P. 1
Mutation génomique Mesmin_2

Mutation génomique Mesmin_2

|Views: 1,311|Likes:

More info:

Published by: Marius Ganhouegnon on Mar 03, 2012
Droits d'auteur :Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOCX, PDF, TXT or read online from Scribd
See more
See less

09/03/2013

pdf

text

original

UNIVERSITE NATIONALE D’ABOMEY-CALAVI ECOLE POLYTECHNIQUE D’ABOMEY-CALAVI DEPARTEMENT DE GENIE DE BIOLOGIE HUMAINE Filière : Analyse biomédicale

(ABM) Année d’étude : 2ème année. Cours : Génétique moléculaire.

EXPOSE
TOUT SUR LES MUTATIONS
Présenté par :

MEHOUME Sabine

Au :

Professeur Clément AGBANGLA

ANNEE ACADEMIQUE : 2011-2012

PLAN
Introduction IIIDEFINITION DE LA MUTATION LES DIFFERENTS NIVEAUX DE MUTATION A- Mutations géniques B- Mutations chromosomiques 1- Anomalies du nombre 2- Anomalies de structure. a) Délétions et duplications chromosomiques b) Doubles ruptures chromosomiques c) Translocations IIIMutations génomiques

1- Les changements de jeux complets de chromosomes (euploïdie aberrante) 2- Les changements de parties de jeux de chromosomes (aneuploïdie). 3- L’euploïdie aberrante IVLES CAUSES DE MUTATIONS 1-La fiabilité de la polymérase et les erreurs de réplication 2 - Des altérations affectant les bases 3 - Les mutations spontanées du cadre de lecture VAGENTS MUTAGENES CONCLUSION. BIBLIOGRAPHIE

1

INTRODUCTION
Les mutations constituent un phénomène essentiel dans le domaine génétique. Elles permettent aux populations d’organismes vivants d’augmenter leur variabilité, pour que la sélection naturelle puisse agir efficacement et déboucher sur le processus que nous appelons évolution biologique. En résumé, une mutation est un événement ayant pour effet de modifier de façon permanente la structure du matériel héréditaire : l’ADN. Les biologistes distinguent trois niveaux de mutations : géniques, chromosomiques et génomiques. I- DEFINITION DE LA MUTATION Le terme mutation est utilisé pour désigner une modification irréversible de l'information génétique et héréditaire dans la séquence d'un génome. Autrement dit c’est la modification brusque et irréversible du matériel génétique aboutissant à une variation de la séquence des bases azotées de l’ADN. Lorsqu'une mutation apparaît dans une cellule sexuelle, ou gamète, elle est transmissible à la descendance et, le plus souvent, stable. Une mutation peut être sans conséquence sur le gène touché et la protéine pour laquelle il code (dans ce cas, elle passe inaperçue), mais elle peut aussi être à l'origine d'une maladie, d'un dysfonctionnement ou d'une anomalie du développement d'un être vivant, voire être létale. De nombreuses mutations entraînent une modification du phénotype (ensemble des caractères observables au niveau d’un organisme. L’ensemble des gènes caractérisant cet organisme étant appelé génotype) sans conséquence défavorable, ni
2

favorable. À l’inverse, mais très rarement, certaines mutations peuvent s’avérer favorables si le gène ainsi modifié code pour une protéine mieux adaptée à l'exécution d'une fonction préexistante, ou si elle confère à l’organisme un caractère lui assurant une meilleure adaptation à son milieu. Les mutations sont la condition sine qu'anone de l’évolution biologique.

II- LES DIFFERENTS NIVEAUX DE MUTATION A- Mutations géniques Les mutations géniques sont celles qui se produisent au niveau du gène. L’unité d’une mutation au niveau génique est une paire de bases chez les vivants mais chez le virus c’est un nucléotide. Selon leurs modalités de modification du gène on distingue :  Les mutations faux sens : ces mutations ponctuelles peuvent être de type transition lorsqu’une base purine est remplacée par une autre base purine ou une base pyrimidique est remplacée par une autre base pyrimidique. Une mutation faux sens est de type transversion lorsqu’une base purine est remplacée par une base pyrimidique ou d’une base pyrimidique par une base purique.  Les mutations non-sens : le changement de nucléotide par un codon provoque le remplacement d’un codon spécifiant d’un acide amine par un codon stop. Cela entraine la production d’une protéine,  Les mutations silencieuses : Ce sont des mutations qui ne pas modifient la séquence d’une protéine a cause de la redondance du code génétique (le nouveau triplet code le même acide amine que le triplet original),ou parce qu’elle touche une région non codante de l’ADN ou un intron .Cette mutation n’a aucune conséquence sur le phénotype. Une mutation synonyme sert à désigner une mutation silencieuse qui touche un exon, sans
3

