Vous êtes sur la page 1sur 15

UNIVERSITE NATIONALE DABOMEY-CALAVI ECOLE POLYTECHNIQUE DABOMEY-CALAVI DEPARTEMENT DE GENIE DE BIOLOGIE HUMAINE Filire : Analyse biomdicale (ABM) Anne

dtude : 2me anne. Cours : Gntique molculaire.

EXPOSE
Les OGM & lES MUTATIONS
Prsent par :

MEHOUME Sabine
Au :

Professeur Clment AGBANGLA


ANNEE ACADEMIQUE : 2011-2012

PLAN
INTRODUCTION IIIGnralit Les mutations A- Les causes des mutations
1- La fiabilit de la polymrase et les erreurs de rplication 2- Des altrations affectant les bases 3- Les mutations spontanes du cadre de lecture

B- Agents mutagnes III- Les Organismes Gntiquement Modifis (OGM) A- Quelques objectifs des OGM B- Origine des OGM C- Mcanismes entre mutation et OGM ; diffrents OGM D- Quelques inconvnients lis la manipulation gntique

Conclusion Bibliographie

INTRODUCTION
En gntique, une mutation est une modification irrversible de l'information gntique et hrditaire contenue dans un gnome. De nombreux micro-organismes (bactries, algues, levures) sont relativement faciles modifier et cultiver, et sont un moyen relativement conomique pour produire des protines particulires vise mdicale travers ce procd de mutation: insuline, hormone de croissance, etc. Ces cellules ou organismes obtenues aprs la mutation sont des Organismes Gntiquement Modifis. Un organisme gntiquement modifi (OGM) est un organisme vivant dont le patrimoine gntique a t modifi par l'Homme. Jusqu' un pass rcent, la slection naturelle au niveau des tres humains na jamais dpass la barrire dune mme espce dans le monde vivant. Actuellement, on assiste un dveloppement des techniques qui rendent possible le transfert de gnes, non seulement entre des espces du mme rgne, mais aussi, des espces du rgne animal vers celles du rgne vgtal et vice versa. Quentend-t-on en ralit par ( OGM ) et mutations ?

I-

Gnralits

Les scientifiques ont observ que suite une insertion, effectue par transformation de la plante laide de lADN transgnique, des mutations du gnome sont trs souvent observes. Ces mutations sont soit des dltions (disparition dun bout dADN), soit des rarrangements de lADN de la plante (modifications de la place des gnes), soit des introductions dADN superflu. Les chercheurs ont tabli que la nature de la mutation dpend de la technique de transformation utilise. Ainsi, en utilisant la bactrie Agrobacterium tumefaciens pour introduire le transgne, les mutations sont des rarrangements tandis quavec le bombardement par particules, les mutations sont plutt des dltions. La frquence de ces mutations suite une transformation va de la centaine plusieurs milliers par gnome. Selon les chercheurs, la frquence et limportance de ces mutations. La dnomination d'organisme gntiquement modifi fait rfrence une modification artificielle du patrimoine gntique d'un organisme. Mais des mutations spontanes ainsi que des systmes de transfert naturel d'ADN appel transfert horizontal de gnes existent qui conduisent l'apparition d'organismes dont le matriel gntique est indit. Ainsi, par exemple, le tabac (Nicotiana tabacum) et le bl rsultent de l'addition spontane de gnomes ancestraux. Dcouvert la fin des annes 1950, le transfert horizontal de gnes a depuis t reconnu comme un processus majeur de l'volution des bactries, mais aussi des eucaryotes. L'apparition de nouveaux gnes dans une espce est un lment important du processus d'volution des espces. Tout tre vivant est compos d'une ou plusieurs cellules. Chez les Procaryotes (bactrie par exemple), cet organisme n'a pas de noyau, et tous ses constituants sont mlangs, le matriel gntique galement. Chez les Eucaryotes, il y a un noyau qui renferme l'information gntique, ce qui permet l'organisme de pouvoir avoir plusieurs cellules diffrencies (il existe des eucaryotes unicellulaire comme les levures). Les vgtaux et les animaux sont des Eucaryotes. Ce noyau contient des chromosomes (voir schma ci-dessous) qui ne sont pas toujours sous cette forme condense. Ces chromosomes sont constitus de brins dADN trs condenss. LADN est la molcule qui porte linformation gntique. Elle

