Vous êtes sur la page 1sur 89

Cours de Python

http://www.dsimb.inserm.fr/~fuchs/python/

Patrick Fuchs et Pierre Poulain prnom [point] nom [arobase] univ-paris-diderot [point] fr

version du 19 avril 2012

DSIMB Inserm UMR_S 665 et Universit Paris Diderot-Paris 7 Institut National de la Transfustion Sanguine (INTS) 75015 Paris, France

Ce document est sous licence Creative Commons BY-SA http://creativecommons.org/licenses/by-sa/2.0/fr/

Bienvenue au cours de Python ! Ce cours a t conu lorigine pour les tudiants dbutants en programmation Python des lires biologie et biochimie de lUniversit Paris Diderot - Paris 7 ; et plus spcialement pour les tudiants du master Biologie Informatique. Ce cours est bas sur les versions 2.x de Python et ne prend pas en compte, pour linstant, les nouvelles versions 3.x. Nanmoins, nous essaierons de le mettre rapidement jour de manire traiter la compatibilit entre les deux gnrations. Si vous relevez des erreurs la lecture de ce document, merci de nous les signaler. Le cours est disponible en version HTML et PDF.

Remerciements
Un grand merci Sander du CMBI de Nijmegen pour la premire version de ce cours. Merci galement tous les contributeurs, occasionels ou rguliers : Jennifer Becq, Virginie Martiny, Romain Laurent, Benoist Laurent, Benjamin Boyer, Hubert Santuz, Catherine Lesourd, Philippe Label, Rmi Cuchillo, Cdric Gageat, Philibert Malbranche, Mikal Naveau. Nous remercions aussi Denis Mestivier de qui nous nous sommes inspirs pour certains exercices. Enn, merci vous tous, les curieux de Python, qui avez t nombreux nous envoyer des retours sur ce cours, nous suggrer des corrections et nous signaler des coquilles. De nombreuses personnes nous ont aussi demand les corrections des exercices. Nous ne les mettons pas sur le site an dviter la tentation de les regarder trop vite, mais vous pouvez nous crire et nous vous les enverrons.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Table des matires

Table des matires

Table des matires


1 Introduction 1.1 Avant de commencer . . . . . . . . . . . . . . . 1.2 Premier contact avec Python sous Linux . . . . 1.3 Premier programme Python . . . . . . . . . . . 1.4 Commentaires . . . . . . . . . . . . . . . . . . . 1.5 Sparateur dinstructions . . . . . . . . . . . . . 1.6 Notion de bloc dinstructions et dindentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 6 6 7 8 8 8 10 10 11 11 13 13 15 16 16 16 16 17 18 18 19 20 20 22 23 23 26 26 26 27 28 29 31 31 33 34 35 35 35 36 37 37 38 3

Variables 2.1 Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 Nommage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3 Oprations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . criture 3.1 criture formate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Listes 4.1 Dnition . . . . . . . . . . 4.2 Utilisation . . . . . . . . . . 4.3 Opration sur les listes . . . 4.4 Indiage ngatif et tranches 4.5 Fonctions range et len . . . 4.6 Listes de listes . . . . . . . . 4.7 Exercices . . . . . . . . . . . Boucles et comparaisons 5.1 Boucles for . . . . . 5.2 Comparaisons . . . 5.3 Boucles while . . . 5.4 Exercices . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

Tests 6.1 Dnition . . . . . . . . . . . 6.2 Tests plusieurs cas . . . . . . 6.3 Tests multiples . . . . . . . . . 6.4 Instructions break et continue 6.5 Exercices . . . . . . . . . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

Fichiers 7.1 Lecture dans un chier . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.2 criture dans un chier . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.3 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Modules 8.1 Dnition . . . . . . . . . . . . . . . . . . . 8.2 Importation de modules . . . . . . . . . . . 8.3 Obtenir de laide sur les modules imports 8.4 Modules courants . . . . . . . . . . . . . . . 8.5 Module sys : passage darguments . . . . . 8.6 Module os . . . . . . . . . . . . . . . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

. . . . . .

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Table des matires

Table des matires

8.7 9

Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

39 41 41 41 41 42 44 44 45 47 47 48 48 50 51 51 52 53 54 54 54 55 56 57 58 59 61 61 62 65 66 66 66 67 68 68 69 69 70 70 71 71 71 75 75

Plus sur les chanes de caractres 9.1 Prambule . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.2 Chanes de caractres et listes . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.3 Caractres spciaux . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.4 Mthodes associes aux chanes de caractres . . . . . . . . . . . . . . . . . . 9.5 Conversion de types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.6 Conversion dune liste de chanes de caractres en une chane de caractres 9.7 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

10 Plus sur les listes 10.1 Proprits des listes 10.2 Test dappartenance 10.3 Copie de listes . . . 10.4 Exercices . . . . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

11 Dictionnaires et tuples 11.1 Dictionnaires . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.2 Tuples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.3 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 Fonctions 12.1 Principe . . . . . . . . 12.2 Dnition . . . . . . 12.3 Passage darguments 12.4 Porte des variables . 12.5 Porte des listes . . . 12.6 Rgle LGI . . . . . . . 12.7 Exercices . . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

. . . . . . .

13 Expressions rgulires et parsing 13.1 Dnition et syntaxe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.2 Module re et fonction search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.3 Exercices : extraction des gnes dun chier genbank . . . . . . . . . . . . . . . . . 14 Cration de modules 14.1 Cration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.2 Utilisation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.3 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 Autres modules dintrt 15.1 Module urllib2 . . . . . . . . . 15.2 Module pickle . . . . . . . . . 15.2.1 Codage des donnes . 15.2.2 Dcodage des donnes 15.3 Exercices . . . . . . . . . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

16 Modules dintrt en bioinformatique 16.1 Module numpy . . . . . . . . . . . . . . . 16.1.1 Objets de type array . . . . . . . . 16.1.2 Un peu dalgbre linaire . . . . . 16.1.3 Un peu de transforme de Fourier 4

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Table des matires

Table des matires

16.2 16.3 16.4 16.5 16.6

Module biopython Module matplotlib Module rpy . . . . Exercice numpy . . Exercice rpy . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

76 77 79 81 82 83 83 84 87 87 87 87 88 89

17 Avoir la classe avec les objets 17.1 Exercices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 Gestion des erreurs 19 Trucs et astuces 19.1 Shebang et /usr/bin/env python . . . . . . . 19.2 Python et utf-8 . . . . . . . . . . . . . . . . . . 19.3 Vitesse ditration dans les boucles . . . . . . 19.4 Liste de comprhension . . . . . . . . . . . . 19.5 Sauvegardez votre historique de commandes

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Introduction

1
1.1

Introduction
Avant de commencer

Avant de dbuter ce cours, voici quelques indications gnrales qui pourront vous servir pour la suite. Familiarisez-vous avec le site www.python.org. Il contient normment dinformations et de liens sur Python et vous permet en outre de le tlcharger pour diffrentes plateformes (Linux, Mac, Windows). La page dindex des modules est particulirement utile. Pour aller plus loin avec Python, Grard Swinnen a crit un trs bon livre intitul Apprendre programmer avec Python et tlchargeable gratuitement. Les ditions Eyrolles proposent galement la version papier de cet ouvrage. Ce cours est bas sur une utilisation de Python sous Linux mais il est parfaitement transposable aux systmes dexploitation Windows et Mac. Lapprentissage dun langage informatique comme Python va ncessiter dcrire des lignes de codes laide dun diteur de texte. Si vous tes dbutants, nous vous conseillons vivement dutiliser gedit ou nedit, qui sont les plus proches des diteurs que lon peut trouver sous Windows (notepad). Des diteurs comme emacs et vi sont trs puissants mais ncessitent un apprentissage particulier.

1.2

Premier contact avec Python sous Linux

Python est un langage interprt, cest--dire que chaque ligne de code est lue puis interprte an dtre excute par lordinateur. Pour vous en rendre compte, lancez la commande : python Celle-ci va dmarrer linterprteur Python. Vous devriez obtenir quelque chose de ce style : [fuchs@opera ~]$ python Python 2.5.1 (r251:54863, Jul 10 2008, 17:25:56) [GCC 4.1.2 20070925 (Red Hat 4.1.2-33)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> Le bloc [fuchs@opera ~]$ reprsente linvite de commande de votre shell sous Linux. Le triple chevron >>> est linvite de Python (prompt en anglais), ce qui signie que Python attend une commande. Tapez par exemple linstruction print "Hello world !" puis validez votre commande avec la touche Entre. Python a excut la commande directement et a afch le texte Hello world !. Il attend ensuite votre prochaine instruction en afchant linvite de linterprteur Python (>>> ). En rsum, voici ce qui a du apparatre sur votre cran : >>> print "Hello world !" Hello world ! >>> Vous pouvez refaire un nouvel essai en vous servant cette fois de linterprteur comme dune machine calculer. 6 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

1.3

Premier programme Python

Introduction

>>> 1 + 1 2 >>> ce stade, vous pouvez entrer une autre commande ou bien quitter linterprteur laide des touches Ctrl-D. Finalement linterprteur Python est un systme interactif dans lequel vous pouvez entrer des commandes, que Python excutera sous vos yeux (au moment o vous validerez la commande en tapant sur Entre). Il existe de nombreux autres langages interprts tels que Perl ou R. Le gros avantage est que lon peut directement tester une commande laide de linterprteur, ce qui est trs utile pour dbugger (cest--dire corriger les ventuelles erreurs dun programme). Gardez bien en mmoire cette proprit de Python qui pourra parfois vous faire gagner un temps prcieux !

1.3

Premier programme Python

Bien sr, linterprteur prsente vite des limites ds lors que lon veut excuter une suite dinstructions plus complexe. Comme tout langage informatique, on peut enregistrer ces instructions dans un chier, que lon appelle communment un script Python. Pour reprendre lexemple prcdent, ouvrez un diteur de texte (par exemple gedit ou nedit) et entrez le code suivant. print 'Hello World !' Ensuite enregistrez votre chier sous le nom test.py, puis quittez lditeur de texte. Lextension standard des scripts Python est .py. Pour excuter votre script, vous avez deux moyens.

1. Soit donner le nom de votre script comme argument la commande Python : [fuchs@opera ~]$ python test.py Hello World ! [fuchs@opera ~]$

2. Soit rendre votre chier excutable. Pour cela deux oprations sont ncessaires : Prcisez au shell la localisation de linterprteur Python en indiquant dans la premire ligne du script : #!/usr/bin/env python Dans notre exemple, le script test.py contient alors le texte suivant : #!/usr/bin/env python print 'Hello World !' Rendez votre script Python excutable en tapant : chmod +x test.py Pour excuter votre script, tapez son nom prcd des deux caractres ./ (an de prciser au shell o se trouve votre script) : [fuchs@opera ~]$ ./test.py Hello World ! [fuchs@opera ~]$ Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 7

Introduction

1.4

Commentaires

1.4

Commentaires

Dans un script, tout ce qui suit le caractre # est ignor par Python jusqu la n de la ligne et est considr comme un commentaire. Une exception notable est la premire ligne de votre script qui peut tre #!/usr/bin/env python et qui a alors une signication particulire pour Python. Les commentaires sont indispensables pour que vous puissiez annoter votre code. Il faut absolument les utiliser pour dcrire les principales parties de votre code dans un langage humain. #!/usr/bin/env python # votre premier script Python print 'Hello World !' # d'autres commandes plus utiles pourraient suivre

1.5

Sparateur dinstructions

Python utilise lespace comme sparateur dinstructions. Cela peut sembler vident, mais il est tout de mme important de le prciser. Par exemple : >>> print 1 1 >>> print1 Traceback (most recent call last): File "<stdin>", line 1, in <module> NameError: name 'print1' is not defined Omettre lespace entre linstruction print et le chiffre 1 renvoie une erreur.

1.6

Notion de bloc dinstructions et dindentation

Pour terminer ce chapitre dintroduction, nous allons aborder ds maintenant les notions de bloc dinstructions et dindentation. En programmation, il est courant de rpter un certain nombre de choses (avec les boucles, voir chapitre 5) ou de faire des choix (avec les tests, voir chapitre 6). Par exemple, imaginez que vous souhaitiez rpter 10 fois 3 instructions diffrentes, les unes la suite des autres. Regardez lexemple suivant en pseudo-code : instruction_qui_indique__Python_de_rpter_10_fois_ce_qui_suit: sous-instruction1 sous-instruction2 sous-instruction3 instruction_suivante La premire ligne correspond une instruction qui va indiquer Python de rpter 10 fois dautres instructions (il sagit dune boucle, on verra le nom de la commande exacte plus tard). Dans le pseudo-code ci-dessus, il y a 3 instructions rpter, nommes sous-instruction1 sous-instruction3. Notez bien les dtails de la syntaxe. La premire ligne indique que lon veut rpter une ou plusieurs instructions, elle se termine par :. Ce symbole : indique Python quil doit attendre un bloc dinstructions, cest--dire un certains nombres de sous-instructions rpter. Python 8 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

1.6

Notion de bloc dinstructions et dindentation

Introduction

reconnat un bloc dinstructions car il est indent. Lindentation est le dcalage dun ou plusieurs espaces ou tabulations des instructions sous-instruction1 sous-instruction3, par rapport instruction_qui_indique__Python_de_rpter_10_fois_ce_qui_suit:. Pratiquement, lindentation en Python doit tre homogne (soit des espaces, soit des tabulations, mais pas un mlange des deux). Une indentation avec 4 espaces est le style dindentation le plus traditionnel et celui qui permet une bonne lisibilit du code. Enn, la ligne instruction_suivante sera excute une fois que le bloc dinstructions sera termin. Si tout cela vous semble un peu fastidieux, ne vous inquitez pas. Vous allez comprendre tous ces dtails, et surtout les acqurir, en continuant ce cours chapitre par chapitre.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Variables

Variables

Une variable est une zone de la mmoire dans laquelle une valeur est stocke. Aux yeux du programmeur, cette variable est dnie par un nom, alors que pour lordinateur, il sagit en fait dune adresse (i.e. une zone particulire de la mmoire). En Python, la dclaration dune variable et son initialisation (c.--d. la premire valeur que lon va stocker dedans) se fait en mme temps. Pour vous en convaincre, regardez puis testez les instructions suivantes aprs avoir lanc linterprteur : >>> x = 2 >>> x 2 Dans cet exemple, nous avons dclar, puis initialis la variable x avec la valeur 2. Linterprteur nous a ensuite permis de regarder le contenu de la variable juste en tapant son nom. Retenez ceci car cest une spcicit de linterprteur Python, trs pratique pour chasser les erreurs (debug) dans un programme. Par contre, la ligne dun script Python qui contient seulement le nom dune variable (sans aucune autre fonction) nafchera pas la valeur de la variable lcran.

2.1

Types

Le type dune variable correspond la nature de celle-ci. Les trois types principaux dont nous aurons besoin sont les entiers, les rels et les chanes de caractres. Bien sr, il existe de nombreux autres types (par exemple, les nombres complexes), cest dailleurs un des gros avantages de Python (si vous ntes pas effrays, vous pouvez vous en rendre compte ici). Dans lexemple prcdent, nous avons stock un nombre entier (int) dans la variable x, mais il est tout a fait possible de stocker des nombres rels (oat) ou des chanes de caractres (string) : >>> y = 3.14 >>> y 3.1400000000000001 >>> a = "bonjour" >>> a 'bonjour' >>> b = 'salut' >>> b 'salut' >>> c = '''girafe''' >>> c 'girafe' Vous remarquez que Python reconnat certains types de variable automatiquement (entier, rel). Par contre, pour une chane de caractres, il faut lentourer de guillemets (simples, doubles voire triples) an dindiquer Python le dbut et la n de la chane. Vous vous posez sans doute une question concernant lexemple du rel. Si vous avez entr le chiffre 3.14, pourquoi Python limprime-t-il nalement avec des zros derrire (3.1400000000000001) ? Un autre exemple : >>> 1.9 1.8999999999999999 >>> 10 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

2.2

Nommage

Variables

Cette fois-ci, Python crit 1.9 sous la forme 1.8 suivi de plusieurs 9 ! Cela sexplique par le fait que, sans rentrer dans les dtails techniques, la manire de coder un rel dans lordinateur est rarement exacte. Python ne nous le cache pas et le montre lorsquil afche ce nombre.

2.2

Nommage

Le nom des variable en Python peut-tre constitu de lettres minuscules (a z), de lettres majuscules (A Z), de nombres (0 9) ou du caractre soulign (_). Nanmoins, un nom de variable ne doit pas dbuter ni par un chiffre, ni par _ et ne peut pas contenir de caractre accentu. Il faut absolument viter dutiliser un mot rserv par Python comme nom de variable (par ex. : print, range, for, from, etc.). Python est sensible la casse, ce qui signie que les variables TesT, test ou TEST sont diffrentes. Enn, nutilisez jamais despace dans un nom de variable puisque celui-ci est le sprateur dinstructions.

2.3

Oprations

Les quatre oprations de base se font de manire simple sur les types numriques (nombres entiers et rels) : >>> x = 45 >>> x + 2 47 >>> y = 2.5 >>> x + y 47.5 >>> (x * 10) / y 180.0 Remarquez toutefois que si vous mlangez les types entiers et rels, le rsultat est renvoy comme un rel (car ce type est plus gnral). Loprateur puissance utilise le symbole ** et pour obtenir le reste dune division entire, on utilise le symbole modulo % : >>> 2**3 8 >>> 3 % 4 3 >>> 8 % 4 0 Oprations sur les chanes de caractres Pour les chanes de caractres, deux oprations sont possibles, laddition et la multiplication : >>> chaine = "Salut" >>> chaine 'Salut' >>> chaine + " Python" 'Salut Python' >>> chaine * 3 'SalutSalutSalut' Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 11

Variables

2.3

Oprations

Loprateur daddition + permet de concatner (assembler) deux chanes de caractres et loprateur de multiplication * permet de dupliquer plusieurs fois une chane.

Oprations illicites Attention ne pas faire dopration illicite car vous obtiendriez un message derreur : >>> 'toto' + 2 Traceback (most recent call last): File "<stdin>", line 1, in ? TypeError: cannot concatenate 'str' and 'int' objects Notez que Python vous donne le maximum dindices dans son message derreur. Dans lexemple prcdent, il vous indique que vous ne pouvez pas mlanger des objets de type str (string, donc des chanes de caractres) avec des objets de type int (donc des entiers), ce qui est assez logique. Fonction type() Si vous ne vous souvenez plus du type dune variable, utilisez la fonction type qui vous le rappelle. >>> x = 2 >>> type(x) <type 'int'> >>> x = 2.0 >>> type(x) <type 'float'> >>> x = '2' >>> type(x) <type 'str'> Faites bien attention, pour Python, la valeur 2 (nombre entier) est diffrente de 2.0 (nombre rel), de mme que 2 (nombre entier) est diffrent de '2' (chane de caractres).

