Vous êtes sur la page 1sur 50

1

Facult de Mdecine et de Pharmacie de FES - MAROC


BIOCHIMIE II (Biochimie-Biologie molculaire)
Travaux dirigs de Biologie Molculaire (Fvrier 2008)
Pr Yves MOREL

QUESTION N 1 (1 point)
La coupure de l'ADN gnomique par l'enzyme de restriction Taq 1 donne en autre un fragment de 600bp
englobant un gne A. Par la mthode de Southern une seule bande est rvle.
Quelle quantit d'ADN reprsente cette bande si 10 g a t dpos ?
A 20 ng
B 20 pg
C 0,2 pg
D 5 pg
E 2 pg
QUESTION N2 (1 point)
Le gnome humain contient des squences rptes et uniques. Parmi les squences suivantes, lesquelles
sont considres comme uniques ?
A squence crant un RFLP (restriction fragment length polymorphism)
B squence Alu
C squence transcrite par la RNA polymrase de type I
D squence codant pour un ARN 5S
E squence transcrite par la RNA polymrase de type II

QUESTION N3
A la suite d'une prise de sang sur anticoagulant, l'extraction de l'ADN se fait partir
A - du srum
B - des plaquettes
C - des leucocytes
D - du plasma
E - des globules rouges

La figure ci-dessous reprsente schmatiquement un gne eucaryote. Rpondez aux 4 questions
suivantes.

QUESTION N 4
O se trouve le site d'initiation, ATG ?
QUESTION N 5
O se trouve le site de polyadnylation ?
QUESTION N 6
O se trouve le site d'initiation de la transcription ?
QUESTION N 7
O se trouve le codon stop ?
QUESTION N 8
Dans le muscle, l'expression du gne ci-dessus (figure avant la question 6) diffre de celle observ dans
les autres tissus, l'ARN messager est constitu des exons 2-3-4-5 et 6. On en dduit :
A l'existence d'un promoteur diffrent dans le muscle
B l'existence d'une modification post transcriptionnelle: une dition
C l'obtention d'une protine de taille diffrente
D la prsence d'un codon stop dans l'exon 2.
5' 3'
1 2 3 4 5
6
1'' 2' 3' 4'
C E
D
A B
5'
2
QUESTION N 9
L'ADN mitochondrial :
A est transmis surtout par le pre
B code pour toutes les protines mitochondriales
C est circulaire
D n'a pas d'intron
E les mutations de cet ADN se traduisent cliniquement surtout par des atteintes musculaires et
encphaliques
QUESTION N10
Parmi les molcules suivantes, lesquelles sont utilises pour marquer radioactivement l'extrmit 5' d'un
oligonuclotide ?
A T7 DNA polymrase
B o-
32
P-dATP
C -
32
P-dATP
D -
32
P-ATP
E T4 polynuclotide-kinase

QUESTION N11 (1 point)
Pour marquer radioactivement une sonde d'ADN par la mthode de multi-amorage au hasard "multi-
random priming", on utilise
A T4 polynuclotide-kinase
B o-
32
P-dCTP
C o-
32
P-CTP
D -
32
P-CTP
E Fragment de klenow

QUESTION N 12 (2 points)
Pour mettre en vidence de longs remaniements de l'ADN gnomique, la mthode de Southern est
frquemment utilise. Parmi les propositions suivantes, quelles en sont les tapes par ordre
chronologique ?
1- Lavage selon des conditions de stringence lies la nature de la sonde
2- Transfert sur une feuille de nylon
3- Migration sur un gel d'agarose
4- Autoradiographie
5- Dnaturation de l'ADN de sujets normaux et de patients
6- Hybridation avec une sonde marque au
32
P
7- Digestion par une enzyme de restriction
8- Extraction de l'ADN de sujets normaux et de patients

A 8 - 5 - 7 - 3 - 2 - 6 - 1 - 4
B 8 - 7 - 5 - 3 - 2 - 6 - 1 - 4
C 8 - 7 - 3 - 6 - 2 - 1 - 5 - 4
D 8 - 7 - 3 - 6 - 2 - 5 - 1 - 4
E 8 - 7 - 3 - 5 - 2 - 6 - 1 4
QUESTION N 13
La mthode de Southern est couramment utilise pour tudier un gne de 3000 bp comme celui codant
pour la 21-hydroxylase, enzyme uniquement surrnalienne.

A - L'ADN des sujets est extrait des leucocytes, digr par un enzyme de restriction, spar par
lectrophorse et transfr sur une feuille de nylon aprs dnaturation par la soude.
B - Le gne tudi reprsente un millionnime du gnome haploide humain.
C - Le gne tudi reprsente un 1/100000ime du gnome haploide humain.
D - On utilise une sonde marque au
32
P provenant d'une librairie d'ADNc de leucocytes.
E - Cette mthode ne permet pas de mettre en vidence une dltion de 8 paires de base.
3
QUESTION N14
Aprs avoir digr l'ADN d'un sujet par l'enzyme de restriction Eco RI, le gne ci-dessous est tudi par
la mthode de Southern. Ce gne est reprsent schmatiquement: les rectangles noirs reprsentent les
exons, les flches les sites de restriction de l'enzyme Eco RI, le nombre en kilobases (kb) entre deux
flches correspond la distance entre deux sites de restriction.



Une seule combinaison ci-dessous correspond l'ensemble des fragments s'hybridant avec une sonde
rprsentant tout l'ADN complmentaire de ce gne :

A - 2,6 kb - 1,5 kb - 3,5 kb - 4,5 kb - 3 kb - 1kb
B - 2,6 kb - 4,5 kb - 3 kb - 1kb
C - 2,6 kb - 4,5 kb - 3 kb
D - 2,6 kb - 1,5 kb - 4,5 kb - 3 kb - 1kb
E - 3,5 kb - 1kb


QUESTION N15
Si le sujet tudi ci-dessus tait homozygote pour une dltion de l'exon 3 qui n'abolit pas de site Eco RI,
on dtecterait par rapport au rsultat de la question prcdente :

A - aucun changement
B - un fragment suprieur 4,5kb avec absence des fragments 4,5 kb et 3 kb
C - un fragment suprieur 4,5kb avec absence du fragment 4,5 kb
D - un fragment infrieur 4,5kb avec absence des fragments 4,5 kb et 3 kb
E - un fragment infrieur 4,5kb avec absence du fragment 4,5 kb

QUESTION N16 (2 points)
A l'aide des deux squences ci-dessous, il est possible de voir qu'il existe un intron.
Squence d'une partie d'un gne :
1 6 11 16 21 81 86 91
5' AGGCA GCACA AGGTG GGGAC TGTCC.......CCA TAGCAG GAGA GCCTC 3'

Squence de l'ADN complmentaire qui correspond cette partie du gne :

5' AGGCA GCACA AGGAG AGCCTC 3'
Par quels nuclotides commence et finit cet intron?

A - 11.......84
B - 14.......87
C - 12.......85
D - 13.......86
E - 22.......86

QUESTION N17
Pour isoler l'ADN complmentaire de la proopiomlanocortine, on utilise:

A - une banque gnomique
B - une banque d'ADN complmentaire hpatique
C - une banque d'ADN complmentaire hypothalamique
D - une banque d'ADN complmentaire de leucocytes
E - une banque d'ADN complmentaire d'anthypophyse
5'
3'
2,6 kb 1,5kb
3,5kb 4,5kb
1
2
4
3
3kb
1kb
4
QUESTION N 18 (2 points)
Un fragment Bgl II-Xba I d'ADN humain reprsentant un gne a t isol partir d'une librairie
gnomique. Pour en faire la carte de restriction et le squenage, on veut le sous cloner dans un plasmide
de 3 kb. Le site de clonage comprend plusieurs sites uniques d'enzymes de restriction dont la localisation
de 5' vers 3' est la suivante: Eco RI - Bam HI - Xba I - Sac I - Hind III. On rappelle les sites de
reconnaissance et de coupure des enzymes suivants :
Site Bam HI 5' G + G A T C C 3' Site Bgl II 5' A + G A T C T 3'
3' C C T A G | G 5' 3' T C T A G | A 5'

Site Eco RI 5' G + A A T T C 3' Site Xba I 5' T + C T A G A 3'
3' C T T A A | G 5' 3' A G A T C | T 5'

A le sous-clonage est impossible
B le sous-clonage ncessite la coupure du plasmide par Eco RI
C le sous-clonage ncessite la coupure du plasmide par Eco RI et Xba I
D le sous-clonage ncessite la coupure du plasmide par Bam HI et Xba I
E le sous-clonage ncessite la coupure du plasmide par Xba I
QUESTION N 19 (3 points)
Les rsultats obtenus aprs digestion de ce plasmide recombinant avec diverses enzymes de restriction
sont les suivants : - avec Xba I : un fragment de 10 kb
- avec Eco RI : un fragment de 10 kb
- avec Sac I : deux fragments de 4 kb et de 6 kb
On en dduit :
A le fragment gnomique insr est de 3 kb
B le fragment gnomique insr est de 7 kb
C le fragment gnomique insr contient 2 sites Sac I
D le fragment gnomique insr contient 1 site Sac I
E le fragment gnomique insr peut tre rcupr par une digestion simultane Eco RI et Xba I

