Barcoding of pathogenic fungi ITS region and its limitations

Wieland Meyer1, Carol Serena1, Sharon Chen1, Michael Arabatzis2 & Aristea Velegraki2
1 Molecular

Mycology Research Laboratory, CIDM, University of Sydney Medical School Western at Westmead Hospital, Westmead Millennium Institute, Westmead, NSW, Australia Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece

2 Mycology

Funding:
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

# 352303 to WM

Issues in Medical Mycology

T. asahii

Significant increase opportunistic fungal infections due to the increase in immunocompromised hosts

Cosmopolitan environmental fungi have emerged as causes of potentially life-threatening diseases

Many emerging pathogenic fungi are inherently resistant to antifungal drugs Certain fungal species are associated with higher risk of sever disease Empirical treatment - risk of antifungal resistance development

Candida spp.

B. capitatus

Aspergillus spp.

Treatment choices are not always well defined

Clinical and economic consequences Declining morphological knowledge Changing Taxonomy
WMeyer, USYD, Australia, Barcoding-Mexico City 2009 Cryptococcus spp.

Rhizopus spp.

Fungal Diversity
How many fungi exist? Estimate (Hawksworth 1993) : 1.6 million species
Only 100,000 species of fungi have been described worldwide

DEllis

DEllis

DEllis Pseudallescheria boydii

DEllis

Aspergillus fumigatus

Penicillium marneffei

Aspergillus niger

DEllis

Trichophyton rubrum

around 100 - 200 species are regularly involved in human or animal mycoses

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Why do we need to know the name of a disease causing fungal agent?

Confirmation of diagnosis Facilitate earlier diagnosis Choice of therapy Initiating earlier intervention with aggressive antifungal treatment Reduce empiric use of antifungal agents Select the correct technique for strain typing to investigate outbreaks or the source of nosocomial infections Identification of risk and prevention of infections
However, conventional identification evaluating phenotypical characteristics is laborious, slow and can often be incorrect
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Molecular diagnostic tools

Achieve rapid and accurate detection and identification of fungi from cultures or clinical specimens

Sequence based identification strategies are the new gold standard for species ID
However, there are major problems with sequence based ID:
(A) Lack of a universally accepted appropriate genetic locus (B) Lack of quality controlled sequence databases (C) Arbitrary defined cut-off points for species ID
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

 WMeyer, USYD, Australia, Barcoding-Mexico City 2009

www.boldsystems.org

ITS1/2 region of the rDNA gene

The International Sub-commission on Fungal Barcoding has proposed the ITS region as the prime fungal barcode or the default region for species identification (http://www.allfungi.com/its-barcode.php).
18S rDNA ITS1
SR6R

5.8S rDNA ITS2

LR1

28S rDNA

ITS

www.boldsystems.org

Primers:

SR6R: 5 AAGTATAAGTCGTAACAAGG 3 LR1: 5 GGTTGGTTTCTTTCCT 3

[Vilgalys & Hesters (1990) J. of Bacteriol. 20: 4238-4246]

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

 WMeyer, USYD, Australia, Barcoding-Mexico City 2009

www.boldsystems.org

If medical fungi are blasted:

e.g. Candida parapsilosis

no results !!!!!!

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

www.boldsystems.org

Public databases: GenBank = EMBL = DDJB

A huge amount of ITS sequences are available in the public database

PROBLEMS WITH THE PUBLIC DATABASES many sequences containing mistakes: as a result of experimental errors misidentification of the species exchange of cultures

limited taxonomic coverage.

the total number of currently available fungal ITS sequences, represents less than 1% of the estimated 1.5 million fungal species
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Species Name

# of sequences
1 1 2 1 1 5 14 5 5 3 2 1 13 1 7 4 1 1 11 3 1 1 1 6 7 7 1 1 1 15 3 1 2 6 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1

