliums prismatiques sont trs rpandus dans le tractus digestif. E. Les canaux excrteurs des glandes sudoripares ont un pithlium tri stratifi.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

191

QCM 8: A propos des pithliums A. Les pithliums pavimenteux stratifis sont favorables aux changes. B. Seul lpiderme est entre autre form dpithlium pavimenteux stratifi kratinis. C. Un msothlium est un pithlium pavimenteux simple dorigine msoblastique susceptible de donner naissance une tumeur maligne D. Tous les noyaux des cellules dun pithlium pseudo stratifi sont sur une mme ligne. E. Lurtre est entre autre form par un pithlium de transition. QCM 9 : A propos des pithliums A. Le msothliome est une tumeur bnigne. B. Les bronches sont constitues dun pithlium cubique simple. C. Les squames de la couche corne de lpiderme sont anucls. D. Luretre, la vessie et lurtre sont forms du mme type dpithlium. E. Les cellules basales dun pithlium pseudo stratifi ont un grand rle dans le renouvellement cellulaire. QCM 10 : A propos des pithliums A. Lendothlium, le msothlium et lpithlium cornen postrieur sont du mme type. B. Les cellules pithliales des tubes collecteurs du rein sont de forme cubique. C. Lpithlium endocervical, situ au niveau du col utrin et du vagin est cylindrique, simple. D. Toutes les cellules dun pithlium pseudo stratifi reposent sur la basale. E. En tat de rpltion, un pithlium polymorphe est un pithlium simple. QCM 11 : A propos des pithliums A. Un pithlium stratifi est dfini en fonction de la forme des cellules des assises les plus superficielles. B. Un pithlium pavimenteux simple est appel pithlium pavimenteux malpighien. C. Les pithliums malpighiens sont localiss au niveau de la cavit buccale, de lsophage, de lexocol, de lpithlium cornen antrieur et de lpiderme. D. En tat de vacuit, les cellules de la vessie sont plus hautes quen tat de rpltion. E. Luretre est form par un pithlium pseudo stratifi. QCM 12 : A propos des pithliums A. Les pithliums se caractrisent par la prsence d'un cytosquelette de cytokratine. B. Les pithliums ne sont jamais en relation directe avec le milieu extrieur. C. Les pithliums jouent seulement un rle de scrtion. D. L'utilisation d'AC monoclonaux anticytokratine permet l'identification des pithliums E. Les pithliums de revtement sont associs un chorion. QCM 13 : A propos des pithliums A .Un endothlium repose sur une lame basale. B. Un endothlium a pour origine l'entoblaste. C. Le msothlium a pour origine le msoblaste. D. L'pithlium des voies ariennes a pour origine embryonnaire l'ectoblaste. E. L'pithlium du rein a pour origine embryonnaire le msoblaste. QCM 14 : A propos des pithliums A. La cavit pritonale est borde d'une sreuse. B. L'endocarde est l'pithlium des cavits cardiaques. C. La cavit pleurale est une cavit en relation avec le milieu extrieur. D. La vitesse de rgnration des pithliums est toujours la mme. E. Le tissu pithlial est un tissu gnralement non vascularis.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

192

QCM 15: A propos des pithliums A. Le tissu pithlial ne se rgnre qu' partir de cellules souches indiffrencies B. Un carcinome peut tre rvl en immunohistochimie grce l'utilisation d'AC anticytokratine. C .Un Adnocarcinome est une tumeur maligne de l'pithlium glandulaire. D. Le ple apical est le plus proche de la basale. E. Un papillome est une tumeur maligne de l'pithlium glandulaire. QCM 16 : A propos des pithliums A. La membrane basale est spcifique aux tissus pithliaux. B. La composition dune basale est toujours identique dun endroit lautre dune mme basale mais varie dun tissu lautre. C .Les cellules conjonctives laborent diffrents composants de la basale dont le collagne IV, le perlcan et la laminine. D .La basale exerce un rle de filtre grce aux protoglycanes hparane sulfate chargs positivement. E. Lors de lsions du tissu pithlial, la basale sert de charpente pour guider les cellules nouvellement formes. QCM 17 : A propos des pithliums A. Lutilisation de techniques courantes ne permet pas de mettre en vidence la membrane basale au microscope optique. B. Le collagne IV et la laminine sont spcifiques des basales. C. La basale a pour rle de favoriser la cohsion entre lpithlium et le conjonctif. D. La basale peut tre dtruite par des cellules cancreuses, celles-ci peuvent alors migrer pour former des tumeurs primaires : les mtastases. E. Pour la formation de la basale, les cellules pithliales laborent la plus grande quantit de fibronectine. QCM 18 : A propos des tissus pithliaux A. Les cellules pithliales sont spares les unes des autres par une membrane basale. B. La nutrition d'un pithlium se fait par diffusion d'lments nutritifs de vaisseaux sanguins du tissu conjonctif sous jacent. C. La cytokratine, protine spcifique du tissu pithlial, permet d'identifier les cellules pithliales. D. Le carcinome ou pithliomas est une tumeur bnigne. E. Un pithlium peut tre l'origine de tumeurs malignes telles que l'adnome et le carcinome. QCM 19 : A propos des pithliums A. Les produits de scrtion dun pithlium glandulaire endocrine comme les glandes sudoripares sont dverss dans le milieu intrieur B. Les glandes composes comme les glandes salivaires ont un canal excrteur ramifi. C. Les glandes sudoripares, salivaires, parotides et sbaces sont exopithliales et pluricellulaires. D. Les glandes de lintestin et de la trache sont pluricellulaires. E. Le mode dexcrtion mrocrine, linverse du mode holocrine ne conserve pas lintgrit cellulaire. QCM 20 : A propos des pithliums A. Les glandes de lurtre et de la muqueuse nasale sont exopithliales et pluricellulaires. B. Le mode apocrine ou mrocrine produit des scrtions protiques et lipidiques. C. Le cytoplasme latro-basal des cellules constituant lacinus sreux est acidophile donc basique. D. Le mucus neutre produit par les glandes muqueuses est PAS ngatif, basophile et mtachromatique. E. Le pancras est la fois une glande exocrine qui libre des composes enzymatiques et une glande endocrine qui synthtise des hormones de type glucagon et insuline.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

193

QCM 21 : A propos de la lame basale A. Elle est inapparente en MO avec les techniques courantes mais visible en ME grce au PAS et limprgnation argentique. B. Le perlcan, synthtis par les cellules pithliales, est lunique protoglycane de la basale. C. Le collagne IV, spcifique des basales, est synthtis en majeure partie par les cellules pithliales. D. La fibronectine est une glycoprotine spcifique des basales. E. La laminine est une glycoprotine constitue de 3 chanes dont 2 sont synthtises par les cellules conjonctives et une par les cellules pithliales. QCM 22 : Rle de la basale A. Elle joue un rle de filtre grce aux glycoprotines B. Les charges ngatives des protoglycanes de la basale empchent le passage de lalbumine (charge ngativement) dans lurine, au niveau de glomrule rnal. C. La prolifration anarchique de cellules tumorales peut entraner la destruction de la basale, permettant une migration distance des cellules cancreuses et la formation de mtastases. D. La basale joue un rle de soutien et de cohsion entre tissu pithlial et tissu conjonctif. E. La basale ne joue aucun rle dans la rgnration tissulaire. QCM 23 : A propos des pithliums glandulaires A. Une glande exocrine dverse son contenu vers lextrieur alors que les glandes endocrines le dversent dans le sang. B. Les glandes sudoripares sont des glandes endocrines dont la portion scrtrice est de type tubuleuse droite. C. Les glandes salivaires sont des glandes composes c'est--dire possdant un canal excrteur ramifi. D. La glande sbace est une glande alvolaire mode dexcrtion holocrine E. La glande parotide est exocrine, acineuse, compose, sreuse et mrocrine. QCM 24: A propos des glandes A. Dans le mode dexcrtion mrocrine, la structure cellulaire reste intacte alors que dans le mode apocrine il y a disparition de la cellule. B. Le mode holomrocrine traduit une excrtion par exocytose de vacuoles au ple apical de la cellule. C. Le mode holocrine correspond le plus souvent lexcrtion de synthses lipidiques. D. Les glandes de Bruhner sont des glandes tubuleuses ramifies c'est--dire dotes dun canal excrteur multiple. E. Les glandes intra pithliales de lestomac sont dites pluricellulaires. QCM 25 : A propos des glandes A. La parotide est une glande sreuse pure. B. Les cellules des glandes sreuses ont un noyau central volumineux alors que les cellules des glandes muqueuses ont un noyau aplati rejet en priphrie. C. Au ple apical des glandes sreuses, on trouve des grains de zymogne basophiles. D. Un mucus acide est PAS positif, acidophile et mtachromatique. E. Un mucus neutre est PAS ngatif. QCM 26 : A propos des cils A. Le microtubule A est reli au microtubule C par des ponts de nature lipidique B. De part et dautre du microtubule A, il y a des expansions : les bras de dynine qui mesurent 15 nm de long sur 5nm de diamtre C. Un microtubule est constitu de tubuline alpha et gamma D. Les monomres de tubulines sassocient en homodimre qui eux mme sassocieront pour former des protofilaments E. Pour former un microtubule, il faut 10 protofilaments qui rsultent de lassociation de dimre de tubuline
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

194

QCM 27 : A propos des cils A. Laxonme est dite de type 9 + 2 car il y a 9 doublets de microtubules ainsi quune paire de microtubule au centre B. Les 2 microtubules centraux, au niveau de laxonme, ont une paroi faite de 10 protofilaments qui leurs sont propres associs 3 protofilaments emprunts C. Le microtubule B a 10 protofilaments qui lui sont propres et 3 protofilaments emprunts au microtubule A D. Le flagelle du spermatozode a une structure comparable celle du cil E. Une modification de larchitecture du cil naura jamais des consquences pathologiques. QCM 28: A propos des cils A. Cest grce aux ponts de nexine que le cil peut assurer son mouvement via lhydrolyse de lATP qui permet de fournir lnergie ncessaire B. Le microtubule C est le plus proche de laxe du cylindre C. Les lames rayonnantes permettent de relier 2 microtubules voisins D. Le cil proprement dit a 2 parties : une partie profonde et une partie superficielle E. Lpithlium de la trache est de type cubique simple et possde des cellules cilies ainsi que des cellules caliciformes qui produisent du mucus QCM 29 : A propos des cils A. Les cils mesurent 5 10 nm de haut et 0,2 nm de diamtre B. En ME on peut observer larchitecture du cil alors quen MO on observe une striation du ple apical C. Au niveau du cil proprement dit il y a des doublets de microtubules et non plus de triplets comme au niveau du corpuscule basal, du fait du microtubule C qui ne se prolonge pas D. Les bras de dynine sont disposs tous les 20nm le long du microtubule A E. Au niveau de la ciliature on observe un cytosquelette de soutien QCM 30 : A propos des cils A. La trache peut tre caractrise par les propositions suivant : cilie, pseudo stratifie. B. Le cil proprement dit a la particularit dmerger de la cellule et dtre recouvert de la membrane basale. C. Le cintosome est constitu de deux parties : un territoire profond et un superficiel. D. Les microtubules C sont relis laxe cylindrique par une lame rayonnante. E. Le territoire superficiel du cintosome possde des lames rayonnantes reliant les microtubules A laxe du cylindre. QCM 31 : A propos des cils A. Par convention le microtubule A est celui le plus proche de laxe du cylindre. B. Le cintosome est un petit cylindre creux dont la paroi est constitue de microtubules groups par 3 en priphrie : en triplet C. Lagencement du cytosquelette peut varier dun cil lautre. D. Les dimensions dun cil sont : 5m de hauteur et 0,2m de diamtre. E. Les triplets sont relis entre eux : du microtubule A au microtubule C dun triplet voisin par des ponts de nature non protique. QCM 32: A propos des cils A. Les cils et les microvillosits ont des lments ressemblant et possdent une mme proprit : celle dtre immobile. B. Sur une coupe transversale de la partie suprieure du cintosome on peut compter 9 triplets. C. Sur une coupe transversale de la partie la plus basale du cintosome on peut mettre en vidence un systme de soutien : des lames rayonnantes qui convergent vers un axe tubulaire central. D. Dans le cil proprement dit, des triplets de microtubule sont rencontrs en priphrie. E. Dans le cil proprement dit, les microtubules A et B se prolongent dans lexpansion ciliaire, le microtubule C sarrtant au sommet du cintosome.
Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

195

QCM 33 : A propos des cils A. Seuls les microtubules B et C sont constitus de 13 protofilaments au sein du cintosome ou du cil proprement dit. B. Sur une coupe transversale de la partie la plus basale du cintosome, les lames rayonnantes convergent vers deux microtubules centraux. C. Laxonme est de types 9+2 et correspond un ensemble de microtubules et de protines associes. D. Dans le cil proprement dit, les fibres rayonnantes convergent vers un manchon central protique. E. Les cils sont des diffrenciations membranaires prsentes au ple basal dune cellule. QCM 34: propos des microvillosits constitutives des plateaux stris ou des bordures en brosse A. Le rle des microvillosits est daugmenter la surface dchange entre les cellules et le milieu extrieur dun facteur 20 environ. B. Les microvillosits sont des digitations mobiles dont le cytosquelette est constitu entre autre de microfilaments dactine de 5 nm de diamtre. C. Bien que celles-ci soient trs fragiles, les microvillosits comportent un cytosquelette qui leur permet de mieux rsister aux agressions. D. Les microfilaments dactine assurant la stabilit de la microvillosit sont lis la membrane plasmique par lintermdiaire de molcules de fimbrine. E. Les filaments intermdiaires constitutifs du cytosquelette de la cellule pithliale sont des filaments de cytokratine et leur diamtre est de 10 nm. QCM 35 : propos de la structure des microvillosits constitutives dune bordure en brosse ou dun plateau stri, des strocils et des cils A. Le cytosquelette est form de microfilaments dactine, de filaments intermdiaires et de microtubules de diamtres respectifs 5, 10 et 45 nm. B. Cils et strocils sont constitus du mme type de cytosquelette. C. Cils et strocils ont une hauteur relativement du mme ordre. D. Le syndrome de Kartagener se caractrise par un situs inversus et un syndrome de strocils immobile. E. En ce qui concerne lultrastructure, la seule diffrence entre cils et strocils est la prsence chez ces premiers de protines activit ATPasique. QCM 36 : A propos des pithliums A. Les microvillosits d'un plateau stri ne se retrouvent qu'au niveau du pole apical des cellules des tubes contourns proximaux du rein. B. La striation observe en MO au niveau du pole apical des cellules pithliales est due la prsence de digitations en doigts de gants appels encore cils. C. Les microvillosits en plateaux stris sont immobiles et trs fragiles. D. Le diamtre des microtubules est deux fois plus petit que celui des filaments intermdiaires qui est lui de 10 nm E. Le glycocalyx est un rseau filamentaire de nature enzymatique utile a la dgradation des aliments et donc facilitant l'absorption intestinale. QCM 37 : A propos des pithliums A. Bien que plus courts, les strocils ont nanmoins des mouvements d'ondulation contrairement aux microvillosits d'une bordure en brosse ou en plateaux stris. B. On en retrouve entre autres dans la trache C. Les cils sont des digitations immobiles qui ont la particularit d'tre anims d'un mouvement unidirectionnel et uniforme D. Le syndrome du cil immobile a pour origine une anomalie du cintosome. E. Le syndrome de Kartagener associe un syndrome du cil immobile, un situs inversus.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

196

QCM 38 : A propos des pithliums A. Au cours du battement ciliaire, la phase de rcupration est plus longue que la phase active car elle ne fait pas appel un mcanisme consommant de lnergie. B. La phase de rcupration constitue une phase de retour la position initiale du cil C. La machinerie permettant au cil de se mouvoir se trouve dans le cil lui mme et non dans la cellule qui le soutien. D. Ceci est dailleurs montr par lexprience qui consiste en lisolement de laxonme, le retirement du manchon central, des ponts protiques et des fibres rayonnantes et qui aboutit la conservation du mouvement ciliaire tel quon lobserve habituellement aprs ajout dATP. E. Les cils ont pour fonction principale au niveau de la trache lvacuation de molcules toxiques piges par le mucus scrt par les cellules glandulaires appeles aussi cellules caliciformes. QCM 39 : A propos des pithliums A. Le tabagisme entraine une augmentation du nombre de cellule ciliaire et une diminution de cellule glandulaires ; ceci a pour consquence laccumulation de particules toxique qui ne sont plus piges par le mucus. B. Des agressions rptes au niveau de la trache aboutissent la stratification de lpithlium cubique simple et donc ltablissement dune mtaplasie malpighienne favorisant le dveloppement dun cancer du poumon. C. Le phnomne dvacuation du mucus vers le pharynx est aussi appel dglutition. D. Le tabac cest tabou, on en viendra tous bout. E. Lhyperscrtion glandulaire aboutit gnralement une insuffisance respiratoire par obstruction des voies ariennes. QCM 40 : A propos des pithliums A. Les invaginations du ple apical des cellules pithliales permettent laugmentation de la surface dchange avec le milieu extracellulaire. B. On retrouve des invaginations au ple basal des cellules pithliales des glandes salivaires sousmaxillaire ainsi quau niveau des tubes contourns du rein. C. Ces invaginations permettent au niveau du rein une augmentation de la rabsorption. D. Dans ces invaginations on trouve de nombreuses mitochondries qui constituent un moyen de transport membranaire E. Les aquaporines sont des canaux prsents au ple basal de certaines cellules pithliales et permettent le passage de molcules d'H2O. QCM 41 : A propos des basales A. La basale est visible en microscopie optique avec des techniques courantes. B. La basale est constitue de collagne VI qui lui est spcifique. C. La laminine est une glycoprotine spcifique des basales. D. Les cellules pithliales synthtisent une des 3 chanes de la laminine, du perlcan et du collagne IV en grande quantit. E. La filtration du sang artriel par la basale est l'origine de l'urine primitive. QCM 42 : A propos des glandes A. Les glandes sudoripares sont de type exocrine. B. La glande thyrode est de type exocrine. C. La glande est un organe part entire, constitu d'un pithlium glandulaire, d'une basale et d'un tissu conjonctif. D. L'pithlium glandulaire est vascularis. E. Les glandes salivaires possdent un canal excrteur ramifi. Ce sont des glandes dites composes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

197

QCM 43 : A propos des glandes A. Les glandes sudoripares possdent un canal scrteur unique et non ramifi : ce sont des glandes dites simples. B. Les glandes de Liberkuhn (de l'estomac) sont des glandes dont la portion scrtrice est tubuleuse droite. C. La portion scrtrice des glandes de Bruhner est tubuleuse ramifie. D. La portion scrtrice des glandes sudoripares est tubuleuse contourne. E. Les cellules caliciformes sont des glandes endo-pithliales unicellulaires disperses dans l'estomac. QCM 44: A propos des glandes A. La muqueuse nasale comporte des glandes endo-pithliales pluricellulaires. B. L'estomac comporte des cellules caliciformes. C. Les glandes intra-pithliales sont toujours unicellulaires. D. L'urtre, la muqueuse nasale et l'estomac comportent des glandes exo-pithliales pluricellulaires. E. Les glandes parotides et le pancras sont des glandes alvolaires. QCM 45 : A propos des basales A. La lame basale a une composition constante d'un tissu l'autre. B. Le collagne IV est spcifique des basales. C. Dans les basales, on trouve des glycoprotines telles que l'entactine, la laminine et la fibronectine. D. Le Dermatane sulfate est le glycosaminoglycane le plus prsent dans les basales. E. La laminine est un glycosaminoglycane spcifique des basales. QCM 46 : A propos des basales A. Les cellules pithliales laborent une chane de la laminine et les cellules conjonctives laborent les deux autres. B. Les cellules pithliales laborent la majeure partie du collagne IV prsent dans les basales. C. Le Perlcan, qui est un GAG de la basale, est labor par les cellules pithliales. D. La basale joue un rle de filtre, comme on peut le voir dans la filtration glomrulaire au niveau rnal. E. Dans certains cancers, la basale peut tre dtruite, ce qui permet la migration distance de cellules cancreuses qui iront former des mtastases, ailleurs dans l'organisme. QCM 47 : A propos des pithliums glandulaires A. Les produits de scrtion des pithliums glandulaires exocrines seront dverss dans le sang. B. Les glandes ramifies sont nommes ainsi car leur canal excrteur est ramifi. C. Les glandes sudoripares sont des glandes tubuleuses contournes. D. Les glandes parotides sont des glandes alvolaires en forme de sac. E. Dans l'intestin, on trouve des glandes intra-pithliales unicellulaires disperses. QCM 48: A propos des pithliums glandulaires A. La glande parotide est exocrine, acineuse, sreuse, holomrocrine et compose. B. On trouve des glandes intra-pithliales dans l'urtre, la muqueuse nasale et l'estomac. C. Le mode d'excrtion holocrine est courant pour les produits de scrtion lipidiques. D. Les glandes muqueuses ont une lumire centrale troite. E. La glande sous-maxillaire est prdominance sreuse.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

198

QCM 49 : A propos des pithliums glandulaires A. Dans la trache, on trouve des glandes intra-pithliales unicellulaires. B. Un exemple d'excrtion apocrine (galement nomme excrtion mrocrine) est la glande mammaire en lactation. C. Les glandes sbaces ont un mode d'excrtion holocrine. D. Le mode d'excrtion holomrocrine est le plus rpandu. E. Les mucopolysaccharides acides sont basophiles et mtachromatiques, mais pas les mucopolysaccharides neutres. QCM 50 : Au niveau d'une Gap jonction, peuvent passer: A. Ca 2+ B. La thymidine kinase C. Na + D. La guanosine phosphoryle: GTP E. La phosphatase alcaline

