Molecular Phylogeny and Phylogeography of Lupinus (Leguminosae) Inferred From Nucleotide Sequences of The RBCL Gene and ITS 1 + 2 Regions of rDNA

P1. Syst. Evol.
208:139-167 (1997)
--Plant Systematics and Evolution

Springer-Verlag 1997 Printed in Austria
Molecular phylogeny and phylogeography of Lupinus (Leguminosae) inferred from nucleotide sequences of the rbcL gene and ITS 1 + 2 regions of rDNA
ERNST KXSS a n d MICHAEL WINK
Received May 2, 1996; in revised version August 6, 1996
Key words: Leguminosae, Papilionoideae, Genisteae, Lupinus. - Molecular phylogeny, cpDNA, rbcL, rDNA, internal transcribed spacer (ITS). Abstract: Total DNA was extracted from 55 species of the Leguminosae (including 29 species of Lupinus). The chloroplast gene rbcL and the ITS 1 + 2 regions of nuclear RNA genes were amplified by polymerase chain reaction (PCR) and sequenced directly. The sequences obtained were evaluated with character state (Maximum Parsimony) and distance methods (Neighbour Joining). Phylogenetic trees obtained with both data sets and methods are mostly congruent. Genisteae and Crotalarieae are sister groups and share ancestry with the 7hermopsideae/Podalyrieae. The genus Lupinus, which forms a monophyletic clade within the Genisteae, shows a distinct Old-New World disjunction and appears to be divided into several more or less distinct groups: (1) The species from the eastern part of South America. (2) The homogeneous rough-seeded group (Scabrispermae)of the Old World species which is well distinguished from the smooth-seeded group (Malacospermae). (3) Within the rather heterogeneous smooth-seeded lupins a smaller subgroup with L. angustifolius, L. hispanicus and L. luteus is recognized. (4) Also separated are North American lupins and South American species with a western distribution. Genetic distances imply that the genus Lupinus evolved during the last 12-14 million years, ruling out the hypothesis that the present Old-New World disjunction can be interpreted as a result of the continental drift. The genetic data suggest an origin in the Old World and an independant colonisation of the Eastern parts of South America as opposed to North America and the Western parts of South America.
The genus Lupinus L. represents a fairly large genus within the Leouminosae. Its species are of Old World and N e w World distribution. The Old World is represented by at least 12 species in the Mediterranean region and N o r t h Africa which are all herbaceous annuals with c h r o m o s o m e counts of 2 n = 3 2 , 36, 38, 40, 42, 50, 52 (GLADSTONES 1974, CARSTAIRS ~%al. 1992). With regard to their seed coat structure lupins have been divided (PLITMANN ~% HEYN 1984) into smooth-seeded (Sect. Malacospermae: L. albus, L. anoustifolius, L. hispanicus, L. luteus, L. micranthus) and rough-seeded species (Sect. Scabrispermae: L. atlanticus, L. cosentinii, L. dioitatus, L. palaestinus, L. pilosus, L. princei, L. somaliensis). In contrast, the N e w World species
140
E. KAss & M. WINCe:
comprise annual and perennial, partly shrubby species with few variations in chromosome numbers (2n=48, 36; DUNN 1984). According to different authors 200-600 species have been described for North and South America, with radiation centers in the Rocky Mountains and the Andes. Because of higher morphological variability and interspecific hybridisation species delimitation sometimes appears ambiguous in some New World species. Due to their agricultural importance, lupins have been of human interest since ancient times and were already mentioned in the very first botanical works: THEOPHRAST (372 288 BC) and following authors (e.g., CATO 234-149 BC; VARRO 116-27 BC; VIRGIL 70-19 BC) described not only the agricultural use but also the medical exploitation of lupins (especially seeds of L. albus) (DIOSCORIDES~ 70 AC). Until the Middle Ages three species were known L. albus, L. luteus and L. angustifolius; description of L. pilosus and L. micranthus followed later (HANELT 1960, HONDELMANN1996). At the end of the 17th century North American lupins, such as L. perennis and L. polyphyllus were brought to Europe. In the first edition of the "Species plantarum" LINN~ listed six species: L. perennis, L. albus, L. varius, L. hirsutus, L. angustifolius and L. luteus (PLANCHUELO1982). In the 19th century DE CANDOLLE(1825-1827) described 36 species, and AGARDH (1835) 76 species. AGARDH divided the genus into groups, which he named after a "lectotype" (i.e. "albi", "lutei", "angustifoli"). The order within the groups is not in agreement with the present phylogenetic evidence (i.e. "albi" contains L. mutabilis, "angustifoli" L. nanus) (see below). After AGARDH(1835) the only complete description of the genus (including a subdivision) was carried out (based partly on DE CANDOLLE 1825-1827 and WATSON 1873) by TAUBERT(1894). Other authors, e.g., BENTHAN (1865), HUTCHINSON(1964) or POLHILL (1976), did not further subdivide this large genus, although the remaining genera of the Genisteae were minutely splitted. The classification of North and South American lupin species by SMITH ("Species Lupinorum", 1917-1938) has caused some confusion, because he described about 600 species of rather uncertain status (PHILLIPS 1995, PLANCHUELO 1982). Inspite of these shortcomings it has to be conceded that SMITH(1944) and before him WATSON (1873) were the only authors who did attempt a subdivision of the North American species. Present publications usually deal with part of the genus, either Old World (KAZIMIERSKI NOWACKI 1961, GLADSTONES 1974, PLITMANN 1981, PLITMANN d~:HEYN 1984, PLITNANN& PAZY 1984) or New World species (PHILLIPS1955; DtrNN & GILLETT 1966; PLANCHUELO1982, 1984; PLANCHUELO& DUNN 1984). In addition lupin classifications can be found in local floras (e.g., GAMS 1923--1924, SMITH 1944, BURKART 1952, AMARALFRANCO& PINTO DA SILVA1968, RIGGINS8~;SHOLARS1993). The size of the genus Lupinus and the wide geographical distribution of its taxa, but also the relatively uniform morphological features (i.e. mostly digitate leaves with many leaflets; herbaceous, seldom shrubby growth; blue or multicoloured flowers in racemes; distinct root nodules) may have been responsible for its incomplete taxonomic analysis. Also an integration of the genus Lupinus in the Genisteae (shrubs or subshrubs characterized by simple or digitate leaves with three leaflets; yellow flowers seldom in form of a raceme) remained ambiguous: This has led (a) to the exclusion of the genus Lupinus at least from part of the Genisteae (ROTHMALER 1944), (b) to the creation of a new tribe together with Ar#yrolobium (HUTCHINSON
Molecular phylogeny and phylogeography of Lupinus
141
1964) or (c) to the separation as a monogeneric subtribe (BISBY1981). Seen from a pragmatic perspective, the morphological homogeneity of the lupins has saved them from being split into several genera (as compared to the taxa of the Cytisus or Genista complex). Since "classical" morphological and cytological studies (PHILLIPS1957, SANUDO 1979, GOLDBLATT 1981, DUNN 1984, CARSrAIRS & al. 1992) did not produce a convincing taxonomy of Lupinus, chemotaxonomical markers including low molecular compounds and macromolecules such as proteins have been widely employed. Due to the occurrence of quinolizidine alkaloids, which are most abundant defence compounds in Lupinus and in other Genisteae a large number of phytochemical studies is available (CRANMER& TURNER 1967; FAUGERAS& PARIS 1971; MEARS & MABRY 1971; SALATINO& GOTTLIEB 1980, 1981; GoMEs & al. 1981; KINGHORN~; SMOLENSKI1981; WINK & WITTE 1983; KINGHORNd~;BALANDRIN1984; HOENEISEN & al. 1993; WINK 1993; HEGNAUER 1994; WINK & al. 1995). Besides alkaloids, non-protein amino acids, flavonoids and isoflavonoids have been covered in some detail (HARBORNE 1969, HARBORNE & al. 1971, NICHOLLS & BOHM 1983, WILLrAMS & al. 1983, HEGNAUER 1994). Since most legumes store seed proteins, surveys based on either protein electrophoresis (SALMANOWlCZ& PRZBYLSKA1994, SALMANOWICZ1995) or serological methods (CRISTOFOLIN1& CHIAPELLA1977, 1984; NOWACKI & JAWORSKI1978; CRISTOFOLINI1987, 1989) have been another means to address the phylogenetic relationships between these tribes and within the genus
Lupinus.
The application of molecular markers, especially of nucleotide sequences, is a recent development, but due to their high resolution and relevance for systematic surveys they are the methods of choice at present. The advantages of molecular markers, e.g. the possibility to cover large taxonomic units and to overcome convergent traits, have been discussed in the reviews of HILLIS & DIXON (1991), DOYLE & al. (1992), HAMBY& ZIMMER(1992), SOLTIS& al. (1992), CHASE& al. (1993), CLEGG (1993), DOYLE & DOYLE (1993), BAUM (1994), DONOGHUE (1994) and OLMSTEAD & PALMER(1994). Molecular approaches addressing taxonomic problems of the Leguminosae have included R F L P analyses (BRUNEAU& DOYLE 1993, DELGADO-SALINAS~; al. 1993, DOYLE ~%DOYLE, 1993, YAMAZAKI1993, BADR & al. 1994, BRUNEAU al. 1995) as well as sequence data. Surveys based on sequence data have been carried out with the evolutionary conserved rbcL gene (WINK & al. 1993; DOYLE 1994, 1995; KXSS & WINK 1994, 1995, 1996) or the more variable internally transcribed spacer regions of nuclear ribosomal genes (WoJCIECHOWSKI al. 1993). Although it was known for & a long time that many taxonomic groups of the Leguminosae must be para- or polyphyletic (POLItILL 1981 a), the "true" phylogenetic relationships of the family can now be deduced for the first time with the help of molecular data. Apart from taxonomic classifications a number of the hypotheses have been published concerning the phylogeography of the genus Lupinus with its distinct Old-New World disjunction: (1) Lupinus should have evolved as a distinct line directly from Sophoroid ancestors in South America, without a close relationship to the other Genisteae (DUNN 1971), or out of the Crotalarieae with South America as the center of origin (DuNN 1984, GROSS 1984).
142
E. KAss & M. WINK:
(2) Alternatively, Lupinus should have derived from Yhermopsideae (Thermopsis) with a North American origin and Europe/Africa as secondary centers of differentiation. In this case the rough and smooth seeded groups could represent single or separate evolutionary lines (PLITMANN 1981). (3) It was also postulated that lupins evolved out of primitive Genisteae in the Mediterranean region and migrated to N o r t h and South America (CRISTOFOLIN~ CHIAPELLA 1984), or (4) together with the rest of the Genisteae, lupins might have derived from Thermopsideae in the Sino-Himalayian region (TURNER 1981) and the Mediterranean and American regions figure as secondary centers of speciation (CRISTOVOLINI 1989). (5) It has also been speculated that after an early development of rough and smooth seeded lupins a further distribution to the Old and New World was caused by continental drift (NOWACKI & JAWORSKI 1978). In the present study we have analysed the nucleotide sequences (both rbcL and ITS-sequences) of 29 lupin species and 26 other taxa of the Papilionoideae to reconstruct the phylogeny of lupins with regard to the evolution of the tribes Genisteae/Thermopsideae/Crotalarieae and the phylogeny and phylogeography of Old and New World lupins.
Materials and methods Plants and DNA isolation. A list of the taxa studied in this survey is given in Table 1. Live plant material has been obtained from the Botanical Garden Heidelberg and from natural habitats, and seed material from other Botanical Gardens as well as the seed banks of the ,,Bundesforschungsanstalt ftir Landwirtschaft Braunschweig-V~lkenrode" (FAL) and the ,,Institut ftir Pflanzengenetik und Kulturpflanzenforschung Gatersleben" (IPK). Plants were grown from seeds whenever possible. Total DNA was isolated from fresh or dried leaf material using a modified version of the CTAB method (DOYLE& DOYLE 1990). PCR and DNA-sequencing. Primer pairs used for PCR flank the beginning and the end of the rbcL-gene (rbcL N: 5'ATG TCACCACAAACAGAAACTAAAGC 3', rbcL R:5' TATCCATTGCTGGGAATTCAAATTTG 3') and the end of the 18S RNA gene and the beginning of the 26S RNA gene (ITS18: 5'GTCCACTGAACCTTATCATTTAGACC 3', ITS26: 5' GCCGTTACTAAGGGAATCCTTGTTAG 3') respectively. For amplification 1 ~tg of total DNA was used as a target, plus 25 pmol each of primers rbcL-N and rbcL-R (or ITS18 and ITS26), 1.5 mM MgCI2, 0.1 mM of each dNTP, 10 ~tl amplification buffer and 2 units Taq-Polymerase (Promega) in a total volume of 100 ~tl.After an initial denaturation (2 rain at 94C) 30 cycles of 30 s at 94C, 30 s at 45C, and 60 s at 72C were performed on a Biometra thermocycler. After 30 cycles the reaction temperature was maintained at 72C for 4 rain and then lowered to 4C for further storage. Non-incorporated primers and nucleotides were inactivated enzymatically by shrimp alkaline phosphatase and exonuclease I and 5 ~tl of 100 ~1 double-stranded PCR product was used to carry out a sequencing reaction according to the "Sequenase PCR direct sequencing kit" (USB-Amersham). 35S-dATP was used as a radioactive tracer. For the rbcL gene, the following sequencing primers were used to obtain overlapping sequences: Primer NR: 399 bp reverse: 5' ATTCGCAAATCTTCCAGACG 3', primer OF: 174 bp: 5' GCCGAATCTTCTACTGGTAC 3', primer 2F: 426 bp, 5' TGCTTATGTTAAAACTTTCC 3', primer 3F: 635 bp: 5' TGCGTTGGAGAGACCGTTTC 3', primer 1R: 1207 bp reverse: 5' GGGTGCCCTAAAGTTCCTCC 3', primer RF: 1105 bp: 5' TATTTCACTCAGGATTGGG 3'. Sequencing primers for the ITS regions completely cover
143
Table 1. Sources of plant material (BG Botanical Garden, FALBundesforschungsanstalt fhr Landwirtschaft Braunschweig-V/Skenrode, I P K Institut fiir Pflanzengenetik und Kulturpflanzenforschung Gatersleben; I, II refers to individuals when two specimens of a species were sequenced: EMBLEuropean Molecular Biology Laboratory) Species Origin Voucher and EMBLaccession-numbers (rbcL, ITS1-2) 87, Z70122, Z72318-9 380, Z70132, Z72308-9 -, Z70164, Z72350-1 64, Z70082, Z72238-9 366, Z70133, Z72310-1 121, Z70135, Z72312-3 -, Z70086, Z72246-7 69, Z70099, Z72270 1 352, Z70077, Z72226-7 95, Z70074, Z72212-3 97, Z70053, Z72164-5 322, Z70068, Z72198-9
Anagyris foetida L. AspaIathus cephalotes THUNB. Cercis siliquastrum L. Chamaecytisus supinus (L.) LINK Crotalaria capensis JACQ. Crotalaria pallida AIT. Cytisus scoparius (L.) LINK Genista tinctoria L. Laburnum anagyroides MED. Lupinus aIbescens HOOKER& ARNOTT L. albifrons BENTH. L. albus L. subsp. 9raecus (BoISS & SPRUNER) FRANCO& P. SILVA L. albus L. subsp, albus (= L. termis FORSK~L) L. angustifolius L. L. arboreus SIMS L. arcticus WATS. L. argenteus PURSH L. aschenbornii SCHAUEP, L. atlanticus GLADSTONES L. aureonitens GILLES L. bemhamii A. A. HELLER L. bogotensis BENTH. L. cosentinii Guss. L. cruckshanskii (HOOK.) SWEET L. densiflorus var. menziesii (AGARDH)C. P. SMITH L. digitatus FORSKXL L. elegans H. B. K. L. formosus E. GREENE var. formosus L. hispanicus BoIss. & REUTERvar. hispanicus L. latifolius J. AGARDH var. latifolius L. luteus L.
I + II: BG Nice, France Cape Province, South Africa BG Heidelberg, Germany BG Heidelberg, Germany Cape Province, South Africa BG Lome, Togo Gellmersbach, Germany BG Heidelberg, Germany I + II: BG Hohenheim, Germany I + II: Sante F6, Argentina BG St Barbara, California I: Saatzucht Hege, Germany
II: Egypt I: Evora, Portugal II: Saatzucht Hege BG Glasgow, UK BG Kirovsk, Russia BG Denver Chirrippo Massif, Costa Rica FAL 22355, Marokko Midano de Bragado, Argentina IPK 51/91, California BG Bogota, Colombia I: FAL 22324, Algerie II: FAL 22346, Tunesia BG Glasgow, UK IPK 49/91, California