changer la séquence de la protéine tronquée. La mutation est dite:  Neutre si elle ne modifie pas la séquence en acides aminés de la protéine  Faux-sens si elle entraîne la modification de la séquence en acides aminés de la protéine  Non-sens si elle entraîne l'apparition d'un signal « stop » qui interrompt la fabrication de la protéine. L’exemple ci-dessous illustre l'effet d'une mutation ponctuelle non-sens dans le gène de la b-globine (un des gènes servant à la fabrication de l’hémoglobine). Le remplacement d'une seule base, C par un T au niveau du codon 39 du gène de la béta-globine provoque l'incorporation d'un signal stop à la place de la glutamine, et donc l’arrêt de synthèse de la protéine. Ceci aboutit à une maladie, la b-thalassémie, caractérisée par un défaut de fabrication de l’hémoglobine.  Frame shift mutation :  Insertion : une (ou plusieurs) base est ajoutée à la séquence d'ADN. Le reste du message est alors décalé, et donc en général perturbé.  Délétion : une (ou plusieurs) base est supprimée de la séquence d'ADN. De même le reste du message est décalé et la protéine perd, dans la plupart des cas, sa fonctionnalité. Ce sont toutes ces anomalies de l'ADN que l'on cherche à mettre en évidence dans le cas d'un test génétique. Les mutations peuvent être soit neutres (sans effet), soit bénéfiques, soit nocives.Cette notion de mutation « bénéfique » ou « nocive » peut varier en fonction de l'environnement ou d'autres paramètres. Par exemple, dans le cas de la couleur de la peau, une peau foncée protège du soleil sous les tropiques (risque plus faible de développer un cancer de la peau). Au contraire, dans l'hémisphère Nord, elle favorise le développement du rachitisme

4

et nécessite chez l'enfant une prévention alimentaire par la vitamine D. Vous comprenez maintenant que l'ADN n'est important qu'en tant que support de l'information génétique ; ce qui détermine l'effet néfaste ou non d'une mutation dans un gène, c'est son impact sur la protéine codée par ce gène, et ceci, dans un contexte environnemental donné. D’autre part, il n'existe pas de règle tout faite permettant de prédire la gravité d'une mutation quel qu’en soit le type. Pour garder l'analogie du « langage » de l'ADN, les mutations correspondent à des erreurs de frappe. Prenons la phrase suivante en français « j'utilise de la colle ». Différentes mutations possibles et leurs conséquences sont détaillées ci-dessous

Comme modifications On voit que, suivant le contexte, et par le fait du hasard, certaines peuvent laisser la phrase inchangée, changer son sens, la rendre dure à lire, la rendre incompréhensible ou tronquée donc illisible. Il en va exactement de même pour l'effet des mutations dans l'ADN, les phrases correspondant à des protéines. Les mutations peuvent laisser ces dernières inchangées, les rendre moins actives ou inactives, leur conférer une fonction différente (potentiellement toxique), les rendre totalement inactives, les tronquer ou empêcher leur production.