est constitue de deux brins, portant des bases azotes. Vous pouvez en voir un bout sur le schma mais en fait la molcule est bien plus longue que a. Un des brins d'ADN est lu par des ribosomes, l'autre servant la rplication. Le ribosome lit les bases par groupe de 3, appels codons, chaque codon correspondant un acide amin. Ces acides amins forment ensuite une protine, ces protines qui vont tre utilises pour fabriquer les cellules et pour faciliter les ractions biochimiques. Avec linformation gntique contenue dans notre ADN, on peut donc obtenir toutes les molcules de notre corps, directement ou indirectement. Chaque protine est code par un gne, c'est--dire une portion de la molcule dADN formant le chromosome.

Chez les eucaryotes, les cellules peuvent tre diffrencies, c'est dire que mme si elles ont des gnes identiques aux autres, leur fonction est diffrente. Chez les humains, la quasi totalit des cellules sont diffrencies. Ainsi, des cellules de peau par exemple ont les mmes gnes que les neurones, les cellules du foie etc. C'est la quantit de production de chaque gne qui entrane ces diffrences.

II-

Les mutations 1- Les causes des mutations

L'origine des mutations spontanes Les mutations sont des erreurs de copie du matriel gntique. Les grandes causes connues de mutations sont Les erreurs faites lors de la prparation la division cellulaire, une trs grande partie des erreurs commises au cours de la rplication du gnome sont corriges immdiatement par des mcanismes complexes et efficaces de rparation de l'ADN, et seule une faible part de ces erreurs deviennent des mutations transmises aux cellules-filles.

Une mutation spontane rsulte d'un processus naturel. On doit les distinguer des mutations induites qui rsultent dune interaction entre lADN et un agent extrieur ou mutagne. Cependant, dans les deux cas, la plupart des mcanismes sont identiques. Toutefois les mutations qui rsultent derreurs de rplication sont vraiment spontanes. a- La fiabilit de la polymrase et les erreurs de rplication Une erreur de rplication avec mise en place dun nuclotide incorrect entrane une mutation lors de la rplication suivante. La frquence des erreurs de la polymrase influe sur la frquence des mutations spontanes. Il existe une 3-5 ex nuclase dont le rle est veiller aux erreurs dincorporation des nuclotides durant la rplication. Des mutations peuvent rsulter de la prsence dune exonuclase correctrice qui supprime tort des paires de bases insres par la polymrase. b- Des altrations affectant les bases Les bases de lADN sont lobjet daltrations structurales spontanes appeles tautomrisations. Chaque base peut exister sous deux formes : ainsi la guanine peut revtir la forme keto ou la forme enol . Ces deux formes sont appeles tautomres ou isomres structuraux. La forme keto est plus courante. La forme enol peut apparatre par transfert dun proton et dlectrons. Les diffrentes formes de tautomres ont des proprits dappariements diffrentes. Si durant la rplication, G est sous la forme enol , la polymrase pourra positionner, en face, un T la place dun C parce que les modalits dappariement ont chang (et ce nest pas une erreur de la polymrase) . Le rsultat est une transition du dinuclotide G-C en A-T. Un autre processus de mutagnse est la dgradation spontane dune base. La damination de C en U est frquente. Elle peut tre rpare par un processus qui dtecte luracile. Dans le cas contraire, le U engendre en vis vis linsertion dun A et entrane une transition de G-C en T-A lors de la rplication. La dsamination de la mthyl-cytosine en T peut aussi intervenir. La mthyl-cytosine est prsente dans le gnome humain dans les squences 5CpG3 qui nexiste