Le tissu conjonctif (20 QCM)


QCM 1 : A propos des gnralits sur le tissu conjonctif A. Le tissu conjonctif a pour origine le feuillet entoblastique. B. Les cellules conjonctives sont souvent lies entre elles par trois types de jonction : les jonctions tanches, les jonctions dancrage et les jonctions communicantes. C. Le tissu cartilagineux a une matrice dure et rigide. D. La substance fondamentale est constitue de fibres et dune matrice extra-cellulaire. E. Les tissus conjonctifs ont des fonctions de dfense, de soutien et mtabolique. QCM 2 : Concernant les lments constitutifs du tissu conjonctif proprement dit A. Les fibres de collagne prennent une coloration rose lorsquon utilise lhmalum osine en microscopie lectronique. B. Les fibres de collagne et les fibres lastiques sont dites de type collagne . C. Les forces de pression qui sexercent sur le tissu conjonctif orientent la disposition des fibres de collagne. D. Les fibrilles lmentaires de collagne montrent un agencement rgulier avec une striation de bandes claires et sombres en microscopie lectronique (ME) E. On trouve de nombreuses fibres de collagne dans le cytoplasme des fibroblastes. QCM 3 : Concernant les lments constitutifs du tissu conjonctif proprement dit A. En coloration ngative, on peut voir des alternances de bandes sombres et claires, lensemble de deux bandes mesurant 134 nm. B. Les fibres rticules ont un plus grand diamtre que les fibres de collagne. C. Le rseau tridimensionnel de fibres rticules est argyrophile et PAS positif. D. Les fibres de rticuline sont riches en collagne III E. Cest au niveau des organes hmatopotiques que lon trouve les fibres rticules.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

199

QCM 4: A propos de la molcule de collagne A. Cest une molcule trs rpandue dans lorganisme. B. Les 3 chanes polypeptidiques sont trs riches en glycine, lysine, hydroxy-proline et hydroxy-lysine C. On a aujourdhui identifi prs de 150 varits de collagne. D. Le collagne II et le collagne V sont trs rpandus dans la peau E. Le collagne XII est associ au collagne I. QCM 5 : A propos de llastine : A. Cest une protine qui est riche en Glycine et Proline comme le collagne. B. Elle prsente ltat relch un enroulement alatoire sur elle mme. C. Les molcules lmentaires dlastine sassocient de manire non covalente. D. les fibres de collagne troitement associes aux fibres lastiques limitent leur extensibilit. E. Le renouvellement des fibres lastiques est variable selon lge. QCM 6 : A propos des fibres lastiques : A. Elles peuvent tre mises en vidences par des colorations lectives en Microscopie Electronique. Ces deux colorants sont lorcine et la fuschine rsorcine. B. Elles se disposent en faisceaux et permettent au tissu conjonctif de supporter des dformations rptes. C. Elles prennent une disposition concentrique au niveau de la paroi aortique qui doit supporter les variations de pression. D. Elles ont un diamtre denviron 1 micron et sont composes de deux lments diffrents : la fibrilline priphrique et une matire amorphe central appel lastine. E. Les microfibrilles de fibrilline viennent sapposer sur llastine forme au pralable et permettent dassurer le maintien de lintgrit des fibres lastiques. QCM 7: A propos de la substance fondamentale A. Cette substance remplit les espaces libres entre cellules et fibres et nest pas colore en Microscopie Optique usuelle. B. On peut la colorer grce des techniques histochimiques : elle est PAS positive, mtachromatique et basophile. C. Ses 4 constituants sont leau (70-80%), des lments minraux et deux types molcules organiques : protoglycanes et glycoprotines. D. La fraction glucidique des glycoprotines est compose de sous units disaccharidiques unies en chanes plus ou moins longues non ramifies. E. Tous les GAG peuvent se lier de manire covalente avec les protines. QCM 8 : A propos du tissu conjonctif A. les GAG attirent les anions grce leurs charges, ces mmes anions sont hydrats et donc amnent avec eux des molcules deau, ce qui permet la turgescence de la matrice. B. Le dficit en un enzyme de dgradation des protoglycanes provoque une maladie de surcharge aussi appele mucopolysaccharidose. C. La fibronectine est un protoglycane qui relie les cellules entre elles et est peu prsente dans les cellules cancreuses. D. Lacide hyaluronique est retrouv dans le liquide articulaire. E. La substance fondamentale est mtachromatique ce qui signifie quelle apparat rose fuchsia colore au bleu de Toluidine.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

200

QCM 9 : A propos du tissu conjonctif A. Le tissu conjonctif peut tre lorigine de tumeurs bnignes : les sarcomes. B. On appelle fibrocyte une cellule jeune avec une forte activit de synthse. C. Le fibroblaste est une cellule doue de mobilit. D. Le fibroblaste labore linterfron &#61538; qui a un rle antibactrien. E. Les histiocytes possdent des rcepteurs aux LDL. QCM 10 : A propos du tissu conjonctif A. Les histiocytes naissent dans la moelle pinire B. Les histiocytes situs au niveau du foie sont aussi appels cellule de Kuppfer. C. Les mastocytes produisent des immunoglobulines. D. Les antignes responsables des phnomnes allergiques sont appels allergne. E. Cest la dgranulation des plasmocytes qui provoque les phnomnes allergiques. QCM 11: A propos du tissu conjonctif A. Lhparine est le mdiateur de lallergie. B. Les IgE sont amens dans la membrane des mastocytes par un segment hydrophobe. C. Les petites granulations qui renferment lhparine sont basophiles et mtachromatiques. D. Le plasmocyte est une cellule qui drive du lymphocyte B E. Le plasmocyte a un noyau trs excentr dont la chromatine est dispose en rayon de roue. QCM 12 : A propos du tissu conjonctif A. Larchoplasme dun plasmocyte est une rgion cellulaire. B. Toutes les cellules du tissu conjonctif sont de tailles semblables. C. Les leucocytes naissent exclusivement dans le tissu conjonctif. D. Les cellules mobiles sont capables de se dplacer dans le tissu conjonctif. E. Les cellules mobiles sont capables, dans certains cas, de traverser la barrire sanguine. QCM 13 : A propos de la composante cellulaire du tissu conjonctif A. Les fibrocytes sont des cellules jeunes. B. Linterfron a une activit pro virale. C. Les HDL non capts sont un facteur dathrosclrose. D. La transformation du lymphocyte B en plasmocyte est irrversible. E. Lhparine est responsable de la mtachromasie des granules cytoplasmiques des mastocytes. QCM 14 : A propos de la composante cellulaire du tissu conjonctif A. Les fibroblastes, tant donn leur jeune ge, ont une faible activit de synthse. B. La chromatine claire avec les nucloles visibles caractrise une grande activit transcriptionelle. C. Les LDL vont tre capts au niveau dun rcepteur cellulaire par exocytose. D. Les macrophages sont des cellules prsentatrices de lantigne, ils ont donc un grand rle dans la rponse immunitaire. E. Lallergne se fixe directement sur un rcepteur spcifique prsent la surface du mastocyte lors du phnomne de dgranulation. QCM 15: A propos de la composante cellulaire du tissu conjonctif A. Les membranes cellulaires sont trs riches en cholestrol. B. Pour valuer un risque dathrosclrose on fait le rapport HDL/LDL, plus il est lev plus le risque est faible. C. Les macrophages ont un rle de dfense spcifique par leur capacit dendocytose. D. Les mastocytes possdent des granulations cytoplasmiques acidophiles et mtachromatiques. E. Les mastocytes synthtisent des immunoglobulines.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

201

QCM 16 : A propos de la composante cellulaire du tissu conjonctif A. Les fibroblastes laborent des facteurs chimiotactiques dont le but est dattirer des cellules qui interviendront de faon spcifique dans la rponse contre un agent tranger. B. Le nombre de rcepteurs aux LDL est programm gntiquement mais diminue avec lge. C. La graisse blanche correspond aux adipocytes plurivacuolaires (les moins frquents chez lhomme). D. Les macrophages ont un appareil lysosomal trs dvelopp. E. Toutes les cellules faisant parti de la composante cellulaire du tissu conjonctif jouent un rle dans la dfense immunitaire. QCM 17 : LDL/HDL, les Adipocytes A. Un rapport LDL/HDL lev est un signe de bonne protection contre l'athrosclrose. B. Les adipocytes sont toujours regroups. C. Les adipocytes interviennent dans le mtabolisme lipidique 3 niveaux : dans la synthse, le stockage et la dgradation. D. Les adipocytes peuvent tre uni ou plurivacuolaires, dans les 2 cas ces cellules ont une taille de l'ordre de 100 m. E. Les adipocytes plurivacuolaires ont un noyau priphrique tandis que les adipocytes univacuolaires ont un noyau central. QCM 18 : A propos des Macrophages A. Les macrophages ont une activit d'endocytose importante ce qui explique que leur appareil lysomial soit trs dvelopp. B. Les macrophages sont en fait des cellules produites dans la moelle osseuse hmatopotique, puis migrent en passant par voie sanguine sous forme de monocytes sanguins et iront s'tablir dans le tissu conjonctif aprs franchissement de l'endothlium. C. Les cellules qui drivent des monocytes appartiennent au systme des phagocytes plurinucls. D. Les cellules de Kuppfer sont en fait des monocytes tablis au niveau du foie, les microgliocytes drivent aussi de monocytes mais qui se sont installs dans le systme nerveux E. Les macrophages jouent un double rle spcifique/aspcifique lors des rponses immunitaires de l'organisme. QCM 19 : A propos des Mastocytes et Plasmocytes A. Les mastocytes renferment des petites granules cytoplasmiques acidophiles et mtachromatiques. B. Ces granules renferment de l'histamine et de l'hparine, cette dernire tant responsable des manifestations cliniques de l'allergie. C. Les mastocytes prsentent leur surface des rcepteurs aux IgE, mais pour que la dgranulation ait lieu, les IgE pralablement fixs aux rcepteurs doivent lier l'allergne. D. Le plasmocyte est une cellule qui drive d'un lymphocyte B impliqu dans une raction immunitaire. E. Les plasmocytes sont les seules cellules de l'organisme capables de synthtiser des Immunoglobulines ou Anticorps lors d'une raction immunitaire. QCM 20 : A propos du Msenchyme A. Le msenchyme est un tissu conjonctif embryonnaire qui drive du 2me feuillet embryonnaire ou msoblaste. B. C'est partir de ce tissu que se forment tous les types de tissus conjonctifs. C. Les cellules msenchymateuses qui le constituent sont de forme toile et prsentent des signes de mitose. D. C'est un tissu riche en fibres collagnes. E. Le tissu le plus proche du msenchyme est la gele de Wharton du cordon ombilical qui se caractrise cependant par une composante fibreuse moins importante.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

202

Le tissu cartilagineux (9 QCM)


QCM 1 : A propos des lments constitutifs du tissu cartilagineux : A. La composante cellulaire reprsente 10% de la masse totale du cartilage. B. Les cellules cartilagineuses sont situes dans des logettes appeles chondroplasmes. C. La composante fibreuse est entre autre constitue par du collagne II associ au collagne XII. D. Le collagne reprsente 40 50% du poids sec du cartilage. E. Le traitement par la trypsine digre les composantes fibreuses et laisse intact la substance fondamentale. QCM 2 : A propos de la substance fondamentale : A. Elle est positive au PAS, acidophile et mtachromatique. B. Elle est compose de glycoprotine spcifique comme la chondronectine et la chondroplasmine. C. Laggrcan, protoglycane composant la substance fondamentale, est constitu 10% dune fraction glucidique et 90% dune fraction protique. D. Laggrcan est compos entre autre de diffrents GAG comme chondrotine sulfate et hparane sulfate. E. Toutes les molcules daggrcan ne sont pas isoles dans la matrice, certains forment des agrgats daggrcan autour dun axe dacide hyaluronique. QCM 3 : A propos des proprits du cartilage : A. Le cartilage hyalin est turgescent c'est--dire gorg deau ce qui lui permet de rsister aux forces de pressions. B. Les charges ngatives des GAG empchent lcrasement du cartilage car si elles sont trop proches elles se repoussent. C. Les pressions exerces sur les cartilages lors des mouvements permettent la diffusion des lments nutritifs, ce qui explique quun alitement prolong soit nfaste pour les cartilages. D. Le cartilage na quun mode de croissance, par apposition de tissu nouvellement form la priphrie, cest la croissance appositionnelle. E. Larthrose est une pathologie du cartilage due au rallongement des chanes glucidiques des GAG. QCM 4 : A propos des diffrents types de cartilage : A. Le cartilage hyalin est prsent au niveau des arcs costaux et de lpiglotte. B. Le pavillon de loreille, le conduit auditif externe et la trompe dEustache sont composs de cartilage lastique. C. Le cartilage fibreux comprend en plus du collagne II associ au IX et du XI, du collagne I, V et XII. D. On retrouve du cartilage fibreux au niveau de la symphyse pubienne. E. Le cartilage lastique reprsente la majeure partie de lbauche. QCM 5 : Gnralits tissu cartilagineux A Le tissu cartilagineux est un tissu de soutien de type conjonctif et dorigine msenchymateuse. B Le tissu cartilagineux est compos de cellules ou chondrocytes et dune matrice molle et lastique. C Le tissu cartilagineux est non vascularis mais innerv, il est recouvert par un tissu conjonctif vascularis : le prichondre. D Le tissu cartilagineux reprsente la plus grande partie du squelette adulte. E Les chondrocytes reprsentent 10% de la masse totale du cartilage.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

203

QCM 6 : Elments constitutifs du cartilage A Lors dune fixation, les chondrocytes changent daspect. Ils passent de globuleux toils. On a un artfact. B La chondronectine est une glycoprotine spcifique du cartilage capable de lier les chondrocytes la matrice. C Les GAG sont hydrophiles, leurs charges ngatives attirent les anions sodiums qui attirent les molcules deau. D Lorganisation de mouvement dans la matrice est essentielle pour la diffusion et la nutrition des lments. E Les fibres collagnes ont une disposition prichondroplastiques, toujours en faisceaux. QCM 7 : Les diffrentes varits de collagne A Le cartilage hyalin est le plus rpandu, on le retrouve au niveau du squelette ftal, de la trache et des bronches par exemple. B Le cartilage hyalin peut tre vu grce lorcine ou la fuscine rsorcine. C Le cartilage lastique est retrouv dans le conduit auditif externe, la trompe deustache et les mnisques. D On retrouve dans le cartilage fibreux du collagne de type I, V, XI E Le cartilage fibreux est recouvert par du prichondre. QCM 8 : A propos de la classification des tissus conjonctifs: A. Les ligaments jaunes sont forms de tissu conjonctif fibreux dense prdominance collagne. B. La graisse blanche est un tissu conjonctif fibreux dense prdominance cellulaire. C. Les adipocytes de la graisse blanche sont regroups en lobules mais pas ceux de la graisse brune. D. La graisse brune a un rle dans la rgulation thermique chez l'adulte. E. La graisse brune est plus richement vascularise et innerve que la graisse blanche. QCM 9 : A propos de la classification des tissus conjonctifs: A. Le tissu rticul est retrouv au niveau des capsules des organes hmatopotiques et lymphodes. B. Le tissu rticul fait partie des tissus conjonctifs fibreux denses car il possde une composition fibreuse de fibres rticules. C. La graisse blanche a une disposition dpendante du sexe avant et aprs la pubert. D. Le tissu prdominance lastique ne comporte pas du tout de fibres collagnes. E. La graisse blanche des rgions palmaires et plantaires une localisation indpendante du sexe.

Le tissu osseux (28 QCM)


QCM 1 : A propos du tissu osseux A. Lostoclasie est un phnomne de destruction de los qui est ncessaire la solidit du squelette. B. Les ostocytes se dposent sur une trave directrice de cartilage ou de faisceaux de collagne ou encore de tissu osseux prexistant et fabriquent la substance ostode. C. Le rachitisme qui se traduit par un taux de Ca effondr ne sera pas guri sans apport exogne de vitamine. D. Chez ladulte, une dcalcification partielle de la matrice osseuse peut tre un signe dostomalacie. E. Lactivit et le nombre des cellules constructrices du tissu osseux peuvent tre modifis par des facteurs rgulateurs tels que la vitamine D.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

204

QCM 2 : A propos du tissu osseux A. Hypertension comme hypotension sont des facteurs mcaniques qui vont stimuler lostoclasie. B. Parmi les facteurs vitaminiques, on compte les vitamines A, C, D qui peuvent influer sur lintgrit du squelette. C. La vitamine C agit sur la synthse du collagne et sur labsorption des sels calciques. D. Une carence en vitamine C entrane une diminution du nombre dostoblaste. E. Une carence en vitamine C est dltre puisque la vitamine C est ncessaire la synthse du collagne qui entre dans la composition de la substance ostode hauteur de 70%. QCM 3 : A propos du tissu osseux A. La calcitonine est une hormone hypercalcmiante agissant en faveur de lostogense et diminuant lostoclasie et lostolyse priostocytaire. B. La parathormone qui a un rle oppos la calcitonine augmente lostolyse priostocytaire, inhibe les ostoblastes et active les ostoclastes. C. Lhormone somatotrope dorigine hypophysaire agit sur la prolifration des cellules ostoclastiques. D. Chez la femme, lostoporose commence essentiellement aprs la mnopause et se traduit par un amincissement des corticales et une rarfaction des traves osseuses. E. La parathormone est une hormone synthtise par les glandes parathyrodiennes qui augmente lactivit des ostoclastes mais qui na aucun effet sur lactivit ou le nombre des ostoblastes. QCM 4 : A propos du tissu osseux A. Lostoclasie est le fait des ostoclastes qui dminralisent la substance osseuse. B. La rarfaction du tissu osseux aprs une longue priode dalitement est lie la diminution de laction de la pesanteur et de la tension musculaire. C. Le tissu osseux primaire sera toujours remplac par du tissu osseux lamellaire grce aux remaniements intervenants au niveau du squelette. D. Il existe une vitamine ayant une action positive sur lostoclasie. E. La vitamine D inhibe laction des ostoclastes mais na pas deffet positif sur les ostoblastes euxmmes. QCM 5 : En ce qui concerne le tissu conjonctif fibreux prdominance lastique : A. Cest le tissu conjonctif le plus rpandu de lorganisme. B. On peut le retrouver dans les parois des gros vaisseaux ainsi que dans les tendons. C. Sur une coupe de tissu conjonctif fibreux prdominance lastique on ne retrouve jamais de fibres de collagne associ aux fibres lastiques. D. Cest un tissu qui permet la libre circulation des cellules. E. Il peut ventuellement tre retrouv au sein de certains ligaments comme le ligament jaune de la colonne. QCM 6 : En ce qui concerne le tissu conjonctif prdominance cellulaire : A. La vascularisation de la graisse brune est plus importante que celle de la graisse blanche. B. Le tissu adipeux univacuolaire encore appel graisse blanche est trs riche en adipocytes. Ces derniers au sein de ce tissu ont leurs noyaux rejets en priphrie cause dune vacuole glucidique trs importante. C. Le tissu adipeux univacuolaire est localis (entre autre) au niveau du panicule adipeux sous cutan ainsi quau niveau des rgions palmaires et plantaires. D. Le tissu adipeux plurivacuolaire encore appel graisse brune se situe au niveau du cou, du cur, du rein et du creux axillaire chez ladulte. E. Le tissu rticul est retrouv dans le stroma des organes hmatopotiques ainsi que dans le stroma cornen.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

205

QCM 7 : En ce qui concerne les gnralits du tissu osseux : A. La matrice extracellulaire est constitue dune fraction organique hauteur de 30% et dune fraction minrale hauteur de 70%. B. Pour tudier le tissu osseux il faut le rendre mou. On peut utiliser le passage par des bains dacides ou contenant de lEDTA sans crainte de dgradation de la composante cellulaire la diffrence du polissage. C. Les pices osseuses peuvent tre considres comme un organe compos de plusieurs tissus. 25% de tissu osseux, 60% de tissu cartilagineux, et 15% de formations conjonctivo-vasculaires. D. Les pices osseuses sont entoures (sauf au niveau des cartilages articulaires) par un tissu conjonctif fibreux dense prdominance collagne non orient, lendoste. E. Dans les os longs, los spongieux est retrouv au niveau de la diaphyse. QCM 8 : En ce qui concerne la composante cellulaire du tissu osseux : A. Les ostoblastes scrtent dans un premier temps la substance pr-osseuse encore appel ostode qui est PAS ngatif. B. La matrice pr-osseuse est minralise par des phosphatases acides pour donner la substance osseuse proprement dite. C. Une fois que lon a la substance osseuse proprement dite lostoblaste change de nom pour devenir ostocyte. D. Les ostoblastes mettent des prolongements qui entre autres peuvent permettre de se relier dautres ostoblastes. Les jonctions entres ostoblastes sont des jonctions communicantes. E. Les ostoplastes sont des cellules nourricires de la trame osseuse. QCM 9 : A propos du tissu osseux: A. Dans l'os organe, on retrouve seulement 25 % de tissu osseux. B. L'os spongieux est form d'une matrice osseuse qui correspond 70 % du volume total. C. Au niveau des os courts, on ne retrouve que de l'os spongieux. D. Au niveau de la vote crnienne, on retrouve des os plats avec la diplo qui est un tissu compact l'intrieur. E. L'os est une structure fige. QCM 10 : A propos des cellules de l'os: A. Les ostoblastes sont en communication par l'intermdiaire de mdiateurs par voie sanguine. B. Les ostoblastes possdent des digitations qui s'ancrent dans les autres cellules du tissu osseux. C. Les ostoblastes ont une forme pavimenteuse pendant une activit intense de construction de l'os et cubique au repos. D. Les ostoblastes ont un noyau nuclol et un cytoplasme avec des granulations PAS + qui contiennent des prcurseurs de la substance pr-osseuse ou ostode. E. Des techniques d'autoradiographie montrent que les ostoblastes fabriquent du collagne II retrouv au niveau des os. QCM 11 : A propos des ostocytes A. Ils possdent des prolongements cellulaires qui empruntent des canalicules permettant la communication intercellulaire. B. Ils ont la capacit dostolyse priostocytaire pour se former une loge dans la substance osseuse. C. Ils possdent un noyau chromatine relche. D. Lensemble de leur corps cellulaire est situ dans lostoclaste. E. Ils jouent un rle dans le maintien de la matrice avoisinante et le mtabolisme phosphocalcique.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