I + II: Wadi Kharit, Egypt
t4, Z70068, Z72200 1 6, 62, Z70064, Z72202-3 3, Z70054, Z72166-7 56, Z70055, Z72156-7 355,-, Z72158-9 331,-, Z72190-1 224, Z70069, Z72216-7 94, Z70075, Z72210-1 252, -, Z72168-9 328, Z70060, Z72192-3 239, 241, Z70070, Z72218-9 37,-, Z72194-5 248, Z70062, Z72186-7 229, 230, Z70071, Z72220 1 31, ,Z72170-1 49,-, Z72172-3 297, 19, Z70065, Z72204-5 8, Z70059, Z72174-5 2, 1, Z70066, Z72206-7
BG Mtinchen, Germany BG Rancho Sta. Ana, Claremont, California I: IPK 481/79 II: FAL 48713, Spain BG Rancho Sta. Ana, Claremount, California I: Evora, Portugal II: Lissabon, Portugal
144 Table 1 (continued) Species Origin
E. KXss & M. WINK:
Voucher and EMBLaccession-numbers (rbcL, ITS1-2) 262, 21, Z70067, Z72208-9 4, Z70063, Z72188-9 180, 179, Z70061, Z72196-7 43, 44, Z70056, Z72176-7 54, Z70057, Z72160-1 304, 305, Z70076, Z72214 5
L. micranthus Guss. L. microcarpus SIMS L. mutabilis SWEET L. nanus BENTH. var. nanus L. nootkatensis DONN ex SIMS L. paraguariensis CHODET~L
HASSLER
L. perennis L. L. pilosus MURRAY L. polycarpus GREENE L. polyphyllus LINDLEY L. princei HARMS L. pubescens BENTH. L. rivularis LINDLEY L. subcarnosus HOOK. L. succulentus KOCH Maackia amurensis RUPRECHT
MAXIM.
I: FAL 22380, Israel II: Spain I + II: Chile I: 'Coyo', Evora, Portugal II: 'Cholita', Evora, Portugal I + II: BG Rancho Sta. Ana, Claremont, California BG Kirovsk, Russia I: Misiones S. Ignacia, Argentina II: Corrienties/Ituzaingo, Argentine BG Heidelberg, Germany I: IPK 68/78 II: FAL 22375, Turkey IPK 54/91, California Traben-Trarbach, Germany I + II: Kenia Chelsea Physics Garden IPK 79/91, California IPK 25/84 BG Glasgow, UK BG G6ttingen, Germany BG Heidelberg, Germany Alpengarten Wien, Austria I + II: Arizona BG Berlin-Dahlem, Germany I + II: BG Heidelberg, Germany I: Bajamar, Tenerife II: BG Heidelberg, Germany BG Heidelberg, Germany BG Heidelberg, Germany Cape Province, South Africa
6, Z70058, Z72162-3 24, 264, Z70073, Z72222-3 254,-, Z72180-1 p4, Z70052, Z72154-5 232, 233, Z70072, Z72224-5 34,-, Z72178-9 258,-, Z72182-3 39, , 61, , Z72184-5 -, Z70137, Z72336-52 199, Z70127, Z72328 9 103, Z70140, Z72342-3 107, Z70141, Z72346-7 250, Z70139, Z72353 39 288, Z70142, Z72340-1 338, 28, Z70106, Z72282 3 -, Z70121, Z72316-7 -, Z70111, Z72290-5 378, Z70130, Z72334-5
Podalyria caIyptrata WILLD. Sophora jaubertii SPACH S. secundiflora (ORTE~.) LAG. S. flavescens AIT. Styphnolobium japonicum L. TeIine canariensis (L.) WEB. &
BERTH.
Thermopsis fabacea DC. Ulex europaeus L. Virgilia oroboides (P. BEROIUS) T. M. SALTER
both strands of the ITS regions to overcome problems of secondary structures: $1:61 bp of the 5.8S r-DNA reverse, 5' CGCATTTCGCTACGTTCTTC 3', $2: 101bp of the 5.8S r-DNA forward, 5' TCTTTGAACGCAAGTTGCGC 3', $3:23 bp before ITS1 forward, 5' AACCTGCGGAAGGATCATTG 3' $4: 23bp behind ITS2 reverse, 5' TAGCCCCGCCTGACCTGAGG 3', $5: 124bp of the 5.8S r-DNA reverse, 5' TTCGGGCGCAACTTGCGTTC 3', $6:19 bp of the 5.8S r-DNA forward, 5' ATATCTCGGCTCTTGCATCG 3'. Primers S1, $2 and $5, $6 were used alternatively.
145
A
30
B
[]
0
mean Disl~ncertx~L
max. Distanc~ rl:x:L
[] []
O
ZX
m e a n [ N ~ m e e IT$1
0 mean D i ~ a n ~ ITS2
max. Distance ITS1
25-
max. Distance ITS2
"i'i
20-
i:i: I
iiii
,.i., .:.l.:, ,4., ,.%
15-
0
&
0
&
::::
:.:.
iii?
T
"i"
t
~
,...., ..., ,.....,
10-
iili
o /1
Fig. 1. Genetic distance within taxonomic groups of the Papilionoideae. A Distances based on rbcL gene sequences (mean _+s.d. and maximal distances), B distances based on ITS1 + 2 sequences (mean _+s.d. and maximal distances) (Cyt-Gr Cytisus-group, Gen-Gr Genistagroup, Gen Genisteae, Cro CrotaIarieae, The Thermopsideae, Pod Podalyrieae, Sop
Sophoreae)
Products of the sequencing reactions were separated on a 6% polyacrylamide/7 M urea gel by electrophoresis at 65 W. After drying, the gel was exposed to an x-ray film (Hyperfilm-MP, Amersham) for 3-4 days, and developed (X-ray developer and fixer, Kodak). About 350 nucleotides were readable per sequencing run. The complete sequences were aligned to the rbcL gene sequence of Lupinus polyphyllus. Phylogenetic trees were reconstructed using the Maximum Parsimony method (MP; phylogeny program PAUP 3.1.1; SWOVFORD 1993), and the distance method Neighbour Joining (N J, as implemented in the program package MEGA 1.0, KUMAR& al. 1993). In the Neighbor Joining analyses genetic distances were calculated based on the Tamura-Nei aIgorithm which corrects for any bias in transition/transversions and uneven codon usage. Gaps in the Dataset (ITS) were excluded from the analysis. Bootstrap analyses (FELSENSTEIN 1988) were performed to obtain confidence estimates for each furcation. When using PAUP exact algorithms were employed ("Branch & Bound"; options: addition sequence furthest, compute via stepwise, keep minimal trees only, ACCTRAN, MULPARS). Additionally, quinolizidine alkaloid patterns of lupins (WINK & al. 1995) were combined in a datamatrix (program Mac Clade; MADDISON& MADDISON1992). Maximum Parsimony
146
E. Kss & M. WINK:
Table 2. Pairwise genetic distances between members of the Papilionoideae and Cercis siIiquastrum based on 1368 nucleotides (primers excluded) of the rbcL gene. Above diagonal: relative distances
1 2 3 4 5 .001 .003 .003 .002 6 7 4 5 5 7 8 6 7 6 6 5 6 5 6 12 15 15 14 21 11 16 44 49 40 41 47 61 57 49 48 54 57 51 67 6 7 8 9 10 .005 .005 .006 .006 .004 .005 .006 ,002 .000 8 7 5 6 5 5 4 5 4 5 11 14 14 13 18 10 15 42 47 40 39 47 61 57 47 46 52 55 49 68 11 .005 .004 .006 .004 .005 .004 .005 .004 .006 .006 7 5 4 5 5 4 6 5 6 13 16 16 15 20 14 19 41 46 39 40 46 60 56 48 47 53 56 50 66 12 ,007 .006 .008 .006 .006 .004 .004 .004 .005 .005 .005 4 5 4 4 3 5 4 5 12 15 15 14 19 13 17 42 47 40 39 44 56 52 45 46 52 53 47 65 13 .006 .004 .007 .005 .004 .004 .004 .003 .004 .004 .004 .003 1 0 0 1 3 2 3 10 13 13 12 19 11 16 40 45 38 37 45 59 55 45 44 50 53 47 65 14 .005 .004 .006 .004 .005 .004 .005 .004 .004 .004 .003 .004 .001 -1 1 2 4 3 4 11 14 14 13 20 12 17 39 44 39 38 46 60 56 46 45 51 54 48 66 15 .006 .004 .007 .005 .004 .004 .004 .003 .004 .004 .004 .003 .000 .001 0 1 3 2 3 10 13 13 12 19 11 16 40 45 38 37 45 59 55 45 44 50 53 47 65 16 .006 .004 .007 .005 .004 .004 .004 .003 .004 .004 .004 .003 .000 .001 .000 1 3 2 3 10 13 13 12 19 ll 16 40 45 38 37 45 59 55 45 44 50 53 47 65 17 .005 .004 .006 .004 .004 .003 .004 .002 .003 .003 .003 .002 .001 .001 .001 .001 2 1 2 9 12 12 11 18 10 15 39 44 37 36 44 58 54 44 43 49 52 46 64 18 .006 .004 .007 .005 .004 .003 .004 ,003 ,004 ,004 ,004 .004 ,002 .003 .002 .002 .001 1 0 11 14 14 13 17 9 16 41 46 39 38 46 60 56 46 45 51 54 48 66 19 .005 .004 .006 .004 .004 .002 .003 .002 .003 ,003 .004 .003 .001 .002 .001 .001 .001 .001 1 10 13 13 12 18 10 15 40 45 38 37 45 59 55 45 44 50 53 47 65 20 .006 .004 .007 .005 ,004 .003 .004 .003 .004 .004 .004 .004 .002 .003 .002 .002 .001 .000 .001 11 14 14 13 17 9 16 41 46 39 38 46 60 56 46 45 51 54 48 66
1 2 3 4 5 6 7 8 9
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Lupinuspolyphytlus Lupinus atbifrons Lupinusnanus Lupinus latifoIius Lupinus murabilis Lupinus densifiorus Lupinusmicrocarpus Lupinus angustifolius Lupinus hispanicus Lupinusluteus Lupinusmicranthus Lupinusalbus LupinusatIanticus Lupinuscosentinii Lupinusdigitatus Lupinusprincei Lupinuspilosus Lupinusalbescens Lupinus aureonitens Lupinus paraguariensis Laburnumanagyroides Chamaecytisussupinus Cytisusnigricans Cytisusscoparius
Genista tinctoria "Felinecanariensis UIex europaeus
Thermopsisfabacea Anagyrisfoetida
Podalyria calyptrata VirgiIia oroboides Aspalathus cephaIotes Crotalaria capens~s Crotalaria pallida Maackia amurensis
Sophoraflavescens Sophorajaubertii
Sophora secundiflora
Sophorajaponica
Cercis siIiquastrum
.001 .001 .001 2 .003 .001 2 4 .002 1 1 3 2 4 4 3 8 6 10 7 9 7 11 8 6 6 8 7 7 7 9 8 7 7 9 8 7 5 9 6 10 8 12 9 8 6 10 7 7 5 9 6 8 6 10 7 8 6 10 7 7 5 9 6 8 6 10 7 7 5 9 6 8 6 l0 7 14 14 16 15 15 15 17 16 15 15 17 16 14 14 16 15 23 21 25 22 13 13 15 14 18 18 20 19 42 40 44 41 47 45 49 46 40 38 42 39 41 39 43 40 47 45 49 46 61 59 63 60 57 55 59 56 49 47 51 48 48 46 50 47 54 52 56 53 57 55 59 56 51 49 53 50 67 67 69 66
.006 .006 .004 .005 .004 .005 .004 .005 .007 .008 .006 .006 .005 .006 .005 .006 .004 .005 .003 .004 .001 .004 .005 1 .005 .006 6 7 .002 7 8 3 7 8 3 0 6 7 5 8 5 6 6 7 5 6 4 5 6 7 5 6 5 6 4 5 5 6 4 5 4 5 3 4 4 5 4 5 3 4 3 4 4 5 4 5 13 14 10 11 16 17 13 14 16 17 13 14 15 16 12 13 21 22 17 18 13 14 9 10 17 18 14 15 43 44 42 42 48 49 47 47 39 40 40 40 40 41 39 39 46 47 47 47 58 59 61 61 54 55 57 57 46 47 47 47 47 48 46 46 53 54 52 52 54 54 55 55 48 49 49 49 66 67 65 68
with heuristic methods was employed ("Heuristic Closest"; options: stepwise addition closest; hold-- 1; TBR; collapse and MULPARS in function). No exhaustive search was possible in this case. Since an additional search under "Random addition" did not reveal other topologies, 100 shortest trees were combined in a "50% Majority Rule" cladogram. Results Sequence variation, genetic distances and divergence times. All rbcL sequences (n = 46) were of equal length (1420 bp), no deletions, insertions or inversions of nucleotides or sequence elements were observed. For the complete dataset, 170 positions were variable and 109 positions parsimony informative. The lengths of ITS sequences (56 species) are relatively equal within Lupinus, with 235-236 bp in ITS1 and 217 bp in ITS2, while single base insertions or deletions occur in the remaining Genisteae and the other tribes. Cercis (subfam. Caesalpinioideae) was used as an outgroup and shows a sequence length of nearly the same size (ITSI: 229 bp, ITS2: 213 pb). In this dataset, 308 positions were variable and 208 positions parsimony informative. The skewness of 1000 randomly sampled trees generated with P A U P
147
(1.0 = 100%); below diagonal: absolute distances: numbers of nucleotide substitutions (sequence of Lupinus polyphyllusidentical to L. arboreus,L. arcticus, L. nootkatensis, and L. perennis;L. mutabilis identical to L. bogotensis)
21 .010 .010 .011 .011 .008 .009 .010 .007 .008 .008 .009 .008 .007 .008 .007 .007 006 .008 .007 .008 5 5 4 13 3 8 37 41 36 35 43 57 53 41 40 46 50 43 62 22 .011 .011 .012 .011 .011 .011 .012 .009 .010 .010 .011 .011 .009 .010 .009 .009 .008 .010 .009 .010 .004 0 l 16 6 11 36 40 35 34 44 56 52 41 39 45 47 42 61 23 .011 .011 .012 .011 .011 .011 .012 .009 .010 .010 .011 .011 .009 .010 .009 .009 .008 .010 .009 .010 .004 .000 1 16 6 11 36 40 35 34 44 56 52 41 39 45 47 42 61 24 .010 .010 .011 .011 .010 .011 .011 .008 .009 .009 .011 .010 .008 .009 .008 .008 .008 .009 .008 .009 .003 .001 .001 15 5 10 37 41 36 35 43 57 53 41 40 46 48 43 62 25 .016 .015 .018 .015 .015 .015 .015 .012 .013 .013 .014 .013 .013 .014 .013 .013 .013 .012 .013 .012 .009 .011 .011 .011 10 13 41 45 41 42 47 59 55 45 46 52 56 49 65 26 .009 .009 .01i .010 .008 .009 .010 .006 .007 .007 .010 .009 .008 .008 .008 .008 .007 .006 .007 .006 .002 .004 .004 .004 .007 27 28 29 .033 .032 ,035 .032 .035 .034 .035 .033 .033 .033 .032 .033 .032 .031 .032 .032 .031 .032 .032 .032 .029 .028 .028 .029 .032 .030 .032 .013 -24 25 42 48 46 26 23 32 35 31 54 30 .028 .027 .030 .027 .028 .027 .028 .028 .028 .028 .027 .028 .027 .027 .027 .027 .026 .027 .027 .027 .025 .025 .025 .025 .029 .026 .028 .015 .017 9 34 45 41 26 22 29 35 30 53 31 .029 .027 .030 .028 .029 .028 .029 .027 .027 .027 .028 .027 .026 .027 ,026 .026 .025 ,027 .026 .027 .025 .024 .024 .025 .030 .025 .029 .014 .018 .006 34 47 45 27 23 28 35 29 51 32 .033 .032 .035 .032 .033 .032 .033 .033 .033 .033 .032 ,031 .032 .032 ,032 .032 .031 .032 .032 .032 .030 .031 .031 .030 ,033 .031 .033 .025 .030 .024 .024 26 26 41 40 43 47 45 66 33 .043 .042 .044 .042 .043 .041 .042 .043 ,043 .043 .042 .039 .042 .042 .042 .042 .041 .042 .042 ,042 .040 .039 ,039 .040 .042 .04l .042 .032 .034 .032 .033 .018 34 35 .035 .033 .036 .034 .035 .032 .033 .033 .033 .033 .034 .032 .032 .032 .032 .032 ,031 .032 .032 .032 .029 .029 .029 .029 .032 .030 .031 .016 .018 .018 .019 .029 .032 .030 23 34 30 29 53 36 .034 .032 .035 .033 ,034.033 .034 .032 .032 .032 .033 .032 .031 .032 .031 .031 .030 .032 .031 .032 .028 .027 .027 .028 .032 .029 .03I .015 .016 .015 .016 .028 .035 .034 ,016 13 35 34 56 37 .038 .037 .039 .037 .038 .037 .038 .037 .037 .037 .037 .037 .035 .036 .035 .035 .035 .036 .035 .036 .032 .032 .032 .032 .037 .033 .035 .020 .023 .020 .020 .030 .042 .039 .024 .009 40 39 61 38 .040 .039 .042 .039 .040 .038 .038 .039 .039 .039 .039 .037 .037 .038 .037 .037 .037 .038 .037 .038 .035 .033 .033 .034 ,039 ,036 .037 .023 .025 .025 .025 .033 .037 .035 .021 .025 .028 20 46 39 .036 ,035 .037 .035 .036 .034 .035 .035 .035 .035 .035 .033 .033 .034 .033 .033 .032 .034 .033 .034 .030 .030 .030 .030 .035 .031 .032 .021 .022 .021 .020 .032 .036 .035 .020 .024 .027 .014 -37 40 .047 .047 ,049 .046 .047 .046 .047 .046 .048 .048 .046 .046 .046 .046 .046 .046 .045 .046 .046 .046 .044 .043 .043 .044 .046 .044 .044 .039 .038 .037 .036 .046 .052 .051 .037 .039 .043 ,032 .026 ,013 ,030 .013 .028 .014 .031 .013 .029 .011 .031 .012 .030 .013 .03l .010 .030 . 0 l i .030 ,011 .030 .013 .029 .012 .030 .011 .028 .012 ,027 .011 .028 .011 .028 .011 .027 .011 .029 .011 .028 ,011 .029 .006 .026 .008 .025 .008 .025 .007 .026 .009 .029 .005 .027 7 -- .029 38 41 -42 45 18 37 40 21 36 41 20 44 47 35 58 60 45 54 56 43 42 44 23 41 44 22 47 50 29 51 53 33 44 46 30 63 63 55 .040 .039 .042 .039 .040 .038 .039 .040 .040 .040 .039 .037 .039 .039 .039 .039 .038 .039 .039 .039 .037 .037 .037 .037 .039 .038 .039 .030 .032 .029 .032 .018 .004 6 46 42 50 48 59 55 53 50 51 49 74 72
from both datasets indicate the presence of significant phylogenetic signals (HILLIS & HUELS]~NBECK1992). For many species two unrelated individuals were sequenced (Table 1), but except for the ITS sequences of the two subspecies of L. albus no intraspecific sequence variation was found. Genetic distances between major taxonomic groups are illustrated in Table 2 (rbcL-dataset) and Table 3 (ITS-dataset). The size (i.e. the number of genera and species) of tribes of the Papilionoideae varies much, due to a more (Podalyrieae and Genisteae) or less (Sophoreae) intense subdivision of the tribes sensu BENTHAM(1865). Since the classification, are often artificial, we must expect that genetic distances between different ranks are not strongly correlated. Although the genus Lupinus contains many taxa, genetic distances between its members are in the range of intrageneric distances (Fig. 1) and reach tribal distances only if compared to those obtained in the small tribe Podalyrieae. Ideally, intrageneric distances should be of equal size; therefore, a separation of Lupinus as a tribe of its own (as suggested by some authors; ROTHMALER 1944, HUTCHINSON 1964) would lead to very uneven classifications compared to the remaining Genisteae. On the other hand, within
148
A
E. K)~ss & M. WINK: Lupinuspolyphyllus ~ Lupinusalbus I ~- Lupinusaureonitens 17 t ~ Chamaecytisussupinus I~1J cytisus scoparius t~ lr" i-qburnumanagyroides ~ 2~5 Genistatinctoria Ulex europaeus Teline canariensis 6 Aspalat#uscephalotes 4 16 --'~ ' 17 ~ Crotalariacapensis ._j I ~ Crotalariapallida 8 Thermopsisfabacea ~-~ i 10 Anagyrisfoetida ~ 9 ~ Podalyriacalyptrata 2] ~ oVirgiliaoroboides [ 10 r~--~ophoraflavescens 1 ~ ' ~ Sophorajaubertii Maackia arnurensis lo Sophorasecundiflora Styphnolobiumjaponicurn -Cercis siliquastrurn . ~
Genisteae
crotalarieae Thermopstcieae Podafyrieae