normalement pas dans les squences codantes des gnes. Cependant, si elle existe et si elle est dsamine en T, aucun systme de rparation ne peut le reconnatre (car T est une base normale). CpG est donc un point chaud . Le troisime type de mutation spontane est constitu par les dgts causs par les radicaux libres de loxygne. Ceux-ci, dans la cellule, proviennent du mtabolisme oxydatif et sont aussi gnr par des agents physiques tels que les radiations. Le rsultat peut tre la production de 8-hydroxyguanine qui sapparie tort avec A induisant une traversions de G-C en T-A. Un autre type enfin, est lalkylation (addition de groupes alkyl tels que mthyl, thyl ou propyl) sur des bases ou le squelette de lADN. Il peut en rsulter la formation de complexes par exemple S-adenosyl-mthionine avec lADN. Les bases alkyles peuvent tre des points de rupture ou de mauvais appariements.

c- Les mutations spontanes du cadre de lecture Ce sont des secteurs avec un nuclotide rpt : Ex : 5AGTCAATCCATGAAAAAATCAG3 3TCAGTTAGGTACTTTTTT AGTC5 Il peut sagir dun glissement entre le brin conserv de lADN et le brin en cours de synthse lors de la rplication. De tels secteurs sont des points chauds .

2- Agents mutagnes
La mutation est un phnomne spontan, d des erreurs dans le processus de rplication de l'ADN. Mais, dans certaines circonstances, le taux de mutations peut tre augment considrablement par des facteurs physiques ou chimiques, appels agents mutagnes ; Certains types d'ondes lectromagntiques (rayons X, rayons gamma, les rayons ultraviolets). Des substances chimiques qui interagissent avec lADN (ou ventuellement avec l'ARN) tels que pesticides, drivs de benzne, solvants, etc.

Des substances chimiques qui interagissent avec des lments impliqus dans la rplication de l'ADN, comme la colchicine qui empche la formation du fuseau achromatique d'o une altration du nombre de chromosomes. une modification du systme de rparation de l'ADN, qui cesse alors de corriger les erreurs de rplications.

III-

Les Organismes Gntiquement Modifis (OGM)

A- Objectifs des OGM Lobjectif des OGM est de fournir des consommateurs loigns des lieux de production des produits aux aromes dvelopps ( Meilleur qualit des aliments), des plantes produisant des sucres et aliments zro calorie ; la rduction des protines allergiques dans certains aliments ;des pantes enrichies en vitamine A, huiles riches en acides gras spcifiques, etc.Dsormais, e gnie gntique permet ; par la modification du patrimoine gntique de plantes, de leur faire synthtiser des substances vaccinantes ;des greffes dorganes danimaux lhomme ;des substituts de sang qui pourrait tre utiliss en cas durgence dans des situations de perte de sang massives ; utilisation de moins de pesticides. B- Origine des OGM Dans toute l'acception du terme, un Organisme gntiquement modifi est un organisme vivant (micro-organisme, vgtal ou animal) dont le gnome a t modifi artificiellement. Cette acception inclut toutes les voies possibles de modification de l'information gntique, allant de la mthode des croisements aux outils du gnie gntique. D'un point de vue lgislatif, un grand nombre de pays et d'organisations utilisent une dfinition plus restrictive en rfrence celle prcise lors du Protocole de Carthagne sur la prvention des risques biotechnologiques et qui entend par Organisme vivant modifi tout organisme vivant possdant une combinaison de matriel gntique indite obtenue par recours la biotechnologie moderne . Cependant, cette dfinition n'est pas reconnue universellement. Certains pays, dont les