12

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

criture

criture

Nous avons dj vu au chapitre prcdent la fonction print qui permet dafcher une chane de caractres. Elle permet en plus dafcher le contenu dune ou plusieurs variables : >>> x = 32 >>> nom = 'John' >>> print nom , ' a ' , x , ' ans' John a 32 ans Python a donc crit la phrase en remplaant les variables x et nom par leur contenu. Vous pouvez noter galement que pour crire plusieurs blocs de texte sur une seule ligne, nous avons utilis le sparateur , avec la commande print. En regardant de plus prs, vous vous aperevrez que Python a automatiquement ajout un espace chaque fois que lon utilisait le sparateur ,. Par consquent, si vous voulez mettre un seul espace entre chaque bloc, vous pouvez retirer ceux de vos chanes de caractres : >>> print nom , 'a' , x , 'ans' John a 32 ans Pour imprimer deux chanes de caractres lune ct de lautre sans espace, vous devrez les concatner : >>> ani1 = 'chat' >>> ani2 = 'souris' >>> print ani1, ani2 chat souris >>> print ani1 + ani2 chatsouris

3.1

criture formate

Imaginez que vous vouliez calculer puis afcher la proportion de GC dun gnome. Notez que la proportion de GC sobtient comme la somme des bases Guanine (G) et Cytosine (C) divise par le nombre total de bases. Sachant que lon a 4500 bases G, 2575 bases C pour un total de 14800 bases, vous pourriez faire comme suit (notez bien lutilisation des parenthses pour grer les priorits des oprateurs) : >>> propGC = (4500.0 + 2575)/14800 >>> print "La proportion de GC est", propGC La proportion de GC est 0.478040540541 Remarquez que si vous aviez fait le calcul avec (4500 + 2575)/14800, vous auriez obtenu 0 car tous les nombres sont des entiers et le rsultat aurait t, lui aussi, un entier. Lintroduction de 4500.0 qui est un rel rsoud le problme, puisque le calcul se fait alors sur des rels. Nanmoins, le rsultat obtenu prsente trop de dcimales (onze dans le cas prsent). Pour pouvoir crire le rsultat plus lisiblement, vous pouvez utiliser loprateur de formatage %. Dans votre cas, vous voulez formater un rel pour lafcher avec deux puis trois dcimales : >>> print "La Le proportion >>> print "La La proportion proportion de GC est %.2f" % propGC de GC est 0.48 proportion de GC est %.3f" % propGC de GC est 0.478 13

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

criture

3.1

criture formate

Le signe % est appel une premire fois (%.2f) pour 1. dsigner lendroit o sera place la variable dans la chane de caractres ; 2. prciser le type de la variable formater, ici f pour oat donc pour un rel ; 3. prciser le formatage voulu, ici .2 soit deux chiffres aprs la virgule. Le signe % est rappel une seconde fois (% propGC) pour indiquer les variables formater. Notez que les rels ainsi formats sont arrondis et non tronqus. Vous pouvez aussi formatez des entiers avec %i (i comme integer) >>> nbG = 4500 >>> print "Le gnome de cet exemple contient %i guanines" % nbG Le gnome de cet exemple contient 4500 guanines ou mettre plusieurs nombres dans une mme chane de caractres. >>> nbG = 4500 >>> nbC = 2575 >>> print "Ce gnome contient %i G et %i C, soit une prop de GC de %.2f" \ ... % (nbG,nbC,propGC) Ce gnome contient 4500 G et 2575 C, soit une prop de GC de 0.48 Remarque : 1. Dans lexemple prcdent, nous avons utilis le symbole % pour formater des variables. Si vous avez besoin dcrire le symbole pourcentage % sans quil soit confondu avec celui servant pour lcriture formate, il suft de le doubler. Toutefois, si lcriture formate nest pas utilise dans la mme chane de caractres o vous voulez utilisez le symbole pourcent, cette opration nest pas ncessaire. Par exemple : >>> nbG = 4500 >>> nbC = 2575 >>> percGC = propGC * 100 >>> print "Ce gnome contient %i G et %i C, soit un %%GC de %.2f" \ ... % (nbG,nbC,percGC) ,"%" Ce gnome contient 4500 G et 2575 C, soit un %GC de 47.80 % 2. Le signe \ en n de ligne permet de poursuivre la commande sur la ligne suivante. Cette syntaxe est pratique lorsque vous voulez taper une commande longue. Enn, il est possible de prciser sur combien de caractres vous voulez quun rsultat soit crit. Dans la portion de code suivant, le caractre ; sert de sparateur entre les instructions sur une mme ligne : >>> print 10 ; print 100 ; print 1000 10 100 1000 >>> print "%4i" % 10 ; print "%4i" % 100 ; print "%4i" % 1000 10 100 1000 >>> Ceci est galement possible sur les chanes de caractres (avec %s, s comme string) : 14 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

3.2

Exercices

criture

>>> print "atom HN" ; print "atom HDE1" atom HN atom HDE1 >>> print "atom %4s" % "HN" ; print "atom %4s" % "HDE1" atom HN atom HDE1 Vous voyez tout de suite lnorme avantage de lcriture formate. Cela permet dcrire en colonnes parfaitement alignes. Nous verrons que ceci est trs pratique si lon veut crire les coordonnes des atomes dune molcule au format PDB.

3.2

Exercices
Conseil : utilisez linterprteur Python pour les exercices 2 5.

1. Ouvrez linterprteur Python et tapez 1+1. Que se passe-t-il ? crivez la mme chose dans un script test.py. Excutez ce script en tapant python test.py dans un shell. Que se passe-t-il ? Pourquoi ? 2. Calculez le pourcentage de GC avec le code percGC = ((4500 + 2575)/14800)*100 puis afchez le rsultat. Que se passe-t-il ? Comment expliquez-vous ce rsultat ? Corrigez linstruction prcdente pour calculer correctement le pourcentage de GC. Afchez cette valeur avec deux dcimales de prcision. 3. Gnrez une chane de caractres reprsentant un oligonuclotide polyA (AAAA...) de 20 bases de longueurs, sans taper littralement toutes les bases. 4. Suivant le modle du dessus, gnrez en une ligne de code un polyA de 20 bases suivi dun polyGC rgulier (GCGCGC...) de 40 bases. 5. En utilisant lcriture formate, afchez en une seule ligne les variables a, b et c dont les valeurs sont respectivement "salut", 102 et 10.318.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

15

Listes

4
4.1

Listes
Dnition

Une liste est une structure de donnes qui contient une srie de valeurs. Python autorise la construction de liste contenant des valeurs de type diffrent (par exemple entier et chane de caractres), ce qui leur confre une grande exibilit. Une liste est dclare par une srie de valeurs (ne pas oublier les guillemets, simples ou doubles, sil sagit de chanes de caractres) spares par des virgules, et le tout encadr par des crochets. En voici quelques exemples : >>> animaux = ['girafe','tigre','singe','souris'] >>> tailles = [5, 2.5, 1.75, 0.15] >>> mixte = ['girafe', 5, 'souris', 0.15] >>> animaux ['girafe', 'tigre', 'singe', 'souris'] >>> tailles [5, 2.5, 1.75, 0.15] >>> mixte ['girafe', 5, 'souris', 0.15] Lorsque lon afche une liste, Python la restitue telle quelle a t saisie.

4.2

Utilisation

Un des gros avantages dune liste est que vous pouvez appeler ses lments par leur position. Ce numro est appel indice (ou index) de la liste. liste : ['girafe', 'tigre', 'singe', 'souris'] indice : 0 1 2 3 Soyez trs attentifs au fait que les indices dune liste de n lments commence 0 et se termine n-1. Voyez lexemple suivant : >>> animaux = ['girafe','tigre','singe','souris'] >>> animaux[0] 'girafe' >>> animaux[1] 'tigre' >>> animaux[3] 'souris' Par consquent, si on appelle llment dindice 4 de notre liste, Python renverra un message derreur : >>> animaux[4] Traceback (innermost last): File "<stdin>", line 1, in ? IndexError: list index out of range Noubliez pas ceci ou vous risqueriez dobtenir des bugs inattendus !

4.3

Opration sur les listes

Tout comme les chanes de caractres, les listes supportent loprateur + de concatnation, ainsi que loprateur * pour la duplication : 16 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

4.4

Indiage ngatif et tranches

Listes

>>> ani1 = >>> ani2 = >>> ani1 + ['girafe', >>> ani1 * ['girafe',

['girafe','tigre'] ['singe','souris'] ani2 'tigre', 'singe', 'souris'] 3 'tigre', 'girafe', 'tigre', 'girafe', 'tigre']

4.4

Indiage ngatif et tranches


La liste peut galement tre indexe avec des nombres ngatifs selon le modle suivant :

liste : ['girafe', 'tigre', 'singe', 'souris'] indice positif : 0 1 2 3 indice ngatif : -4 -3 -2 -1 ou encore : liste : ['A','C','D','E','F','G','H','I','K','L'] indice positif : 0 1 2 3 4 5 6 7 8 9 indice negatif : -10 -9 -8 -7 -6 -5 -4 -3 - 2 -1 Les indices ngatifs reviennent compter partir de la n. Leur principal avantage est que vous pouvez appeler le dernier lment dune liste laide de lindice -1 sans pour autant connatre la longueur de la liste. >>> animaux = ['girafe','tigre','singe','souris'] >>> animaux[-4] 'girafe' >>> animaux[-2] 'singe' >>> animaux[-1] 'souris' Un autre avantage des listes est la possibilit de slectionner une partie en utilisant un indiage construit sur le modle [m:n+1] pour rcuprer tous les lments, du mime au nime (de llment m inclus llment n+1 exclus). On dit alors quon rcupre une tranche de la liste, par exemple : >>> animaux = ['girafe', 'tigre', 'singe', 'souris'] >>> animaux[0:2] ['girafe', 'tigre'] >>> animaux[0:3] ['girafe', 'tigre', 'singe'] >>> animaux[0:] ['girafe', 'tigre', 'singe', 'souris'] >>> animaux[:] ['girafe', 'tigre', 'singe', 'souris'] >>> animaux[1:] ['tigre', 'singe', 'souris'] >>> animaux[1:-1] ['tigre', 'singe'] Remarquez que lorsquaucun indice nest indiqu gauche ou droite du symbole : , Python prend par dfaut tous les lments depuis le dbut ou tous les lments jusqu la n respectivement. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 17

Listes

4.5

Fonctions range et len

Dans les versions rcentes de Python, on peut aussi prciser le pas en ajoutant un : supplmentaire et en indiquant le pas par un entier. >>> animaux = ['girafe', 'tigre', 'singe', 'souris'] >>> animaux[0:3:2] ['girafe', 'singe'] >>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> x [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> x[::1] [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> x[::2] [0, 2, 4, 6, 8] >>> x[::3] [0, 3, 6, 9] >>> x[1:6:3] [1, 4] Finalement, on voit que laccs au contenu dune liste avec des crochets fonctionne sur le modle liste[dbut:fin:pas].

4.5

Fonctions range et len

Linstruction range() vous permet de crer des listes dentiers (et dentiers uniquement) de manire simple et rapide. Voyez plutt : >>> range(10) [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> range(0,5) [0, 1, 2, 3, 4] >>> range(15,20) [15, 16, 17, 18, 19] >>> range(0,1000,200) [0, 200, 400, 600, 800] >>> range(2,-2,-1) [2, 1, 0, -1] Linstruction range() fonctionne sur le modle range([dbut,] fin[, pas]). Les arguments entre crochets sont optionnels. Linstruction len() vous permet de connatre la longueur dune liste, ce qui parfois est bien pratique lorsquon lit un chier par exemple, et que lon ne connat pas a priori la longueur des lignes. Voici un exemple dutilisation : >>> animaux = ['girafe', 'tigre', 'singe', 'souris'] >>> len(animaux) 4 >>> len(range(10)) 10

4.6

Listes de listes

Pour nir, sachez quil est tout--fait possible de construire des listes de listes. Cette fonctionnalit peut tre parfois trs pratique. Par exemple : 18 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

4.7

Exercices

Listes

>>> enclos1 = ['girafe', 4] >>> enclos2 = ['tigre', 2] >>> enclos3 = ['singe', 5] >>> zoo = [enclos1, enclos2, enclos3] >>> zoo [['girafe', 4], ['tigre', 2], ['singe', 5]] Dans cet exemple, chaque sous-liste contient une catgorie danimal et le nombre danimaux pour chaque catgorie. Pour accder un lment de la sous-liste, on utilise un double indiage. >>> zoo[1] ['tigre', 2] >>> zoo[1][0] 'tigre' >>> zoo[1][1] 2 On verra un peu plus loin quil existe en Python les dictionnaires qui sont trs pratiques pour faire ce genre de choses. On verra aussi quil existe un module nomm numpy permettant de grer des listes ou tableaux de nombres (vecteurs et matrices), ainsi que de faire des oprations dessus.

4.7

Exercices
Conseil : utilisez linterprteur Python.

1. Constituez une liste semaine contenant les 7 jours de la semaine. partir de cette liste, comment rcuprez-vous seulement les 5 premiers jours de la semaine dune part, et ceux du week-end dautre part (utilisez pour cela lindiage) ? Cherchez un autre moyen pour arriver au mme rsultat (en utilisant un autre indiage). 2. Trouvez deux manires pour accder au dernier jour de la semaine. 3. Inversez les jours de la semaine en une commande. 4. Crez 4 listes hiver, printemps, ete et automne contenant les mois correspondant ces saisons. Crez ensuite une liste saisons contenant les sous-listes hiver, printemps,ete et automne. Prvoyez ce que valent les variables suivantes, puis vriez-le dans linterprteur : saisons[2] saisons[1][0] saisons[1:2] saisons[:][1] Comment expliquez-vous ce dernier rsultat ? 5. Afchez la table des 9 en une seule commande avec linstruction range(). 6. Avec Python, rpondez la question suivante en une seule commande. Combien y a-t-il de nombres pairs dans lintervalle [2 , 10000] inclus ?

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

19

Boucles et comparaisons

5
5.1

Boucles et comparaisons
Boucles for

Imaginez que vous ayez une liste de quatre lments dont vous voulez afcher les lments les uns aprs les autres. Dans ltat actuel de vos connaissances, il faudrait taper quelque chose du style : animaux = ['girafe','tigre','singe','souris'] print animaux[0] print animaux[1] print animaux[2] print animaux[3] Si votre liste ne contient que quatre lments, ceci est encore faisable mais imaginez quelle en contienne 100 voire 1000 ! Pour remdier cela, il faut utiliser les boucles. Regardez lexemple suivant : >>> animaux = ['girafe','tigre','singe','souris'] >>> for i in animaux: ... print i ... girafe tigre singe souris En fait, la variable i va prendre successivement les diffrentes valeurs de la liste animaux chacune de ses itrations. Dores et dj, remarquez avec attention lindentation. Vous voyez que linstruction print i est dcale par rapport linstruction for i in animaux:. Outre une meilleure lisibilit, ceci est formellement requis en Python. Toutes les instructions que lon veut rpter constituent le corps de la boucle (ou un bloc dinstructions) et doivent tre indentes dun(e) ou plusieurs espace(s) ou tabulation(s). Dans le cas contraire, Python vous renvoie un message derreur : >>> for i in animaux: ... print i File "<stdin>", line 2 print i ^ IndentationError: expected an indented block Notez galement que si le corps de votre boucle contient plusieurs instructions, celles-ci doivent tre indentes de la mme manire (e.g. si vous avez indent la premire instruction avec deux espaces, vous devez faire de mme avec la deuxime instruction, etc). Remarquez galement un autre aspect de la syntaxe, une instruction for doit absolument se terminer par le signe deux-points:. Il est aussi possible dutiliser une tranche dune liste : >>> animaux = ['girafe','tigre','singe','souris'] >>> for i in animaux[1:3]: ... print i ... tigre singe 20 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

5.1

Boucles for

Boucles et comparaisons

On a vu que les boucles for pouvaient utiliser une liste contenant des chanes de caractres, mais elles peuvent tout aussi bien utiliser des listes numriques. En utilisant linstruction range on peut facilement accder une liste dentiers. >>> for i in range(4): ... print i ... 0 1 2 3 Par consquent, vous pouvez utiliser les boucles comme une itration sur les indices des lments dune liste. >>> animaux = ['girafe', 'tigre', 'singe', 'souris'] >>> for i in range(4): ... print animaux[i] ... girafe tigre singe souris Cependant, la mthode utiliser pour parcourir avec une boucle for les lments dune liste est celle qui ralise les itrations directement sur les lements. >>> animaux = ['girafe','tigre','singe','souris'] >>> for i in animaux: ... print i ... girafe tigre singe souris Si vous avez besoin de parcourir votre liste par ses indices, prfrez la fonction xrange() qui sutilise de la mme manire que range() mais qui ne construit pas de liste et qui est donc beaucoup plus rapide. La fonction range() ne sera donc employe que pour crer des listes dentiers. >>> animaux = ['girafe','tigre','singe','souris'] >>> for i in xrange(4): ... print animaux[i] ... girafe tigre singe souris Enn, si vous avez besoin de lindice dun lment dune liste et de llment lui-mme, la fonction enumerate() est pratique. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 21

Boucles et comparaisons

5.2

Comparaisons

>>> animaux = ['girafe','tigre','singe','souris'] >>> for i, ani in enumerate(animaux): ... print i, ani ... 0 girafe 1 tigre 2 singe 3 souris

5.2

Comparaisons

Avant de passer une autre sorte de boucles (les boucles while), nous abordons tout de suite les comparaisons. Celles-ci seront reprises dans le chapitre des tests. Python est capable deffectuer toute une srie de comparaisons entre le contenu de diffrentes variables, telles que : syntaxe Python == != > >= < <= signification gal diffrent de suprieur suprieur ou gal infrieur infrieur ou gal

Observez lexemple suivant sur des nombres entiers. >>> x >>> x True >>> x False >>> x True = 5 == 5 > 10 < 10

Python renvoie la valeur True si la comparaison est vraie et False si elle est fausse. True et False sont des boolens. Faites bien attention ne pas confondre loprateur daffectation = qui donne une valeur une variable et loprateur de comparaison == qui compare les valeurs de deux variables. Vous pouvez galement effectuer des comparaisons sur des chanes de caractres. >>> animal >>> animal False >>> animal True >>> animal True = "tigre" == "tig" != "tig" == 'tigre'

Dans le cas des chanes de caractres, a priori seuls les tests == et != ont un sens. En fait, on peut aussi utiliser les oprateurs <, >, <= et >=. Dans ce cas lordre alphabtique est pris en compte, par exemple : >>> "a" < "b" True 22 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

5.3

Boucles while

Boucles et comparaisons

"a" est infrieur "b" car il est situ avant dans lordre alphabtique. En fait, cest lordre ASCII des caractres qui est pris en compte (i.e. chaque caractre est affect un code numrique), on peut donc comparer aussi des caractres spciaux (comme # ou ~) entre eux. On peut aussi comparer des chanes plus dun caractre. >>> "ali" < "alo" True >>> "abb" < "ada" True Dans ce cas, Python compare caractre par caractre de la gauche vers la droite (le premier avec le premier, le deuxime avec le deuxime, etc). Ds quun caractre est diffrent entre lune et lautre des chanes, il considre que la chane la plus petite est celle qui prsente le caractre ayant le plus petit code ASCII (les caractres suivants de la chane sont ignors dans la comparaison), comme dans notre test "abb" < "ada" ci-dessus.

5.3

Boucles while

Une autre alternative linstruction for couramment utilise en informatique est la boucle while. Le principe est simple. Une srie dinstructions est excute tant quune condition est vraie. Par exemple : >>> i = 1 >>> while i <= 4: ... print i ... i = i + 1 ... 1 2 3 4 Remarquez quil est encore une fois ncessaire dindenter le bloc dinstructions. Une boucle while ncessite trois lments pour fonctionner correctement : 1. linitialisation de la variable de test avant la boucle ; 2. le test de la variable associ linstruction while ; 3. lincrmentation de la variable de test dans le corps de la boucle. Faites bien attention aux tests et lincrmentation que vous utilisez car une erreur mne souvent des boucles innies qui ne sarrtent pas. Vous pouvez nanmoins toujours stopper lexcution dun script Python laide de la combinaison de touches Ctrl-C.

