Vous êtes sur la page 1sur 3

TD Biologie Molculaire SVISVI- S6 (2009-2010)

Exercice 1:
Soit la squence d'ADN bactrienne suivante: 5'- ATTTACGGGCCTTAATGGCATAACCGCCTAATGGTTAACCGCTAGCGCG - 3' Q1- Donner la squence de l'ADN double brin correspondant. Q2- A quelle condition cet ADN double brin serait transcrit in vivo ? Q3- Donner la squence du transcrit ventuelle.

R1- La squence de l'ADN double brin correspondant.


5'ATTTACGGGCCTTAATGGCATAACCGCCTAATGGTTAACCGCTAGCGCG 3' 3 TAAATGCCCGGAATTACCGTATTGGCGGATTACCAATTGGCGATCGCGC 5

R2- Cet ADN double brin serait transcrit in vivo sil existe un Promoteur en amont. R3- Squence du transcrit ventuelle.
Rappel : Par convention : Le brin dADN transcrit est appel brin antisens. Le brin dADN non transcrit est appel brin sens.

Pour avoir un transcrit nous allons supposer la prsence dun promoteur. Nous avons ainsi deux possibilits : Possibilit 1:

La squence du transcrit:
5' AUUUACGGGCCUUAAUGGCAUAACCGCCUAAUGGUUAACCGCUAGCGCG 3'

Possibilit 2:

La squence du transcrit:
3 UAAAUGCCCGGAAUUACCGUAUUGGCGGAUUACCAAUUGGCGAUCGCGC 5

Exercice 2 :
Ci-joint une reprsentation shmatique de la structure dun gne isol de plantes.

Q1- Definir la nature de l`lement en amont du 1er exon Q2- Reprsenter sur le shma la position du codon dinitiation ATG et du codon stop Q3- Donner les bordures probables de l`un des trois introns Q4- Schmatiser la structure du pr-ARNm et de lARNm mature forms partir de ce gne Q5- Une mutation occure au niveau du site dpissage situ au dbut de lintron 2 le rendant inconnu par la machinerie dpissage. Donner la structure de lARNm qui drive de ce gne.

R1- Definir la nature de l`lement en amont du 1er exon: Promoteur R2- Reprsenter sur le shma la position du codon dinitiation ATG et du codon stop

R3- Donner les bordures probables de l`un des trois introns


Bordure 5 de lintron: - GT (ADN)/ -GU (ARN) ou site donneur. Bordure 3 de lintron - AG ou site accepteur.

R4- Schmatiser la structure du pr-ARNm et de lARNm mature forms partir de ce gne


Pr- ARNm :

ARNm mature:

R5- Une mutation occure au niveau du site dpissage situ au dbut de lintron 2 le rendant inconnu par la machinerie dpissage. Donner la structure de lARNm qui drive de ce gne.