QUESTION N20 (2 points)
On utilise la mthode de PCR pour dterminer si un sujet est porteur d'une mutation d'un gne
responsable d'une maladie gntique.
Voici la liste des produits et de mthodes pouvant tre utiliss
1- Taq polymrase
2- l'enzyme de restriction Taq I
3- ADN gnomique
4- dnaturation -hybridation des amorces- extension (25 cycles)
5- hybridation des amorces-dnaturation de l'ADN gnomique- extension (25 cycles)
6- dsoxynuclotides (dATP, dCTP, dGTP, dTTP)
7- didsoxynuclotides (ddATP, ddCTP, ddGTP, ddTTP)
Parmi les propositions suivantes, laquelle permettra d'amplifier ce fragment ?
A on met dans le mme tube (3 + 1 + 7) puis on ralise 4
B on met dans le mme tube (3 + 1 + 6) puis on ralise 5
C on met dans le mme tube (3 + 2 + 7) puis on ralise 4
D on met dans le mme tube (3 + 2 + 7) puis on ralise 5
E aucune solution juste
QUESTION N21
Parmi les molcules suivantes, lesquelles sont utilises pour amplifier un fragment d'ADN humain par la
mthode de PCR ?
A - l'ADN humain
B - oligonuclotides servant d'amorces
C - l'enzyme de restriction Taq I
D - des ribonuclotides
E - la Taq polymrase
5
QUESTION N22
Les produits de PCR amplifis donnent sur un gel d'agarose un profil qui diffre selon la concentration en
MgCl
2
utilise:


[1], concentration en MgCl
2
utilise pour obtenir le profil 1, [2].....pour le profil 2, [3] ......
D'aprs les trois profils, vous pouvez dduire que

A - [1] < [2] < [3]
B - [2] < [1] < [3]
C - [3] < [2] < [1]
D - [2] < [3] < [1]
E - [1] < [3] < [2]

QUESTION N23
Les produits de PCR amplifis donnent sur un gel d'agarose un profil qui diffre selon la temprature
utilise:


T1, temprature utilise pour obtenir le profil 1, T2.....pour le profil 2, T3 ......
D'aprs les trois profils, vous pouvez dduire que

A - T1 < T2 < T3
B - T2 < T1 < T3
C - T3 < T2 < T1
D - T2 < T3 < T1
E - T2 = T3 < T1
QUESTION N24

Pour trouver les meilleures conditions d'amplification spcifique d'un fragment d'ADN de 500 bp par la
mthode de PCR, on fait varier un seul paramtre, la temprature. De quelle temprature s'agit-il?
A - de la temprature de dnaturation de l'ADN
B - de la temprature d'extension des amorces
C - des tempratures de dnaturation et d'hybridation des amorces
D - de la temprature d'hybridation des amorces
E - des tempratures de dnaturation et d'extension des amorces

1 2 3
500 pb
1 2 3
500 pb
6
QUESTION N 25 (1 point)


Cette figure reprsente le gne d'une protine enzymatique qui prsente un peptide signal.
O commence la squence nuclotidique qui code pour ce peptide signal (utilisez la nomenclature
donne en cours) ?


QUESTION N 26 (3 points)

On ralise un Western blot pour tudier l'expression de ce gne dans le foie et le muscle. Deux anticorps
sont utiliss: l'anticorps monoclonal 1 est dirig contre l'pitope cod par l'exon 5 qui contient la
squence du site actif; l'anticorps monoclonal 2 est dirig contre l'pitope cod par l'exon 3. Ces deux
anticorps sont des anticorps de souris.
A noter qu'on observe la mme activit enzymatique dans les deux tissus, mais avec une rgulation
diffrente. Le transcrit primaire du gne ci-dessus est identique dans les deux tissus.
Ci dessous, la liste de diffrentes tapes exprimentales permettant d'tudier une protine (des tapes
intermdiaires peuvent ne pas tre cites).

1- Autoradiographie
2 - Transfert sur une membrane de nylon ou nitrocellulose
3 - Incubation avec un anticorps anti-anticorps de souris marqu l'iode radio-actif
4 - Biopsie du tissu
5 - Gel-filtration
6 - Electrophorse en utilisant un gel SDS-acrylamide avec mercaptothanol.
7 - Incubation avec soit l'anticorps 1 soit avec l'anticorps 2
8- Lavage

Dans quel ordre, se droule la ralisation de ce Western blot ?

A 4 - 5 - 2 - 7 - 8 - 3 - 8 - 1
B 4 - 6 - 2 - 3 - 8 - 7 - 8 - 1
C 4 - 5 - 2 - 3 - 8 - 7 - 8 - 1
D 4 - 6 - 2 - 7 - 8 - 3 - 8 - 1
E 4 - 2 - 7 - 8 - 3 - 8 - 6 - 1
C E
D
5'
3'
1 2 3 4 5
6
1''
2'
3'
4'
A
B
5'
7
QUESTION N27 (2 points)


muscle foie muscle foie
Les rsultats ci-dessus du Western blot et les renseignements donns ci-dessus permettent d'en dduire

A les deux protines ont la mme taille
B chacun des deux protines peut avoir plusieurs sous-units de taille diffrente
C chacun des deux protines peut avoir plusieurs sous-units de taille identique
D les deux protines sont codes par des gnes diffrents
E les deux protines sont des isoenzymes

QUESTION N 28 (2 points)
Quel est le mcanisme responsable des profils nots sur le western blot ?
A promoteur diffrent
B pissage alternatif de l'exon 5 dans le muscle
C pissage alternatif de l'exon 3 dans le muscle
D pissage alternatif de l'exon 5 dans le foie
E pissage alternatif de l'exon 3 dans le foie

ENONCE CORRESPONDANT AUX QUESTIONS (29 34)
La squence suivante est celle d'un exon avec ses bordures introniques. La partie codante reprsente
300bp :
5 ' AGTACCTTGATGGCATGACTAGTACCCGGGCTAATCGATCCC

Ile Gln Gln Arg Leu Gln Glu Glu Leu Asp His Glu Leu
GATCATTCCCCAG [ ATT CAG CAG CGA CTG CAG GAG GAG CTA GAC CAC GAA CTG

Gly Pro Gly Ala Ser Ser Ser Arg...............//................ Thr Arg Pro Ser Se
GGC CCT GGT GCC TCC AGC TCC CGG ...............//................ACA CGG CCC AGC AG ]

GTGACTCCCGAGGGTTGGGGAGTCATTCGATGGCATAGCT 3'

QUESTION N 29 (3 points)
Quelles sont parmi les amorces suivantes les deux qui vous demanderez synthtiser pour amplifier par
la mthode de PCR cet exon ?
A 5' TCGATACGGTAGCTTACTGA 3'
B 5' AGTCATTCGATGGCATAGCT 3'
C 5' AGCTATGCCATCGAATGACT 3'
D 5' TCATGGAACTACCGTACTGA 3'
E 5' AGTACCTTGATGGCATGACT 3'

QUESTION N 30 (2 points)
Quelle est la longueur du fragment amplifi ?
A 355 bp
B 395 bp
C 375 bp
D 300 bp
E aucune
Anticorps 1 Anticorps 2
25 ?
15 ?
8
QUESTION N 31 (1 point)
Une mutation C T apparait dans le troisime codon Glutamine (Leu-Gln-Glu).
Nous rappelons que les sites de reconnaissance des enzymes de restriction, Eco RI et Pst I, sont les
suivants:
5' G + AATT C 3' site Eco RI 5' C TGCA + G 3' site Pst I
3' C TTAA | G 5' 3' G | ACGT C 5'

Quel est le retentissement de cette mutation ?
A changement d'acide amin
B pas de retentissement
C dcalage du cadre de lecture
D apparition d'un codon stop
E aucune

QUESTION N 32

Le profil lectrophortique de l'ADN correctement digr d'un malade homozygote pour cette mutation
montrera par rapport celui de l'ADN control

A aucune diffrence
B apparition d'une bande supplmentaire plus grande
C apparition d'une bande supplmentaire plus petite
D disparition d'une bande sans autre changement
E disparition de deux bandes avec apparition d'une bande plus grande

QUESTION N 33
Pour mettre en vidence cette mutation, plusieurs tapes sont proposes

1- Amplification d'un fragment d'ADN entourant cette mutation
2- Coloration au bromure d'thidium du gel d'agarose
3- Digestion par l'enzyme Eco RI
4- Digestion par l'enzyme Pst I
5- Digestion par les enzymes Eco RI et Pst I
6- Migration sur un gel d'agarose
7- Photographie du gel color
8- Extraction de l'ADN d'un sujet normal et du sujet suspect d'avoir cette mutation

Dans quel ordre, faites-vous cette exprience ?

A 8 - 5 - 1 - 2 - 6 - 7
B 8 - 1 - 4 - 6 - 2 - 7
C 8 - 4 - 1 - 2 - 6 - 7
D 8 - 3 - 1 - 6 - 2 - 7
E 8 - 1 - 3 - 6 - 2 - 7

QUESTION N 34 (1 point)
Chez un malade htrozygote pour cette mutation (c'est--dire ayant cette mutation sur un seul de ses
deux chromosomes), quel est le profil lectrophortique obtenu aprs amplification de ce fragment et
coupure par l'enzyme de restriction dont le site est modifi par cette mutation (on admet qu' il est unique
dans ce fragment) ?
A 1 bande
B 2 bandes
C 3 bandes
D 4 bandes E :5 bandes
9
Enonc correspondant au Gne de la Dystrophine
Les dltions du gne de la dystrophine sont responsables de deux maladies musculaires, l'une trs svre
appele Myopathie de Duchenne, l'autre moins grave appele "Maladie de Becker". A la fin du fascicule,
vous avez la squence des exons 44 51 du gne de la dystrophine et leurs bordures introniques. Le reste
des introns de taille trs grande est marqu par des pointills (-----------). Sous les parties exoniques se
trouvent la squence des acides amins. La jonction intron-exon n'est pas signale et peut se trouver 1
ou 2 bp du codon indiqu. De mme la fin d'un exon peut correspondre un codon incomplet. Une mini-
dystrophine dpourvue de la squence protique code par les exons 44 51 reste un peu fonctionnelle.
La numrotation correspond aux nuclotides.

