Vous êtes sur la page 1sur 46

Squence 3

Reproduction conforme de la cellule et rplication de lADN Variabilit gntique et mutation de lADN

Sommaire
1. Reproduction conforme de la cellule et rplication de lADN 2. Variabilit gntique et mutation de lADN Synthse de la squence 3 Exercices de la squence 3 Devoir autocorrectif n 2

Squence 3 SN12

Cned Acadmie en ligne

Reproduction conforme de la cellule et rplication de lADN

Pour sinterroger Le dveloppement dun tre vivant partir dune cellule uf implique des divisions cellulaires et les cellules se diffrencient en types cellulaires spcifiques des organes quelles constituent. LADN, constituant des chromosomes est le support molculaire de linformation gntique contenue dans le noyau. Cette molcule, selon le moment du cycle de vie dune cellule peut se prsenter sous diffrents degrs de condensation (denroulement). Tantt dcondens, lADN forme la chromatine diffuse ; tantt condens il forme un chromosome visible au microscope

Document 1

Une mme matire sous deux formes


rembobinage

dbobinage chromatine rembobinage chromosomes

Comme la pelote est de la laine soigneusement enroule, le chromosome est de la chromatine soigneusement enroule.

laine dbobine

dbobinage

pelotes de laine

Linformation gntique est intgralement transmise au cours dune division cellulaire. Le nombre de chromosomes dans une cellule humaine est constant : il y en a 23 de types diffrents dans les gamtes et 23 paires de chaque type dans les autres cellules. Ceci concerne tous les tres vivants eucaryotes (dont les cellules possdent un noyau diffrenci) comme par exemple le mouton

Document 2

Cellule uf de mouton 54 chomosomes

Mouton form de cellules 54 chomosomes

Squence 3 SN12

Cned Acadmie en ligne

E Quelles

sont les modalits de la division cellulaire au niveau chromosomique et comment linformation gntique estelle intgralement transmise dune cellule mre aux deux cellules filles obtenues par sa division ?

Le cycle cellulaire et ses phases


1. Aspects du matriel gntique au cours dun cycle cellulaire
Dans le noyau dune cellule humaine, les molcules dADN sont enroules autour de protines spcifiques appeles histones. Le degr denroulement de lADN est variable au cours de la vie cellulaire. En dehors des priodes de mitose, lenroulement est relativement lche, on dit que lADN est dcondens. Lassociation ADN-histones dcondens forme des filaments trs fins appels nuclofilaments (=filaments du noyau) uniquement visibles en microscopie lectronique trs fort grossissement. Lensemble constitue la chromatine diffuse du noyau. Au contraire, lors des divisions cellulaires, le degr denroulement de lADN est plus important, lADN se condense pour former les chromosomes. En dbut de division, chaque chromosome visible est constitu de deux chromatides unies entre-elles au niveau du centromre. Chaque chromatide est constitue dune molcule dADN. Le schma du document 3 illustre la structure dun chromosome condens en priode de division cellulaire.

Activit 1
Document 3

Chromosomes et ADN au cours dun cycle cellulaire


Recenser, extraire et organiser des informations
Structure dun chromosome en priode de division cellulaire
Une chromatide

Lautre chromatide

Centromre

Squence 3 SN12

Cned Acadmie en ligne

1 En utilisant les figurs indiqus, reprer les diffrentes parties dun

chromosome. Document 4 Aspects du matriel gntique au cours de diffrentes phases du cycle cellulaire
Noyau observ au MET (x 4000). Quel est le constituant principal du noyau ? Quel est sa nature molculaire ? Schmatisation dune partie dun nuclofilament. Lgender le schma. Ltat de lADN est

Cellule sanguine (leucocyte) observe au MET. Repasser en rouge le contour du noyau et complter les lgendes.

tat du matriel gntique en dehors de la Cellule de jacinthe au microscope optique (x 600) Reprsentation schmatique de lADN dune des deux chromatides dun chromosome. Ltat de lADN est

tat du matriel gntique en priode de la 2 Complter le tableau du document 4 indiquant les aspects du matriel

gntique diffrents moments de la vie cellulaire.


retenir En dehors de la division cellulaire (interphase), les molcules dADN sont dcondenses en chromatine diffuse. En dbut de division cellulaire (mitose), les molcules dADN sont condenses en chromosomes deux chromatides. Chaque chromatide est constitue dune molcule dADN.

Squence 3 SN12

Cned Acadmie en ligne

Document 5

Chromosome et ADN

2. Les modifications des structures cellulaires et le comportement des chromosomes au cours de la mitose
On va approfondir les aspects chromosomiques de la mitose aborde dans les classes prcdentes On a observ prcdemment quen interphase, le contenu nuclaire se prsente sous forme de chromatine diffuse et lors de la mitose (du grec mitosis = bton), le matriel nuclaire devient visible sous forme de chromosomes. Pour observer la mitose on choisit un organe en croissance rapide, par exemple dans une racine de jacinthe o des mitoses sont observables On distingue diffrentes tapes au cours desquelles le matriel nuclaire subit des modifications. On dlimite arbitrairement plusieurs phases de la mitose pour en faciliter la description et on leur donne un nom. Chaque phase est caractrise par un tat nuclaire particulier Ici, sont prsentes les diffrentes tapes de la mitose de cellules de racine de jacinthe observes au microscope optique (x 600). Microphotographie gauche et interprtation schmatique droite. La premire phase de la mitose (document 6) ou prophase est la phase la plus longue (de 15 60 min). Document 6 Prophase

Squence 3 SN12

Cned Acadmie en ligne

Les nuclofilaments se condensent pour constituer les chromosomes. ce stade chaque chromosome correspond deux chromatides unies au niveau du centromre. Un faisceau de fibres protiques forme un fuseau de division qui se met en place autour du noyau cellulaire. La deuxime phase (document 7) ou mtaphase ne dure que quelques minutes. Document 7 Mtaphase

Vue polaire

Vue polaire

Vue quatoriale

Lenveloppe nuclaire se fragmente et disparat progressivement. Les chromosomes se rassemblent au centre de la cellule, au niveau du plan quatorial de la cellule, cest--dire gale distance des deux ples du fuseau de division. Chaque chromatide dun chromosome se fixe, par une structure particulire situe prs du centromre, des fibres du fuseau relies lun ou lautre des ples de la cellule. Remarque : cest ce stade que sont raliss les caryotypes (ensemble des chromosomes dune cellule) car le degr de condensation de lADN est maximal et donc les chromosomes le mieux visibles. La troisime phase (document 8) ou anaphase ne dure que 2 3 min. Document 8 Anaphase

Il y a clivage au centromre (chaque centromre se scinde en deux) et les deux chromatides de chaque chromosome se sparent. Les fibres du fuseau se raccourcissent et tractent les chromosomes une chromatide vers lun ou lautre des ples de la cellule (le centromre en avant, les bras du chromosome en arrire). Les chromosomes se dplacent environ 1mm par seconde. la fin de lanaphase, un lot complet de chromosomes une chromatide se trouve chacun des deux ples de la cellule. La quatrime phase (document 9) ou telophase dure 15 60 minutes.

Squence 3 SN12

Cned Acadmie en ligne

Document 9

Tlophase

LADN se dcondense, ce qui entrane la disparition progressive des chromosomes et la reconstitution de la chromatine diffuse. Les fibres du fuseau de division disparaissent. Une enveloppe nuclaire se reconstitue pour former le futur noyau de chacune des deux cellules filles. La mitose sachve par la sparation des cytoplasmes des deux cellules filles (cytodirse) qui entrent en interphase. Les modalits diffrent pour les cellules animales ou vgtales (document10). Document 10 Sparation des cellules filles (animales ou vgtales) en fin de mitose Pour une cellule animale, elle se ralise par un tranglement centripte jusqu sparation des deux cellules filles.
Chez les animaux : Une cellule mre donne deux cellules filles semblables entre elles et semblables la cellule mre.

Dans le cas dune cellule vgtale, la sparation des cellules filles dbute par la formation dune nouvelle paroi rigide au niveau du plan quatorial de la cellule mre. Cette nouvelle paroi se dveloppe de manire centrifuge jusqu se raccorder la paroi existante de la cellule mre.
Chez les vgtaux : Une cellule mre donne deux cellules filles semblables entre elles et semblables la cellule mre.

La mitose est donc aussi une transformation du cytoplasme et de la taille des cellules.