Species name

# of sequences
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 2 1 1 1 1 5 7 1 1 1 1 1 1 1 1 1 6 5 1 1 1 1 1 1 1 1

Absidia corymbifera Acremonium kilense Acremonium strictum Alternaria alternata Amylomyces rouxii Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus terreus Aureobasidium pullulans Bipolaris australiensis Candida albicans Candida catenulate Candida dubliniensis Candida famata/ Debaryomyces hansenii Candida fennica Candida glabrata Candida guilliermondii Candida haemulonii Candida inconspicua Candida inositophila Candida intermedia var intermedia Candida krusei/ Issatchenkia orientalis Candida lipolytica/ Yarrowia lipolytica Candida lusitaniae Candida mucifera Candida norvegensis Candida norvegica Candida parapsilosis Candida pelliculosa/ Pichia anomala Candida rugosa Candida saitoana Candida tropicalis Chaetomium globosum Chrysosporium tropicum Cladosporium carrionii Cladosporium cladosporioides Cladosporium sphaerospermum Clavispora lusitaniae Cryptococcus humicolus Cryptococcus humicucolus Cryptococcus laurentti Cryptococcus neoformans var gattii Cryptococcus neoformans var. grubii Debaryomyces carsonii Endomycopsis ohmeri Epicoccum floccosum Epicoccum nigrum Epidermophyton floccosum Eurotium amstelodami Exserohilum rostratum Fusarium dimerum

Fusarium nygamai Fusarium oxysporum Geotrichum candidum Kluyveromyces marxianus Kodamaea ohmeri Metschnikowia reukaufii Microsporium gypseum Microsporum gypseum Microsporum canis Nannizziopsis vriesii Paecilomyces lilacinus Penicillium brevicompactum Penicillium chrysogenum Penicillium marneffei Penicillum brevicompactum Penicillum chrysogenum Penicillum citrinum Phialophora verrucosa Pichia burtonii Pichia capsulata Pichia farinose Pichia holstii Pichia jadinii Pichia mexicana Rhizopus microsporus Rhizormucor pusillus Saccharomyces exiguus Scedosporium apiospermum Scedosporium prolifcans Scopulariopsis brevicaulis Stachybotrys chartarum Torulaspora delbrueckii Trichoderma harzianum Trichoderma terrestre Trichoderma viride Trichophyton ajelloi Trichophyton gourvillii Trichophyton mentagrophytes var varinterdigitale Trichophyton mentagrophytes Trichophyton rubrum Trichophyton schoenleinii Trichophyton simii Trichophyton soudanense Trichophyton tonsurans Trichosporon asahii Ulocladium chartarum Wangiella dermatitidis Zygoascus hellenicus

Sequences generated for the first time, for species, for which no ITS sequences had been deposited in GenBank before

24 new sequences for species previously not sequenced

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Sequenced based ID currently based on cut-off of 98-99% similarity with the type culture of the species in question.
However, population based studies showed that the sequences variation in clinical samples is much higher as those type culture dependent cut-off values.

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Cladogram of 50 ITS sequences of strains of Candida albicans generated by UPGMA

AF455531 AF455428 EU266569 DQ231534 DQ231531 AB049119 DQ231532 AY672930 WM01.163 DQ231527 AY939786 AF217609 EU266566 DQ231530 AB032174 WM01.218 AY196001 WM01.160 WM01.161 AJ249486 WM01.159 AF455457 AB032173 AB032172 DQ231536 AB018037 AB018037 WM230 AJ853878 AY939789 WM01.217B AY939807 AF455483 AF455476 DQ231529 AB049121 AB018038 WM02.195 AB365317 AB049122 44455524 WM229 EU266568 EF198003 EF192231 L47111 AB305093 WM01.158 WM01.157 AB049120

ITS sequence variation of C. albicans strains obtained from clinical samples

ITS Sequence types generated for the example species: C. albicans
Sequence type 1 2 3 4 5 6 7 8 9 10 11 Number of sequences 29 8 3 2 2 1 1 1 1 1 1 voucher sequences
EF567994 AB018038 EF567987 AY939807 AB305093 AY939789 EF567993 EF567995 EU266568 EF198003 EF192231

ST 1

Representative cultura/remark WM01.218 CBS 1905 WM 01.157

Clinical sample

WM 01.217B WM 229

ST 4 ST 2

C. albicans

ST 5 ST 3

0.0030

0.0025

0.0020

0.0015

0.0010

0.0005

0.0000

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Carolina Serena

Species

Intraspecies variation (%)