Sophoreae __
.2
~4
Cercideae (Caesalpinioideae)
Maximum parsimony
,---Lupinus albu$ 1 Lupinus polyphyllus I ~gL Lupinusaureonitens ~ee 1~ Chamaec~'sussupinus J I hCY scopatius tisu$ ~F Laburnumanagyroides 4G~ Genistatinctoria .C-U L._ Ulexeuropaeus G3L Telinecanariensi$ .---] ~ Aspalathuscephalotes F-- Crotalarfacapensls | :tee !_ Crotalariapallida Podalyria calyptrata ---'] 5i ~ ~ i L---Thermopsis Virgiliaoroboides ~ fabacea ---'] Anagyris foetida r - Sophora flavescens e~ Sophorajaubertii M a a c k i a amurensis - Sophorasecundiflora - Styphnolobiumjaponicum Cercis siliquastrurn
0' ~,01
Genisteae
Crotalarieae Podalyrieae Thermopsideae Sophoreae Ce~ideae (Caesa~mio~eae)
Neighbour Joining
Fig. 2. Phylogenetic relationships between tribes of the Papilionoideae based on rbcL (A) and ITS (B) sequences using Cercis siliquastrum (Caesalpinioideae) as an outgroup. A Upper panel: analysis by maximum parsimony, phylogram of the single most parsimonious tree of a branch & bound search (length 251 steps, min/max length 183-540 steps: CI 0.750, HI 0.250, RI 0.829, RC 0.622); branch lengths are proportional to the number of nucleotide substitutions between taxa (indicated above each branch). Lower panel: NJ analysis, numbers at each furcation are bootstrap values (100 replicates) using the TANURA-NEI algorithm; branch lengths are proportional to the distance between taxa. B Upper panel: MP analysis, phylogram of the single most parsimonious tree of a branch & bound search (length 687 steps, min/max length 446-1095 steps; CI 0.649, HI 0.351, RI, 0.629, RC 0.408). Lower panel: NJ analysis: numbers below each furcation are bootstrap values (100 replicates) using the TAMURA-NEIalgorithm

