ARTICLE IN PRESS

Tuberculosis (2008) 88, 273282

Available at www.sciencedirect.com

journal homepage: http://intl.elsevierhealth.com/journals/tube

Rv3134c/devR/devS operon of Mycobacterium bovis BCG is differentially transcribed under in vitro stress conditions
Juan German Rodrigueza, Claudia Sof Burbanoa, Carmen Nunezb, a a a a a a Clara Eugenia Gonzalez , Mar Mercedes Zambrano , Mar Jesus Garc b, a, Patricia Del Portillo
a b

Corporacion Corpogen, Carrera 5 No. 66A-34, Bogota, Colombia Departamento de Medicina Preventiva y Salud Publica, Facultad de Medicina, Universidad Autonoma de Madrid, st/Arzobispo Morcillo, 4. 28029-Madrid, Spain Received 8 August 2007; received in revised form 8 November 2007; accepted 29 November 2007

KEYWORDS
Mycobacterium bovis; M. tuberculosis; DevR/DevS twocomponent system; Dormancy

Summary DevR is a transcriptional regulator that mediates the genetic response of Mycobacterium tuberculosis and Mycobacterium bovis to oxygen limitation and nitric oxide exposure. devR is part of an operon that includes the genes devS and Rv3134c, which encode an oxygen sensor protein and a protein that contains a universal stress protein domain, respectively. Here, we report the transcriptional analysis and quantitative expression of Rv3134c/devR/ devS under in vitro stress conditions including oxygen limitation, low nutrients and ex vivo macrophage infection. At least three different promoters were found to control Rv3134c/ devR/devS expression under the stresses tested. Two promoters were identied upstream of devR, one was active under hypoxia and the other under nutrient starvation. A single promoter was identied upstream of Rv3134c, and transcripts from this promoter were detected only under hypoxia. Rv3134c to devR were found to be co-transcribed only under hypoxia, whereas devR/devS were co-transcribed both in aerobiosis and starvation. RTqPCR showed an increase in the ratio hypoxia/aerobiosis and in starvation/nutrients in all genes. devR/devS showed transient expression in the rst days of macrophage infection. Our results indicate that Rv3134c/devR/devS of M. bovis BCG constitutes an operon with complex regulation that participates in bacterial response against a wide range of stresses. & 2007 Elsevier Ltd. All rights reserved.

Corresponding author. Tel.: +57 1 3484609; fax: +57 1 3484607.

E-mail address: pdelportillo@corpogen.org (P. Del Portillo). 1472-9792/$ - see front matter & 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.tube.2007.11.011

ARTICLE IN PRESS
274 J.G. Rodriguez et al. operon in Mycobacterium bovis BCG under stress conditions that included in vitro oxygen depletion and low nutrients, as well as ex vivo macrophage infection. M. bovis BCG was used in this study because the structural organization of the Rv3134c/devR/devS region is identical, to that of M. tuberculosis H37Rv and it has been previously shown that oxygen depletion also induces a dormancy response in M. bovis BCG.13,20

Introduction
It is estimated that one-third of the global population is infected with Mycobacterium tuberculosis the causative agent of human tuberculosis.1 Around 9095% of the infected population is able to control the disease but can nevertheless remain latently infected in a physiological condition characterized by a positive skin test and no demonstrable clinical or radiological signs of active disease.2 In the latent infection a residual population of viable bacteria can be maintained for long periods of time, constituting an important mycobacterial reservoir.3,4 A better understanding of the hostpathogen interactions that result in latent infection could therefore provide important insights for efcient tuberculosis control. Recent reports suggest that M. tuberculosis coexisted with early hominids and that therefore both the bacillus and its host have developed strategies to coexist.5 In this context, latency could be considered to be the result of a continuous cross talk between the host immune system and the pathogen.6 M. tuberculosis has developed a series of adaptation mechanisms to the numerous environmental conditions that the host offers such as oxidizing agents, low pH, hypoxia and nutrient starvation, among others.7 Two-component regulatory signal transduction systems (TCS) are one of the major mechanisms by which bacteria can deal with changes in environmental conditions. These signal TCS involve a sensor histidine kinase (HK) that is autophosphorylated in response to an environmental stimulus. The phosphoryl group is then transferred to a response regulator protein (RR) which modulates gene expression in an appropriate bacterial response.810 The genome of M. tuberculosis H37Rv has revealed the presence of 11 pairs of TCS including phoP phoR, mprAmprB, prrAprrB, regX3senX3, trcRtrcS, devRdevS and kdpEkdpD11 and, more recently, PdtaS PdtaR.12 The genome also contains 3 isolated regulators and 3 isolated sensor proteins.11 These TCS are expected to modulate gene expression and direct the adaptation of tubercle bacilli to hostile environmental challenges in order to survive within the human host.13 Among the TCS, the devR (Rv3133c; BCG 3156c)/devS (Rv3132c; BCG 3155c) genetic system (also known as dosR/ dosS) has been amply studied. It was rst identied by its differential expression in the virulent M. tuberculosis H37Rv and the avirulent M. tuberculosis H37Ra strains.14 The devS gene that encodes a sensor HK protein of 578 amino acids is preceded by the devR gene which encodes an RR protein of 217 amino acids.14 DevR is a transcriptional regulator that mediates the response of M. tuberculosis to oxygen limitation and which, under hypoxic conditions, regulates the expression of around 48 genes.1517 This transcriptional factor is also induced by nitric oxide.18 Twenty-seven base pairs upstream of devR is the gene Rv3134c (BCG 3157c), that is presumably in the same operon and transcribed in the same direction as the TCS. It is predicted to encode an AlaVal rich protein of 268 amino acids containing a universal stress protein domain.14 Studies of Rv3134c/devR/devS operon in M. tuberculosis under aerobic culture conditions have demonstrated multiple transcriptional start points, thus indicating a complex regulation of these genes.19 In this paper, we report the transcriptional analysis and the quantitative expression of the Rv3134c/devR/devS