tats-Unis, ne font pas de ce recours la biotechnologie moderne une notion discriminante. Ainsi, si lUnion europenne, dans la directive 2001/18/CE dfinit un OGM comme un organisme, l'exception des tres humains, dont le matriel gntique a t modifi d'une manire qui ne s'effectue pas naturellement par multiplication et/ou par recombinaison naturelle et si lOCDE dfinit les OGM comme : a plant or animal micro-organism or virus, which has been genetically engineered or modified , les tats-Unis considrent qu'un OGM est un organisme ayant subi un changement dans le matriel gntique [...], que ce soit par l'intermdiaire de la slection classique, du gnie gntique [ou] de la mutagense . Certains pays, comme par exemple le Canada, mme s'ils acceptent la dfinition restrictive , appliquent aux OGM la mme rglementation que celle qui a cours pour les produits modifis par des mthodes classiques. Les controverses qui s'expriment l'gard des OGM portent essentiellement sur ceux qui relvent de la dfinition restrictive , soit ceux obtenus par gnie gntique. La transgnse est l'opration de gnie gntique la plus couramment utilise pour l'obtention d' OGM . Ainsi, organisme transgnique, est souvent utilis comme synonyme d'organisme gntiquement modifi. Cependant, si un organisme transgnique est toujours un organisme gntiquement modifi , un organisme gntiquement modifi n'est pas toujours un organisme transgnique . L'intervention humaine conduisant fabriquer des OGM consiste dans la majorit des cas ajouter une petite portion d'ADN d'un organisme dans l'ADN d'un autre organisme (transgnse). Les techniques sont : Techniques de recombinaison de l'ADN impliquant la formation de nouvelles combinaisons de matriel gntique par l'insertion de molcules d'acide nuclique, produites de n'importe quelle faon hors d'un organisme, l'intrieur de tout virus, plasmide bactrien ou autre systme vecteur et leur incorporation dans un organisme hte l'intrieur duquel elles n'apparaissent pas de faon naturelle, mais o elles peuvent se multiplier de faon continue ;

Techniques impliquant l'incorporation directe dans un organisme de matriel hrditaire prpar l'extrieur de l'organisme, y compris la micro-injection, la macroinjection et le micro encapsulation ; Techniques de fusion cellulaire (y compris la fusion de protoplastes) ou d'hybridation dans lesquelles des cellules vivantes prsentant de nouvelles combinaisons de matriel gntique hrditaire sont constitues par la fusion de deux cellules ou davantage au moyen de mthodes qui ne sont pas mises en uvre de faon naturelle. Premiers pas des OGM Les premiers OGM sont des bactries transgniques. La premire tentative de transgnse par lamricain Paul Berg et ses collaborateurs en 1972, consista en lintgration dun fragment d'ADN du virus SV40, cancrigne, dans le gnome de la bactrie E. Coli prsente l'tat naturel dans le tube digestif humain. Cet essai avait pour objectif de dmontrer la possibilit de recombiner, in vitro, deux ADN d'origines diffrentes. L'ADN recombinant ne put tre rpliqu dans la bactrie. Cependant, devant la puissance des outils leur porte, les scientifiques inquiets dcident lors de la confrence d'Asilomar dun moratoire qui sera lev en 1977. En 1977, le plasmide Ti de la bactrie du sol Agrobacterium tumefaciens est identifi. Ce plasmide sert cette bactrie de vecteur pour transfrer un fragment d'ADN, l'ADN-T (ADN de transfert, ou ADN transfr), dans le gnome d'une plante. Cet ADN comporte plusieurs gnes dont le produit est ncessaire la bactrie au cours de son cycle infectieux. Quelques annes plus tard cette bactrie sera utilise pour crer les premires plantes transgniques. En 1978, une souche de levure (eucaryote) auxotrophe pour la leucine est transforme par un plasmide d'origine bactrienne portant le gne LEU2. En 1978, un gne humain codant linsuline est introduit dans la bactrie Escherichia coli, afin que cette dernire produise linsuline humaine. Cette insuline dite recombinante est la premire application commerciale, en 1982 du gnie