QUESTION N35 (2 points)
Parmi les dltions suivantes, quelles sont celles responsables de la Maladie de Duchenne (myopathie
svre)
A dltion de l'exon 44
B dltion de l'exon 45
C dltion de l'exon 46
D dltion de l'exon 47
E dltion de l'exon 48
QUESTION N36 (2 points)
Parmi les dltions suivantes, quelles sont celles responsables de la Maladie de Becker (myopathie moins
grave)
A dltion de l'exon 49
B dltion de l'exon 50
C dltion de l'exon 51
D dltions englobant les exons 47 et 48
E dltions englobant les exons 48 et 49
QUESTION N 37 (2 points)
Parmi les dltions suivantes, quelles sont celles responsables de la Maladie de Duchenne (myopathie
grave)
A dltions englobant les exons 45, 46 et 47
B dltions englobant les exons 46, 47 et 48
C dltions englobant les exons 46, 47, 48, 49 et 50
D dltions englobant les exons 47, 48, 49 et 50
E dltions englobant les exons 48, 49, 50 et 51

QUESTION N 38 (2 points)
Pour tudier l'exon 51 du gne de la dystrophine, un fragment de 340 bp (voir question suivante) est
amplifi par la mthode de PCR. Quelles sont parmi les amorces suivantes de 20 bp les deux que vous
demanderiez synthtiser pour amplifier ce fragment ?

A 5' AAAATGATAAAAGTTGGCAG 3'
B 5' AAATTGGCTCTTTAGCTTGT 3'
C 5' GACGGTTGAAAATAGTAAAA 3'
D 5' ACAAGCTAAAGAGCCAATTT 3'
E 5' CTGCCAACTTTTATCATTTT 3'

QUESTION N 39 (1 point, 1 seule rponse juste)
Par quels nuclotides commence et se termine le fragment prcdent amplifi ?

A 1791 et 2110
B 1811 et 2130
C 1791 et 2130
D 1811 et 2110
E 1791 et 2130
10
Sites de restriction pour les questions 40 et 41

BstN I: 5' CC + TGG 3' Mbo I: 5' + GATC 3'
Mse I: 5' T + TAA 3' Afl II: 5' C + TTAAG 3'

QUESTION N 40 (1 point)

La mutation du nuclotide 2021 en T situ dans l'exon 51 du gne de la dystrophine ?

A ne modifie pas la fonction de la dystrophine
B cre un site de restriction
C entrane un dcalage de lecture
D change un acide amin un autre diffrent
E donne une protine tronque

QUESTION N 41 (1 point)
La mutation du nuclotide 2030 en T situ dans l'exon 51 du gne de la dystrophine ?

A ne modifie pas la fonction de la dystrophine
B cre un site de restriction
C entrane un dcalage de lecture
D change un acide amin un autre diffrent
E donne une protine tronque

Squence des exons 44 51 du gne de la dystrophine et des bordures introniques

11


12
Problme sur FGFR2

La squence ci-dessous correspond une partie du gne du rcepteur de type 2 de FGF (fibroblaste
growth factor). Elle commence dans un exon et se termine dans un autre exon. Sous les parties
exoniques, la squence protique correspond la troisime boucle Immunoglobuline-like de la partie
extra-cellulaire de ce rcepteur. La suite 3 du gne code pour le passage transmembranaire et la partie
cytoplasmique qui contient deux domaines tyrosine-kinases. Ala : GCU GCA GCC GCG


QUESTION N 42 (2 points)
Lexamen de ces squences nuclotidique et protiques permet de dire que :

A il existe 3 introns
B les sites accepteurs sont les plus frquemment rencontrs chez les gnes humains
C il existe la possibit de pont disulfure intra-chane dans cette 3me boucle
D la dltion de lexon (contenant les nuclotides 250-350) donnerait une protine tronque
E il existe 3 sites potentiels de N-glycosylation

Le changement du nuclotide 328 G en A est responsable chez un nouveau-n dun syndrome
malformatif trs important des os de crne et de la face. Plusieurs hypothses ont t mises pour
expliquer la gravit de cette mutation .
QUESTION N 43 (3 points)

La premire est la cration dun site Accepteur. Dans ce cas

A le rcepteur FGF de type 2 est plus court de 17 acides amins
B le rcepteur FGF est tronqu du domaine transmembranaire et des domaines tyrosine-kinases
C il existe un dcalage de lecture
D lARNm mature de FGFR de type 2 est plus court que lARNm normal
E aucune des propositions ci-dessus nest juste
13
QUESTION N 44 (3 points)
La seconde est la cration dun site Donneur. Dans ce cas

A le rcepteur FGF de type 2 est plus court de 17 acides amins
B le rcepteur FGF est tronqu du domaine transmembranaire et des domaines tyrosine-kinases
C il existe un dcalage de lecture
D lARNm mature de FGFR de type 2 est plus court que lARNm normal
E aucune des propositions ci-dessus nest juste

QUESTION N 45 (1 point)
En considrant que le patient est homozygote pour cette mutation, on ralise une RT-PCR partir

A dADN extrait de muscle
B dADN extrait de fibroblaste
C dADN extrait de surrnale
D dADN extrait dos
E aucune des propositions ci-dessus nest juste

QUESTION N 46 (2 points)
En considrant que le patient est homozygote pour cette mutation, on ralise une RT, puis une PCR en
prenant comme amorces des oligonuclotides compris entre 100 - 120 et 500 - 520.
Parmi les oligonuclotides suivants, lesquels sont utiliss ?

A G T C T G G G G A A G C T G T A A T C T C
B G A G A T T A C A G C T T C C C C A G A C
C C T C T A A T G T C G A A G G G G T C T G
D C T T G A G G T A G G G C A G C C C G T C
E G A C G G G C T G C C C T A C C T C A A G

Items de rponse pour les 3 questions suivantes
Ci-dessous 5 squences potentielles obtenues aprs le squenage du produit de PCR (seulement une
partie de la squence du produit de PCR est montre, la partie souligne est la plus intressante pour
rpondre la question) ?

A TATACGTGCTTGGCGGGTAATTCTATTGG
B TATACGTGCTTGGCAGGTAATTCTATTGG
C GTTCTCAAGGTAATTCTATTGGGATATCC
D TATACGTGCTTGGCAGCGCCTGGAAGAGAAAA
E GTTCTCAAGCGCCTGGAAGAGAAAAGGAG

QUESTION N 47 (2 points, 1 seule rponse juste)

Si la mutation cre un site accepteur, quelle est la bonne squence ?

QUESTION N 48 (2 points, 1 seule rponse juste)

Si la mutation cre un site donneur, quelle est la bonne squence ?

QUESTION N 49 (2 points, 1 seule rponse juste)

Prenons une troisime hypothse, lexon, qui porte la mutation, est limin par exon skipping , quelle
est la bonne squence ?
14
Squence de la PROINSULINE ci-dessous et premires questions du problme sur lINSULINE








15















QUESTION N50 (1 point)
Pour isoler ce gne humain, une sonde d'ADN complmentaire de l'insuline a t obtenue partir

A d'une banque gnomique
B d'une banque d'ADN complmentaire hpatique
C d'une banque d'ADN complmentaire d'hypophyse
D d'une banque d'ADN complmentaire de pancras
E aucune rponse bonne
QUESTION N 51 (4 points)
L'ARN messager mature de l'insuline sans compter l'extrmit 3' polyA est peu prs long de ?

A 333 paires de bases
B 350 paires de bases
C 423 paires de bases
D 465 paires de bases
E 490 paires de bases
16

QUESTION N 52 (1 point)
Combien d'introns contient le gne de l'insuline ?
A 1
B 2
C 3
D 4
E aucune rponse juste
17
Problme sur lINSULINE (suite) : voir squence du gne sur fascicule part
QUESTION N 53 (2 points)
Combien d'acides amins contient le peptide signal de l'insuline?
A 15
B 24
C 33
D 41
E 45
QUESTION N 54 (2 points)
Chez un patient homozygote pour la mutation du nuclotide G en T appele R65L du gne de l'insuline,
on ralise partir du plasma un western blot en utilisant un anticorps polyclonal de lapin reconnaissant
les deux chanes de l'insuline ? Ci dessous se trouve la liste de diffrentes tapes exprimentales
permettant d'tudier l'expression de ce gne mut de l'insuline (des tapes intermdiaires peuvent ne pas
tre cites ou tre inutiles dans cette exprience).
1 - Lavage
2 - Incubation avec un anticorps anti-anticorps de souris li un enzyme
3 - Prise de sang
4 - Transfert sur une membrane de nylon ou nitrocellulose
5 - Incubation avec un anticorps anti-anticorps de lapin li un enzyme
6 - Electrophorse en utilisant un gel SDS-acrylamide avec mercaptothanol.
7 - Incubation avec l'anticorps polyclonal dirig contre l'insuline ?
8- Raction enzymatique avec formation d'un produit mesurable

Dans quel ordre, se droule la ralisation de ce Western blot ?
A 3 - 7 - 6 - 4 - 2 - 8 - 1
B 3 - 6 - 4 - 7 - 5 - 1 - 8
C 3 - 7 - 6 - 4 - 2 - 8 - 1
D 3 - 6 - 4 - 7 - 2 - 8 - 1
E 3 - 7 - 6 - 4 - 5 - 8 - 1

Ci-dessus se trouvent 5 profils de Western blot.
En tenant compte de deux renseignements supplmentaires :
- la bande accompagne d'une astrisque (*) correspond la proinsuline
- on considre que la proinsuline est absente dans le sang d'un individu normal
Rpondez aux questions suivantes
QUESTION N55 (1 point)
Quelle est environ la taille de la proinsuline ?
A 258 paires de bases
B 86000 daltons
C 10214 daltons
D 8,6 kilodaltons
E 86 kilopaires de base
QUESTION N56 (2 points)
Quel est le profil de Western blot qui correspond un homme normal ?