Materials and methods

M. bovis BCG culture conditions
For all experiments M. bovis BCG Pasteur strain 1137P2 was grown in Middlebrook 7H9 broth (Difco) plus 10% OADC supplement (Becton Dickinson) and 0.05% v/v Tween 80 (JT Baker), unless otherwise specied. The aerobic cultures were grown to exponential phase (OD600 of 0.5) in 500 cm asks at 37 1C and 90 rpm. The in vitro low oxygen stress condition was performed as described previously,13 with minor modications. The primary culture was diluted to an OD600 of 0.020.03 in 400 ml of fresh medium in a 1 l ask, grown to an OD600 of 0.40.5 (exponential phase) and then divided in halves. One half was centrifuged at 4600g, and cells were resuspended in fresh medium and grown with agitation as described above (aerobic culture). The other half was divided into 13 ml cultures that were dispensed in 5 15 ml screw-capped polypropylene tubes and maintained static throughout the experiment (hypoxic culture). A parallel culture with methylene blue, which was monitored daily by spectrophotometric reading at 665 nm, was used as an indicator of oxygen consumption. Hypoxic cultures were processed at 0, 10 and 20 days to extract RNA. Low nutrient experiments were performed according to Betts et al.21 The primary culture was diluted to an OD600 of 0.020.03 in 250 ml fresh medium in a 1 l ask, grown to exponential phase and then divided in halves. Cells were pelleted by centrifugation and resuspended in either 7H9 medium or PBS. RNA isolation was carried out at 0, 4 and 15 days.

Macrophage culture and mycobacterial infection

M. bovis BCG was grown to exponential phase (OD600 0.40.6) and resuspended in cell culture medium (DMEM, Gibco BRLs), supplemented with inactivated 10% fetal calf serum (Gibco BRLs) without adding antibiotics. Aliquots were stored at 70 1C. The J774 murine macrophage cell line was prepared and infected as previously described.22 Before infection the bacterial clumps were dispersed by shaking in a bead beater (BioSpec Products) in the presence of 0.71 mm glass beads for few seconds. For each time point, 6 107 macrophages were infected using 1:5 (macrophage:bacilli) as multiplicity of infection (MOI). Uptake of bacteria by macrophages was analyzed by acid-fast staining of the monolayer. After 6 h of phagocytosis, extracellular bacteria were eliminated by washes with fresh warmed medium. Infected monolayers were recovered by adding guanidium isothiocyanate, and the macrophages were lysed at 0, 24 and 72 h after infection. The bacteria were

ARTICLE IN PRESS
Rv3134c/devR/devS operon of Mycobacterium bovis BCG is differentially transcribed under in vitro stress conditions 275 harvested by centrifugation and the mycobacterial RNA was isolated from each sample as described previously.22 followed by enzyme inactivation at 70 1C for 15 min. The residual RNA was removed using RNAase H and T1. Excess nucleotides and primers were removed from the rst strand product by column purication according to the manufactures instructions. Addition of the dC tailing to the 30 end cDNA was carried out using 15 ml of the cDNA puried sample, and the nal composition of the reaction was: 10 mM TrisHCl (pH 8.4), 25 mM KCl, 1.5 mM MgCl2, 200 mM dCTP and 1 ml terminal deoxynucleotidyl transferase (TdT). Previous to addition of the TdT enzyme, the mix was incubated for 23 min at 94 1C and chilled on ice. After addition of TdT enzyme, the reaction was incubated 1 h at 4 1C on ice, nally the enzyme was inactivated at 65 1C for 10 min. 45 ml of the tailed cDNA obtained from the above protocol was amplied by PCR using the abridge amplied primer (AAP) supplied by the Kit and a specic primer (GSP1) designed downstream of the ATG of each gene (Table 1). The PCR conditions were: 20 mM TrisHCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 400 nM of each primer, 200 mM each dNTP and 2.5 U Taq DNA polymerase (CorpoGen). Reactions were maintained at 4 1C on ice until denaturation step. The reaction mix was heated to 94 1C for 4 min before cycling for 35 cycles of 94 1C for 30 s, 63 1C for 30 s and 72 1C for 30 s; followed by a nal extension of 72 1C for 7 min. A 1/100 dilution of the PCR was re-amplied using the Abridged Universal Amplication Primer (AUAP) supplied by the Kit and a new set of specic nested primers (GSP2) (Table 1) in a nal concentration of 200 nM. The reaction conditions were as described above. The amplied products were analyzed by electrophoresis in 1.5% agarose gels stained with ethidium bromide. Nested amplied products were cloned using the TOPO TA II cloning system (Invitrogen) and veried by PCR with M13 universal primers.