Squence 3 SN12

Cned Acadmie en ligne

Activit 2

Reprage des diffrentes phases au cours dun cycle cellulaire


Recenser, extraire et organiser des informations sous forme de schmas
Le document 11 reprsente schmatiquement les diffrentes tapes dun cycle cellulaire dune cellule fictive ayant 2 paires de chromosomes. Repasser en deux couleurs diffrentes chaque chromosome de chaque paire. Indiquer les noms de chaque tape du cycle cellulaire.

Document 11

Schmas des diffrentes phases dun cycle cellulaire

retenir Les cellules se divisent au rythme de cycles cellulaires, chacun comprenant une interphase (priode hors division) et une mitose (priode de division). Le comportement des chromosomes permet de distinguer quatre phases au cours de la mitose : La prophase : la chromatine se condense en chromosomes 2 chromatides ; lenveloppe nuclaire disparat et un fuseau de division apparat. La mtaphase : les chromosomes sont condenss au maximum et se regroupent dans le plan quatorial de la cellule. Lanaphase : il y a clivage des centromres et chaque chromatide de chaque chromosome migre un ple oppos de la cellule ; il y a donc une rpartition gale du nombre de chromosome dans chaque future cellule fille. La tlophase : la migration tant acheve, les chromosomes une chromatide se dcondensent ; les enveloppes nuclaires se reconstituent autour de chaque amas de chromatine. La division sachve par la sparation des deux cellules filles (cytodirse). Les cellules filles hritent de la mme information gntique que celle de la cellule mre : les deux chromatides (donc les deux molcules dADN) de chaque chromosome sont donc rigoureusement identiques.

Squence 3 SN12

Cned Acadmie en ligne

Document 12

Schma bilan dun cycle cellulaire


Disparition de la membrane nuclaire Centromre 2 chromatides Interphase Condensation de la chromatine en chromosomes 1 cellule mre (2n=4) Mtaphase Alignement des chromosomes 2 chromatides Plaque quatoriale Fuseau mitodique

1 chromosome 2 chromatides

Chromatine = ensemble des chromosomes drouls (2n = 4)

Mitose

Les chromosomes 1 chromatide se dcondensent Sparation des 2 cellules filles par formation dune paroi Apparition de la membrane nuclaire 2 cellules filles

Sparation des chromosomes en 2 au niveau des centromres Puis migration vers les ples de chaque chromatide grce au fuseau de division.

(2n = 4)

Tlophase

Anaphase

Activit 3

Relation entre nombre de chromosomes et nombre de molcules dADN


Comprendre le lien entre les phnomnes naturels et le langage mathmatique.
Le document 13 reprsente le caryotype de lespce humaine (nombre de chromosomes contenus dans le noyau de chaque cellule humaine except les cellules reproductrices). Il est de 23 paires.

Document 13

Caryotype dune cellule humaine Combien y a-t-il de molcules dADN dans une cellule humaine en dbut de mitose ? Combien y a-t-il de molcules dADN diffrentes ?

3. Caryotypes et dfinition dune espce


Chez la plupart des tres vivants les chromosomes sont rpartis par paires. Dans lespce humaine la majorit des cellules contient 46 chromosomes, soit 23 paires. On distingue 22 paires de chromosomes identiques (autosomes) pour les deux sexes et 1 paire de chromosomes sexuels : XX chez la femme et XY chez lhomme. Les gamtes ne contiennent que 23 chromosomes (1 de chaque paire). Ainsi, lors de la fcondation, les 23 paires de chromosomes sont reconstitues dans la cellule uf et a fortiori dans toutes les cellules de lindividu qui en drive par mitoses.

10

Squence 3 SN12

Cned Acadmie en ligne

Voici dautres exemples parmi des espces animales ou vgtales : la drosophile a 4 paires de chromosomes, la grenouille en a 24, le chien 39, le pommier 17 et le papillon Lysandria 190 !

Activit 4

Comparaison de caryotypes despces diffrentes Utiliser ses connaissances et extraire des informations pour justifier une rponse.
Caryotypes despces diffrentes Caryotype 1 Caryotype 2

Document 14

Caryotype 3

Caryotype 4

Caryotype 5

1 tablir les constantes et les diffrences entre les diffrents caryotypes

prsents.
2 Attribuer chacun des caryotypes lespce lui correspondant. Justi-

fier les choix.


3 Reprer et expliquer la diffrence entre les caryotypes 3 et 4. retenir Le caryotype dun individu est spcifique de lespce laquelle il appartient. Cest donc un des fondements de la dfinition de lespce.

Squence 3 SN12

11

Cned Acadmie en ligne

4 Anomalies chromosomiques et explications

Des erreurs peuvent parfois se produire lors de la formation des gamtes ou de la mitose des autres types de cellules ce qui entrane des anomalies chromosomiques dans les cellules filles. On distingue des anomalies de nombre et de structure.

a- Les anomalies de nombre peuvent se traduire par labsence de un


ou plusieurs chromosomes. Labsence dun autosome chez un nouveau-n est exceptionnelle du fait sans doute de leur limination ds le dbut de la vie embryonnaire. Labsence dun chromosome X est moins rare (syndrome de Turner). Il est beaucoup plus frquent que lanomalie soit due la prsence dun ou plusieurs chromosomes surnumraires. On observe ainsi des trisomies (prsence dun chromosome surnumraire) : trisomie 21 (syndrome de Dawn), 18 et 13 (syndrome de Patau) pour les plus frquentes. Les trisomies des chromosomes sexuels sont trs frquentes : XXX, XXY (syndrome de Klinefelter), XYY. Il existe aussi des anomalies de nombre plus importantes : XXXX Document 15 Caryotypes de diffrents individus prsentant une anomalie chromosomique de nombre. Caryotype 1 Caryotype 2

Caryotype 3

Caryotype 4

Activit 5

Quelques exemples danomalies chromosomiques de nombre


Extraire des informations pour justifier une rponse. Reprer et nommer, en le justifiant, les anomalies chromosomiques de nombre illustres dans le document 15. Ces anomalies de nombre peuvent tre homognes (prsentes dans toutes les cellules) ou en mosaque (non prsentes dans toutes les cellules).

12

Squence 3 SN12

Cned Acadmie en ligne

Quand elles sont homognes, elles sexpliquent le plus souvent par un droulement anormal de la formation des gamtes : deux chromosomes dune mme paire au lieu dun seul peuvent alors se retrouver dans un mme gamte. Si ce gamte est fcond par un gamte normal, luf qui en rsultera sera donc trisomique ; si le gamte ne contient aucun chromosome de la paire considre, luf sera monosomique. Quand elles sont en mosaque, elles rsultent de la non sparation dune paire de chromosomes aprs quelques mitoses de la cellule uf qui initialement avait un caryotype normal. Lindividu issu de cet uf possdera donc des cellules au caryotype normal et des cellules au caryotype anormal. Enfin il existe des polyplodies dont la plus frquente est la triplodie caractrise par la prsence de trois chromosomes de chaque type. Elle est due des accidents de la fcondation dont le plus frquent est une dispermie (ovule fcond par deux spermatozodes).

b- Les anomalies de structure peuvent concerner un ou plusieurs chromosomes. Elles sont prsentes ds la conception (dans les gamtes) ou se forment lors des premires mitoses de la cellule uf. Elles sont habituellement la consquence de cassures chromosomiques suivies par une ou plusieurs soudures anormales. Ces anomalies de structure rsultent principalement de dltions, translocations ou inversions. Une dltion rsulte de la perte dun fragment de chromosome. Elles saccompagnent de symptmes cliniques svres chez le nouveaun. La perte peut se situer un seul bout de chromosome ou aux deux bouts ; elle peut galement se situer au milieu dun chromosome. Une translocation rsulte de la soudure dun fragment de chromosome sur un autre chromosome qui a lui-mme subi une cassure. Une inversion rsulte de deux cassures dun chromosome. Au lieu dtre limin, le fragment situ entre les deux cassures reste en place. Il na subi quune rotation de 180 qui bouleverse la squence des gnes sur le chromosome. Lindividu porteur de cette anomalie na ni perte ni gain de matriel gntique et le rarrangement est dit quilibr. Normalement, il ny a aucun symptme clinique la naissance. Document 16 Diffrents types danomalies chromosomiques de structure Anomalie 1

Squence 3 SN12

13

Cned Acadmie en ligne

Anomalie 2

Anomalie 3

Anomalie 4

Anomalie 5

Activit 6

Quelques exemples danomalies chromosomiques de structure


Extraire des informations pour justifier une rponse. Reprer et nommer, en le justifiant, les anomalies chromosomiques de structure illustres dans le document 16.
Parfois, lors dune translocation, cest un chromosome entier qui est transloqu sur un autre chromosome. Par exemple certains individus ont un de leurs chromosomes 21 soud un chromosome 14. Il ny a pas danomalie clinique chez le sujet porteur car il ny a ni perte ni gain de matriel gntique. On dit que la translocation est quilibre. Mais si cette personne produit des gamtes avec un chromosome 21 normal et un chromosome 14 transloqu, elle risque davoir un enfant trisomique 21.