X kD
Marqueurs
A B C D E
*
0, 5X kD
18
QUESTION N57 (2 points)
Quel est le profil du Western blot qui correspond l'individu homozygote pour la mutation R65L ?

QUESTION N 58 (3 points)
Pour tudier cette mutation chez les parents et d'autres membres de la famille, un fragment d'environ 250
bp est amplifi par la mthode de PCR. Une des deux amorces se trouve proche du site accepteur de
l'intron qui prcde l'exon qui porte cette mutation. Quelles sont parmi les amorces suivantes de 20 bp les
deux que vous demanderiez synthtiser pour amplifier ce fragment qui contient la mutation ?

A 5' TGCTCTGCGCGGCACGTCCT 3'
B 5' ACGCAGCCTGCAGGCAGCCC 3'
C 5' GAACCAGCCCTGCTGTGCCG 3'
D 5' CTTGGTCGGGACGACACGGC 3'
E 5' CGGCACAGCAGGGCTGGTTC 3'

QUESTION N 59 (1 point)
Nous rappelons que les sites de reconnaissance des enzymes de restriction, Eco RI et Hind III, sont les
suivants:
5' G + AATT C 3' site Eco RI 5' A + AGCT T 3' site Hind III
3' C TTAA | G 5' 3' T TCGA | A 5'
Chez un htrozygote pour cette mutation (un seul de ses deux chromosomes porte cette mutation), aprs
amplification de ce fragment d'ADN que faites-vous pour mettre en vidence cette mutation R65L du
gne de l'insuline ? Cochez les tapes utilises.

A coloration par le bleu de coomassie
B digestion par l'enzyme Eco RI
C digestion par l'enzyme Hind III
D lectrophorse en utilisant un gel d'agarose
E lectrophorse en utilisant un gel SDS-polyacrylamide

QUESTION N 60 (2 points)
Quel profil obtient-on (rsultat 5 bp prs) ?

A 1 bande de 256 bp
B 2 bandes de 174bp et 82 bp
C 2 bandes de 154 bp et 102 bp
D 3 bandes de 256 bp, 154 bp et 102 bp
E 3 bandes de 256 bp, 174 bp et 82 bp

Biochimie II /Biologie Molculaire 1
re
session Mai 2004 (extraits) : Rcepteur aux andrognes

Les lsions du gne du rcepteur aux andrognes sont responsables du syndrome dinsensibilit aux
andrognes. Il sagit dune maladie gntique transmission rcessive lie au chromosome X. Seuls les
individus 46,XY sont atteints. Il existe deux formes cliniques : lune complte donnant un phnotype
fminin, lautre incomplte donnant une ambigut des organes gnitaux externes.
A la fin du fascicule, vous avez deux squences contenant les rgions codantes du rcepteur aux
andrognes (squence 1 et squence 2). La squence 1 reprsente la squence partielle de l'ADN
complmentaire du rcepteur aux andrognes (il manque les extrmits 5' et 3'). Elle contient des
astrisques qui correspondent des acides amins trs conservs parmi le rcepteur aux andrognes de
nombreuses espces. Lacide amin 667 correspond au premier acide amin de lhlice o H1 du
domaine qui en contient 12. Lacide amin qui termine la 12
me
hlice o est S900. Les exons sont
nomms en lettre.
QUESTION N 61 (3 points)

A la squence 1 peut tre obtenue aprs lextraction de lADN dun individu
B la squence 2 provient dune banque dADN gnomique
C le rcepteur aux andrognes contient 919 acides amins daprs ces deux squences
D ces deux squences contiennent plusieurs zones rptes
19
E les acides amins marqus par un astrisque appartiennent au domaine liant les andrognes
QUESTION N62 (2 points)
Le rcepteur aux andrognes
A est un rcepteur membranaire
B se lie lADN sous forme dhtrodimre
C a son domaine liant les andrognes qui stend de lexon D lexon H
D lie un coactivateur en labsence de ligand
E recrute des histones-dactylases en prsence de ligand

QUESTION N 63 (1 point)
Deux ARN messagers du rcepteur aux andrognes sont dtects par la mthode de Northern en utilisant
comme sonde lADN complmentaire du gne du rcepteur aux andrognes. Lun prdominant a une
taille de 10 kb, lautre une taille de 7 kb. Pour raliser ce Northern, plusieurs tapes sont utilises. Parmi
celles listes ci-dessous, lesquelles ont servi la ralisation de ce Northern.

A Extraction de l'ADN de la prostate ou de fibroblaste de peau gnitale
B Digestion de lARN par des enzymes de restriction
C Aprs sparation de lARNm par lectrophorse, transfert sur une feuille de nylon
D Avant le transfert, dnaturation de lARNm par la soude
E Amplification par RT-PCR
QUESTION N64 (1 point)

Comme la diffrence de taille entre les 2 ARN messagers de 10 kb et 7 kb du rcepteur aux andrognes
ne sont pas secondaire un pissage alternatif, elle pourrait tre due (aidez-vous des longueurs des
squences 1 et 2)

A une initiation diffrente de la traduction
B une initiation diffrente de la transcription
C la prsence de deux sites de la polyadnylation
D la prsence de deux codons stop
E Aucune des rponses prcdentes n'est juste

Enonc pour les questions 65 71

En hybridant avec lADN complmentaire du rcepteur aux andrognes une banque dADN gnomique,
plusieurs clones ont t isols. La carte de restriction de lun de ces clones est dessine sur la figure ci-
dessous. Le fragment Sma I-Kpn I (2601-4000) reprsente le fragment de la squence 2 allant du
nuclotide 169 au nuclotide 1568. Le Northern prcdent est hybrid par 3 fragments distincts du clone
ci-dessous. Les fragments Sma I-Kpn I (2601-4000) et Sma I-Sma I (1401-2600) donnent un signal
dhybridation avec deux bandes, lune de 10 kb et lautre de 7 kb. Avec le fragment Xba I-Nsi I, il ny a
pas de bandes lautoradiographie. Il nexiste quun seul site dinitiation de la transcription.


Pour dterminer avec prcision le site dinitiation de la transcription, on ralise une exprience utilisant la
protection la nuclase S1. Elle se droule en 3 tapes :
i) hybridation en phase liquide de fragments dADN complmentaire du brin 5-3 du clone (figure
la question 26) aux ARN totaux extraits de tissus prostatiques;
ii) coupure par la nuclase S1;
N
s
i

I
E
c
o

R
I
S
m
a

I
X
b
a

I
K
p
n

I
S
m
a

I
E
c
o

R
I
B
s
t

N
I
Clone provenant dune banque gnomique hybridpar lADNc du rcepteur aux andrognes
Les chiffres correspondent la position du nuclotide prcdant la coupure par l enzyme de restriction. Le
nombre 0 par la coupure par Xha I est arbitraire.
0
2
6
0
0
4
0
0
0
1
4
0
0
7
5
0
1
6
0
0
pb
3 5
20
iii) lectrophorse et autoradiographie.
Le rsultat est sur la figure ci-dessous.



QUESTION N 65 (1 point)
Les trois sondes (1, 2 et 3) utilises respectivement dans les expriences dposes sur les lignes 1, 2 et 3
ont t marques en 5'

A par la Taq polymrase
B par la rserve transcriptase
C par la T4 polynuclotide-kinase
D en utilisant de l'ATP marqu en par le
32
P
E en utilisant de l'ATP marqu en o par le
32
P

QUESTION N 66 (3 points)
On peut en dduire que le gne du rcepteur aux andrognes

A a son site dinitiation de la transcription situ ~80 pb de son site dinitiation de la traduction
B a 9 introns
C a son site dinitiation de la transcription situ ~1110 pb de son site dinitiation de la traduction
D a une rgion non codante en 5 denviron 1310 pb (5UTR)
E a une rgion non codante en 5 denviron 1510 pb (5UTR)

QUESTION N 67 (3 points)
On peut en dduire daprs tous les renseignements dj obtenus depuis le dbut que

A les squences 1 et 2 ne contiennent pas le site dinitiation de la transcription
B linsertion de la queue polyA peut se faire sur le nuclotide 3120 de la squence 1
C la transcription peut sarrter au nuclotide 4343 de la squence 2
D le fragment en amont du site Nsi I nest pas transcrit
E la partie 3 non codante est de taille variable

QUESTION N 68 (2 points)

Pour connatre la squence gnomique de la partie 5 en amont (upstream) de la squence 2, on utilise
lors du squencage du clone gnomique ci-dessus une amorce correspondant la squence souligne A1
dans la squence 2.
Loligonuclotide utilis sera :

A 5' CGCCTGTTGAACTCTTCTGAGC 3'
B 5' GCGGACAACTTGAGAAGACTCG 3'
C 5' GCTCAGTTGAAAATAGTAGGCG 3'
D 5' GCTCAGAAGAGTTCAACAGGCG 3'
E 5' CGAGTCTTCTCAAGTTGTCCGC 3'
1 2 3
0, 2 kpb
1, 2 kpb
1, 4 kpb
Autoradiographieaprs protection la nuclase S1
Sonde 1 : Nsi I-Bst N I (750-1600)
Sonde 2 : Sma I-Sma I (1400-2600)
Sonde 3 : Sma I-Kpn I (2601-4000)
21

QUESTION N 69 (2 points)
Une dltion de lexon B du gne du rcepteur aux andrognes, englobant les bordures introniques, est
responsable dune forme complte dinsensibilit aux andrognes.
Cette dltion