RNA preparation
About 2030 ml of the cultures was centrifuged at 4600g, the cells were washed once with TE (TrisHCl 10 mM, pH 7.5, EDTA 1 mM) and then broken with zirconiumsilica beads (0.1 mm) in the presence of acid phenol (0.3 M sodium acetate)/Fabuloso cationic detergent (Colgate Palmolive, Colombia)/ chloroform (1/1/0.2) in a Mini-Bead BeaterTM (BioSpec Products) at fast speed during 1 min. RNA was then chloroform extracted and precipitated with isopropanol containing 0.3 M sodium acetate. Pelleted material was washed in 70% ethanol and resuspended in 30 ml of RNAse free water. The RNA was analyzed by electrophoresis and quantied by spectrophotometry at 260 nm.

Transcriptional analysis by RACE

The transcriptional start points were determined in RNA puried from broth cultures using rapid amplication of cDNA ends (RACE system Version 2.0, Invitrogen Life Technologies), to amplify the 50 ends of the transcribed selected genes, following the manufacturers recommendations. The designed specic primers near to the 50 ends are listed in Table 1 and Figure 1A. For cDNA synthesis 400500 ng of total RNA in a nal volume of 50 ml was used; the nal composition of the reactions was: 200 U SuperScriptTM II RT, 20 mM TrisHCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 10 mM DTT, 100 nM cDNA specic primer and 400 mM each dNTP. The reactions were incubated for 50 min at 50 1C

Table 1

Primers used in this study. Primer RT1 RT2 RT3 RT5 cD3134 cDevR cDevS GSP 3134 GSP devR GSP devS Nes3134 NesDevR NesDevS QRT 1 QRT 2 QRT 3 QRT 4 QRT 5 QRT 6 QRTf 16S QRTf 16S Sequence (50 30 ) ATC GAA TTC TCG CCG ACC GAA TGT TCC TA ATC GGT ACC CGT AGT TGG GAG AGC GTG TG ATC GAA TTC GCC GGG TCA GCT GTT CGT CG GCG GCA CGC ATT CGA GGA ACC GCG GAC ATG ATC AAG GCC AAC TCC ATT CCC TTG TAG GCC TTT CGG TAG GTG CCG AAC CGA CGC ACA GCA TC GCA CCG GCG AGA ATC GCA TC ATC CGC CGA ACG GTC TCC TC CGG ACC TGG ACT CCT GCA TC GCA TGG CCT CGT CAG AGG TG CCG GTC GTG CAC CTC CAT AG TGCGCTGTCTGATCCTCACG CGCCAACTCCATTCCCTTGA TGCTGTCCCGCACGAACGTA CGATGCTCCGTGCAGGTCAT GCTGTCCACGCTGCTGAAAC GGTAGAGCCGGGTCCAGTG ATGACGGCCTTCGGGTTGTAA CGGCTGCTGGCACGTAGTTG 110 118 100 109 PCR (bp) Amplied region

Experiments RT-PCR

219 419

devR/devS Rv3134c/devR

RACE

50 50 50 50 50 50

end end end end end end

RT-qPCR

devR devS Rv3134c 16S

ARTICLE IN PRESS
276 J.G. Rodriguez et al.

cdevS
QRT3 QRT4 QRT1

cdevR
QRT2 QRT5

c3134c
QRT6

devS RT1 RT2

dev R RT3

Rv3134c RT5

-120
devR

Rv3134c

-40

AEROBIC 1 2 3 4 1

HYPOXIC 2 3 4

PCR RT1/RT2

219 bp PCR RT3/RT5 1 2 3 4 1 2 3 4 5

419 bp

Figure 1 (A) Schematic representation of the Rv3134c/devR/devS genomic region of Mycobacterium bovis BCG. Large arrows represent the ORFs. The small arrows represent primers used to amplied intergenic regions in RT-PCR experiments. Gray arrows above represent primers used for cDNA synthesis in RACE experiments. (B) Electropherograms obtained from 50 RACE-PCR experiments in hypoxic condition. Their corresponding sequences are shown for the 120 and 40 bp TSP (black arrows). The last base after the dC tail corresponds to the rst transcribed nucleotide (TSP). Vertical black bars represent the consensus sequence recognized by the DevR protein according to Ref. 19 (C) RT-PCR with primers RT1 and RT2 in aerobic and hypoxic conditions. (D) RTPCR with primers RT3 and RT5 in aerobic and hypoxic condition. Lane 1: control without AMV retrotranscriptase; lane 2: cDNA obtained in aerobic or hypoxic condition; lane 3: DNA positive control; lane 4: negative control; lane 5: molecular weight markers (100 bp, Promega). Arrows indicate the molecular size of the amplied band.

Recombinant plasmids were sequenced (Macrogen) and the data were subsequently analyzed by BLAST tools.

Analysis of Rv3134c/devR/devS co-transcription using RT-PCR

To determine transcriptional coupling, we designed primers to amplify the intergenic regions of Rv3134c/devR/devS genes23 (Table 1, Figure 1A). cDNA was prepared from RNA

isolated from cultures under hypoxic and starvation conditions using AMV-RT and random hexamers (Promega). Amplications were performed in a nal volume of 20 ml containing 1 PCR buffer, 1.5 mM MgCl2, 0.5 mM primer, 0.12 mM dNTPs and 0.5 U of Taq DNA polymerase (CorpoGen). The PCR was performed with a denaturation step of 94 1C for 4 min following for 35 cycles of 94 1C for 30 s, 60 1C for 30 s, 72 1C for 30 s and a nal extension at 72 1C for 5 min. The products were analyzed by 1.5% agarose gel electrophoresis.