B
149
[
I
21 --
a4
26
sp /athus cepha/otos [ I ~115 ~r~- Crotalaria capensis I I ~Crotalaria pallida ]1 21 2= Podalyria calyptrata 28 / ~ Viroilia oroboides | ~ Thermopsisfabacea [ .111 J '~ ~.~nagyrisfoetida hol [ 31 ~ Sophora flavescens '-~ 39 i ,~ Sophorajaubertii Maackia amurensis 5o Sophora secundiflora Styphnolobiumjaponicum Cercis siliquastrum
Lupinus polyphyllus Lupinus a/bus 1 ~ Lupinus aureonitens 14 ] 61~ Chamaecy~sussupinus I~ Cytisus scoparius I ~ ~ l~bumum anagyroides J I~ ~ Genista tinctoria 1 ~ULgJ_ 20 Telinecanariensis I 1 ~-L!~- Ulex europaeus
13~--.-
Genisteae
(b
----q
]
~ ~
Crotalarieae Podalyrieae Thermopsideae Sophoreae _ _
Cercideae (Caesalpinioideae)
Maximum parsimony
91
Lupinus albus Lupinus aureon!tens II Tefine canafiensls I [~l Ulex europaeus 9s I h Genista tinctoria I II r - Laburnum anagyroides j s=-~,r--Chamaecytisus supinua I -~3-L_ Cytisus scopafiua I F---- Aspalathus cephalotes s ~ Crotalafia capensis lee ~_ Crotalafia pal/ida r- Podalyria calyptrata -'-] ~ee L_ Vir.giliaoroboides Thermopsis fabacea "--] ~ee [ Anagyfis foetida Maackia amurensis Sophora flavescens -~ tee [ Sophora jaubertii Sophora secundiflora Styphnolobium japonicum Cercis siliquastrum - 29~ ~
sgr- Lupinus polyphyllus
Genisteae
Crotalarieae Podalyfieae Thennopsideae Sophoreae __ Cercideae ( Caesalpinioideae)
.01
Neighbour Joining
Fig. 2 (continued)
Lupinus distance values were observed that come close to the distances of the Cytisus- or Genista-complex (Fig. 1), which, depending on the author, contain up to
20 genera (HOLUBOVA-KLASKOVA1964, GIBBS 1966, POLHmL 1976, BIS~ 1981). If equal standards would be applied, many genera of the Cytisus- and Genista-group would collapse or Lupinus would have to be subdivided.
150
E. K)~ss & M. W~NK:
Table 3. Pairwise genetic distances between members of the Papilionoideae and Cercis siIiquastrum based on ITS 1 + 2 nucleotides sequences. Above diagonal: relative distances (1.0 = 100%); below
10
11
12
13
14
15
16
17
18
19
20
21
22
23
1 2 3 4 5 6 7 8 9
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49
Lupinus polyphyllus Lupinus albifrons Lupinus arboreus Lupinus benthamii Lupinus eIegans Lupinusformosus Lupinus latifolius Lupinus nanus Lupinus polycarpus Lupinus rivularis LupinussuccuIentus Lupinus densiflorus Lupinus mierocarpus Lupinus bogotensis Lupnusmutabilis Lupinus albus I Lupinus albus II Lupinus angustifolius Lupinus hispanicus Lupinus Iuteus Lupinus micramhus Lupinus aureonitens Lupinus albescens Lupinusparagual'iensis Lupinusatlamicus Lupinus cosentinii Lupinus digitatus Lupinus pilosus Lupinusprincei Laburnum anagyroides Chamaecytisus supinus Cytisus nigricans Cyrisus scoparius Genista tinctoria Teline canariensis Ulex europaeus AspaIathus cephalotes Crotalaria capensis CrotaIaria pallida Thermopsisfabacea Anagyrisfoetida Podalyria calyptrata Virgilia oroboides Maaekia amurensis Sophoraflavescens SophoJ,ajaponica Sophorajauberti Sophorasecundiflora Cercissiliquastrum
2 1 1 1 3 1 10 4 1 2 7 9 1 3 7 8 9 9 13 14 15 16 22 16 14 16 16 16 25 33 31 33 45 38 38 46 54 53 76 76 65 68 83 93 97 89 108 158
.004 .002 .002 .002 .007 .002 .022 .009 .002 .004 .015 ~020 .002 .007 ,015 .017 .020 .020 .028 .031 .033 .035 - .002 .007 .007 ,002 .007 .026 .013 .002 .004 .015 ,020 .007 .011 .020 .022 .024 .024 .033 .035 .033 .039 1 - .004 .004 .004 .004 .024 .011 .000 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 3 2 - .004 .009 .004 .024 .011 .004 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 3 2 2 - 0.09 .004 .024 .011 .004 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 1 2 4 4 - .009 .028 .011 .004 .007 .017 ,022 .009 .013 .022 ,024 .026 .026 .035 .037 .035 .041 3 2 2 2 4 - .020 .011 .004 .007 .017 .022 .004 .009 .017 .020 .022 ,022 .031 .033 .035 .037 12 11 11 11 13 9 - .017 .024 .022 .033 ,037 .024 .024 .033 .035 .039 .041 .046 .048 .050 .052 6 5 5 5 5 5 8 - .Oll .013 .024 .028 .011 .015 .024 .026 .028 .028 .037 .039 .037 .039 1 0 2 2 2 2 11 5 - .007 ,017 .022 .004 .009 .017 .020 .022 .022 .031 .033 ,035 .037 2 3 3 3 3 3 10 6 3 - .011 .015 .007 .007 .015 ,017 .024 .024 .028 .031 .033 .039 7 8 8 8 8 8 15 11 8 5 .004 .017 .017 .022 .024 .028 .035 .039 .041 .039 .046 9 10 10 10 10 10 17 13 i0 7 2 - .022 .022 .026 .028 .033 .035 .039 .046 .044 .050 3 2 2 2 4 2 11 5 2 3 8 10 - .004 .017 .020 .022 .022 .031 .033 .035 .037 5 4 4 4 6 4 11 7 4 3 8 10 2 - .017 .020 .026 .026 ,031 .033 .039 .041 9 8 8 8 10 8 15 11 8 7 10 12 8 8 - .002 .022 .024 ,028 .028 .035 .033 10 9 9 9 I1 9 16 12 9 8 11 13 9 9 1 - .024 .026 .031 .031 .037 .035 11 10 10 10 12 10 18 13 10 11 13 15 10 12 10 11 - .013 .022 .039 .035 .037 11 10 10 10 12 10 19 i3 10 11 16 16 10 12 11 12 6 -- .013 ,037 .039 .039 15 14 14 14 16 14 21 17 14 13 18 18 14 14 13 14 10 6 .041 .048 .048 16 15 15 15 17 15 22 18 15 14 19 21 15 15 13 14 18 17 19 - .048 .046 15 16 16 16 16 16 23 17 16 15 18 20 16 18 16 17 16 18 22 22 .007 18 17 17 17 19 17 24 18 17 18 21 23 17 19 15 16 17 18 22 21 3 24 23 23 23 25 23 30 24 23 24 27 29 23 25 21 22 23 24 28 28 13 10 18 17 17 17 19 17 22 20 17 16 19 21 17 17 16 17 17 20 21 24 21 22 16 15 15 15 17 15 20 18 15 14 17 19 15 15 14 15 15 18 19 22 20 21 18 17 I7 17 19 17 22 20 17 16 17 19 17 17 16 17 17 20 21 24 22 23 18 17 17 17 19 17 22 20 17 16 19 2I 17 17 16 17 17 20 21 24 22 23 18 17 17 17 19 17 22 20 17 16 17 19 17 17 16 17 17 20 21 24 22 23 27 26 24 26 28 25 33 29 26 27 30 32 26 28 26 27 28 30 30 34 32 33 35 34 32 34 34 33 41 35 34 35 38 40 34 36 34 35 36 38 40 42 40 41 33 32 30 32 34 31 38 35 32 33 36 38 32 32 32 33 34 36 38 37 36 37 35 34 32 34 36 33 38 37 34 33 36 38 34 34 32 33 36 38 38 38 40 41 45 44 44 46 44 44 49 45 44 47 51 53 46 48 45 46 47 49 50 51 53 52 38 37 39 39 37 37 41 40 37 38 41 43 39 39 37 38 40 43 45 39 43 44 40 39 37 39 39 37 42 38 39 40 43 45 39 41 39 40 41 43 45 47 43 44 48 47 45 45 47 46 51 48 47 46 48 50 47 47 45 46 50 52 52 49 51 50 56 55 53 55 55 54 63 56 55 56 57 58 55 57 55 56 57 58 61 58 59 60 55 54 52 54 54 53 62 55 54 55 57 59 54 56 54 55 55 58 61 59 60 61 78 77 75 77 77 76 81 77 77 78 81 83 77 79 77 78 79 81 83 82 78 79 78 77 77 77 77 76 81 77 77 78 79 81 77 79 77 78 79 81 82 83 79 80 65 64 66 66 64 65 71 66 64 67 70 70 66 68 66 67 65 66 68 71 72 73 68 67 69 69 67 68 74 69 67 70 73 73 69 71 69 70 68 69 71 74 75 76 83 82 84 82 82 83 86 82 82 85 90 90 84 86 87 88 88 88 89 91 94 94 93 92 94 94 92 93 97 94 92 95 94 96 93 95 92 93 93 96 97 96 96 95 97 96 98 97 96 97 102 96 96 98 99 101 98 99 95 96 99 100 100 101 102 101 89 88 90 90 88 89 93 90 88 91 92 94 89 91 91 92 93 94 95 94 92 93 110 109 108 108 109 108 112 109 109 108 104 106 109 109 106 107 110 113 113 111 114 113 I57 158 157 159 156 158 156 156 158 156 159 159 159 159 158 159 161 162 161 163 164 165
In the rbcL trees (Fig. 2A) branch lengths, which are correlated to base substitutions or genetic distances, differ substantially between the Sophoreae/Podalyrieae/Thermopsideae on one hand and Crotalarieae/Genisteaeon the other hand. This phenomenon cannot be explained by the fossil record or morphological data. More likely, a change in mutational rates occurred which was confirmed by a relative rate test (according to SARICH & WILSON 1973). Therefore, it is extremely difficult to estimate reliable evolutionary rates and thus divergence times using the rbcL gene (K~ss 1995, KXss & WINK 1996). Mutational rates seem to be much more even in the ITS dataset (Fig. 2B; KXss 1995, K)~ss & WINg 1996). The model of KINURa (1980) was used to estimate evolutionary rates. With a proposed divergence time of 60 mio years for Cercis (subfam. Caesalpinioideae)and Sophora (subfam. PapiIionoideae)(i.e. for the separation of both subfamilies; HE~,ENDEEN & al. 1992) evolutionary rates of 3.6 10 . 9 (ITS1)/3.3 10- 9 (ITS2) were calculated (equivalent to 0.36-0.33% base substitutions
151
diagonal: absolute distances: numbers of nucleotide substitutions (sequence of Lupinus polyphyllus identical to L. arcticus, L. argenteus, L. nootkatensis, and L. perennis, L. elegans identical to L. pubescens and L. aschenbornii; L. mutabilis identical to L. cruckshanskii)
24 .048 .052 .050 .050 .050 054 .050 .065 .052 .050 052 .059 .063 .050 .054 .046 .048 .050 .052 .061 061 .028 .022
-
25 .035 .039 .037 .037 .037 .04t .037 .048 .044 .037 .035 .041 .046 .037 .037 .035 .037 .037 .044 .046 .052 .046 .048 .065 3 3 3 3 33 41 39 39 53 43 48 51 60 59 82 82 67 70 92 99 104 96 113 158
26 .031 .035 .033 .033 .033 .037 .033 .044 .039 .033 .031 .037 .041 .033 .033 .03I .033 .033 .039 .041 .048 .044 .046 .063 .007 2 2 2 31 39 37 37 51 41 46 51 60 59 82 82 67 70 92 99 102 96 111 159
27 .035 .039 .037 .037 .037 .041 .037 .048 .044 .037 .035 .037 .041 .037 .037 .035 .037 .037 .044 .046 .052 .048 .050 .068 .007 .004 2 0 33 4i 39 39 53 43 48 51 60 59 84 84 67 70 94 99 102 96 111 158
28 .035 .039 .037 .037 ,037 .041 .037 .048 .044 .037 .035 .041 .046 .037 .037 .035 .037 .037 .044 .046 .052 .048 .050 .068 .007 .004 .004 2 33 41 39 39 53 43 48 51 60 59 84 82 67 70 93 99 104 96 i13 158
29 .035 .039 .037 .037 .037 .041 .037 .048 .044 .037 .035 .037 .041 .037 .037 .035 .037 .037 .044 .046 .052 .048 .050 .068 .007 .004 .000 .004 33 41 39 39 53 43 48 51 60 59 84 84 67 70 94 99 102 96 111 I58
30 .055 .059 .057 .052 .057 .061 .055 .072 .063 .057 .059 .066 .070 .057 .061 .057 .059 .061 .066 .066 .074 .070 .072 .090 .072 .068 .072 .072 .072 14 17 ]6 40 33 33 39 48 47 69 70 64 67 85 89 96 87 103 164
31 .072 .076 .074 .070 .074 .074 .072 .090 .076 .074 .076 .083 .087 .074 .079 .074 .076 .079 .083 .087 .092 .087 .090 .107 .090 .085 ,090 .090 .090 .031 19 13 40 38 38 43 52 51 70 73 62 66 86 86 98 84 104 161
32 .068 .072 .070 .066 ,070 .074 .068 .083 .076 .070 .072 .079 .083 .070 .070 .070 ,072 .074 .079 .083 .081 .079 .08i ,100 .085 .081 .085 ,085 ,085 ,037 ,042 15 47 37 34 45 54 55 67 72 66 69 87 87 102 84 110 165
33 .072 .076 .074 .070 .074 .079 ,072 .083 .081 .074 .072 .079 .083 .074 .074 .070 .072 .079 .083 .083 .083 .087 ,090 .103 .085 .081 .085 .085 .085 .035 .028 .033 43 35 35 46 56 53 67 75 63 67 86 86 97 84 104 159
34 .099 .099 .096 .096 ,101 .096 .096 .107 .099 .096 ,103 .112 .116 .101 ,105 .099 .101 .103 .107 .110 .112 .116 .114 .132 .116 .112 .II6 .116 .116 .088 .088 .103 .095 47 50 54 65 66 82 85 67 70 89 92 99 88 112 158
35 .083 .083 .081 .086 .086 .081 .081 .090 .088 .081 .083 .090 .094 .086 .086 .081 .083 .088 .094 .099 .086 .094 .096 .116 .094 .090 ,094 .094 .094 .072 .083 .081 .077 .103 38 51 58 59 80 82 69 71 90 97 98 92 104 165
36 ,083 .087 .085 .081 ,085 .085 .081 .092 ,083 .085 .087 .094 .098 .085 .090 .085 .087 .090 .094 .098 .103 .094 .096 .116 ,105 ,100 .105 .105 .105 .072 .083 .074 .077 JlO .083 49 58 58 76 81 71 74 94 94 97 93 113 168
37 .101 .105 .103 .098 .098 .103 .101 .112 .105 .103 .101 .105 .109 .103 .103 .098 .i01 .109 .114 .114 .107 .112 .109 .I29 .112 .112 .112 .112 .112 ,086 .094 .099 .101 .119 .112 .I07 37 34 71 76 61 64 84 88 98 85 101 160
38 .1t8 .123 .120 .116 .120 .120 .118 .138 .123 .120 .123 .125 .127 .120 .125 .120 .123 .125 .127 ,133 .127 .129 .131 .142 .131 .131 .131 .13I .131 .105 .114 .118 .123 .143 ,I28 .127 .081 -15 78 82 58 59 94 98 108 93 111 164
39 .116 .120 ,118 ,114 ,118 .118 .116 .136 .120 .118 .120 .125 .129 .118 .123 .118 .120 .120 .127 .133 .129 .131 .133 .140 .129 .129 .129 .129 .129 .103 .112 .121 .116 .145 .130 .127 .074 .033 76 80 58 61 91 98 I03 94 109 156
40 .166 .170 .168 .164 .168 168 .166 .177 .168 .168 .170 .177 ,181 .168 .172 .168 .170 .172 .177 .181 .179 .170 .172 .188 .I79 ,179 .183 .183 .183 .15l .153 .147 .147 .180 .176 ,166 .155 ,171 .166 39 62 67 77 80 104 71 109 159
41 .166 .170 .168 .168 .168 168 .166 .177 .168 .168 .170 .172 .177 .168 .173 .168 .I71 .I73 .177 .179 .182 .173 .175 .193 .179 .179 .184 .179 .184 .154 .160 .158 .164 .187 .181 .178 .167 .180 .175 .085 65 70 78 80 96 74 103 155
42 .143 .143 .140 .145 .145 .140 .143 .156 .145 .140 .147 .154 .154 .145 .149 .145 .147 .143 .145 .149 .156 .158 .I60 .164 .147 .147 .147 .147 .147 .141 .136 .145 .138 .148 .152 .156 .134 .127 .127 .136 .143 7 72 82 97 74 i03 151
43 .149 .i49 .147 .151 .151 .147 .149 .162 .151 .147 .154 ,160 .I60 .151 .156 .151 .154 .149 .151 .156 .162 .164 .167 .171 .I54 .154 .154 .154 .154 .147 .i45 .152 .147 .155 .157 .163 .141 .130 .i34 .147 .154 .015 77 87 101 79 106 156
44 ,182 .182 .180 .185 .180 .180 .182 .189 .180 .180 .187 .198 .198 .185 .189 .191 .193 .193 .193 .196 .200 .207 .207 .209 .202 .202 .207 .204 .207 .187 .189 .192 .189 .197 .199 .207 .185 .207 .200 .169 .172 ,159 .170 88 108 85 115 155
45 .204 .204 .202 ,206 .206 .202 .204 .213 .206 .202 .208 ,206 .211 .204 .208 .202 .204 .204 .211 .213 .211 .21t .208 .224 ,217 .217 .217 .217 .217 .196 .189 .191 .189 .203 .214 .207 .193 ,215 .215 ,175 .176 .181 .192 .194 101 31 108 155
46 .213 .213 .21i .215 .213 .21i .213 .224 .211 .211 .215 .218 .22 .215 .218 .209 .211 .218 .220 .220 .222 .224 .222 .229 .229 .224 .224 .229 .224 .211 .216 ,225 .214 .219 .217 .214 .216 .238 .227 .229 .211 .214 .222 .238 .223 105 91 144
47 .196 .196 .193 .198 .198 .193 .196 .204 .198 .193 .200 .202 .207 .196 .200 .200 .202 .204 .207 .209 .207 .202 .204 .220 .21I .211 .211 .211 .211 .192 .185 .185 .185 .195 .204 .205 .187 .205 ,207 .156 .163 .163 .174 ,188 .068 .232 101 t60
48 .237 .242 .240 .237 .237 .240 .237 .246 .240 .240 .237 .229 .233 .240 .240 .233 .235 .242 .248 .248 .244 .251 .248 .262 .248 .244 .244 .248 .244 .227 .229 .242 .229 .248 .230 .249 .222 .244 .240 .240 .227 .227 .233 .254 .238 .200 .223 t65
49 .355 .353 ,355 .353 .357 .351 .355 .35I .351 .355 .351 .357 .357 .357 .357 .355 .357 .362 .364 .362 .366 .369 .371 .369 .355 .357 .355 .355 .355 .369 .362 .372 .358 .356 .372 .378 .360 .369 .351 .357 .349 .341 .352 .351 .350 .325 .362 .372 --
30 29 31 31 31 41 49 46 47 60 53 53 59 65 64 86 88 75 78 95 102 I04 100 119 164
per million years), without correction for transition/transversion ratios and 1.2" 10- 9 (ITS1 + 2) per base per year (equivalent to 0.12% base sustitutions per million years) with correction of transition and transversion events. These rates were applied to distances of taxa pairs of the different tribes and groups to estimate approximate divergence times for lupins and other taxa (Table 4). Phylogenetie position of the genus Lupinus. In a first set of analyses we have determined the phylogenetic position of Lupinus within the Papilionoideae, employing rbcL (Fig. 2A) and ITS data (Fig. 2B). Independent of the methods used for phylogeny reconstructions (i.e. MP or N J) or the genes analyzed, the monophyletic genus Lupinus always clusters with the Genisteae (Fig. 2A, B). Both datasets show that Crotalaria and Aspalathus (as representatives of the tribe Crotalarieae) are a well supported sister tribe to the Genisteae and share ancestry with them. The Genisteae themselves form a natural, monophyletic group. Three clusters seem to have evolved in the Genisteae: the Cytisus complex (Cytisus, Chamaecytisus and
152
A
3 1 I I
E. KXss & M. WINK:

Lupinus polyphyllus
2 .
Lupinus nanus
i Lupinus mutabilis 1 2 Lupinus angustifolius Lupinus luteus 3 1_ Lupinus albus Lupinus cosentinii
New World Species (North America and western regions of South America)
-J-~ Lupinus princei Lupinus pilosus
lr_~ Lupinus albescens

1
1
-
Laburnum anagyroides
Old World Species (Mediterranean region and North Africa)
I'
I
Lupinus paraguariensis
Lupinus aureonitens Laburnum anagyroides
--1 New World Species (Eastern regions of South America)
Maximum parsimony
93
[ ,. ~: .... i
Lupinus polyphyllus Lupinus nanus
Lupinus mutabilis 6-~41 Lupinus angustifolius - Lupinus luteus 3z/ Lupinus albus 4~ L upinus pilosus ] r - - - Lupinus cosentinii ---4 o~ L Lupinus princei 5z I ~ Lupinus albescens ' Lupinus paraguariensis 65 JLupinus aureonitens
New World Species (Eastern regions of South America)
.00t
Neighbour Joining Fig. 3. Phylogeographic relationships between Old and New World lupins using Laburnum anagyroides as a outgroup and rbcL (A) or ITS (B) sequences. A Upper panel: MP analysis, phylogram of the single most parsimonius tree of a branch & bound search (length 27 steps, min/max length 26-48 steps; CI 0.963, HI 0.037, RI 0.955, RC 0.919). Lower panel: N J-bootstrap analysis using the TANURA-NEI algorithm. B Upper panel: MP analysis, phylogram of the single most parsimonious tree of a branch & bound search (length 81 steps, min/max length 72-133 steps; CI 0.889, HI 0.111, RI 0.852, RC 0.758). Lower panel: N J-bootstrap analysis using the TAMURA-NEIalgorithm allies), the Genista complex (Genista, Ulex, Teline and allies) and the genus Lupinus which was always distinct, albeit a sister group to the Cytisus-Genista complex. Whereas the Podalyrieae/ Thermopsideae/ Sophora flavescens/ Sophora jaubertii appear in a monophyletic clade in the rbcL dataset (Fig. 2A) which shares ancestry with the Genisteae and Crotalarieae, they are divided into separate units in the ITS

B
153
[ t 3~____{ Lupinusangustifolius 3
9 Lupinus luteus j Lupinus cosentinii l ~ Lupinuspilosus I1 Lupinusprincei - Lupinus aureonitens LA~ Lupinus albescens
I lo
Lupinus polyphyllus I 3 I _ Lupinusnanus 2 Lupinusmutabilis j~ ~ 3 _ Lupinus albus
1
Lupinus paraguariensis - ~ Laburnum anagyroides ] -~ _~
Maximum parsimony
z:
8B_5 Lupinus polyphyllus ~ Lupinus nanus - - Lupinus mutabilis -Lupinus albus Lupinus angustifolius Lupinus luteus [ Lupinus cosentinii i o6 I F - Lupinus pilosus ~-a8 Lupinus princei tL_ --5~'_upinus aureonitens 1ee Lupinus albescens Lupinus paraguariensis Laburnum anagyroides
8~
'.81
Neighbour Joining
Fig. 3 (continued)
data set (which is based on more informative positions; Fig. 2B). The monotypic genus Maackia which clearly belongs to this cluster, assumes various positions which cannot be resolved with certainty (see low bootstrap values), ldrgilia, included either in the PodaIyrieae (POLHILL 1981C) or in the Sophoreae (HUTCHINSON 1964) definitely belongs to the Podalyrieae. Sophorajaponica has recently been reclassified as Styphnolobium japonicum (L.) SCHOTT (PALOMINO al. 1993, SOVSA & RUDD 1993), on the basis of habit, stipels, bracteoles, legume and chromosome numbers which would agree with its isolated position in the molecular trees and being separated from the other Sophoreae at the base of the Papilionoideae.
154 A
Lupinusangustifolius
E. K)~ss & M. WINK:
]
Malacospermae
- I m
Lupinus hispanicus Lupinus luteus
Lupinus micranthus Lupinus albus
Lupinusatlanticus
Lupinus cosentinii
l Scabrispermae
- - - -
Lupinusdigitatus Lupinuspdncei Lupinuspilosus Laburnumanagyroides
Maximum parsimony
Lupinus angustifolius Lupinus hispanicus 93 Lupinusluteus
Malacospermae
Lupinus micranthus 42~_~ Lupinus cosentinii I J I Lupinus digitatus ScabriLupinus princei spermae 58 ] L Lupinus atlanticus I~__I Lupinus albus _ _ Malacospermae _ _ Scabri291 Lupinus pilosus spermae Laburnum anagyroides
[~
r - - 1 0
,801
Neighbour-Joining
Fig. 4. Phylogenetic relationships between Old World lupins based on rbcL (A) or ITS (B) sequence data. A Upper panel MP analysis; strict consensus cladogram of the 5 most parsimonious trees of a branch & bound search (length 22 steps, min/max length 20-32 steps; CI 0.909, HI 0.091, RI 0.833, RC 0.758). Lower panel: NJ-bootstrap analysis using the TAMURA-NEI algorithm. B Upper panel: MP analysis; strict consensus cladogram of the 3 most parsimonious trees of a branch search (length 70 steps, min/max length 64/214 steps; CI 0.914, HI 0.086, RI 0.960, RC 0.878). Lower panel: NJ-bootstrap analysis using the TAMURA-NEI algorithm
Relationships within the genus Lupinus. Phylogenetic relationships in the genus Lupinus (Figs. 3-5) were constructed using Laburnum anagyroicles as an outgroup. Laburnum, belonging to the Genisteae, was chosen because both its rbcL and ITS sequences show very few autapomorphies thus minimizing homoplasy. Since the complete data set oflupins is very complex, subsets were chosen which are illustrated and compared in the following. The first trees provide an overview over the

B
2
155
Lupinus a/bus I Lupinus atbus II Lupinus micranthus
Malacospermae
Lupinus angustifolius 1 Lupinus hispanicus Lupinus luteus Lupinus atlanticus Lupinus digitatus Lupinus princei
23
3[-2
, 1
5.
[__
1
ScabrF spermae
Lupinus pflosus Lupinus cosentinii Laburnum anagyroides
Maximum parsimony
97 ~_u~in,sM/busI
5~
Lupinus a/bus 11 Lupinus micranthus Lupinus angustifolius Lupinus hispanicus Lupinus luteus U kupinus atlanticus 7-61611 Lupinus dlgitatus l ~[ Lupinus princei
tog
Malacospermae
lL27o2'22
Scabrispermae
q ,91
Neighbour-Joining
Fig. 4 (continued) geographical groups, i.e. Old and New World lupins (Fig 2A, B), whereas the other trees analyse the phylogeny of different subgroups in more detail (Figs. 4, 5). Disjunction of Old and New World lupins. Although only few informative (11)/ variable (23) positions are available for analysis in the rbcL dataset (Fig. 3A), tree topology in the ITS tree (based on 32 informative/70 variable positions; Fig. 3B) is almost congruent. Whereas South and North American lupins occur in clearly separated clades, Old World lupins show phylogenetic relationships with either group of New World lupins (Fig. 3A, B); three major evolutionary lines become visible: (1) The South American species of the "Atlantic region", i.e. eastern South America (PLANCHUELO 1984). (2) The rough-seeded Old World lupins (L. cosentinii, L. princei, L. pilosus) probably sharing common ancestory with the South American lupins of the Atlantic region.
156
E. KXss & M. WINI{:

Lupinuspolyphyllus 1 Lupinus albifrons - J - ~ Lupinuslatifolius 2 Lupinusarboreus Lupinusarcticus Lupinusnootkatensis bogotens s 2i Lupinus nanus Lupinusperennis Lupinus Lupinusmutablis Lupinusdensiflorus 4 1 ] ~ Lupinus microcarpus Laburnumanagyroides
24
B
2 1
Lupinuspolyphyllus Lupinusarcticus Lupinusargenteus Lupinusnootkatensis Lupinusperennis Lupinusalbifrons Lupinusarboreus
1
3 1
[__
7 1
Lupinuspubescens Lupinusaschenbomfi Lupinusformosus Lupinuslatifolius Lupinusnanus Lupinus polycarpus Lupinus rivulafis Lupinussucculentus Lupinusdensiflorus Lupinusmicrocarpus Lupinusbogotensis Lupinuscruckshanskfi Lupinusmutabifis Lupinusbenthamii
Lupinus elegans
Maximum parsimony
Maximum parsimony
Lupinuspolyphyllus Lupinus argenteus I Lupinus nootkatensis t Lupinusperennis I Lupinusarcticus I I Lupinusaschenbornii Lupinus elegans I l Lupinuspubescens 4~ Lupinus albifrons 21 .~-- Lupinus formosus =~Lupinus arboreus ~Lupinusrivularis s_~TLupinussucculentus Lupinus densiflorus L Lupinus microcarpus _~BLupinusbogotensis Lupinus cru_ckshanskii Lupinus mutabilis - Lupinus latifolius Lupinus nanus 7~ L~ Lupinuspotycarpus Lupinus benthamii Laburnumanagyroides e'
,
.~
Lupinus polxohyllus Lupinus arcticus 57 Lupinus nanus Lupinus perennis 6o Lupinus nootkatensis Lupinus arboreus Lupinus albifrons Lupinus latifolius Lupinus bogotensis ? Lupinus mutabilis Lupinus densiflorus 99 Lupinus microcarpus Laburnum anagyroides @
r - -
1.881
Neighbour-Joining
Neighbour-Joining
Fig. 5. Phylogenetic relationships between New World lupins (North, Central and South America (Andean region) based on rbcL (A) and ITS (B) sequence data. A Upper panel: MP analysis, phylogram of the single most parsimonious trees of a branch & bound search (length 23 steps, min/max length 21-53 steps; CI 0.913, HI 0.087, RI 0.938, RC 0.856). Lower panel: N J-bootstrap analysis using the TAMURA-NEIalgorithm. B Upper panel: MP analysis; strict consensus cladogram of the 25 most parsimonious trees of a branch & bound search (length 53 steps, min/max length 47-95 steps; CI 0.887, HI 0.113, RI 0.875, RC 0.776). Lower panel: N J-bootstrap analysis using the TAMURA-NEI algorithm
(3) The third line in all trees contain L. angustifolius and L. luteus from the Old World, North American species (L. polyphyllus, L. nanus) and South American species (L. mutabilis) of western distribution (i.e. the "Andean region"; PLANCHt~LO 1984). A major difference was encountered for the position of the smooth-seeded L. albus: In the rbcL trees (Fig. 3A) L. albus stands apart from the other Malaco-
157
spermae (L. angustifolius and L. luteus) albeit the number of base substitutions show its distinctness from the Scabrispermae. In the more informative ITS trees (Fig. 3B) L. albus clearly clusters with the Malacospermae but again it is well separated. Relationships within Old World lupins. In the following analyses, we have tried to reconstruct the phylogeny of lupins within geographic groups. The phylogenetic trees based on rbcL and ITS data covering the Old World Lupinus species (Fig. 4A, B) support the taxonomic separation oflupins in rough- and smooth-seeded species. Whereas the rough-seeded lupins appear to be closely related, the smooth-seeded taxa form a rather heterogeneous assemblage. Three lines are apparent: (1) The Scabrispermae (L. cosentinii, L. digitatus, L. princei, L. atlanticus, L. piIosus), which do not show much variability, are supported as a distinct group by both base substitutions and bootstrap values in the ITS data set (Fig. 4B). (2) The smooth-seeded group of L. angustiJblius, L. hispanicus and L. luteus. (3) The smooth-seeded L. albus and L. micranthus which share morphological and chemical traits (e.g., patterns of quinolizidine alkaloids; WINK & al. 1995), are clustered in a common clade in ITS trees (Fig. 4B), whereas in rbcL-trees (Fig. 4A) they are separated and even positioned in the rough-seeded lupin clade. This discrepancy can be explained by the fact that only few characters are left in the rbcL data set (14 informative/20 variable positions) as compared to the higher number of informative (32)/variable (70) characters in the ITS dataset. In consequence, we assume that the ITS-data set is more reliable. The difference between L. albus I and II in the ITS data set correlates with the distinction of two subspecies L. albus subsp. albus and L. albus subsp, graecus. Relationships in New World lupins. In contrast to the twelve Mediterranean/African Lupinus species some hundred American species, often of doubtful taxonomic relevance, have been described. In the rbcL trees of North American and South American lupins of western distribution (L. mutabilis, L. bogotensis, L. microcarpus) again only few characters are available for an analysis (8 informative/ 20 variable characters; Fig. 5A). Nevertheless a few clades become apparent; e.g., L. microcarpus/L, densiflorus (equivalent to the "microcarpi"-group of SMITH(1944) or "platycarpos"-group of WATSON1873, which also share a particular alkaloid pattern in that both taxa accumulate alpha-pyridone alkaloids; WINK & al. 1995), the South American L. mutabilis and L. bogotensis and the L. perennis/L, nootkatensis/ L. arboreus/L, polyphyllus complex of perennial lupins with related alkaloid profiles. A better differentiation of these taxa is achieved in the ITS data set (consisting of 24 informative/51 variable characters); still many of the furcations are supported by single base substitution only (Fig. 5B): Again L. microcarpus/L, densiflorus (plus L. succulentus), furthermore the South American L. mutabilis/L, cruckshanskii/L. bogotensis and the annual species L. nanus/L, polycarpus (equivalent to the "micranthi"-group of SMITH 1944) form reproducible and morphologically supported subgroups. Three other clades (which are less well supported) include (a) mainly shrubby species (L. albifrons, L. arboreus, L. rivularis) or (b) species of Central or northern South American origin (L. aschenbornii, L. elegans, L. pubescens) and (c) the perennial L. polyphyllus, L. arcticus, L. perennis and L. nootkatensis which did not show any interspecific variability (Fig. 5A, B). As mentioned above, the South
158
E. KASS& M. WINK:
American lupins of easterly distribution (i.e.L. aureonitens, L. albescens and L. paraguariensis) represent a distinct evolutionary line and are not closely connected to the other New World lupins (Fig. 3).
Discussion
In general, trees based on rbcL and ITS sequence data and studied by both NJ and M P (Figs. 2-5) show a high degree of congruence, indicating that the conclusions drawn from clades which are identical in all reconstructions are well supported. Differences between data sets can be due to homoplasies but also to reticulate evolution inside a genus caused by past hybridizations. Since bootstrap values supporting divergent branches in rbcL as compared to ITS trees were usually small, we omitted a detailed discussion in most instances. Evolution from Sophora to Lupinus. Part of the Sophoreae appear at the base of the Papilionoideae and some of the basal taxa already show very elaborate papilionoid features (e.g., Styphnolobium japonicum). Molecular data imply that the Sophoreae and also the genus Sophora do not represent natural groups, but an artificial assemblage. This was also revealed in an analysis based on rbcL data covering a wider range of taxa of the Papilionoideae (KXss & WINK 1995, 1996). The next cluster branching off the evolutionary line leading to lupins contains members of Sophoreae, Podalyrieae and Thermopsideae. The genetic data do not confirm that Thermopsis or other "woody temperate Thermopsideae, (PLITMANN1981) were direct ancestors of the Genisteae though they obviously share ancestry. Sero-systematic surveys came to a similar conclusion for the relationships between the Sophoreae/Thermopsideae/Genisteae (CmSTOVOLIM & CHIAPELLA 1984; CRISTOFOLINI1987), although the stringency and resolution of the sequence data was not achieved. Genisteae and Crotalarieae, which figure as sister groups, are the most advanced groups and a direct evolution from sophoroid ancestors can be excluded. Although Genisteae and Crotalarieae derived from the same ancestral line, the number of nucleotide substitutions imply that it is unlikely that CrotaIaria is ancestral to Lupinus as suggested by DtrNN (1984). POLHILL (1981a) assumed that the morphological resemblence of genera of these tribes was due to convergence and considered Thermopsideae/Genisteae and Podalyrieae/Liparieae/Crotalarieae as distinct independent evolutionary lines, a view that is not supported by the present molecular data. The taxonomic rank of Lupinus and the Genisteae seems to be best described by BISBY (1981; based on the tribal definition of POLHILL 1976), who assigned subtribus rank to Lupinus and grouped the rest of the Genisteae without a further tribal subdivision. Both our data sets lead to the conclusion that Genisteae are a natural monophyletic group that includes Lupinus. A contradictory conclusion was recently drawn from RFLP data of cpDNA (BADR & al. 1994), which might be due to an uneven taxon sampling. Better correlated again are serological studies that suggested a monophyletic origin of Lupinus and a close relationship with Genisteae (CRISTOFOLINI 1989). Evolution and phylogeography of the Lupinuscomplex. The marked differences between rough- and smooth-seeded lupins, which are evident from molecular data,
159
can be found in serological (CRISTOFOLINI 1989), protein (SALMANOWICZ & PRZYBYLSKA 1994, SALMANOWICZ 1995) and flavonoid data (WILLIAMS & al. 1983). However, quinolizidine alkaloids do not allow such an unambiguous classification (Fig. 6) (WINK & al. 1995); e.g., the bicyclic lupinine or multiflorine-type alkaloids (which occur in a limited number of taxa only) are the major alkaloids of the rough-seeded lupins, but also occur in smooth-seeded species, such as L. luteus and in some North and South American species. Molecular data clearly show that the rough-seeded lupins (Scabrispermae) are closely related and do not detect a closer relatedness of the subgroups L. atlanticus, L. digitatus and L. cosentinii (CARSTAIRS al. 1992) nor of L. digitatus and L. & cosentinii (SALMANOWICZ PRZYBYLSKA1994, SALMANOWICZ1995). The surveys 8~; based on alkaloids (CARSTAIRS 1992, WINK & al. 1995), flavonoid (WILLIAMS& al. 1983) and protein data (SALMANOWICZ PRZYBYLSKA1994, SALMANOW1CZ1995) & also support the uniformness of this group. PLITMANN (1981) assumed that the differences between rough-seeded species are mainly quantitative. As the roughseeded species do not grow sympatrically, it might be suggested that they are geographically isolated forms of one species and might as well be regarded as subspecies (as in "Flora Europaea", AMARAL FRANCO PINTO DA SILVA 1968), although their genetic distances, chromosome data and crossing behaviour indicate species status (CARSTAIRS al. 1992). The rough-seeded species were thought to be & ancestral to North American species when flavonoid patterns were evaluated (WILLIAMS& al. 1983, PLITMANN& HEYN 1984). However, molecular data indicate that they have diverged prior to the evolution of North American species (Fig. 3), and that a relationship exists with South American lupins of easterly distribution ("atlantic group"). As already stated, the smooth-seeded species are far more heterogeneous than the rough-seeded ones. The close relationship ofL. luteus and L. hispanicus was never questioned (PLITMANN1981), but L. angustifolius has to be included in this group according to molecular data and flavonoid pattern (WILLIAMS& al. 1983) but not to alkaloid data (Fig. 6). Some phylogenetic reconstructions (Fig. 4) imply that L. albus and L. rnicranthus are genetically related, albeit not very closely. Also their alkaloid patterns show similarities; both taxa contain alkaloids of the multiflorine series (WINK ~; al. 1995), but their flavonoid pattern differ (WILLIAMS & al. 1983). Genetically, L. micranthus differs most from all other Old World lupins, confirming serological data (CRISTOVOLIN~1989). Seed characters and alkaloid data (PLITMANN 1981, PLITMANN& PAZY 1984) implied that the smooth-seeded Old World lupins (especially L. angustifolius) are closer connected to the North American than to other Old World lupins, a view that is corroborated by our molecular data (Figs. 3, 4). Only part of the American lupins have been covered by our present study; but if the results of both datasets are combined at least three groups of New World lupins are apparent; (1) the South American species of eastern origin (Atlantic region), (2) the North American species and South American species of western distribution (Andean region) and (3) possibly the "microcarpi" ("platycarpos") group with L. microcarpus of North and South American distribution. The surveys of WATSON (1873) and SMITH(1944) differ because WATSONonly considered qualitative differences to establish groups (i.e. the small number of ovules or the joint cotyledons in his "platycarpos" group), while SMITH preferred a very thorough grouping based on
160
E. KASS& M. WINK:
quantitative differences. However, the authors agree in the "microcarpi/platycarpos" group which is also clearly defined in the molecular trees (Fig. 5). While WATSON (1873) did not further subdivide the North American species, some groups of SMITH (1944) are also confirmed by molecular data (like the "micranthi" -group), while others (like the "arborei"-group) are not well supported. Neither flavonoid data (NICHOLLS& BOHM 1983) nor alkaloid data (Fig. 6) provide a better resolution. Serological data agree in so far as no marked difference between annual and perennial species were found (CRISTOFOLINI 1989). Members of the Cytisus and Genista complex (plus allies) are Old World species. Considering the position of lupins in the phylogenetic trees (Figs. 2, 3) we conclude that ancestors oflupins also had an Old World distribution and that the New World lupins derived from them. The existence of distinct evolutionary lines (Fig. 3) and the genetic distances (Tables 2, 3) imply that lupins must have reached North and South America independently from their Old World origin, whereas a North American origin or a South American origin directly from Sophoreae or Crotalarieae is less likely. The close connection between North American lupins and South American taxa of the Andes, suggests a migration from North to South America. Although a close connection between rough-seeded Old World species and South American lupins ("Atlantic region") has not been suggested before, phytochemical data provide some additional evidence: Multiflorine and derivatives are abundant in the atlantic South American species (e.g., L. albescens) and in the rough-seeded species plus L. albus and L. micranthus of Old World distribution, but are not accumulated to any substantial degree in North American species (W~NK & al. 1995). While a migration via the Bering street could have been one way for the European species to reach North America until recent times (correlating well with a divergence time of about 3-4 mio years; Table 4), it is not certain how the Old World lupins could have reached atlantic South America. Assuming that the calibration of the "molecular clock" (Table 4) is reliable, theories that explain the present distribution with plate tectonics cannot be correct. At the time the Papilionoideae and lupins evolved (Table 4), the continents had already been separated for a long time. Either land bridges connected the continents for a much longer period, or other means like storms, water or animals ("long range dispersal"; DUNN
Table 4. Divergence times (mio years) between different groups of PapiIionoideae based on ITS 1 + 2 sequences (see Table 3) Taxon
Lupinus: Old World and North American species Lupinus: Scabrispermae and Malacospermae Lupinus of eastern regions of South America and Scabrispermae Lupinus and Genisteae Genisteae and CrotaIarieae Genisteae and Thermopsideae Thermopsideae and Sophoreae
ITS1 ~ 4 ,,~ 6 ~ 8 ~ 14 ,,~ 18 ~ 26 ~ 33
ITS2 ~ ~ ~ ~ ~ ~ ~ 3 5 8 12 16 25 34