A donne une protine tronque c'est--dire de taille infrieure la protine normale
B donne une protine liant les andrognes, mais ne liant pas lADN
C donne une protine dtectable par western blot avec un anticorps monoclonal dirig contre un
pitope correspond aux acides amins 800 850 du rcepteur aux andrognes
D donne une protine capable in vitro de stimuler lactivit dun gne reporter (lucifrase) ayant
dans sa rgion promotrice plusieurs ARE
E sera dtectable en tudiant lARNm par RT-PCR

QUESTION N 70 (3 points)
Avant l'utilisation de la biologie molculaire permettant le squenage du gne du rcepteur aux
andrognes, ltude de la liaison des andrognes sur des fibroblastes en culture provenant dune biopsie
de peau gnitale dun patient suspect dinsensibilit complte aux andrognes tait un outil diagnostique
en permettant d'valuer le KD et le nombre de rcepteurs.
Parmi les mutations suivantes qui sont toutes responsables dune insensibilit complte aux andrognes,
lesquelles abolissent totalement la liaison des andrognes ces fibroblastes.
A mutation C784Y (TGTTAT)
B mutation dans lintron B (ou 2) changeant le nuclotide 2 A en C produisant un exon skipping
de lexon C
C mutation R607X (CGATGA)
D mutation H874C (CATCGT)
E mutation C619S (TGTTCT)

QUESTION N 71 (3 points)
Un patient, porteur de la mutation Q60X (CAGTAG) du gne du rcepteur aux andrognes a une forme
partielle dinsensibilit aux andrognes. Ltude de la liaison des andrognes sur des fibroblastes en
culture de ce patient montre une liaison diminue mais relle aux rcepteurs.
Le western blot fait partir des extraits cellulaires (1 et 3 : fibroblastes du sujet normal ; 2 et 4 :
fibroblastes du patient ayant la mutation Q60X) est hybrid par deux anticorps monoclonaux diffrents;
lun (anticorps A) reconnat lextrmit N-terminale de la protine, lautre (anticorps B) reconnat le
domaine de liaison des andrognes (figure ci-dessous).


On peut en conclure que cette mutation

A donne une protine tronque de son domaine de liaison lADN
B ne donne aucune protine
C donne une protine tronque ne contenant pas les 200 premiers acides amins
D entrane lutilisation dun nouveau site dinitiation de la traduction permettant la synthse dune
protine commenant par la mthionine 189
E donne un ARN messager mature plus court
~ 108 kDa
~ 78 kDa
We ste rn blot
Anticorps A Anticorps B
1 2 3 4
22
Facult de Mdecine et de Pharmacie de FES
1re anne - mai 2004 (1
re
session)
EPREUVE DE BIOCHIMIE ET BIOLOGIE MOLECULAIRE
Pr Yves MOREL

dure de lpreuve : 90 minutes
IMPORTANT : vous devez vrifier que votre livret contient 20 questions :
QUESTIONS N 1 20
En rponse chaque question vous pouvez noircir une cinq cases sur la grille

QUESTION N 1 (1 point)
Le gnome humain contient des squences rptes et uniques. Parmi les squences suivantes, lesquelles
sont considres comme uniques ?

A squence crant un RFLP (restriction fragment length polymorphism)
B squence Alu
C squence transcrite par la RNA polymrase de type I
D squence codant pour un SNP
E squence transcrite par la DNA polymrase de type II

QUESTION N 2 (1 point)
Parmi les domaines suivants, lesquels se retrouvent dans une protine nuclaire qui module la
transcription.

A domaine 7 passages transmembranaires
B domaine leucine zipper
C domaine du peptide signal
D domaine 2 doigts de zinc
E homodomaine

QUESTION N 3 (1 point)
Un coactivateur

A se lie une squence HRE
B permet de tranformer leuchromatine en htrochromatine
C a une activit histone dactylase
D peut se lier au domaine de liaison contenant 12 hlices o
E agit comme un mdiateur pour augmenter la transcription dun gne

QUESTION N 4 (1 point)

La protine HP1 (heterochromatine protein 1)

A se lie des coactivateurs
B permet de tranformer leuchromatine en htrochromatine
C favorise le recrutement dune histone dacetylase pour inactiver lhistone adjacent
D se lie au rsidu lysyl 9 dans lhistone H3
E inhibe directement la RNA polymrase DNA dpendante de type II

23
Enonc pour les Questions n 5 et 6
Pour liminer le gne AMH dans les cellules de Sertoli au moment de la pubert chez la souris, il faut
obtenir un ensemble de croisements entre des souris normales et transgniques comme le montre la figure
ci-dessous. La recombinaison homologue a lieu dans les cellules ES. Les cellules ES sont incorpores
dans un blastocyte. La souris obtenue correspond la souris 1 de larbre ci-dessous. La souris 4 est
homozygote par linvalidation conditionnelle du gne AMH (il sera appel gne AMH*). La souris 8 a le
matriel gntique permettant tout moment dinvalider compltement le gne AMH.

QUESTION N 5 (2 points)
La souris 1 a t obtenue aprs recombinaison homologue avec un vecteur recombinant.
Ce vecteur recombinant avant son introduction dans les cellules ES contient

A une partie de la squence gnomique de lAMH
B un gne NEO qui a t introduit dans un exon du gne AMH en provoquant un dcalage de lecture
C un des exons codant pour un domaine essentiel de la fonction anti-mullerienne qui est entour par
des sites CRE
D le gne Thymidine kinase pour obtenir une slection positive
E au moins trois sites Lox P

QUESTION N 6 (2 points)
Daprs larbre gnalogique, on peut dire

A la souris 8 est homozygote pour le gne AMH* et htrozygote pour le gne CRE-
LBDantistrogne
B au moins une de deux souris 6 et 7 est htrozygote pour le gne CRE-LBDantistrogne et le
gne AMH*
C la souris 5 contient dans son ADN un gne CRE-LBDantistrogne pouvant sil est transcrit
donner une protine fusion CRE-domaine de liaison aux strognes mut capable de lier seulement
un anti-strogne comme le Tamoxifne
D la souris 5 contient dans son ADN le gne CRE-LBDantistrogne sous le contrle dun
promoteur spcifique de cellules cardiaques
E la souris nest quhtrozygote pour le gne CRE-LBDantistrogne

QUESTION N 7 (1 point)
Ltiquettage dune protine Y

A se ralise avant la synthse de la protine Y
B permet de purifier les molcules qui interagissent avec cette protine Y
C ncessite pour des tudes in vivo le transfert dun vecteur dexpression pouvant produire une
protine de fusion comme la green fluorescent protein + protine Y
D ncessite la connaissance de la fonction de la protine Y
E permet la purification de la protine Y par une chromatographie daffinit
1
2
4
3
5
6 7
8
24
Enonc pour les Questions suivantes : Le dficit en 17|-hydroxystrode dhydrognase
Le dficit en 17|-hydroxystrode dhydrognase (17|-HSD), maladie transmission autosomique
rcessive, est responsable chez le sujet 46,XY dune ambigut sexuelle due labsence de synthse de
testostrone par les cellules de Leydig du testicule. Il est trs frquent dans la bande de Gaza. Lenzyme
responsable na jamais pu tre purifi mme partiellement partir du tissu testiculaire.


Avant la dcouverte du gne 17|-HSD de type 3 responsable de cette maladie, deux gnes ont t isols.
- Le gne 17|-HSD de type 1 catalysant les ractions 2 et 4.
- Le gne 17|-HSD de type 2 catalysant la raction 3.
Les ADNc de ces 2 gnes nhybrident pas les ARNm dorigine testiculaire qui sont dposs sur un
northern blot.

QUESTION N 8 (1 point)
Parmi les propositions suivantes, quelles sont les tapes qui diffrent entre la mthode de Northern et la
mthode de Southern ?

A Lavage aprs hybridation selon des conditions de stringence lies la nature de la sonde
B Transfert sur une feuille de nylon
C Dnaturation par la soude du gel dlctrophorse avant le transfert sur la feuille de nylon
D Hybridation avec une sonde marque au
32
P
E Digestion par une enzyme de restriction

QUESTION N 9 (2 points)
Des auteurs ont isol lADNc responsable du dficit en 17|-HSD partir dune banque dADNc de
testicule construite dans un vecteur dexpression. Pour dcouvrir le bon clone, ils ont recherch les clones
dADNc qui synthtisent de la
3
H-testostrone. Parmi les outils suivants, lesquels ont t utiliss lors de
cette exprience ?