5

 Mutations dynamiques Ces mutations évoluent d'une génération à l'autre, elles correspondent à des répétitions importantes de certains triplets au niveau de l'ADN (CAG et GGG). En général, le terme de mutation s'accompagne d'un préjugé négatif. Il évoque en premier lieu quelque chose d'anormal se traduisant par des malformations ou une maladie. Il faut dire que la science-fiction avec son lot de mutants en tout genre a largement contribué à l'ancrage de ce préjugé. B- Mutations chromosomiques Une catégorie plus rare de mutations est constituée de ce qu’on appelle les mutations chromosomiques. Des morceaux entiers de chromosomes sont déjà existants. Dans un cas comme dans l’autre, des dizaines, voire des centaines de gènes se retrouvent déplacés. Etant donné que la régulation de l’activité d’un gène dépend en partie de sa localisation dans le génome, les mutations chromosomiques ont en général des effets extrêmement dramatiques, car elles altèrent la quantité de produit génique, ou modifient le moment où un gène donné est activé où désactivé. 1- Anomalies du nombre Trisomie 21 (syndrome de Down). Peut être, due à la non disjonction des Chr. 21 lors de la 1ère division de méiose, à la non disjonction des chromatides à la 2ème division de méiose ou mors de la première mitose de l’œuf. Le plus souvent ces incidents se produisent lors de la gamétogenèse chez la femme « âgée ». Autres anomalies du nombre portant sur les autosomes : Excès : trisomie 13, 14, 15 ou 18 (décès précoce). Défaut: monosomie des autosomes inconnus. Il existe des cas où les chromosomes se referment sur eux-mêmes (ring). Ces chromosomes se perdent.au cours des mitoses et les sujets deviennent
6

monosomiques pour beaucoup de cellules. Espérance de vie très brève. Anomalies du nombre portant sur les hétéronomes.(poly 3) Non-disjonction lors de la méiose, des chromosomes sexuels. Phénotypes féminins: -Syndrome de Turner 45X (AA, XO): taille petite, puberté incomplète, niveau mental inférieur à la moyenne. -Trisomie X 47X(AA, XXX): morphologie normale, fertilité faible. -Syndromes tétra ou pathologiques marqués. Phénotypes masculins: -Syndrome de Klinefelter (AA, XXY): grande taille, aspect féminin, puberté incomplète. -Double chromosome Y(AA, XYY): grande taille, calvitie précoce. (Taux de criminalité recensée plus importante que la moyenne, le fait d'être pris résultant d'un QI inférieur à la moyenne !) Le sexe est déterminé par la présence ou l'absence d'un chromosome Y. Le surnombre de X détermine des états pathologiques. 2- Anomalies de structure. Résultent de cassures chromosomiques, entraînent une perte ou un déplacement des segments isolés et la formation de chromosomes remaniés. a) Délétions et duplications chromosomiques Après cassure, un fragment sans centromère ne suit pas la mitose. Le plus souvent pas viables. Certains cas pathologiques connus: -Maladie du cri du chat: perte du bras court du chromosome 5. -Délétion du bras court d'un des X chez la femme. Duplication: insertion d'un fragment de chromosome supplémentaire. Peu d'effets. penta X(AA, XXXX ou XXXXX): états

7

b) Doubles ruptures chromosomiques -Délétion segmentaire: perte d'un segment, effets sérieux. -Inversion: sujet normal. -Chromosomes en anneaux : pertes, donc monosomies. c) Translocations Passage d'un fragment de chromosome sur un autre, homologue ou non. Les translocations réciproques sont des cassures suivies d'un échange entre deux chromosomes distincts. Les translocations par fusion centrique sont équilibrées car il y a fusion de 2 chromosomes télocentriques au niveau du centromère. A l'occasion de la translocation, il peut y avoir perte de matériel. Le plus souvent, la perte est négligeable et les sujets ne manifestent aucun trouble. Mais lors de la gamétogenèse il se forme des gamètes anormaux.

Exemple de la translocation équilibrée entre le chromosome 21 et le chromosome 13,14 ou 15. (Groupe D) Ce sujet peut former 6 types de gamètes: - normal : (21 et D) - diplo 21 : (21-D) et (21) - transloqué : (21-D) - nullo 21 : (D) seul - diplo-D : (21-D) et (D) (rare) - nullo-D : (21) seul (rare)
8