Document 17

Translocation dun chromosome 21 sur un chromosome 14

14

Squence 3 SN12

Cned Acadmie en ligne

Activit 7

Origine dune anomalie chromosomique de structure


Extraire des informations pour justifier une rponse
Quel individu du couple prsente une anomalie chromosomique de structure ? Justifier la rponse.

retenir Des erreurs lors de la formation des gamtes ou de la mitose dautres types de cellules peuvent tre lorigine danomalies chromosomiques de nombre ou de structure dans le caryotype. Les anomalies de nombre se traduisent par un chromosome en plus ou en moins dans le caryotype. Les anomalies de structure se traduisent par des fragments de chromosomes manquants ou supplmentaires. La multiplicit des exemples montre que le matriel chromosomique est trs mallable.

Une cellule mre possde la mme information que les deux cellules filles issues de sa mitose. Les deux chromatides de chaque chromosome de la cellule mre sont donc identiques. La cellule mre possde deux fois la mme information gntique en dbut de mitose.
E Problme:

Par quels mcanismes et quel moment?

Les mcanismes de la reproduction conforme lchelle molculaire


Dans les classes prcdentes, vous avez appris que le support molculaire de linformation gntique est lADN port par les chromosomes. Une molcule dADN est forme de 2 brins ou chanes enrouls en une double hlice. Chaque brin est constitu dunits lmentaires enchanes appeles nuclotides. Il existe 4 nuclotides diffrents se distinguant par la nature dun de leurs constituants appel bases azotes : ladnine (A), la cytosine(C), la guanine (G) et la thymine (T). Les 2 brins sont associs sur toute leur longueur de telle sorte que A est toujours en face de T et G en face de C : on dit que les 2 brins sont complmentaires. Une molcule dADN est caractrise par sa squence, cest--dire le nombre, la nature et lordre dans lequel les nuclotides senchanent.

Activit 8

Rappel sur la structure dune molcule dADN


Recenser, extraire et organiser des informations pour complter un schma. Complter la squence nuclotidique des 2 brins de la molcule du document 18 pour illustrer une squence nuclotidique de votre choix dun fragment dune molcule dADN.
Squence 3 SN12

15

Cned Acadmie en ligne

Document 18

LADN, une molcule forme de deux brins complmentaires

Activit 9
Document 19

Relations entre chromosomes et ADN au cours de la mitose


Chromosomes, ADN, transmission de linformation gntique.
A cellule en B cellule en

16

Squence 3 SN12

Cned Acadmie en ligne

1 Mobiliser ses connaissances

La cellule du document 19 est diplode ; identifier le stade de mitose de la cellule du cadre A ainsi que les paires de chromosomes homologues, en les coloriant diffremment. Rappel : une cellule est diplode lorsquelle possde des chromosomes homologues, cest--dire semblables morphologiquement deux deux ; les chromosomes homologues dune paire ont la mme taille et le centromre la mme hauteur.
2 Communiquer par un schma

Schmatiser le plus simplement possible, dans la case libre sous cette photo, le caryotype de cette cellule,
3 Mobiliser ses connaissances

Identifier le stade de mitose du cadre B et rappeler lvnement chromosomique marquant cette phase.
4 Communiquer par un schma

Schmatiser dans la case libre sous cette photo, le caryotype de cette cellule, en utilisant le mme code qu la question 2.
5 Daprs ses connaissances, adopter une dmarche dductive

Les caryotypes des cellules filles et de la cellule mre sont identiques entre eux. Indiquer quel phnomne chromosomique doit alors se produire dans la cellule mre et quel moment de son cycle cellulaire ?
6 Daprs ses connaissances, adopter une dmarche dductive

Indiquer si une cellule haplode (ne possdant quun seul exemplaire de chaque type de chromosome) peut subir une mitose ? Justifier la rponse.
7 Exprimer graphiquement des rsultats, mobiliser ses connaissances

en relation avec le problme Le dosage de la quantit dADN dans le noyau puis dans chacun des lots de chromosomes prsents dans une cellule en division a donn les rsultats consigns dans le document 20 : Document 20 Quantit dADN en fonction du temps dans une cellule en division
Temps (heures) Quantit dADN (u.a) Temps (heures) Quantit dADN (u.a) u.a : unit arbitraire. 0 8 9 7 1 8 10 8 1.45 8 12 8 1.50 4 13.45 8 3 4 13.50 4 3.50 4 15 4 7 5 7 5

a- Tracer le graphe de la quantit dADN en fonction du temps.


Echelles : 1 cm pour 1 heure et 1cm pour 1 unit arbitraire dADN.

Squence 3 SN12

17

Cned Acadmie en ligne

Aide la ralisation du graphique La grandeur tudie (ce que lon mesure), est reprsente en ordonnes. La courbe reprsente lvolution de cette grandeur en fonction de ce qui est reprsent en abscisses. Le titre est une phrase du type variation de y en fonction de x . Les axes tracs la rgle se terminent par une flche. Il faut reporter la signification des axes (paramtre mesur et unit). Choisir une chelle proportionne pour les deux axes. Reporter les points suivant les valeurs donnes.

b- Certaines variations de la quantit dADN correspondent des ana-

phase tlophase de mitose : les identifier et les repasser en rouge sur le graphe. Justifier le choix.

c- Indiquer quoi peuvent correspondre les autres variations de la


quantit dADN ? Justifier la rponse.

d- Sachant que pour ces cellules, la mitose dure une heure, que la pro-

phase et la mtaphase reprsentent 75% du temps de division, dlimiter sur le graphe le dbut et la fin dune mitose.

e- Dlimiter sur le graphe la dure de linterphase et dun cycle cellulaire entier.


Cest donc la rduction de moiti de la quantit dADN qui permet de reprer la mitose dune cellule. Cette rduction correspond la sparation des chromatides des chromosomes de chaque paire. La prophase et la mtaphase ont lieu un peu avant, la tlophase et la cytodirse ont lieu un peu aprs. La dure qui spare une mitose de la suivante correspond linterphase qui dure de quelques heures plusieurs semaines ou plus encore.
retenir Lvolution de la quantit dADN au cours dun cycle cellulaire permet de dlimiter ses diffrentes phases. En interphase, on distingue trois priodes : Durant la phase qui suit la mitose (phase G1, G pour gap of time en anglais cest--dire intervalle de temps en franais), la quantit dADN est constante et caractristique des cellules de lespce (quantit Q). Durant la phase o la quantit dADN double (quantit 2Q), il y a rplication de lADN (phase S de synthse). La phase S est suivie dune phase o la quantit dADN reste constante 2Q (phase G2). En fin dinterphase la cellule est prte subir la mitose.

Au cours de la phase S il est possible dobserver des zones de ddoublement des nuclofilaments appeles yeux de rplication qui correspondent aux endroits o lADN se rplique.

18

Squence 3 SN12

Cned Acadmie en ligne

Document 21

Yeux de rplication au niveau de lADN dune cellule de Hamster en phase S (MET). Interprtation graphique
Nuclofilament

Yeux de rplication (microscopie lectronique)

Oeil de rplication

Deux futures chromatides dun chromosome

Ancien brin

Nouveau brin

Document 22

Bilan

Je repre : - la cellule mre : - les cellules filles : - les images de mitose : - les images dinterphase : - lADN en phase G1 : - lADN en phase S : - lADN en phase G2 : - lADN de la chromatine : - lADN des chromosomes :

Activit 10

volution de la structure de lADN au cours dun cycle cellulaire


Mobiliser ses connaissances partir dune reprsentation schmatique Associer chaque image du document 22 au repre correspondant.
1 Les mcanismes de rplication de lADN

Rappels sur la structure de lADN : Cest une grosse molcule (macromolcule) forme de deux chanes ou brins enrouls en une double hlice. Chaque brin comprend quatre types

Squence 3 SN12

19

Cned Acadmie en ligne

dunits appels nuclotides qui se distinguent par un de leur constituant appel base azote. On symbolise chaque base azote par une lettre : A, C, T et G. Les deux brins dune molcule dADN sont relis lun lautre sur toute leur longueur par leurs bases azotes, qui forment toujours le mme couple : A est toujours associ T et C G. Chaque brin est donc complmentaire de lautre.

