CP Chem

nd
2 Semester
Test 1
STUDY GUIDE

Define and give an example:

Stationary phase:

Mobile phase:

Retention Factor:

In a peanut butter plant, a quality control chemist uses gas chromatography to test for aflatoxin, a mold
that can grow on peanuts in the ground and make the peanuts toxic. The aflatoxin has a Rf of 0.33 when
he uses a 25 foot tube in the machine. One day, the lab supplier makes a mistake and ships him a 30
foot tube for his machine. What is the Rf of the aflatoxin if the chemist uses the 30 foot tube because it's
all he has?

How far did the aflatoxin travel in a 25 ft. tube?

In a 30 ft. tube?

What is almost everything in your body made of?

If DNA is never permitted to leave a cell nucleus, how do the instructions from the DNA get
understood by the rest of the cell?

Define:

transcription

translation

mRNA

What are two important ways RNA is chemically different from DNA?

1. What does the word DNA stand for?

 2. DNA is a polymer, which means that it is made up of
many repeating single units (monomers). What are
the monomers called?

3. There are 4 different variations of these monomers (4

different bases), what are those?

4. The base_________ pairs with _________. The base ___________ Pairs with
__________.

This is called complementary base pairs. Thus one strand of the DNA is
complementary to the
other strand (opposite/matching).

5. Based on this base paring system, which of the following is/are true?

a. Cells contain the same amount of T as A

b. Cells contain the same amount of C as G
c. Cells contain the same amount of T as G
d. Cells contain the same amount of A as C

7. DNA is in the ______________ of cells. DNA contains information to make

________________which are responsible for all activities in the cell. So the primary
function of
DNA is to store and transmit genetic information.

9. Two scientists are given credit for discovering the structure of DNA. What is the
name of
those two scientists?

10.What is the name of the process of making a copy of the DNA?

When an error occurs in making a copy, we say that the DNA contains a __________
.

11.What is the name of the enzyme that unwinds DNA?

12.What is the name of the enzyme that copies the DNA/makes the
complementary copy?
13.
Write a Complementary sequence for this strand of DNA:
AATTCGCCGGTATTAGACGTT

1. Proteins are one of the biomolecules in our cells. They are polymers of
_______________
Note: 20 different amino acids make up our proteins and they can be arranged in
different orders,
making different proteins. Proteins are responsible for most of what happens in
our cells. They
have a structural role (cytoskeletal system that holds the shape of the cell),
catalyst role (enzymes
that speed up reactions by reducing the activation energy-energy required to
allow the reaction to
take place), functional role (such as proteins that carry molecules and organelles
across the cell,
proteins that function as transporters, allow molecules to get in and out of the
cell, etc. Given that
proteins do just about everything in the cell and the DNA codes for these proteins,
the DNA
contains almost all the information the cells need to produce parts that make
them function.
The mRNA is used as a template to produce proteins. What is this process called?

3. What is a codon?

5. What is the Start codon? What are the stop codons?

6. What is the machinery used for translation?

7. What would each of the following codons code for?

AUG
UAG
UAA
UGA
GAU
CAC

8. What would the mRNA sequence below code for (write the amino acid
sequence):
AUGGACACACAUUUAUUCUGUGUCUGA

How would the sequence change if it was mutated at the end into:
AUGGACACACAUUUAUUCUGUGUCUGG

How would the protein be affected?

10. What is a polypeptide?

11. If you have the following polypeptide, what would be the possible sequence of
DNA:
tyrosine-proline-aspartic acid-isoleucine-cysteine
 15.What is the purpose of having multiple codons coding for the same amino
acid?

16.What is a point mutation? Provide an example.

17. What is a frame shift mutation? Provide an example.