97[ -90 ~ [ - [- 97
81
161
Lupinus polyphyllus Lupinus perennis Lupinus mutabilis Lupinus albus Lupinus micranthus Lupinus elegans Lupinus pubescens Lupinus cruckshanskii Lupinus albifrons
75 65
94
Lupinus arboreus Lupinus formosus Lupinus nootkatensis Lupinus argenleus Lupinus densiflorus Lupinus microcarpus Lupinus polycarpus Lupinus arcticus
97 F- I__
I 97 l- I__
52 94
_ 9 ~ - - Lupinushispanicus
68
41
71
87
-
--
Lupinus pilosus Lupinus atlanticus Lupinus digitatus Lupinus albescens Lupinus paraguariensJs Lupinus princei Lupinus cosentinii Lupinus nanus
56
87[
90 65
9o ~ I- -
Lupinus succulentus
94 ~ ]
/I
Lupinus angustifolius Lupinus aureonitens Lupinus latifolius Lupinus luteus
Maximumparsimony
Fig. 6. Dendrogram based on quinolizidine alkaloid pattern of lupins (WINK al. 1995); analysis by maximum parsimony: 50% majority rule consensus cladogram of 100 parsimonious trees of a heuristic closest search (length 231 steps, min/max length 84-392 steps; CI 0.364, HI 0.641, RI 0.523, RC 0.190). The number indicates how often a branch was found in 100 trees 1971) must be responsible for the dispersal of seeds or plants from the Old World to South America. Chemical versus molecular phylogeny. Chemical characters such as the distribution of certain secondary metabolites have been used for cladistic analyses in some recent studies of legume systematics (CRISP & DOYLE 1995). However, since the production of secondary metabolites is important for the fitness of a plant (i.e. they function as defence or signal compounds; WINK 1988, 1992), patterns of secondary metabolites must be regarded as adaptive, especially at a low taxonomic level. The tribes of this survey have always been considered to be related because of the occurrence of quinolizidine alkaloids. As this trait is already developed in the early
162
E. KASS& M. WINK:
Sophoreae the quinolizidine alkaloid producing tribes were regarded as old. However, the genetic data show that Genisteae and Crotalarieae certainly are advanced tribes. Furthermore, a strict survey of alkaloid patterns shows some major exceptions. Not all genera of the Podalyrieae and Crotalarieae accumulate quinolizidine alkaloids and most importantly, CrotaIaria which produces pyrrolizidine instead of quinolizidine alkaloids, would be excluded from this evolutionary line if the occurrence of these chemical compounds would be evaluated in a strict cladistic way. To illustrate the limited value of alkaloid pattern as a taxonomic marker, we employed the alkaloid analysis of WINK & al. (1995) to create a data matrix of quinolizidine alkaloids. Individual quinolizidine alkaloids were counted as present or absent in this matrix. The resulting 50% majority rule consensus of a m a x i m u m parsimony analysis (Fig. 6) reveals only few phylogenetically meaningful relationships in the genus Lupinus; the rough seeded lupins are more or less recognized as a group because of their consistent pattern of multiflorine-type alkaloids. If a strict consensus was employed, all branches collapsed and no information remained. A recent analysis that combined molecular data (RFLP-pattern) of lupins with the "evolution" of quinolizidine alkaloid patterns (YAMAZAKI 8 al. 1993) was equally unsuccessful.
This work was supported by the Deutsche Forschungsgemeinschaft (SPP Molekulare Grundlagen der Evolution bei Pflanzen; Wi 719/8-1,2). For plant and seed material of Lupinus we are indebted to ANA PLANCHUELO, BEVAN BUIRCHELL and to several seed collections and Botanical Gardens as indicated in Table 1).
References
AGARDH, C., 1835: Synopsis generls Lupini.- Lund: Berling. AMARAL, FRANCO, J. DO, PINTO DA SILVA, A.R., 1968: Lupinus L . - I n TUTIN, T. G.,
HEYWOOD,V. H., BURGES,N. A., MOORE,D. M., VALENTINE, H., WALTERS,S. M., WEBB, D. D. A., (Eds): Flora Europaea, 2, pp. 105-106.- Cambridge: Cambridge University Press. BADR, A., MARTIN, W., JENSEN,U., 1994: Chloroplast restriction site polymorphism in Genisteae (Leguminosae) suggests a common origin for European and American lupines. P1. Syst. Evol. 193: 95-106. BAUM, D., 1994: RbcL and seed-plant phylogeny. - TREE 9: 39-41. BENTHAM,G., 1865: Leguminosae.- In BENTHAM,G., HOOKER,J. D., (Eds): Genera plantarum, 1(2), pp. 434 600. London: Reeve. BISBY, F. A., 1981: Genisteae (ADANS.)BENTH.- In POLHILL, R. M., RAVEN,P. H., (Eds): Advances in legume systematics, 1, pp. 409-425. - Kew: Royal Botanic Gardens. BRUNEAU,A., DOYLE,J. J., 1993: Phylogenetic analysis of chloroplast DNA restriction site characters in Erythrina L. (Phaseoleae: Leguminosae). - Syst. Bot. 18: 229-247. - PALMER, J. D., 1990: A chloroplast DNA inversion as a subtrial character in the Phaseoleae (Leguminosae). - Syst. Bot. 15: 378-386. - DOYLE, J. L., 1995: Phylogenetic relationship in Phaseoleae: evidence from chloroplast DNA restriction site characters. - In CRISP, M., DOYLE, J. J., (Eds): Advances in legume systematics, 7, pp. 309-330. - Kew: Royal Botanic Gardens. BURKART, A., 1952: Las leguminosas Argentinas silvestres y cultivadas. Buenos Aires: Acme Agency. CANDOLLE, A. P., DE, 1825-1827: Prodromus systematics naturalis, 2.-Paris: Treuttel & Wfirtz.
163
CARSTAIRS,S. A., BUIRCHELL,B. J., COWLING,W. A., 1992: Chromosome number, size and
interspecific crossing ability of three Old World lupins, Lupinus princei HARMS, L. atIamicus GLADSTONESand L. digitatus FORSKKL,and implications for cyto-systematic relationships among the rough-seeded lupins. - J. Roy. Soc. Western Australia 75: 83-88. CHASE, M. W., & al., 1993: An analysis of nucleotide sequences from the plastid gene rbcL.- Ann. Missouri Bot. Gard. 80: 528-580. CLEGG, M. T., 1993: Chloroplast gene sequences and the study of plant evolution. Proc. Natl. Acad. Sci. USA 90:363 367. CRANMER, M. F., TURNER, B. L., 1967: Systematic significance of lupine alkaloids with particular reference to Baptisia (Leguminosae).- Evolution 21: 508-517. CRISP, M. D., DOYLE,J. J., 1995: Advances in legume systematics. 7. - Kew: Royal Botanic Gardens. CRISTOFOLINI,G., 1987: Serological relationships among Sophoreae, Yhermopsideae and Genisteae (Fabaceae). Bot. J. Linn. Soc. 94:421 432. - 1989: A serological contribution to the systematics of the genus Lupinus (Fabaceae). - P1. Syst. Evol. 166: 265-278. CHIAPELLA,L. F., 1977: Serological systematics of the tribe Genisteae (Fabaceae). - Taxon 26: 43-56. 1984: Origin and diversification of Genisteae (Fabaceae): a serosystematic purview. Webbia 38: 105-122. DELGADO-SALINAS,A., BRUNEAU, A., DOYLE, J. J., 1993: Chloroplast DNA phylogenetic studies in the New World PhaseoIinae (Leguminosae: Papilionoideae: Phaseoleae). - Syst. Bot. 18:6 17. DONOGI-IUE, M. J., 1994: Progress and prospects in reconstructing plant phylogeny. Ann. Missouri Bot. Gard. 81: 405-418. DOYLE,J. J., 1993: DNA, phylogeny and the flowering of plant systematics.- BioScience 43: 380-389. 1994: Phylogeny of the legume family: an approach to understanding the origins of nodulation.- Annual Rev. Ecol. Syst. 25: 325-349. 1995: DNA data and legume phylogeny: a progress report. - In CRISP, M., DOYLE,J. J., (Eds): Advances in legume systematics, 7, pp. 11-13.- Kew: Royal Botanic Gardens. DOYLE, J. L., 1990: Isolation of plant DNA from fresh tissue.- Focus 12: 13-15. - 1993: Chloroplast DNA phylogeny of the papilionoid legume tribe Phaseoleae.-Syst. Bot. 18:309 327. LAVIN,M., BRUNEAU,A., 1992: Contributions of molecular data to papilionoid legume systematics. - In SOLTIS,P. S., SOLTIS,D. E., DOYLE,J. J., (Eds): Molecular systematics of plants, pp. 223-251.-New York: Chapman & Hall. DUNN, D. B., 1971: A case of long range dispersal and "rapid speciation" in Lupinus. -Trans. Missouri Acad. Sci. 5: 26-38. 1984: Genetic resources: cytotaxonomy and distribution of new world lupin species. - In Proceedings of the Third International Lupin Conference, pp. 68-85.- La Rochelle: International Lupin Association. - GILLETT,J. M., 1966: The lupines of Canada and Alaska. Canada Department of Agriculture, Monograph 2. - Ottawa: Queen's Printer. FAUGERAS,G., PARIS, R., 1971: Nouvelles recherches phytochimiques sur les Papilionac6esG6nist6es d'Europe. - Boissiera 19: 201-218. FELSENSTEIN, J., 1988: Phylogenies from molecular sequences: inference and reliability.Annual Rev. Genet. 22: 521-565. GAMS,H., 1923-1924: Leguminosae. - In HEGI,G., (Ed.): Illustrierte Flora yon Mitteleuropa 4(3), pp. 1113-1644. - Wien: Pichler.
164
E. K)iss & M. WINK:
GraBS, P. E., 1966: A revision of the genus Genista L. - Notes Roy. Bot. Gard. Edinburgh 27:
1 1 - 9 9 .
GLADSTONES,J. S., 1974: Lupins of the Mediterranean region and Africa. - Techn. Bull. Dept. Agric. Western Australia 26: 1-48. GOLDBLATT, P., 1981: Cytology and the phylogeny of Leguminosae.-In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 427-463.- Kew: Royal Botanic Gardens. GOMES, C. M. R., GOTTLIEB, 0. R., GOTTILEB, R. G., SALATINOA., 1981: Phytochemistry in perspective: chemosystematics of the Papilionoideae. - In POL~IILL,R. M., RAVEN,P. H., (Eds): Advances in legume systematics, 1, pp. 409 425. - Kew: Royal Botanic Gardens. GROSS, R., 1984: First Reinhold yon Sengbusch memorial lecture: Lupins in the Old and New w o r l d - a biological-cultural coevolution.- In: Proceedings of the Third International Lupin Conference, pp. 244-277.- Rochelle: International Lupin Association. HAMBY, R. K., ZIMMER, E. A., 1992: Ribosomal RNA as a phylogenetic tool in plant systematics.- In SOLTIS,P. S., SOLTIS,D. E., DOYLE,J. J., (Eds): Molecular systematics of plants, pp. 50-91. - New York: Chapman & Hall. HANELT,P., 1960: Die Lupinen. - Wittenberg: Ziemsen. HARBORNE,J. B., 1969: Chemosystematics of the Leguminosae. Flavonoid and isoflavonoid patterns in the tribe Genisteae. - Phytochemistry 8: 1449-1456. 1971: Distribution of flavonoids in the Leguminosae.- In HARBORNE,J. B., BOULTER,D., TURNER, B. L., (Eds): Chemotaxonomy of the Leguminosae, pp. 31-67.- London: Academic Press. - BOULTER, TURNER,B. L., (Eds), 1971: Chemotaxonomy of the Leguminosae. - London: D., Academic Press. HEGNAUEP,,R., 1994: Chemotaxonomie der Pflanzen, lla, Leguminosae. Basel: Birkh/iuser. HERENDEEN,P. S., CREPET,W. L., DILCHER,D. L., 1992: The fossil history of the Leguminosae: phylogenetic and biogeographic implications.- In HERENDEEN, P. S., DILCI~R, D. L., (Eds): Advances in legume systematics, 4, pp. 303-316. - Kew: Royal Botanical Gardens. HILLIS, D. M., DIXON, M. T., 1991: Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Rev. Biol. 66: 411-453. HUELSENBECK,J. P., 1992: Signal, noise, and reliability in molecular phylogenetic analyses.- J. Hered. 83: 189-195. HITCHCOCK,C. L., CRONQUIST,A., OWNBEY,M., THOMPSON,J. W., 1961: Vascular plants of the Pacific Northwest. 3. - Seattle: University of Washington Press. HOENEISEN,M., SILVA,M., WIN~, M., CRAWFORD,D. J., STUESSY,T., 1993: Alkaloids of Sophora of Juan Fernandez islands and related taxa. Bol. Soc. Chilena Quimica 38: 167-171. HOLUBOVA-KLASKOVA, 1964: Bemerkungen zur Gliederung der Gattung Cytisus L. s.1. A., Acta Univ. Carol. Biol., Suppl. 2:1 24. HONDELMANN,W., 1996: Die Lupine: Geschichte und Evolution einer Kulturpflanze. - Wiss. Mitt. FAL Braunschweig-V61kenrode, Special issue 162. HUTCHINSON,J., 1964: The genera of flowering plants. 1. - London: Oxford University Press. KXss, E., 1995: Molekulare Phylogenie der Schmetterlingsblfitler (Familie Leguminosae).Ph.D Thesis, University of Heidelberg. WINK, M., 1992: rbcL sequences from lupins and other legume species. - P1. Molec. Evol. Newslett. 2: 21-26. 1994: Molecular phylogeny of lupins. - In MARTINS,J. M. N., BEIRAODA COSTA, M. L., (Eds): Advances in lupin research. Proceedings of the 7th International Lupin Conference, Evora, Portugal, pp. 267-270. Lisbon: ISA Press. 1995: Molecular phylogeny of the Papilionoideae (family Leguminosae): RbcL gene sequences versus chemical taxonomy. - Bot. Acta 108: 149-162.
-

