Deaf1 & Grh: Novel Transcription Activators for Drosophila Embryonic Epidermal Development

Datoya Brown

Fayetteville State University BIOL 430-01: Special Problems Dr. Christina Swanson 2012 December 04

INTRODUCTION Transcriptional regulation Normal development of an organism depends on precisely regulated spatial expression of its genes. Conlon and Raff (1999) note that having an adequate balance between cell growth, cell proliferation, and cell death ensures correct cell, tissue and animal size. The type of processes required for this precise measurement is regulated by a process known as transcription. Transcription results in the production of RNA to be translated into protein, thus engineering genes and promoting gene expression in an organism. Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. Cellular differentiation and morphogenesis are controlled by expression of specific set of genes. Studying the regulation of gene expression will help in understanding the functional role of that gene. It can be studied at protein level, by using the antibodies specific to the gene product, and at RNA levels by using anti-sense mRNA. For the purposes of this research paper, we used the latter method to study regulation of a gene called Dacapo. The fact that the epidermal cell proliferation is terminated with good synchrony at a precise developmental stage, in combination with the genetic possibilities, provides a unique and decisive advantage for the analysis of the regulatory mechanisms that stop cell proliferation in vivo (Lane et al, 1996). The aim of this project was to investigate the role of Deformed Epidermal Autoregulatory Factor 1 (Deaf1) and Grainyhead (Grh), in regulating expression of the Dacapo gene. The available information on the biochemical role of these TFs and their expression profile as well as tissue and developmental stage specific regulation of expression is not complete. Molecular genetic analysis of expression in Drosophila may provide valuable insight into its regulation and function. Therefore, spatial distribution of DAP RNA transcript in

Drosophila embryos was studied by in situ hybridization and antibody staining respectively. Our objective was to identify novel transcriptional regulators of the dap gene.

Basic Biology of Drosophila melanogaster In the sciences the fruit fly Drosophila melanogaster has shown to be a lasting model for biological research. Adopted as a genetics research model well over a hundred years ago by Thomas Hunt Morgan (Singh and Irvine, 2012) this species is still one of the most powerful

Figure 1. Life Cycle of Drosophila melanogaster

model organisms. In the modern era, D. melanogaster was the first major complex organism to have its genome sequenced (Adams et al, 2000). The fruit fly may be considered multiple model organisms, each with its own specific advantages, defined by developmental stage (Figure 1):

the embryo, the larva, the pupa, and the adult. The embryo is often used in fundamental developmental studies examining pattern formation, cell fate determination, organogenesis, and neuronal development and axon pathfinding. Dacapo The gene dacapo (Dap) is a protein coding gene found in the specific species Drosophila melanogaster. There is experimental evidence that it has the molecular function of cyclindependent protein kinase inhibitor activity. Cyclin-dependent protein kinases (CKI) are proteins used to arrest cell proliferation at appropriate stages of development. The protein Dap encodes a CKI with an essential function during normal embryonic development (de Nooij et al, 1996)

Currently Known Information Drosophila has long been at the forefront of studies of transcriptional regulation, and is currently one of the most tractable models for animal transcriptional control. Many fundamental concepts such as the regulation of development by categorized cascades of transcription factors originated in research on Drosophila. With the dacapo gene, earlier studies have revealed that is maintains a necessity to be expressed for embryonic survival. Drosophila should prove to be of valuable interest in the general understanding of transcriptional regulation of cell fate specification. One of the specific questions being addressed by researchers in the field is, How is dap transcription regulated in the Drosophila embryo?

Role During Embryogenesis One of the great challenges of biology is to understand how cell diversity is generated during development. During embryogenesis the expression of dap has an association with exit from the cell cycle (de Nooij et al, 1996). This is a very important factor for higher organisms

that cannot function without control over cellular differentiation, and other developmental decisions.

Normal Expressions in the Embryo In various tissues, expression of Dap occurs precisely during the last mitotic division that cells undergo before they terminally differentiate. In the embryonic epidermis, a rapid accumulation of Dap mRNA and Dap protein is detected just before these cells arrest. The induction of dap directly regulates the developmental cues that dictate cell cycle exit (de Nooij et al, 2000). The regulation of dap at the transcriptional level seems unlikely to account fully for the dynamic expression pattern of Dap protein. In the embryonic epidermis, dacapo expression starts during G2 of the final division cycle and is required for the arrest of cell cycle progression in G1 after the final mitosis. The onset of dacapo transcription is the earliest event known to be required for the epidermal cell proliferation arrest. To advance an understanding of the regulatory mechanisms that terminate cell proliferation at the appropriate stage, the control of dacapo transcription has been analyzed. dacapo transcription is not coupled to cell cycle progression. It is not affected in mutants where proliferation is arrested either too early or too late. Moreover, upregulation of dacapo expression is not an obligatory event of the cell cycle exit process. The control of dacapo expression varies in different stages and tissues. The dacapo regulatory region includes many independent cis-regulatory elements. The elements that control epidermal expression integrate developmental cues that time the arrest of cell proliferation (Meyer et al, 2002). In this paper we collectively try to replicate previous experimentation to see if there a novel TFs. Possible Transcription Factors