ARTICLE IN PRESS
Rv3134c/devR/devS operon of Mycobacterium bovis BCG is differentially transcribed under in vitro stress conditions 277

Analysis of gene expression by reverse transcription quantitative PCR

Two independent RNA samples were treated with DNase I (Promega) and duplicate cDNA synthesis of each one was performed using AMV-RT (Promega) and random hexamers (Invitrogen). For primer annealing, 400 ng of RNA and 1 mM of random primers were heated to 93 1C for 2 min in a volume of 15 ml and then snap cooled on ice prior to the addition of the remaining components. Reverse transcription was carried out in a nal volume of 50 ml containing 0.2 mM of each dNTP, 10 U AMV-RT and 50 mM KCl, and incubated at 50 1C for 50 min. Finally, the enzyme was heat inactivated to 65 1C for 15 min. In the case of cDNAs prepared from RNA puried from intracellular bacteria, the conditions were modied as follows: 500 ng RNA; 1 mM random primers; 1 mM dNTPs; 40 U RNAse inhibitor (Rnasin Plus- Promega); and 200 U of AMV-RT. Five microliter of two independent cDNAs was subjected to RT-qPCR using the light cycler and the Fast Start DNA Master Plus SYBR Green I System (Roche Molecular Diagnostic). Each cDNA was run by triplicate in a 15 ml reaction volume containing 1 Fast Start Master Plus SYBR Green I mix supplemented with 3.5 mM MgCl2, and 0.2 mM of each primer. Reactions were heated to 95 1C for 10 min before cycling for 35 cycles of 95 1C for 10 s, 60 1C (devR and 16S DNA), 62 1C (devS, Rv3134c) for 10 s and 72 1C for 10 s. Fluorescence was captured at the end of each cycle after heating to 80 1C to ensure the denaturation of primer dimers. At the end of the PCR a melting curve analysis was performed. For each pair of primers (Table 1) a DNA standard curve was carried out, and these values were used to calculate the number of copies detected in the samples. For the in vitro studies, absolute quantication was used while for macrophage analysis the data were normalized using 16S rRNA as reference. The results were statistically analyzed by means of a one-way ANOVA and, if appropriate, a Tukey test with the program Statistix 7.0 (Analytical Software).

In silico promoter analysis

Analysis of possible promoter regions was conducted using the programs MyPatternFinder (http://www.imtech.res.in/ raghava/MyPattern; D. Sharma and others, unpublished data) and neural network promoter prediction (NNPP) program (http://www.fruity.org/seq-tools/nnppAbs.htlm).

identify the second TSP located 273 bp upstream of devR and the TSPs upstream of Rv3134c (at 240 and 280 bp upstream), even though the sequences in this region are 100% identical in both M. bovis BCG and M. tuberculosis. These discrepancies are most probably due to the fact that with RACE, detection of long transcripts is difcult because of formation of secondary structures that interfere with the cDNA synthesis. In hypoxic condition, we detected two active TSP sites, the one previously identied 120 pb upstream from devR, and another located 40 pb upstream of Rv3134c (Figure 1B). These data indicate that under low oxygen tension, the Rv3134c/devR/devS operon is transcribed from two TSP, one upstream of the devR gene and other upstream of Rv3134c. In order to determine if the genes of the Rv3134c/devR/ devS operon are co-transcribed in hypoxia, we conducted RT-PCR experiments with primers designed to amplify the intergenic regions (Table 1, Figure 1A). Under aerobic and hypoxic conditions a band of the expected size (219 bp) was obtained with primers RT1 and RT2 designed to amplify the region between devS and devR (Figure 1C), suggesting that these genes are co-transcribed in both conditions. Regarding the genetic region between devR/Rv3134c, we did not observe the expected amplication band of 419 bp in the aerobic condition using primers RT3RT5, suggesting that these genes are independently transcribed (Figure 1D). By contrast, in hypoxic conditions we detected the expected amplication band (419 bp) for this genetic region (Figure 1D), suggesting that in this case a large transcript is made from Rv3134c to the devR gene. Reverse transcription quantitative PCR (RT-qPCR) was used to quantify the expression of the Rv3134c/devR/devS genes under hypoxic and aerobic conditions. Expression of the hspX gene was also analyzed because it has been shown to be overexpressed during hypoxic stress.15 As expected, expression of hspX was higher under hypoxia; by day 10, hspX expression was on average three times greater and was 50 times greater by day 20 in comparison with the aerobic cultures (Figure 2). The Rv3134c/devR/devS genes were also induced in hypoxic conditions. The Rv3134c gene had the maximum level of expression at day 10, which was 5.5-fold greater in comparison with the aerated control culture, expression that increased slightly by day 20 (8-fold). devR showed a 4-fold induction by day 10 and a 13-fold increase at day 20 with respect to the aerated control. devS gene expression increased 2-fold at day 10 and increase slightly to three times the aerobic culture at day 20 (Figure 2).