A
3
H-oestradiol comme substrat
B
3
H-A4-androstnedione comme substrat
C lADNc du gne 17|HSD de type 2 comme sonde
D des anticorps anti-17|HSD de type 2 comme sonde
E des anticorps anti-17|HSD de type 3 comme sonde
O
O
OH
HO
O
OH
1 1
Testostrone A4-androstnedione
stradiol strone
2 2
3 3
4 4
HO
O
5 5
6 6
O
O
OH
HO
O
OH
1 1
Testostrone A4-androstnedione
stradiol strone
2 2
3 3
4 4
HO
O
5 5
6 6
25
QUESTION N 10 (3 points)
A la fin du fascicule, vous avez deux squences 5'3' correspondant soit cet ADN complmentaire soit
une partie du gne 17|-HSD de type 3. Les triangles sont situs au dessus du dbut dun exon. La
numrotation utilise dans ces deux squences est totalement indpendante. La squence correspondante
lADN complmentaire est complte. Lenzyme code par le gne 17|-HSD de type 3 ne catalyse
quune seule raction, la conversion de la A4-Androstnedione en testostrone. La seule bande dtectable
par ces squences sur lautoradiographie dun Northern reprsentatif dun nombre important de tissus
correspond celle du testicule. On peut dire que

A lADNc du gne 17|-HSD de type 3 correspond la squence 2
B la squence 2 contient toute la squence du gne 17|-HSD de type 3
C la bande dtecte lors du Northern est suprieure 1,1 kDA
D un exon est constitu uniquement dune squence non codante (UTR)
E lADNc du gne 17|-HSD de type 3 correspond la squence 1

QUESTION N11 (2 points)
La squence 1
A contient un site de polyadnylation
B comprend les exons 3, 4 et 5
C comprend la squence complte de deux introns
D montre que lintron 5 commence au nuclotide 501
E reprsente le 0,32 millionime du gnome haplode humain

QUESTION N12 (1 point)
La mutation R80Q est la plus frquente du dficit en 17|-HSD car elle atteint la population de la bande
de Gaza o une trs forte consanguinit existe. Cette mutation
A est situe dans lexon 2
B change le nuclotide 146 en A (numrotation de la squence 1)
C change le nuclotide 147 en A (numrotation de la squence 1)
D change le nuclotide 148 en A (numrotation de la squence 1)
E aurait pu crer un site donneur

QUESTION N13 (1 point)
Le dpistage de cette mutation R80Q peut tre faite large chelle dans la population de la bande de
Gaza. Plusieurs mthodes peuvent tre utilises, mais elles ncessitent toutes au pralable une extraction
de lADN chez chaque individu et une amplification par PCR du fragment de 970 bp de la squence 1.
Voici la liste des produits et de mthodes pouvant tre utiliss
1- Taq polymrase
2- l'enzyme de restriction Taq I
3- ADN gnomique
4- ARN
5- dnaturation -hybridation des amorces- extension (25 cycles)
6- hybridation des amorces-dnaturation de l'ADN gnomique- extension (25 cycles)
7- dsoxynuclotides (dATP, dCTP, dGTP, dTTP)
8- didsoxynuclotides (ddATP, ddCTP, ddGTP, ddTTP)
Parmi les propositions suivantes, laquelle permettra d'amplifier ce fragment ?

A on met dans le mme tube (4 + 2 + 7) puis on ralise 6
B on met dans le mme tube (3 + 1 + 8) puis on ralise 5
C on met dans le mme tube (4 + 1 + 7) puis on ralise 5
D on met dans le mme tube (3 + 2 + 7) puis on ralise 6
E on met dans le mme tube (3 + 1 + 7) puis on ralise 5

26
QUESTION N14 (2 points)
Si la mthode de coupure par les enzymes de restriction est utilise, quels sont les items justes

A coupure du fragment de 970 bp par lenzyme Alu I
B un sujet normal a trois bandes : 606 bp, 219 bp, 145 bp
C un sujet htrozygote pour la mutation a quatre bandes : 825 bp, 606 bp, 219 bp, 145 bp
D un sujet homozygote pour la mutation a deux bandes : 825 bp, 145 bp
E un sujet htrozygote pour la mutation a quatre bandes : 751 bp, 606 bp, 219 bp, 145 bp

QUESTION N15 (2 points)
Si la mthode de dot-blot est utilise, quels sont les items justes. Les squences des sondes correspondent
aux squences 5-3 donnes la fin du polycop.

A les sondes utilises peuvent tre des oligonuclotides denviron 20 nuclotides marqus grce
une T4-polynuclotidekinase en utilisant de [o
32
P]ATP
B lune des sondes a comme squence (dbut T138) 5TTATTAGCCGGACGCTGGAA 3
C lune des sondes a comme squence (dbut T138) 5TTATTAGCCGAACGCTGGAA 3
D lune des sondes a comme squence (dbut T138) 5TTATTAGCCAGACGCTGGAA 3
E Deux sondes marques hybrident en mme temps la mme feuille de nylon

QUESTION N16 (1 point)
La mutation changeant le nuclotide 189 (squence 1) en T

A est situe dans lintron 3
B scrit IVS4+4A>T
C scrit IVS3-4A>T
D se trouve dans le site accepteur de lintron 3
E est une mutation stop

Enonc pour les Questions 17, 18, 19 et 20
Aprs gonadectomie, lARN dun patient homozygote pour cette mutation changeant le nuclotide 189
(squence 1) en T est extrait du tissu gonadique. Le Northern (figure droite) est hybrid par lADNc du
gne 17|-HSD de type 3. LARN est amplifi par RT-PCR en utilisant deux amorces, lune situe dans
lexon 1 (amorce 1) et lautre dans lexon 5 (amorce 2). Llectrophorse des produits obtenus montre
lexistence de 2 bandes. Le squenage de 5 l de la raction de RT-PCR est fait en utilisant plusieurs
amorces. On nobtient une squence lisible sur toute sa longueur quavec une amorce se trouvant dans
lexon 4. On retrouve en particulier cette squence (le brin dADN ci-dessous est le mme que ceux des
squences 1 et 2 situes la fin du fascicule) :
5 GAAAGCGTACTCGTTCGAGAGCGGACTACAGGGAGGAGTGTGAA 3

QUESTION N17 (3 points)
Cette squence 5 GAAAGCGTACTCGTTCGAGAGCGGACTACAGGGAGGAGTGTGAA 3

A ne correspond qu lexon 4
B correspond la jonction entre lexon 4 et 5
C correspond la jonction entre lexon 3 et 4
D correspond la jonction entre lexon 3 et 5
E correspond la jonction entre lexon 2 et 4
27
QUESTION N18 (3 points)

On peut dire que

A les fragments dposes dans les puits (normal et mut) de la figure ci-dessus droite sont des
fragments dADN
B les bandes visibles sur llectrophorse des produits de RT-PCR ont t colores par le bleue de
coomassie
C la squence ci-dessus a pu tre obtenue en utilisant lamorce dduite de la squence 461-480
(squence 1) : 5 CCTGCAAGTTTTTCTTTAAT 3
D la squence ci-dessus a pu tre obtenue en utilisant lamorce dduite de la squence 411-430
(squence 1) : 5 TGCTTGTATAATCTTCACAC 3
E la squence ci-dessus a pu tre obtenue en utilisant lamorce dduite de la squence 461-480
(squence 1) : 5 ATTAAAGAAAAACTTGCAGG 3

QUESTION N19 (2 points)

En vous aidant du profil du Northern blot ci-dessus, des rponses aux questions 17 et 18 et en considrant
que lune des bandes de lARN mut correspond lexon skipping des exons 3 et 4, ltude du
retentissement de la mutation changeant le nuclotide 189 (squence 1) en T ltat homozygote (voir le
profil mut du Northern blot ci-dessus et) permet de dire que

A lARNm rsultant dun pissage normal du gne 17|-HSD de type 3 nest pas visible sur le
Northern (profil mut)
B la bande qui a la taille la plus grande correspond un ARNm sans lexon 4
C la bande qui a la taille la plus petite correspond un ARNm sans les exons 3 et 4
D lARN ayant la plus grande taille na pas darrt prmatur de la traduction
E lARN ayant la plus petite taille correspond lexon 4

QUESTION N20 (2 points)

La protine rsultant de lexon skipping des exons 3 et 4

A est une protine dau moins de 240 acides amins
B peut tre visualise par la mthode de Southern
C sera dtecte par un anticorps monoclonal anti-17|-HSD de type 3 dirig contre la partie C-
terminal de la protine
D ne sera pas dtecte par un anticorps monoclonal anti-17|-HSD de type 3 dirig contre les acides
amins 80 140
E est une protine trs courte de 82 AA (mthionine 1 incluse)

28
Facult de Mdecine et de Pharmacie de FES
1re anne - mai 2005 (1
re
session)
EPREUVE DE BIOCHIMIE ET BIOLOGIE MOLECULAIRE
Pr Yves MOREL
dure de lpreuve : 90 minutes
IMPORTANT : vous devez vrifier que votre livret contient 20 questions :
QUESTIONS N 1 20
En rponse chaque question vous pouvez noircir une cinq cases sur la grille

QUESTION N 1 (1 point)

Un microsatellite spcifique dune rgion de notre gnome

A est bialllique
B est une squence rpte variable dun individu lautre
C doit tre amplifi avec des amorces contenant en 3 au moins 2 3 copies du motif rpt
D peut tre une squence Alu
E peut tre un SNP

QUESTION N 2 (1 point)

Un SNP single nuclotide polymorphism
A est bialllique
B est un microsatellite
C concerne un polymorphisme suprieur 1% de la population
D est assez rare (environ 500 000 dans notre gnome haplode)
E est une squence unique

QUESTION N 3 (1 point)

Un domaine leucine-zipper
A contient une hlice o avec beaucoup dacides amins chane latrale basique
B est constitu de 3 hlices o
C contient ube rptition de rsidus leucyl
D permet la constitution de dimres grce aux chanes latrales charges de rsidus leucyl
E indique que la protine est un coactivateur

QUESTION N 4 (1 point)

Un gne domestique house keeping gene

A na pas de bote TATA
B sexprime spcifiquement dans un tissu
C est une squence unique
D est un pseudogne par duplication
E possde dans la rgion rgulatrice une squence GC hypermthyle
29
QUESTION N 5 (1 point)
Le code gntique

A est chevauchant
B est dgnr
C est constitu de 64 codons codant 20 acides amins
D est spcifique despce
E permet de protger lindividu en ayant par exemple 6 codons pour les acides amins les plus
frquemment rencontrs dans les protines

QUESTION N 6 (1 point)
A propos des polymrases,

A lARN polymrase ADN dpendante de type III permet la transcription des tRNA
B lARN polymrase ADN dpendante de type I permet la transcription des ARN ribosomaux
C lADN polymrase ADN dpendante de type II permet la transcription des squences gniques
uniques
D la Taq polymrase est une ADN polymrase thermosensible
E la Transcriptase inverse est une ARN polymrase

QUESTION N 7 (1 point)
A propos de la transgense,

A le gne NEO permet dinvalider le gne lors de la transgense conditionnelle
B le gne NEO permet la slection positive suelement des cellules ayant eu une recombinaison
homologue
C le gne TK (thymidine-kinase) permet la phosphorylation de la nomycine
D un des sites Lox P doit tre dans un exon pour une invalidation conditionnelle de ce gne
E la slection des cellules ES ayant eu une recombinaison homolgue ncessite dabord une slection
positive suivie dune slection ngative.