Après fécondation avec un individu normal, il y a quatre types d'embryons: -25% normaux -25% mongoliens (masqués car caryotype à nombre normal) -25% porteurs d'une translocation -25% monosomiques 21. Létalité. III- Mutations génomiques Les mutations génomiques ont lieu lorsqu’une configuration chromosomique entière est répliquée, ou bien lorsque les chromosomes de deux génomes différents se fondent dans la même cellule. Dans la nature, ces phénomènes, qui se produisent rarement, sont résumés sous le terme « polyploïdie ».Un individu polyploïde peut naître de la fusion des gamètes de deux espèces différentes, ou de la non réduction du nombre chromosomique pendant la méiose. Les mutations génomiques sont en général désastreuses pour un organisme, car elles bouleversent le fragile équilibre des fonctions de milliers de gènes. Malgré cela, il est fréquent que de nouvelles espèces de plantes voient le jour par polyploïdie, alors que le phénomène est bien plus rare chez les animaux. Le premier grand type de mutation génomique est le changement du nombre de chromosomes. Les changements du nombre de chromosomes sont généralement répertoriés en deux groupes: 1. Les changements de jeux complets de chromosomes (euploïdie aberrante)

L’euploïdie aberrante
Les organismes possédant un nombre de chromosomes multiple du nombre haploïde de chromosomes sont dits euploïdes.

9

Les euploïdes possédant plus de deux jeux de chromosomes sont dits polyploïdes. Les organismes qui possèdent un nombre supérieur ou inférieur au nombre normal de jeux de chromosomes sont des polyploïdes aberrants. On parle de triploïdes (3n), tétraploïdes (4n), pentaploïdes (5n), hexaploïdes (6n), etc. Un individu appartenant à une espèce normalement diploïde, qui possède plutôt un seul jeu de chromosome (n), est dit monploïde. Chez les polyploïdes, il faut distinguer les autopolyploïdes, composés de multiples jeux provenant d’une même espèce ; des allopolyploïdes, comportant des jeux de chromosomes issus de deux espèces différentes ou plus. Les allo polyploïdes ne se forment qu’entre des espèces étroitement apparentes. Il faut cependant garder à l’esprit que chez les allopolyploïdes les différents jeux de chromosomes ne sont que partiellement homologues (homéologues) et non parfaitement homologues, comme chez les autopolyploïdes.

2. Les changements de parties de jeux de chromosomes (aneuploïdie). Un aneuploïde est un organisme dont le nombre de chromosomes diffère du type sauvage par une partie du jeu de chromosomes. Généralement, le jeu de chromosomes aneuploïde diffère du type sauvage seulement par un chromosome ou par un petit nombre de chromosomes. Les aneuploïdes peuvent comporter un nombre de chromosomes supérieur ou inférieur à celui du type sauvage. La nomenclature des aneuploïdes est basée sur le nombre de copies du chromosome concerne dans l’ tat aneuploïde. Par exemple, l’état aneuploïde 2n – 1 est appelé monosomique, car il comporte une seule copie d’un chromosome spécifique au lieu des deux copies présentes chez son parent diploïde. L’aneuploïde 2n + 1 est appelé trisomique, 2n - 2 est nullisomique et n + 1 est disomique.

10

IV- LES CAUSES DE MUTATIONS L'origine des mutations spontanées Les mutations sont des « erreurs de copie » du matériel génétique. Les grandes causes connues de mutations sont Les erreurs faites lors de la préparation à la division cellulaire, Une très grande partie des erreurs commises au cours de la réplication du génome sont corrigées immédiatement par des mécanismes complexes et efficaces de réparation de l'ADN, et seule une faible part de ces erreurs deviennent des mutations transmises aux cellules-filles. Une mutation spontanée résulte d'un processus naturel. On doit les distinguer des mutations induites qui résultent d’une interaction entre l’ADN et un agent extérieur ou mutagène. Cependant, dans les deux cas, la plupart des mécanismes sont identiques. Toutefois les mutations qui résultent d’erreurs de réplication sont vraiment spontanées. 1- La fiabilité de la polymérase et les erreurs de réplication Une erreur de réplication avec mise en place d’un nucléotide incorrect entraîne une mutation lors de la réplication suivante. La fréquence des erreurs de la polymérase influe sur la fréquence des mutations spontanées. Il existe une 3’-5’ ex nucléase dont le rôle est veiller aux erreurs d’incorporation des nucléotides durant la réplication. Des mutations peuvent résulter de la présence d’une exonucléase « correctrice » qui supprime à tort des paires de bases insérées par la polymérase. 2- Des altérations affectant les bases Les bases de l’ADN sont l’objet d’altérations structurales spontanées appelées tautomérisations. Chaque base peut exister sous deux formes : ainsi la guanine peut revêtir la forme « keto » ou la forme « enol ». Ces deux formes sont
11