206

QCM 12 : A propos de la matrice extracellulaire du tissu osseux A. La fraction minrale contient des cristaux dHydroxy Apatite sous forme daiguilles de 100 Angstrms, disposes paralllement aux fibres de collagne. B.99% des 600g de Calcium prsents dans lorganisme sont contenus dans le squelette. C. Des glycoprotines spcifiques du tissu osseux (Ostocalcine, Ostopontine, Ostonectine) interviennent dans la liaison des fractions organiques et minrales. D. On retrouve trois types de molcules de collagne dans le tissu osseux : collagnes I (majoritaire), V et XI. E. Les Carbonates de Magnsium, les Phosphates de Calcium et les cristaux dHydroxy Apatite entrent dans la composition de la fraction minrale. QCM 13: A propos du tissu osseux secondaire A. On le rencontre de faon pathologique au cours des ostosarcomes dans lesquels les ostoblastes trs actifs vont prolifrer de manire importante. B. Il existe trois types de tissu osseux secondaire: haversien, compact et spongieux. C. Dans le tissu osseux compact, on trouve des sries de 8 15 lamelles concentriques que lon nomme ostones. D. On retrouve de trs nombreux ostones dans les traves du tissu osseux secondaire spongieux. E. Le systme circonfrentiel interne est tapiss par lendoste alors que le systme circonfrentiel externe est tapiss par le prioste. QCM 14 : A propos du tissu osseux A. Lostoclaste est une cellule multinucle issue de la fusion de plusieurs macrophages entre eux. B. Les ostoclastes vont avoir une action dostolyse priostocytaire qui va entraner une dminralisation du tissu osseux. C. Les ostoclastes contiennent des hydrolases lysosomiales qui vont faciliter leur fonction de digestion. D. Le tissu osseux primaire est observ dans des processus pathologiques tels que la rparation aprs une fracture osseuse par formation dun cal osseux. E. Dans le tissu osseux primaire, on trouve de nombreux ostones comportant un canal central nourricier. QCM 15 : A propos du tissu osseux A. Une carence en vitamine C entrane un arrt de la biosynthse de la substance ostode. B. La vitamine D va favoriser labsorption des ions sodiums au niveau du tube digestif. C. Lostomalacie est une maladie osseuse de lenfant. D. Le traitement dune ostomalacie est un apport important de vitamine C. E. Un alitement prolong peut entraner une diminution de la masse osseuse par unit de volume. QCM 16 : A propos du tissu osseux A. Lostogense et lostoclasie doivent tre en parfait quilibre afin de permettre los dacqurir sa solidit et sa fonctionnalit. B. Lassociation dune ostoclasie priphrique et dune ostogense mdullaire permet la croissance diaphysaire. C. La croissance dun os long est permise par une ostogense centripte et une ostoclasie centrifuge. D. Lossification membraneuse est le mode de formation des os du crne. E. Los enchondral est une structure rsistante et fige.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

207

QCM 17 : A propos du tissu osseux A. Au cours de la croissance diaphysaire il y a rsorption osseuse la face externe de la diaphyse. B. Lostogense ncessite la prsence dun support comme par exemple une trave osseuse prexistante. C. Lostogense est favorise par la parathormone et freine par la calcitonine. D. Lostogense est favorise par une immobilisation prolonge. E. Une ostogense normale est dpendante de facteurs vitaminiques. QCM 18 : A propos du tissu osseux A. Les ostoclastes synthtisent la substance pr osseuse ou ostode. B. Lors du phnomne de minralisation les ostoplastes se diffrencient en ostocytes. C. Lostogense ncessite toujours la prsence de cellules dorigine msenchymateuse. D. Les ostoclastes possdent un stocke enzymatique important. E. Au cours de lossification primaire enchondrale il y a formation de tissus osseux lamellaire. QCM 19 : Lossification primaire A. Lossification primaire piphysaire a lieu la naissance pour lpiphyse infrieure mais plus tard pour lpiphyse suprieure. B. Les bourgeons conjonctivo-vasculaires vont pntrer dans los durant la vie ftale. C. Lossification se fait partir dun point principal qui est dailleurs lunique point dossification. D. Le cartilage daccroissement va spuiser en regard de lpiphyse pour donner une lame osseuse piphysaire. E. La forme anatomique de los ne requiert pas de points dossification secondaire. QCM 20 : La priode des remaniements A. Los non lamellaire est bien adapt au rle du tissu osseux, il est de type priostique ou enchondral. B. Lostoclasie de los primaire est progressive ce qui permet de ne pas compromettre le rle de soutien. C. Les ostoclastes dorigine mdullaire creusent des tunnels perpendiculaires au grand axe de los qui constitueront par la suite les canaux de Havers. D. Aprs le passage des ostoclastes, les ostoblastes tapissent la face interne des lacunes de Howship pour constituer une lamelle pr-osseuse qui se minralise, le puit cylindrique se comble presque compltement pour constituer un ostone avec canal de Havers au centre. E. Les ostoclastes recreusent, il y a donc une succession de cycles mais il persiste la fin de los primaire. QCM 21 : La croissance en paisseur A. La croissance en paisseur est lie lactivit ostogne du prioste B. Lors dune rsection prioste, la croissance en paisseur se poursuit partout sauf l o le prioste est absent. C. Si on ralise une rsection sous prioste la brche ne se recomble pas lendroit de la rsection. D. Lexprience de lalizarine (colorant) montre que le prioste a une croissance appositionnelle car on observe une succession de couches colores ou non si lon alterne un rgime avec alizarine ou sans. E. Durant la croissance en paisseur los priostique fabriqu est directement de los secondaire. QCM 22 : Aspects volutifs du cartilage daccroissement A. Au niveau de la ligne drosion, llargissement de la cavit mdullaire se fait uniquement sous laction des ostoclastes. B. La disparition du cartilage hypertrophique non calcifi au niveau de la ligne drosion va permettre la formation dune zone ostode ou pr-osseuse par les ostoblastes. C. La zone ostode se forme par minralisation de la zone ossiforme D. Au niveau de la face interne de la cavit mdullaire, de los enchondral persiste et paissit la couche dos priostique sous-jacente. E. Le cartilage hypertrophique constitue une zone de conjonctif ostogne.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

208

QCM 23 : Au sujet de lHaversification A. Los lamellaire, du fait de sa structure en perptuel remaniement est peu adapt au rle de soutien que doit jouer los, cest pourquoi, par le phnomne dhaversification il sera transform en tissu osseux non lamellaire, solide et adapt. B. Phnomnes dostoclasie et dostogne salternent pendant une vingtaine danne, au cours de la priode des remaniements. C. Les ostoclastes creusent des tunnels dans une direction perpendiculaire au grand axe de los, il sagit des futurs canaux de Volkman ou futurs Ostones. D. En revanche les tunnels creuss dans le sens du grand axe vont constituer des puits cylindrique qui deviendront le sige de la formation de systme de Havers. E. Il ne persistera aucune trave dos primaire lachvement de la croissance osseuse. QCM 24 : Croissance en paisseur - Croissance en longueur A. Une rsection prioste empche une croissance l o le prioste a t enlev. B. De mme pour la rsection sous prioste, on nobserve pas dossification post-rsection lendroit sectionn. C. Pour dmontrer lexistence dune croissance appositionnelle priostique, on injecte de lalizarine (colore los en formation) tout au long de la croissance. D. La croissance en longueur est permise grce la prsence de cartilages de conjugaison. E. Larrt de la croissance en longueur sexplique par le fait qu un moment donn, la maturation osseuse devient plus importante que la prolifration cartilagineuse ; ce qui amne la disparition du cartilage de croissance, support de la croissance osseuse. QCM 25 : A propos du tissu osseux A. Les protines non collagnes interviennent dans la minralisation. B. La fraction minrale est constitue de phosphate de magnsium, de phosphate tricalcique et de carbonates de calcium. C. Lensemble du squelette humain comporte 1200g de calcium, soit 90% du calcium total de lorganisme. D. le tissu osseux lamellaire ou primaire est mis en place ds le dbut de la formation dun os. E. le tissu osseux secondaire prsente de nombreux ostocytes. QCM 26 : A propos du tissu osseux A. Du tissu osseux primaire peut se rencontrer lors dostosarcomes. Ce cancer est lorigine de fractures multiples, ainsi que dune dsorganisation vasculaire importante. B. Le tissu osseux secondaire se caractrise par une minralisation importante. C. Les fibres collagnes du tissu osseux primaire ont une disposition plexiforme. D. Un systme de havers incomplet ou ostone est constitu de 8 15 lamelles concentriques. E. Le canal de havers donne passage des formations conjonctivo-vasculaires, lymphatiques et nerveuses. QCM 27 : A propos du tissu osseux A. Le diamtre du canal de havers varie de 2 10 microns. B. Le tissu osseux primaire ne contient pas de systme de havers. C. La ligne cmentante ou limite drosion ostoclastique comprend une matrice peu minralise et pauvre en fibres collagne. D. les canaux de volkman communiquent avec la cavit mdullaire grce aux canaux de havers. E. Le systme circonfrentiel interne est tapiss par le prioste.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

209

QCM 28 : A propos du tissu osseux A. Le tissu osseux spongieux est plus fragile que le tissu osseux compact. B. Chez ladulte, aprs une fracture de la rgion mtaphysaire, les nouvelles traves prennent une direction diffrente de celle des traves dorigine. C. Toutes les canalicules dbouchent sur la cavit mdullaire. D. Les anastomoses des traves sont orientes selon les forces physiques de pression. E. Les traves comportent essentiellement des systmes de havers complets.

Le sang (70 QCM)


QCM 1 : A propos du sang A. La coloration au May Grnwald Giemsa utilise pour les frottis sanguins a deux temps : May Grunwald (bleu de mthylne et osine) puis Giemsa (azur de mthylne et osine) B. Il est important deffectuer ces frottis sanguins pour tudier le sang car il existe de nombreuses pathologies du sang qui retentissent sur les organes C. Un prlvement de sang qui a t ralis en prsence danticoagulant permet la remise en suspension des cellules sanguines par simple agitation contrairement un prlvement ralis sans anticoagulant D. Le frottis sanguin consiste en un talement pluricellulaire dune goutte de sang qui va tre fixe par simple dessiccation E. Le sang a pour seul rle un rle de transporteur des gaz et lments nutritifs QCM 2 : A propos des globules rouges (GR) A. Ce sont des cellules trs peu diffrencies avec pour particularit principale de ne pas possder de noyau B. Leur cytoplasme apparat en MO acidophile, ceci est du la prsence dhmoglobine C. Ils ont une forme de disque biconcave qui apparat aplatie de profil et arrondie de face D. La forme biconcave est indirectement lie des interactions entre des protines transmembranaires, le rseau de spectrine et les microfilaments dactine E. Cette forme particulire leur permet davoir une surface dchange importante et augmente leur plasticit ce qui est ncessaire leur circulation dans les vaisseaux QCM 3: A propos du sang A. La maladie de Minkowski Chauffard est lie en grande majorit des mutations des gnes codant pour la spectrine, on parle galement de sphrocytose B. Dans cette pathologie, les GR perdent leur forme de disque pour un aspect sphrique et deviennent alors indformable C. Il existe dautres anomalies des GR concernant leur formation : une anisocytose est une variation de forme alors quune anisochromie est une variation de couleur D. Dans le cas de ces anomalies de structures du GR, on observe une importante dshydratation du fait des pompes Na et K E. Lhmolyse est la destruction massive des GR au niveau de la moelle osseuse et du foie

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

210

QCM 4 : A propos du sang A. A la membrane plasmique des GR, au niveau des nuds du rseau de spectrine, les dimres de spectrine sont lis des microfilaments dactine de petite taille, eux-mmes relis des glycoprotines transmembranaires via des molcules dassociation B. En dehors des nuds, les molcules dassociations sont essentiellement des molcules dankyrine C. Le groupe sanguin le plus rpandu est le groupe A dfini comme ayant des antignes de type A la surface des membranes des hmaties et des anticorps anti B dans le srum D. Dans le srum existe des Ac naturels de type IgG qui peuvent traverser la barrire placentaire contrairement aux IgM E. Le groupe O est donneur universel car il ne prsente dAg susceptible dtre dtruits pas les IgM du srum, et le groupe AB est receveur universel car il ne prsente pas dAc anti-A ou anti-B dans le srum. QCM 5 : A propos des gnralits sur le sang A. Le sang est un tissu conjonctif dorigine msenchymateuse. B. Lors dun prlvement sanguin, lajout dun anticoagulant avant sdimentation ou centrifugation permet dobtenir deux fractions : le srum et le culot. C. Le srum correspond la fraction plasmatique dpourvue de fibrinogne. D. Dans les conditions sans anticoagulant, la ragitation ne remet pas en suspension le caillot dans le srum car les cellules sanguines sont emprisonnes par des fibres de fibrine. E. Le sang est un mlange de cellules ou lments figurs dans un matrice liquide ou srum. QCM 6 : A propos des gnralits sur le sang A. Lhmatocrite est le pourcentage de sang occup par les globules rouges. B. Lhmatocrite est augment chez lenfant et le nouveau-n. C. Lors de la ralisation dun frottis sanguin, la fixation se fait au formol. D. Les colorants utiliss pour raliser un frottis sanguin sont le bleu mthylne, losine et lazur de mthylne constituant ainsi la coloration du May Grnwald GIEMSA (on ne tient pas compte de lordre dans lesquels ils sont utiliss !!!). E. Lhmatocrite chez lhomme est de 45% +/-5, et chez la femme de 40% +/-5. QCM 7 : A propos des globules rouges A. Son cytoplasme est osinophile ou basophile. B. Sa forme biconvexe a pour intrt daugmenter la surface dchange avec le milieu environnant. C. Il possde comme la plupart des cellules de lorganisme un noyau. D. Son diamtre est de 7,5 nm ce qui lui permet de circuler dans les capillaires sans problme. E. Lanisocytose est une anomalie de la taille et la pokilocytose est une anomalie de la forme. QCM 8 : A propos des globules rouges A. Une personne du groupe B possde dans anticorps antiB dans le srum et des antignes A la surface de la cellule. B. Le systme ABO comprend quatre groupes A, B, AB, et O. La connaissance de ces groupes est trs importante lors de transfusion sanguine. C. La Maladie de Minkowski-Chauffard est caractrise notamment par une sphrocytose, mais et associe dautres pathologies comme une anisocytose (=modification de la couleur). D. Les sujets du groupe O sont donneurs universels car leurs globules rouges ne portent pas dantignes. E. Lanisochromie est une pathologie de la couleur des globules rouges.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

211

QCM 9 : En cas danmie hmolytique nonatale par incompatibilit rhsus fto-maternelle : A. Il faut que le pre soit rhsus ngatif et la mre rhsus positif. Lenfant sera rhsus positif. B. Proche du terme, les globules rouges de la mre passent chez le ftus qui dveloppe une rponse immunitaire ce qui provoque chez lui une anmie. C. Le traitement prventif doit tre fait avant le terme de la premire grossesse car sinon le risque est grand pour le ftus. D. Au cours de la premire grossesse, les anticorps produit par le ftus sont uniquement des IgM qui ne peuvent pas traverser la barrire placentaire. E. Le traitement curatif se fait par injection de globules rouges rhsus positif comme ceux du ftus. QCM 10 : A propos de lhmoglobine : A. Cest une htroprotine forme dune fraction protique et dune fraction non protique. B. La globine est une protine forme de 4 chanes polypeptidique identiques 2 2 qui fixe lO2. C. Lhmoglobine est forme dun seul hme qui transporte le fer ferrique. D. Lhmoglobine doit lutter contre lhyperhydratation ce qui rend les globules rouges indformables en utilisant lATP du catabolisme du glucose. E. Quand le fer Fe2+ se transforme en Fe3+, on obtient de la mthmoglobine qui sera immdiatement dtruite car elle nest plus fonctionnelle. QCM 11 : En ce qui concerne la dure de vie des globules rouges : A. On calcule la dure de vie moyenne des globules rouges en utilisant de la glycine radioactive. B. Au moment de lintroduction de la glycine radioactive, on mesure une radioactivit dans le sang. C. La dure de vie maximale des globules rouges et de 120 jours. D. La demi-vie des globules rouges est calcule en utilisant du 51Cr radioactif qui est intgr dans lADN des globules rouges. E. La diffrence obtenu entre les deux techniques est quon ne fait pas les mesures sur les mmes populations de globules rouges. QCM 12 : En ce qui concerne le devenir des globules rouges : A. Lhmoglobine est dgrade en totalit : globine et hme. B. La bilirubine libre se promne librement dans le sang do son nom. C. La bilirubine conjugue est obtenue dans le foie grce une enzyme : la glucuronyl transfrase. D. Cette bilirubine glucoronoconjugue est totalement limine dans les urines par le rein. E. Chez un nouveau-n chez qui le foie est immature, on a des taux levs de bilirubine libre qui entranent des atteintes neurologiques aprs fixation au niveau du systme nerveux central. QCM 13 : En ce qui concerne lorigine et la formation des cellules sanguines : A. Les cellules de la ligne rouge reprsentent 10 30% des cellules mdullaires. B. A partir dun prorythroblaste, on obtient 32 globules rouges C. Les cellules souches multipotentes se divisent directement en prorythroblastes. D. Le prorythroblaste peut se diffrencier en cellules de la ligne rouge mais aussi en cellules des autres lignes en cas de besoin. E. On observe les cellules sanguines en formation aprs aspiration de moelle pinire au niveau du sternum puis coloration en MGG.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

212

QCM 14 : A propos de lrythropose A. Au cours de lrythropose les cytoplasmes des cellules sont de plus en plus basophiles. B. Lrythropotine, hormone glycoprotique, induit la diffrenciation des cellules souches multipotentes en prorythroblastes. C. Lors dhyper oxygnation, la scrtion drythropotine augmente. D. Le fer est recycl mais une partie est perdue par voie digestive, urinaire et par la transpiration. E. La vitamine B 12 favorise la synthse dADN. QCM 15 : A propos des globules blancs A. Les polynuclaires sont spars en trois grandes catgories selon laffinit tinctoriales des granulations la coloration de May Grunwald Giemsa. B. Les polynuclaires neutrophiles (PNN) contiennent des granulations neutrophiles ou secondaires qui sont spcifiques de ce type de cellule. C. Sur certains lobes des PNN, chez lhomme, on peut observer un petit diverticule en forme de baguette de tambour : le corpuscule de Barr. D. Les granulations azurophiles des PNN contiennent du lysozyme et de la lactoferrine. E. Les PNN sont impliqus dans la dfense antibactrienne aspcifique grce la diapdse, la mobilit active, le chimiotactisme et la phagocytose. QCM 16 : A propos des PNN dans la dfense antibactrienne A. Les bactries mettent des signaux chimiotactiques en direction des cellules endothliales, cela entrane la diapdse des PNN. B. Parmi les lments toxiques produits par les bactries par la voie dpendante de lO2 on trouve des protines basiques du lysozyme et de la lactoferrine. C. Les protines basiques ont un pouvoir bactriostatique. D. En prsence dHalogne, le peroxyde dHydrogne (H2O2) gnre des substances toxiques grce la myloproxydase. E. Aprs phagocytose le PNN ne survit gnralement pas plus dune minute. QCM 17 : A propos des PNN A. Les PNN reprsentent environ 30% des globules blancs chez ladulte. B. Les granulations primaires contiennent entre autre des hydrolases acides et du lysozyme qui ont un rle bactricide. C. Les granulations primaires ou azurophiles des PNN sont de plus grandes tailles et plus nombreuses. D. Les PNN grce leur proprit de diapdse sont aussi appels microphages en opposition aux macrophages qui sont les cellules poubelles de lorganisme. E. Les amas de PNN altrs ou pyocytes constituent le pus. QCM 18 : A propos de la rgulation de lrythropose : A. Lrythropotine induit la diffrenciation des cellules souches multipotentes en prorythroblastes. B. Lhyper-oxygnation augmente la synthse dEPO et donc le nombre de transporteurs. C. Le simple recyclage du fer suffit pour la synthse dhmoglobine. D. Laction conjointe du fer et de lEPO permet la sortie des rticulocytes dans le sang. E. La vit B12 et lacide folique sont ncessaires la synthse dADN.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

