Vous êtes sur la page 1sur 17

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Partie 3 : gntique

Chapitre 1 : la transmission dun caractre au cours de la reproduction sexue

Rappel : la reproduction sexue comprend 2 phnomnes fondamentaux successifs : La miose lors de la gamtogense : division aire qui permet la production de gamtes ou haplodes ; La fcondation ou fusion de 2 gamtes (1 + 1) lorigine de la uf qui permet le retour la diplodie et le maintien du nombre de chromosomes au fur et mesure des gnrations.

Linformation gntique est contenue dans le noyau et son support biologique est lADN, constituant des chromosomes. Aussi bien chez lhomme que chez les autres espces vivantes (animales ou vgtales) la reproduction sexue permet la transmission de caractres hrditaires.

I- la notion de caractres hrditaires A- Quest ce quun caractre hrditaire ? B notion de gnes C Notion de phnotype D le gnotype et la localisation du gne II- la transmission des allles au cours de la reproduction sexue III Etude des croisements chez la souris IV- Etude de croisement chez la belle de nuit

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

I la notion de caractres hrditaires


A - Quest ce quun caractre hrditaire ?
Chez lhomme on connat un grand nombre de caractres transmissibles la descendance, donc hrditaires : Caractres morphologiques : couleur des cheveux, de la peau, des yeux, forme du nez, des oreilles. Caractres physiologiques : groupes sanguins Maladies hrditaires : mucoviscidose, myopathie .

Or un individu provient dune unique, la uf. Celle-ci contient, pour chaque caractre hrditaire un Dterminant transmissible appel gne. Lensemble des gnes constitue le programme gntique ou gnome de lindividu. Chez lhomme, on pense quil y a environ 30 000 gnes. Le noyau contient cette information gntique ou gnome.

B notion de gnes
Un gne est une petite portion de chromosome qui contient les informations ncessaires la dtermination de tel ou tel caractre cest dire quil dirige la construction dune protine. Un gne est donc le plan de construction pour enchaner les acides amins dans un ordre prcis. Un gne est donc un fragment de la molcule dADN constituant le chromosome. 1 gne 1 protine aire un caractre

Cest lenchanement des nuclotides dans un ordre prcis qui constitue le plan de construction pour la protine. La squence des nuclotides est une information code pour la squence des acides amins.

Du message hrditaire la construction protique Le gne de lhmoglobine (protine des globules rouges transportant lO2) ADN Brin 1= plan De fabrication Squence normale CACGTGGAATGAGGTCTCCTC GTGCACCTTACTCCAGAGGAG squence anormale CACGTGGAATGAGGTCACCTC GTGCACCTTACT CCAGTGGAG

produit fabriqu Val-His-Leu-Thr-Pro-Glu-Glu = protine Hmoglobine normale

Val-His-Leu-Thr-Pro-Val-Glu Hmoglobine anormale

Problmes circulatoires 2

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Exemple 1 : la pigmentation de la peau

Le gne E

Expression du gne E Synthse dune protine = enzyme E fonctionnelle

Catalyse la raction chimique : Tyrosine (acide amin) mlanine = pigment brun

Pigmentation des de la peau ou des cheveux = caractre cheveux sombres

Exemple 2 : fille ou garon ? Les scientifiques viennent de dcouvrir quun tout petit gne (appel TDF) situ sur le chromosome Y est responsable de la dtermination du sexe. Sa prsence ou son absence chez un embryon de 6 semaines, qui nest encore ni fille ni garon, est lorigine de son volution vers lun ou lautre des 2 sexes. Daprs Corinne Jamma Sciences et avenir mars 1988.

Fragment de chromosome Y = gne TDF prsent synthse dune protine TDF garon Gne TDF absent pas de synthse de la protine TDF fille

C Notion de phnotype

La protine est le produit de lexpression du gne. Le caractre est le phnotype. Le phnotype dun individu est lensemble des caractres observables toutes les chelles. Le caractre est donc ce qui se voit. Le gne est ce qui se transmet. Exemple : La couleur des cheveux ou la taille phnotype observable lchelle macroscopique Le groupe sanguin phnotype observable lchelle de la

Le phnotype dpend troitement de la prsence de certaines protines ou de leur absence. Exemple : lalbinisme Lenzyme E est soit absente soit non fonctionnelle la raction nest pas catalyse la mlanine nest pas produite pas de pigment brun dans les phnotype cheveux et peau blancs Nous nhritons pas de nos phnotypes, ils se dveloppent au cours de la vie en fonction des gnes et de lenvironnement (alimentation par exemple) 3

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Trs souvent un caractre nest pas dtermin par un seul gne mais par plusieurs : Exemple : la couleur des yeux Le phnotype scrit entre [ ] Exemple : [poils noirs] [albinos]

D le gnotype et la localisation du gne

Chaque gne a un emplacement prcis sur les chromosomes. Cet emplacement est le mme chez tous les individus de la mme espce. Cet emplacement est le locus du gne. Exemple : le gne groupe sanguin est sur le chromosome n 9, sur le bras long.