Enonc pour les questions suivantes

Tous les nonces des questions suivantes peuvent servir rpondre aux questions 8 20
A la fin du fascicule se trouvent deux squences :

1- la squence du gne de la 21-hydroxylase, CYP21 et de son pseudogne CYP21P (distribue en
cours). La squence complte correspond celle du gne fonctionnel, CYP21. Pour le pseudogne
CYP21P, seulement les nuclotides diffrents sont nots. Dans les deux squences, un trait signale la
dltion dun nuclotide. Les flches verticales indiquent les dbuts de la transcription. Entre le dbut de
la transcription et le dbut de la traduction, il nexiste pas dintron.

2- la squence de lextrmit 3 de lADN complmentaire sans la queue polyA du gne de la 21-
hydroxylase.

Ce gne code pour une enzyme, le cytochrome P450c21, exclusivement surrnalien, qui catalyse une 21-
hydroxylation. Cette raction est irrversible. Le dficit en 21-hydroxylase, maladie transmission
autosomique rcessive, est responsable dune hyperplasie congnitale des surrnales. La forme la plus
grave entrane une dhydratation svre du nouveau-n par un syndrome de perte de sel. Durant la vie
ftale, le nouveau-n 46 XX prsente une virilisation des organes gnitaux externes mais a des organes
gnitaux internes normaux.
30
QUESTION N 8 (3 points)
On peut dire que

A la fin de la transcription du gne CYP21 peut tre dtermine
B le gne CYP21 contient 10 exons
C le gne CYP21 contient un exon sans squence codante
D le dbut de la transcription se trouve un endroit attendu si lon regarde la squence du gne
CYP21
E le dernier nuclotide transcrit est le nuclotide 2706 (squence 1)

QUESTION N 9 (3 points)

Le pseudogne CYP21P

A est un rtroposon
B contient dans la partie codante 2 insertions de nuclotides qui entranent un dcalage de lecture
avec formation dun codon stop
C contient une dltion qui entrane un dcalage de lecture avec formation dun codon stop
D contient une mutation ponctuelle qui cre un codon stop
E contient une insertion qui entrane un codon stop dans le mme exon

QUESTION N 10 (3 points)( une seule rponse juste)

En vous aidant des deux squences, quelle serait la taille ( 5pb prs) de lADNc correspondant
lARNm le plus transcrit

A 1491 pb
B 2179 pb
C 2207 pb
D 2251 pb
E 2360 pb

QUESTION N 11 (2 points)

La protine SF1, rcepteur nuclaire orphelin, et lACTH, peptide, rgulent lexpression du gne CYP21.
On peut dire que

A SF1 contient plusieurs passages transmembranaires
B ACTH est synthtis par lhypophyse sous forme dun prcurseur nomm la POMC
C ACTH se lie un rcepteur membranaire sept passages transmembranaires qui a pour second
messager le systme tyrosine-kinase
D SF1 doit lier un lment de rponse appel enhancer
E Pour stimuler la transcription, le domaine 12 hlices o de SF1 change de conformation pour
recruter des histones dactylases
31
QUESTION N 12 (2 points)
Le premier ADNc dcouvert concernant le gne CYP21 a t isol chez le bovin. Cet ADNc bovin a t
utilis pour isoler lADNc humain du gne CYP21. Comme lhomologie de squence entre lADNc
bovin et humain est diffrente, la sonde dADNc CYP21 bovine hybride avec des conditions diffrentes
dhybridation les banques bovines et humaines dADNc. On peut dire que

A cest une banque humaine dADNc de foie qui a permis disoler lADNc CYP21 humain
B la temprature dhybridation de la banque humaine a t suprieure celle utilise pour la banque
bovine
C la concentration en sel lors de lhybridration de la banque humaine a t suprieure celle utilise
pour la banque bovine
D cette sonde contient des introns
E lADNc humain isol, dont la squence est la fin de ce fascicule, contient les exons 8, 9, 10 et 11
du gne CYP21

QUESTION N 13 (2 points)
Pour dterminer le dbut de la transcription, deux mthodes sont possibles. Si on utilise la mthode par la
protection la nuclase S1, lesquelles des phrases suivantes sont justes ?

A extraction de lARNm dans le tissu o sexprime le gne CYP21
B utilisation dune sonde marque situe en amont de la premire flche et allant jusquau nuclotide
150
C coupure par la RNase
D migration des fragments protgs sur un gel de squence
E utilisation dun e amorce complmentaire de la squence correspondante aux 7 premiers acides
amins de la protine Cytochrome P450c21

QUESTION N 14 (2 points)
Pour dterminer le dbut de la transcription, deux mthodes sont possibles. Si on utilise la RT-PCR, on
prend une amorce dans la rgion du gne CYP21 o dbute la traduction. Lesquelles des phrases
suivantes sont justes ?

A extraction de lARNm dans le tissue o sexprime le gene CYP21
B utilisation de lamorce 5 ATGCTGCTCCTGGGCCTGCT 3
C utilisation de lamorce 5 TACGACGAGGACCCGGACGA 3
D utilisation de lamorce 5 AGCAGGCCCAGGAGCAGCAT 3
E migration des fragments synthtiss sur un gel de squence

QUESTION N 15 (2 points)

Pour tudier la mutation Q318X, la plus frquente en Tunisie dans le dficit en 2&-hydroxylase, on
utilise une amplification dun fragment dADN en utilisant des amorces trs spcifiques du gne.
Cette mutation modifie lun des sites de restriction ci-dessous (appel site Q318X). Le fragment normal
amplifi contient trois sites de restriction de lenzyme dont le site est modifi.
Site Bam HI 5' G + GATCC 3' Site Bgl II 5' A + GATCT 3'
Site Eco RI 5' CTGCA + G3' Site Xba I 5' T + CTAGA 3'
On peut dire que

A cette mutation est localise dans lexon 7
B cette mutation entrane un dcalage de lecture et une protine tronque
C le fragment amplifi normal aprs digestion donne 4 bandes
D le fragment amplifi contenant la mutation ltat homozygote donne 5 bandes
E le fragment amplifi contenant la mutation ltat htrozygote donne 5 bandes
32
QUESTION N 16 (2 points)

La dltion de lexon 3 ltat homozygote

A donne une ARNm plus court
B nentrane pas de dcalage de lecture
C donne une protine tronque de 108 acides amins
D fait apparatre un codon stop dans lexon 5
E donne une protine reconnue par un anticorps monoclonal dirig vers lpitope reconnaissant les
acides amins 110-130


Enonc commun pour les questions n 17 n20

Le nuclotide 655 C du gne CYP21 peut subir deux changements qui ont des consquences diffrentes.
Un seul de ces changements modifie un site de restriction (site Alu : AGCT).
1 - Le changement de C en A ne modifie pas la maturation du transcrit primaire et lactivit 21-
hydroxylase.
2 - En revanche, le changement de C en G ltat homozygote donne un dficit en 21-hydroxylase trs
svre.
QUESTION N17 (1 point)
Le changement de C en A

A peut tre mis en vidence en amplifiant par PCR un fragment le contenant et en digrant le
fragment amplifi par une enzyme de restriction
B est un RFLP
C est un polymorphisme appel SNP : single nucleotide polymorphism
D peut tre mis en vidence en amplifiant par PCR un fragment le contenant et en faisant un dot blot
E se trouve dans lintron 3 du gne CYP21

QUESTION N18 (3 points)
Le changement de C en G

A fait disparatre le site Alu I (AGCT)
B fait apparatre une mutation dltre qui scrit IVS2-13C>G
C entranerait un dcalage du cadre de lecture si le site accepteur quil cre est utilis
D donnerait une protine de 498 acides amins si le site accepteur quil cre est utilis
E donnerait une protine tronque si le site accepteur quil cre est utilis

33
QUESTION N19 (2 points)
En fait des expriences in vitro montrent que le site accepteur potentiel cre par ce changement du
nuclotide 655 C en G nest pas reconnu. Le caractre dltre sexplique par des anomalies dpissage
qui ne sont pas celle prvue. Ceci a t dmontr grce ltude de la corticosurrnale dune patiente
homozygote pour cette mutation qui a subi une surrnalectomie bilatrale parce quelle ne prenait pas son
traitement. A partir de ce tissu surrnalien, une protection de lARN total par la nuclase S1 a t ralise
(rsultat figure ci-dessous : WT normal ; C>G homozygote pour la mutation). La sonde utilise
commence en 5 au milieu de lintron 2 du gne CYP21 et se termine en 3 au milieu de lexon 3. Elle est
marque par la mthode multi-amorcage au hasard . Lorigine des flches en pointill montre la fin de
la protection de lARN en 5 (nuclotide en gras). Chaque fragment protg est numrot. La squence
dADN situe sous la figure est la copie de lune des deux qui se trouvent la fin du fascicule.