So far, no known possible transcription factor that have been identified bind directly to the enhancer to activate expression of dap in the embryonic epidermis. Localization of Enhancer Embryonic transcription must be under the control of an enhancer that specifically activates transcription of dap in the embryo. Figure 2 illustrates the specific region previous research pointed towards for such TFs. Authors identified a DNA region that activates transcription in the embryonic epidermis between -3.8 and -3.5 kb upstream of the dap promoter. They successful did this by testing multiple pieces of DNA upstream of the dap gene for their ability to activate expression of a reporter gene.

Figure 2. Analysis of the dap regulatory region (Meyer et al. 2002) The dap genomic regions of D. melanogaster and D. virilis were isolated, sequenced and compared. The coding sequences are indicated by black boxes

Dap Embryonic Transcription Factor Regulatory Enhancers After using candidate and bioinformatics approaches to identify transcription factors that bind and regulate an enhancer, two transcriptional activators that have potential binding sites within the dap enhancer and are also expressed in the embryonic epidermis were accepted. The two TFs were Grainyhead (Grh) and Deformed Epidermal Autoregulatory Factor 1 (Deaf1), below are the known regions coding sequences respectively. Grainyhead sites are highlighted in
red and Deaf1 sites are blue.

{CAAAATCTGAGAAGGGTCACTGTTCCTTTTTTCCCCCCTGTTAATAAATTCGTCTTGT GATTGAAAACCCCCAAATGACCGAGCGGTCTACCTGCATTTTATGGCCATCTTACTAT ATCGGACTCCCTTTTCCAACCTGTTTTGTGGATGATTTTCGAAAGGATTTCGGTTTTC TGTATTTTCCTACGTTAAACGATCGCCGACGCCGATTGCCTCGCTGCTT}

Deformed Epidermal Autoregulatory Factor 1 (Deaf1) Protein The transcription factor DEAF-1 is the mammalian homologue of a critical Drosophila developmental gene and is essential for embryonic survival. Deformed epidermal autoregulatory factor-1 (DEAF-1) is a transcription factor that was originally shown to bind the autoregulatory enhancer of the Deformed (Dfd) Hox gene, which is activated in embryonic head segments of Drosophila. DEAF-1 is maternally expressed, and the encoded protein is broadly distributed throughout the early embryo. This aspect of Drosophila embryos was essential in studying gene transcriptional regulation for this research project. Grainyhead (Grh) Protein

Expression of Grh is first seen in stage 11 in both the epidermis and central nervous system (Bray et al, 1989).In contrast to its known role as a repressor, Venkatesan et al (2003) prove that Grh is also a transcriptional activator. Grainyhead regulates genes involved in

epidermal development. An incredible amount of work has been expended in understanding the mechanism by which GRH acts as a transcriptional activator. This work has aided in an understanding of the basic apparatus for transcriptional activation. Studies of the role of GRH in transcriptional activation have resulted in the isolation of coactivators associated with the TATAbinding protein that mediates transcriptional activation (Dynlacht, 1991).

Hypothesis We collectively hypothesized that the Grh and Deaf1 transcription factors (TFs) regulate dap transcription in the Drosophila embryo. MATERIALS AND METHODS Drosophila Stock Three strains of fruit flies of the species Drosophila melanogaster were obtained. One strain consisted of true-breeding wild-type flies and the other two consisted of flies with two different mutations, the dominant Deformed epidermal autoregulatory factor 1 (Deaf1) mutation and the other Grainyhead (Grh) mutation. Mutant embryos were generated from heterozygous mutant parents. Maintenance of homozygous mutant stocks is nonexistent due to lethality characteristics. RNA Probe preparation When making the probe, we used special nucleotides that are linked to a molecule that can be visualized indirectly via a color-developing reaction. Probes used in this study consisted of Digoxigenin-linked nucleotides. After applying the probe to our tissue (whole embryos), we exposed the tissue to anti-Digoxigenin antibodies that were fused to an alkaline phosphatase

molecule; these antibodies bind specifically to the Digoxigenin-labeled probe. The alkaline phosphatase was visualized in a color-developing reaction as the final step of the ISH. This color-developing reaction allowed us to see where our probe, and thus our mRNA, localized within the tissue.