gntique. Linsuline utilise actuellement pour traiter le diabte est produite partir dOGM. En 1982, le premier animal gntiquement modifi est obtenu. Il s'agit d'une souris gante laquelle le gne de l'hormone de croissance du rat a t transfr. En 1983, le premier vgtal gntiquement modifi est obtenu : un plant de tabac modifi pour rsister un antibiotique, la kanamycine. 1985, voit la premire plante transgnique rsistante un insecte : un tabac dans lequel un gne de toxine de la bactrie Bacillus thuringiensis a t introduit. En 2010, le premier organisme contenant un gnome intgralement fabriqu par l'homme est dcrit dans le journal Science. Il s'agit d'une souche de Mycoplasma capricolum dont le gnome a t retir est remplac par le gnome JCVI-syn1.0 conu par l'quipe de Craig Venter, donnant naissance une souche Mycoplasma mycoides. Le gnome a t cr par la synthse de 1 078 oligonuclotides de 1 080 paires de bases, c'est 1 078 fragments ont t assembls en 109 fragments de 10 080 paires de bases, eux-mmes assembls en 11 fragments de 100 000 paires de bases finalement runis au sein du gnome circulaire de 1 077 947 paires de bases.

C- Mcanismes entre mutation et OGM ; diffrents OGM Un grand nombre d'OGM sont cres dans le but de mener des expriences scientifiques. La modification du gnome d'un organisme est aujourd'hui l'un des outils les plus utiliss pour comprendre le fonctionnement d'un organisme. De nombreux micro-organismes (bactries, algues, levures) sont relativement faciles modifier et cultiver, et sont un moyen relativement conomique pour produire des protines particulires vise mdicale: insuline, hormone de croissance, etc. Des essais sont galement mens dans le mme but partir de mammifres, en visant la production de la protine recherche dans le lait, facile recueillir et traiter. Les protines ainsi obtenues, dites recombinantes ne sont pas elles-mmes des OGM. Les principales plantes cultives (soja, mas, coton, tabac, etc.) ont des versions gntiquement modifies, avec de nouvelles proprits agricoles : rsistance aux

insectes, rsistance un herbicide, enrichissement en composants nutritifs. Cependant, dans le contexte agro-alimentaire, ces nouvelles varits suscitent des controverses. Les principales plantes OGM cultives en 2006 sont le soja, qui sert lalimentation du btail, et le mas. Les animaux transgniques sont plus difficiles obtenir, et les varits ainsi obtenues ne sont pas encore commercialises des fins de consommation. Si une ligne dhommes tait issue de modifications gntiques, elle ferait partie des OGM. Production des OGM de la slection gntique la transgnse La slection gntique consiste ne conserver que les organismes vivants qui ont les caractristiques souhaites par le slectionneur. Une telle opration n'a de sens que parce que les caractres gntiques sont hrditaires et qu'ils peuvent varier spontanment d'une gnration l'autre. Les mcanismes induisant ces variations, appels mutations, ont lieu chez toutes les espces. Il s'agit de la modification d'une base de l'ADN qui rsulte soit d'une erreur de copie, lorsque l'ADN se rplique pour donner deux cellules filles, soit de l'effet mutagne d'une substance chimique ou d'un rayonnement. Chez les organismes les plus rudimentaires, des conditions de stress peuvent aussi induire une instabilit de l'ADN, ce qui met l'individu en pril mais offre plus de chances l'espce de s'adapter aux conditions auxquelles elle est soumise. Certaines mutations ne portent pas que sur la modification de bases de l'ADN, mais sur des remaniements plus ou moins profonds des chromosomes qui ont un impact majeur sur l'volution des organismes vivants. laboration des organismes transgniques Hormis pour la xnobiologie, la possibilit de fabriquer un OGM repose sur le fait que le langage gntique est universel dans tout le monde du vivant connu ce

jour. Du fait de cette universalit, un gne, issus d'un organisme donneur , peut tre introduit dans un organisme receveur , lequel le prenant son propre compte, est en mesure de le dcoder et ainsi fabriquer la (ou les) protine(s) qui lui correspond, chacune de celles-ci ayant une fonction. Cette linarit base sur une interprtation du dogme central de la biologie molculaire s'avre en ralit plus complexe :

un gne pourra coder plusieurs protines une protine pourra avoir plusieurs fonctions l'expression d'un gne dpend de divers facteurs environnementaux. l'universalit du code gntique, ne suffit pas garantir que lexpression d'un

gne d'un organisme s'oprera ou s'oprera correctement dans un autre organisme. Un certain nombre d'informations contenues dans les gnes ne sont pas (ou mal) comprises d'une espce une autre. Une srie de modifications du gne s'avre alors ncessaire. Le transgne introduit in fine n'est donc pas le gne original mais un gne modifi, une Construction Gntique Artificielle.