Activit 11

Dcouverte des mcanismes de la rplication de lADN


Pratiquer une dmarche scientifique, raisonner avec rigueur pour valider ou invalider une hypothse
Deux hypothses relatives aux mcanismes de la rplication peuvent tre mises : Hypothse1 : rplication conservative : aprs ouverture de la molcule dADN, chaque brin sert de matrice la synthse par complmentarit de bases de 2 nouveaux brins, qui sassemblent pour former la nouvelle molcule dADN. Hypothse 2 : rplication semi conservative : aprs ouverture de la molcule dADN, chaque brin sert de matrice et sera complt par complmentarit, jusqu la sparation totale des brins initiaux ; 2 molcules sont ainsi formes.
1 Sachant que les bactries ne possdent quun chromosome, et donc

quune seule molcule dADN par cellule, reprsenter schmatiquement les molcules dADN de premire gnration pour chaque hypothse en utilisant la reprsentation simplifie dune molcule dADN propose et une couleur rouge pour les brins nouveaux dADN.

Afin de valider une des deux hypothses, Meselson et Stahl (1951) ont travaill sur une bactrie trs commune, Escherichia Coli et ont ralis diffrentes expriences. Document 23 Principe et protocole Principe : La destine des molcules dune cellule peut tre suivie en utilisant des isotopes marqueurs, par exemple 15N, lisotope lourd de lazote 14N. Lazote 15N sincorpore sans discrimination dans tous les composs azots de la cellule, y compris lADN. Les molcules dADN marques avec 15N sont plus lourdes que celles contenant 14N ; elles peuvent tre spares par centrifugation en gradient de densit et leur densit peut tre value.

20

Squence 3 SN12

Cned Acadmie en ligne

Protocole : des bactries sont cultives pendant plusieurs gnrations sur un milieu contenant des sels dammonium tous marqus par 15N. Quand tout lADN des bactries contient du 15N, on transfre ces dernires sur un milieu 14N. Elles poursuivent leurs divisions de faon synchrone ; on prlve des bactries des temps correspondant au doublement de la population et on mesure la densit de lADN extrait de ces bactries.
2 Pour chaque hypothse, quels rsultats peut-on prvoir aprs une g-

nration sur milieu 14N ? Rpondre en compltant le document 24. Les rsultats sexpriment en % dADN lourd, lger ou hybride.
hypothse 1 hypothse 2

Document 24

densit de lADN de premire gnration sur 14N

3 Reprsenter schmatiquement les molcules dADN de premire et

deuxime gnration pour chaque hypothse. Reprendre le mme figur que pour la question 1 avec en noir 1 brin lger et en rouge 1 brin lourd .
4 Indiquer alors les rsultats prvisibles (% dADN lourd, lger, hybride)

aprs deux gnrations sur milieu 14N, en compltant le document 25. Document 25
hypothse 1 hypothse 2

densit de lADN de premire gnration sur 14N

Squence 3 SN12

21

Cned Acadmie en ligne

Document 26

Exprience et rsultats obtenus par Meselson et Stahl Technique exprimentale de la centrifugation en gradient de densit : Elle permet de sparer des molcules en fonction de leur poids molculaire. On utilise du CsCl (chlorure de csium) car il a une densit proche de celle de lADN. Quand une solution de CsCl est centrifuge, le CsCl forme un gradient continu de densit plus leve au fond du tube quau sommet du tube. Donc un chantillon dADN squilibrera dans le CsCl lendroit o la densit de la solution de CsCl sera quivalente sa propre densit. LADN15 aura donc une position dquilibre dans le tube (densit de 1.724) infrieure celle de lADN14 (densit de 1.710). Remarque : on localise lADN laide dun faisceau de rayons UV.

5 Les informations tires des rsultats permettent-elles de valider une

des hypothses et de rfuter lautre ? Prciser la rponse et justifier.

Activit 12

Relation entre chromosome mtaphasique et ADN


Mobiliser ses connaissances en relation avec le problme
Le schma du document 27 reprsente un chromosome en mtaphase et la molcule dADN qui constitue une de ses deux chromatides. Complter ce schma en reprsentant la molcule dADN correspondant la deuxime chromatide. Justifier la rponse.

Document 27

Chromosome en mtaphase

22

Squence 3 SN12

Cned Acadmie en ligne

retenir LADN se rplique selon un mode semi conservatif. Les deux brins de la molcule dADN scartent par rupture des liaisons chimiques qui unissent les bases complmentaires. Des nuclotides libres fournis par les nutriments se positionnent en face de leurs bases complmentaires et se lient entre eux pour former un nouveau brin dADN. Ainsi les molcules dADN filles identiques entre elles et la molcule mre contiennent chacune un brin de la molcule mre et un brin noform. Cette synthse ncessite aussi un complexe enzymatique (ADN polymrase) et de lnergie fournie par les nutriments. Aprs la rplication, les deux molcules dADN identiques nouvellement formes constitueront en se condensant les deux chromatides dun chromosome unies par un centromre. 5 La vitesse de rplication de lADN

La PCR (raction de polymrisation en chane) est une technique qui permet damplifier (en plusieurs millions dexemplaires) un fragment dADN bien prcis (microsatellite). La PCR se droule in-vitro. Le fragment dADN amplifier est plac dans lappareil PCR. Premire tape : la dnaturation On dnature le fragment dADN squencer une temprature de 95C pendant une minute, afin de sparer les deux brins de lADN. Deuxime tape : lhybridation A une temprature de 50C pendant une minute, on ajoute de courtes amorces nuclotidiques de synthse monobrins, complmentaires des deux extrmits de la squence du fragment dADN amplifier. Troisime tape : la polymrisation A une temprature de 72C pendant une minute, des enzymes (ADN polymrases qui interviennent naturellement dans le processus de rplication) sont ajoutes pour permettre la synthse dun brin complmentaire de chacun des deux brins spars. On ajoute quatre nuclotides (dsoxyribonuclotides ou dNTP) : dATP, dTTP, dCTP, dGTP qui par complmentarit vont se lier chacun des deux brins. Llongation commence partir des amorces et se poursuit jusqu lobtention de deux copies de lADN initial. Les trois tapes sont rptes pendant n cycles. On obtient ainsi 2, 4, 8 jusqu 33554432 copies au bout de 25 cycles ! Document 28 Principe de la PCR
Premier cycle : trois phases
1) Chauffage 95 brin ancien brin nouveau 2) Refroidissement 50

T TT

Deuxime cycle

TTT

3) Chauffage 72

Squence 3 SN12

23

Cned Acadmie en ligne

Deuxime cycle :
1) Chauffage 95 2) Refroidissement 50 3) Chauffage 72

Troisime cycle :
95 50 puis 72

Bilan
microsatellite que lon veut tudier

1er cycle

2me cycle

3me cycle

4me cycle

........

dans un tout petit tube

Ainsi chez certaines bactries, la PCR a montr que la copie dun brin dADN se fait une vitesse denviron 1500 nuclotides par seconde.

Activit 13

Estimation de la vitesse de rplication


Comprendre le lien entre les phnomnes naturels et le langage mathmatique. Mobiliser ses connaissances en relation avec le problme. Considrons que le seul chromosome et donc la seule molcule dADN que possde une bactrie, contient 4,7 millions de paires de bases. On peut admettre que la vitesse de rplication de lADN in-vivo quivaut celle qui se ralise avec la PCR.
Combien faut-il de temps, au minimum, pour une rplication complte de la molcule dADN chez ces bactries ? Remarque : Llongation dun nouveau brin seffectue la vitesse de seulement 50 nuclotides par seconde pour lADN humain. Chez tous les eucaryotes, louverture de la molcule dADN seffectue en de nombreux points sous forme dyeux de rplication (document 29), ce qui permet daugmenter considrablement la vitesse de rplication. On estime quil suffit de quelques heures pour que la totalit de lADN (environ 6 milliards de paires de bases) dune cellule humaine soit rpliqu.

24

Squence 3 SN12

Cned Acadmie en ligne

retenir Chez les eucaryotes, la vitesse de rplication de la molcule dADN peut atteindre plusieurs dizaines de nuclotides par seconde et il suffit de quelques heures pour que la totalit de lADN dune cellule soit rpliqu.