Whole-Mount In Situ Hybridization ISH was 3-day process for the provisions of the course. Prior to the in situ hybridization, Drosophila embryos of the desired genotype and age, which for experimentation purposes was 57 hours old, were collected from private stock. These embryos were then fixed in formaldehyde and stored at -20C until ready for use. All embryos were stored in 1.5 mL Eppendorf tubes. RNA probe was also previously generated that includes the Digoxigenin-labeled nucleotides and was complementary to the dap mRNA. ISH Day 1 (Pretreatment) Embryos were first washed to remove formaldehyde and transferred into hybridization buffer. The probe was then diluted in the hybridization buffer before application to embryos. Dilution was prepared by adding 0.5 l of probe to 250 l of Hybridization Buffer. Probe was then heated to 85C for 5 minutes, thus removing any secondary structure within the probe to ensure hybridization to mRNA. Afterwards, probe is then transferred to ice for 2 minutes. For next 5 minutes probe is allowed to gain room temperature. The solution embryos were immersed in (hybridization buffer without probe added) was removed, without removing the embryos ,by carefully and slowly pipetting up the liquid above the embryos, without touching or disturbing the embryos. Small volume of residual liquid was

left behind to further prevent disturbance of embryos. 250 l of probe was then added to embryos by transferring the probe into the tube with the embryos using a micropipette. ISH Day 2 (Supplementary Washes) The second day consisted of a series of washes that removed any excess probe not bound to mRNA from the embryos. These washes prevented any background staining and thereby allowing real staining to be clear and obvious. These washes were performed by Dr. Swanson subsequently to the pretreatment. ISH Day 3 (Antibody Staining) Prior to experimentation, Dr. Swanson incubated the embryos in the anti-Digoxigenin-Alkaline Phosphatase antibody, which will bind to labeled probe and will drive the color-developing reaction. Solution from previous washes was removed from embryos carefully, without disturbing the embryos. We then added 500 l of AP buffer to embryos and incubated for 5 minutes on rocking/rotating platform. While embryos were incubating in AP buffer, we prepared color developing solution by adding 1 ml of AP buffer to a clean microfuge tube, then adding 2 l of BCIP and 2.5 l of NBT to the AP buffer in that tube. Once 5 minute incubation was over, we allowed embryos to gradually resettle at the bottom of the tube (about 30 seconds), then removed AP buffer carefully, without removing embryos. 1 ml of developing solution was added to the embryos. Embryos were incubated in developing solution on rotating platform until color stain developed. This can take anywhere from 5 minutes to 5 hours, but for this experiment we anticipated a 10-15 minute reaction.. Checking tube every 3-5 minutes, more frequently after 10 minutes has passed, to see if color has developed; embryos turned blue as stain developed. We held the tubes against a white sheet of paper to allow easy visualization of the stain. The embryos full incubation time for color developing reaction was 24 minutes, 37 seconds at room temperature.

To stop the color reaction (if you allow it to proceed too long, the stain will spread to tissues that arent truly expressing specified mRNA), we removed color-developing solution from embryos (once theyve were allowed to settle). Next, we added 1 ml of PBS-Tween to the embryos, allow them to resettle, then removed solution.. this process was subsequently repeated 5 more times. After washing steps, 1 ml PBS-Tween was added to embryos and given to Dr. Swanson for mounting onto slides for microscopic imagery. These methods were used for both wild-type embryos, Deaf1 and Grh mutants. RESULTS Weve confirmed that dap is expressed in wild-type, 5-7 hour old embryos, and that our reagents and protocol worked.

Statistical Analysis The initial overall expected outcome of the experiment using wild-type was that majority of Drosophila embryos would stain during ISH, thus illustrating transcriptional activation of dacapo gene.

Drosophila melanogaster Strain

Wild Type Deaf1 Mutant Grh Mutant Total(s)

Total Embryos
464 247 151 862

Express dap mRNA (%)

(90%) (61%) (95%) 246%

No dap mRNA Expression (%)

(10%) (39%) (5%) 54%

Table 1 Triple Strain Drosophila In Situ Hybridization Results (Source: Compiled data from the entire class, for illustration purposes only)

Since we performed the ISH on wild-type embryos first, the standard for overall embryos tested was taken. As noted in Table 1. the observed frequency of dap expression differed significantly between wild-type and Grh embryos (statistical analysis of p = 0.03). This value

was barely below the cut-off for statistical significance in which a significant value was either 0.05. Previous data showed that dap transcription initiates in the embryonic epidermis in 5-7 hour old embryos.

Published ISH

Wild-type Embryo

Wild-type embryo with sense probe (control)

Figure 3. Expression of dap mRNA in Drosophila embryos: Expression of Dap RNA in all wild type embryos. (A)Previous staining of dap mRNA (Lane et al, 1996) (B) Staining of dap mRNA in wild-type embryos (C)Dap RNA detected in at embryonic stage (5-7 hour old) by whole-mount in-situ hybridization using a digoxygenin-labeled probe. In the cellular blastoderm stage, Dap is found in the whole embryo. Expression persists in differentiating mesodermal tissues and the neuroctodermal region during gastrulation, germband elongation, and segmentation.