appelées tautomères ou isomères structuraux. La forme « keto » est plus courante. La forme « enol » peut apparaître par transfert d’un proton et d’électrons. Les différentes formes de tautomères ont des propriétés d’appariements différentes. Si durant la réplication, G est sous la forme « enol », la polymérase pourra positionner, en face, un T à la place d’un C parce que les modalités d’appariement ont changé (et ce n’est pas une erreur de la polymérase) . Le résultat est une transition du dinucléotide G-C en A-T. Un autre processus de mutagénèse est la dégradation spontanée d’une base. La déamination de C en U est fréquente. Elle peut être réparée par un processus qui détecte l’uracile. Dans le cas contraire, le U engendre en vis à vis l’insertion d’un A et entraîne une transition de G-C en T-A lors de la réplication. La désamination de la méthyl-cytosine en T peut aussi intervenir. La méthyl-cytosine est présente dans le génome humain dans les séquences 5’CpG3’ qui n’existe normalement pas dans les séquences codantes des gènes. Cependant, si elle existe et si elle est désaminée en T, aucun système de réparation ne peut le reconnaître (car T est une base normale). CpG est donc un « point chaud ». Le troisième type de mutation spontanée est constitué par les dégâts causés par les radicaux libres de l’oxygène. Ceux-ci, dans la cellule, proviennent du métabolisme oxydatif et sont aussi généré par des agents physiques tels que les radiations. Le résultat peut être la production de 8-hydroxyguanine qui s’apparie à tort avec A induisant une traversions de G-C en T-A. Un autre type enfin, est l’ alkylation(addition de groupes alkyl tels que méthyl, éthyl ou propyl) sur des bases ou le squelette de l’ADN. Il peut en résulter la formation de complexes par exemple S-adenosylméthionine avec l’ ADN. Les bases alkyles peuvent être des points de rupture ou de mauvais appariements.

12

3- Les mutations spontanées du cadre de lecture Ce sont des secteurs avec un nucléotide répété : Ex : 5’AGTCAATCCATGAAAAAATCAG3’ 3’TCAGTTAGGTACTTTTTT AGTC5’ Il peut s’agir d’un glissement entre le brin conservé de l’ADN et le brin en cours de synthèse lors de la réplication. De tels secteurs sont des « points chauds ».

V-

AGENTS MUTAGENES

La mutation est un phénomène spontané, dû à des erreurs dans le processus de réplication de l'ADN. Mais, dans certaines circonstances, le taux de mutations peut être augmenté considérablement par des facteurs physiques ou chimiques, appelés agents mutagènes ; •Certains types d'ondes électromagnétiques (rayons X, rayons gamma, les rayons ultraviolets). •Des substances chimiques qui interagissent avec l’ADN (ou éventuellement avec l'ARN) tels que pesticides, dérivés de benzène, solvants, etc. •Des substances chimiques qui interagissent avec des éléments impliqués dans la réplication de l'ADN, comme la colchicine qui empêche la formation du fuseau achromatique d'où une altération du nombre de chromosomes. •une modification du système de réparation de l'ADN, qui cesse alors de corriger les erreurs de réplications.

13

CONCLUSION. Les mutations sont sans doute le moteur de l'évolution des êtres vivants. Mieux connaître leurs mécanismes nous permettra de comprendre l'évolution, mais dans une plus brève échéance de soigner certaines maladies héréditaires. Si les gènes atteints sont connus, l'utilisation du diagnostic anténatal permet de repérer les anomalies génétiques.

14

BIBLIOGRAPHIE/Webographie - www.google.bj . consulté le 06/02/2012 - Programme du cours de génétique chimie-biologie-géologie 2ème année Université de cocody Abidjan laboratoire de génétique UFR de biosciences. Consulté le 10/02/2012 -Gelehrter T., Collins F. Principes de génétique moléculaire et médicale. Editions Pradel, Paris 1992.consulté le 04/02/2012 -Catégories : Mécanisme de l'évolution | Modification de l'information génétique consulté le 12/02/2012

15

You're Reading a Free Preview

Télécharger
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->