Results
Transcriptional analysis under hypoxic stress
In order to establish the transcriptional start point (TSP) of Rv3134c/devR/devS in M. bovis BCG, RNA from aerobic and hypoxic cultures was isolated, and 50 RACE experiments were carried out. Cultures were considered hypoxic at day 10, based on oxidation of methylene blue indicator dye. In our aerobic model we could detect a 120 pb TSP upstream of the devR gene inside the coding region corresponding to Rv3134c (Figure 1B), a result that is consistent with one of the TSPs identied previously.19 However, we failed to

Transcriptional analysis under nutrient stress

In order to analyze expression of the operon during low nutrient stress conditions, we performed RACE, RT-PCR and RT-qPCR experiments with RNA extracted from low nutrient cultures at days 4 and 15. RACE analysis identied a putative TSP located 102 bp upstream of devR (Figure 3A), indicating that devR/devS operon is expressed under nutrient stress and its transcription occurs from a different initiation site compared with the aerobic condition (120 pb). We were unable to detect a TSP upstream of Rv3134c. RT-PCR experiments of intergenic regions did not show positive amplication bands using RNA from a 4-day culture (data not

ARTICLE IN PRESS
278
Rv3134c devR

J.G. Rodriguez et al.

1.00E+06

1.00E+06

Aerobic Hypoxic 1.00E+04 0 10 Time (days) devS 20 1.00E+04 0

Aerobic Hypoxic 10 Time (days) 20

hspX

1.00E+06 1.E+06

Aerobic Hypoxic 1.00E+04 0 10 Time (days) 20 1.E+04 0

Aerobic Hypoxic 10 Time (days) 20

Figure 2 Expression levels of the genes in study at 0, 10 and 20 days of the experiment. Gray bars represent hypoxic condition. Black bars represent aerobic conditions. Error bars show 7standard deviation. Two independent RNA samples were analyzed, and mRNA levels were calculated by absolute quantication method.

shown). However, by day 15 of starvation, the RT-PCR analysis revealed amplication between the devR/devS genes although it failed to amplify the devR/Rv3134c region (Figure 3B). This result suggests the existence of a single transcript for devR/devS that is expressed independently of the Rv3134c gene, similar to what happens under aerobic conditions. RT-qPCR analysis indicated that although there was no induction at day 4 of starvation, by day 15 all the genes showed increased expression, with respect to the control condition, with the exception of hspX. Rv3134c had a 4.6-fold induction, devR had a 33-fold induction and devS had a 9.6-fold induction in comparison to normal culture (Figure 4).

In silico promoter analysis

The presence of various transcripts and, specically, the identication of different TSPs prompted us to search for possible 10 and 35 promoter consensus boxes that could control the transcription of this locus under the conditions tested in this work. Analysis of the regions upstream of the experimentally determined TSPs and consensus elements proposed for various M. tuberculosis sigma factors24 failed to identify perfect matches or sequences with one mismatch to the consensus 10 or 35 promoter elements. Sequences that were similar to consensus motifs corresponding to SigC (91.6%), SigH (72.7%), and SigE (70%) binding sites, were located upstream from the TSPs, results that must be further conrmed by electrophoretic mobility shift assay (EMSA) analysis (Table 2).

Expression of devR/devS inside murine macrophages

We also wanted to investigate if devR/devS could be induced in naive macrophages. The 16S rRNA content was used to normalize the quantication of relative expression. Our results showed that upon M. bovis BCG entry inside the cells, there is a transient increase in the expression of devR/devS at 24 h that then decreased by 72 h. Different levels of expression were observed for devR and devS, with devR expression being 20 times greater than that of devS (Figure 5).

Discussion
The DevR/S two-component regulatory system is involved in the adaptation of M. tuberculosis to in vitro hypoxic and NO exposures, conditions that resemble the environment inside granulomas in the course of in vivo infections.15,18 DevR is also required for the long-term survival of M. bovis BCG under hypoxic conditions, reason for which it received the name of dormancy survival regulator.20 Recently, transcriptomic analyses have demonstrated that this transcription

ARTICLE IN PRESS
Rv3134c/devR/devS operon of Mycobacterium bovis BCG is differentially transcribed under in vitro stress conditions 279

- 102

devR

Rv3134c

5'RACE PCR
PCR RT1/RT2 1 2 3 4 1 PCR RT3/RT5 2 3 4

219 bp

419 bp

Figure 3 (A) Schematic representation of the genetic organization of the Rv3134c/devR genomic region. Large arrows represent the ORFs. Electropherogram obtained from a 50 RACE-PCR experiment in low nutrient condition. The last base after the dC tail corresponds to the rst nucleotide transcribed (TSP). The TSP of 102 bp are shown (black arrow). Vertical black bars represent consensus sequence recognized by DevR protein according to Ref.19. Vertical dashed bar represents potential promoters to alternative sigma factors. (B) RTPCR experiments in low nutrient condition. RT1RT2 primers used to amplify the region devR/devS. RT3RT5 primers used to amplify the intergenic region devR/Rv3134c. Lane 1: control without AMV retrotranscriptase; lane 2: cDNA in low nutrient condition; lane 3: DNA positive control; lane 4: negative control.