Document 29

Schma bilan de la rplication semi-conservative de lADN

Bilan du chapitre
Deux mcanismes fondamentaux assurent la transmission de lintgralit de linformation gntique au cours dun cycle cellulaire : La rplication semi-conservative de lADN au cours de linterphase. Elle permet une cellule davoir des chromosomes deux chromatides dont linformation gntique est rigoureusement identique. La mitose qui suit linterphase. Elle permet la rpartition des chromosomes en deux lots identiques. En effet, les deux cellules filles issues de la mitose hritent de la totalit de linformation gntique de la cellule mre sous la forme dun lot complet de chromosomes une chromatide. La rplication de lADN assure donc une stabilit qualitative de linformation gntique et la mitose assure sa stabilit quantitative.

Quantit dADN par cellule (units arbitraires) 8 4 0 5 10 Temps (h) 15

Squence 3 SN12

25

Cned Acadmie en ligne

Variabilit gntique et mutation de lADN


Jai deux gnes codant pour la couleur de mon pelage, comme toutes les souris. Mon pelage me montre que lun de mes gnes porte lallle souris grise Mon cadet me montre que mon autre gne du pelage porte linformation souris blanche

PAPA

MAMAN Je suis bien le fils de mes parents car le caractre souris grise lemporte sur le caractre souris blanche

Fils ain

Fils cadet

Pour sinterroger Vous avez appris dans les classes prcdentes que les gnes sont responsables de lexpression des caractres dun individu. Au sein dune espce, un gne peut prsenter de multiples variantes appeles allles. Pour lensemble de ses gnes, un individu possde deux allles (identiques ou diffrents) pour chaque gne. Les 2 chromosomes dune mme paire sont gntiquement diffrents chez un individu et diffrents de ceux de tous les individus de lespce laquelle ils appartiennent. LADN, molcule constituant les gnes, est une molcule relativement instable et peut subir des modifications spontanes ou provoques appeles mutations (avec perte, gain ou remplacement dun ou plusieurs nuclotides). Les mutations sont lorigine du polyalllisme des gnes. De fait, la variation gntique des individus repose sur la variabilit de lADN.

E Lendommagement

de la molcule dADN lorigine dventuelles mutations peut-il tre rpar par la cellule ? sont les diffrents types de mutations conserves et leurs consquences sur les individus porteurs? quoi les mutations sont-elles un fondement de la biodiversit ?

E Quels

E En

26

Squence 3 SN12

Cned Acadmie en ligne

Mobiliser les acquis : Activit 1 Rappels sur la notion de diversit gntique


Raisonner, recenser et extraire des informations
Depuis les dernires dcennies, les outils de la biotechnologie molculaire ont permis de squencer lADN. Il est ainsi possible de comparer des squences dADN de diffrents gnes ou dallles diffrents dun mme gne. Le document 1 reprsente les squences dun des 2 brins de lADN de deux gnes permettant la synthse de 2 hormones : le gne codant pour la synthse dADH (hormone qui permet la rabsorption de leau au niveau du rein) et le gne codant pour linsuline (une des hormones qui rgule la glycmie, cest--dire le taux de glucose sanguin). Document 1 Squence nuclotidique des gnes de lADH et de linsuline
1 ADH 10 20 90

TGCTACTTCCAGAACTGCCCGAGGGGC

Insuline AAACACTTGGTTGTGGACAGCCCGAGTGTGGAC ..TTCTGG

1 En quoi diffre la squence des 2 gnes ?

Le document 2 reprsente les squences partielles dADN dun des 2 brins, de 2 allles dun mme gne : le gne codant pour une molcule marqueur des groupes sanguins du systme ABO. Le reste de la squence non reprsente est rigoureusement identique. Remarque : chaque allle comprend 1062 nuclotides Document 2 Squences nuclotidiques partielles des allles A et B
520 700 790 800

Allle A GTGCGCGCCTAC..CCGGCT.TACCTGGGGGGGT.. Allle B GTGGGCGCCTAC..CCAGCT..TACATGGGGGCGT..

2 Comparer la squence des deux allles. 3 Dfinir alors partir de cet exemple la mutation dun gne ?

Le document 3 schmatise la localisation de 4 gnes sur une des 23 paires de chromosomes chez deux individus appartenant lespce humaine.

Squence 3 SN12

27

Cned Acadmie en ligne

4 Exploiter le document 3 pour

Aide Dterminer le nombre dallles diffrents pour chaque individu et le nombre dallles diffrents pour les 2 individus. Complter le tableau. Individus 1 et 2 = population

rappeler en quoi consiste la diversit gntique au sein dune population dindividus appartenant la mme espce.

Individu 1 Gne a Gne b Gne c Gne d Gne e

Individu 2

LADN est une molcule endommageable


Pendant sa rplication ou en dehors, lADN est soumis en permanence des activits mtaboliques intracellulaires et des facteurs extracellulaires ou environnementaux qui peuvent lendommager. Chaque jour, jusqu 1 million de nuclotides dune cellule humaine sont endommags. Il existe plusieurs systmes de rparation, dont la vitesse et lefficacit dpendent de nombreux paramtres : type et ge de la cellule, facteurs environnementaux.

28

Squence 3 SN12

Cned Acadmie en ligne

De nombreux gnes codant pour des protines impliques dans la dure de vie cellulaire interviennent dans la rparation de lADN endommag. Grce certaines de ces protines spcifiques, la cellule dtecte les dommages ou lsions. Ces protines se fixent aux structures anormales telles que une base azote modifie, une rupture des liaisons chimiques entre bases, un fragment dADN monobrin ou une dformation de la double hlice dADN. Avant la rparation, les structures anormales sont supprimes. Des enzymes (glycosylase par exemple) interviennent pour les liminer. La rparation consiste la synthse dun brin complmentaire du brin restant non endommag. Deux enzymes principales interviennent, lADN polymrase (pour la synthse du nouveau brin) et lADN ligase (pour suturer les 2 brins). Ces mcanismes, quand ils sont efficaces, maintiennent donc lintgrit des cellules quand elles se divisent ou pendant leur dure de vie. Si la rparation nest pas efficace, il apparat une mutation de lADN. Les cellules mutes, si elles poursuivent de faon incontrle leurs divisions, transmettent cette mutation leurs cellules filles. Ce qui peut tre lorigine de cancers dorigine gntique (cancer du sein, du colon). Elles peuvent aussi entrer en dormance irrversible (snescence) ou subir une mort par suicide cellulaire (apoptose).

Activit 2

Consquences des endommagements de lADN Recenser et extraire des informations


1 Indiquer des endommagements possibles de lADN. 2 Citer les deux tapes permettant la rparation de lADN endommag. 3 Quelles consquences peuvent avoir une non rparation dun endom-

magement de lADN dune cellule ?


retenir LADN peut tre endommag lors de la rplication ou durant la vie de la cellule. En gnral, des protines dont certaines enzymes, permettent une rparation. Si lendommagement nest pas rpar et si la cellule survit, il apparat une mutation. Cette mutation est transmissible si elle poursuit ses divisions.
E Quelles

sont les consquences des mutations?

Consquences des mutations


Une mutation est spontane et alatoire. Au sein dune population de cellules, la frquence des mutations est faible. On admet une probabilit denviron 10-6, cest--dire quune mutation touche 1 cellule sur

Squence 3 SN12

29

Cned Acadmie en ligne

1 million. Mais tant donn le nombre de gnes chez un individu, la probabilit quune mutation dun gne apparaisse nest pas ngligeable, dautant plus que lindividu est expos laction dagents favorisant les mutations et qualifis de mutagnes.

Activit 3

Probabilit de la mutation dun gne


Comprendre le lien entre les phnomnes naturels et le langage mathmatique.
Sachant que le nombre de gnes dans lespce humaine est denviron 30000, valuez la probabilit quune mutation apparaisse dans une cellule.
1. Exemple

de linfluence de lirradiation dune culture de levures par des UV

Nous savons que les mutations sont lorigine des diffrents allles des gnes.