5.4

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Soit la liste ['vache','souris','levure','bacterie']. Afchez lensemble des lments de cette liste (un lment par ligne) de trois manires diffrentes (deux avec for et une avec while). 2. Constituez une liste semaine contenant les 7 jours de la semaine. crivez une srie dinstructions afchant les jours de la semaine (en utiliser une boucle for), ainsi quune autre srie dinstructions afchant les jours du week-end (en utilisant une boucle while). 3. Avec une boucle, afchez les nombres de 1 10 sur une seule ligne. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 23

Boucles et comparaisons

5.4

Exercices

4. Soit impairs la liste de nombres [1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21]. crivez un programme qui, partir de la liste impairs, construit une liste pairs dans laquelle tous les lments de impairs sont incrments de 1. 5. Voici les notes dun tudiant [14, 9, 6, 8, 12]. Calculez la moyenne de ces notes. Utilisez lcriture formate pour afcher la valeur de la moyenne avec deux dcimales. 6. Soit la liste X contenant les nombres entiers de 0 10. Calculez le produit des nombres conscutifs deux deux de X en utilisant une boucle. Exemple pour les premires itrations : 0 2 6 12 7. Triangle. crivez un script qui dessine un triangle comme celui-ci : * ** *** **** ***** ****** ******* ******** ********* ********** 8. Triangle invers. crivez un script qui dessine un triangle comme celui-ci : ********** ********* ******** ******* ****** ***** **** *** ** * 9. Triangle gauche. crivez un script qui dessine un triangle comme celui-ci : * ** *** **** ***** ****** ******* ******** ********* **********

24

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

5.4

Exercices

Boucles et comparaisons

10. Triangle isocle. crivez un script qui dessine un triangle comme celui-ci : * *** ***** ******* ********* *********** ************* *************** ***************** ******************* 11. Exercice +++. Suite de Fibonacci. La suite de Fibonacci est une suite mathmatique qui porte le nom de Leonardo Fibonacci, un mathmaticien italien du XIIIe sicle. Initialement, cette suite a t utilise pour dcrire la croissance dune population de lapins mais elle est peut galement tre utilise pour dcrire certains motifs gomtriques retrouvs dans la nature (coquillages, eurs de tournesol...). Par dnition, les deux premiers termes de la suite de Fibonacci sont 0 et 1. Ensuite, le terme au rang n est la somme des nombres aux rangs n - 1 et n - 2. Par exemple, les 10 premiers termes de la suite de Fibonacci sont 0, 1, 1, 2, 3, 5, 8, 13, 21, 34. crivez un script qui construit la liste des 20 premiers termes de la suite de Fibonacci puis lafche.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

25

Tests

6
6.1

Tests
Dnition

Les tests sont un lment essentiel tout langage informatique si on veut lui donner un peu de complexit car ils permettent lordinateur de prendre des dcisions si telle ou telle condition est vraie ou fausse. Pour cela, Python utilise linstruction if ainsi quune comparaison que nous avons aborde au chapitre prcdent. En voici un exemple : >>> x = 2 >>> if x == 2: ... print "Le test est vrai !" ... Le test est vrai ! >>> x = "tigre" >>> if x == "tigre": ... print "Le test est vrai !" ... Plusieurs remarques concernant ces deux exemples : Dans le premier exemple, le test tant vrai, linstruction print "Le test est vrai !" est excute. Dans le second exemple, le test est faux et rien nest afch. Les blocs dinstruction dans les tests doivent forcment tre indents comme les boucles for et while. Lindentation indique la porte des instructions excuter si le test est vrai. Linstruction if se termine comme les instructions for et while par le caractre :.

6.2

Tests plusieurs cas

Parfois, il est pratique de tester si la condition est vraie ou si elle est fausse dans une mme instruction if. Plutt que dutiliser deux instructions if, on peut se servir de if et de else : >>> x = 2 >>> if x == 2: ... print "Le test ... else: ... print "Le test ... Le test est vrai ! >>> x = 3 >>> if x == 2: ... print "Le test ... else: ... print "Le test ... Le test est faux !

est vrai !" est faux !"

est vrai !" est faux !"

On peut utiliser une srie de tests dans la mme instruction if, notamment pour tester plusieurs valeurs dune mme variable. Par exemple, on se propose de tirer au sort une base dADN puis dafcher le nom de cette dernire. Dans le code suivant, nous utilisons lintruction random.choice(liste) qui renvoie un lment choisi au hasard dans une liste. Linstruction import random sera vue plus tard, admettez pour le moment quelle est ncessaire. >>> import random 26 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

6.3

Tests multiples

Tests

>>> base = random.choice(["a", "t", "c", "g"]) >>> if base == "a": ... print "choix d'une adnine" ... elif base == "t": ... print "choix d'une thymine" ... elif base == "c": ... print "choix d'une cytosine" ... elif base == "g": ... print "choix d'une guanine" ... choix d'une cytosine Dans cet exemple, Python teste la premire condition, puis, si et seulement si elle est fausse, teste la deuxime et ainsi de suite... Le code correspondant la premire condition vrie est excut puis Python sort du if. Remarque De nouveau, faites bien attention lindentation dans ces deux derniers exemples ! Vous devez tre trs rigoureux ce niveau l. Pour vous en convaincre, excutez ces deux scripts dans linterprteur Python : Script 1 : nombres = [4, 5, 6] for i in nombres: if i == 5: print "Le test est vrai" print "car la variable i vaut", i Script 2 : nombres = [4, 5, 6] for i in nombres: if i == 5: print "Le test est vrai" print "car la variable i vaut", i Comment expliquez-vous ce rsultat ?

6.3

Tests multiples

Les tests multiples permettent de tester plusieurs conditions en mme temps en utilisant des oprateurs boolens. Les deux oprateurs les plus couramment utiliss sont le OU et le ET. Voici un petit rappel du mode de fonctionnement de ces oprateurs : Condition 1 Vrai Vrai Faux Faux Vrai Vrai Faux Faux Oprateur OU OU OU OU ET ET ET ET Condition 2 Vrai Faux Vrai Faux Vrai Faux Vrai Faux Rsultat Vrai Vrai Vrai Faux Vrai Faux Faux Faux

En Python, on utilise le mot rserv and pour loprateur ET et le mot rserv or pour loprateur OU. Respectez bien la casse, and et or scrivent en minuscule. En voici un exemple dutilisation : Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 27

Tests

6.4

Instructions break et continue

>>> x = 2 >>> y = 2 >>> if x == 2 and y == 2: ... print "le test est vrai" ... le test est vrai Notez que le mme rsulat serait obtenu en utilisant deux instructions if imbriques : >>> x = 2 >>> y = 2 >>> if x == 2: ... if y == 2: ... print "le test est vrai" ... le test est vrai Vous pouvez aussi tester directement leffet de ces oprateurs laide de True et False (attention respecter la casse). >>> True or False True Enn, on peut utiliser loprateur logique de ngation not qui inverse le rsultat dune condition : >>> not True False >>> not False True >>> not (True and True) False

6.4

Instructions break et continue

Ces deux instructions permet de modier le comportement dune boucle (for ou while) avec un test. Linstruction break stoppe la boucle. >>> for i in range(5): ... if i > 2: ... break ... print i ... 0 1 2 Linstruction continue saute litration suivante. >>> for i in range(5): ... if i == 2: ... continue ... print i 28 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

6.5

Exercices

Tests

... 0 1 3 4

6.5

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Constituez une liste semaine contenant les sept jours de la semaine. En utilisant une boucle, crivez chaque jour de la semaine ainsi que les messages suivants : Au travail sil sagit du lundi au jeudi Chouette c'est vendredi sil sagit du vendredi Repos ce week-end sil sagit du week-end. (Les messages ne sont que des suggestions, vous pouvez laisser aller votre imagination.) 2. La liste ci-dessous reprsente une squence dADN : ["A","C","G","T","T","A","G","C","T","A","A","C","G"] crivez un script qui transforme cette squence en sa squence complmentaire. Rappel : la squence complmentaire sobtient en remplaant A par T, T par A, C par G et G par C. 3. La fonction min() de Python, renvoie llment le plus petit dune liste. Sans utiliser cette fonction, crivez un script qui dtermine le plus petit lment de la liste [8, 4, 6, 1, 5]. 4. La liste ci-dessous reprsente une squence dacides amins ["A","R","A","W","W","A","W","A","R","W","W","R","A","G","A","R"] Calculez la frquence en alanine (A), arginine (R), tryptophane (W) et glycine (G) dans cette squence. 5. Voici les notes dun tudiant [14, 9, 13, 15, 12]. crivez un script qui afche la note maximum (fonction max()), la note minimum (fonction min()) et qui calcule la moyenne. Afchez la valeur de la moyenne avec deux dcimales. Afchez aussi la mention obtenue sachant que la mention est passable si la moyenne est entre 10 inclus et 12 exclus, assez-bien entre 12 inclus et 14 exclus et bien au-del de 14. 6. Faites une boucle qui parcourt les nombres de 0 20 et qui afche les nombres pairs infrieurs ou gaux 10 dune part, et les nombres impairs strictement suprieur 10 dautre part. Pour cet exercice, vous pourrez utiliser loprateur modulo % qui retourne le reste de la division entire entre deux nombres. 7. Exercice +++. Conjecture de Syracuse. La conjecture de Syracuse est une conjecture mathmatique qui reste improuve ce jour et qui est dnie de la manire suivante. Soit un entier positif n. Si n est pair, alors le diviser par 2. Si il est impair, alors le multiplier par 3 et lui ajouter 1. En rptant cette procdure, la suite de nombres atteint la valeur 1 puis se prolonge indniment par une suite de trois valeurs triviales appele cycle trivial. Jusqu prsent, la conjecture de Syracuse, selon laquelle depuis nimporte quel entier positif la suite de Syracuse atteint 1, na pas t mise en dfaut. Par exemple, les premiers lments de la suite de Syracuse pour un entier de dpart de 10 sont : 10, 5, 16, 8, 4, 2, 1... crivez un script qui, partant dun entier positif n, cre une liste des nombres de la suite de Syracuse. Avec diffrents points de dpart (n), la conjecture de Syracuse est-elle toujours vrie ? Quels sont les nombres qui constituent le cycle trivial ? Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 29

Tests

6.5

Exercices

Remarque 1 : pour cet exercice, vous avez besoin de faire un nombre ditrations inconnu pour que la suite de Syracuse atteigne 1 puis entame son cycle trivial. Vous pourrez tester votre algorithme avec un nombre arbitraire ditrations, typiquement 20 ou 100, suivant votre nombre n de dpart. Remarque 2 : un nombre est pair lorsque le reste de sa division entire (oprateur modulo %) par 2 est nul. 8. Exercice +++. Attribution simple de structure secondaire. Les angles didres phi/psi dune hlice alpha parfaite ont une valeur de -57 degrs et -47 degrs respectivement. Bien sr, il est trs rare que lon trouve ces valeurs parfaites dans une protine, par consquent il est couramment accept de tolrer une dviation de +/- 30 degrs sur celles-ci. Ci-dessous vous avez une liste de listes contenant les valeurs de phi/psi de la premire hlice de la protine 1TFE. laide de cette liste, crivez un programme qui teste, pour chacun des rsidus, sils sont ou non en hlice. [[48.6,53.4],[-124.9,156.7],[-66.2,-30.8],[-58.8,-43.1], [-73.9,-40.6],[-53.7,-37.5],[-80.6,-16.0],[-68.5,135.0], [-64.9,-23.5],[-66.9,-45.5],[-69.6,-41.0],[-62.7,-37.5], [-68.2,-38.3],[-61.2,-49.1],[-59.7,-41.1],[-63.2,-48.5], [-65.5,-38.5],[-64.1,-40.7],[-63.6,-40.8],[-66.4,-44.5], [-56.0,-52.5],[-55.4,-44.6],[-58.6,-44.0],[-77.5,-39.1], [-91.7,-11.9],[48.6,53.4]] \ \ \ \ \ \

9. Exercice +++. Dtermination des nombres premiers infrieurs 100. Voici un extrait de larticle sur les nombres premiers tir de lencyclopdie en ligne wikipdia. Un nombre premier est un entier naturel qui admet exactement deux diviseurs distincts entiers et positifs (qui sont alors 1 et lui-mme). Cette dnition exclut 1, qui na quun seul diviseur entier positif. Par opposition, un nombre non nul produit de deux nombres entiers diffrents de 1 est dit compos. Par exemple 6 = 2 3 est compos, tout comme 21 = 3 7, mais 11 est premier car 1 et 11 sont les seuls diviseurs de 11. Les nombres 0 et 1 ne sont ni premiers ni composs. Dterminez les nombres premiers infrieurs 100. Combien y a-t-il de nombres premiers entre 0 et 100 ? Pour vous aider, nous vous proposons deux mthodes. Mthode 1 (peu optimale mais assez intuitive) Pour chaque nombre de 2 100, calculez le reste de la division entire (avec loprateur modulo %) depuis 1 jusqu lui-mme. Si cest un nombre premier, il aura exactement deux nombres pour lesquels le reste de la division entire est gal 0 (1 et lui-mme). Si ce nest pas un nombre premier, il aura plus de deux nombres pour lesquels le reste de la division entire est gal 0. Mthode 2 (plus optimale et plus rapide, mais un peu plus complique) Vous pouvez parcourir tous les nombres de 2 100 et vrier si ceux-ci sont composs, cest--dire quils sont le produit de deux nombres premiers. Pratiquement, cela consiste vrier que le reste de la division entire (oprateur modulo %) entre le nombre considr et nimporte quel nombre premier est nul. Le cas chant, ce nombre nest pas premier.

30

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Fichiers

7
7.1

Fichiers
Lecture dans un chier

Dans la plupart des travaux de programmation, on doit lire ou crire dans un chier. Python possde pour cela tout un tas doutils qui vous simplient la vie. Avant de passer un exemple concret, crez un chier dans un diteur de texte que vous enregistrerez dans votre rpertoire avec le nom zoo.txt, par exemple : girafe tigre singe souris Ensuite, testez cet exemple : >>> filin = open('zoo.txt', 'r') >>> filin <open file 'zoo.txt', mode 'r' at 0x7f8ea16efc00> >>> filin.readlines() ['girafe\n', 'tigre\n', 'singe\n', 'souris\n'] >>> filin.close() >>> filin <closed file 'zoo.txt', mode 'r' at 0x7f8ea16efc00> La premire commande ouvre le chier zoo.txt en lecture seule (ceci est indiqu avec la lettre r). Remarquez que le chier nest pas encore lu, mais simplement ouvert (un peu comme lorsquon ouvre un livre, mais quon ne la pas encore lu). Lorsquon afche la valeur de la variable filin, vous voyez que Python la considre comme un objet de type chier <open file 'zoo.txt', mode 'r' at 0x7f8ea16efc00> Et oui, Python est un langage orient objet. Retenez seulement que lon peut considrer chaque variable comme un objet sur lequel on peut appliquer des mthodes. propos de mthode, on applique la mthode readlines() sur lobjet filin dans linstruction suivante (remarquez la syntaxe du type objet.mthode). Ceci nous retourne une liste contenant toutes les lignes du chier (dans notre analogie avec un livre, ceci correspondrait lire les lignes du livre). Enn, on applique la mthode close() sur lobjet filin, ce qui vous vous en doutez, va fermer le chier (ceci correspondrait bien sr fermer le livre). On pourra remarquer que ltat de lobjet a chang <closed file 'zoo.txt', mode 'r' at 0x7f8ea16efc00> Vous navez bien-sr pas retenir ces concepts dobjets pour pouvoir programmer avec Python, nous avons juste ouvert cette parenthse pour attirer votre attention sur la syntaxe. Remarque : nutilisez jamais le mot file comme nom de variable pour un chier car file est un mot rserv de Python. Voici maintenant un exemple complet de lecture dun chier avec Python. >>> filin = open('zoo.txt', 'r') >>> lignes = filin.readlines() >>> lignes ['girafe\n', 'tigre\n', 'singe\n', 'souris\n'] >>> for i in lignes: ... print i ... Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 31

Fichiers

7.1

Lecture dans un chier

girafe tigre singe souris >>> filin.close() Vous voyez quen cinq lignes de code, vous avez lu et parcouru le chier. Remarques : Notez que la liste lignes contient le caractre \n la n de chacun de ses lments. Ceci correspond au saut la ligne de chacune dentre elles (ceci est cod par un caractre spcial que lon symbolise par \n). Vous pourrez parfois rencontrer galement la notation octale \012. Remarquez aussi que lorsque lon afche les diffrentes lignes du chier laide de la boucle for et de linstruction print, Python saute chaque fois une ligne. Mthode read() Il existe dautres mthodes que readlines() pour lire (et manipuler) un chier. Par exemple, la mthode read() lit tout le contenu dun chier et renvoie une chane de caractres unique. >>> filin = open('zoo.txt', 'r') >>> filin.read() 'girafe\ntigre\nsinge\nsouris\n' >>> filin.close() Mthode readline() La mthode readline() (sans s) lit une ligne dun chier et la renvoie sous forme dune chane de caractres. chaque nouvel appel de readline(), la ligne suivante est renvoye. Associe la boucle while, cette mthode permet de lire un chier ligne par ligne. >>> filin = open('zoo.txt', 'r') >>> ligne = filin.readline() >>> while ligne != "": ... print ligne ... ligne = filin.readline() ... girafe tigre singe souris >>> filin.close() 32 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

7.2

criture dans un chier

Fichiers

Mthodes seek() et tell() Les mthodes seek() et tell() permettent respectivement de se dplacer au nime caractre (plus exactement au nime octet) dun chier et dafcher o en est la lecture du chier, cest--dire quel caractre (ou octet) est en train dtre lu. >>> filin = open('zoo.txt', 'r') >>> filin.readline() 'girafe\n' >>> filin.tell() 7 >>> filin.seek(0) >>> filin.tell() 0 >>> filin.readline() 'girafe\n' >>> filin.close() On remarque qu louverture dun chier, le tout premier caractre est considr comme le caractre 0 (tout comme le premier lment dune liste). La mthode seek() permet facilement de remonter au dbut du chier lorsque lon est arriv la n ou lorsquon en a lu une partie. Itrations directement sur le chier Python essaie de vous faciliter la vie au maximum. Voici un moyen la fois simple et lgant de parcourir un chier. >>> filin = open('zoo.txt', 'r') >>> for li in filin: ... print li ... girafe tigre singe souris >>> filin.close() La boucle for va demander Python daller lire le chier ligne par ligne. Privilgiez cette mthode par la suite.

7.2

criture dans un chier


crire dans un chier est aussi simple que de le lire. Voyez lexemple suivant :

>>> >>> >>> ... ... >>>

animaux2 = ['poisson', 'abeille', 'chat'] filout = open('zoo2.txt', 'w') for i in animaux2: filout.write(i) filout.close() 33

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Fichiers

7.3

Exercices

Le contenu du chier zoo2.txt est poissonabeillechat. Quelques commentaires sur cet exemple : Aprs avoir initialis la liste animaux2, nous avons ouvert un chier mais cette fois-ci en mode criture (avec le caractre w). Ensuite, on a balay cette liste laide dune boucle. chaque itration, nous avons crit chaque lment de la liste dans le chier. Remarquez nouveau la mthode write() qui sapplique sur lobjet filout. Enn, on a ferm le chier avec la mthode close(). Vous voyez quil est extrmement simple en Python de lire ou dcrire dans un chier. Remarque. Si votre programme produit uniquement du texte, vous pouvez lcrire sur la sortie standard (avec linstruction print). Lavantage est que dans ce cas lutilisateur peut bncier de toute les potentialits dUnix (redirection, tri, parsing...). Sil veut crire le rsultat du programme dans un chier, il pourra toujours le faire en redirigeant la sortie.

7.3

Exercices

Conseil : pour les exercices 1 et 2, utilisez linterprteur Python. Pour les exercices suivants, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Dans lexemple 'girafe', 'tigre', etc, ci-dessus, comment expliquer vous que Python saute une ligne chaque itration ? Rcrivez les instructions ad-hoc pour que Python crive le contenu du chier sans sauter de ligne. 2. En reprenant le dernier exemple sur lcriture dans un chier, vous pouvez constater que les noms danimaux ont t crits les uns la suite des autres, sans retour la ligne. Comment expliquez-vous ce rsultat ? Modiez les instructions de manire crire un animal par ligne. 3. Dans cet exercice, nous allons utiliser une sortie partielle de DSSP (Dene Secondary Structure of Proteins), qui est un logiciel dextraction des structures secondaires. Ce chier contient 5 colonnes correspondant respectivement au numro de rsidu, lacide amin, sa structure secondaire et ses angles phi/psi. Tlchargez le chier rst_helix_1tfe.txt sur le site du cours et sauvegardez-le dans votre rpertoire de travail (jetez-y un oeil en passant). Chargez les lignes de ce chier en les plaant dans une liste puis fermez le chier. crivez chaque ligne lcran pour vrier que vous avez bien charg le chier. crivez dans un chier output.txt chacune des lignes. Noubliez pas le retour la ligne pour chaque acide amin. crivez dans un chier output2.txt chacune des lignes suivies du message line checked. Encore une fois, noubliez pas les retours la ligne.