213

QCM 19 : A propos de la formule sanguine A. Une hmatocrite de 30% est pathologique pour une femme. B. Le nombre moyen de globules rouges chez un homme est de 5 millions par ml. C. Le taux dhmoglobine est le reflet de la capacit fixer loxygne, on parle danmie en dessous de 13g pour un homme et 12g pour une femme. D. Il existe diffrent type danmies caractrises par le volume globulaire moyen et la concentration corpusculaire moyenne en hmoglobine. E. Un CCMH > 36% rvle une hyperchromie. QCM 20 : A propos des globules blancs : A. On distingue 2 grandes catgories de globules blancs : les polynuclaires et les granulocytes. B. On distingue 3 catgories de polynuclaire en fonction de laffinit tinctoriale de leurs granulations. C. Les granulations des polynuclaires neutrophiles nont aucune affinit particulire alors que celles des polynuclaires osinophiles ont une forte affinit pour lazur de mthylne. D. Les PNN reprsentent 30% des globules blancs. E. Les PNN ont 2 types de granulations : les primaires, spcifiques, neutrophiles et les secondaires azurophiles QCM 21 : A propos des PNN A. Les PNN ont un noyau plurilob mais nont pas de nuclole. B. Chez la femme, on constate souvent la prsence dun diverticule appel corpuscule de Bar, qui est un reliquat de chromosome X inactiv. C. Les granulations primaires des PNN ont une action bactricide alors que les secondaires ont une action bactriostatique. D. On trouve du lysozyme dans les 2 types de granulations des PNN mais lenzyme lactoferrine nest prsente que dans les secondaires. E. Les PNN assurent une dfense antibactrienne spcifique. QCM 22 : A propos des PNN A. Ils sont dous de proprits de diapdse, de mobilit active, de chimiotactisme et de phagocytose. B. Les PNN peuvent passer la barrire endothliale grce leur mobilit active. C. La voie dpendante de loxygne produit des drivs ractifs de loxygne. D. La combinaison dH2O2 et dhalogne permet la formation de substances toxiques. E. La voie indpendante de loxygne utilise des protines basiques bactricides et de la lactoferrine bactriostatique. QCM 23 : Concernant lorigine et la formation A. Un myloblaste donne seize PNN. B. Sur un frottis mdullaire, on observe 4 8% de promylocytes. C. Les mtamylocytes possdent autant de granulations primaires que de granulations secondaires. D. Sur un frottis mdullaire, on observe 50 70% de cellules de la ligne rythroblastique, 10 30% de cellules la ligne granuleuse et 10% de cellules de la ligne lymphode E. un frottis mdullaire, on observe 50 70% de cellules de la ligne granuleuse, 10 30% de cellules la ligne rythroblastique et 10% de cellules de la ligne lymphode. QCM 24 : Concernant les PNB A. Les granulations des PNB contiennent de lhparine qui est 1 GAG basique anticoagulant B. Les PNB exercent surtout leur rle dans le secteur vasculaire C. Les PNB possdent des proprits de diapdse la diffrence des PNE D. Les PNB possdent leur membrane des rcepteurs pour les IgE E. Les IgE produites par les PNB viennent se fixer lors de la 2 rponse immunitaire

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

214

QCM 25 : Concernant les PNE A. Les granulations des PNE contiennent de lhistaminase qui est une enzyme de destruction de lhistamine. B. Les granulations des PNE contiennent un facteur activant la dgranulation des PNB. C. Les IgA exercent un rle de chimiotactisme envers les PNE ce qui leur permet dtre attirs sur le lieu de linfection. D. Lobservation des granulations des PNE en MO met en vidence un cristal E. Les PNE ont des proprits de diapdse, de mobilit active, de chimiotactisme et de phagocytose. QCM 26 : Concernant les PNE A. Le principal rle des PNE est la diminution des phnomnes allergiques par, entre autres, la neutralisation de lhistamine. B. Une infection virale provoque une augmentation des PNE. C. Les PNE restent moins longtemps que les PNN dans le secteur tissulaire mais restent en temps identique dans la moelle (10 jours) et dans le sang (12h). D. Les territoires prfrentiels des PNE sont lappareil respiratoire, lappareil digestif et la peau, soit les territoires en contact avec le milieu extrieur. E. Une augmentation des PNE est une hyper-osinophilie. QCM 27 : A propos de lorigine ou de la formation des PNN A. Les PNN reprsentent 20 30 % des cellules sur un frottis sanguin. B. Le myloblaste possde autant de granulations primaires et secondaires. C. La division du mtamylocyte en PNN est la dernire tape de la formation des PNN. D. Sur un frottis mdullaire les lments de la ligne lymphode reprsentent 30% des cellules. E. - Les PNN restent 4 5 jours dans le compartiment vasculaire QCM 28 : A propos des polynuclaires A. Les PNB restent 12 heures dans le compartiment vasculaire notamment dans le secteur marginal explor lors de la prise de sang. B. Le noyau trifoli des PNB possde une chromatine condense dite laque. C. Les granulations des PNB contiennent de lhistamine qui est un GAG acide anticoagulant. D. Les PNB possdent la proprit de diapdse qui leur permet de passer du secteur vasculaire au secteur tissulaire. E. La dgranulation du PNB est directement issue de la fixation de 2 IgE sur sa membrane. QCM 29 : A propos des PNE A. Le PNE est une cellule sphrique avec un noyau bilob dont la chromatine est condense et un cytoplasme avec des granulations orange vif denviron 1m de diamtre. B. Au cours du phnomne allergique les PNE librent de lhistaminase qui dtruit lhistamine. C. Les PNE possdent la proprit de diapdse et peuvent donc passer du compartiment tissulaire au compartiment vasculaire. D. Les PNE possdent des proprits chimiotactiques envers certains parasites capables de migrer. E. Les PNE exercent leur activit antiparasitaire en phagocytant les parasites. QCM 30: A propos des compartiments A. Les PNE restent 4 5 jours dans le compartiment tissulaire. B. La maturation tissulaire des PNN est dpendante du GM-CSF. C. Les PNN et les PNE restent environ 12h dans le compartiment vasculaire. D. La maturation terminale des PNN a lieu dans le secteur tissulaire. E. Sur un frottis mdullaire les cellules de la ligne granuleuse sont majoritaires.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

215

QCM 31 : A propos du sang A. La libration dhistamine lors du choc anaphylactique entrane la dilatation des vaisseaux provoquant une hypertension. B. Les granulations des PNE visibles en ME possdent un facteur inhibant la dgranulation des PNB et des mastocytes. C. Le noyau trilob des PNE contient une chromatine trs condense qui tmoigne dune faible activit de synthse protique. D. Les PNE reprsentent 60% des globules blancs E. Les IgE fixs par un rcepteur la surface des PNE sont susceptibles dentraner une dgranulation de ces GB en se liant lAg QCM 32 : A propos des lymphocytes A Le cytoplasme du petit lymphocyte contient des granulations azurophiles colores en fuchsia par lazur de Mthylne B. 75% des lymphocytes sont des lymphocytes T, 15% des lymphocytes B et 10% sont des lymphocytes NK. C. La rponse immunitaire des lymphocytes T est totalement mdiation humorale. D. Les plasmocytes ne sont jamais prsents dans le courant sanguin en situation pathologique. E. Lacquisition de limmunocomptence se fait dans les organes lymphodes priphriques. QCM 33 : A propos des monocytes A. Ce sont les plus gros leucocytes de lorganisme. B. Leur noyau est volumineux, chromatine motte daspect laqu. C. Leurs granulations azurophiles sont assimilables des lysosomes. D. Ils sont lorigine des cellules de Kuppfer du foie. E. Ils reprsentent 60% des globules blancs. QCM 34 : A propos des monocytes. A. Ils possdent un prcurseur commun avec les PNB. B. Leur maturation mdullaire dure 3 heures. C. Ils font 15 20 m de diamtre. D. Ils sont lorigine du systme des phagocytes mononucles. E. Ils jouent un rle dans la dfense spcifique et non spcifique de lorganisme. QCM 35 : On ralise une formule leucocytaire qui donne les rsultats suivants, exprims par mm 3 de sang: GB=6000, 3000 PNN, 60 PNE, 80 PNB, 1860 lymphocytes, 1000 Monocytes. On constate : A. Trop de PNN B. Pas assez de PNE. C. Pas assez de PNB. D. Un nombre normal de lymphocytes. E. Trop de Monocytes. QCM 36 : A propos des plaquettes et de lhmostase A. Les plaquettes expriment en permanence le rcepteur au fibrinogne. B. Les plaquettes prsentent sur leur membrane le facteur de Von Willebrant qui interagit lors d'une brche vasculaire avec le rcepteur du facteur de Von Willebrant prsent au niveau du collagne sous endothlial. C. Les cellules endothliales normales ont des proprits antiplaquettaires et thrombognes. D. Lors d'une brche vasculaire on remarque un premier phnomne qui est une vasodilatation rflexe. E. Les plaquettes actives librent de l'ATP et de la srotonine, permettant le recrutement et l'activation d'autres plaquettes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

216

QCM 37 : A propos des plaquettes et de lhmostase A. L'activit plaquettaire se traduit par un changement de forme des plaquettes ainsi que par l'expression leurs membranes du rcepteur au fibrinogne. B. Le calcium est un cofacteur indispensable l'interaction du facteur de von Willebrant et du rcepteur du facteur de von Willebrant. C. C'est au cours de l'hmostase secondaire que se forme le clou plaquettaire. D. La prothrombine permet la transformation du fibrinogne en fibrine. E. Des lments du cytosquelette des plaquettes interviennent dans la rtraction du caillot. QCM 38 : A propos des plaquettes et de lhmostase A. Les plaquettes naissent de la fragmentation du noyau d'un mgacaryocyte thrombocytogne ou granuleux. B. Un mgacaryocyte granuleux donnera naissance 5000-10000 plaquettes environ. C. Le mgacaryocyte granuleux drive directement du mgacaryoblaste. D. Le mgacaryoblaste drive du prorythroblaste. E. La maturation de la ligne plaquettaire est sous dpendance de l'rythropotine. QCM 39 : A propos des plaquettes et de lhmostase A. Un nombre de plaquette de l'ordre de 100000/mm3 de sang est associ un risque hmorragique. B. La dure de vie des plaquettes dans le courant sanguin est de 10 jours. C. Un nombre de plaquette infrieur 150000/mm3 de sang dfini une thrombopnie. D. La maturation mdullaire des plaquettes est de 12 jours. E. Une femme prsentant l'hmogramme un nombre de plaquettes de 99000/mm3 de sang prsente un risque d'hmorragie spontane. QCM 40 : A propos des plaquettes et de lhmostase A. Le mgacaryocyte basophile fragmente son cytoplasme pour donner naissance aux plaquettes. B. Le plasminogne transforme la fibrine en PDF. C. La thrombine permet la transformation du fibrinogne soluble en fibrine insoluble. D. La fibrine permet la stabilisation du clou plaquettaire. E.L'hmostase primaire comprend la formation du clou plaquettaire et stabilisation par la fibrine. QCM 41 : A propos des plaquettes et de lhmostase A. Les trois tapes aboutissant au comblement dune brche vasculaire sont lhmostase primaire, lhmostase secondaire et la fibrinolyse, elles interviennent la suite lune de lautre. B. Cest la mise nu du sous endothlium qui dclenche le processus dhmostase. C. Lhmostase primaire permet la formation du clou plaquettaire. D. Lexistence dune brche vasculaire entrane une vasoconstriction rflexe. E. La plaquette exprime le facteur de Von Willebrand sa membrane, celui-ci trouve son rcepteur sur le collagne du sous-endothlium. QCM 42 : A propos des plaquettes et de lhmostase A. Lactivation plaquettaire, qui se traduit notamment par un changement de forme de la cellule qui devient sphrique et hrisse, est suivi de ladhsion plaquettaire. B. Les plaquettes actives dversent le contenu de leurs granules : ADP et srotonine puis le Calcium. C. Sans Calcium, il ne peut pas y avoir interaction entre le fibrinogne et son rcepteur et donc pas dagrgation plaquettaire puisque celui-ci constitue un agent pontant entre les plaquettes. D. Le rcepteur du fibrinogne est exprim de manire constitutive par la plaquette. E. La boucle activation-agrgation se poursuit jusqu ce que la brche soit entirement comble.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

217

QCM 43 : A propos des plaquettes et de lhmostase A. Lhmostase secondaire permet la stabilisation du clou plaquettaire, et ainsi constituer le caillot. B. La thrombine permet la polymrisation du fibrinogne en fibrine insoluble. C. La rtraction du caillot se fait grce aux proprits contractiles des plaquettes et notamment de lactine. Cette rtraction permet lexpulsion du plasma pris dans le caillot et la recirculation du sang. D. Lors de la fibrinolyse, la plasmine qui vient du plasminogne qui a t cliv, va transformer la thrombine en PDF pour dtruire le caillot. E. LADP et la Srotonine librs par les plaquettes actives permettent le recrutement et lactivation dautres plaquettes. QCM 44: A propos des plaquettes et de lhmostase A. Les plaquettes sont formes partir dune cellule souche qui subit des endomitoses. Elle ne se divise pas mais augmente sa quantit dADN et son volume. B. Le Mgacaryoblaste donne naissance aux plaquettes en fragmentant son cytoplasme uniquement. C. Cette fragmentation permet de former 5000 10 000 plaquettes. D. La maturation mdullaire des plaquettes est sous la dpendance du GM-CSF. E. Les plaquettes survivent 2 jours dans le courant sanguin. QCM 45 : A propos des plaquettes et de lhmostase A. La limite suprieure de thrombopnie est 100 000 plaquettes/mm3 B. Une thrombocytose peut entraner des agrgations spontanes. C. Des hmorragies spontanes peuvent tre observes chez des personnes avec un taux de plaquettes 20 000/mm3 D. La quantit dADN dans les cellules productrices de plaquettes passe de 2n 32n. E. Le mgacaryoblaste, la premire cellule identifiable de la ligne plaquettaire possde un noyau polyplode. QCM 46 : A propos de lhmatopose A. Sur un frottis mdullaire, on distingue des cellules souches multipotentes lorigine de toutes les lignes sanguines B. Une des 2 cellules filles de la cellule souche multipotente ne se diffrencie pas : ceci permet lauto renouvellement C. Une des 2 cellules filles de la cellule souche multipotente se diffrencie : cest la dtermination qui donne un progniteur D. Les cellules souches multipotentes se divisent lentement, ceci diminue le risque de transmission de mutation E. Une mutation sur lADN dune cellule souche multipotente atteint ensuite toutes les lignes sanguines QCM 47 : A propos de lhmatopose A. Une souris irradie 10 Gy qui on injecte un nodule prcurseur de plaquettes provenant de la rate survivra et reformera les 3 lignes sanguines B. Chez la souris, la rate est un organe hmatopotique uniquement durant la vie embryonnaire C. Le progniteur des globules rouges, de certains globules blancs et des plaquettes est le mme : la cellule souche mylode D. La CFUE apparat avant la BFUE E. La CFUE subit 6 divisions avant de donner le prorythroblaste

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

218

QCM 48 : A propos de lhmatopose A. La BFUE subit le plus de divisions B. Lamplification des cellules se fait en amont du prorythroblaste. C. La maturation des cellules souches dtermines prcde le passage dans le sang D. Une altration de lADN des cellules souches multipotentes peut tre lorigine dune leucmie. E. Un prorythroblaste est lorigine dun seul globule rouge. QCM 49: A propos de lhmatopose A. Malgr les divisions, le nombre de cellules souches multipotentes est constant B. Une souris soumise 10 Gy meurt dasphyxie : il ny a plus de globules rouges pour acheminer lO2 C. Lhmatopose extra embryonnaire se met en place ds la 5me semaine D. Lhmatopose devient intra embryonnaire la fin du 2eme mois quand lhmatopose extra embryonnaire disparat. E. Lhmatopose mdullaire a lieu dans la moelle pinire des os. QCM 50 : A propos de lhmatopose A. Une cellule mre donne deux cellules filles qui vont se diffrencier et une cellule fille qui va rester identique la mre B. Une infection bactrienne est la cause de la mort des souris qui prsentent une aplasie mdullaire. C. La CFUS est une cellule souche multipotente de toutes les lignes D. La cellule souche lymphode est exclusivement prcurseur des lymphocytes E. La circulation intra embryonnaire se met en place ds la 3me semaine QCM 51 : A propos de lhmatopose A. Une mme cellule souche multipotente est lorigine de toute la ligne sanguine B. Chaque nodule de la rate du rat est spcifique dune ligne cellulaire C. Seule une cellule diffrencie peut possder lanomalie de la leucmie mylode chronique D. La BFUE donne 6 divisions avant de devenir une CFUE alors que celle-ci donne 8 15 divisions avant de donner un prorythroblaste E. Les premires cellules sanguines forment de petits lots partir de la 3me semaine de vie intra utrine QCM 52 : A propos de lhmatopose A. La cellule souche multipotente nest pas identifiable sur un frottis mdullaire B. Un nodule de prcurseur de la ligne rythroblastique ne va donner que des globules rouges C. La CFUE est la premire cellule morphologiquement identifiable de la ligne. D. Il y a exclusivement des cellules souches dtermines dans les nodules E. Les colonies formes par les BFUE ont un aspect clat QCM 53 : A propos de lhmatopose A. Ltape de dtermination touchant la cellule souche progniteur se fait dans la moelle osseuse B. La leucmie mylode chronique est due une translocation du chromosome philadelphie C. La CFUE se divise moins que la BFUE D. Lhmatopose hpato splnique se termine ds le 4me mois quand lhmatopose mdullaire commence E. La maturation des cellules sanguines se fait en partie dans le sang

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

219

QCM 54 : A propos de lhmatopose A. Les cellules souches multipotentes se divisent rapidement ce qui leur permet dassurer le renouvellement de toutes les cellules sanguines B. Les nodules prsents sur la rate des souris sont des tches noires. C. La cellule souche mylode est lorigine de tous les globules blancs. D. Le prorythroblaste va forcment se diffrencier en globule rouge E. Lhmatopose mdullaire commence au 4me mois de la vie intra utrine car avant, los nest pas assez form

QCM 55 : A propos des lymphocytes A. Les lymphocytes adultes sont des leucocytes mononuclaires qui se localisent prfrentiellement dans le sang. B. Les grands lymphocytes, qui reprsentent 90% des lymphocytes sanguins, mesurent 9 15 microns de diamtre. C. Les grands lymphocytes prsentent des granulations azurophiles colores en bleu par lazur de mthylne. D.75% des lymphocytes sanguins sont thymo dpendants et portent les marqueurs CD19 et CD20. E. Lhypolymphocytose est une diminution du nombre de lymphocytes. QCM 56 : A propos des lymphocytes et des plasmocytes A. En immunofluorescence directe (Microscopie optique fluorescence), les lymphocytes T peuvent tre visualiss par des anticorps anti CD3 fluorescents. B. On ne trouve pas de plasmocyte dans le courant sanguin en situation physiologique. C. Les lymphocytes B vont dtruire les cellules tumorales. D. Les lymphocytes B sont des acteurs de la rponse immunitaire mdiation humorale car ils produisent des immunoglobulines libres dans le sang. E. Les lymphocytes vont acqurir leur immunocomptence dans les organes lymphodes centraux (Moelle osseuse et thymus). QCM 57 : A propos des monocytes A. Ces cellules de 40 microns de diamtre reprsentent 6% des leucocytes. B. Ils possdent un noyau rniforme et des granulations basophiles assimilables des lysosomes. C. Ils sont lorigine du systme des phagocytes mononucles qui comprend entre autres, les macrophages et les histiocytes du tissu conjonctif, les microgliocytes du foie, et les ostoclastes du tissu osseux. D. Ils sont forms dans la moelle osseuse et vont achever leur diffrenciation dans les tissus. E. Ils ont un prcurseur et un facteur de croissance (GM-CSF) commun avec les PNN. QCM 58: Chez une jeune fille qui a de la fivre, on ralise une formule leucocytaire qui donne les rsultats suivants par millimtre cube de sang : 10 000 Leucocytes dont 6000 Lymphocytes, 3500 PNN, 300 Monocytes, 150 PNE et 50 PNB. A. Elle prsente un nombre trop faible de PNN par millimtre cube de sang. B. Elle prsente un nombre normal de leucocytes mais une hyper-lymphocytose. C. Elle prsente une formule leucocytaire dadulte avec des proportions denviron 60% de lymphocytes et 30% (plus ou moins 10%) de PNN. D. Elle prsente un nombre normal de monocytes par millimtre cube de sang. E. Son nombre de PNE par millimtre cube de sang est normal.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

220

QCM 59 : A propos des plaquettes A. Ce sont des lments discodes anucls de 2 4microns de diamtre prsentant un cytosquelette trs dvelopp, compos dactine et de microtubules. B. Dans les granulations du hyalomre, on retrouve entre autres du Calcium, de la Srotonine, de lADP et des facteurs de coagulation. C. Leur membrane plasmique est recouverte dun glycocalyx compos de glycoprotines impliques dans lagrgation plaquettaire. D. On en retrouve de 15 000 40 000 par millimtre cube de sang. E. Elles possdent des granulations cytoplasmiques de diffrentes varits, claires ou sombres en microscopie lectronique. QCM 60 : Devant une fivre 39 dun adulte, le mdecin demande des examens complmentaires. Indiquer parmi les constantes biologiques celles qui vous paraissent perturbes. A. Les polynuclaires neutrophiles 9000/mm3 de sang. B. Les globules blancs 8000/mm3 de sang. C. Les lymphocytes 2000/mm3 de sang. D. Les polynuclaires osinophiles 800/mm3. E. Les monocytes 500/ mm3 QCM 61 : Un homme de 40 ans consulte pour une fatigue persistante et des cphales. Hmogramme : GR 4.106/mm 3, Hb 10gr/100ml, Ht 30%, PNE 200/ mm3, Plaquettes 250000/ mm3. Que montre lhmogramme ? A. Un nombre de PNE suffisant. B. Anmie microcytaire. C. Anmie hyperchrome. D. Anmie hypochrome. E. Anmie microcytaire normochrome. QCM 62 : Une femme de 30 ans se plaint dasthnie et de cphales. Son mdecin suspectant une anmie prescrit un certain nombre dexamens biologiques. Indiquer parmi les constantes biologiques celles qui vous paraissent non perturbes. A. Hmatocrite 42 %. B. Globule rouge 5.106/ mm3 de sang. C. Volume globulaire moyen 903. D. Hmoglobine 9gr/100ml. E. Concentration corpusculaire moyenne en hmoglobine 25%. QCM 63 : A propos du sang. A. Le taux normal de leucocytes dun enfant de 10 ans est de 6000 15000/ mm3. B. Le taux moyen de globules blancs chez le nouveau-n est infrieur au taux moyen de lenfant ou de ladulte C. Chez lenfant entre 4 et 10 ans il y a une inversion du taux de lymphocytes et de PNN par rapport aux valeurs observes chez ladulte et le nouveau-n. D. On parle dhyperleucocytose quand il y a une augmentation du taux de globules blancs. E. Les rticulocytes reprsentent 5% des rythrocytes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