Activit 4

Consquences dune exposition aux rayons ultra-violets


Recenser, extraire et organiser des informations / Comprendre le lien entre les phnomnes naturels et le langage mathmatique / Communiquer dans un langage scientifiquement appropri (tableau) / Exprimer des rsultats en utilisant un tableur
Des tudes exprimentales ont t ralises chez des populations de levures. Information n1 : Par division, les levures forment des colonies constitues de millions de cellules. Dune taille de quelques millimtres en moyenne, les colonies sont visibles lil nu. Les souches sauvages (les plus frquentes dans la nature) forment des colonies blanches. Une souche moins frquente forme des colonies rouges. Ces colonies sont donc facilement reprables. La couleur rouge de ces levures a pour origine laccumulation dans les cellules, dune molcule qui soxyde au contact de l02 formant un pigment rouge. On a tudi exprimentalement linfluence des rayons ultra-violets sur le taux de mutation de lADN des levures. Information n2 : Les UV altrent la structure de la molcule dADN Les rayons ultra-violets(UV) transportent de lnergie. Un photon UV qui est de courte longueur donde transporte une grande quantit dnergie. En plus de chauffer les molcules, les rayons UV peuvent les fragmenter, les dcouper. Ainsi la molcule dADN absorbe la lumire UV 254 nm ce qui provoque des cassures dans sa structure. Des processus de rparation faisant in-

30

Squence 3 SN12

Cned Acadmie en ligne

tervenir des protines spcialises existent. Si ces protines sont trop sollicites elles ne pourront cependant pas empcher la formation de lsions irrversibles. On pose alors lhypothse suivante : les rayons ultra-violets sont responsables de mutations. Pour prouver cette hypothse, on a ralis une exprience : Matriel biologique : on utilise des cellules de levures faciles cultiver sur un milieu de culture en bote de ptri. Au bout de quelques jours, elles forment des colonies constitues de millions de levures toutes identiques.
1 Indiquer ce que lon appelle colonie de levures et comment elle

sest forme. Principe de lexprience : On ensemence plusieurs milieux avec le mme nombre de levures formant des colonies rouges (couleur due la prsence dun allle couleur rouge du gne responsable de la couleur des levures). Chaque bote est place sous une lampe UV pendant une dure dtermine. Au bout de 3 jours, des colonies blanches sont apparues et elles sont dautant plus nombreuses que le temps dexposition aux UV a t long.. Document 3 Exposition des levures de couleur rouge aux UV

10 secondes

5 secondes

2 secondes

0 seconde

2 Quelle est la consquence de lexposition des levures aux UV ? Pour-

quoi peut-on dire quune mutation est intervenue dans le gnome des levures ? Une tude exprimentale quantitative est ralise : Des botes contenant 50 cellules de levure de couleur rouge ont t exposes aux UV pendant des temps diffrents : 0, 2, 5 et 10 secondes. On considre alors comme exprience tmoin la culture nayant pas subi dexposition aux UV.

Squence 3 SN12

31

Cned Acadmie en ligne

Les rsultats exprimentaux sont consigns dans le tableau ci-dessous :


Culture 1 Temps dexposition aux UV (secondes) Nombre total de colonies au bout de trois jours Colonies rouges Colonies crmes 0 50 48 2 Culture 2 2 25 20 5 Culture 3 5 15 8 7 Aide Dcrire = crire les constats, aucune explication nest demande. Dduire = donner une rponse au problme que soulve les constats. Expliquer = dire pourquoi on observe telle chose. On connat lexplication, il faut donc utiliser les connaissances acquises prcdemment. On rdige alors une phrase du type : je sais que (on nonce ses connaissances), cest pourquoi (on nonce ce que lon doit expliquer). Culture 4 10 10 0 10

3 Que met en vidence la culture n 1 ? 4 Calculer le pourcentage de co-

lonies survivantes dans chaque culture ainsi que le taux de mutation dans chaque bote en % (Taux de mutation = (nombre de colonies mutes x 100) / nombre de colonies au dpart. Reporter les rsultats dans un tableau.
5 Tracer le graphique de la survie

des levures (% de colonies survivantes en fonction du temps dexposition aux UV) puis exploitez-le (= dcrire, dduire ou expliquer).
6 Tracer le graphique montrant

lvolution du taux de mutation en fonction du temps dexposition aux UV puis exploiter-le.


7 Conclusion : Lhypothse formule au dpart est-elle valide ?

Aide la ralisation du graphique laide du logiciel Open Office Calc version 3 :


E Ouvrir

un fichier dans le classeur de Open Office.

E Construire

et remplir un tableau de mesures : Inscrire la signification et les valeurs de la variable X (qui apparatront en abscisses) dans la colonne de gauche. Inscrire la signification et les valeurs de la variable Y (qui apparatront en ordonnes) dans la seconde colonne.

32

Squence 3 SN12

Cned Acadmie en ligne

E Construire

un graphique du type Y = f(X) : Cliquer la 1re cellule des valeurs de la colonne X (ou de son intitul pour faire apparatre le nom des courbes dans le cadre Lgende du diagramme) et tendre la slection lensemble du tableau avec la souris. OpenOffice mettra automatiquement en X les donnes de la premire colonne de gauche et en Y celles des diffrentes colonnes de droite. Cliquer insertion Cliquer sur Dans Assistant de diagramme : 1- Type de diagramme Choisir et points et lignes

Cliquer Suivant 2- Plage de donnes Slectionner la 1re ligne comme tiquette Cliquer suivant 2 fois 3- lments du diagramme Taper le titre du diagramme et les titres des axes X et Y Cliquer terminer
E Imprimer

le graphique : Agrandir le graphe avec la souris en maintenant la touche shift () enfonce pour faire apparatre entirement le titre Slectionner toutes les colonnes de donnes Cliquer droit sur le graphe et copier-coller dans un fichier de traitement de texte avant dimprimer

2. Quelques

exemples dans les populations humaines

Activit 5

Consquences possibles dune mutation


Recenser, extraire et organiser des informations Exploiter les textes du document 4 afin de complter le tableau propos, justifiant les affirmations suivantes :

Squence 3 SN12

33

Cned Acadmie en ligne

Suivant quelles affectent des cellules germinales ( lorigine des cellules sexuelles) ou des cellules somatiques (autres que les gamtes), les mutations sont ou non transmissibles la descendance. Elles peuvent conduire une variabilit gntique non pathologique ou des cancers, dans lesquels lenvironnement joue un rle non ngligeable, ou encore des maladies hrditaires plus ou moins graves.
Document 4
A- 25 ans aprs Tchernobyl Le 26 avril 1986, lexplosion dun racteur de la centrale de Tchernobyl provoquait un rejet de radioactivit dans latmosphre durant plus de 10 jours Le principal effet sanitaire depuis laccident a t une augmentation du nombre de cancers de la thyrode (glande la base du cou) chez les enfants de moins de 15 ans (700 cas dclars au lieu de quelques dizaines en temps normal) Laugmentation apparat chez les enfants ns avant la catastrophe ou exposs durant la grossesse de leur mre, mais pas chez ceux ns plus tard Certains rayons radioactifs peuvent provoquer des lsions varies : ruptures au niveau des liaisons entre les bases azotes de lADN, ce qui spare les deux brins de la molcule, modifications chimiques de certaines bases azotes Selon la dose de radiation absorbe, le mtabolisme ou le processus de dveloppement peuvent tre modifis B- Soleil et ADN Lexposition prolonge au rayonnement solaire peut dclencher, surtout chez les individus peau claire, des lsions de lADN des cellules de la peau. En effet, le soleil met des rayons trs pntrants, les UV, qui peuvent altrer considrablement le matriel gntique Certaines de ces mutations sont lorigine dune prolifration de clones cellulaires ; il se forme des tumeurs qui voluent frquemment en cancers. En France, prs de 100000 cas de cancers de la peau sont diagnostiqus tous les ans et laugmentation annuelle est denviron 10%. Lun des cancers, le mlanome malin, est la premire cause de cancer chez les adultes.

C- Dans lespce humaine, la plupart des gnes existent sous diffrents allles lorigine de caractres normaux . Par exemple, le gne responsable du caractre groupe sanguin du systme ABO prsente 3 versions allliques : A, B et O. Selon les 2 allles possds, un individu un individu sera de groupe A, B, AB ou O.

D- La mucoviscidose est une maladie grave qui atteint 1 enfant sur 2 500 en France, filles et garons confondus. Le gne responsable est localis sur le chromosome 7. La squence des allles de ce gne a t dtermine. La maladie ne se dclare que si les deux chromosomes 7 des cellules dun individu sont porteurs du mme allle responsable de la maladie.

Type de cellule

Transmissibilit

Consquences

Exemples

34

Squence 3 SN12

Cned Acadmie en ligne

retenir Les mutations affectent tous les types de cellules. Pour un gne la frquence des mutations spontanes est faible (1 copie pour un million) mais elle peut augmenter par laction dagents environnementaux dits mutagnes. Les agents mutagnes accentuent les lsions spontanes de lADN et les mutations sont les consquences de ces lsions non rpares et donc conserves. Les agents mutagnes sont de deux ordres : agents physiques (rayons X, rayons gamma, rayons UV) et agents chimiques (benzne, acide nitreux). Les mutations affectant les cellules somatiques (cellules autres que les gamtes) se retrouvent dans le clone issu de leurs divisions mais disparaissent la mort de lindividu porteur. Elles peuvent tre lorigine de caractres pathologiques ou non. Les mutations affectant les cellules germinales (gamtes) peuvent tre transmises aux gnrations suivantes et deviennent alors hrditaires.