34

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Modules

8
8.1

Modules
Dnition

Les modules sont des programmes Python qui contiennent des fonctions que lon est amen rutiliser souvent (on les appelle aussi bibliothques ou libraries). Les dveloppeurs de Python ont mis au point de nombreux modules qui effectuent une quantit phnomnale de tches. Pour cette raison, prenez le rexe de vrier si une partie du code que vous souhaitez crire nexiste pas dj sous forme de module. La plupart de ces modules sont dj installs dans les versions standards de Python. Vous pouvez accder une documentation exhaustive sur le site de Python. Surfez un peu sur ce site, la quantit de modules est impressionante.

8.2

Importation de modules

Jusqu maintenant, nous avons rencontr une fois cette notion de module lorsque nous avons voulu tirer un nombre alatoire. >>> import random >>> random.randint(0,10) 4 Regardons de plus prs cet exemple : Linstruction import permet daccder toutes les fonctions du module random Ensuite, nous utilisons la fonction (ou mthode) randint(a,b) du module random. Attention cette fonction renvoie un nombre entier alatoirement entre a inclus et b inclus (contrairement range() par exemple). Remarquez la notation objet random.randint() o la fonction randint() peut tre considre comme une mthode de lobjet random. Il existe un autre moyen dimporter une ou des fonctions dun module : >>> from random import randint >>> randint(0,10) 7 laide du mot-cl from, vous pouvez importer une fonction spcique dun module donn. Remarquez que dans ce cas il est inutile de rpter le nom du module, seul le nom de ladite fonction est requis. On peut galement importer toutes les fonctions dun module : >>> from random import * >>> x = [1, 2, 3, 4] >>> shuffle(x) >>> x [2, 3, 1, 4] >>> shuffle(x) >>> x [4, 2, 1, 3] >>> randint(0,50) 46 >>> uniform(0,2.5) 0.64943174760727951 Comme vous lavez devin, linstruction from random import * importe toutes les fonctions du module random. On peut ainsi utiliser toutes ses fonctions directement, comme par exemple shuffle(), qui permute une liste alatoirement. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 35

Modules

8.3

Obtenir de laide sur les modules imports

Dans la pratique, plutt que de charger toutes les fonctions dun module en une seule fois (from random import *), nous vous conseillons de charger le module (import random) puis dappeler explicitement les fonctions voulues (random.randint(0,2)). Enn, si vous voulez vider de la mmoire un module dj charg, vous pouvez utiliser linstruction del : >>> import random >>> random.randint(0,10) 2 >>> del random >>> random.randint(0,10) Traceback (most recent call last): File "<stdin>", line 1, in ? NameError: name 'random' is not defined Vous pouvez constater quun rappel dune fonction du module random aprs lavoir vid de la mmoire retourne un message derreur. Enn, il est galement possible de dnir un alias (un nom plus court) pour un module : >>> import random as rand >>> rand.randint(1, 10) 6 Dans cet exemple, les fonctions du module random sont accessibles via lalias rand.

8.3

Obtenir de laide sur les modules imports

Pour obtenir de laide sur un module rien de plus simple, il suft dinvoquer la commande help() : >>> import random >>> help(random) ... On peut se promener dans laide avec les ches ou les touches page-up et page-down (comme dans les commandes Unix man, more ou less). Il est aussi possible dinvoquer de laide sur une fonction particulire dun module de la manire suivante help(random.randint).

La commande help() est en fait une commande plus gnrale permettant davoir de laide sur nimporte quel objet charg en mmoire. >>> x = range(2) >>> help(x) Help on list object: class list(object) | list() -> new list | list(sequence) -> new list initialized from sequence's items | | Methods defined here: | | __add__(...) 36 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

8.4

Modules courants

Modules

| | ...

x.__add__(y) <==> x+y

Enn, si on veut connatre en seul coup doeil toutes les mthodes ou variables associes un objet, on peut utiliser la commande dir :

>>> import random >>> dir(random) ['BPF', 'LOG4', 'NV_MAGICCONST', 'RECIP_BPF', 'Random', 'SG_MAGICCONST', 'SystemR 'TWOPI', 'WichmannHill', '_BuiltinMethodType', '_MethodType', '__all__', '__built '__doc__', '__file__', '__name__', '_acos', '_ceil', '_cos', '_e', '_exp', '_hexl '_inst', '_log', '_pi', '_random', '_sin', '_sqrt', '_test', '_test_generator', '_urandom', '_warn', 'betavariate', 'choice', 'expovariate', 'gammavariate', 'gau 'getrandbits', 'getstate', 'jumpahead', 'lognormvariate', 'normalvariate', 'paretovariate', 'randint', 'random', 'randrange', 'sample', 'seed', 'setstate', 'shuffle', 'uniform', 'vonmisesvariate', 'weibullvariate'] >>>

8.4

Modules courants

Il existe une srie de modules que vous serez probablement amens utiliser si vous programmez en Python. En voici une liste non exhaustive. Pour la liste complte, reportez-vous la page des modules sur le site de Python : math : fonctions et constantes mathmatiques de base (sin, cos, exp, pi...). sys : passage darguments, gestion de lentre/sortie standard... os : dialogue avec le systme dexploitation (e.g. permet de sortir de Python, lancer une commande en shell, puis de revenir Python). random : gnration de nombres alatoires. time : permet daccder lheure de lordinateur et aux fonctions grant le temps. calendar : fonctions de calendrier. prole : permet dvaluer le temps dexcution de chaque fonction dans un programme (proling en anglais). urllib2 : permet de rcuprer des donnes sur internet depuis python. Tkinter : interface python avec Tk (permet de crer des objets graphiques ; ncessite dinstaller Tk). re : gestion des expressions rgulires. pickle : criture et lecture de structures Python (comme les dictionnaires par exemple). Nous vous conseillons vivement daller surfer sur les pages de ces modules pour dcouvrir toutes leurs potentialits. Vous verrez plus tard comment crer votre propres modules lorsque vous tes amens rutiliser souvent vos propres fonctions. Enn, notez quil existe de nombreux autres modules qui ne sont pas installs de base dans Python mais qui sont de grand intrt en bioinformatique (au sens large). Citons-en quelquesuns : numpy (algbre linaire, transforme de Fourier), biopython (recherche dans les banques de donnes biologiques), rpy (dialogue R/Python)...

8.5

Module sys : passage darguments

Le module sys contient (comme son nom lindique) des fonctions et des variables spciques au systme, ou plus exactement linterprteur lui-mme. Par exemple, il permet de grer lentre (stdin) et la sortie standard (stdout). Ce module est particulirement intressant pour rcuprer les arguments passs un script Python lorsque celui-ci est appel en ligne Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 37

Modules

8.6

Module os

de commande. Dans cet exemple, oublions linterprteur et crivons le script suivant que lon enregistrera sous le nom test.py (noubliez pas de le rendre excutable) : #!/usr/bin/env python import sys print sys.argv Ensuite lancez test.py suivi de plusieurs arguments. Par exemple : poulain@cumin> python test.py salut girafe 42 ['test.py', 'salut', 'girafe', '42'] Dans lexemple prcdent, poulain@cumin> reprsente linvite du shell, test.py est le nom du script Python, salut, girafe et 42 sont les arguments passs au script. La variable sys.argv est une liste qui reprsente tous les arguments de la ligne de commande, y compris le nom du script lui mme quon peut retrouver dans sys.argv[0]. On peut donc accder chacun de ces arguments avec sys.argv[1], sys.argv[2]... On peut aussi utiliser la fonction sys.exit() pour quitter un script Python. On peut donner comme argument un objet (en gnral une chane de caractres) qui sera renvoy au moment ou Python quittera le script. Par exemple, si vous attendez au moins un argument en ligne de commande, vous pouvez renvoyer un message pour indiquer lutilisateur ce que le script attend comme argument : #!/usr/bin/env python import sys if len(sys.argv) != 2: sys.exit("ERREUR : il faut exactement un argument.") # # suite du script # Puis on lexcute sans argument : poulain@cumin> python test.py ERREUR : il faut exactement un argument. Notez quici on vrie que le script possde deux arguments car le nom du script lui-mme est le premier argument et file.txt constitue le second.

8.6

Module os
Le module os gre linterface avec le systme dexploitation. Une fonction pratique de ce module permet de grer la prsence dun chier sur le disque.

>>> import sys >>> import os >>> if os.path.exists("toto.pdb"): ... print "le fichier est prsent" ... else: ... sys.exit("le fichier est absent") ... le fichier est absent 38 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

8.7

Exercices

Modules

Dans cet exemple, si le chier nest pas prsent sur le disque, on quitte le programme avec la fonction exit() du module sys. La fonction system() permet dappeler nimporte quelle commande externe.

>>> import os >>> os.system("ls -al") total 5416 drwxr-xr-x 2 poulain dsimb 4096 2010-07-21 14:33 drwxr-xr-x 6 poulain dsimb 4096 2010-07-21 14:26 -rw-r--r-- 1 poulain dsimb 124335 2010-07-21 14:31 -rw-r--r-- 1 poulain dsimb 4706057 2010-07-21 14:31 -rw-r--r-- 1 poulain dsimb 233585 2010-07-21 14:30 -rw-r--r-- 1 poulain dsimb 463559 2010-07-21 14:33 0

. .. 1BTA.pdb NC_000913.fna NC_001133.fna NC_001133.gbk

La commande externe ls -al est introduite comme une chane de caractres la fonction system().

8.7

Exercices

Conseil : pour les trois premiers exercices, utilisez linterprteur Python. Pour les exercices suivants, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Afchez sur la mme ligne les nombres de 10 20 (inclus) ainsi que leur racine carre avec 3 dcimales (module math). Exemple : 10 11 12 13 3.162 3.317 3.464 3.606

2. Calculez le cosinus de pi/2 (module math). 3. Afchez la liste des chiers du rpertoire courant avec le module os. Nutilisez pas la fonction os.system() mais la fonction os.listdir() (lisez la documentation pour comprendre comment lutiliser). 4. crivez les nombres de 1 10 avec 1 seconde dintervalle (module time). 5. Gnrez une squence alatoire de 20 chiffres, ceux-ci tant des entiers tirs entre 1 et 4 (module random). 6. Gnrez une squence alatoire de 20 bases de deux manires diffrentes (module random). 7. Dterminez votre jour (lundi, mardi...) de naissance (module calendar). 8. Exercice +++. valuation du nombre par la mthode Monte Carlo. Soit un cercle de rayon 1 (en rouge) inscrit dans un carr de cot 2 (en bleu). Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 39

Modules

8.7

Exercices

Laire du carr vaut (2R)2 soit 4. Laire du cercle vaut R2 soit . En choississant N points alatoires ( laide dune distribution uniforme) lintrieur du carr, la probabilit que ces points se trouvent aussi dans le cercle est p= aire du cercle = aire du carr 4

Soit n, le nombre points effectivement dans le cercle, il vient alors p= do =4 n = , N 4 n . N

Dterminez une approximation de par cette mthode. Pour cela, vous allez, pour N itrations, choisir alatoirement les coordonnes dun point entre -1 et 1 (fonction uniform() du module random), calculer la distance entre le centre du cercle et ce point et dterminer si cette distance est infrieure au rayon du cercle. Le cas chant, le compteur n sera incrment. Que vaut lapproximation de pour 100 itrations ? 500 ? 1000 ? Conseil : pour les premiers exercices, utilisez linterprteur Python.

40

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

Plus sur les chanes de caractres

9
9.1

Plus sur les chanes de caractres


Prambule

Nous avons dj abord les chanes de caractres dans le chapitre variables et criture. Ici nous allons un peu plus loin notamment avec les mthodes associes aux chanes de caractres. Notez quil existe un module string mais qui est maintenant considr comme obsolte depuis la version 2.5 de Python.

9.2

Chanes de caractres et listes


Les chanes de caractres peuvent tre considres comme des listes.

>>> animaux = "girafe tigre" >>> animaux 'girafe tigre' >>> len(animaux) 12 >>> animaux[3] 'a' Nous pouvons donc utiliser certaines proprits des listes comme les tranches : >>> animaux = "girafe tigre" >>> animaux[0:4] 'gira' >>> animaux[9:] 'gre' >>> animaux[:-2] 'girafe tig' A contrario des listes, les chanes de caractres prsentent toutefois une diffrence notable, ce sont des listes non modiables. Une fois dnie, vous ne pouvez plus modier un de ses lments. Le cas chant, Python renvoie un message derreur : >>> animaux = "girafe tigre" >>> animaux[4] 'f' >>> animaux[4] = "F" Traceback (most recent call last): File "<stdin>", line 1, in <module> TypeError: 'str' object does not support item assignment Par consquent, si vous voulez modier une chane, vous tes obligs den construire une nouvelle. Pour cela, noubliez pas que les oprateurs de concatnation (+) et de duplication (*) (cf chapitre variables et criture) peuvent vous aider. Vous pouvez galement gnrer une liste, qui elle est modiable, puis revenir une chane.

9.3

Caractres spciaux

Il existe certains caractres spciaux comme le \n que nous avons dj vu (pour le retour la ligne). Le \t vous permet dcrire une tabulation. Si vous voulez crire un guillemet simple ou double (et que celui-ci ne soit pas confondus avec les guillemets de dclaration de la chane de caractres), vous pouvez utiliser \' ou \" ou utiliser respectivement des guillements doubles ou simple pour dclarer votre chane de caractres. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 41

Plus sur les chanes de caractres

9.4

Mthodes associes aux chanes de caractres

>>> print "Un retour a la ligne\npuis une tabulation\t, puis un guillemet\"" Un retour a la ligne puis une tabulation , puis un guillemet" >>> print 'J\'imprime un guillemet simple' J'imprime un guillemet simple >>> print "Un brin d'ADN" Un brin d'ADN >>> print 'Python est un "super" langage' Python est un "super" langage Lorsquon souhaite crire un texte sur plusieurs lignes, il est trs commode dutiliser les guillemets triples permettant de conserver le formatage (notamment les retours la ligne) : >>> x = '''souris ... chat ... abeille''' >>> x 'souris\nchat\nabeille' >>> print x souris chat abeille

9.4

Mthodes associes aux chanes de caractres


Voici quelques mthodes spciques aux objets de type string :

>>> x = "girafe" >>> x.upper() 'GIRAFE' >>> x 'girafe' >>> 'TIGRE'.lower() 'tigre' Les fonctions lower() et upper() passent un texte en minuscule et en majuscule respectivement. On remarque que lutilisation de ces fonctions naltrent pas la chane de dpart mais renvoie la chane transforme. Pour mettre en majuscule la premire lettre seulement, vous pouvez faire : >>> x[0].upper() + x[1:] 'Girafe' ou encore plus simple avec la fonction Python adquate : >>> x.capitalize() 'Girafe' Il existe une mthode associe aux chanes de caractres qui est particulirement pratique, la fonction split() : >>> animaux = "girafe tigre singe" >>> animaux.split() ['girafe', 'tigre', 'singe'] 42 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

9.4

Mthodes associes aux chanes de caractres

Plus sur les chanes de caractres

>>> for i in animaux.split(): ... print i ... girafe tigre singe La fonction split() dcoupe la ligne en champs, en utilisant comme sparateur les espaces ou les tabulations. Il est possible de modier le sparateur de champs, par exemple : >>> animaux = "girafe:tigre:singe" >>> animaux.split(":") ['girafe', 'tigre', 'singe'] La fonction find() recherche une chane de caractres passe en argument. >>> >>> 1 >>> 3 >>> -1 animal = "girafe" animal.find('i') animal.find('afe') animal.find('tig')

Si llment recherch est trouv, alors lindice du dbut de llment dans la chane de caractres est renvoy. Si llment nest pas trouv, alors la valeur -1 est renvoye. Si llment recherch est trouv plusieurs fois, seul lindice de la premire occurence est retourn : >>> animaux = "girafe tigre" >>> animaux.find("i") 1 On trouve aussi la fonction replace(), qui serait lquivalent de la fonction de substitution de la commande Unix sed : >>> animaux = "girafe tigre" >>> animaux.replace("tigre", "singe") 'girafe singe' >>> animaux.replace("i", "o") 'gorafe togre' Enn, la fonction count() compte le nombre doccurences dune chane de caractres passe en argument : >>> >>> 2 >>> 0 >>> 1 animaux = "girafe tigre" animaux.count("i") animaux.count("z") animaux.count("tigre")

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

43

Plus sur les chanes de caractres

9.5

Conversion de types

9.5

Conversion de types

Dans tout langage de programmation, on est souvent amen convertir les types, cest-dire passer dun type numrique une chane de caractres ou vice-versa. En Python, rien de plus simple avec les fonctions int(), float() et str(). Pour vous en convaincre, regardez ces exemples : >>> i = 3 >>> str(i) '3' >>> i = '456' >>> int(i) 456 >>> float(i) 456.0 >>> i = '3.1416' >>> float(i) 3.1415999999999999 Ces conversions sont essentielles lorsquon lit ou crit des nombres dans un chier. En effet, les nombres dans un chier sont considrs comme du texte par la fonction readlines(), par consquent il faut les convertir si on veut effectuer des oprations numriques dessus.

9.6

Conversion dune liste de chanes de caractres en une chane de caractres

La conversion dune liste de chanes de caractres en une chane de caractres est un peu particulire puisquelle fait appelle la fonction join(). >>> seq = ["A", "T", "G", "A", "T"] >>> seq ['A', 'T', 'G', 'A', 'T'] >>> "-".join(seq) 'A-T-G-A-T' >>> " ".join(seq) 'A T G A T' >>> "".join(seq) 'ATGAT' Les lments de la liste initiale sont concatns les uns la suite des autres et intercals par un sparateur qui peut tre nimporte quelle chane de caractres (ici, nous avons utilis un tiret, un espace et rien). Attention, la fonction join() ne sapplique qu une liste de chanes de caractres. >>> maliste = ["A", 5, "G"] >>> " ".join(maliste) Traceback (most recent call last): File "<stdin>", line 1, in <module> TypeError: sequence item 1: expected string, int found Nous esprons quaprs ce petit tour dhorizon vous serez convaincu de la richesse des mthodes associes aux chanes de caractres. Pour avoir une liste exhaustive de lensemble des mthodes associes une variable particulire, vous pouvez utiliser la commande dir(). 44 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

9.7

Exercices

Plus sur les chanes de caractres

>>> dir(animaux) ['__add__', '__class__', '__contains__', '__delattr__', '__doc__', '__eq__', '__g '__getattribute__', '__getitem__', '__getnewargs__', '__getslice__', '__gt__', '__hash__', '__init__', '__le__', '__len__', '__lt__', '__mod__', '__mul__', '__n '__new__', '__reduce__', '__reduce_ex__', '__repr__', '__rmod__', '__rmul__', '__setattr__', '__str__', 'capitalize', 'center', 'count', 'decode', 'encode', 'endswith', 'expandtabs', 'find', 'index', 'isalnum', 'isalpha', 'isdigit', 'islo 'isspace', 'istitle', 'isupper', 'join', 'ljust', 'lower', 'lstrip', 'partition', 'replace', 'rfind', 'rindex', 'rjust', 'rpartition', 'rsplit', 'rstrip', 'split', 'splitlines', 'startswith', 'strip', 'swapcase', 'title', 'translate', 'upper', 'zfill'] Pour linstant vous pouvez ignorer les mthodes qui commencent et qui se terminent par deux tirets bas (underscores) __ . Vous pouvez ensuite accder laide et la documentation dune fonction particulire avec help() : >>> help(animaux.split) Help on built-in function split: split(...) S.split([sep [,maxsplit]]) -> list of strings Return a list of the words in the string S, using sep as the delimiter string. If maxsplit is given, at most maxsplit splits are done. If sep is not specified or is None, any whitespace string is a separator. (END)

9.7

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Soit la liste ['girafe', 'tigre', 'singe', 'souris']. Avec une boucle, afchez chaque lment ainsi que sa taille (nombre de caractres). 2. Soit la squence nuclique ATATACGGATCGGCTGTTGCCTGCGTAGTAGCGT. Calculez la frquence de chaque base dans cette squence. 3. Soit la squence protique ALA GLY GLU ARG TRP TYR SER GLY ALA TRP. Transformez cette squence en une chane de caractres en utilisant le code une lettre pour les acides amins. 4. Distance de Hamming. La distance de Hamming mesure la diffrence entre deux squences de mme taille en sommant le nombre de positions qui, pour chaque squence, ne correspondent pas au mme acide amin. Calculez la distance de Hamming pour les squences AGWPSGGASAGLAIL et IGWPSAGASAGLWIL. 5. Palindrome. Un palindrome est un mot ou une phrase dont lordre des lettres reste le mme si on le lit de gauche droite ou de droite gauche. Par exemple, ressasser et Engage le jeu que je le gagne sont des palindromes. crivez un script qui dtermine si une chane de caractres est un palindrome. Pensez vous dbarasser des majuscules et des espaces. Testez si les expressions suivantes sont des palindromes : Radar , Never odd or even , Karine alla en Iran , Un roc si biscornu . Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 45

Plus sur les chanes de caractres

9.7

Exercices

6. Mot composable. Un mot est composable partir dune squence de lettres si la squence contient toutes les lettres du mot. Comme au Scrabble, chaque lettre de la squence ne peut tre utilise quune seule fois. Par exemple, coucou est composable partir de uocuoceokzefhu. crivez un script qui permet de savoir si un mot est composable partir dune squence de lettres. Testez le avec diffrents mots et squences. Remarque : dans votre script, le mot et la squence de lettres seront des chanes de caractres. 7. Alphabet et pangramme. Les codes ASCII des lettres minuscules de lalphabet vont de 97 (lettre a) 122 (lettre z). La fonction chr() prend en argument un code ASCII sous forme dune entier et renvoie le caractre correspondant. Ainsi chr(97) renvoie 'a', chr(98) renvoie 'b' et ainsi de suite. crivez un script qui construit une chane de caractres contenant toutes les lettres de lalphabet. Un pangramme est une phrase comportant au moins une fois chaque lettre de lalphabet. Par exemple, Portez ce vieux whisky au juge blond qui fume est un pangramme. Modiez le script prcdent pour dterminer si une chane de caractres est un pangramme ou non. Pensez vous dbarasser des majuscules le cas chant. Testez si les expressions suivantes sont des pangrammes : Monsieur Jack vous dactylographiez bien mieux que votre ami Wolf , Buvez de ce whisky que le patron juge fameux . 8. Tlchargez le chier pdb 1BTA dans votre rpertoire. Faites un script qui rcupre seulement les carbones alpha et qui les afche lcran. 9. En vous basant sur le script prcdent, afchez lcran les carbones alpha des deux premiers rsidus. Toujours avec le mme script, calculez la distance inter atomique entre ces deux atomes. 10. En vous basant sur le script prcdent, calculez les distances entre carbones alpha conscutifs. Afchez ces distances sous la forme numero_calpha_1 numero_calpha_2 distance la n du script, faites galement afcher la moyenne des distances. La distance inter carbone alpha dans les protines est trs stable et de lordre de 3,8 angstrms. Observez avec attention les valeurs que vous avez obtenues. Expliquez lanomalie dtecte.