Cas des groupes sanguins Les marqueurs membranaires lorigine des groupes sanguins

La prsence ou labsence de certaines molcules chimiques A et B (= antignes A et B) est responsable des groupes sanguins du systme ABO.

Comment un gne groupe sanguin dtermine-t-il lappartenance tel ou tel groupe sanguin ? Le gne code pour une enzyme qui dirige la synthse des marqueurs membranaires La possde lenzyme A fonctionnelle synthse du marqueur ou antigne A La possde lenzyme B fonctionnelle synthse du marqueur ou antigne B La possde une enzyme non fonctionnelle absence de marqueur

Les hmaties de groupe sanguin AB ont donc fabriqu les enzymes A et B.

La notion de chromosomes homologues


Dans chaque , il y a des autosomes homologues il y a 2 chromosomes n 9 : un dorigine paternelle, un dorigine maternelle.

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Cas dun individu de groupe sanguin AB

un des 2 chromosomes n 9 porte au locus groupe sanguin une information gntique qui code pour la synthse de lenzyme A. Lautre chromosome n 9 porte au mme locus, le locus groupe sanguin linformation gntique qui code pour la synthse de lenzyme B.

Cas dun individu de groupe O Les 2 chromosomes homologues portent la mme information gntique, celle qui code pour lenzyme non fonctionnelle.

conclusion: Tous les individus portent au mme locus le mme gne mais cet endroit prcis du chromosome linformation gntique contenue dans lADN peut ne pas tre la mme. Pour ces diffrentes versions du gne, on parle dallles. A, B et O sont 3 allles diffrents du gne groupe sanguin

Cellules de groupe A A Locus du gne groupe sanguin A A O

Cellules de groupe B

Cellule de groupe AB

Cellule de groupe O

Ecriture des gnotypes dans le cas des autosomes Le gnotype : est lensemble des allles dun gne que possde un individu. cela scrit sous la forme dune fraction Exemple : [A] A A ou A O [B] B B ou B O [AB] A B [O] O O

Les 2 barres symbolisent les 2 chromosomes homologues.

Homozygotie htrozygotie Quand les 2 allles du gne sont identiques, on dit que la est homozygote pour ce gne. 5

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Quand les 2 allles sont diffrents, on dit que la est htrozygote pour le gne.

Cas des gonosomes ou chromosomes sexuels X et Y


Exemple de la myopathie de Duchenne : le gne responsable de cette maladie code pour une protine des cellules musculaires. Son locus est sur le bras court du chromosome X

Cas des filles

cas des garons

m M m

XX

XY

Les filles possdent 2 allles du gne : 1 sur chaque chromosome X. Les garons ne possdent quun seul allle du gne port par X. Le chromosome Y, beaucoup plus petit que X nest homologue de X que sur une petite partie. Ecriture des gnotypes dans le cas de gnes ports par les gonosomes XM Xm Xm Y

Bilan : chaque individu possde 2 exemplaires de chacun des gnes ports par les autosomes. Pour les gnes ports par les gonosomes, les filles en possdent 2 et les garons un seul.

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

II la transmission des allles au cours de la reproduction sexue


Les gnes sont ports par les chromosomes. Les 2 chromatides dun chromosome sont formes chacune dune molcule dADN. Les 2 molcules constituant les 2 chromatides sont des molcules sur. Elles sont issues de la rplication semi-conservative de lADN en phase S dinterphase. Elles sont donc gntiquement identiques.

Exercice : Schmatiser la garniture chromosomique dune en mtaphase de mitose dans le cas dune homozygote et dans le cas dune htrozygote pour un gne A

Cas dune homozygote pour le gne A

Cas dune htrozygote pour le gne A

Au cours de la 1re division de miose, les chromosomes homologues sont spars : il y a disjonction alatoire des chromosomes homologues. Il en est donc de mme pour les allles du gne. Chaque gamte ne contient donc quun seul allle pour chaque gne. Il est haplode.

La fcondation runit le patrimoine gntique apport par le spermatozode et celui apport par lovule. Elle permet le retour la diplodie dans la uf chaque gne est alors prsent en 2 exemplaires, identiques ou non, 1 dorigine paternelle apport par le spz et 1 dorigine maternelle apport par lovule.