E Quels

sont les diffrents types de mutations?

Les diffrents types de mutations


Rappel : Vous avez appris en seconde quune mutation dun gne se dfinit comme un ou plusieurs changements de sa squence de nuclotides. Il sagit cette anne de caractriser prcisment les diffrents types de mutations pouvant affecter un gne lorigine de son polyalllisme. Reprenons lexemple dun gne polyalllique : le gne dterminant les groupes sanguins ABO

Document 5

Le dterminisme des groupes sanguins du systme ABO Les groupes sanguins sont lis la prsence la surface des hmaties (globules rouges) de molcules appeles marqueurs. Ces molcules sont synthtises lors de ractions biochimiques dont lune delle est catalyse par une enzyme code par un gne situ sur le chromosome 9. Ce gne possde 3 allles : les allles A et B permettent la synthse dune enzyme fonctionnelle A ou B, lallle O la synthse dune enzyme inactive.

Squence 3 SN12

35

Cned Acadmie en ligne

Schmatisation des vnements se droulant lintrieur dune hmatie dun individu de groupe A on peut crire : [A]
allle A marqueur A hmatie du groupe A

chromosome 9

enzyme A

molcules prsentes dans les cytoplasmes des cellules allle B marqueur B hmatie du groupe B

chromosome 9
E Comment

enzyme B

expliquer gntiquement lexistence du groupe AB?

Chez un individu de groupe AB, les hmaties ont la fois le marqueur A et le marqueur B : les deux enzymes sont synthtises. Ceci est possible car dans nos cellules, nous avons deux allles de chaque gne. On peut donc avoir lallle A et B. On peut crire la combinaison alllique possde dans ce cas par (A//B).

Activit 6

Relations entre les allles ABO et les marqueurs synthtiss


Recenser, extraire et organiser des informations Daprs le document 5, complter le schma prcdent et les tableaux ci-dessous : Tableau indiquant, pour chaque allle du gne, lenzyme rsultant de son expression ainsi que le marqueur synthtis

ALLELE A B O

ENZYME produite

MARQUEUR prsent la surface des hmaties

Tableau indiquant pour chaque combinaison dallles possible les protines synthtises, les marqueurs fabriqus ainsi que le groupe sanguin en rsultant :
Combinaison dallles (A//A) Enzyme(s) synthtises Enzyme A Marqueur(s) synthtis(s) Marqueurs A Groupe sanguin [A]

36

Squence 3 SN12

Cned Acadmie en ligne

Activit 7

La nature des mutations lorigine des allles ABO


Recenser, extraire et organiser des informations. Raisonner pour proposer une explication.
Donnes sur les allles ABO : Le document 6 prsente la comparaison dun des brins de lADN des 3 allles du gne des groupes sanguins du systme ABO, diffrents endroits de la squence. Les parties de squences prsentes sont suffisantes pour comprendre les types de mutations qui ont t lorigine des 3 allles.

Document 6

Fin de squence nuclotidique des 3 allles

Comparaison de la squence des allles A et O entre le 240me nuclotide et le 269me (en amont la squence est rigoureusement identique)

Comparaison de la squence des allles B et O entre le 240me nuclotide et le 269me (en amont la squence est rigoureusement identique)

Comparaison avec alignement des allles A et O (lalignement consiste aligner les portions de A et O contenant des squences identiques face face, mme si dans la ralit elles sont dcales). En aval de la squence prsente, il y a identit totale des nuclotides.

Squence 3 SN12

37

Cned Acadmie en ligne

Comparaison avec alignement des allles B et O. En aval de la squence prsente, il y a identit totale des nuclotides

1 Saisies des donnes.

a- Reprendre le document 2 et rappeler les diffrences entre les deux allles A et B. b- Combien de nuclotides comporte chaque allle ? c- Daprs la comparaison simple des allles A et B par rapport O, quels constats faites-vous ? d- Que constatez-vous lorsque les portions de A et B par rapport O sont alignes ? Proposez une explication.
2 Exploitations des donnes.

a- Lapparition dallles nouveaux est explique par la survenue de mutations qui affectent des allles dj existants. Quels constats sont favorables cette explication ? b- On distingue plusieurs types de mutations dites ponctuelles car ne concernant quun nuclotide de la squence dun gne : Les mutations par substitution : remplacement dun nuclotide par un autre. Les mutations par insertion ou addition : ajout dun nuclotide entre 2 nuclotides de la squence. Les mutations par dltion : perte dun nuclotide dans la squence. Dans lhistoire volutive du gne tudi, les scientifiques ont montr que les allles 0 et B sont apparus par mutation de lallle A. Identifier les types de mutations lorigine de lapparition des allles B et O. c- Dans lhypothse o lallle O est le plus ancien, proposez une explication sur lorigine des allles A et B.
retenir Ltude des gnes des populations actuelles montre que leur polyalllisme rsulte de laccumulation de mutations survenues au cours de lvolution. Les mutations dun gne sont lorigine dallles nouveaux. Elles modifient alatoirement la squence nuclotidique du gne et consistent soit en : une substitution (changement dun ou plusieurs nuclotides) une insertion ou addition (gain dun ou plusieurs nuclotides) une dltion (perte dun ou plusieurs nuclotides) Ainsi la majorit des gnes sont polyallliques.

38

Squence 3 SN12

Cned Acadmie en ligne

Les mutations fondement de la biodiversit


Une espce, par dfinition, est un ensemble de populations dindividus, interfcondes entre elles et isoles au point de vue reproductif de toute autre espce. Nous avons appris quau sein dune population, la plupart des gnes existe sous diffrentes versions ou allles, chaque individu en possdant deux pour chaque gne. Reprenons lexemple du gne des groupes sanguins du systme ABO pour caractriser la diversit alllique dune population au sein de lespce humaine.

Activit 8

tude de la frquence des allles A, B et O dans diffrentes populations humaines Recenser, extraire et organiser des informations. Raisonner. Rpartition statistique des allles A, B et O dans quelques populations (frquence en %)
Groupe Population Franais Chinois Russes Pygmes Hindous Sudois A 27.8 22.0 25.0 22.7 20.6 30.7 B 8.8 20.1 18.5 21.9 25.4 7.4 Aide Comparer judicieusement des populations dont la couleur de peau est diffrente (par exemple Russes et Pygmes) ou dont la couleur de peau est identique (par exemple Russes et Sudois). O 63.4 57.9 56.5 55.4 54.0 61.9

Document 7

Ce tableau illustre le fait que des populations gographiquement loignes possdent toutes le gne. Ce qui les distingue, cest la frquence relative des 3 allles. Cette tude permet dillustrer la diversit alllique mais aussi de rendre caduque la notion de races humaines base sur des critres morphologiques comme par exemple celui de la couleur de la peau.

Rechercher daprs les donnes du tableau, quelques exemples qui illustrent que la rpartition statistique des allles du gne du systme sanguin ABO ne concide pas avec la notion de races humaines base sur la couleur de la peau.

Squence 3 SN12

39

Cned Acadmie en ligne

retenir Au sein dune espce, les populations partagent les mmes gnes avec des frquences allliques diffrentes. Les mutations sont la source alatoire de la diversit des allles ; En cela, elles sont le fondement de la biodiversit gntique des populations.

Bilan du chapitre
LADN est une molcule fragile qui peut subir des endommagements, notamment lors de la rplication, et tre lorigine de mutations conserves transmissibles ou non selon les cellules concernes. Les mutations sont spontanes mais leur frquence est augmente par des agents favorisants appels mutagnes. Alatoires, les mutations sont la source de la diversit des allles des diffrents gnes. En cela, elles fondent la biodiversit gntique des individus.