46

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

10

Plus sur les listes

10
10.1

Plus sur les listes


Proprits des listes

Jusqu maintenant, nous avons toujours utilis des listes qui taient dj remplies. Nous savons comment modier un de ses lments, mais il est aussi parfois trs pratique den remanier la taille (e. g. ajouter, insrer ou supprimer un ou plusieurs lments, etc.). Les listes possdent cet effet des mthodes qui leurs sont propres. Observez les exemples suivants : append() pour ajouter un lment la n dune liste. >>> x = [1,2,3] >>> x.append(5) >>> x [1, 2, 3, 5] qui est quivalent >>> x = [1,2,3] >>> x = x + [5] >>> x [1, 2, 3, 5] insert() pour insrer un object dans une liste avec un indice dtermin. >>> x.insert(2,-15) >>> x [1, 2, -15, 3, 5] del pour supprimer un lment dune liste une indice dtermin. >>> del x[1] >>> x [1, -15, 3, 5] remove() pour supprimer un lment dune liste partir de sa valeur >>> x.remove(5) >>> x [1, -15, 3] sort() pour trier une liste. >>> x.sort() >>> x [-15, 1, 3] reverse() pour inverser une liste. >>> x.reverse() >>> x [3, 1, -15] count() pour compter le nombre dlments (pass en argument) dans une liste. >>> l=[1, 2, 4, 3, 1, 1] >>> l.count(1) 3 >>> l.count(4) 1 >>> l.count(23) 0 Remarque 1 : attention, une liste remanie nest pas renvoye ! Pensez-y dans vos utilisations futures des listes. Remarque 2 : attention, certaines fonctions ci-dessus dcalent les indices dune liste (par exemple insert(), del etc). Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 47

10

Plus sur les listes

10.2

Test dappartenance

La mthode append() est particulirement pratique car elle permet de construire une liste au fur et mesure des itrations dune boucle. Pour cela, il est commode de dnir pralablement une liste vide de la forme maliste = []. Voici un exemple o une chane de caractres est convertie en liste : >>> seq = 'CAAAGGTAACGC' >>> seq_list = [] >>> seq_list [] >>> for i in seq: ... seq_list.append(i) ... >>> seq_list ['C', 'A', 'A', 'A', 'G', 'G', 'T', 'A', 'A', 'C', 'G', 'C'] Remarquez que vous pouvez directement utiliser la fonction list() qui prend nimporte quel objet squentiel (liste, chane de caractres, tuples, etc.) et qui renvoie une liste : >>> seq = 'CAAAGGTAACGC' >>> list(seq) ['C', 'A', 'A', 'A', 'G', 'G', 'T', 'A', 'A', 'C', 'G', 'C'] Cette mthode est certes plus simple, mais il arrive parfois que lon doive utiliser les boucles tout de mme, comme lorquon lit un chier.

10.2

Test dappartenance

Linscription in permet de tester si un lment fait partie dune liste. liste >>> 3 True >>> 4 False >>> 3 False >>> 4 True = [1, 3, 5, 7, 9] in liste in liste not in liste not in liste

La variation avec not permet, a contrario, de vrier quun lement nest pas dans une liste.

10.3

Copie de listes

Il est trs important de savoir que laffectation dune liste ( partir dune liste prexistante) cre en ralit une rfrence et non une copie : >>> >>> >>> [1, >>> >>> [1, 48 x = [1,2,3] y = x y 2, 3] x[1] = -15 y -15, 3] Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

10.3

Copie de listes

10

Plus sur les listes

Vous voyez que la modication de x modie y aussi. Rappelez-vous de ceci dans vos futurs programmes car cela pourrait avoir des effets dsastreux ! Techniquement, Python utilise des pointeurs (comme dans le langage C) vers les mmes objets et ne cre pas de copie moins que vous nen ayez fait la demande explicitement. Regardez cet exemple : >>> >>> >>> >>> [1, x = [1,2,3] y = x[:] x[1] = -15 y 2, 3]

Dans lexemple prcdent, x[:] a cr une copie la vole de la liste x. Vous pouvez utiliser aussi la fonction list() qui renvoie explicitement une liste : >>> >>> >>> >>> [1, x = [1,2,3] y = list(x) x[1] = -15 y 2, 3]

Attention, les deux techniques prcdentes ne fonctionnent que pour les listes une dimension, autrement dit les listes qui ne contienent pas elles-mmes dautres listes. >>> x = [[1,2],[3,4]] >>> x [[1, 2], [3, 4]] >>> y = x[:] >>> y[1][1] = 55 >>> y [[1, 2], [3, 55]] >>> x [[1, 2], [3, 55]] >>> y = list(x) >>> y[1][1] = 77 >>> y [[1, 2], [3, 77]] >>> x [[1, 2], [3, 77]] La mthode de copie qui marche tous les coups consiste appeler la fonction deepcopy() du module copy. >>> import copy >>> x = [[1,2],[3,4]] >>> x [[1, 2], [3, 4]] >>> y = copy.deepcopy(x) >>> y[1][1] = 99 >>> y [[1, 2], [3, 99]] >>> x [[1, 2], [3, 4]] Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 49

10

Plus sur les listes

10.4

Exercices

10.4

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Soit la liste de nombres [8, 3, 12.5, 45, 25.5, 52, 1]. Triez les nombres de cette liste par ordre croissant, sans utiliser la fonction sort() (les fonctions min(), append() et remove() vous seront utiles). 2. Gnrez alatoirement une squence nuclique de 20 bases en utilisant une liste et la mthode append(). 3. Transformez la squence nuclique TCTGTTAACCATCCACTTCG en sa squence complmentaire inverse. Noubliez pas que la squence complmentaire doit tre inverse, pensez aux mthodes des listes ! 4. Soit la liste de nombres [5, 1, 1, 2, 5, 6, 3, 4, 4, 4, 2]. Enlevez les doublons de cette liste, triez-l et afchez-l. 5. Gnrez alatoirement une squence nuclique de 50 bases contenant 10 % de A, 50 % de G, 30 % de T et 10 % de C. 6. Exercice +++. Triangle de Pascal Voici le dbut du triangle de Pascal : 1 11 121 1331 14641 ... Comprenez comment une ligne est construite partir de la prcente. partir de lordre 1 (ligne 2, 11), gnrez lordre suivant (121). Vous pouvez utiliser une liste pralablement gnre avec range(). Gnralisez laide dune boucle. crivez dans un chier pascal.out les lignes du triangle de Pascal de lordre 1 jusqu lordre 10.

50

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

11

Dictionnaires et tuples

11
11.1

Dictionnaires et tuples
Dictionnaires

Les dictionnaires se rvlent trs pratiques lorsque vous devez manipuler des structures complexes dcrire et que les listes prsentent leurs limites. Les dictionnaires sont des collections non ordonnes dobjets, c--d quil ny a pas de notion dordre (i. e. pas dindice). On accde aux valeurs dun dictionnaire par des cls. Ceci semble un peu confus ? Regardez lexemple suivant : >>> ani1 = {} >>> ani1['nom'] = 'girafe' >>> ani1['taille'] = 5.0 >>> ani1['poids'] = 1100 >>> ani1 {'nom': 'girafe', 'poids': 1100, 'taille': 5.0} >>> ani1['taille'] 5.0 En premier, on dnit un dictionnaire vide avec les symboles {} (tout comme on peut le faire pour les listes avec []). Ensuite, on remplit le dictionnaire avec diffrentes cls auxquelles on affecte des valeurs (une par cl). Vous pouvez mettre autant de cls que vous voulez dans un dictionnaire (tout comme vous pouvez ajouter autant dlments que vous voulez dans une liste). Pour rcuprer la valeur dune cl donne, il suft dutiliser une syntaxe du style dictionnaire['cle']. Mthodes keys() et values() Les mthodes keys() et values() renvoient, comme vous vous en doutez, les cls et les valeurs dun dictionnaire (sous forme de liste) : >>> ani1.keys() ['nom', 'poids', 'taille'] >>> ani1.values() ['girafe', 1100, 5.0] On peut aussi initialiser toutes les cls dun dictionnaire en une seule opration : >>> ani2 = {'nom':'singe', 'poids':70, 'taille':1.75} Liste de dictionnaires En crant une liste de dictionnaires possdant les mmes cls, on obtient une structure qui ressemble une base de donnes :

>>> animaux = [ani1, ani2] >>> animaux [{'nom': 'girafe', 'poids': 1100, 'taille': 5.0}, {'nom': 'singe', 'poids': 70, ' >>> >>> for ani in animaux: ... print ani['nom'] ... girafe singe Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 51

11

Dictionnaires et tuples

11.2

Tuples

Existence dune clef Enn, pour vrier si une cl existe, vous pouvez utiliser la proprit has_key() : >>> if ani2.has_key('poids'): ... print "La clef 'poids' existe pour ani2" ... La clef 'poids' existe pour ani2 Python permet mme de simplier encore les choses : >>> if "poids" in ani2: ... print "La clef 'poids' existe pour ani2" ... La clef 'poids' existe pour ani2 Vous voyez que les dictionnaires permettent de grer des structures complexes de manire plus explicite que les listes.

11.2

Tuples

Les tuples correspondent aux listes la diffrence quils sont non modiables. On a vu la section prcdente que les listes pouvaient tre modies par des rfrences ; les tuples vous permettent de vous affranchir de ce problme. Pratiquement, ils utilisent les parenthses au lieu des crochets : >>> x = (1,2,3) >>> x (1, 2, 3) >>> x[2] 3 >>> x[0:2] (1, 2) >>> x[2] = 15 Traceback (innermost last): File "<stdin>", line 1, in ? TypeError: object doesn't support item assignment Laffectation et lindiage fonctionne comme avec les listes, mais si lon essaie de modier un des lments du tuple, Python renvoie un message derreur. Si vous voulez ajouter un lment (ou le modier), vous devez crer un autre tuple : >>> x = (1,2,3) >>> x + (2,) (1, 2, 3, 2) Remarquez que pour utiliser un tuple dun seul lment, vous devez utiliser une syntaxe avec une virgule (element,), ceci pour viter une ambigut avec une simple expression. Autre particularit des tuples, il est possible den crer de nouveaux sans les parenthses, ds lors que ceci ne pose pas dambigut avec une autre expression : >>> >>> (1, >>> >>> (1, 52 x = (1,2,3) x 2, 3) x = 1,2,3 x 2, 3) Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

11.3

Exercices

11

Dictionnaires et tuples

Toutefois, nous vous conseillons dutiliser systmatiquement les parenthses an dviter les confusions. Enn, on peut utiliser la fonction tuple(sequence) qui fonctionne exactement comme la fonction list, c--d quelle prend en argument un objet squentiel et renvoie le tuple correspondant : >>> range(10) [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> tuple(range(10)) (0, 1, 2, 3, 4, 5, 6, 7, 8, 9) >>> tuple("ATGCCGCGAT") ('A', 'T', 'G', 'C', 'C', 'G', 'C', 'G', 'A', 'T') Remarque : les listes, dictionnaires, tuples sont des objets qui peuvent contenir des collections dautres objets. On peut donc construire des listes qui contiennent des dictionnaires, des tuples ou dautres listes, mais aussi des dictionnaires contenant des tuples, des listes, etc.

11.3

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. En utilisant un dictionnaire et la fonction has_key(), dterminez le nombre doccurences de chaque acide amin dans la squence AGWPSGGASAGLAILWGASAIMPGALW. Le dictionnaire ne doit contenir que les acides amins prsents dans la squence. 2. Soit la squence nuclotidique suivante : ACCTAGCCATGTAGAATCGCCTAGGCTTTAGCTAGCTCTAGCTAGCTG En utilisant un dictionnaire, faites un programme qui rpertorie tous les mots de 2 lettres qui existent dans la sequence (AA, AC, AG, AT, etc.) ainsi que leur nombre doccurences puis qui les afche lcran. 3. Faites de mme avec des mots de 3 et 4 lettres. 4. En vous basant sur les scripts prcdents, extrayez les mots de 2 lettres et leur occurence sur le gnome du chromosome I de la levure du boulanger Saccharomyces cerevisiae NC_001133.fna. Attention, le gnome complet est fourni au format fasta. 5. Crez un script extract-words.py qui prend en arguments un chier genbank suivi dun entier compris entre 1 et 4. Ce script doit extraire du chier genbank tous les mots (ainsi que leur nombre doccurences) du nombre de lettres passes en option. 6. Appliquez ce script sur le gnome dEscherichia coli : NC_000913.fna (au format fasta). Cette mthode vous parat-elle efcace sur un gnome assez gros comme celui dE. Coli ? Comment pourrait-on en amliorer la rapidit ? 7. partir du chier PDB 1BTA, construisez un dictionnaire qui contient 4 cls se rfrant au premier carbone alpha : le numro du rsidu, puis les coordonnes x, y et z. 8. Sur le mme modle que ci-dessus, crez une liste de dictionnaires pour chacun des carbones alpha de la protine. 9. laide de cette liste, calculez les coordonnes x, y et z du barycentre de ces carbones alpha.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

53

12

Fonctions

12
12.1

Fonctions
Principe

En programmation, les fonctions sont trs utiles pour raliser plusieurs fois la mme opration au sein dun programme. Elles permettent galement de rendre le code plus lisible et plus clair en le fractionnant en blocs logiques. Vous connaissez dj certaines fonctions Python, par exemple math.cos(angle) du module math renvoie le cosinus de la variable angle exprime en radian. Vous connaissez aussi des fonctions internes Python comme range() ou len(). Pour linstant, une fonction est vos yeux une sorte de bote noire : laquelle vous passez une (ou zero ou plusieurs) valeur(s) entre parenthses. Ces valeurs sont appeles arguments. Qui effectue une action. Par exemple random.shuffle() permute alatoirement une liste. Et qui renvoie ventuellement un rsultat. Par exemple si vous appelez la fonction range() en lui passant la valeur 5 (range(5)), celleci vous renvoie une liste de nombres entiers de 0 4 ([0, 1, 2, 3, 4]). Au contraire, aux yeux du programmeur une fonction est une portion de code effectuant une action bien particulire. Avant de dmarrer sur la syntaxe, revenons sur cette notion de bote noire : 1. Une fonction effectue une tche. Pour cela, elle reoit ventuellement des arguments et renvoie ventuellement un rsultat. Ce qui se passe en son sein nintresse pas directement lutilisateur. Par exemple, il est inutile de savoir comment la fonction math.cos() calcule un cosinus, on a juste besoin de savoir quil faut lui passer en argument un angle en radian et quelle renvoie le cosinus de cet angle. Ce qui se passe au sein de la fonction ne regarde que le programmeur (cest--dire vous dans ce chapitre). 2. Chaque fonction effectue en gnral une tche unique et prcise. Si cela se complique, il est plus judicieux dcrire plusieurs fonctions (qui peuvent ventuellement sappeler les unes les autres). Cette modularit amliore la qualit gnrale et la lisibilit du code. Vous verrez quen Python, les fonctions prsentent une grande exibilit.

12.2

Dnition

Pour dnir une fonction, Python utilise le mot-cl def et si on veut que celle-ci renvoie une valeur, il faut utiliser le mot-cl return. Par exemple : >>> def carre(x): ... return x**2 ... >>> print carre(2) 4 Remarquez que la syntaxe de def utilise les : comme les boucles for, while ainsi que les tests if, un bloc dinstrutions est donc attendu. De mme que pour les boucles et les tests, lindentation de ce bloc dinstructions (i.e. le corps de la fonction) est obligatoire. Dans lexemple prcdent, nous avons pass un argument la fonction carre() qui nous a retourn une valeur que nous avons afche lcran. Que veut dire valeur retourne ? Et bien cela signie que cette dernire est stockable dans une variable : 54 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

12.3

Passage darguments

12

Fonctions

>>> res = carre(2) >>> print res 4 Ici, le rsultat renvoy par la fonction est stocke dans la variable res. Notez quune fonction ne prend pas forcment un argument et ne renvoie pas forcment une valeur, par exemple : >>> def hello(): ... print "bonjour" ... >>> hello() bonjour Dans ce cas la fonction hello() se contente dimprimer la chane de caractres "hello" lcran. Elle ne prend aucun argument et ne renvoie aucun rsultat. Par consquent, cela na pas de sens de vouloir rcuprer dans une variable le rsultat renvoy par une telle fonction . Si on essaie tout de mme, Python affecte la valeur None qui signie rien en anglais : >>> x = hello() bonjour >>> print x None

12.3

Passage darguments

Le nombre dargument(s) que lon peut passer une fonction est variable. Nous avons vu ci-dessus des fonctions auxquelles on passait 0 ou 1 argument. Dans les chapitres prcdentes, vous avez vu des fonctions internes Python qui prenaient au moins 2 arguments, pour rappel souvenez-vous de range(1,10) ou encore range(1,10,2). Le nombre dargument est donc laiss libre linitiative du programmeur qui est en train de dvelopper une nouvelle fonction. Une particularit des fonctions en Python est que vous ntes pas oblig de prciser le type des arguments que vous lui passez, ds lors que les oprations que vous effectuez avec ces arguments sont valides. Python est en effet connu comme tant un langage au typage dynamique, cest--dire quil reconnat pour vous le type des variables au moment de lexcution, par exemple : >>> def fois(x,y): ... return x*y ... >>> fois(2,3) 6 >>> fois(3.1415,5.23) 16.430045000000003 >>> fois('to',2) 'toto' Loprateur * reconnait plusieurs types (entiers, rels, chanes de caractres), notre fonction est donc capable deffectuer plusieurs tches ! Un autre gros avantage de Python est que ses fonctions sont capables de renvoyer plusieurs valeurs la fois, comme dans cette fraction de code : >>> def carre_cube(x): ... return x**2,x**3 ... Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 55

12

Fonctions

12.4

Porte des variables

>>> carre_cube(2) (4, 8) Vous voyez quen ralit Python renvoie un objet squentiel qui peut par consquent contenir plusieurs valeurs. Dans notre exemple Python renvoie un objet tuple car on a utilis une syntaxe de ce type. Notre fonction pourrait tout autant renvoyer une liste : >>> def carre_cube2(x): ... return [x**2,x**3] ... >>> carre_cube2(3) [9, 27] Enn, il est possible de passer un ou plusieurs argument(s) de manire facultative et de leur attribuer une valeur par dfaut : >>> def useless_fct(x=1): ... return x ... >>> useless_fct() 1 >>> useless_fct(10) 10 Notez que si on passe plusieurs arguments une fonction, le ou les arguments facultatifs doivent tre situs aprs les arguments obligatoires. Il faut donc crire def fct(x, y, z=1):.