221

QCM 64 : Indiquer les valeurs normales chez lhomme adulte. A .Taux de PNN 60 +/- 10 %. B. Taux de PNE 0 1%. C. Taux de PNB 1 3%. D. Taux dHb de 13 17gr/100ml. E. Taux dHt 40 +/- 5%. QCM 65 : Un enfant de 3 ans prsente dimportantes cphales. Le mdecin lui prescrit un certains nombres dexamens. Lhmogramme montre : Globules Rouges 4. 106 / mm3, hmoglobine 14g/100mL, hmatocrite 40%, rticulocytes 50 000/mm3, globules blancs 8000/mm3 (PNN 40%, PNB 3%, PNE 1%, lymphocytes 40%), plaquettes 10 000/ mm3. Que montre lhmogramme ? A. Un nombre anormalement bas de lymphocytes B. Un nombre normal de rticulocytes C. Une thrombopnie avec un risque dhmorragie spontane D. Un volume globulaire moyen de 100 3 E. Une anmie macrocytaire hypochrome QCM 66 : A propos de lanmie hmolytique nonatale par incompatibilit rhsus ftomaternelle : A. Peu importe que lenfant soit rhsus positif ou ngatif, le risque danmie existe seulement si la mre est rhsus ngatif et le pre positif. B. Lanmie hmolytique est due aux anticorps anti-rhsus naturels de la mre qui passent la barrire placentaire et qui provoque la destruction des hmaties. C. Lanmie hmolytique peut mettre en jeu le pronostic vital du nouveau-n lors dune premire grossesse. D. Pour prvenir lanmie on injecte la mre des anticorps anti-rhsus positif quelques minutes aprs laccouchement. E. Les anticorps anti-rhsus de la mre qui traversent la barrire placentaire sont de type IgG. QCM 67 : En ce qui concerne le cytoplasme ou stroma des globules rouges : A. Lhmoglobine est une htroprotine constitue de 4 globines et dun seul hme. B. Le CO2 est transport par la carbhmoglobine grce lhme. C. Ce sont les 4 atomes de fer qui permettent de fixer loxygne. D. Lhmoglobine est constitue dune fraction glucidique la globine et dune fraction non glucidique lhme. E. Les globules rouges doivent leur couleur la prsence du sang quils contiennent. QCM 68 : En ce qui concerne les globules rouges : A. Lhyperhydratation est palli par les pompes Na+/Ca++ qui fonctionnent grce lATP du catabolisme du glucose. B. La mthmoglobine a plus daffinit avec loxygne que lhmoglobine. C. La mthmoglobine rductase permet de passer du fer ferreux au fer ferrique et ainsi permettre de remplacer la mthmoglobine en hmoglobine. D. Ladministration de glycine radioactive permet de dvaluer la dure de vie des globules rouges 120 heure. E. La demi-vie des globules rouges est dtermine grce au 51Cr et slve 28 jours.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

222

QCM 69 : En ce qui concerne le devenir des globules rouges en fin de vie : A. La globine sera transforme en acides amins. B. Le fer est achemin jusquau rein pour finir dans les urines. C. La bilirubine libre non conjugue hydrosoluble se fixe sur lalbumine et est transport vers le foie. D. La bilirubine libre est transforme en bilirubine conjugue par la glucuronyl transfrase. E. Lors de lanmie hmolytique chez le nouveau-n, la bilirubine libre peut devenir dangereuse en se fixant sur les centres nerveux du fait de limmaturit du foie qui est dpass par la quantit de bilirubine produite. QCM 70 : En ce qui concerne lorigine et la formation des globules rouges : A. Il existe une dperdition de lordre de plus de 5 milliards de globules rouges par jours. B. Jusquau stade rythroblaste acidophile la cellule souche va subir des diffrentiations. C. A partir du stade rythroblaste acidophiles la cellule subi une maturation et ne se divise plus. D. Le noyau des rticulocytes est dit pycnotique. E. Le caractre basique des prorythroblastes est d limportante synthse dARNm.

Le tissu musculaire (38 QCM)


QCM 1 : A propos du tissu musculaire A. On dfinit plusieurs fibres squelettiques selon leur origine, structure, modalit de contraction et localisation anatomique. B. Il existe en tout et pour tout 2 types de tissu musculaire : le T.M. stri squelettique et le T.M. lisse. C. Le tissu musculaire lisse est sous la dpendance du systme nerveux vgtatif sympathique et parasympathique. D. Le tissu myocardique est un type particulier de tissu musculaire lisse, dou de contractions autonomes. E. Le tissu musculaire myocardique est totalement autonome. QCM 2 : A propos de la cellule musculaire : morphologie et structure A. Les musculaires ou Rhabdomyocytes peuvent tre lorigine de Rhabdomyosarcome : tumeurs malignes chez lenfant. B. La cellule musculaire qui est une fibre mesure environ quelques 100aines de m quelques cm de long pour un diamtre de quelques 100aines de m. C. La membrane ou sarcolemme comprend pour certains auteurs la membrane plasmique + la lame basale dpaisseurs respectives 5-7 m et 30-40 m. D. Sous le sarcomre sont prsents de nombreux noyaux allongs et aplatis. E. Le cytoplasme contient des myofibrilles disposes uniquement dans certaines zones de la cellule. QCM 3 : A propos de la structure des myofibrilles A. Toutes les bandes sombres/claires se correspondent parfaitement lintrieur dune cellule, les myofibrilles sont donc daspect stri. B. Les microfilaments fins sinsrent sur les disques Z et mesurent 1 m de long pour 5 7 m de diamtre. C. Les colonnettes de Leydig sont mieux vues sur une coupe transversale et alors appeles champ de Cohneim. D. Les bandes I sont birfringentes. E. Il ny a pas de myofilaments fins au niveau de la bande H

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

223

QCM 4 : A propos de la membrane plasmique des fibres musculaires A. La membrane plasmique comprend de trs nombreux orifices dinvaginations tubuleuses transversales de direction perpendiculaire au grand axe de la cellule : les tubules T. B. Ces tubules T permettent la propagation de lexcitation en profondeur de la cellule. C. La membrane plasmique nest pas trs dformable ce qui limite lallongement de la cellule. D. Le sarcolemme est pour certains auteurs compos dune membrane plasmique et dune lame basale, cette dernire tant environ 5 fois plus paisse. E. Les tubules transverses permettent la pntration en profondeur de lexcitation. QCM 5 : A propos des myofilaments pais : A. La myosine est une molcule forme de 4 chanes lgres toutes identiques et de 2 chanes lourdes. B. Les chanes lourdes forment uniquement la queue. La tte est forme uniquement par les chanes lgres. C. Aprs action de la chymotrypsine sur la myosine, on obtient deux fragments : - un form de la plus grande partie de la queue : la meromyosine lourde - un form de la plus petite partie de la queue, de la tte et des chanes lgres : la meromyosine lgre. D. Aprs action de la papane, on obtient une partie forme des ttes globulaires toujours associes aux chanes lgres. E. La tte de la myosine prsente en mme temps le site ATPasique et le site de liaison lactine. QCM 6 : A propos du rticulum sarcoplasmique : A. Cest un rticulum granuleux. B. Il est form de canalicules longitudinaux qui se dversent dans des citernes terminales en rapport troit avec la membrane plasmique. C. Pour un sarcomre, on trouve deux triades : chacune tant compose dun tubule T flanqu de deux citernes terminales et se projetant au niveau de la jonction bande claire bande sombre. D. Il est en rapport avec le sarcolemme, les myofibrilles et les lments du sarcoplasme : appareil de Golgi, enclaves glycogniques, mitochondries. E. Linflux nerveux arrivant au niveau dune cellule musculaire se propage uniquement en surface de la cellule. QCM 7: A propos des fibres rouges lentes : A. La production dATP se fait principalement par phosphorylation oxydative. B. Pour produire de lATP, il faut donc des mitochondries, de la myoglobine et des capillaires en grande quantit. C. Leur contraction est lente car leur activit ATPasique est faible. D. Leur contraction se droule sur un temps assez court. E. Les fibres ont un diamtre important car les mitochondries sont en nombre important. QCM 8 : A propos des fibres blanches et des fibres intermdiaires : A. Les fibres blanches portent ce nom car elles ont peu de myoglobine. B. Les fibres blanches ont une activit ATPasique importante donc une contraction rapide et une fatigabilit rapide. C. Les fibres intermdiaires sont des fibres rouges rapides oxydatives. D. Les fibres intermdiaires ont une activit ATPasique importante comme les fibres rouges lentes. E. Les fibres intermdiaires ont un diamtre compris entre celui des fibres blanches plus grand et celui des fibres rouges rapides plus petit.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

224

QCM 9 : A propos de la topographique du muscle A Lenveloppe conjonctive du muscle, pimysium ou aponvrose, est faite dun conjonctif fibreux dense unitendu. B Le prymisium compartimente le muscle en faisceaux primaires, secondaires, etc. C Chaque cellule musculaire est entoure dun tissu conjonctif lche : lendomysium. D On trouve dans lendomysium des formations vasculaires et nerveuses. E Il y a beaucoup de cellules musculaires au contact du tendon. QCM 10 : A propos de linnervation motrice du muscle squelettique. A Les formations musculaires sont des structures contraction volontaire dpendante du systme nerveux crbro-spinal. B Linnervation motrice dpend du motoneurone qui part de la corne postrieure de la moelle. C Une fibre nerveuse innerve des fibres musculaires de types diffrents, lensemble formant une unit motrice. D Le nombre de fibres musculaires innerv par un mme motoneurone est lev lorsque le mouvement est fin et prcis. E Les fibres motrices tablissent gnralement une synapse neuromusculaire sur lextrmit de la fibre musculaire. QCM 11 : A propos de linnervation motrice du muscle squelettique. A Le motoneurone est un motoneurone multipolaire qui met des fibres motrices amylinises. B Une unit motrice est lensemble form par un motoneurone et toutes les fibres quil innerve. C Une fibre nerveuse innerve jusqu 10 fibres musculaires. D Pour des mouvements trs fins on peut avoir une fibre nerveuse pour une fibre musculaire. E La synapse neuromusculaire stablit dans la partie moyenne de la fibre musculaire. QCM 12 : A propos de la synapse neuromusculaire A Au niveau de la plaque motrice il y a un rapport de continuit entre les deux fibres. B Au niveau de la synapse neuromusculaire, le sarcoplasme de la fibre musculaire est plus abondant et contient peu de noyaux. C La gaine de myline de la fibre nerveuse est interrompue avant larborisation. D Lensemble des deux fentes synaptiques constitue lappareil sous neural. E Lactylcholinestrase se situe au niveau de lappareil sous neural QCM 13 : A propos de l'innervation sensitive A. Les fuseaux neuromusculaires sont des petits organes situs entre les fibres musculaires et sont solidaires de l'endomysium. B. Les cellules extra fusales sac nuclaire sont plus volumineuses que les cellules chaines nuclaires. C. L'innervation gamma, dont le neurone est de diamtre infrieur au motoneurone alpha, concerne les cellules extra fusales. D. La frquence de l'influx nerveux est inversement proportionnelle au degr de l'tirement du muscle. E. Les cellules contractiles intra fusales ont une innervation motrice gamma issue de la corne grise postrieure de la moelle.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

225

QCM 14 : A propos de l'innervation sensitive A. L'innervation motrice gamma envoie un influx moteur constant vers les cellules intra fusales. B. Le moindre tirement des cellules intra fusales provoque un influx sensitif vers la moelle qui est transmis au motoneurone alpha situ dans la corne grise antrieure. C. L'innervation motrice gamma accroit la sensibilit des cellules intra fusales en les positionnant juste au dessus du seuil d'excitation. D. Les cellules sac ou chaine nuclaire possdent des myofibrilles contractiles situes leurs extrmits. E. La fibre sensitive s'enroule autour de la partie centrale de la cellule intra fusale alors que le motoneurone gamma entre en contact avec la cellule au niveau de la partie myofibrillaire. QCM 15 : Concernant les phnomnes observs lors de la contraction musculaire A. En MO, on observe un rtrcissement des 2 demi-bandes claires dans un sarcomre. B. La bande H reste inchange. C. Par diffraction aux rayons X, on constate que les myofilaments pais ou fins ont toujours une mme longueur. D. Elle se caractrise par le glissement des myofilaments pais autour des myofilaments fins. E. Au cours de l'tirement, les bandes sombres s'largissent. QCM 16: A propos du mcanisme d'action de la contraction musculaire A. Au niveau de la synapse neuromusculaire, il y a libration d'Actylcholine dans le rticulum permettant sa dpolarisation. B. La fixation de l'actylcholine sur les rcepteurs de la membrane plasmique entrane l'ouverture des canaux ioniques. C. La libration massive de calcium dans le sarcoplasme entrane la dpolarisation du rticulum. D. Le test l'quorine permet de conclure que la libration de calcium prcde la rponse mcanique. E. L'utilisation de calcium radioactif sur des cellules en contraction permet d'observer un marquage trs diffus dans la cellule. QCM 17 : A propos de linnervation sensitive du muscle stri squelettique A. Linnervation sensitive dun muscle sert renseigner le centre nerveux sur le degr de contraction ou dtirement de ce muscle. B. Les fuseaux neuromusculaires sont de petits organes denviron m de diamtre et de 10m de long. C. Il ny a pas de cellules musculaires lintrieur des fuseaux neuromusculaires. D. Les fuseaux neuromusculaires sont solidaires du primysium et ils sont dlimits par une capsule qui est en fait une enveloppe conjonctive. E. Les cellules musculaires intrafusales sont des cellules musculaires lisses QCM 18 : A propos de linnervation sensitive du muscle stri squelettique A. Que ce soit des cellules intrafusales chane ou sac les noyaux sont toujours en position centrale. B. Les cellules intrafusales possdent une innervation motrice par des motoneurones . C. Les neurones moteurs des cellules musculaires intrafusales se terminent sur les portions priphriques du fuseau neuromusculaire. D. Les fibres nerveuses sensitives du fuseau neuromusculaire partent des parties priphriques du fuseau pour aller vers les centres nerveux tandis que les fibres motrices partent des centres pour aller vers la partie mdiane du fuseau. E. Linflux nerveux envoy cause de la distension du muscle a une certaine frquence qui est proportionnelle au degr dtirement de ce muscle.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

226

QCM 19: A propos de la contraction du muscle stri squelettique A. Lors de la contraction les myofilaments fins rtrcissent alors que les myofilaments pais restent inchangs. B. La contraction se fait par un glissement des myofilaments fins autour des myofilaments pais grce la formation et rupture successives de ponts dunion actine-tropomyosine. C. Le mdiateur de la synapse neuromusculaire est ladrnaline. D. Cest la fixation de lactylcholine sur des rcepteurs de la membrane plasmique de la fibre nerveuse qui dclenche louverture des canaux ioniques. E. Louverture des canaux ioniques entrane une dpolarisation de la membrane de la cellule musculaire. QCM 20 : A propos de la contraction du muscle stri squelettique A. Dans le phnomne de la contraction on peut dire quil y a chronologiquement dabord une rponse lectrique, puis une libration de calcium et enfin la rponse mcanique. B. En utilisant du calcium marqu on observe un marquage diffus dans la cellule au repos. C. Pour fonctionner au maximum, la myosine a besoin dATP mais aussi de lactine. D. La tropomyosine possde un site de fixation pour le calcium. E. Le dcrochement des liaisons actine-myosine ncessite lATP. QCM 21 : A propos de la fibre musculaire strie squelettique A. Lors de la relaxation, la tropomoduline reprend sa place et masque les sites de liaison. B. Le cyanure et les gaz neurotoxiques entranent la mort par asphyxie. C. Les molcules de curare ont une grande affinit pour les rcepteurs de lactylcholine. D. La toxine botulinique dgrade les molcules dactylcholine. La contraction est alors impossible. E. Lors de la myasthnie, des auto-anticorps sont synthtiss contre lactylcholinestrase. QCM 22 : A propos des cellules satellites des fibres musculaires lisses A. Ce sont des cellules souches hyperactives. B. Elles sont positionnes entre la membrane plasmique et la lame basale de la fibre musculaire. C. En cas de lsion, ces cellules binucles peuvent se ractiver et reconstituer dautres fibres. D. Ce sont des cellules volumineuses qui renferment un petit noyau. E. Ce sont des cellules mononucles, dont le noyau est entour dun mince liser cytoplasmique. QCM 23 : A propos du tissu musculaire lisse A. Il compose les muscles lisses contraction volontaire. B. Il est trs largement distribu dans lorganisme. C. Il est prsent au niveau de la peau. D. Cest un tissu vascularis mais non innerv. E. Le cur est un muscle lisse. QCM 24: A propos de la cellule musculaire lisse A. Cest une petite cellule fusiforme aux extrmits effiles, dilate en sa partie mdiane. B. Sa longueur est variable selon sa localisation. C. Sa membrane plasmique prsente de petites vaginations qui forment des vsicules : les cavoles, qui restent en relation avec le rticulum sarcoplasmique. D. Elle est limite par le sarcoplasme. E. Elle communique avec des cellules musculaires lisses par des GAP jonctions.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

227

QCM 25 : A propos des poisons musculaires et des anomalies A. Le Curare inhibe lactylcholinestrase, ce qui provoque une mort par asphyxie. B. La toxine botulinique inhibe la libration de lActylcholine. C. Les gaz neurotoxiques empchent la relaxation des muscles respiratoires. D. Le Curare et les Anticorps auto-immuns produits dans la Myasthnie vont perturber la fixation de lactylcholine sur ses rcepteurs. E. Le Curare et la toxine botulinique inhibent la contraction musculaire. QCM 26 : A propos de la fibre musculaire lisse A. Ses myofibrilles dactine vont venir saccrocher sur les corps denses. B. Les corps denses, situs sous la membrane, sont lquivalent des disques Z des fibres musculaires stries squelettiques. C. Dans les formations vasculaires, son cytosquelette est compos de filaments intermdiaires de Desmine, alors que dans les formations non vasculaires, il est compos de filaments intermdiaires de Desmine et de Vimentine. D. Dans les corps denses, on a une condensation de protines telles que la troponine et lalpha-actinine. E. Elle a un diamtre denviron 20 microns et une longueur denviron 200 microns. QCM 27 : A propos de la fibre musculaire lisse A. Les microfilaments de myosine et dactine vont saccrocher sur les corps denses. B. Les mitochondries sont surtout situes en priphrie de la cellule, sous la membrane plasmique. C. Elle peut atteindre 500 microns de long au niveau de lutrus gravide. D. Sa membrane prsente des tubules T, en relation avec le rticulum sarcoplasmique. E. Le noyau est situ dans un fuseau axial, allong dans le grand axe de la cellule, dans une zone libre de toute structure. QCM 28: A propos de la distribution des fibres musculaires lisses A. Les capsules conjonctives comportent une tunique de fibres musculaires lisses. B. La musculature lisse des organes creux prsente une couche circulaire interne et une couche longitudinale externe. C. Le conjonctif sous-cutan prsente des fibres musculaires lisses isoles ou regroupes en petits faisceaux. D. Les fibres musculaires lisses peuvent constituer de vritables muscles individualiss tels que les muscles arrecteurs des poils. E. L'axe conjonctif des villosits intestinales est en partie form de tuniques de fibres musculaires lisses. QCM 29 : A propos du tissu musculaire A. Il existe deux types de cellules stries dans le myocarde : les cellules myocardiques qui sont des cellules musculaires et les cellules cardionectrices qui jouent un rle dans la conduction mais ne sont pas musculaires. B. Les tubules T des cellules myocardiques se disposent au niveau des stries Z la jonction entre la bande claire et la bande sombre de la cellule. C. Les traits scalariformes reprsentent la zone de jonction entre les cellules, ils comportent deux diffrenciations membranaires particulires dont lune favorisant la communication entre cellules adjacentes. D. Les zonulas adherens permettent dancrer les myofilaments dactine sur les zones longitudinales qui sont lquivalent des disques Z. E. Les gaps jonctions ou nexus opposent une faible rsistance au passage des potentiels daction.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