No. of sequences (in house/GenBank) 86 (5/81) 60 (14/46) 25 (5/20) 41 (5/36) 30 ( 4/26) 61 (11/50) 36 (5/31) 10 (1/9) 29 (6/23) 10 (3/8) 4 (1/3) 20 (1/17) 19 (7/12) 30 (8/22) 15 (0/15) 53 (10/43) 20 (1/19) 34 (2/32) 30 (4/26) 4 (1/3) 11 (2/9) 57 (9/48) 10 (1/9) 7 (2/5) 13 (1/12) 9 (4/5) 23 (7/16) 26 (5/21)

Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus terreus Candida albicans Candida dubliniensis Candida glabrata Candida guillermondii Candida haemulonii type I Candida haemulonii type II Candida kefyr Candida krusei Candida lusitaniae Candida metapsilosis Candida parapsilosis Candida orthopsilosis Candida pelliculosa Candida tropicalis Candida utilis Candida zeylanoides Cryptococcus gattii Microsporum canis Microsporum gypseum Paecilomyces lilacinus Scedoporium aurantiacum Scedosporium prolificans Trichophyton rubrum

3.55 1.37 6.26 4,30 4.23 3.34 2.49 2.54 4.82 0.40 0.40 4.10 2.14 8.22 1.81 0 1.89 2.85 8.35 3.14 2.90 1.75 0 1.00 1.96 0.56 2.01 1.82

~ 2.92 %
Bougnoux et al. 2003 JCM 41:5265-6.

~ 2.50 %
Dodgson et al. 2003 JCM 41:5709-17.

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Molecular species borders currently undefined!

Currently type culture based cut off point: 99%

Clinical sample based cut off value: 92% similarity

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Carolina Serena/Wieland Meyer

Comparative sequence based identification is only meaningful if:

well-curated, robust and reliable databases are available that are populated with sequence data from:
type or reference strains (where possible) a wide range of clinical strains a wide variety of target species

the strains have been rigorously validated in terms of their nomenclature

WMeyer, USYD, Australia, Barcoding-Mexico City 2009

New Quality controlled ITS sequence database at the Molecular Mycology Research Laboratory
at: http://www.mycologylab.org/BioloMICSID.aspx

3
4 5 7 6

8
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Conclusions
Fungal species have polymorphic ITS 1/2 regions, with the intra-species variation differing depending on the species under investigation The currently used cut off 98-99% is incorrect, population based intraspecies sequence variation ranges from 0% to 8.35% since resulting in a new cut off point of 91%, depending on the species tested The quality controlled in-house ITS data offer a higher accuracy and better predictive value for the correct identification of clinically important fungi than GenBank A quality controlled well-curated database containing sequences of 480 strains representing 182 human pathogenic fungal species is available for comparative sequence based fungal ID via the world-wide-web at: www.mycologylab.org Other well-curated ITS database are:
CBS Fungal Biodiversity Centre database for medical fungi (http://www.cbs.knaw.nl/databases/) Fusarium spp. (FUSARIUM-ID v. 1.0; http://fusarium.cbio.psu.edu/index.html) Phaeoacremonium spp. (http://www.cbs.knaw.nl/phaeoacremonium/biolomics.aspx) Trichoderma spp. (http://www.isth.info/morphology.php) Mycorrhizal fungi (UNITE, http://unite.ut.ee/)
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Need to be integrated into BOLD

Possible genetic loci for fungal ID

COX1 ITS1/2 region
does not work for fungi overlapping homology

Alternative loci:
D1/D2 LSU rDNA gene overlapping homology Histone spacer TUB AFTOL genes: RNA polymerase genes RPB1 RPB2
for fungal ID most likely a combination of genes needed
WMeyer, USYD, Australia, Barcoding-Mexico City 2009

Acknowledgements
Molecular Mycology Research Laboratory, University of Sydney, Sydney Medical School - Western at Westmead Hospital Carolina Serena, Fabian Carriconde, Krystyna Maszewska, Matthew Huynh, Clement Kin Ming Tsui, Nathalie van de Wiele, Sharon Chen, Wieland Meyer Centre for Infectious Disease and Microbiology, Westmead Hospital Fanrong Kong, Ying Sun, Catriona Halliday, Xianyu Zeng, Guy Porter, Ok-Cha Lee, Tania Sorrell

CBS-Fungal Biodiversity Center, Utrecht, The Netherlands BioAware, Hannut, Belgium

Vincent Robert Mycology Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece Aristea Velegraki, Michael Arabatzis Funding:
# 352303 to WM

WMeyer, USYD, Australia, Barcoding-Mexico City 2009