12.4

Porte des variables

Il est trs important lorsque lon manipule des fonctions de connatre la porte des variables. Premirement, on peut crer des variables au sein dune fonction qui ne seront pas visibles lextrieur de celle-ci ; on les appelle variables locales. Observez le code suivant : >>> def mafonction(): ... x = 2 ... print 'x vaut',x,'dans la fonction' ... >>> mafonction() x vaut 2 dans la fonction >>> print x Traceback (most recent call last): File "<stdin>", line 1, in ? NameError: name 'x' is not defined Lorsque Python excute le code de la fonction, il connait le contenu de la variable x. Par contre, de retour dans le module principal (dans notre cas, il sagit de linterprteur Python), il ne la connat plus do le message derreur. De mme, une variable passe en argument est considre comme locale lorsquon arrive dans la fonction : >>> def mafonction(x): ... print 'x vaut',x,'dans la fonction' ... >>> mafonction(2) x vaut 2 dans la fonction 56 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

12.5

Porte des listes

12

Fonctions

>>> print x Traceback (most recent call last): File "<stdin>", line 1, in ? NameError: name 'x' is not defined Deuximement, lorsquune variable dclare la racine du module (cest comme cela que lon appelle un programme Python), elle est visible dans tout le module. >>> ... ... >>> >>> 3 >>> 3 def mafonction(): print x x = 3 mafonction() print x

Dans ce cas, la variable x est visible dans le module principal et dans toutes les fonctions du module. Toutefois, Python ne permet pas la modication dune variable globale dans une fonction : >>> def mafonction(): ... x = x + 1 ... >>> x=1 >>> mafonction() Traceback (most recent call last): File "<stdin>", line 1, in <module> File "<stdin>", line 2, in fct UnboundLocalError: local variable 'x' referenced before assignment Lerreur renvoye montre que Python pense que x est une variable locale qui na pas t encore assigne. Si on veut vraiment modier une variable globale dans une fonction, il faut utiliser le mot-cl global : >>> ... ... ... >>> >>> >>> 2 def mafonction(): global x x = x + 1 x=1 mafonction() x

Dans ce dernier cas, le mot-cl global a forc la variable x a tre globale plutt que locale au sein de la fonction.

12.5

Porte des listes

Soyez extrmement attentifs avec les types modiables (tels que les listes) car vous pouvez les changer au sein dune fonction : >>> def mafonction(): ... liste[1] = -127 ... Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 57

12

Fonctions

12.6

Rgle LGI

>>> >>> >>> [1,

liste = [1,2,3] mafonction() liste -127, 3]

De mme que si vous passez une liste en argument, elle est tout autant modiable au sein de la fonction : >>> ... ... >>> >>> >>> [1, def mafonction(x): x[1] = -15 y = [1,2,3] mafonction(y) y -15, 3]

Si vous voulez viter ce problme, utilisez des tuples, Python renverra une erreur puisque ces derniers sont non modiables ! Une autre solution pour viter la modication dune liste lorsquelle est passe en tant quargument, est de la passer explicitement (comme nous lavons fait pour laffectation) an quelle reste intacte dans le programme principal. >>> ... ... >>> >>> >>> [1, >>> >>> [1, def mafonction(x): x[1] = -15 y = [1,2,3] mafonction(y[:]) y 2, 3] mafonction(list(y)) y 2, 3]

Dans ces deux derniers exemples, une copie de y est cre la vole lorsquon appelle la fonction, ainsi la liste y du module principal reste intacte.

12.6

Rgle LGI

Lorsque Python rencontre une variable, il va traiter la rsolution de son nom avec des priorits particulires : dabord il va regarder si la variable est locale, puis si elle nexiste pas localement, il vriera si elle est globale et enn si elle nest pas globale, il testera si elle est interne (par exemple la fonction len() est considre comme une fonction interne Python, i.e. elle existe chaque fois que vous lancez Python). On appelle cette rgle la rgle LGI pour locale, globale, interne. En voici un exemple : >>> def mafonction(): ... x = 4 ... print 'Dans la fonction x vaut', x ... >>> x = -15 >>> mafonction() Dans la fonction x vaut 4 >>> print 'Dans le module principal x vaut',x Dans le module principal x vaut -15 58 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

12.7

Exercices

12

Fonctions

Vous voyez que dans la fonction, x a pris la valeur qui lui tait dnie localement en priorit sur sa valeur dnie dans le module principal. Conseil : mme si Python peut reconnatre une variable ayant le mme nom que ses fonctions ou variables internes, vitez de les utiliser car ceci rendra votre code confus !

12.7

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Prdisez le comportement de ce code sans le recopier dans un script ni dans linterprteur Python : def hello(prenom): print "Bonjour", prenom hello("Patrick") print x 2. Prdisez le comportement de ce code sans le recopier dans un script ni dans linterprteur Python : x = 10 def hello(prenom): print "Bonjour", prenom hello("Patrick") print x 3. Prdisez le comportement de ce code sans le recopier dans un script ni dans linterprteur Python : x = 10 def hello(prenom): print "Bonjour", prenom print x hello("Patrick") print x 4. Prdisez le comportement de ce code sans le recopier dans un script ni dans linterprteur Python : x = 10 def hello(prenom): x = 42 print "Bonjour", prenom print x hello("Patrick") print x Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 59

12

Fonctions

12.7

Exercices

5. Crez une fonction qui prend une liste de bases et qui renvoie la squence complmentaire dune squence dADN sous forme de liste. 6. partir dune squence dADN ATCGATCGATCGCTGCTAGC, renvoyez le brin complmentaire (noubliez pas que la squence doit tre inverse). 7. Crez une fonction distance() qui calcule une distance euclidienne en 3 dimensions entre deux atomes. En reprenant lexercice sur le calcul de la distance entre carbones alpha conscutifs de la protine 1BTA (chapitre sur les chanes de caractres), refaites la mme chose en utilisant votre fonction distance().

60

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

13

Expressions rgulires et parsing

13

Expressions rgulires et parsing

Le module re vous permet dutiliser des expressions rgulires au sein de Python. Les expressions rgulires sont aussi appeles en anglais regular expressions ou regex. Elles sont incontournables en bioinformatique lorsque vous voulez rcuprer des informations dans un chier. Cette action de recherche de donnes dans un chier est appele plus gnralement parsing (qui signie littralement analyse syntaxique en anglais). Le parsing fait partie du travail quotidien du bioinformaticien, il est sans arrt en train de fouiller dans des chiers pour en extraire des informations dintrt comme par exemple rcuprer les coordonnes 3D des atomes dune protines dans un chier PDB ou alors extraire les gnes dun chier genbank. Dans ce chapitre, nous ne ferons que quelques rappels sur les expressions rgulires. Pour un documentation plus complte, rfrez-vous la page daide des expressions rgulires sur le site ofciel de Python.

13.1

Dnition et syntaxe

Une expression rgulire est une suite de caractres qui a pour but de dcrire un fragment de texte. Elle est constitu de deux types de caractres : 1. Les caractres dits normaux. 2. Les mtacaractres ayant une signication particulire, par exemple ^ signie dbut de ligne et non pas le caractre chapeau littral. Certains programmes Unix comme egrep, sed ou encore awk savent interprter les expressions rgulires. Tous ces programmes fonctionnent gnralement selon le schma suivant : 1. Le programme lit un chier ligne par ligne. 2. Pour chaque ligne lue, si lexpression rgulire passe en argument est prsente alors le programme effectue une action. Par exemple, pour le programme egrep :

[fuchs@rome cours_python]$ egrep "^DEF" herp_virus.gbk DEFINITION Human herpesvirus 2, complete genome. [fuchs@rome cours_python]$

Ici, egrep renvoie toutes les lignes du chier genbank du virus de lherps (herp_virus.gbk) qui correspondent lexpression rgulire ^DEF (i.e. DEF en dbut de ligne).

Avant de voir comment Python gre les expressions rgulires, voici quelques lments de syntaxe des mtacaractres : Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 61

13

Expressions rgulires et parsing

13.2

Module re et fonction search

[ABC]

[A-Z] [a-z] [0-9] [A-Za-z0-9] [^AB]

* +

? {n} {n,m} {n,} {,m} (CG|TT)

dbut de chane de caractres ou de ligne Exemple : lexpression ^ATG correspond la chane de caractres ATGCGT mais pas la chane CCATGTT. n de chane de caractres ou de ligne Exemple : lexpression ATG$ correspond la chane de caractres TGCATG mais pas avec la chane CCATGTT. nimporte quel caractre (mais un caractre quand mme) Exemple : lexpression A.G correspond ATG, AtG, A4G, mais aussi A-G ou A G. le caractre A ou B ou C (un seul caractre) Exemple : lexpression T[ABC]G correspond TAG, TBG ou TCG, mais pas TG. nimporte quelle lettre majuscule Exemple : lexpression C[A-Z]T correspond CAT, CBT, CCT... nimporte quelle lettre minuscule nimporte quel chiffre nimporte quel caractre alphanumrique nimporte quel caractre sauf A et B Exemple : lexpression CG[^AB]T correspond CG9T, CGCT... mais pas CGAT ni CGBT. caractre dchappement (pour protger certains caractres) Exemple : lexpression \+ dsigne le caractre + sans autre signication particulire. Lexpression A\.G correspond A.G et non pas A suivi de nimporte quel caractre, suivi de G. 0 n fois le caractre prcdent ou lexpression entre parenthses prcdente Exemple : lexpression A(CG)*T correspond AT, ACGT, ACGCGT... 1 n fois le caractre prcdent ou lexpression entre parenthses prcdente Exemple : lexpression A(CG)+T correspond ACGT, ACGCGT... mais pas AT. 0 1 fois le caractre prcdent ou lexpression entre parenthses prcdente Exemple : lexpression A(CG)?T correspond AT ou ACGT. n fois le caractre prcdent ou lexpression entre parenthses prcdente n m fois le caractre prcdent ou lexpression entre parenthses prcdente au moins n fois le caractre prcdent ou lexpression entre parenthses prcdente au plus m fois le caractre prcdent ou lexpression entre parenthses prcdente chanes de caractres CG ou TT Exemple : lexpression A(CG|TT)C correspond ACGC ou ATTC.

13.2

Module re et fonction search

Dans le module re, la fonction search() permet de rechercher un motif (pattern) au sein dune chane de caractres avec une syntaxe de la forme search(motif, chaine). Si motif existe dans chaine, Python renvoie une instance MatchObject. Sans entrer dans les dtails propres au langage orient objet, si on utilise cette instance dans un test, il sera considr comme vrai. Regardez cet exemple dans lequel on va rechercher le motif tigre dans la chane de caractres "girafe tigre singe" : >>> import re 62 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

13.2

Module re et fonction search

13

Expressions rgulires et parsing

>>> animaux = "girafe tigre singe" >>> re.search('tigre', animaux) <_sre.SRE_Match object at 0x7fefdaefe2a0> >>> if re.search('tigre', animaux): ... print "OK" ... OK Fonction match() Il existe aussi la fonction match() dans le module re qui fonctionne sur le modle de search(). La diffrence est quelle renvoie une instance MatchObject seulement lorsque lexpression rgulire correspond (match) au dbut de la chane ( partir du premier caractre). >>> animaux = "girafe tigre singe" >>> re.search('tigre', animaux) <_sre.SRE_Match object at 0x7fefdaefe718> >>> re.match('tigre', animaux) Nous vous recommandons plutt lusage de la fonction search(). Si vous souhaitez avoir une correspondance avec le dbut de la chane, vous pouvez toujours utiliser laccroche de dbut de ligne ^. Compilation dexpressions rgulires Il est aussi commode de pralablement compiler lexpression rgulire laide de la fonction compile() qui renvoie un objet de type expression rgulire : >>> regex = re.compile("^tigre") >>> regex <_sre.SRE_Pattern object at 0x7fefdafd0df0> On peut alors utiliser directement cet objet avec la mthode search() : >>> animaux = "girafe tigre singe" >>> regex.search(animaux) >>> animaux = "tigre singe" >>> regex.search(animaux) <_sre.SRE_Match object at 0x7fefdaefe718> >>> animaux = "singe tigre" >>> regex.search(animaux) Groupes Python renvoie un objet MatchObject lorsquune expression rgulire trouve une correspondance dans une chane pour quon puisse rcuprer des informations sur les zones de correspondance. >>> regex = re.compile('([0-9]+)\.([0-9]+)') >>> resultat = regex.search("pi vaut 3.14") >>> resultat.group(0) '3.14' >>> resultat.group(1) '3' Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 63

13

Expressions rgulires et parsing

13.2

Module re et fonction search

>>> resultat.group(2) '14' >>> resultat.start() 8 >>> resultat.end() 12 Dans cet exemple, on recherche un nombre compos de plusieurs chiffres [0-9]+, suivi dun point \. (le point a une signication comme mtacaractre, donc il faut lchapper avec \ pour quil ait une signication de point), suivi dun nombre plusieurs chiffres [0-9]+. Les parenthses dans lexpression rgulire permettent de crer des groupes qui seront rcuprs ultrieurement par la fonction group(). La totalit de la correspondance est donn par group(0), le premier lment entre parenthse est donn par group(1) et le second par group(2). Les fonctions start() et end() donnent respectivement la position de dbut et de n de la zone qui correspond lexpression rgulire. Notez que la fonction search() ne renvoie que la premire zone qui correspond lexpression rgulire, mme sil en existe plusieurs : >>> resultat = regex.search("pi vaut 3.14 et e vaut 2.72") >>> resultat.group(0) '3.14' Fonction ndall() Pour rcuprer chaque zone, vous pouvez utiliser la fonction findall() qui renvoie une liste des lments en correspondance. >>> regex = re.compile('[0-9]+\.[0-9]+') >>> resultat = regex.findall("pi vaut 3.14 et e vaut 2.72") >>> resultat ['3.14', '2.72'] >>> regex = re.compile('([0-9]+)\.([0-9]+)') >>> resultat = regex.findall("pi vaut 3.14 et e vaut 2.72") >>> resultat [('3', '14'), ('2', '72')] Fonction sub() Enn, la fonction sub() permet deffectuer des remplacements assez puissants. Par dfaut la fonction sub(chaine1,chaine2) remplace toutes les occurrences trouves par lexpression rgulire dans chaine2 par chaine1. Si vous souhaitez ne remplacer que les n premires occurrences, utilisez largument count=n : >>> 'pi >>> 'pi regex.sub('quelque vaut quelque chose regex.sub('quelque vaut quelque chose chose',"pi vaut 3.14 et e vaut 2.72") et e vaut quelque chose' chose',"pi vaut 3.14 et e vaut 2.72", count=1) et e vaut 2.72'

Nous esprons que vous tes convaincus de la puissance du module re et des expressions rgulires, alors vos expressions rgulires ! 64 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

13.3

Exercices : extraction des gnes dun chier genbank 13

Expressions rgulires et parsing

13.3

Exercices : extraction des gnes dun chier genbank

Pour les exercices suivants, vous utiliserez le module dexpressions rgulires re et le chier genbank du chromosome I de la levure du boulanger Saccharomyces cerevisiae NC_001133.gbk. 1. crivez un script qui extrait lorganisme du chier genbank NC_001133.gbk. 2. Modiez le script prcdent pour quil afche toutes les lignes qui indiquent lemplacement du dbut et de la n des gnes, du type : gene 58..272

3. Faites de mme avec les gnes complmentaires : gene complement(55979..56935)

4. Rcuprez maintenant la squence nuclique et afchez-la lcran. Vriez que vous navez pas fait derreur en comparant la taille de la squence extraite avec celle indique dans le chier genbank. 5. Mettez cette squence dans une liste et rcuprez les deux premiers gnes (en les afchant lcran). Attention, le premier gne est un gne complmentaire, noubliez pas de prendre le complmentaire inverse de la squence extraite. 6. partir de toutes ces petites oprations que vous transformerez en fonctions, concevez un programme genbank2fasta.py qui extrait tous les gnes dun chier genbank fourni en argument et les afche lcran. Pour cela vous pourrez utiliser tout ce que vous avez vu jusqu prsent (fonctions, listes, modules, etc.). 7. partir du script prcdent, refaites le mme programme (genbank2fasta.py) en crivant chaque gne au format fasta dans un chier. Pour rappel, lcriture dune squence au format fasta est le suivant : >ligne de commentaire sequence sur une ligne de 80 caractres maxi suite de la squence ....................... suite de la squence ....................... Vous utiliserez comme ligne de commentaire le nom de lorganisme, suivi du numero du gne, suivi des positions de dbut et de n du gne, comme dans cet exemple >Saccharomyces cerevisiae 1 1807 2169 Les noms des chiers fasta seront de la forme gene1.fasta, gene2.fasta, etc.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

65

14

Cration de modules

14
14.1

Cration de modules
Cration

Vous pouvez crez votres propres modules trs simplement en Python. Il vous suft dcrire un ensemble de fonctions (et/ou de variables) dans un chier, puis denregistrer celui-ci avec une extension .py (comme nimporte quel script Python). titre dexemple, voici le contenu du module message.py. """Module inutile qui affiche des messages :-) """ def Bonjour(nom): """Affiche bonjour ! """ return "bonjour " + nom def Ciao(nom): """Affiche ciao ! """ return "ciao " + nom def Hello(nom): """Affiche hello ! """ return "hello " + nom + " !" date=16092008

14.2

Utilisation

Pour appeler une fonction ou une variable de ce module, il faut que le chier message.py soit dans le rpertoire courant (dans lequel on travaille) ou bien dans un rpertoire indiqu par la variable denvironnement Unix PYTHONPATH. Ensuite, il suft dimporter le module et toutes ses fonctions (et variables) vous sont alors accessibles. La premire fois quun module est import, Python cre un chier avec une extension .pyc (ici message.pyc) qui contient le bytecode (code prcompil) du module. Lappel du module se fait avec la commande import message. Notez que le chier est bien enregistr avec une extension .py et pourtant on ne la prcise pas lorsquon importe le module. Ensuite on peut utiliser les fonctions comme avec un module classique. >>> import message >>> message.Hello("Joe") 'hello Joe !' >>> message.Ciao("Bill") 'ciao Bill' >>> message.Bonjour("Monsieur") 'bonjour Monsieur' >>> message.date 16092008 Les commentaires (entre triple guillemets) situs en dbut de module et sous chaque fonction permettent de fournir de laide invoque ensuite par la commande help() : 66 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

14.3

Exercices

14

Cration de modules

>>> help(message) NAME message - Module inutile qui affiche des messages :-) FILE /home/cumin/poulain/message.py FUNCTIONS Hello(nom) Affiche hello ! Bonjour(nom) Affiche bonjour ! Ciao(nom) Affiche ciao ! DATA date = 16092008 Remarques : Les fonctions dans un module peuvent sappeler les unes les autres. Les fonctions dans un module peuvent appeler des fonctions situes dans un autre module sil a t pralablement import avec la commande import. Vous voyez que les modules sont dune simplicit enfantine crer. Si vous avez des fonctions que vous serez amens utiliser souvent, nhsitez plus !