228

QCM 30 : A propos du tissu musculaire A. Les cellules auriculaires scrtent le facteur natriurtique atrial qui rgule le volume sanguin et la pression artrielle en agissant sur llimination de leau et du sodium au niveau rnal. B. Les cellules du tissu nodal possdent moins de fibres contractiles et sont plus petites que les cellules myocardiques. C. La contraction se propage de loreillette vers les ventricules grce aux gaps jonction. D. Cest le nud sinusal situ la jonction entre oreillette et ventricule qui impose sa frquence lensemble du cur. E. La frquence cardiaque de repos est maintenue environ 70 battements/min grce au systme nerveux vgtatif orthosympathique qui a une action frnatrice. QCM 31 : A propos du tissu musculaire A. Le faisceau de His qui fait suite au nud dAschoff-Tawara et donnera le rseau de Purkinje circule dans la cloison inter ventriculaire. B. Les desmosomes donnent un ancrage pour les myofilaments dactine au niveau des zones transversales des traits scalariformes. C. Contrairement la fibre strie squelettique, la cellule myocardique possde un noyau unique et priphrique. D. La cellule myocardique est fusiforme, simple ou bifurque ses extrmits, extrmits qui vont entrer en contact avec dautres cellules myocardiques ralisant ainsi un rseau tridimensionnel. E. Dans la cellule myocardique, les structures fibrillaires se tiennent lcart du noyau. QCM 32 : A propos du tissu musculaire A. Les tubules T des cellules myocardiques ont un diamtre suprieur ceux des cellules musculaires stries squelettiques. B. Au niveau de latrium, on trouve les cellules auriculaires qui sont de type glandulaire. C. Le rticulum sarcoplasmique a des rapports troits avec les myofibrilles et avec les invaginations tubuleuses et constitue le rservoir Calcium de la cellule. D. Les cellules cardionectrices possdent un potentiel de membrane spcifique en fonction de ltage. E. Il nexiste pas de configuration en triade au niveau des cellules myocardiques. QCM 33 : A propos du tissu musculaire A. La cellule myocardique a une longueur de 50 100 microns. B. La cellule myocardique est strie transversalement comme la cellule strie squelettique. C. Les disques intercalaires ont un rle dans la cohsion des cellules entre elles notamment par leur portion horizontale. D. Les cellules cardionectrices qui constituent le tissu nodal ont un appareil contractile plus dvelopp car ce sont elles qui initie le mouvement cardiaque. E. Le tissu conjonctif constitue les valvules, les anneaux artriels et la charpente du cur. QCM 34 : A propos du tissu musculaire A. Les cellules myocardiques ont un diamtre de 20nm et une longueur de 50 100 nm. B. Les cellules myocardiques sont caractrises entre autre par un noyau unique en position centrale. C. Le tissu myocardique est constitu de cellules musculaires lisses myocardiques. D. Les tubules T de la cellule myocardique se disposent en regard des stries Z. E. Dans les cellules myocardiques les citernes terminales sont en rapport troit avec les tubules T.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

229

QCM 35 : A propos du tissu musculaire A. Les cellules auriculaires scrtent le facteur natriurtique atrial. B. Le facteur natriurtique atrial permet la rgulation de la pression artrielle. C. Les traits scalariformes prsent entre les cellules musculaires lisses cardiaques comportent dans leur zone transversale des desmosomes et des zonulas adherens. D. Les traits scalariformes comportent dans leur zone longitudinale des gaps jonctions. E. Les disques intercalaires permettent entre autre l'ancrage de myofilaments d'actines. QCM 36 : A propos du tissu musculaire A.L'endocarde est l'pithlium qui tapisse les cavits cardiaques et est au contact du sang. B. L'picarde est tapiss par un endothlium. C. Le feuillet viscral est en continuit avec le feuillet parital. D. Les cellules cardionectrices possdent un potentiel de membrane instable qui leur permet une contractilit spontane. E. Les cellules du nud d'Aschoff Tawara sont les cellules cardionectrices qui ont le rythme de contraction le plus lev. QCM 37 : A propos du tissu musculaire A. Le faisceau de His se trouve dans la cloison inter-atriale. B. La prsence de gap jonction dans les disques intercalaires permet la transmission des potentiels d'actions de cellules cellules. C. Dans la cellule myocardique, les citernes terminales sont localises en regard des stries Z. D. Le myocarde n'est constitu que de cellules musculaires stries myocardiques. E. Les cellules cardionectrices du rseau de Purkinje sont celles qui ont le rythmes de contraction le plus rapide. QCM 38 : A propos du tissu musculaire A. Les cellules auriculaires constituent les cellules scrtrices du tissu nodal. B. Les cellules cardionectrices du rseau de Purkinje sont plus grosses, plus ples et possdent moins de myofibrilles. C. Le pricarde sreux est constitu de l'picarde ou feuillet parital et du pricarde proprement dit ou feuillet viscral. D. Les zones transversales des disques intercalaires sont situes la place de la strie Z. E. Les molcules de myosine s'accrochent sur les disques intercalaires par l'intermdiaire des zonula adherens.

Les techniques (12 QCM)


QCM 1 : A propos de la microscopie A. La rsolution de la microscopie optique est de 0,2m alors que celle de la microscopie photonique est de 0,2nm. B. La microscopie lectronique permet un grossissement d'un facteur 1000 par rapport l'il humain. C. En microscopie optique, on a une rsolution de 0,2 nm. D. La microscopie photonique a une rsolution de 2m. E. En microscopie lectronique, les structures denses apparaissent sombres.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

230

QCM 2 : A propos de la microscopie A. En microscopie photonique, un faisceau d'lectrons est projet sur un cran fluorescent ou sur un film photographique aprs traverse d'une coupe de tissu. B. La microscopie lectronique permet un grossissement d'un facteur 100 par rapport la microscopie optique. C. En microscopie lectronique, on a une rsolution de 2nm. D. La microscopie lectronique permet un grossissement d'un facteur 1 000 000 par rapport l'il humain. E. En microscopie lectronique, les structures peu denses apparaissent sombres QCM 3 : A propos de la microscopie optique (MO) : la fixation et les fixateurs A. Le formol 4% est particulirement bien adapt aux petites pices en raison dune pntration rapide. B. Le liquide de Bouin et le liquide de Duboscq-Brazil sont particulirement adapts la fixation de fragment de petite taille en raison dune pntration rapide. C. Le liquide de Carnoy est utilis prfrentiellement pour observer les organites cytoplasmiques. D. La fixation a pour but de figer les structures cellulaires dans un tat qui soit le plus proche possible de celui quelles prsentent ltat vivant. E. Seuls les agents chimiques permettent de fixer des structures cellulaires. QCM 4 : A propos de la microscopie optique A. Le protocole dune prparation de montage en MO sont successivement : prlvement, fixation, dshydratation, passage dans un solvant de la paraffine, inclusion, coupe, dparaffinage, rhydratation, coloration, montage : dshydratation, bain de solvant de type xylne ; observation. B. La paraffine a la proprit entre autres dtre miscible leau et aux alcools. C. Ltape de dshydratation consiste placer lchantillon dans des bains dalcool de concentration dcroissante. D. En MO, les coupes ralises laide dun ultra microtome sont de lordre de 5 7 nm. E. La paraffine est liquide temprature ambiante et solide 56C. QCM 5 : A propos de la microscopie lectronique (ME) A. La taille du prlvement ne doit pas excder le mm 3. B. La fixation est ralise haute temprature afin dviter lautolyse. C. Les milieux dinclusion sont des rsines qui polymrisent temprature ambiante telle que le Baume du Canada ou EUKITT. D. Les rsines utilises pour linclusion prsentent des proprits comparables celle de la paraffine. Elles sont non miscibles leau et aux alcools, miscibles loxyde de propylne. E. Les coupes sont ralises laide dun ultra microtome et sont de lordre de 50nm. QCM 6 : A propos de la MET et de la MEB A. En ME, les colorants les plus utiliss sont lActate dUranyle (cytoplasme) et le Citrate de Plomb (noyaux). B. En ME les coupes sont traites directement sans quil soit ncessaire dliminer la rsine ou de rhydrater. C. En coloration ngative lchantillon apparat plus clair que ce qui lentoure dans le but de visualiser les contours et les irrgularits de surface. D. La dshydratation et lombrage avec un mlange or-palladium est suffisant en MET. E. En ME, les coupes sont recueillies sur une grille mtallique, seul support permettant la fois lobservation et le passage des lectrons.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

231

QCM 7 : A propos de la microscopie optique A. Selon la nature du prlvement et la technique utilise, la fixation ne sera pas ncessaire B. Le formol 4% est particulirement bien adapt aux pices volumineuses car il y pntre rapidement C. Avant la coloration on effectue des coupes des pices opratoires dune paisseur de 5 7m D. Pour durcir les prlvements on utilise de la paraffine qui est miscible leau E. Dans la rgion visible du spectre lumineux, la majorit des constituants de la cellule sont transparents car riche en eau, il va donc falloir effectuer des colorations QCM 8 : A propos de la microscopie lectronique transmission A. La ME en transmission a comme la MO un faisceau lumineux B. Pour la fixation on peut utiliser les mlanges fixateurs de la MO mais il existe des fixateurs usuels que sont le Glutaraldhyde ou le Paraformaldhyde C. Pour une fixation optimale on ralise, en plus de la fixation, une post fixation laide de Glutaraldhyde D. Contrairement la MO, en MET la fixation se fait dans des rsines acryliques ou poxy qui sont de plus grande duret que la paraffine E. Pour raliser linclusion, il faut dshydrater les chantillons dans des bains dalcools de concentration croissante avant de les plonger dans un bain de xylne QCM 9 : A propos de la microscopie optique et lectronique A. Le principe de la coloration en MET est daugmenter lopacit aux lectrons et nest pas une vritable coloration comme en MO B. En MO, avant linclusion en paraffine il faut dshydrater les chantillons puis les rhydrater avant la coloration alors que cette dernire tape nest pas ncessaire en ME C. La fixation en MET se fait en milieu tamponne (pH de 7,2-7 ,5) et basse temprature (- 4C) D. En MET la coloration se fait base de sels de mtaux lourds. Les colorants usuels sont lActate dUranyle pour les noyaux et le Citrate de Plomb pour le cytoplasme E. La ME balayage permet dobserver la surface des cellules avec les reliefs quau niveau de cellules bien isoles QCM 10 : A propos de la microscopie optique et lectronique A. La paraffine a un point de fusion 56C ce qui explique quelle soit solide 20C B. Les coupes en MO sont ralises laide dun microtome muni dun rasoir en acier alors quen MET il sagit dun ultramicrotome muni dun rasoir avec un diamant ou un clat de verre ce qui explique une paisseur de coupe infrieure dans ce dernier cas (50nm) C. Les coupes en MO sont disposes sur une lame porte objet et colles laide de Baume de Canada D. En MO, les colorants basiques (hmalum, bleu de toluidine..) sont chargs positivement et ragissent avec les noyaux E. Un colorant mtachromatique est un colorant capable de donner une teinte diffrente de celle de la solution colorante certaines structures tissulaires (ex : losine) QCM 11 : A propos de la microscopie lectronique transmission A. Le principe demeure le mme que celui de la microscopie optique sauf que le faisceau lumineux est remplac par un faisceau de rayon X. B. La taille du prlvement ne doit pas excder le mm3 C. On peut utiliser les mlanges fixateurs de la MO D. La fixation se ralise haute temprature afin dviter les phnomnes dautolyse. E. Lpaisseur des coupes ralises est 1000 fois plus fine quen MO, c'est--dire quelles sont de lordre de 50 nm.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

232

QCM 12 : A propos des techniques spciales A. Lautohistoradiographie consiste faire pntrer dans les cellules un compos fluorescent et dceler ensuite sa localisation grce la proprit que possdent les fluorochromes impressionner une mulsion photographie. B. Lmulsion est une suspension de fins cristaux de bromure dargent dans de la glatine C. Pour pouvoir inclure des lipides en paraffine aprs utilisation de solvant, on peut les fixer avec de lacide osmique. D. Dans la raction de Feulgen lieu une oxydation chlorhydrique qui libre des fonctions aldhydique du ribose E. Lhistoenzymologie permet de localiser les sites actifs de certaines enzymes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

233

CORRECTION

Correction - Gnralits
QCM 1 : Rponses vraies A, E B. Faux : Rsolution MO=0,2 microns C. Faux : Microscopie photonique = MO D. Faux : le chorion est vascularis QCM 2 : Rponses vraies B, E A. Faux : c'est de la profondeur la superficie C. Faux : Tissu nerveux d'origine ectoblastique D. Faux : Msoblaste est l'origine du tissu conjonctif et de certains pithliums QCM 3 : Rponses vraies C A. Faux : il manque le tissu nerveux ; le tissu osseux est un driv du tissu conjonctif B. Faux D. Faux : l'origine commune est le feuillet superficiel=ectoderme E. Faux : Pas forcment. Cette dfinition est celle du tissu pithlial. QCM 4 : Rponses vraies B, D A. Faux : 3e semaine C. Faux : l'entoblaste ou endoderme est le plus profond des 3 feuillets E. Faux : c'est l'pithlium des voies aro-digestives qui drive de l'entoblaste et non pas les voies arodigestives en entier

Correction Le tissu pithlial


QCM 1 : Rponses vraies D, E A. Faux : les pithliums sont innervs B. Faux : les vaisseaux sanguins sont dans le chorion sous jacent C. Faux : les pithliums peuvent galement se renouveler partir de cellules souches diffrencies (ex:foie) QCM 2 : Rponses vraies : C A. Faux - Les adnomes sont des tumeurs bnignes. B. Faux - La sreuse est lassociation pithlium basale chorion. D. Faux - Ce sont des filaments intermdiaires de cytokratines. E. Faux - De mme intima = association pithlium basale chorion. QCM 3 : Rponses vraies : A, C, D, E B. Faux - 3 catgories: de revtement, glandulaire, et sensorielle QCM 4 : Rponses vraies : C, D A. Faux Le tissu pithlial nest pas vascularis ! B. Faux - Le chorion est le tissu conjonctif sous jacent. E. Faux - Les papillomes sont des tumeurs bnignes. 234

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

QCM 5 : Rponses vraies : A B. Faux Que du prismatique, pas de cubique ! C. Faux - Un msothliome est une tumeur du msothlium. D. Faux - La cytokratine ne fait pas partie du rseau terminal, il est en dessous. E. Faux - On ne peut pas parler de cils concernant les strocils qui ne sont pas contractiles. QCM 6 : Rponses vraies E A. Faux - attention a lorthographe, le bon terme est msothlium B. Faux - cest linverse C. Faux - ce nest pas un pithlium, cest une muqueuse = pithlium + MB + chorion ! D. Faux - pas dpithlium cubique dans les tubes collecteurs. QCM 7 : Rponses vraies A, B, D C. Faux E. Faux - bistratifi. QCM 8 : Rponses vraies B, C A. Faux - cest les pavimenteux simples. D. Faux E. Faux - cest luretre et la vessie. QCM 9 : Rponses vraies C, E A. Faux - tumeur maligne. B. Faux - ce sont les bronchioles terminales. D. Faux - uretre et vessie : de transition mais urtre : cylindrique. QCM 10 : Rponses vraies A, C, D B. Faux - cylindriques E. Faux - pithlium stratifi quelque soit ltat de vacuit ou rpltion. QCM 11 : Rponses vraies A, C, D B. Faux - malpighien= stratifi pavimenteux. E. Faux - cest lurtre. Uretre = polymorphe QCM 12 : Rponses vraies A, D, E B. Faux - exemple la peau. C. Faux - il joue aussi un rle de protection, d'absorption, de barrire slective..... QCM 13 : Rponses vraies A, C, E B. Faux - a pour origine le msoblaste D. Faux - a pour origine l'entoblaste QCM 14 : Rponses vraies A B. Faux - l'endocarde est constitu d'un pithlium, d'une basale et d'un conjonctif C. Faux - la cavit pleurale est borde par une sreuse et n'est donc pas en relation avec l'extrieur. D. Faux - exemple 30 jours pour l'piderme et 3 5 jours pour l'intestin. E. Faux - un pithlium n'est jamais vascularis!

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

235

QCM 15 : Rponses vraies B, C A. Faux - aussi partir de cellules diffrencies exemple dans le rein. D. Faux - c'est le ple basal. E. Faux - le papillome est une tumeur bnigne d'un pithlium de revtement. QCM 16 : Rponses vraies : E A. Faux - non spcifique B. Faux - peut varier dun endroit lautre dune mme basale. C. Faux - le perlcan est labor par les cellules pithliales. D. Faux - chargs ngativement.

QCM 17 : Rponses vraies : A, B, C D. Faux - mtastases = tumeurs secondaires E. Faux - la fibronectine est labore pour moiti par les cellules pithliales (non la plus grande partie) et pour lau par les cellules conjonctives QCM 18 : Rponses vraies B, C A. Faux : basale spare pithlium et chorion D. Faux : ce sont des tumeurs malignes E. Faux : l'adnome est une tumeur bnigne QCM 19 : Rponses vraies B, C A. Faux - glandes sudoripares = glandes exocrines D. Faux - elles sont unicellulaires E. Faux - cest linverse QCM 20 : Rponses vraies E A. Faux - pluricellulaires oui mais intrapithliales B. Faux - apocrine # mrocrine ; apocrine = holomrocrine C. Faux - ce cytoplasme est basophile cad affin pour les colorants basiques. Cest donc un territoire acide D. Faux - le mucus quil soit acide ou neutre est toujours PAS positif. Le mucus neutre en revanche est basophile ngatif et mtachromatique ngatif QCM 21 : Rponses vraies E A. Faux - PAS et imprgnation argentique sont des techniques de MO et non de ME B. Faux - ce nest pas lunique car les cellules conjonctives en synthtisent dautres C. Faux - la majeure partie du collagne IV est synthtise par les cellules conjonctives D. Faux - cest la laminine qui est spcifique des basales QCM 22 : Rponses vraies B, C, D A. Faux - elle joue un rle de filtre grce aux charges ngatives des protoglycanes E. Faux - elle joue un rle de guide dans la rgnration tissulaire QCM 23 : Rponses vraies A, C, D, E B. Faux - elles sont tubuleuses contournes et exocrines QCM 24 : Rponses vraies B, C, E A. Faux - dans le mode apocrine la cellule ne disparat pas cest juste une exagration du mode mrocrine, cest dans le mode holocrine quil y a disparition cellulaire D. Faux - cest sa partie scrtrice qui est ramifie, pas son canal excrteur

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

236

QCM 25 : Rponses vraies A, B C. Faux - les grains de zymogne sont acidophiles D. Faux - le mucus acide est basophile E. Faux - le mucus neutre est PAS positif QCM 26 : Rponses vraies B A. Faux il sagit de pont de nature protique C. Faux les 2 isoformes sont alpha et beta D. Faux il sagit dhterodimre (alpha et beta) E. Faux il en faut 13 QCM 27 : Rponses vraies C A. Faux ce nest pas une paire mais 2 microtubules spars B. Faux ce nest pas possible puisque ces microtubules sont spars, ils ont donc leur 13 protofilaments qui leurs sont propres D. Faux la structure du flagelle est diffrente de celle du cil E. Faux il y aura un dysfonctionnement qui conduira limmobilit, syndrome du cil immobile QCM 28 : Rponses vraies : aucunes A. Faux cest le rle des bras de dynine qui ont une activit ATPasique B. Faux cest le microtubule A C. Faux elles relient le microtubule A laxe tubulaire central D. Faux cest pour le corpuscule basal E. Faux cest un pithlium pseudo stratifi QCM 29 : Rponses vraies B, C, D, E A. Faux ce sont des QCM 30 : Rponses vraies C A. Faux : la trache est un organe, cest vrai si lon considre lpithlium respiratoire de la trache. B. Faux : recouvert par la membrane plasmique ! D. Faux : se sont les microtubules A. E. Faux : territoire superficiel est dpourvu de lame rayonnante. QCM 31 : Rponses vraies A, B, D C. Faux : toujours identique. E. Faux : pont de nature protique. QCM 32 : Rponses vraies B, C, E A. Faux : les cils sont mobiles et les microvillosits sont immobiles. D. Faux : les triplets sont dans le cintosome, dans le cil proprement dit on trouve des doublets priphriques. QCM 33 : Rponses vraies C, D A. Faux : seul le microtubule A est complet. B. Faux : converge vers un axe tubulaire central. E. Faux : au ple apical. QCM 34 : Rponses vraies A, C, E B. microvillosits immobiles D. non, il sagit des molcules de myosine I et de calmoduline

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

237

QCM 35 : Rponses vraies C A. microtubules de diamtre 25 nm B. pas du tout ! D. syndrome du cil immobile E. non, structure trs diffrente. Attention, ne pas confondre cils et strocils QCM 36 : Rponses vraies C, E A. Faux - au niveau des cellules intestinales aussi par exemple B. Faux - pas cils mais plateaux stris ou bordure en brosse D. Faux - filaments d'actine 5 nm ; filaments intermdiaire 10 nm ; microtubules 25 nm QCM 37 : Rponses vraies B, E A. Faux - ils sont plus longs que les plateaux stris ou les bordures en brosses B. Vrai - on peut aussi les retrouver dans le canal pididymaire C. Faux - attention au pige! Il s'agit de digitations mobiles D. Faux - une anomalie de l'axonme du cil QCM 38 : Rponses vraies B, C, E A. Faux - la dure est la mme D. Faux - au cours de cette exprience, on observe uniquement lallongement de laxonme et non un mouvement de battement ciliaire QCM 39 : Rponses vraies C, (D), E A. Faux - cest linverse B. Faux - il sagit dun pithlium pavimenteux simple D. pas sr (les deux rponses sont acceptes) QCM 40 : Rponses vraies B, C, E A. Faux - ple basal D. Faux - les mitochondries fournissent de lnergie aux transporteurs qui se trouvent dans la membrane QCM 41 : Rponses vraies C, E A. Faux : la basale est visible avec la technique du PAS et par imprgnation argentique B. Faux : Collagne IV en petite quantite D. Faux : les cellules epithliales synthtisent du collagne IV en petite quantite QCM 42 : Rponses vraies A, C, E B. Faux : endocrine D. Faux : Ce n'est pas l'pithlium qui est vascularis mais la glande QCM 43 : Rponses vraies C, D A. Faux : canal excrteur B. Faux : les glandes de Liberkuhn sont dans l'intestin E. Faux : les cellules caliciformes sont dans la trache QCM 44 : Rponses vraies A B. Faux : l'estomac comporte des glandes endo-pithliales pluricellulaires C. Faux : il existe aussi des glandes intra-pithliales pluricellulaires D. Faux : ce sont des glandes endopithliales E. Faux : ce sont des glandes acineuses

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

238

QCM 45 : Rponses vraies B, C A. Faux : la composition des lames basales varie d'un tissu l'autre. D. Faux : c'est l'Hparane Sulfate E. Faux : La laminine est une glycoprotine QCM 46 : Rponses vraies A, D, E B. Faux : ce sont les cellules conjonctives C. Faux : le Perlcan est un protoglycane compos d'Hparane Sulfate ( qui est lui un glycosaminoglycane) QCM 47 : Rponses vraies C, E A. Faux : Les produits de scrtion des pithliums glandulaires exocrine seront dverss dans le milieu extrieur ou dans des cavits d'organes B. Faux : Attention, il ne faut pas confondre glandes tubuleuses ramifies (on parle ici de portion scrtrice) et glandes composes qui ont un canal excrteur ramifi. D. Faux : Les glandes parotides sont acineuses QCM 48 : Rponses vraies B, C, E A. Faux : La glande parotide est mrocrine D. Faux : Les glandes muqueuses ont une lumire centrale trs large.