factor controls the coordinated change in expression of about 48 genes, including some related with biosynthesis of cell wall proteins, when bacteria are subjected to hypoxia and NO exposure.17,25,26 Due to the key role of this regulator in the dormancy of M. tuberculosis, its ne regulation has been matter of research by several authors.14,17,26 The transcriptional analysis of the Rv3134c/devR/devS genomic region of M. tuberculosis under aerobic conditions demonstrated that it was transcribed from multiple promoters.19 Here we investigated the transcriptional activity of these genes under oxygen limitation and nutrient deprivation in M. bovis BCG. The results obtained by RT-PCR and RACE assays, revealed the presence of two overlapping transcripts in hypoxic condition. One transcript, which initiates at 120 pb of devR and extends to devS, had been identied previously in M. tuberculosis.19 Another transcript initiates at 40 pb upstream of Rv3134c and extends to devR. Under aerobic conditions only the transcript initiating at 120 bp with respect to devR was identied here. According to RTPCR results, the transcription of Rv3134c in this condition could occur from a different TSP independent of devR/devS. Under such conditions the transcription probably starts from the 240 or 286 TSPs identied by Bagchi et al.19 The RT-PCR experiments showed that in all the condition tested, devR/devS were co-transcribed indicating that they constitute an operon. However, the experiments of qRTPCR showed different levels of expression for each gene

(Figures 2 and 4). This could be due to mRNA stability, which is inuenced by variables such as the presence of RNAases in a specic moment of the cell cycle, or the presence of proteins and internal structures like hairpins that protect the mRNA transcript from degradation. It is therefore possible that the devRdevS transcript suffers a process of decay that differentially affects each gene and could explain the differences in the level of expression detected. Our results could bring insights to the apparently contradictory results obtained by Saini et al.13 and Sherman et al.15 Working with an M. tuberculosis mutant strain, Saini et al.13 showed that deletion of the 30 end of the devR gene did not abrogate expression of devS in either hypoxic or aerobic condition, a result that can be explained by the fact that their deletion did not include the 120 TSP, which might still drive transcription of devS trough the kanamycin cassette. By contrast, Sherman et al.15 showed the abrogation of expression in aerobic and hypoxic conditions of devR/ devS in a mutant strain in which the Rv3134c was deleted. In their mutant, the 120 pb TSP upstream of devR was replaced by a kanamycin sequence and therefore no transcription-translation of DevR/DevS could be produced. The absence of the 120 TSP, which leads to basal expression, could therefore explain the absence of transcription in their study. As a consequence, the DevR regulatory protein is not synthesized resulting in no activation of some dormancy related genes like hspX.

ARTICLE IN PRESS
280
Rv3134c 1.00E+06 devR

J.G. Rodriguez et al.

1.00E+06

1.00E+04

1.00E+04

1.00E+02

Normal PBS 0 4 Time (days) devS 15

Normal PBS 1.00E+02 0 4 Time (days) hspX 15

1.00E+06

1.00E+06 1.00E+04 1.00E+04 Normal PBS 0 4 Time (days) 15 Normal PBS 1.00E+02 0 4 Time (days) 15

1.00E+02

Figure 4 Expression levels of the genes under low nutrients at 4 and 15 days of the experiment. Gray bars represent low nutrient condition. Black bars represent normal condition. Error bars show 7standard deviation. Two independent RNA samples were analyzed and mRNA levels were calculated by absolute quantication method.

0.02 ratio 0.015 0.01 0.005 0 0h

devR/rrs16S

24h time dev S/rrs16S

72h

0.001 ratio 0.0005 0 0h

24h time

72h

Figure 5 Relative expression levels of devS and devR genes in macrophage experiments at 0, 24, and 72 h of infection. Two independent RNA samples were analyzed.

DevR binding motifs have been previously identied17 and several of them have been located by bioinformatics analysis inside and upstream of Rv3134c.19 Based on our results, taking into account the results obtained in other works, we postulate the following scenario for the establishment of the dormancy program: DevS HK senses the oxygen level27 and activates DevR by phosphorylation which, in

turn, increase its binding afnity to several DNA motifs upstream of the operon, thus boosting its own transcription and DevR protein concentration. At increased concentration, DevR phosphorylated protein would be appropriate to activate the genes which have been associated with dormancy. Under nutrient stress, the operon is induced but its regulation differs from that observed under hypoxic/aerobic conditions. Transcription is initiated from a 102 bp TSP upstream of devR and is independent of Rv3134c that is transcribed from its own promoter (240/286). The induction of this operon in low nutrient stress is not surprising, since other authors have shown that it responds to a variety of different stimuli.28 The fact that the hspX gene is not overexpressed with respect to the control indicates that the induction of the Rv3134c/devR/devS operon is specic to this stress and is not due to oxygen deprivation during prolonged incubation. The absence of hspX expression is consistent with previous work using a controlled stationary phase model in which the oxygen level was maintained constant.29 It has been previously demonstrated that DevR positively regulates expression of hspX and therefore the absence of expression under nutrient starvation could be explained by the fact that devR transcripts are two orders of magnitude lower than in the hypoxic conditions, a concentration that might not be sufcient to turn on hspX, as well as some others dormancy genes. The effect on other dormancy genes will have to be further analyzed.