14.3

Exercices

Conseil : pour cet exercice, crivez un script dans un chier, puis excutez-le dans un shell. 1. Reprenez lensemble des fonctions qui grent le traitement de squences nucliques et incluez-les dans un module adn.py. Testez-les au fur et mesure.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

67

15

Autres modules dintrt

15

Autres modules dintrt

Nous allons voir dans cette section deux modules qui peuvent se rvler trs pratiques. Le premier (urllib2) permet de tlcharger nimporte quel chier depuis internet. Le second (pickle) permet denregistrer des objets python pour pouvoir les retrouver tels quels plus tard. Ces deux modules sont prsents par dfaut dans nimporte quelle distribution Python.

15.1

Module urllib2

Les modules urllib et urllib2 permettent de rapatrier, directement avec Python, des chiers depuis internet. Nous naborderons ici que des exemples simples, mais libre vous dapprofondir si besoin. Il existe des diffrences subtiles entre urllib et urllib2 que nous naborderons pas ici mais qui sont consultables sur la documentation ofcielle de Python. Dans ce cours, nous avons choisi de vous prsenter urllib2 car une des fonctions principales (urlopen()) est considre comme obsolte dans urllib depuis la version 2.6 de Python. Prenons un exemple simple, supposons que vous souhaitiez rapatrier le chier PDB de la protine barstar. En Unix vous utiliseriez probablement la commande wget, regardez comment faire en Python : >>> import urllib2 >>> u = urllib2.urlopen("http://www.pdb.org/pdb/files/1BTA.pdb") >>> pdb_lines = u.readlines() >>> u.close() >>> for i in pdb_lines: ... print i, ... HEADER RIBONUCLEASE INHIBITOR 09-MAY-94 1BTA TITLE THREE-DIMENSIONAL SOLUTION STRUCTURE AND 13C ASSIGNMENTS OF TITLE 2 BARSTAR USING NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY COMPND MOL_ID: 1; COMPND 2 MOLECULE: BARSTAR; COMPND 3 CHAIN: A; COMPND 4 ENGINEERED: YES SOURCE MOL_ID: 1; SOURCE 2 ORGANISM_SCIENTIFIC: BACILLUS AMYLOLIQUEFACIENS; SOURCE 3 ORGANISM_TAXID: 1390 [...] >>> Comme vous le voyez, il suft dutiliser la fonction urlopen() et de lui passer en argument une URL (i.e. adresse internet) sous forme de chane de caractres. Ds lors, les mthodes associes aux chiers (cf chapitre 6) sont accessibles (read(), readline(), readlines(), etc.). Il est galement possible denregistrer le chier tlcharg : >>> >>> >>> >>> >>> >>> >>> 68 import urllib2 u = urllib2.urlopen("http://www.pdb.org/pdb/files/1BTA.pdb") pdb_file_content = u.read() u.close() f = open("1BTA.pdb","w") f.write(pdb_file_content) f.close() Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

15.2

Module pickle

15

Autres modules dintrt

Dans ce dernier exemple, nous rcuprons le chier complet sous la forme dune chane de caractres unique (avec la fonction read()). Le chier est ensuite enregistr dans le rpertoire courant (duquel vous avez lanc linterprteur Python). Nous vous laissons imaginer comment faire sur une srie de plusieurs chiers (cf. exercices).

15.2

Module pickle

Le module pickle permet deffectuer une srialisation et dsrialisation des donnes. Il sagit en fait dencoder (dune manire particulire) les objets que lon peut crer en Python (variables, listes, dictionnaires, fonctions, classes, etc.) an de les stocker dans un chier, puis de les rcuprer, sans devoir effectuer une tape de parsing. 15.2.1 Codage des donnes

Pour encoder des donnes avec pickle et les envoyer dans un chier, on peut utiliser la fonction dump(obj,file) (o file est un chier dj ouvert) : >>> import pickle >>> fileout = open("mydata.dat","w") >>> maliste = range(10) >>> mondico = {'year': 2000, 'name': 'Far beyond driven', 'author': 'Pantera', 'style': 'Trash Metal'} >>> pickle.dump(maliste,fileout) >>> pickle.dump(mondico,fileout) >>> pickle.dump(3.14,fileout) >>> fileout.close() Si on observe le chier cr, on saperoit que les donnes sont codes : >>> import os >>> os.system("cat mydata.dat") (lp0 I0 aI1 aI2 aI3 aI4 aI5 aI6 aI7 aI8 aI9 a.(dp0 S'style' p1 S'Trash Metal' p2 sS'author' p3 S'Pantera' p4 sS'name' p5 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 69

15

Autres modules dintrt

15.3

Exercices

S'Far beyond driven' p6 sS'year' p7 I2000 s.F3.1400000000000001 .0 >>> 15.2.2 Dcodage des donnes

Pour dcoder les donnes, rien de plus simple, il suft dutiliser la fonction load(file) o file est un chier ouvert en lecture : >>> filein = open("mydata.dat") >>> pickle.load(filein) [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> pickle.load(filein) {'style': 'Trash Metal', 'year': 2000, 'name': 'Far beyond driven', 'author': 'Pantera'} >>> pickle.load(filein) 3.1400000000000001 Attention ne pas utiliser la fonction load une fois de trop, sinon une erreur est gnre : >>> pickle.load(filein) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/usr/lib/python2.5/pickle.py", line 1370, in load return Unpickler(file).load() File "/usr/lib/python2.5/pickle.py", line 858, in load dispatch[key](self) File "/usr/lib/python2.5/pickle.py", line 880, in load_eof raise EOFError EOFError >>> Il est noter quil existe un module quivalent mais beaucoup plus rapide, le module cpickle.

15.3

Exercices

1. Concevez un script qui rapatrie de manire automatique le chier 1MSE.pdb depuis la Protein Data Bank ( laide du module urllib2). 2. On souhaite rcuprer les structure 3D de la partie N-terminale de la protine HSP90 en prsence de diffrents co-cristaux, les codes PDB sont 3K97, 3K98 et 3K99. crivez un script Python qui tlcharge de manire automatique les chiers PDB ( laide du module urllib2 et dune boucle) et les enregistre dans le rpertoire courant. 3. Reprenez le dictionnaire des mots de 4 lettres du gnome du chromosome I de la levure S. cerevisiae (exercice 7 sur les dictionnaires et tuples). Encodez le dictionnaire dans un chier avec le module pickle. Quittez Python et regardez attentivement le chier gnr avec un diteur de texte. Relancez Python, et dcodez le dictionnaire.

70

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16

Modules dintrt en bioinformatique

16

Modules dintrt en bioinformatique

Nous allons voir dans cette section quelques modules trs importants en bioinformatique. Le premier numpy permet notamment de manipuler des vecteurs et des matrices en Python. Le module biopython permet de travailler sur des donnes biologiques type squence (nuclique et protique) ou structure (chier PDB). Le module matplotlib permet de dessiner des graphiques depuis Python. Enn, le module rpy permet dinterfacer nimporte quelle fonction du puissant programme R. Ces modules ne sont pas fournis avec le distribution Python de base (contrairement tous les autres modules vus prcdemment). Nous ne nous tendrons pas sur la manire de les installer. Consultez pour cela la documentation sur les sites internet des modules en question. Sachez cependant que ces modules existent dans la plupart des distributions Linux rcentes. Dans ce chapitre, nous vous montrererons quelques exemples dutlisation de ces modules pour vous convaincre de leur pertinence.

16.1

Module numpy

Le module numpy est incontournable en bioinformatique. Il permet deffectuer des calculs sur des vecteurs ou des matrices, lment par lment, via un nouveau type dobjet appel array. Ce module contient des fonctions de base pour faire de lalgbre linaire, des transformes de Fourier ou encore des tirages de nombre alatoire plus sophistiqus quavec le module random. Vous pourrez trouver les sources de numpy cette adresse. Notez quil existe un autre module scipy que nous naborderons pas dans ce cours. scipy est lui mme bas sur numpy, mais il en tend considrablement les possibilits de ce dernier (e.g. statistiques, optimisation, intgration numrique, traitement du signal, traitement dimage, algorithmes gntiques, etc.). 16.1.1 Objets de type array

Les objets de type array correspondent des tableaux une ou plusieurs dimensions et permettent deffectuer du calcul vectoriel. La fonction array() permet la conversion dun objet squentiel (type liste ou tuple) en un objet de type array. Voici un exemple simple de conversion dune liste une dimension en objet array : >>> import numpy >>> a = [1,2,3] >>> numpy.array(a) array([1, 2, 3]) >>> b = numpy.array(a) >>> type(b) <type 'numpy.ndarray'> >>> b array([1, 2, 3]) Nous avons converti la liste a en array, mais cela aurait donn le mme rsultat si on avait converti le tuple (1,2,3). Par ailleurs, vous voyez que lorsquon demande Python le contenu dun objet array, les symboles ([]) sont utiliss pour le distinguer dune liste [] ou dun tuple (). Notez quun objet array ne peut contenir que des valeurs numriques. Vous ne pouvez pas, par exemple, convertir une liste contenant des chanes de caractres en objet de type array. La fonction arange() est quivalente range() et permet de construire un array une dimension de manire simple. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 71

16

Modules dintrt en bioinformatique

16.1

Module numpy

>>> numpy.arange(10) array([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]) >>> numpy.arange(10.0) array([ 0., 1., 2., 3., 4., 5., 6., 7., 8., >>> numpy.arange(10,0,-1) array([10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) >>>

9.])

Un des avantages de la fonction arange() est quelle permet de gnrer des objets array qui contiennent des entiers ou de rels selon largument quon lui passe. La diffrence fondamentale entre un objet array une dimension et une liste (ou un tuple) est que celui-ci est considr comme un vecteur. Par consquent on peut effectuer des oprations lment par lment dessus, ce qui est bien commode lorsquon analyse de grandes quantits de donnes. Regardez ces exemples : >>> v = numpy.arange(4) >>> v array([0, 1, 2, 3]) >>> v + 1 array([1, 2, 3, 4]) >>> v + 0.1 array([ 0.1, 1.1, 2.1, >>> v * 2 array([0, 2, 4, 6]) >>> v * v array([0, 1, 4, 9])

3.1])

Notez bien sur le dernier exemple de multiplication que larray nal correspond la multiplication lment par lment des deux array initiaux. Avec les listes, ces oprations nauraient t possibles quen utilisant des boucles ! Nous vous encourageons donc utiliser dornavent les objets array lorsque vous aurez besoin de faire des oprations lment par lment. Il est aussi possible de construire des objets array deux dimensions, il suft de passer en argument une liste de listes la fonction array() : >>> numpy.array([[1,2,3],[2,3,4],[3,4,5]]) array([[1, 2, 3], [2, 3, 4], [3, 4, 5]]) >>> Attention, plus complexe encore ! On peut aussi crer des tableaux trois dimensions en passant la fonction array() une liste de listes de listes : >>> numpy.array([[[1,2],[2,3]],[[4,5],[5,6]]]) array([[[1, 2], [2, 3]], [[4, 5], [5, 6]]]) >>> 72 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16.1

Module numpy

16

Modules dintrt en bioinformatique

La fonction array() peut crer des tableaux nimporte quel nombre de dimensions. Toutefois a devient vite compliqu lorsquon dpasse trois dimensions. Retenez quun objet array une dimension peut tre considr comme un vecteur et un array deux dimensions comme une matrice. Pour rcuprer un ou plusieurs lment(s) dun objet array, vous pouvez utiliser lindiage ou les tranchage, de la mme manire que pour les listes. >>> a = numpy.arange(10) >>> a array([0, 1, 2, 3, 4, 5, 6, 7, 8, 9]) >>> a[5:] array([5, 6, 7, 8, 9]) >>> a[::2] array([0, 2, 4, 6, 8]) >>> a[1] 1 Dans le cas dun objet array deux dimensions, vous pouvez rcuprer une ligne, une colonne ou bien un seul lment. >>> a = numpy.array([[1,2],[3,4]]) >>> a array([[1, 2], [3, 4]]) >>> a[:,0] array([1, 3]) >>> a[0,:] array([1, 2]) >>> a[1,1] 4 La syntaxe a[m,:] rcupre la ligne m-1, et a[:,n] rcupre la colonne n-1. Les tranches sont videmment aussi utilisables sur un tableau deux dimensions. Il peut tre parfois pnible de construire une matrice (array deux dimensions) laide dune liste de listes. Le module numpy contient quelques fonctions commodes pour construire des matrices partir de rien. Les fonctions zeros() et ones() permettent de construire des objets array contenant des 0 ou de 1, respectivement. Il suft de leur passer un tuple indiquant la dimensionnalit voulue. >>> numpy.zeros((3,3)) array([[ 0., 0., 0.], [ 0., 0., 0.], [ 0., 0., 0.]]) >>> numpy.zeros((3,3),int) array([[0, 0, 0], [0, 0, 0], [0, 0, 0]]) >>> numpy.ones((3,3)) array([[ 1., 1., 1.], [ 1., 1., 1.], [ 1., 1., 1.]]) Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 73

16

Modules dintrt en bioinformatique

16.1

Module numpy

Par dfaut, les fonctions zeros() et ones() gnrent des rels, mais vous pouvez demander des entiers en passant loption int en second argument. Enn il existe les fonctions reshape() et resize() qui permettent de remanier volont les dimensions dun array. Il faut pour cela, leur passer en argument lobjet array remanier ainsi quun tuple indiquant la nouvelle dimensionnalit. >>> a = numpy.arange(9) >>> a array([0, 1, 2, 3, 4, 5, 6, 7, 8]) >>> numpy.reshape(a,(3,3)) array([[0, 1, 2], [3, 4, 5], [6, 7, 8]]) Toutefois, reshape() attend un tuple dont la dimension est compatible avec le nombre dlments contenus dans larray de dpart, alors que resize() sen moque et remplira le nouvel objet array gnr mme si les longueurs ne coincident pas. >>> a = numpy.arange(9) >>> a.reshape((2,2)) Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: total size of new array must be unchanged >>> numpy.resize(a,(2,2)) array([[0, 1], [2, 3]]) >>> numpy.resize(a,(4,4)) array([[0, 1, 2, 3], [4, 5, 6, 7], [8, 0, 1, 2], [3, 4, 5, 6]]) Dans lexemple prcdent, la fonction reshape() renvoie une erreur si les dimensions ne concident pas. La fonction resize() duplique ou coupe la liste initiale sil le faut jusqu temps que le nouvel array soit rempli. Si vous ne vous souvenez plus de la dimension dun objet array, la fonction shape() permet den retrouver la taille. >>> a = numpy.arange(3) >>> numpy.shape(a) (3,) Enn, la fonction transpose() renvoie la transpose dun array. Par exemple pour une matrice : >>> a array([[1, 2, 3], [4, 5, 6], [7, 8, 9]]) >>> numpy.transpose(a) array([[1, 4, 7], [2, 5, 8], [3, 6, 9]]) 74 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16.1

Module numpy

16

Modules dintrt en bioinformatique

16.1.2

Un peu dalgbre linaire

Aprs avoir manipul les vecteurs et les matrices, voici quelques fonctions pour faire de lalgbre linaire. La fonction dot() vous permet de faire une multiplication de matrices. >>> a = numpy.resize(numpy.arange(4),(2,2)) >>> a array([[0, 1], [2, 3]]) >>> numpy.dot(a,a) array([[ 2, 3], [ 6, 11]]) >>> a * a array([[0, 1], [4, 9]]) Notez bien que dot(a,a) renvoie le produit matriciel entre deux matrices, alors que a*a renvoie le produit lment par lment 1 . Pour toutes les oprations suivantes, il faudra utiliser des fonctions dans le sous-module numpy.linalg. La fonction inv() renvoie linverse dune matrice carre, det() son dterminant, eig() ses vecteurs et valeurs propres. >>> a array([[0, 1], [2, 3]]) >>> numpy.linalg.inv(a) array([[-1.5, 0.5], [ 1. , 0. ]]) >>> numpy.linalg.det(a) -2.0 >>> numpy.linalg.eig(a) (array([-0.56155281, 3.56155281]), array([[-0.87192821, -0.27032301], [ 0.48963374, -0.96276969]])) >>> numpy.linalg.eig(a)[0] array([-0.56155281, 3.56155281]) >>> numpy.linalg.eig(a)[1] array([[-0.87192821, -0.27032301], [ 0.48963374, -0.96276969]]) Notez que la fonction eig() renvoie un tuple dont le premier lment correspond aux valeurs propres et le second lment aux vecteurs propres. 16.1.3 Un peu de transforme de Fourier

La transforme de Fourier est trs utilise pour lanalyse de signaux, notamment lorsquon souhaite extraire des priodicits au sein dun signal bruit. Le module numpy possde la fonction fft() (dans le sous-module fft) permettant de calculer des transformes de Fourier. Voici un petit exemple sur la fonction cosinus de laquelle on souhaite extraire la priode laide de la fonction fft() :
1. Dans numpy, il existe galement des objets de type matrix pour lesquels les multiplications de matrices sont diffrents, mais nous ne les aborderons pas ici.

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

75

16

Modules dintrt en bioinformatique

16.2

Module biopython

# 1) on definit la fonction y = cos(x) import numpy debut = -2 * numpy.pi fin = 2 * numpy.pi pas = 0.1 x = numpy.arange(debut,fin,pas) y = numpy.cos(x) # 2) on calcule la TF de la fonction cosinus TF=numpy.fft.fft(y) ABSTF = numpy.abs(TF) # abcisse du spectre en radian^-1 pas_xABSTF = 1/(fin-debut) x_ABSTF = numpy.arange(0,pas_xABSTF * len(ABSTF),pas_xABSTF) Plusieurs commentaires sur cet exemple. Vous constatez que numpy rednit certaines fonctions ou constantes mathmatiques de base, comme pi (nombre ), cos() (fonction cosinus) ou abs() (valeur absolue, ou module dun complexe). Ceci est bien pratique car nous navons pas appeler ces fonctions ou constantes depuis le module math, le code en est ainsi plus lisible. Dans la partie 1), on dnit le vecteur x reprsentant un angle allant de -2 2 radians par pas de 0,1 et le vecteur y comme le cosinus de x. En 2) on calcule la transforme de Fourier avec la fonction fft() qui renvoie un vecteur (objet array une dimension) de nombres complexes. Eh oui, le module numpy gre aussi les nombres complexes ! On extrait ensuite le module du rsultat prcdent avec la fonction abs(). La variable x_ABSTFL reprsente labscisse du spectre (en radian-1). La variable ABSTF contient le spectre lui mme. Lanalyse de ce dernier nous donne un pic 0,15 radian-1, ce qui correspond bien 2 (plutt bon signe de retrouver ce rsultat). Le graphe de ce spectre est prsent dans la partie ddie matplotlib (section 16.3). Notez que tout au long de cette partie, nous avons toujours utilis la syntaxe numpy.fonction() pour bien vous montrer quelles taient les fonctions propres numpy. Bien sr dans vos futurs scripts il sera plus commode dimporter compltement le module numpy avec linstruction from numpy import *. Vous pourrez ensuite appeler les fonctions de numpy directement (sans le prxe numpy.). Si vous souhaitez quand mme spcier pour chaque fonction numpy son module dappartenance, vous pouvez dnir un alias pour numpy avec linstruction import numpy as np. Le module numpy est alors connu sous le nom np. Par lappel de la fonction array() se fera par np.array().

16.2

Module biopython

Le module biopython propose de nombreuses fonctionnalits trs utiles en bioinformatique. Le tutoriel est particulirement bien fait, nhsitez pas le consulter. Voici quelques exemples dutilisation. Dnition dune squence. >>> import Bio >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> ADN = Seq("ATATCGGCTATAGCATGCA", IUPAC.unambiguous_dna) >>> ADN Seq('ATATCGGCTATAGCATGCA', IUPACUnambiguousDNA()) 76 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16.3

Module matplotlib

16

Modules dintrt en bioinformatique

IUPAC.unambiguous_dna signie que la squence entre est bien une squence dADN.