-
165
1996: Molecular evolution of the Leguminosae: Phylogeny of the three subfamilies based on rbcL-sequences.- Biochem. Syst. Ecol. 24:365 378. KAZIMIERSKI,T., NOWACKI,E., 1961: Lupins of the Old World. - Genet. Polon. 2:113 118. KIMURA, M., 1980: A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Molec. Evol. 16: 121-147. KINGHORN, A. D., SMOLENSKI,S. J., 1981: Alkaloids of Papilionoideae.- In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 2, pp. 585-598.-Kew: Royal Botanic Gardens. - BALANDRIN, M. F., 1984: Quinolizidine alkaloids of the Leguminosae: structural types, analysis, chemotaxonomy, and biological activities. - In PELLETIER,E. S., (Ed.): Alkaloids: chemical and biological perspectives, pp. 105-148.- New York: Wiley. KUMAR, S., TAMURA,K., NEI, M., 1993: MEGA molecular evolutionary genetics analysis, version 1.0. - Pennsylvania State University. LAVIN, M., DOYLE, J. J., PALMER,J. D., 1990: Evolutionary significance of the loss of the chloroplast-DNA inverted repeat in the Leguminosae subfamily Papilionoideae.- Evolution 44: 390-402. MADDISON, W. P., MADDISON,D. R., 1992: MacClade: analysis of phylogeny and character evolution, version 3.0.- Sunderland: Sinauer. MEARS, J. A., MABRY, T. J., 1971: Alkaloids in the Leguminosae.-In HARBORNE,J. B., BO~JLTER,D., TURNER, B. L., (Eds): Chemotaxonomy of the Leguminosae, pp. 83-168. London: Academic Press. NICHOLLS, K. W., BOHM, B. A., 1983: Flavonoids and affinities of some North American lupines. Canad. J. Bot. 61: 708-730. NOWACKI, E., JAWORSKI, A., 1978: A study on the evolution of the genus Lupinus by serological methods. - Genet. Polon. 5:47-56 OLMSTEAD,R. G., PALMER,J. D., 1994: Chloroplast DNA systematics: a review of methods and data analysis. - Amer. J. Bot. 81: 1205-1224. PALMER,J. D., SINGH,G. P., PILLAY,D. Y. N., 1983: Structure and sequence evolution of three legume chloroplast DNAs. Molec. Gen. Genet. 190: 13-19. - ALDRICH,J., THOMPSON,W. F., 1987: Chloroplast DNA evolution among legumes: loss of a large inverted repeat occurred prior to other sequence rearrangements.- Curr. Genet. 11: 275-286. THOMPSON,W. F., 1988: Evolutionary significance of inversions in legume chloroplast D N A s . - Curt. Genet. 14: 65-74. PALOMINO, G., MARTINEZ, P., BERNAL, C., SOUSA, S. M., 1993: Chromosomal differences among some species of the genus Sophora L. and Styphnolobium SCUOTT.- Ann. Missouri Bot. Gard. 80: 284-290. PHILLIVS, L. L., 1955: A revision of the perennial species of Lupinus of North America exclusive of Southwestern United States. Res. Stud. State Coll. Wash. 23: 161-201. 1957: Chromosome numbers in Lupinus.- Madrofio 14: 30-36. PLANCHUELO, A.M., 1982: Literature review of the genus Lupinus. Lupine Newslett. 4: 37-39. 1984: Taxonomic studies of Lupinus in South America.- In: Proceedings of the Third International Lupin Conference, pp. 39-54.- La Rochelle: International Lupin Association. D~NN, D. B., 1984: The simple leaved lupines and their relatives in Argentina.- Ann. Missouri Bot. Gard. 71: 92-103. PLITMANN, U., 1981: Evolutionary history of the Old World lupines.- Taxon 30: 430-437. HEYN, C. C., 1984: Old World lupins: taxonomy, evolutionary relationships, and links with New World species. - In: Proceedings of the Third International Lupin Conference, pp. 56-66.- La Rochelle: International Lupin Association.
-
166
E. K)~ss & M. WINK:
- PAZY, B., 1984: Cytogeographical distribution of Old world Lupinus. - Webbia 38: 531-
539. POLHILL,R. M., 1976: Genisteae (ADANS.)BENTH.and related tribes. - Bot. Syst. 1:143 380. - 1981a: Papilionoideae.- In POLmLL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics. 1, pp. 191-205.- Kew: Royal Botanic Gardens. - 1981b: Crotalarieae.-In POLnlLL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics. 1, pp. 399-402. - Kew: Royal Botanic Gardens. - 1981c: Podalyrieae.-In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics. 1, pp. 396-397. - Kew: Royal Botanic Gardens. RAVEN, P. H., (Eds), 1981: Advances in legume systematics. 1 & 2 . - Kew: Royal Botanic Gardens. RAVEN,P. H., POLItlLL, R. M., 1981: Biogeography of the Leguminosae.- In POLHILL,R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 409-425.-Kew: Royal Botanic Gardens. RIGGINS, R., SHOLARS, T., 1993: Lupinus.- In HICKMAN,J. C., (Ed.): The Japson Manual, higher plants of California, pp. 622-636. - Berkeley: University of California Press. ROTHMALER,W., 1944: Die Gliederung der Gattung Cytisus L. Feddes Repert. 53: 137-150. SALATINO,A., GOTTLIEB,O. R., 1980: Quinolizidine alkaloids as systematic markers of the Papilionoideae.- Biochem. Syst. Ecol. 8: 133-147. - 1981: Quinolizidine alkaloids as systematic markers of the Genisteae.-Biochem. Syst. Ecol. 9: 267-273. 1983: Chemogeographical evolution of quinolizidines in PapiIionoideae. P1. Syst. Evol. 143: 167-174. SALMANOW~CZ,B. P., 1995: Comparative study of seed albumins in the old-World Lupinus species (Fabaceae) by reversed-phase HPLC. - P1. Syst. Evol. 195: 77-86. PRZYBYLSKA, J., 1994: Electrophoretic patterns of seed albumins in the Old-World Lupinus species (Fabaceae): variation in the 2S albumin class. - P1. Syst. Evol. 192:67 78. SANGER, F., NICKLEN, S., COULSON,A. R., 1977: DNA sequencing with chain-terminating inhibitors.- Proc. Natl. Acad. Sci. USA 74:5463 5467. SANUDO, A., 1979: Chromosome variability in the Genisteae (ADAMS.) BENTH. (Leguminosae). - Webbia 34: 363-408. SARICH, V. M., WILSON,A. C., 1973: Generation time and genome evolution in primates.Science 179:1144-1147. SMITH, C. P., 1917 1938: Species Lupinorum. - California: Saratoga. - 1944: Lupinus.- In ABRAMS,L., (Ed.): Illustrated Flora of the Pacific states, 2, pp. 483519.- Stanford University: Stanford University Press. SOLTIS,P. S., SOLTIS,D. E., DOYLE,J. J., 1992: Molecular systematics of plants. - N e w York: Chapman & Hall. SOUSA, S. M., RUDD, V. E., 1993: Revision of the genus Styphnolobium (Leguminosae, Papilionoideae, Sophoreae). - Ann. Missouri Bot. Gard. 80: 270-283. SWOFFORD, D. L., 1993: PAUP: phylogenetic analysis using parsimony, version 3.1.1. Computer program distributed by the Illinois Natural History Survey, Champaign, Illinois. TAUBERT, P., 1894: Leguminosae.-In ENGLER, A., PRANTL, K., (Eds): Die nattirlichen Pftanzenfamilien, 3(3), pp. 70-396. - Leipzig: Engelmann. TURNER, B. L., 1981: Thermopsideae.- In POLmLL, R. M., RAVEN,P. H., (Eds): Advances in legume systematics, 1, pp. 403-408. Kew: Royal Botanic Gardens. WATSON, S., 1873: Revision of the extra-tropical North American species of the genera Lupinus, Potentilla and Oenothera.- Proc. Amer. Acad. Arts 8: 517-618.
-
167
WILLIAMS,C. A., DEMISSIE,A., HARBORNE,J. B., 1983: Flavonoids as taxonomic markers in Old World Lupinus species.- Biochem. Syst. Ecol. 11:221-231. WINK, M., 1988: Plant breeding: importance of plant secondary metabolites for protection against pathogens and herbivors. Theor. Appl. Genet. 75: 225-233. 1992: The role of quinolizidine alkaloids in plant insect interactions. In BERNAYS,E. A., (Ed.): Insect plant interactions, 4, pp. 131 166. Boca Raton: IRC Press. - 1993: Quinolizidine alkaloids. - In WATERMAN,P., (Ed.): Methods in plant biochemistry, 8, pp. 197 239. - London: Academic Press. - WITTE, L., 1983: Evidence for a wide-spread occurrence of the genes of quinolizidine alkaloid biosynthesis.- FEBS Lett. 159:196 200. - KKss, E., KAUFMANN,M., 1993: Molecular versus chemical taxonomy. - In NAHRSTEDT, A., (Ed.): Society for Medical Plant Research, 41st congress, pp. 17-18. - Stuttgart: Thieme. - MEISSNER,C., WITTE, L., 1995: Patterns ofquinolizidine alkaloids in 56 species of the genus Lupinus. - Phytochemistry 38:139-153. WOJCIECtlOWSKI, M. F., SANDERSON,M. J., BALDWIN, B. G., DONOGHUE, M. J., 1993: Monophyly of aneuploid Astraoalus (Fabaceae): evidence from nuclear ribosomal DNA internal transcribed spacer sequences.- Amer. J. Bot. 80: 711-722. YAMAZAKI, M., SATO, A., SAITO, K., MURAKOSHI,I., 1993: Molecular phylogeny based on R F L P and its relation with alkaloid patterns in Lupinus plants. - Biol. Pharm. Bull. 16: 1182-1184. Address of the authors: Dr ERNST KXSS, Prof. Dr MICHAEL WINK (correspondence), Institut ffir Pharmazeutische Biologie, Universit/it Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg, Germany. Accepted August 12, 1996 by F. EHRENDORFER

Molecular Phylogeny and Phylogeography of Lupinus (Leguminosae) Inferred From Nucleotide Sequences of The RBCL Gene and ITS 1 + 2 Regions of rDNA

Transféré par

Informations du document

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Molecular Phylogeny and Phylogeography of Lupinus (Leguminosae) Inferred From Nucleotide Sequences of The RBCL Gene and ITS 1 + 2 Regions of rDNA

Transféré par

Droits d'auteur :

Formats disponibles

P1. Syst. Evol.

--Plant Systematics and Evolution

Received May 2, 1996; in revised version August 6, 1996

E. KAss & M. WINCe:

Molecular phylogeny and phylogeography of Lupinus

E. KAss & M. WINK:

Molecular phylogeny and phylogeography of Lupinus

144 Table 1 (continued) Species Origin

E. KXss & M. WINK:

Molecular phylogeny and phylogeography of Lupinus

max. Distance ITS2

,...., ..., ,.....,

E. Kss & M. WINK:

Molecular phylogeny and phylogeography of Lupinus

crotalarieae Thermopstcieae Podafyrieae

Crotalarieae Podalyrieae Thermopsideae Sophoreae Ce~ideae (Caesa~mio~eae)

Molecular phylogeny and phylogeography of Lupinus

Crotalarieae Podalyrieae Thermopsideae Sophoreae _ _

sgr- Lupinus polyphyllus

Crotalarieae Podalyfieae Thennopsideae Sophoreae __ Cercideae ( Caesalpinioideae)

E. K)~ss & M. W~NK:

Molecular phylogeny and phylogeography of Lupinus

30 29 31 31 31 41 49 46 47 60 53 53 59 65 64 86 88 75 78 95 102 I04 100 119 164

E. KXss & M. WINK:

-J-~ Lupinus princei Lupinus pilosus

lr_~ Lupinus albescens

Old World Species (Mediterranean region and North Africa)

Lupinus aureonitens Laburnum anagyroides

--1 New World Species (Eastern regions of South America)

Lupinus polyphyllus Lupinus nanus

Old World Species (Mediterranean region and North Africa)

New World Species (Eastern regions of South America)

Molecular phylogeny and phylogeography of Lupinus

Lupinus polyphyllus I 3 I _ Lupinusnanus 2 Lupinusmutabilis j~ ~ 3 _ Lupinus albus

Old World Species (Mediterranean region and North Africa)

New World Species (Eastern regions of South America)

Old World Species (Mediterranean region and North Africa)

New World Species (Eastern regions of South America)

E. K)~ss & M. WINK:

Lupinus hispanicus Lupinus luteus

Lupinus micranthus Lupinus albus

Lupinusdigitatus Lupinuspdncei Lupinuspilosus Laburnumanagyroides

Molecular phylogeny and phylogeography of Lupinus

Lupinus a/bus I Lupinus atbus II Lupinus micranthus

Lupinus pflosus Lupinus cosentinii Laburnum anagyroides

E. KXss & M. WINI{:

Lupinuspolyphyllus Lupinusarcticus Lupinusargenteus Lupinusnootkatensis Lupinusperennis Lupinusalbifrons Lupinusarboreus

Molecular phylogeny and phylogeography of Lupinus

Molecular phylogeny and phylogeography of Lupinus

ITS1 ~ 4 ,,~ 6 ~ 8 ~ 14 ,,~ 18 ~ 26 ~ 33

Molecular phylogeny and phylogeography of Lupinus

Lupinus angustifolius Lupinus aureonitens Lupinus latifolius Lupinus luteus

Molecular phylogeny and phylogeography of Lupinus

E. K)iss & M. WINK:

Molecular phylogeny and phylogeography of Lupinus

E. K)~ss & M. WINK:

Molecular phylogeny and phylogeography of Lupinus

Vous aimerez peut-être aussi