40

Squence 3 SN12

Cned Acadmie en ligne

ynthse de la squence 3
Chez les Eucaryotes, les chromosomes qui portent linformation gntique sont des structures constantes et permanentes des cellules. Au cours dun cycle cellulaire (interphase et mitose), ils sont dans un tat de condensation variable. Pour les cellules somatiques, la mitose est une reproduction conforme en ce qui concerne le nombre et le type de chromosomes. Le caryotype est donc conserv au cours des gnrations cellulaires. Il existe cependant des anomalies chromosomiques qui peuvent altrer le caryotype et avoir des consquences sur les caractristiques de lindividu porteur. LADN est le support molculaire des chromosomes. Chaque chromatide dun chromosome double contient une molcule dADN. Lors de linterphase, en phase S, lADN subit une rplication semi-conservative qui permet de conserver la mme squence de nuclotides et donc le mme message gntique dans les deux molcules filles issues dune molcule mre. Ainsi, la rplication de lADN au cours de linterphase et la rpartition des chromosomes en deux lots identiques lors de la mitose sont les deux mcanismes cellulaires ncessaires la reproduction conforme aux chelles molculaire et cellulaire.

Squence 3 SN12

41

Cned Acadmie en ligne

E
Exercice 1

xercices de la squence 3
Mobiliser ses connaissances
1 Dfinir brivement les termes suivants :

Chromatide Mitose Phase S Rplication semi-conservative Chromatine.


2 Rdiger une phrase correctement construite en associant les termes

suivants : a- Chromosomes doubles Mtaphase Plaque quatoriale. b- Chromosomes simples Anaphase deux lots.
3 QCM : Entourer la ou les affirmations(s) exacte(s).

a- Les chromosomes sont visibles durant tout le cycle cellulaire. b- Lors de la mitose, les chromosomes sont dcondenss. c- Chaque chromatide est constitue dune molcule dADN. d- La rplication de lADN fait intervenir lARN polymrase. e- La rplication de lADN a lieu lors de la mitose. f- La rplication de lADN a lieu durant linterphase. g- La rplication est dite semi-conservative car elle conserve la moiti des chromosomes. h- La rplication est dite semi-conservative car elle conserve un des deux brins des molcules dADN. i- Une mutation est lorigine de la cration dun nouveau gne. j- Une mutation est lorigine dun nouvel allle dun gne. k- Une mutation par dltion rajoute un nuclotide dans la squence dun gne.

Exercice 2

Raisonner. Appliquer une dmarche dductive La BrdU est une molcule analogue au nuclotide thymine. Dans un milieu de culture contenant de la BrdU, les cellules lincorporent la place des nuclotides thymine au moment de la rplication de lADN. Grce une mthode de coloration des chromosomes, lincorporation de BrdU a une consquence observable : Si lADN ne comporte plus de thymine, les chromatides sont peu colores (pointills sur le schma). Si lincorporation de BrdU nest que partielle, les chromatides sont normalement colores (en noir sur le schma).

42

Squence 3 SN12

Cned Acadmie en ligne

Des cellules cultives jusque-l sur un milieu avec thymine, sont places en dbut dinterphase dans un milieu de culture o la thymine est remplace par la BrdU. Au cours dun des cycles cellulaires suivants, une observation est ralise aprs coloration.
1 Aprs avoir schmatis la structure dune portion de molcule dADN

initiale (longueur de la squence limite 10 nuclotides), expliquez et illustrez son devenir dans le milieu de culture contenant la BrdU. Vous Indiquerez, en le justifiant, quel moment prcis et au cours de quel cycle cellulaire a t ralise lobservation traduite par le dessin.
2 Immdiatement aprs la division cellulaire dessine ici, les cellules

filles sont replaces dans un milieu normal. Indiquez laspect (ou les aspects) prvisible(s) des chromosomes la mitose suivante. Justifiez.

Exercice 3

Extraire et organiser des informations. Raisonner. Appliquer une dmarche dductive. Formuler une hypothse. ADN et formation des spermatozodes La spermatogense est le processus par lequel les spermatozodes sont forms. Les spermatozodes des animaux mles se forment dans les testicules. Chez les mammifres, les cellules souches lorigine des spermatozodes sont les spermatogonies. Celles-ci se multiplient pour en-

Squence 3 SN12

43

Cned Acadmie en ligne

tretenir un stock permanent de cellules souches. partir de la pubert, lorsque la fonction de reproduction devient oprationnelle, certaines spermatogonies se transforment progressivement et se divisent en passant par diffrents stades (qui constituent la ligne spermatique). Les tapes de la spermatogense sont illustres par le schma suivant :

Utiliser les informations du tableau suivant pour dterminer :


1 Le(s) nom(s) des cellules qui subissent une mitose. Justifier la r-

ponse.
2 Le(s) nom(s) des cellules qui subissent une division diffrente de la

mitose. Justifier la rponse.


3 Formuler une hypothse en ce qui concerne le caryotype des cellules

issues dune division diffrente de la mitose.


Aide La question 3 est difficile mais essayez dy rflchir
E Anticiper

le fait que les gamtes sont lorigine dune potentielle cellule uf lors de la fcondation. La fcondation doit donc rtablir un caryotype 2n chromosomes avec 2 exemplaires de chaque type (soit 23 paires dans lespce humaine) qui sera celui de lindividu qui en rsultera.

E Raisonner

en mettant en relation le taux dADN dans les cellules et leur garniture chromosomique possible (nombre et type de chromosomes et nombre de chromatides par chromosome).

44

Squence 3 SN12

Cned Acadmie en ligne

Devoir autocorrectif n 2
Important

Ce devoir nest pas envoyer la correction.

Partie 1

Restitution organise de connaissances


Expliquer et illustrer par un choix judicieux de schmas la notion de reproduction cellulaire conforme dun point de vue qualitatif au niveau chromosomique et molculaire.

Partie 2 Exercice 1

Pratique du raisonnement scientifique Recherche dinformations utiles la rsolution dun problme scientifique. partir de lexploitation du document, tudiez les rles des rayons UV et du gne de lenzyme ERCC3 dans lapparition des taches brunes chez un individu atteint de Xeroderma pigmentosum. Le Xeroderma pigmentosum est une maladie rare hrditaire marque par lapparition de taches brunes sur la peau dues une mortalit cellulaire importante. Des risques accrus de dvelopper des cancers de la peau existent chez les malades.
1 Les rayons UV peuvent endommager lADN de cellules entranant, par

exemple, la formation dune liaison entre deux thymines successives. Ces deux thymines lies par une liaison covalente forment alors un dimre de thymine. La prsence de ces dimres perturbe le fonctionnement cellulaire et provoque la mort des cellules.
G C T A T A A T C G ADN non altr UV G C T A T A A T C G

ADN avec dimres de thymine

2 On prlve des cellules chez un individu sain et chez un individu at-

teint de Xeroderma pigmentosum. Ces cellules sont soumises des doses croissantes de radiations UV. On mesure, 24 heures plus tard, le nombre de dimres de thymine dans lADN de ces cellules en fonction de lintensit du rayonnement auquel elles ont t soumises. Les rsultats obtenus sont prsents ci-aprs.

Devoir autocorrectif SN12

45

Cned Acadmie en ligne

Frquence des dimres de Thymine (unit arbitraire)

20 Individu sain 15 Individu atteint du Xerodema pigmentosum

10

0 0 25 50 75 Dose dU.V. (erg.mm2) 100

3 On prlve des cellules chez un individu sain et chez un individu at-

teint de Xeroderma pigmentosum. Ces cellules sont mises en culture puis soumises pendant une dure donne un rayonnement UV de 25 erg mm-2. On mesure ensuite lvolution du pourcentage de dimres de thymine dans lADN des cellules de ces deux cultures. Les rsultats obtenus sont prsents ci-dessous.
% de thymine prsente ltat de dimre dans lADN 0,10 Cellules dun individu atteint du Xerodema pigmentosum

0,05 Cellules dun individu sain

0 12h 24h temps

4 Lenzyme ERCC3 permet la rparation des dimres de thymine dans

lADN. La squence du gne codant pour cette protine a t dtermine : elle est identique chez tous les sujets atteints de Xeroderma pigmentosum. On compare une portion de la squence des allles de ce gne chez un individu sain et chez un individu malade. Chaque individu atteint possde deux allles muts identiques.
Sain Malade AAAGAAGAGCAACAG AAAGAAGAGAAACAG

46

Devoir autocorrectif SN12

Cned Acadmie en ligne

Exercice 2

Rsolution dun problme scientifique partir de lexploitation de documents en relation avec les connaissances. Utilisez les informations apportes par les documents 1 et 2 ainsi que vos connaissances, pour montrer lchelle cellulaire et molculaire, les modifications du matriel gntique dune cellule, au cours du cycle cellulaire. volution de la quantit dADN au cours du temps
Quantit dADN par cellule (units arbitraires)

Document 1

10

15

temps (h)

Document 2

tapes dun cycle cellulaire observes au microscope optique a b

Devoir autocorrectif SN12

47

Cned Acadmie en ligne