Obtention de la squence complmentaire et complmentaire inverse.

>>> ADN.complement() Seq('TATAGCCGATATCGTACGT', IUPACUnambiguousDNA()) >>> ADN.reverse_complement() Seq('TGCATGCTATAGCCGATAT', IUPACUnambiguousDNA())

Traduction en squence protique.

>>> ADN.translate() Seq('ISAIAC', IUPACProtein())

16.3

Module matplotlib

Le module matplotlib permet de gnrer des graphes interactifs depuis Python. Il est loutil complmentaire de numpy et scipy lorsquon veut faire de lanalyse de donnes. Nous ne prsenterons ici quun petit exemple traitant de la reprsentation graphique de la fonction cosinus et de la recherche de sa priode par transforme de Fourier (voir galement la section 16.1.3). Plutt quun long discours, regardez cet exemple que nous commenterons aprs.

# define cosine function from pylab import * debut = -2 * pi fin = 2 * pi pas = 0.1 x = arange(debut,fin,pas) y = cos(x) # draw the plot plot(x,y) xlabel('angle (rad)') ylabel('cos(angle)') title('Fonction: y = cos(x)') grid() show()

Vous devriez obtenir une image comme celle-ci : Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 77

16

Modules dintrt en bioinformatique

16.3

Module matplotlib

Vous constatez que le module matplotlib gnre un fentre graphique interactive permettant lutilisateur de votre script de manipuler le graphe (enregistrer comme image, zoomer, etc.). Revenons maintenant sur le code. Tout dabord, vous voyez quon importe le module sappelle pylab (et non pas matplotlib). Le module pylab importe lui-mme toutes les fonctions (et variables) du module numpy (e.g. pi, cos, arange, etc.). Il est plus commode de limporter par from pylab import * que par import pylab. La partie qui nous intresse (aprs la ligne # draw the plot) contient les parties spciques matplotlib. Vous constatez que les commandes sont trs intuitives. La fonction plot() va gnrer un graphique avec des lignes et prend comme valeurs en abscisse (x) et en ordonnes (y) des vecteurs de type array une dimension. Les fonctions xlabel() et ylabel() sont utiles pour donner un nom aux axes. title() permet de dnir le titre du graphique. grid() afche une grille en lligrane. Jusquici, aucun graphe nest afch. Pour activer lafchage lcran du graphique, il faut appeler la fonction show(). Celle-ci va activer une boucle dite gtk qui attendra les manipulations de lutilisateur. Les commandes Python ventuellement situes aprs la fonction show() seront excutes seulement lorsque lutilisateur fermera la fentre graphique (petite croix en haut droite). Voici maintenant lexemple complet sur la fonction cosinus et sa transforme de Fourier. from pylab import * # define cosine function x = arange(-2*pi,2*pi,0.1) y = cos(x) # calculate TF of cosine function TF=fft(y) 78 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16.4

Module rpy

16

Modules dintrt en bioinformatique

ABSTF = abs(TF) pas_xABSTF = 1/(4*pi) x_ABSTF = arange(0,pas_xABSTF * len(ABSTF),pas_xABSTF) # draw cos plot plot(x,y) xlabel('angle (rad)') ylabel('cos(angle)') title('Fonction: y = cos(x)') grid() show() # plot TF of cosine plot(x_ABSTF[:20],ABSTF[:20]) xlabel('inverse angle (rad^-1)') ylabel('Intensity') title('Spectrum of cosine function') grid() show() Le premier graphe doit afcher la fonction cosinus comme ci-dessus et le second doit ressembler cela :

On retrouve bien le pic 0,15 radian-1 correspondant 2 radians. Voil, nous esprons que ce petit exemple vous aura convaincu de lutilit du module matplotlib. Sachez quil peut faire bien plus, par exemple gnrer des histogrammes ou toutes sortes de graphiques utiles en analyse de donnes.

16.4

Module rpy

R est un programme extrmement puissant permettant deffectuer des analyses statistiques. Il contient tout un tas de fonctions permettant de gnrer divers types de graphiques. Nous Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 79

16

Modules dintrt en bioinformatique

16.4

Module rpy

ne rentrerons pas dans les dtails de R, mais nous vous montrerons quelques exemples pour gnrer des graphiques avec R depuis Python. Les vecteurs de R peuvent tre remplacs par des listes en Python. En interne, rpy manipule des variables de types array car il est bas sur le module numpy vu prcdemment. Dans cet exemple, nous allons trac les coordonnes alatoires de 50 points. import random import rpy # construction d'une liste de 50 lments croissants x = range(1, 51) # construction d'une liste de 50 lments alatoires y = [] for i in x: y.append( random.random() ) # enregistrement du graphique dans un fichier png rpy.r.png("rpy_test1.png") # dessin des points rpy.r.plot(x, y, xlab="position", ylab="coordonnes", col="black", pch=3) # fin du graphique rpy.r.dev_off() Voici le chier rpy_test1.png obtenu :

Les fonctions R sont accessibles par le sous-module r du module rpy. Les fonctions png() et plot() sont utilisables comme en R. Les fonctions qui contiennent un point dans leur nom en R (dev.off()) sont utilisables avec un caractre soulign _ la place (ici dev_off()). Voyons maintenant un exemple plus intressant, pour lequel on calcule la distribution des diffrentes bases dans une squence nuclique : from rpy import r as R seq = "ACGATCATAGCGAGCTACGTAGAA" seq2 = list( seq )

80

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

16.5

Exercice numpy

16

Modules dintrt en bioinformatique

R.png("rpy_test2.png") # tri des bases car unique() n'ordonne pas les donnes # alors que table() le fait seq3 = R.sort( seq2 ) # listes des bases prsentes bases = R.unique( seq3 ) # effectif de chaque base effectifs = R.table( seq3 ) # dessin du barplot et sauvegarde de la position des abscisses coords = R.barplot( effectifs, ylab="nombre de bases") # ajout du texte pour l'axe des abscisses R.text(coords, -0.5, bases, xpd = True, cex = 1.5, font = 2 ) R.dev_off() Voici le chier rpy_test2.png obtenu :

Pour plus de concision, le module rpy.r est renom en R. Les boolens TRUE et FALSE en R (dans la fonction text()) doivent tre remplacs par leurs quivalents en Python (True et False ; attention la casse).

16.5

Exercice numpy

Cet exercice prsente le calcul de la distance entre deux carbones alpha conscutifs de la barstar. Il demande quelques notions dUnix et ncessite le module numpy de Python. 1. Tlchargez le chier 1BTA.pdb sur le site de la PDB. 2. Pour que le sparateur dcimal soit le point (au lieu de la virgule, par dfaut sur les systmes dexploitation franais), il faut au pralable rednir la variable LC_NUMERIC en bash : export LC_NUMERIC=C Extrayez les coordonnes atomiques de tous les carbones alpha de la barstar dans le chier 1BTA_CA.txt avec la commande Unix suivante :
awk '$1=="ATOM" && $3=="CA" {printf "%.3f %.3f %.3f ", $7, $8, $9}' 1BTA.pdb > 1BTA_CA.txt

Les coordonnes sont toutes enregistres sur une seul ligne, les unes aprs les autres, dans le chier 1BTA_CA.txt. Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 81

16

Modules dintrt en bioinformatique

16.6

Exercice rpy

3. Ouvrez le chier 1BTA_CA.txt avec Python et crez une liste contenant toutes les coordonnes sous forme de rels avec les fonctions split() et float(). 4. Avec la fonction array() du module numpy, convertissez cette liste en matrice. 5. Avec la fonction reshape() de numpy, et connaissant le nombre dacides amins de la barstar, construisez une matrice deux dimensions contenant les coordonnes des carbones alpha. 6. Crez une matrice qui contient les coordonnes des n-1 premiers carbones alpha et une autre qui contient les coordonnes des n-1 derniers carbones alpha. 7. En utilisant les oprateurs mathmatiques habituels (-, **2, +) et les fonctions sqrt() et sum() du module numpy, calculez la distance entre les atomes n et n+1. 8. Afchez les distances entre carbones alpha conscutifs et reprez la valeur surprenante.

16.6

Exercice rpy

1. Soit la squence protique WVAAGALTIWPILGALVILG. Reprsentez avec le module rpy la distribution des diffrents acides amins. 2. Reprenez lexercice du calcul de la distance entre deux carbones alpha conscutifs de la barstar avec numpy et reprsentez cette distance avec rpy.

82

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

17

Avoir la classe avec les objets

17

Avoir la classe avec les objets

Une classe permet de dnir des objets qui sont des reprsentants (des instances) de cette classe. Les objets peuvent possder des attributs (variables associes aux objets) et des mthodes ( fonctions associes aux objets). Exemple de la classe Rectangle : class Rectangle: "ceci est la classe Rectangle" # initialisation d'un objet # dfinition des attributs avec des valeurs par dfaut def __init__(self, long = 0.0, larg = 0.0, coul = "blanc"): self.longueur = long self.largeur = larg self.couleur = coul # definition de la mthode qui calcule la surface def calculSurface(self): print "surface = %.2f m2" %(self.longueur * self.largeur) # definition de la mthode qui transforme un rectangle en carr def changeCarre(self, cote): self.longueur = cote self.largeur = cote Ici, longueur, largeur et couleur sont des attributs alors que calculPerimetre(), calculSurface() et changeCarre() sont des mthodes. Tous les attributs et toutes les mthodes se rfrent toujours self qui dsigne lobjet lui mme. Attention, les mthodes prennent toujours au moins self comme argument. Exemples dutilisation de la classe Rectangle : # cration d'un objet Rectangle avec les paramtres par dfaut rect1 = Rectangle() print rect1.longueur, rect1.largeur, rect1.couleur # sans surprise : rect1.calculSurface() # on change le rectangle en carr rect1.changeCarre(30) rect1.calculSurface() # cration d'un objet Rectangle avec des paramtres imposs rect2 = Rectangle(2, 3, "rouge") rect2.calculSurface()

17.1

Exercices

Conseil : pour ces exercices, crivez des scripts dans des chiers, puis excutez-les dans un shell. 1. Entranez-vous avec la classe Rectangle. Crez la mthode calculPerimetre() qui calcule le primre dun objet rectangle. 2. Crez une nouvelle classe Atome avec les attributs x, y, z (qui contiennent les coordonnes atomique) et la mthode calculDistance(). Testez cette classe sur plusieurs exemples. 3. Amliorez la classe Atome avec de nouveaux attributs (par ex. : masse, charge, etc.) et de nouvelles mthodes (par ex. : calculCentreMasse(), calculRayonGyration()). Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 83

18

Gestion des erreurs

18

Gestion des erreurs

La gestion des erreurs permet dviter que votre programme plante en prvoyant vous mme les sources derreurs ventuelles. Voici un exemple dans lequel on demande lutilisateur dentrer un nombre, puis on afche ce nombre. >>> nb = int(raw_input("Entrez un nombre: ")) Entrez un nombre: 23 >>> print nb 23 La fonction raw_input() permet lutilisateur de saisir une chane de caractres. Cette chane de caractres est ensuite transforme en nombre entier avec la fonction int(). Si lutilisateur ne rentre pas un nombre, voici ce qui se passe : >>> nb = int(raw_input("Entrez un nombre: ")) Entrez un nombre: ATCG Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: invalid literal for int() with base 10: 'ATCG' Lerreur provient de la fonction int() qui na pas pu convertir la chane de caractres "ATCG" en nombre, ce qui est normal. Le jeu dinstruction try / except permet de tester lexcution dune commande et dintervenir en cas derreur. >>> try: ... nb = int(raw_input("Entrez un nombre: ")) ... except: ... print "Vous n'avez pas entr un nombre !" ... Entrez un nombre: ATCG Vous n'avez pas entr un nombre ! Dans cette exemple, lerreur renvoye par la fonction int() (qui ne peut pas convertir "ATCG" en nombre) est intercepte et dclenche lafchage du message davertissement. On peut ainsi redemander sans cesse un nombre lutilisateur, jusqu ce que celui-ci en rentre bien un. >>> while 1: ... try: ... nb = int(raw_input("Entrez un nombre: ")) ... print "Le nombre est", nb ... break ... except: ... print "Vous n'avez pas entr un nombre !" ... print "Essayez encore" ... Entrez un nombre: ATCG Vous n'avez pas entr un nombre ! Essayez encore Entrez un nombre: toto 84 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

18

Gestion des erreurs

Vous n'avez pas entr un nombre ! Essayez encore Entrez un nombre: 55 Le nombre est 55 Notez que dans cet exemple, linstruction while 1 est une boucle innie (car la condition 1 est toujours vrie) dont larrt est forc par la commande break lorsque lutilisateur a effectivement bien rentr un nombre. La gestion des erreurs est trs utile ds lors que des donnes extrieures entrent dans le programme, que ce soit directement par lutilisateur (avec la fonction raw_input()) ou par des chiers. Vous pouvez par exemple vrier quun chier a bien t ouvert. >>> nom = "toto.pdb" >>> try: ... f = open(nom, "r") ... except: ... print "Impossible d'ouvrir le fichier", nom Si une erreur est dclenche, cest sans doute que le chier nexiste pas lemplacement indiqu sur le disque ou que (sous Unix), vous nayez pas les droits daccs pour le lire. Il est galement possible de spcier le type derreur grer. Le premier exemple que nous avons tudi peut scrire : >>> try: ... nb = int(raw_input("Entrez un nombre: ")) ... except ValueError: ... print "Vous n'avez pas entr un nombre !" ... Entrez un nombre: ATCG Vous n'avez pas entr un nombre ! Ici, on intercepte une erreur de type ValueError, ce qui correspond bien un problme de conversion avec int(). Il existe dautres types derreurs comme RuntimeError, TypeError, NameError, IOError, etc. Enn, on peut aussi tre trs prcis dans le message derreur. Observez la fonction downloadPage() qui, avec le module urllib2, tlcharge un chier sur internet. import urllib2 def downloadPage(address): error = "" page = "" try: data = urllib2.urlopen(address) page = data.read() except IOError, e: if hasattr(e, 'reason'): error = "Cannot reach web server: " + str(e.reason) if hasattr(e, 'code'): error = "Server failed %d" %(e.code) return page, error Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 85

18

Gestion des erreurs

La variable e est une instance (un reprsentant) de lerreur de type IOError. Certains de ces attributs sont tests avec la fonction hasattr() pour ainsi afner le message renvoy (ici contenu dans la variable error).

86

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

19

Trucs et astuces

19
19.1

Trucs et astuces
Shebang et /usr/bin/env python

Lorsque vous programmez sur un sytme Unix, le shebang correspond aux caractres #! qui se trouve au dbut de la premire ligne dun script. Le shebang est suivi du chemin complet du programme qui interprte le script. En Python, on trouve souvent la notation #! /usr/bin/python Cependant, lexcutable python ne se trouve pas toujours dans le rpertoire /usr/bin. Pour maximiser la portabilit de votre script Python sur plusieurs systmes Unix, utilisez plutt cette notation : #! /usr/bin/env python Dans le cas prsent, on appelle le programme denvironnement env (qui se situe toujours dans le rpertoire /usr/bin) pour lui demander o se trouve lexcutable python.

19.2

Python et utf-8

Si vous utilisez des caractres accentus dans des chanes de caractres ou bien mme dans des commentaires, cela occasionnera une erreur lors de lexcution de votre script. Pour viter ce genre de dsagrment, ajoutez la ligne suivante la deuxime ligne (la position est importante) de votre script : # -*- coding: utf-8 -*En rsum, tous vos scripts Python devraient ainsi dbuter par les lignes : #! /usr/bin/env python # -*- coding: utf-8 -*-

19.3

Vitesse ditration dans les boucles

La vitesse ditration (de parcours) des lements dune liste peut tre trs diffrente selon la structure de boucle utilise. Pour vous en convaincre, copiez les lignes suivantes dans un script Python (par exemple boucles.py) puis excutez-le. #! /usr/bin/env python # -*- coding: utf-8 -*import time # cration d'une liste de 5 000 000 d'lments # ( adapter suivant la vitess de vos machines) taille = 5000000 print "Cration d'une liste avec %d lements" %( taille ) toto = range( taille ) # la variable 'a' accde un lment de la liste # mthode 1 start = time.time() Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant 87

19

Trucs et astuces

19.4

Liste de comprhension

for i in range( len(toto) ): a = toto[i] print "mthode 1 (for in range) : %.1f secondes" %( time.time() - start ) # mthode 2 start = time.time() for ele in toto: a = ele print "mthode 2 (for in) : %.1f secondes" %( time.time() - start ) # mthode 3 start = time.time() for i in xrange( len(toto) ): a = toto[i] print "mthode 3 (for in xrange) : %.1f secondes" %( time.time() - start ) # mthode 4 start = time.time() for idx, ele in enumerate( toto ): a = ele print "mthode 4 (for in enumerate): %.1f secondes" %( time.time() - start ) Vous devriez obtenir une sortie similaire celle-ci : poulain@cumin> Cration d'une mthode 1 (for mthode 2 (for mthode 3 (for mthode 4 (for ./boucles.py liste avec 5000000 lements in range) : 1.8 secondes in) : 1.0 secondes in xrange) : 1.2 secondes in enumerate): 1.4 secondes

La mthode la plus rapide pour parcourir une liste est donc ditrer directement sur les lments (for element in liste). Cette instruction est privilgier le plus possible. La mthode for i in range(len(liste)) est particulirement lente car la commande range(len(liste)) gnre une norme liste avec tous les indices des lments (la cration de liste est assez lente en Python). Si vous voulez absolument parcourir une liste avec les indices des lements, utilisez plutt la commande for i in xrange(len(liste)) car linstruction xrange() ne va pas crer une liste mais incrmenter un compteur qui correspond lindice des lments successifs de la liste. Enn, la commande for indice, element in enumerate(liste) est particulirement efcace pour rcuprer en mme temps llment et son indice.

19.4

Liste de comprhension

Une manire originale et trs puissante de gnrer des listes est la comprhension de liste. Pour plus de dtails, consultez ce sujet le site de Python et celui de wikipdia. Voici quelques exemples : Nombres pairs compris entre 0 et 99 print [i for i in range(99) if i%2 == 0] Le mme rsultat est obtenu avec print range(0,99,2) ou 88 Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

19.5

Sauvegardez votre historique de commandes

19

Trucs et astuces

print range(0,99)[::2] Jeu sur la casse des mots dune phrase. message = "C'est sympa la BioInfo" msg_lst = message.split() print [[m.upper(), m.lower(), len(m)] for m in msg_lst] Formatage dune squence avec 60 caractres par ligne
# exemple d'une squence de 150 alanines seq = "A"*150 width= 60 print "\n".join( [seq[i:i+width] for i in range(0,len(seq),width)] )

Formatage fasta dune squence (avec la ligne de commentaire)


commentaire = "mon commentaire" # exemple d'une squence de 150 alanines. seq = "A"*150 width= 60 print "> "+commentaire+"\n"+"\n".join( [seq[i:i+width] for i in range(0,len(seq),width)] )

Slection des lignes correspondantes aux carbones alpha dans un chier pdb
# ouverture du fichier pdb (par exemple 1BTA.pdb) pdb = open("1BTA.pdb", "r") # slection des lignes correspondantes aux C alpha CA_line = [line for line in pdb if line.split()[0] == "ATOM" and line.split()[2] == "CA"] # fermeture du fichier pdb.close() # ventuellement affichage des lignes print CA_line

19.5

Sauvegardez votre historique de commandes

Vous pouvez sauvegarder lhistorique des commandes utilises dans linterprteur Python avec le module readline. >>> print "hello" hello >>> a = 22 >>> a = a + 11 >>> print a 33 >>> import readline >>> readline.write_history_file() Quittez Python. Lhistorique de toutes vos commandes est dans votre rpertoire personnel, dans le chier .history. Relancez linterprteur Python. >>> import readline >>> readline.read_history_file() Vous pouvez accder aux commandes de la session prcdente avec la che du haut de votre clavier. >>> print "hello" hello >>> a = 22 >>> a = a + 11 >>> print a 33

Cours de Python / Universit Paris Diderot - Paris 7 / UFR Sciences du Vivant

89

Vous aimerez peut-être aussi