QCM 49 : Rponses vraies A, C, E A. Vrai : cellules caliciformes mucus B. Faux : Apocrine=Holomrocrine D. Faux : c'est le mode mrocrine le plus largement rpandu QCM 50 : Rponses vraies: A, C, D B. Faux: c'est une enzyme donc est trop grosse pour passer E. Faux: idem B

Correction - Le tissu conjonctif


QCM 1 : Rponses vraies E A. Faux : il drive du feuillet msoblastique, parfois du feuillet ectoblastique mais pas entoblastique. B. Faux : cest le tissu pithlial dans lequel on trouve ces jonctions ; dans le tissu conjonctif les cellules sont souvent loignes les unes des autres. C. Faux : dure et lastique D. Faux : cest la matrice qui est constitue par les fibres et la substance fondamentale. QCM 2 : Rponses vraies D A. Faux : la coloration hmalum/osine se ralise en microscopie optique B. Faux : fibres de type collagne = rticules + collagne C. Faux : ce sont les forces de tension qui orientent lagencement des fibres E. Faux : les fibres sont lextrieur de la cellule ; lintrieur on na que du pro-collagne dans des vsicules.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

239

QCM 3 : Rponses vraies A, C, D, E B. Faux : les fibres de collagne ( 1 10 m) ont un plus gros calibre que les fibres rticules ( de lordre dune fraction de micron) QCM 4 : Rponses vraies A, E B. Faux : trs riches en glycine, proline, hydroxy-proline et hydroxy-lysine C. Faux : 15 varits seulement D. Faux : I et V surtout au niveau de la peau ; II au niveau du cartilage QCM 5 : Rponses vraies : A, B, D, E C. Les molcules dlastine sassocient de manire covalente. QCM 6 : Rponses vraies : C, D A. les colorations lectives sont utilises en Microscopie Optique B. les fibres lastiques se disposent en rseaux. E. La fibrilline est forme en premire et sert de charpente pour llastine. QCM 7 : Rponses vraies : A, B, C D. Ce sont des chanes courtes et ramifies dans les glycoprotines. E. Lacide hyaluronique ne se lie jamais de manire covalente avec des protines. QCM 8 : Rponses vraies : B, D, E A. Les GAG chargs ngativement attirent les cations. C. La fibronectine est une glycoprotine. QCM 9 : Rponses vraies : aucune A. Faux: tumeur maligne. B. Faux: cest le fibroblaste. C. Faux: elle est fixe. D. Faux: rle antiviral. E. Faux: ce sont les fibroblastes. QCM 10 : Rponses vraies : B, D A. Faux: dans la moelle osseuse hmatopotique. C. Faux: ce sont les plasmocytes. E. Faux: ce sont les mastocytes qui ont des granulations responsables de lallergie. QCM 11 : Rponses vraies : C, D, E A. Faux : cest lhistamine qui est aussi contenue dans les granulations mastocytaires. B. Faux : il existe un rcepteur sur la membrane du mastocyte responsable de linteraction IgE/ mastocyte. QCM 12 : Rponses vraies : A, D, E B. Faux : les adipocytes sont plus volumineux C. Faux : ce sont des cellules sanguines elles naissent donc dans la moelle osseuse hmatopotique. QCM 13 : Rponses vraies : D, E A. Faux ce sont les fibroblastes. B. Faux activit anti virale. C. Faux HDL: facteur de protection.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

240

QCM 14 : Rponses vraies B, D A. Faux: ont une grande activit de synthse. C. Faux: endocytose. E. Faux: un IgE est fix au rcepteur du mastocyte puis lallergne vient se fixer lIgE et entrane la dgranulation du mastocyte. QCM 15 : Rponses vraies : A, B C. Faux : la phagocytose fait parti de la dfense aspcifique. D. Faux : elles sont BASOPHILES et mtachromatiques. E. Faux : ce sont les plasmocytes. QCM 16 : Rponses vraies : A, B, D C. Faux : graisse blanche= adipocytes univacuolaires : la plus frquente chez lhomme. D. Vrai : car ont des proprits de phagocytose. E. Faux : par exemple les adipocytes. QCM 17 : Rponses vraies : C, D A. Faux : c'est l'inverse HDL/LDL lev = protection B. Faux : les adipocytes ne sont pas toujours regroups, regroups ils forment le tissu adipeux E. Faux : inversion, plurivacuolaires = noyau central ; univacuolaires = noyau priphrique QCM 18 : Rponses vraies : A, B, D, E C. Faux : les monocytes et les cellules qui en drivent correspondent au systme des phagocytes mononucles QCM 19 : Rponses vraies : C, D, E A. Faux : granules cytoplasmiques basophiles et mtachromatiques B. Faux : c'est l'histamine qui est responsable des manifestations cliniques de l'allergie QCM 20 : Rponses vraies : A, B, C D. Faux : tissu pauvre en fibres collagnes E. Faux : la gele de Wharton contient plus de fibres que le msenchyme

Correction - Le tissu cartilagineux


QCM 1 : Rponses vraies : A, D B. Faux - chondroplasTes C. Faux - collagne II associ au IX E. Faux - cest linverse QCM 2 : Rponses vraies : D, E A. Faux - basophile B. Faux - chondronectine seulement C. Faux - cest linverse QCM 3 : Rponses vraies : A, B, C D. Faux - 2 types de croissance : appositionnelle et interstitielle E. Faux - raccourcissement

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

241

QCM 4 : Rponses vraies : B, C, D A. Faux - piglotte + cartilage lastique E. Faux - cest le cartilage hyalin QCM 5 : Rponses vraies : A, E B Faux - matrice dure et lastique. C Faux - le tissu cartilagineux nest pas innerv D Faux - squelette ftal et non adulte QCM 6 : Rponses vraies : A, B, D C Faux - cations sodiums E Faux - soit isoles, soit en faisceaux QCM 7 : Rponses vraies : A B Faux - cest le cartilage lastique C Faux - dans les mnisques cest du cartilage fibreux D Faux - collagne I, V et XII E Faux- pas de prichondre au niveau du tissu fibreux cartilagineux et au niveau articulaire. QCM 8 : Rponses vraies : E A. Faux: prdominance lastique B. Faux: tissu conjonctif prdominance cellulaire C. Faux: les adipocytes de graisse blanche et de graisse brune sont regroups en lobules D. Faux: graisse brune a un rle dans la rgulation thermique chez le foetus et le nouveau-n uniquement QCM 9 : Rponses vraies: E A. Faux: au niveau du stroma = charpente B. Faux: c'est un tissu conjonctif prdominance cellulaire C. Faux: uniquement aprs la pubert D. Faux: constitu aussi par des fibres collagnes qui limitent l'extension des fibres lastiques

Correction - Le tissu osseux


QCM 1 : Rponses vraies : A, C, D B. Faux, ce sont les ostoblastes qui se dposent sur les traves directrices, ils deviendront ultrieurement des ostocytes. E. Faux, la vitamine D nagit pas sur le nombre ou lactivit des cellules. QCM 2 : Rponses vraies : A, D B. Faux, seules les vitamines C et D sont importantes au niveau du squelette. C. Faux, la vitamine C na pas daction sur les sels calciques. E. Faux, le collagne reprsente 95% de la substance osseuse (chiffre connatre) QCM 3 : Rponses vraies : B, D A. Faux, la calcitonine est hypocalcmiante. C. Faux, cette hormone stimule la prolifration des cellules ostoblastiques. E. Faux, la parathormone inhibe la synthse des ostoblastes.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

242

QCM 4 : Rponses vraies : A, B C. Faux, exception : les osselets o persiste le tissu osseux primaire. D. Faux, aucune des vitamines ne favorise lostoclasie. E. Faux, la vitamine D na pas daction sur lactivit ou le nombre des cellules. QCM 5 : Rponses vraies : E A. Faux, cest un des tissus conjonctifs les moins rpandus. Le tissu conjonctif proprement dit le plus reprsent est le tissu conjonctif lche. B. Faux, on le retrouve bien dans les parois des gros vaisseaux mais pas dans les tendons (o il y a du tissu conjonctif fibreux dense prdominance collagne.). C. Faux, on peut en retrouver, les fibres de collagnes permettent dviter que les fibres lastiques se rompent cause dtirements trop importants. D. Faux, cest le tissu rticul qui permet cela. QCM 6 : Rponses vraies : A, C B. Faux, cest une vacuole lipidique et non pas glucidique !!! D. Faux, les localisations sont bonnes mais elles sont seulement retrouves chez le ftus et le nouveaun, et non pas chez ladulte. E. Faux, le stroma cornen est form par du tissu conjonctif fibreux dense prdominance collagne orient bitendu. QCM 7 : Rponses vraies : A, B C. Faux, cest 60% de moelle hmatopotique et non pas de tissu cartilagineux. D. Faux, ce nest pas lendoste mais le prioste. E. Faux, cest au niveau de lpiphyse. QCM 8 : Rponses vraies : A, C, D B. Faux, la substance osseuse est minralise par la phosphatase alcaline et non pas acide. E. Faux, les ostoplastes sont les loges dans lesquels se trouvent les ostocytes. QCM 9 : Rponses vraies: A B. Faux: 20 % C. Faux: dans la partie externe et au centre on trouve de l'os compact D. Faux: la diplo est un tissu spongieux E. Faux: os est en perptuel remaniement QCM 10 : Rponses vraies: D A. Faux: communication par des Gap J au niveau des prolongements cytoplasmiques B. Faux: s'ancrent sur la trave directrice dj existante C. Faux: sont cubiques en activit et aplatis au repos E. Faux: collagne I QCM 11 : Rponses vraies : A, B, E C. Faux: chromatine trs condense D. Faux: dans lostoplaste QCM 12 : Rponses vraies : A, C B. Faux : 1200g de Calcium dans lorganisme D. Faux: dans le tissu osseux, collagnes de type I, V et XII E. Faux: matrice extracellulaire contient des Carbonates de Calcium, des Phosphates de Magnsium et des Cristaux dHydroxy-Apatite.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

243

QCM 13 : Rponses vraies : C, E A. Faux : cest le tissu osseux primaire qui est rencontr dans les ostosarcomes B. Faux: Tissu Osseux secondaire= Tissu osseux haversien. Il en existe 2 types : compact et spongieux D. Faux: on trouve surtout des systmes de Havers incomplets. Ostone= systme de Havers complet QCM 14 : Rponses vraies : C A. Faux : issu de la fusion des Monocytes B. Faux: ce sont les ostocytes qui ralisent lostolyse priostocytaire D. Faux: la rparation des fractures est un processus PHYSIOLOGIQUE E. Faux: le tissu osseux primaire est dsorganis, sans ostones QCM 15 : Rponses vraies : A, E B. Faux , cest lion Calcium. C. Faux, Lostomalacie est une maladie de ladulte. D. Faux, un apport de vitamine D. QCM 16 : Rponses vraies : A ,C, D A. Faux, la substance fondamentale est basophile. B. Faux, cest lassociation dune ostoclasie mdullaire et une ostogense priphrique. E. Faux, los est en perptuel remaniement: cest une structure trs transitoire. QCM 17 : Rponses vraies : B, E A. Faux, cest la face interne de la diaphyse. C. Faux, lostogense est favorise par la calcitonine et lostoclasie par la parathormone. D. Faux, cest lostoclasie qui est favorise par une immobilisation prolonge. QCM 18 : Rponses vraies : C, D A. Faux, se sont les ostoblastes. B. Faux, se sont les ostoBlastes qui se diffrencient en ostocytes. E. Faux, formation dos non lamellaire. QCM 19 : Rponses vraies : B A. Faux, cest linverse C. Faux, pas lunique, existence de points dossification secondaire D. Faux, lame osseuse piphysaire en regard de la diaphyse E. Faux, ce sont les points dossification secondaires qui donnent los sa forme anatomique QCM 20 : Rponses vraies : B,D A. Faux, los non lamellaire peut tre de type priostique ou enchondral mais il est mal adapt au rle du tissu osseux C. Faux, ce sont les canaux de Volkmann (qui sont bien perpendiculaires au grand axe) et non de Havers (// au grand axe) E. Faux, Los primaire est remplac par los secondaire, ne persiste pas. QCM 21 : A, B, D C. Faux, la brche se recomble puisque le prioste nest pas endommag E. Faux, los fabriqu est de los primaire

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

244

QCM 22 : Rponses vraies : D, E A. Faux, Lrosion se fait aussi par des chondroclastes B. Faux, Il sagit en fait de la disparition du cartilage hypertrophique minralis C. Faux, Cest linverse : la zone ostode va devenir la zone ossiforme par minralisation. QCM 23 : Rponses vraies : B, D, E A. Faux, Lhaversification entraine la transformation du tissu osseux non lamellaire en tissu osseux lamellaire mais il est vrai que los lamellaire est en perptuel remaniement tout au long de la vie. C. Faux, Faux, ostone nest pas synonyme de canal de Volkmann. QCM 24 : Rponses vraies : A, D, E B. Faux, il y a comblement de la brche C. Faux, on injecte (rgime) par intermittence de lAlizarine pour se rendre compte de lvolution de la croissance. QCM 25 : Rponses vraies : A, B C. Faux, 99% D. Faux, Non lamellaire E. Faux, primaire QCM 26 : Rponses vraies : A, B, C, E C. VRAI c'est--dire quelles se disposent dans nimporte quelle position dans lespace, et quelles nont pas de forme particulire D. Faux, complet QCM 27 : Rponses vraies : B A. Faux, 20 100 microns C. Faux, Trs minralise D. Faux, cest linverse E. Faux, externe QCM 28 : Rponses vraies : B, C, D A. Faux, est aussi solide ! E. Faux, incomplets

Correction Le sang
QCM 1 : Rponses vraies A, B, C D. Faux - il sagit dun talement monocellulaire E. Faux - rle aussi de dfense de lorganisme QCM 2 : Rponses vraies B, C, E A. Faux - cellules trs hautement diffrencie D. Faux - Ceci est directement li QCM 3 : Rponses vraies B, D A. Faux - elle est le plus souvent lie des mutations de gnes de lankyrine C. Faux - lanisocytose est une variation de taille E. Faux - au niveau de la moelle osseuse et de la rate

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

245

QCM 4 : Rponses vraies A, B, C, E D. Faux - les IgG sont des Ac acquis QCM 5 : Rponses vraies : A, C, D B. Faux - avec un anticoagulant, on obtient du plasma et le culot. E. Faux - la matrice liquide est le plasma. QCM 6 : Rponses vraies : A, D, E B. Faux - elle est augmente chez le nouveau-n mais diminue chez lenfant. C. Faux - la fixation se fait par disscation. QCM 7 : Rponses vraies : E A. Faux - le cytoplasme est osinophile = acidophile. B. Faux - forme biconcave. C. Faux - GR est anucl, sans organite. D. Faux - son diamtre est de 7,5 m. QCM 8 : Rponses vraies : B, D, E A. Faux - si groupe B : GR avec antigne B et srum avec anticorps antiA. C. Faux - la phrase est vrai sauf que ANISOCYTOSE = modification de la taille. QCM 9 : Rponses vraies : Aucune A. Faux, le pre doit tre rhsus positif et la mre rhsus ngatif. B. Faux, les globules rouges ftaux passent dans le sang maternel qui produit des anticorps qui passent dans le sang ftal et dtruisent les globules rouges ftaux. C. Faux, le traitement prventif est mis en place juste aprs la premire grossesse. D. Faux, pas uniquement des IgM mais en majorit. E. Faux, rhsus positif. QCM 10 : Rponses vraies : A, D B. Faux, elle fixe le CO2 C. Faux, Hb : 4 hmes qui portent le fer ferreux : Fe2+ E. Faux, il y a la mthmoglobine rductase qui transforme Fe3+ en Fe2+ QCM 11 : Rponses vraies : A, E B. Faux, la glycine est capte immdiatement par les cellules donc la radioactivit est nulle. C. Faux, cest la dure de vie moyenne qui est de 120 jours. D. Faux, le 51Cr* se fixe sur la membrane plasmique des globules rouges. QCM 12 : Rponses vraies : C, E A. Faux, le fer de lhme est recycl ainsi que la globine. B. Faux, elle est transporte par lalbumine. D. Faux, limination aussi par les selles. QCM 13 : Rponses vraies : A B. Faux, donne 16 globules rouges. C. Faux, il y a plusieurs intermdiaires. D. Faux, uniquement en cellules de la ligne rouge E. Faux, cest de la moelle osseuse et pas de la moelle pinire.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

246

QCM 14 : Rponses vraies : B, D, E A. Faux - de moins en moins basophile C. Faux - diminue QCM 15 : Rponses vraies : A, B, E C. Faux - observ chez la femme, il correspond un des chromosomes X inactiv. D. Faux - ce sont les granulations neutrophiles QCM 16 : Rponses vraies : A, D B. Faux - cest dans la voie indpendante de lO2 C. Faux - elles ont un pouvoir bactricide. Cest la lactoferrine qui a un pouvoir bactriostatique. E. Faux - pas plus dune heure. QCM 17 : Rponses vraies : B, D, E A. Faux - 60% C. Faux - les granulations primaires sont moins nombreuses QCM 18 : Rponses vraies : A, E B. Faux: cest lhypo-oxygnation C. Faux: pertes digestive, urinaire et par la sueur du fer importantes donc necessit dun apport alimentaire D. Faux: seulement lEPO QCM 19 : Rponses vraies : C, D A. Faux: non pathologique car pour une femme on a un cart de 35 45% B. Faux: par mm3 et non mL E. Faux: il ny a jamais dhyperchromie QCM 20 : Rponses vraies : B A. Faux: polynuclaire=granulocyte, le 2me type sont les mononuclaires C. Faux: ce sont les PNB qui on tune affinit pour lazur D. Faux: 60% E. Faux: cest linverse entre primaire et secondaire QCM 21 : Rponses vraies : A, B, C D. Faux: la lactoferrine nest pas une enzyme E. Faux: aspcifique QCM 22 : Rponses vraies : A, C, D, E B. Faux: grce leurs proprits de diapdse QCM 23 : Rponses vraies B, E A. Faux: donne 8 PNN C. Faux: plus de granulations secondaires ! D. Faux: voir item E QCM 24 : Rponses vraies D A. Faux: hparine = GAG acide B. Faux: dans le secteur tissulaire essentiellement ! C. Faux: tous les PN ont la proprit de diapdse ! E. Faux: Les IgE ne sont pas produites par les PNB.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

247

QCM 25 : Rponses vraies A, E B. Faux: PNE contiennent un facteur inhibant la dgranulation des mastocytes et des PNB. C. Faux: Pas IgA, que des IgE D. Faux: Cest lobservation en ME QCM 26 : Rponses vraies A, D, E B. Faux: PNE impliqus dans infection parasitaires ! C. Faux: PNE dans les tissus : 10 jours alors que PNN : 4 5 jours ! QCM 27 : Rponses vraies A. Faux: sur un frottis mdullaire B. Faux: pas de granulations secondaires C. Faux: pas une tape de division cest juste une maturation du mtamylocyte en PNN ! D. Faux: reprsentent de 10% E. Faux: vasculaire: 12h tissulaire: 4 5 jours QCM 28 : Rponses vraies B, D A. Faux: secteur marginal pas explor dans la prise de sang ! C. Faux: pas lhistamine cest lhparine qui est un GAG acide anticoagulant E. Faux: dgranulation lie la fixation dallergne sur 2 IgE qui sont elles-mmes fixes sur des rcepteurs IgE de la membrane des PNB. QCM 29 : Rponses vraies A, B, D C. Faux: que du compartiment vasculaire au compartiment tissulaire E. Faux: Pas de phagocytose des parasites ! QCM 30 : Rponses vraies C, E A. Faux: 10 jours B. Faux: maturation mdullaire D. Faux: dans le secteur mdullaire QCM 31 : Rponses vraies B A. Faux: dilatation des vaisseaux : hypotension C. Faux: PNE noyau bilob D. Faux: 1 3 % E. Faux: Rcepteur des IgE sur les PNB. QCM 32 : Rponses vraies B A. Faux: grand lymphocyte. C. Faux: lymphocytes B. D. Faux: physiologique. E. Faux: centraux QCM 33 : Rponses vraies A, D, C B. Faux: cest pour les petits lymphocytes. E. Faux: 6% +/- 2%. QCM 34 : Rponses vraies C, D, E A. Faux: PNN. B. Faux: 3 jours.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