mme si le gne introduit dans le nouvel organisme est traduit effectivement en

la protine qu'il est cens exprimer, il n'est pas en l'tat des connaissances d'apprcier empiriquement et systmatiquement que la transgnse na pas modifi la qualit de la protine en question. Les maladies gntiques prion sont dues de simples dfauts de repliement d'une protine particulire. Postrieurement la transgnse, la protine peut faire l'objet de modifications post-traductionnelles ncessaires sa fonctionnalit. L'environnement cellulaire variant d'un organisme un autre, il n'est pas en l'tat des connaissances d'apprcier l'identit suppose exister entre le lieu d'expression originel de la protine (dans l'organisme donneur ) et son lieu d'expression final (dans l'organisme receveur ).

Les diffrentes tapes de la cration d'un OGM sont :

L'identification et le clonage de la squence d'intrt introduire dans

l'organisme cible,

La ralisation du transgne, c'est--dire la molcule d'ADN introduire dans

l'organisme cible, il peut s'agir de la squence d'intrt seule, ou d'une squence comportant plusieurs gnes.

L'introduction du transgne dans une cellule de l'organisme cible, puis son

intgration au gnome.

Dans certains cas une tape de rgnration d'un organisme complet est

ncessaire (par exemple on peut modifier une cellule vgtale partir de laquelle une plante se dveloppera). Le dernier point comporte deux tapes essentielles, diffrentes l'une de l'autre, mais souvent confondues. Le transfert d'une molcule d'ADN dans un organisme et le transfert de cette mme molcule dans le gnome de l'organisme. Cette confusion est renforce par l'utilisation du terme vecteur qui dsigne la fois, une molcule d'ADN comportant le ou les gnes d'intrt (plasmides, transposons, virus (gnome)), ou l'organisme vivant (Agrobacterium tumefaciens, virus) qui permet l'introduction du premier vecteur dans l'organisme cible. D- Quelques inconvnients lis la manipulation des OGM Ils se rencontrent surtout dans le rgne vgtal et dans llevage. Ces inconvnients sont multiples. Quelques exemples : - Le gnie gntique utilise certaines substances pour faciliter les manipulations gntiques et qui restent aprs dans les OGM. De ce fait, ils font peser de graves menaces sur la sant des personnes qui les consomment (poulets, pommes de terre, lgumes manipuls.) - La technologie des OGM permet le transfert de gnes de certaines cultures tropicales vers certaines cultures tempres. Ceci rend possible leur production en zone tempre, empchant ainsi les pays tropicaux de trouver un march pour vendre leur produit : ex : du coton, du caf, du cacao..

- Les OGM peuvent poser dans certains cas des problmes de pollution gntique et constituer une menace pour lenvironnement. Ex des pollens dOGM qui se rpandent dans la nature Introduction dOGM rsistants leurs prdateurs dans un milieu aquatique entranant une dsorganisation de lcosystme et de la chane alimentaire.

CONCLUSION
De nos jours, les OGM reprsentent un grand espoir dans de nombreux domaines thrapeutique. Leur dveloppement dans la production de mdicament doit tre encourag car ils participent non seulement aux traitements de maladies actuellement incurables, mais ils permettent aussi de faire progresser la connaissance physiopathologique de nombreuses maladies en dpit des risques quil en possde.

BIBLIOGRAPHIE www.google.fr consult le 18/02/12 Cahier de physiologie cellulaire du Professeur-Assistant, Casmir D.AKPOVI