ARTICLE IN PRESS
Rv3134c/devR/devS operon of Mycobacterium bovis BCG is differentially transcribed under in vitro stress conditions 281

Table 2

Potential promoter elements upstream of dev R in starvation. 35 Spacer 1722 17 1620 16 1519 18 10 SGTTS tGTTC CGTSSS CGTCGC SGTTG aGcTG Spacer TSP Reference 24 12 7 15 C 24 C 24 C

SigH consensus devR SigC consensus devR SigE consensus devR

SGGAAC GccAAC SSSAAT CGCAAa GGRMC GGcCG

S G/C; M A/C; R A/G. Upper case represents match with the consensus sequence.

The overexpression of Rv3134c under both stresses suggests that it may be playing an important role in these conditions. Rv3134c contains a universal stress protein domain related to that contained in UspA, a small cytoplasmic bacterial protein whose expression is enhanced when cells are exposed to stresses like heat shock, nutrient starvation, cell growth arrest, or DNA-damaging agents. Thus Rv3134c, like UspA, might be involved in a general stress endurance activity.30 Many two-component systems, such as phoPQ in Salmonella typhimurium,31 bvgAS of Bordetella pertussis32 and phoPR in Bacillus subtilis and M. tuberculosis,33,34 are transcribed from more than one promoter. This strategy allows for differential usage and regulation of promoters under diverse environmental conditions to facilitate bacterial adaptation. In addition, regulation of the Rv3134c/devR/ devS operon might also be controlled by more than one sigma factor, as was suggested by the identication of possible consensus elements for SigH, SigC, and SigE (Table 2). Promoter elements in mycobacteria are difcult to identify by bioinformatics analysis and additional experimental evidence would have to be provided given the inexact matches to identied consensus sequences. SigH is induced in response to heat shock, oxidative stress and macrophage invasion, while SigC is induced during oxidative stress.18 More interesting is the fact that SigE is induced during prolonged nutrient starvation,24,35 making these interesting candidates for regulation under this condition. Within macrophages and/or the granuloma, the mycobacterium has to face multiple stresses and the ability of the devR/devS operon to sense these stresses could be advantageous in terms of eliciting a response and adapting to the changing environmental conditions. Inside nonactivated macrophages the expression of devR/devS is transient and, more interesting devR is expressed 20 times more than devS. One possible explanation for these observed differences could be attributed to the newly identied orphan devT sensor.36 This sensor is autophosphorylated over a wide range of Ca2+ and could potentially lead to devR activation in the intracellular milleu. However, we have no explanation for the low transcriptional level of devS inside macrophages. One alternative could be the presence of transcription termination sites downstream of devR gene; unfortunately, in M. tuberculosis the transcription terminal signals are not well known and the hairpin formation downstream of stop codons is not evident.37 It is

also possible that inside macrophages, the bacterial RNAse enzymes, could lead to rapid degradation of the transcript. The current work provides further support for the complex regulation underlying the Rv3134c/devR/devS operon in mycobacteria, whose extensive evidence suggests plays a critical role during latency. This was evident not only using in vitro cultures but also when analyzing expression within macrophages. However, in order to fully understand the regulation of this operon, these expression analyses will have to be further validated using in vivo latency animal models.

Acknowledgment
This work was supported by the INCO Project Contract No. ICA4-CT-2002-10063. Funding: None. Competing interests: None declared. Ethical approval: Not required.

References
1. Dye C, Watt CJ, Bleed DM, Hosseini SM, Raviglione MC. Evolution of tuberculosis control and prospects for reducing tuberculosis incidence, prevalence, and deaths globally. JA M A 2005; 293:276775. 2. Nuermberger E, Bishai WR, Grosset JH. Latent tuberculosis infection. Semin Respir Crit Care Med 2004;25:31736. 3. Neyrolles O, Hernandez-Pando R, Pietri-Rouxel F, Forne P, Tailleux L, Barrios JA, et al. Is adipose tissue a place for Mycobacterium tuberculosis persistence? PLoS ONE 2006;1:e43. 4. Frothingham R, Stout JE, Hamilton CD. Current issues in global tuberculosis control. Int J Infect Dis 2005;9:297311. 5. Gutierrez MC, Brisse S, Brosch R, Fabre M, Oma B, Marmiesse s M. Ancient origin and Gene Mosaicism of the progenitor of Mycobacterium tuberculosis. PLoS Pathogens 2005;1(1):e5. 6. Ulrichs T, Kosmiadi GA, PradI SJL, Tltukhina M, Mishenko V, Gushina N. Differential organization of the local immune response in patients with active cavitary tuberculosis or with nonprogressive tuberculoma. J Infect Dis 2005;192:8997.