248

QCM 35 : Rponses vraies D, E A. Faux: 3 000 4 200 (60% +/- 10%) B. Faux: 60 180. C. Faux: trop. 0 60. E. Vrai : 240 480. QCM 36 : Rponses vraies : A. Faux: que lorsqu'elles sont active B. Faux: le rcepteur du facteur de von Willebrant se situe sur les plaquettes alors que le facteur de von Willebrant se trouve au niveau du collagne sous endothlial. C. Faux: antithrombogne. D. Faux: une vasoconstriction rflexe. E. Faux: les plaquettes actives librent de l'ADP et de la srotonine. QCM 37 : Rponses vraies : A, E B. Faux: le calcium est indispensable l'interaction du fibrinogne et son rcepteur. C. Faux: le clou plaquettaire se forme pendant l'hmostase primaire. D. Faux: C'est la thrombine qui permet cette transformation. QCM 38 : Rponses vraies : B A. Faux: c'est la fragmentation du cytoplasme! C. Faux: il drive du mgacaryocyte basophile. D. Faux: le prorythroblaste est la cellule souches dtermine qui donne naissance aux GR. E. Faux: de la thrombopotine. QCM 39 : Rponses vraies : A, B, C D. Faux: 8 jours. E. Faux: le risque d'hmorragie spontane est partir d'un nombre de plaquette d'environ 20000/mm3 de sang. QCM 40 : Rponses vraies : C, D A. Faux: c'est le mgacaryocyte granuleux B. Faux: c'est la plasmine qui transforme la fibrine en pdf. E. Faux: la stabilisation par la fibrine se fait lors de l'hmostase secondaire QCM 41 : Rponses vraies : B, C, D A. Faux: Ces tapes sont intriques. E. Faux: Cest linverse, le facteur de Von Willebrand est sur le collagne et la plaquette exprime son rcepteur. QCM 42 : Rponses vraies : B, C, E A. Faux: Ladhsion est suivie de lactivation. D. Faux: Le rcepteur du fibrinogne nest exprim que par la plaquette active. QCM 43 : Rponses vraies : A, B, C, E D. Faux: Cest la fibrine qui est dgrade en PDF. QCM 44 : Rponses vraies : A, C B. Faux: Cest le mgacaryocyte granuleux ou thrombocytogne. D. Faux: Elle est sous la dpendance de la Thrombopotine. E. Faux: Les plaquettes survivent 10 jours dans le courant sanguin.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

249

QCM 45 : Rponses vraies : B, C, D A. Faux: La fourchette du taux normal de plaquettes est 150 000 - 400 000 E. Faux: Cest le Mgacaryocyte qui a un noyau polyplode. QCM 46 : Rponses vraies B, C, D, E A. Faux: les cellules souches multipotentes ne sont pas morphologiquement identifiables sur un frottis mdullaire QCM 47 : Rponses vraies A, C, E B. Faux: chez la souris : tout au long de sa vie D. Faux: cest linverse : BFUE CFUE. QCM 48 : Rponses vraies A, B, C, D, E QCM 49 : Rponses vraies A B. Faux: la souris meurt dinfection il ny a plus de globules blancs pour dfendre lorganisme C. Faux: cest la 3eme semaine quelle se met en place D. Faux: cest ds la 6eme semaine quelle se met en place E. Faux: moelle osseuse et non moelle pinire QCM 50 : Rponses vraies B, C, D A. Faux: la cellule mre donne une cellule fille qui va se diffrencier et une cellule fille qui va rester souche. E. Faux: cest dabord une circulation extra embryonnaire qui se met en jeu : la 3me semaine QCM 51 : Rponses vraies A, E B. Faux: un mme nodule peut tre prcurseur de plusieurs lignes sanguines C. Faux: la cellule souche possde le mme caryotype, elle a donc aussi lanomalie D. Faux: cest linverse : BFUE 8 15 divisions et CFUE 6 divisions QCM 52 : Rponses vraies A, E B. Faux: il y a une reconstitution des 3 lignes C. Faux: ce sont les prorythroblastes D. Faux: il y a aussi des CFUS qui sont multipotentes QCM 53 : Rponses vraies B, C, E A. Faux: la dtermination concerne la cellule souche multipotente D. Faux: les deux hmatoposes sont concomitantes du 4me mois la fin du 8me mois : quand se termine lhmatopose hpato splnique QCM 54 : Rponses vraies D, E A. Faux: elles se divisent lentement B. Faux: les nodules sont de couleur blanchtre C. Faux: pas des lymphocytes : pour ceux-ci cest la cellule souche lymphode QCM 55 : Rponses vraies : Aucune A. Faux : Les lymphocytes adultes se localisent surtout dans les organes lymphodes priphriques B. Faux: Les petits lymphocytes reprsentent 90% des lymphocytes du sang. C. Faux: Granulations azurophiles colores en fuchsia. D. Faux: LB avec CD19 et CD20. LT avec CD3. E. Faux: La diminution du nombre de lymphocytes est nomme lymphopnie.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

250

QCM 56 : Rponses vraies A, B, E C. Faux : LT dtruisent les cellules tumorales. D. Faux: ce sont les plasmocytes qui scrtent les Ig. QCM 57 : Rponses vraies B, D, E A. Faux : Diamtre des monocytes=15-20 microns C. Faux: Les microgliocytes sont dans le tissu nerveux. QCM 58 : Rponses vraies B, D Attention dans ce QCM, il faut considrer le nombre absolu de chaque lment par millimtre cube de sang (et non pas leur proportion qui est fausse par laugmentation du nombre de lymphocytes). A. Faux : Nombre normal de PNN compris entre 2700 et 6000. C. Faux : La formule leucocytaire adulte comporte des proportions de 60% PNN et 30% Lymphocytes environ. D. Vrai : Nombre normal de monocytes compris entre 270 et 600. E. Faux : Nombre normal de PNE compris entre 90 et 200. QCM 59 : Rponses vraies A, C, E B .Faux : Les granulations sont dans le granulomre. D. Faux: 150 000 400 000 plaquettes par millimtre cube de sang. QCM 60 : Rponses vraies A, D A. Vrai - valeur normale des PNN : 2250 7000/ mm3 de sang + CALCUL : le taux de PNN est de 60+/- 10%, pour obtenir les valeurs il faut multiplier % par les valeurs des GB + Exemple : * pour la valeur min 0,50x4500 = 2250 * pour la valeur max 0,70x10000 = 7000 B. Faux : valeur normale des GB : 4500 10000/ mm3 C. Faux : valeur normale des Lymphocyte : 900 4000/ mm3 (mme calcul quavec les PNN mais avec 30+/- 10% pour les lymphocytes) D. Vrai - valeur normale des PNE : de 45 300/ mm3 (mme calcul quavec les PNN avec 1 3%). E. Faux : valeur normale des Monocytes : 180 800/ mm3 (mme calcul quavec les PNN avec 6+/- 2%) QCM 61 : Rponses vraies A, B, E A. Vrai - valeur normale des PNE : 45 300/ mm3. B. Vrai - VGM = Ht / nombre GR = 0.3.109 / 4.1O6 = 753 (valeur normale de 85 95). NB : il faut multiplier lhmatocrite par 109 pour obtenir le rsultat en 3 C. Faux : impossible !!! Lhyperchrome nexiste pas D. Faux : CCMH = Hb / Ht = 10 / 30 = 33% normochrome (valeur normale 32 36 %). QCM 62 : Rponses vraies A, B, C A. Vrai - valeur normale de lHt est de 40 +/- 5% chez la femme. B. Vrai - valeur normale des GR est de 4,5.106 +/- 700000. C. Vrai - VGM normal : 85 95 3 D. Faux : valeur normale de lHb est de 12 16gr/100ml. E. Faux : valeur normale du CCMH est de 32 36%.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

251

QCM 63 : Rponses vraies A, D B. Faux : taux moyen GB * nouveau-n 18000/ mm3 donc suprieur. * adulte 6000/ mm3 * enfant 9000/ mm3 C. Faux : retour aux valeurs normales entre 4 et 10 ans. E. Faux : 1% QCM 64 : Rponses vraies A, D B. Faux : PNE 1 3%. C. Faux : PNB 0 1%. E. Faux : Ht homme 45 +/- 5%. QCM 65 : Rponses vraies B, C, D A. Faux : * Dans lhmogramme, lymphocytes 40% et globules blancs 8000/mm3 donc il y a 0,40 x 8000 = 3200/ mm3 lymphocytes * Or les valeurs normales chez lenfant sont : 60 +/- 10% de lymphocytes et 6000 15 000/mm3 pour les GB * Les valeurs seuils sont donc : => 0,50 x 6000 = 3000 => 0,70 x 15 000 = 10 500 * Dans ce cas, 3200 est bien situ dans les valeurs normales, donc le taux de lymphocytes est suffisant B. Vrai - Taux normal de rticulocytes est de 25 000 100 000/ mm3 C. Vrai - Plaquettes = 150 000 400 000/ mm3 On parle de thrombopnie si le taux est inf. 150 000 plaquettes et sil est inf. 20 000 il y a un risque dhmorragie spontane E. Faux : CCMH = 14 / 40 = 35% cest donc une anmie macrocytaire (VGM de 1003) normochrome (35% bien entre les valeurs normales de 32 36%) QCM 66 : Rponses vraies : D, E A. Faux, il faut que lenfant soit rhsus positif pour que la mre rhsus ngatif dveloppe une rponse immunitaire. B. Faux, les anticorps anti-rhsus maternels sont acquis et non naturels, il nexiste pas danticorps antirhsus naturels. C. Faux, les problmes engendrs par lanmie ne peuvent se rencontrer qu partir de la deuxime grossesse car la rponse immunitaire primaire est lente et donc les anticorps anti-rhsus nont pas le temps dapparatre. QCM 67 : Rponses vraies : C A. Faux, il y a 1 globine et 4 hmes. B. Faux, le CO2 est bien transport par la carbhmoglobine mais grce la globine. D. Faux, ce nest pas glucidique mais protique. E. Faux, cest nimporte quoi, les globules rouges doivent leur couleur lhmoglobine. QCM 68 : Rponses vraies : E A. Faux, Na+/K+ B. Faux, la mthmoglobine est incapable de fixer lO2 C. Faux, cest du fer ferrique (Fe3+) en fer ferreux (Fe2+). D. Faux, cest 120 jours.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

252

QCM 69 : Rponses vraies : A, D, E B. Faux, le fer est recycl pour lrythropose. C. Faux, la bilirubine libre est liposoluble. (Libre<----->Liposoluble) QCM 70 : Rponses vraies : A, B, C, E D. Faux, les rticulocytes sont anucls.

Correction Le tissu musculaire


QCM 1 : Rponses vraies A, C B. Faux : il y a aussi le tissu musculaire stri myocardique qui constitue un 3me type D. Faux : cest un type trs particulier de tissu musculaire stri comme lindique son nom E. Faux : rgulation par le systme nerveux (vgtatif) QCM 2 : Rponses vraies A, C B. Faux : 10aine de m D. Faux : ne pas confondre sarcolemme et sarcomre ! E. Faux : myofibrilles occupent la majorit du volume de la cellule QCM 3 : Rponses vraies A, B, C, E D. Faux : ce sont les bandes A qui sont birfringentes QCM 4 : Rponses vraies A, B, D C. Faux : au contraire la membrane plasmique est trs lastique et rsistante pour faire face aux nombreux changements de formes de la cellule selon ltat de contraction E. Faux : non, ce sont les tubules T QCM 5 : Rponses vraies : D, E A. Faux : les chanes lgres sont identiques 2 2. B. Faux : les chanes lourdes forment la queue et une partie de la tte. C. Faux : cest le contraire QCM 6 : Rponses vraies : B, C, D A. Faux : cest un rticulum lisse E. Faux : propagation en surface et en profondeur. QCM 7 : Rponses vraies : A, B, C D. Faux : fatigue lente do contraction maintenue dans le temps E. Faux : diamtre faible car peu de myofibrilles QCM 8 : Rponses vraies : A, B, C, E D. Faux : les fibres rouges lentes ont une activit ATPasique faible. QCM 9 : Rponses vraies B, C, D A. Faux : conjonctif fibreux dense bitendu E. Faux : cest par lintermdiaire de toutes les formations conjonctives que les efforts de la contraction individuelle vont tre transmis aux extrmits.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

253

QCM 10 : Rponse vraie A B. Faux : corne antrieure C. Faux : du mme type D. Faux : cest le contraire E. Faux : dans la partie mdiane QCM 11 : Rponses vraies B, D, E A. Faux : mylinises C. Faux : jusqu 150 fibres musculaires QCM 12 : Rponses vraies C, D, E A. Faux rapport de contigut B. Faux nombreux noyaux QCM 13 : Rponses vraies A. Faux : fuseau neuromusculaire solidaire du primysium B. Faux : cellules intra fusales sac nuclaire C. Faux : L'innervation gamma concerne les cellules intra fusales D. Faux : frquence de l'influx nerveux est proportionnelle au degr de l'tirement du muscle E. Faux : innervation motrice gamma issue de la corne grise antrieure de la moelle QCM 14 : Rponses vraies A, B, C, D, E QCM 15 : Rponses vraies A, C B. Faux : la bande H diminue voire disparait D. Faux : glissement des myofilaments fins autour des myofilaments pais E. Faux : Au cours de l'tirement, les bandes sombres restent inchanges QCM 16 : Rponses vraies B, D, E A. Faux : libration d'Actylcholine dans l'appareil sous neural C. Faux : la dpolarisation du rticulum entrane la libration massive de calcium dans le sarcoplasme QCM 17 : Rponses vraies A, D B. Faux : 1/2mm de diamtre et 10 mm de long C. Faux : il y a des cellules musculaires lintrieur des fuseaux neuromusculaires : cellules intrafusales E. Faux : cellules stries QCM 18 : Rponses vraies A, C, E B. Faux : neurones D. Faux : Sensitif part de la partie mdiane et moteur arrive partie priph QCM 19 : Rponses vraies E A. Faux : Les myofilaments ont toujours la mme longueur B. Faux : Ce sont des ponts actine-myosine C. Faux : cest lactylcholine D. Faux : Fixation de lactylcholine sur des rcepteurs de la membrane de la fibre musculaire QCM 20 : Rponses vraies A, C, E B. Faux : Au repos le marquage est strictement localis dans les cavits du RE. D. Faux : Cest la troponine

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

254

QCM 21 : Rponses vraies : C A. Faux : tropomyosine B. Faux : curare D. Faux : inhibe la libration de lactylcholine E. Faux : contre les rcepteurs de lactylcholine QCM 22 : Rponses vraies : B, E A. Faux : quiescentes C. Faux : mononucles D. Faux : petites QCM 23 : Rponses vraies : B, C A. Faux : involontaire D. Faux : innerv E. Faux : stri QCM 24 : Rponses vraies : A, B, E C. Faux : invaginations D. Faux : sarcolemme QCM 25 : Rponses vraies B, C, D, E A. Faux : le curare se lie aux rcepteurs cholinergiques et empche la fixation de l'actylcholine. QCM 26 : Rponses vraies B A. Faux : il n'y a PAS DE MYOFIBRILLE dans les fibres musculaires lisses, mais des myofilaments. C. Faux : c'est l'inverse D. Faux : PAS DE TROPONINE dans la fibre musculaire squelettique E. Faux : la fibre musculaire lisse mesure de 100 200 microns de long en moyenne et 5 10 microns de diamtre. QCM 27 : Rponses vraies B, C, E A. Faux : les microfilaments de myosine se tiennent distance des corps denses. D. Faux : CAVEOLES dans fibre musculaire lisse - TUBULES T dans fibre musculaire strie QCM 28 : Rponses vraies B, C, D A. Faux : cellules isoles ou petits faisceaux de fibres musculaires lisses dans les capsules conjonctives E. Faux : cellules isoles ou petits faisceaux de fibres musculaires lisses dans l'axe conjonctif des villosits intestinales. QCM 29 : Rponses vraies : C, E A. Faux. Les cellules cardionectrices sont aussi des cellules musculaires. B. Faux. Ils se disposent au niveau des stries Z, ce qui ne correspond au milieu de la bande claire. C. Vrai. Communication grce aux nexus. D. Faux. Lancrage se fait au niveau des zones transversales. QCM 30 : Rponses vraies : A, C B. Faux. Ces cellules sont plus grosses. D. Faux. Le nud sinusal est situ sous lorifice de la veine cave craniale, dans latrium. E. Faux. Cest le parasympathique qui a une action frnatrice.

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

255

QCM 31 : Rponses vraies : A, E B. Faux. Les desmosomes sont toujours situ lcart des structures filamentaires. C. Faux. Noyau central. D. Faux. La cellule myocardique est cylindrique. QCM 32 : Rponses vraies : A, B, C, D, E QCM 33 : Rponses vraies : A, B, E C. Faux. Cest par leur portion verticale o se trouvent desmosomes et zonula adherens. D. Faux. Moins de myofibrilles, appareil contractile plus faible. QCM 34 : B, D A. Faux, un diamtre de 20m et une longeur de 50 100 m!!! C. Faux, des cellules musculaires stries myocardiques. E. Faux, il n'existe pas de citerne terminale, se sont les formations pdicules qui sont en rapport avec les tubules T. QCM 35 :A, B, D, E. C. Faux, les cellules musculaires stries myocardiques. QCM 36 : C, D A. Faux, l'endocarde est constitu d'un pithlium, d'une membrane basale et d'un conjonctif. B. Faux, par un msothlium. E. Faux, c'est le nud sinusal. QCM 37 : B A. Faux, c'est dans la cloison inter ventriculaire. C. Faux, il n'y a pas de citerne terminale, se sont les tubules T. D. Faux, ainsi que de cellules cardionectrices et cellules auriculaires. E. Faux, le plus lent. QCM 38 : B, D A. Faux, se sont les cellules cardionectrices qui appartiennent au tissu nodal, en revanche les cellules auriculaires sont bien scrtrices. C. Faux, feuillet viscral = picarde feuillet parital = pricarde proprement dit. E. Faux, c'est l'actine.

Correction Les techniques


QCM 1 : Rponses vraies E A. Faux : Microscopie Optique = Microscopie Photonique de rsolution 0,2m B. Faux : en ME, on a un grossissement d'un facteur 1000 par rapport la MO C. Faux : Me : rsolution de 0.2nm D. Faux : 0,2m

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

256

QCM 2 : Rponses vraies D A. Faux : en ME B. Faux : facteur 1000 C. Faux : Rsolution en ME=0,2nm E. Faux : les structures peu denses apparaissent claires QCM 3 : Rponses vraies B, D A. Faux : bien adapt aux pices volumineuses en raison dune pntration lente. C. Faux : pour prserver les structures nuclaires et en particulier les chromosomes (caryotype). E. Faux : il existe aussi des agents physiques : conglation et dessiccation. QCM 4 : Rponses vraies A B. Faux : non miscible leau et aux alcools. C. Faux : de concentration croissante (50, 70, 90, 100) D. Faux : ralises avec un microtome, sont de lordre de 5 7 m. E. Faux : paraffine liquide 56C et solide temprature ambiante. QCM 5 : Rponses vraies A, D, E B. Faux : lautolyse a lieu temprature ambiante et la fixation 4C. C. Faux : Le baume du Canada est utilis pour le montage en MO. Linclusion en ME est ralise avec des Rsines Acryliques, Epoxy. QCM 6 : Rponses vraies B, C, E A. Faux : lActate dUranyle pour le noyau et le Citrate de Plomb pour le cytoplasme. D. Faux : cest au MEB. QCM 7 : Rponses vraies : C, E A. Faux, la fixation est indispensable B. Faux, le formol est bien adapt en raison dune pntration lente D. Faux, la paraffine est non miscible leau ni aux alcools QCM 8 : Rponses vraies : D A. Faux, cest un faisceau dlectrons en ME B. Faux, les mlanges fixateurs de la MO sont inutilisables C. Faux, la post fixation se fait avec du ttroxyde dOsmium E. Faux, le xylne est utilis en MO pour la paraffine, en ME les rsines et poxy sont miscibles loxyde de propylne QCM 9 : Rponses vraies : A, B, D C. Faux, cest basse temprature mais + 4C E. Faux, permet cette observation sur des cellules isoles et sur des tissus ou organes QCM 10 : Rponses vraies : A, B, D C. Faux il sagit dalbumine glycrine E. Faux, il sagit du bleu de toluidine QCM 11 : Rponses vraies B A. Faux Cest un faisceau dlectron C. Faux D. Faux La fixation se fait basse temprature (4C) E. Faux 100 fois plus fines

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

257

QCM 12 : Rponses vraies B, C, E A. Faux On introduit un compos radioactif qui met des radiations D. Faux Cest une hydrolyse chlorhydrique sur le dsoxyribose

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

258

POLYCOPI : QCM N :

PAGE N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : -------------------------------------------------------------------------------------------------------------------------------

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

259

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

260

POLYCOPI : QCM N :

PAGE N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : -------------------------------------------------------------------------------------------------------------------------------

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

261

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

262

POLYCOPI : QCM N :

PAGE N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : -------------------------------------------------------------------------------------------------------------------------------

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

263

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

264

POLYCOPI : QCM N :

PAGE N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : ------------------------------------------------------------------------------------------------------------------------------POLYCOPI : PAGE N : QCM N :

ITEM :..

ou

NONC

Erreur : Nom Prnom et N de Tl ou E-mail : -------------------------------------------------------------------------------------------------------------------------------

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

265

Tous Droits rservs au Tutorat Associatif Toulousain (Droits dposs chez Crasafe) Sauf autorisation, la duplication, la vente, la diffusion partielle ou totale de ce polycopi sont interdites

266

Vous aimerez peut-être aussi