A propos de cette protection la nuclase S1,
A le marquage de la sonde a t effectu grce une polynuclotide-kinase
B la sonde gnomique va shybrider avec lARNm mature soit normal soit mut
C la nuclase S1 dgrade lADN ou lARN monobrin
D cest une mthode plus sensible que la RT-PCR pour tudier lARNm
E limage ci-dessus est une autoradiographie dun gel dacrylamide utilis pour le squenage

QUESTION N 20 (3 points)

LARN du patient homozygote pour la mutation C>G a t amplifi par la raction de RT-PCR et sous
clon. Plusieurs clones ont t dtects par la mme sonde utilise pour la protection la nuclase S1. Le
squenage de ces clones est fait avec une amorce situe au dbut de lexon 3 avant la dltion de 8bp
prsente dans le pseudogne. Les bandes 1 et 2 correspondent aux fragments protgs de la figure incluse
dans la question prcdente. On peut dire que

A lamorce utilise pour le squencage est 5AAGAACTACCCGGACCTGTCCTTG 3
B le squencage de lADNc correspondant lpissage dduite de la bande 1 permet de dire que
lARNm mature sera 5CCACUUACCUUUCCCACCCU 3
C le squencage de lADNc correspondant lpissage dduite de la bande 2 permet de dire que le
lARNm mature sera 5CCACUUACCUCCCCCACCUCCU 3
D la protine traduite partir de lARNm obtenu daprs lpissage dduite de la bande 1 est
tronque
E la protine traduite partir de lARNm obtenu daprs lpissage dduite de la bande 2 est
tronque

5 CATCAGTTCCCACCCTCCAGCCCCCACCTCCTCCTGCAGACAAG 3
G
W
T




C
>
G
Sens de la migration
1 2 3
5 CATCAGTTCCCACCCTCCAGCCCCCACCTCCTCCTGCAGACAAG 3
G
W
T




C
>
G
Sens de la migration
5 CATCAGTTCCCACCCTCCAGCCCCCACCTCCTCCTGCAGACAAG 3
G
W
T




C
>
G
Sens de la migration
1 2 3
34










35



36



37



38



39

40

41

42

43

44


45


46




TATA
Facteurs trans
Facteurs de
transcription
de base
ARN polymerase II
Promoteur (~100 pb 500 pb)
Rgion transcrite




Rgions
rgulatrices

enhancer
Signal de
polyadenylation
Exon

Exon


Exon

Intron

stop

ATG

Intron


AATAA
47





agccctccag gacaggctgc atcagaagag gccatcaagc aggtctgttc caagggcctt 60
tgcgtcaggt gggctcagga ttccagggtg gctggacccc aggccccagc tctgcagcag 120
ggaggacgtg gctgggctcg tgaagcatgt gggggtgagc ccaggggccc caaggcaggg 180
cacctggcct tcagcctgcc tcagccctgc ctgtctccca gatcactgtc cttctgcc 238
atggccctgtggatgcgcctcctgcccctgctggcgctgctggcc 283
M A L W M R L L P L L A L L A
ctctggggacctgacccagccgcagcctttgtgaaccaacacctg 328
L W G P D P A A A F V N Q H L
tgcggctcacacctggtggaagctctctacctagtgtgcggggaa 373
C G S H L V E A L Y L V C G E
cgaggcttcttctacacacccaagacccgccgggaggcagaggac 418
R G F F Y T P K T R R E A E D
ctgcagg gtgag ccaactgccc attgctgccc ctggccgccc ccagccaccc 470
L Q V
cctgctcctg gcgctcccac ccagcatggg cagaaggggg caggaggctg ccacccagca 530 gggggtcagg
tgcacttttt taaaaagaag ttctcttggt cacgtcctaa aagtgaccag 590 ctccctgtgg cccagtcaga
atctcagcct gaggacggtg ttggcttcgg cagccccgag 650 atacatcaga gggtgggcac gctcctccct
ccactcgccc ctcaaacaaa tgccccgcag 710 cccatttctc caccctcatt tgatgaccgc agattcaagt
gttttgttaa gtaaagtcct 770 gggtgacctg gggtcacagg gtgccccacg ctgcctgcct ctgggcgaac
accccatcac 830 gcccggagga gggcgtggct gcctgcctga gtgggccaga cccctgtcgc caggcctcac 890
ggcagctcca tagtcaggag atggggaaga tgctggggac aggccctggg gagaagtact 950 gggatcacct
gttcaggctc ccactgtgac gctgccccgg ggcgggggaa ggaggtggga 1010 catgtgggcg ttggggcctg
taggtccaca cccagtgtgg gtgaccctcc ctctaacctg 1070 ggtccagccc ggctggagat gggtgggagt
gcgacctagg gctggcgggc aggcgggcac 1130 tgtgtctccc tgactgtgtc ctcctgtgtc cctctgcctc
gccgctgttc cggaacctgc 1190 tctgcgcggc acgtcctggc ag 1202
tggggcaggtggagctgggcgggggccctggtgcaggcagcctgcag 1259
G Q V E L G G G P G A G S L Q
cccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgc 1325
P L A L E G S L Q K R G I V E Q C C T S I C
tccctctaccagctggagaactactgcaactagac gcagcccgca ggcagcccca 1380
48
S L Y Q L E N Y C N *
cacccgccgc ctcctgcacc gagagagatg gaataaagcc cttgaaccag ccctgctgtg 1440
ccgtctgtgt gtcttggggg ccctg


Figure : Squence du gne de linsuline humaine



Quel tissu ? cDNA
Pour isoler ce gne humain, une sonde d'ADN complmentaire de l'insuline a t obtenue partir

A d'une banque gnomique
B d'une banque d'ADN complmentaire hpatique
C d'une banque d'ADN complmentaire d'hypophyse
D d'une banque d'ADN complmentaire de pancras
E aucune rponse bonne

Taille (bases) ARNm mature ?
L'ARN messager mature de l'insuline sans compter l'extrmit 3' polyA est peu prs long de ?

A 333 paires de bases
B 350 paires de bases
C 423 paires de bases
D 465 paires de bases
E 490 paires de bases
Taille (bases) ARNm codante ?

Combien dintron contient le gne de linsuline ?

Quelle environ la taille (pb) de la proinsuline ?


Quelle la taille (acides amins) de la proinsuline ?

Combien d'acides amins contient le peptide signal de l'insuline?
A 15
B 24
C 33
D 41
E 45


Chez un patient homozygote pour la mutation du nuclotide G en T appele R65L du gne de l'insuline,
on ralise partir du plasma un western blot en utilisant un anticorps polyclonal de lapin reconnaissant
les deux chanes de l'insuline ? Ci dessous se trouve la liste de diffrentes tapes exprimentales
permettant d'tudier l'expression de ce gne mut de l'insuline (des tapes intermdiaires peuvent ne pas
tre cites ou tre inutiles dans cette exprience).
1 - Lavage
2 - Incubation avec un anticorps anti-anticorps de souris li un enzyme
3 - Prise de sang
4 - Transfert sur une membrane de nylon ou nitrocellulose
5 - Incubation avec un anticorps anti-anticorps de lapin li un enzyme
6 - Electrophorse en utilisant un gel SDS-acrylamide avec mercaptothanol.
7 - Incubation avec l'anticorps polyclonal dirig contre l'insuline ?
8- Raction enzymatique avec formation d'un produit mesurable

49
Dans quel ordre, se droule la ralisation de ce Western blot ?
A 3 - 7 - 6 - 4 - 2 - 8 - 1
B 3 - 6 - 4 - 7 - 5 - 1 - 8
C 3 - 7 - 6 - 4 - 2 - 8 - 1
D 3 - 6 - 4 - 7 - 2 - 8 - 1
E 3 - 7 - 6 - 4 - 5 - 8 1



Ci-dessus se trouvent 5 profils de Western blot.

En tenant compte de deux renseignements supplmentaires :
- la bande accompagne d'une astrisque (*) correspond la proinsuline
- on considre que la proinsuline est absente dans le sang d'un individu normal
Rpondez aux questions suivantes

Quel est le profil de Western blot qui correspond un homme normal ?

QUESTION N57 (2 points)
Quel est le profil du Western blot qui correspond l'individu homozygote pour la mutation R65L ?

QUESTION N 58 (3 points)
Pour tudier cette mutation chez les parents et d'autres membres de la famille, un fragment d'environ 250
bp est amplifi par la mthode de PCR. Une des deux amorces se trouve proche du site accepteur de
l'intron qui prcde l'exon qui porte cette mutation. Quelles sont parmi les amorces suivantes de 20 bp les
deux que vous demanderiez synthtiser pour amplifier ce fragment qui contient la mutation ?

A 5' TGCTCTGCGCGGCACGTCCT 3'
B 5' ACGCAGCCTGCAGGCAGCCC 3'
C 5' GAACCAGCCCTGCTGTGCCG 3'
D 5' CTTGGTCGGGACGACACGGC 3'
E 5' CGGCACAGCAGGGCTGGTTC 3'

QUESTION N 59 (1 point)
Nous rappelons que les sites de reconnaissance des enzymes de restriction, Eco RI et Hind III, sont les
suivants:
5' G + AATT C 3' site Eco RI 5' A + AGCT T 3' site Hind III
3' C TTAA | G 5' 3' T TCGA | A 5'
Chez un htrozygote pour cette mutation (un seul de ses deux chromosomes porte cette mutation),
aprs amplification de ce fragment d'ADN que faites-vous pour mettre en vidence cette mutation R65L
du gne de l'insuline ? Cochez les tapes utilises.

A coloration par le bleu de coomassie
B digestion par l'enzyme Eco RI
C digestion par l'enzyme Hind III
D lectrophorse en utilisant un gel d'agarose
X kD
Marqueurs
A B C D E
*
0, 5X kD
50
E lectrophorse en utilisant un gel SDS-polyacrylamide

QUESTION N 60 (2 points)
Quel profil obtient-on (rsultat 5 bp prs) ?

A 1 bande de 256 bp
B 2 bandes de 174bp et 82 bp
C 2 bandes de 154 bp et 102 bp
D 3 bandes de 256 bp, 154 bp et 102 bp
E 3 bandes de 256 bp, 174 bp et 82 bp