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

III Etude des croisements chez la souris


Pour tudier la transmission des caractres, les chercheurs ont utilis la mthode dhybridation entre individus de races pures. On pratique des croisements entre individus de la mme espce prsentant le mme caractre, par exemple la couleur du poil. A chaque gnration, tous les individus ne prsentant pas le caractre choisi sont isols peu peu il ne reste que des individus homozygotes pour le caractre tudi. On parle de monohybridisme chaque fois que lon ralise le croisement de 2 lignes pures qui diffrent par un seul caractre.

La mthode dhybridation

Etude du gnotype et du phnotype des parents P Les parents ont un phnotype [blanc] ou [gris] . Les populations sont homognes : tous les individus dune mme population de souris ont le mme phnotype. Comment obtient-on des populations homognes ?

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Schmatisation 1 : Complter les schmas des tapes lorigine de la formation des gamtes pour lobtention de souris de race pure et de la uf lorigine des souris dans le cas de la slection des souris grises Parent 1 : en interphase G1 Parent 2 :

en interphase G2

Prophase I

Anaphase I

Tlophase I

Anaphase II

Tlophase II

Fcondation uf ou zygote

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Bilan : Au cours de la gamtogense les 2 allles dun gne sont spars au cours de la 1
re

division de miose lors

de la disjonction des chromosomes homologues. Les gamtes sont haplodes et ne contiennent quun allle de chaque gne. Dans le cas dindividus de race pure cest dire homozygotes pour le gne tudi, tous les gamtes produits sont identiques. Leur gnotype scrit : Souris grise gamtes (G) Souris blanche gamtes (b)

Etude de la F1 :
Tous les individus ont le mme phnotype [gris] la population F1 est homogne. Quel est le gnotype des individus de F1 ? Complter le schma n 2 : origine des individus de la F1

Les 2 parents P1 et P2 homozygotes pour le gne produisent chacun un seul type de gamtes (g) pour lun et (b) pour lautre. les individus F1 sont issus de zygotes. Chaque zygote est issu de la fcondation entre un gamte (g) et un gamte (b) de lautre parent ils sont donc htrozygotes pour le gne g b On dit que les individus F1 sont des hybrides. Pourtant ils sont tous de phnotype [gris] le caractre gris est seul sexprimer dans le phnotype. On dit quil est dominant par rapport au caractre blanc. Par extension, on dit que lallle gris est dominant sur lallle blanc. Lallle blanc est rcessif. On dit dun allle quil est dominant quand le phnotype est identique que le gnotype soit homozygote ou htrozygote. En rgle gnrale, on note lallle dominant avec une majuscule et lallle rcessif avec une minuscule : G et b gnotype de la F1 : G b

Les gamtes produits par les individus F1 Schmatiser les tapes de la miose lorigine des gamtes ou produits par les souris de la F1.

10

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Schmatisation 2 : les tapes de la formation des gamtes et du zygote dans le cas de lhybridation entre des souris grises et blanches. origine du gnotype des souris F1 Parent P1 : Interphase G1 Parent P2 :

Interphase G2

Prophase I

Anaphase I

Tlophase I

Anaphase II

Tlophase II

Fcondation zygote 11

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Schmatisation n 3 : les gamtes produits par les souris grises de F1

Souris F1 Dbut de prophase I

souris F1

Anaphase I

Tlophase I

Anaphase II

Tlophase II

12

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Le mle F1 produit 2 types de gamtes quiprobables (G) et (b) soit 50 % de chacun. La femelle F1 produit aussi 2 types dovules (G) et (b) quiprobables.

Ces gamtes se rencontrent au hasard au cours de la fcondation. Un chiquier de croisement rend compte des possibilits de rencontre entre ces gamtes et de la probabilit de chaque possibilit. Gamtes gamtes G (1/2 ) G (1/2) G g [G] G b [G] b (1/2) G b [G] b b [b]

b (1/2)

Les individus F2 ont donc 3 gnotypes possibles mais ont 2 phnotypes possibles population non homogne G 25 % G G b 50 % b b 25 %

[gris]

75 %

[blanc] 25 %

exercice dapplication : On croise une souris F1 issue de parents de race pure blanche et grise avec une souris blanche. Quobtiendra-t-on comme descendance ?

Corrig de lexercice sur les souris : ce croisement sappelle un croisement test La souris F1 est htrozygote pour le gne La souris blanche exprime dans son phnotype lallle b rcessif elle est donc ncessairement double rcessive cest dire homozygote (race pure ) b B

La souris grise F1 produits 2 types de gamtes quiprobables : (G) et (b) par disjonction des allles au cours de la miose. La souris blanche ne produit quun seul type de gamtes (b) Lchiquier de croisement rend compte des probabilits de rencontre entre ces gamtes.