ARTICLE IN PRESS
282
7. Manganelli R, Provvedi R, Rodrigue S, Beaucher J, Gaudreau L, Smith I. Sigma factors and global gene regulation in Mycobacterium tuberculosis. J Bacteriol 2004;186:895902. 8. Stock AM, Robinson VL, Goudreau PN. Two-component signal transduction. Annu Rev Biochem 2000;69:183215. 9. Stock JB, Surette MG, Levit M, Park P. Two-component signal transduction systems: structurefunction relationships and mechanisms of catalysis. In: Hoch JA, Silhavy TJ, editors. Two-component signal transduction. Washington, DC: American Society for Microbiology; 1995. p. 2551. 10. Shrivastava R, Das DR, Wiker HG, Das AK. Modelling and docking of the proteins of a unique two-component system from Mycobacterium tuberculosis and the mechanism of phosphotransfer. Biochem Biophys Res Commun 2006;344:132733. 11. Cole ST, Brosch R, Parkhill J, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998;393:53744.Erratum in: Nature 1998; 396(6707):190. 12. Morth JP, Gosmann S, Nowak E, Tucker PA. A novel twocomponent system found in Mycobacterium tuberculosis. FEBS Lett 2005;579:41458. 13. Saini DK, Malhotra V, Dey D, Pant N, Das TK, Tyagi JS. DevRDevS is a bona de two-component system of Mycobacterium tuberculosis that is hypoxia-responsive in the absence of the DNA-binding domain of DevR. Microbiology 2004;150:86575. 14. Dasgupta N, Kapur V, Singh KK, Das TK, Sachdeva S, Jyothisri K. Characterization of a two component system, devRdevS, of Mycobacterium tuberculosis. Tuberc Lung Dis 2000;80:14159. 15. Sherman DR, Voskuil M, Schnappinger D, Liao R, Harrell MI, Schoolnik GK. Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystalline. Proc Natl Acad Sci USA 2001;98:75349. 16. Boon C, Li R, Qi R, Dick T. Proteins of Mycobacterium bovis BCG induced in Wayne dormancy model. J Bacteriol 2001;183: 26726. 17. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M. Rv3133c/devR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 2003;48:83343. 18. Voskuil MI, Schnappinger D, Visconti KC, Harrell MI, Dolganov GM, Sherman DR. Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. J Exp Med 2003;198:70513. 19. Bagchi G, Chauhan S, Sharma D, Tyagi JS. Transcription and autoregulation of the Rv3134cdevRdevS operon of Mycobacterium tuberculosis. Microbiology 2005;151:404553. 20. Boon C, Dick T. Mycobacterium bovis response regulator essential for hypoxic dormancy. J Bacteriol 2002;184:67607. 21. Betts JC, Lukey PT, Robb LC, McAdam RA, Duncan K. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression proling. Mol Microbiol 2002;43:71731. 22. Menendez MC, Rebollo MJ, Nunez MC, Cox RA, Garc MJ. a Analysis of the precursor rRNA fractions of rapidly growing

J.G. Rodriguez et al.

mycobacteria: quantication by methods that include the use of a promoter (rrn A P1) as a novel standard. J Bacteriol 2005;187:53443. Camacho LR, Constant P, Raynaud C, Laneelle MA, Triccas JA, Gicquel B. Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. J Biol Chem 2001;276:1984554. Rodrigue S, Pravvedi R, Jacques PE, Gaudreau L, Manganelli RT. The sigma factors of Mycobacterium tuberculosis. FEMS Microbiol Rev 2006;30:92641. Voskuil MI, Visconti KC, Schoolnik GK. Mycobacterium tuberculosis gene expression during adaptation to stationary phase and low-oxygen dormancy. Tuberculosis 2004;84:21827. Muttucumarua DGN, Robertsa G, Hindsb J, Stablerb RA, Parish T. Gene expression prole of Mycobacterium tuberculosis in a nonreplicating state. Tuberculosis 2004;84:23946. Ioanoviciu A, Yukl ET, Moenne-Loccoz P, de Montellano PR. DevS, a heme-containing two-component oxygen sensor of Mycobacterium tuberculosis. Biochemistry 2007;46:425060. Kendall Sl, Movahedzadeh F, Rison SC, Wernisch L, Parish T, Duncan K. The Mycobacterium tuberculosis dosRS two-component system is induced by multiple stresses. Tuberculosis 2004;84:24755. Hampshire T, Soneji S, Bacon J, James BW, Hinds J, Laing K. Stationary phase gene expression of Mycobacterium tuberculosis following a progressive nutrient depletion: a model for persistent organisms? Tuberculosis 2004;84:22838. Sousa MC, McKay DB. Structure of the universal stress protein of Haemophilus inuenzae. Structure 2001;9:113541. Soncini FC, Vescovi EG, Groisman EA. Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon. J Bacteriol 1999;177:436471. Scarlato V, Prugnola A, Arico B, Rappuoli R. Positive transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis. Proc Natl Acad Sci USA 1990;87:67537. Paul S, Birkey S, Liu W, Hulett FM. Autoinduction of Bacillus subtilis phoPR operon transcription results from enhanced transcription from EsA- and EsE-responsive promoters by phosphorylated PhoP. J Bacteriol 2004;186:426275. Soto CY, Menendez MC, Perez E, Samper S, Gomez AB, Garcia MJ. IS6110 mediates increased transcription of the phoP virulence gene in a multidrug-resistant clinical isolate responsible for tuberculosis outbreaks. J Clin Microbiol 2004;42: 2129. Smith I, Bishai WR, Nagaraja V. Control of mycobacterial transcription. In: Cole ST, Eisenach KD, McMurray DN, Jacobs WR, editors. Tuberculosis and the tubercle bacillus. ASM Press; 2005. p. 21934. Saini DK, Malhotra V, Tyagi JS. Cross talk between DevS sensor kinase homologue, Rv2027c and DevR response regulator of Mycobacterium tuberculosis. FEBS Lett 2004;565:7580. Washio T, Sasayama J, Tomita M. Analysis of complete genomes suggests that many prokaryotes do not rely on hairpin formation in transcription termination. Nucl Acid Res 1998;26:545663.

23.

24.

25.

26.

27.

28.

29.

30. 31.

32.

33.

34.

35.

36.

37.