The images of wild-type embryos expressing dap mRNA is depicted in Figure 3. These images were taken from a microscope and enlarged for better view. In this strain of Drosophila, there is normal initiation of expression of the RNA and protein even at one of the earliest stages of embryonic development (Figure 3A-B). No dap mRNA expression is observed in wild-type embryos with sense probe included (Figure 3C). Upon viewing other microscopic images for expression of dap, significantly more Grh embryos expressed dap mRNA than wild-type embryos. This difference was scarcely significant, thereby suggesting that the difference could have been due simply to coincidence and might never be observed again if experimentation were to be repeated. The observed frequency of dap expression differed significantly between wild-type and Deaf1 embryos as well (p = 0.0001). In this case the difference was noticeably significant. We observed that there were significantly

fewer Deaf1 embryos that expressed dap mRNA than wild-type embryos. In this case, the pvalue was so small that it is very unlikely that the difference was due to chance.

Grainyhead (Grh)

Deaf1 Embryo-No Staining

Deaf1 Embryo-With Staining

Figure 4. In Situ Hybridization of dap mutants Grainyhead (Grh) and Deaf1. (A) depiction of one of the Grh embryos showing staining in epidermis (B)No staining of one of the various Deaf1 embryos (C) More epidermis staining showing localization of dap mRNA during ISH

The results obtained from ISH of both Grh and Deaf1 Drosophila embryos (Figure 4) show that Grh is required for embryonic development (Figure 4A) It has localized mRNA expression directly in the epidermis. For Deaf1 embryos various embryos did not obtain the stain during experimentation (Figure 4B). However there was notable staining to document in Deaf1 (Figure 4C).

DISCUSSION The final differentiated state of organs, tissues, and cells that make up adult organisms is the end result of a developmental program of gene expression that is initiated at fertilization and elaborated during embryogenesis. The Drosophila is being used as a model organism in biological research for nearly a century due to its similarity with the human proteins, some of which may serve as potential drug targets. It lends itself well to behavioral studies. Scientists have discovered an identifiable match between the genetic code of fruit flies and over 60% of known human disease genes. Moreover, about 50% of fly protein sequences are believed to have mammalian analogues. The type of fly that is utilized in our research is the Drosophila melanogaster, a common species used for scientific experiments [Roberts, 1986]. The benefit of

using Drosophila is that they are relatively easy to maintain and daily embryo collection can be accomplished easily using an automated egg collection system. Based on the in situ hybridization (ISH) experimental results the conclusion is that the gene dacapo mRNA is localized within the tissue (Drosophila embryo) of Grh embryos and Deaf1 embryos. This is stated due to obvious staining in the localized region providing insight as to the genes specific designation for activation in Drosophila species. In regards to antibody staining, there is no visible staining of some of the Deaf1 embryos but the could be contributed to the human error when conducting the experiment. Our hypothesis can be supported partially by one of the transcription factors tested. However, the other portion has to be rejected because satisfactory results were not obtained. Possible errors could be ISH time lapse for color reactive staining. Preliminary results are yet to be determined until further extensive duplications of the experiment.

Bibliography Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, et al. The genome sequence of Drosophila melanogaster. Science. 2000; (287):21852195. Bray SJ, Burke B, Brown NH, Hirsh J. Embryonic expression pattern of a family of Drosophila proteins that interact with a central nervous system regulatory element. Genes & Development 1989;( 3):1130-1145 Conlon I., and Raff M. Size control in animal development. Cell. 1999; (96):235-244. De Nooij JC et al. A cyclin-dependent kinase inhibitor, Dacapo, is necessary for timely exit from the cell cycle during Drosophila embryogenesis. Cell .1996; (87):1237-1247. Dynlacht BD, Hoey T, and Tjian R. Isolation of coactivators associated with the TATA-binding protein that mediate transcriptional activation. Cell. 1991; 66(3): 563-576 Gross CT, McGinnis W. DEAF-1, a novel protein that binds an essential region in a Deformed response element. Embo J. 1996; (15):19611970. Lane, ME; Sauer, K; Wallace, K; Jan, YN; Lehner, CF; Vaessin, H. Dacapo, a cyclin-dependent kinase inhibitor, stops cell proliferation during Drosophila development. Cell. 1996; (87):12251235. Roberts DB. Drosophila: A Practical Approach. Oxford: IRL Press, 1986. Singh A, Irvine KD. Drosophila as a Model for Understanding Development and Disease. Developmental Dynamics. 2012; 241 (1):1-2. Venkatesan K, McManus HR, Mello CC, Smith TF, Hansen U. Functional conservation between members of an ancient duplicated transcription factor family, LSF/Grainyhead. Nucleic Acids Research. 2003; 31(15): 4304-4316