13

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Les descendants seront : 50 % de souris grises et 50 % de souris blanches Ces croisements test sont un moyen de vrifier facilement le gnotype dun hybride.

IV Etude de croisement chez la belle de nuit


Ce sont des plantes dont on connat des varits pures fleurs rouges et des varits pures fleurs blanches. On effectue un croisement entre ces 2 varits de fleurs. Puis on croisement les fleurs F1 entre elles. On obtient F2. Croisement de 2 lignes pures de belles de nuit

14

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Etude de la gnration F1
Les parents sont de race pure ils sont donc homozygotes pour le gne couleur ils produisent chacun un seul type de gamtes (R) ou (B) La F1 est homogne et hybride pour le gne R B Les individus sont de phnotype rose : il ny a pas de dominance entre les allles R et B du gne couleur : on dit que les 2 allles sont codominants.

Etude de la F2
Les hybrides F1 produisent chacun 2 types de gamtes quiprobables (R) et (B) Un chiquier de croisement rend compte des rencontres possibles entre ces gamtes.

Interprtation des rsultats des croisements de belles de nuits de race pure

Ainsi on obtient 3 phnotypes diffrents en F2 : 25 % [R], 50 % de [rose] et 25 % [B].Les fleurs rouges et blanches sont des races pures. 15

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Gnralisation On interprte les rsultats (uniformit des hybrides de 1
re

gnration et htrognit de la gnration suivant) par

une sparation des allles au moment de la formation des gamtes. Dans tous les croisements de mono hybridisme du type de ceux que lon vient dtudier, on obtient toujours en F2 des frquences stables : , dans le cas de la dominance dun allle sur un autre, , , dans le cas de la codominance.

Exercice n 1 Considrons la souche de drosophiles ailes vestigiales [vg] ; les mouches vestigiales se distinguent des mouches sauvages [vg+] par la taille de leurs ailes rduites de petites spatules. Croisons des mouches de races pures : une femelle sauvage avec un mle vestigial (le croisement rciproque, femelle vestigiale avec un mle sauvage donnerait exactement les mmes rsultats). Tous les individus de la 1
re

gnration ont le phnotype sauvage.


me

Si nous prenons les femelles de F1 et que nous oprons un croisement en retour avec des mles [vg], nous obtenons en 2 gnration 50 % de mouches [}vestigiales] et 50 % de mouches [sauvages]

Interprtez ces rsultats

Exercice n 2 : 1. Une population de volailles dites andalouses comprend des animaux de 3 couleurs diffrentes : noires, blanches et bleues. Les volailles noires croises entre elles donnent toujours des volailles noires. Les volailles blanches croises entre elles donnent toujours des volailles blanches. Les volailles bleues croises entre elles donnent un mlange de volailles noires, blanches et bleues. Le croisement dune volaille noire avec une volaille blanche donne toujours des volailles bleues.

En tenant compte de ces rsultats exprimentaux, expliquez ce quon entend par ligne pure et hybride. Classez les 3 types de volaille dans ces 2 groupes en justifiant.

2. Les statistiques sur des milliers de volailles bleues croises entre elles donnent la rpartition approximative suivante : Volailles bleues : 50 % Volaille blanche : 25 % Volaille noire : 25 %

Expliquez ces rsultats. 3. On procde au croisement dune volaille noire avec une volaille bleue ; ralisez un tableau qui permet den prvoir les rsultats. 16

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

Exercice n 3 Le pelage de lapins domestiques prsente 3 aspects lis des variations dun mme gne : Type chinchilla : pelage uniforme mais argent Type himalayan : pelage blanc sauf aux extrmits (nez, queue et pattes antrieures colores) Type albinos : pelage uniformment blanc

1. Le croisement chinchilla x himalayan donne en F1 des chinchillas et en F2 (F1 x F1) de chinchilla et dhimalayans. Le croisement chinchilla x albinos donne en F1 des chinchillas et en F2, de chinchillas et dalbinos. Le croisement himalayan x albinos donne en F1 des himalayans et en F2, dhimalayans et dalbinos. Interprtez ces rsultats, tous obtenus partir de races pures.

2. Une cage renferme une femelle himalayan et 2 mles, un albinos et un chinchilla. La femelle a 8 descendants : 2 himalayans, 4 chinchillas et 2 albinos. Quel est le pre et quels sont les gnotypes de la mre, du pre et des descendants ?

17