Molecular Human Reproduction Vol.9, No.4 pp.

199203, 2003

DOI: 10.1093/molehr/gag029

Inhibin, activin, follistatin, activin receptors and b-glycan gene expression in the placental tissue of patients with pre-eclampsia
D.Casagrandi1, C.Beareld1, J.Geary2, C.W.Redman3 and S.Muttukrishna1,4
Department of Obstetrics and Gynaecology, Royal Free UCL Medical School, 8696 Chenies Mews, London WC1E 6HX, Department of Haematology, University College London, 88, Chenies Mews, London, 3Nufeld Department of Obstetrics and Gynaecology, John Radcliffe Hospital, Oxford OX3 9DU, UK
2 1

To whom correspondence should be addressed at: Department of Obstetrics and Gynaecology, RFUCL Medical School, 8696 Chenies Mews, London WC1E 6HX, UK. E-mail: s.muttukrishna@ucl.ac.uk
Downloaded from http://molehr.oxfordjournals.org/ by guest on January 14, 2013

The objective of this study was to quantify the relative expression of inhibin a, inhibin/activin bA, bB, bC, follistatin, activin receptors and b-glycan genes in placental tissue of term pre-eclamptic patients and controls to investigate if these genes are up-regulated in the placenta in pre-eclampsia. Seven women with pre-eclampsia symptoms were matched with 10 normal pregnant controls for gestational age, maternal age, and parity. Total RNA was isolated from each sample. Complementary DNA samples produced by reverse transcription were used in the real time PCR to quantify the expression of inhibin a subunit, inhibin/activin bA, bB, bC subunits, follistatin, ACTRIA, ACTRIB, ACTRIIA, ACTRIIB, b-glycan and GAPDH genes. The ratio between the target and GAPDH expression was calculated to provide relative gene expression. Inhibin a:GAPDH and inhibin/activin bA:GAPDH ratios were signicantly higher in placental tissue from women with pre-eclampsia (P = 0.04 and P = 0.01 respectively) compared with matched control placental gene expression. Placental samples from both groups expressed bB, bC, follistatin, activin receptors and b-glycan genes. However, there was no signicant difference in the relative expression of these genes between the groups. Increases in the placental expression of inhibin a and inhibin/activin bA subunit genes could contribute to the rise in circulating levels of inhibin A and activin A in pre-eclampsia. The mechanism(s) involved in increased gene expression in pre-eclampsia is as yet unclear. Key words: activin/activin receptors/b-glycan/follistatin/inhibin

Introduction
Inhibins (ab dimers) and activins (bb dimmers) are glycoprotein hormones belonging to the transforming growth factor b super family. Follistatin is a high-afnity activin binding protein. There are two types of activin receptors, ACTRI (A and B) and ACTRII (A and B). ACTRIIA and ACTRIIB are membrane receptors to which activin binds and promotes the recruitment and phosphorylation of type I receptor serine kinase which then regulates gene expression by activating Smad proteins (Carcamo et al., 1994; Attisano et al., 1996). Binding of activin to the Type II receptor stabilizes the receptor complex and activates signal transduction. Inhibin can also bind to Type II activin receptors but it does not activate the receptor complex. Recently, type III TGF-b receptor b-glycan was shown to function as an inhibin co-receptor with ACTRII (Lewis et al., 2000). b-glycan binds inhibin with high afnity and enhances binding in cells coexpressing ACTRII and b-glycan. b-glycan also confers inhibin sensitivity to cell lines that otherwise respond poorly to this hormone (Lewis et al., 2000). We and several others have previously shown that the levels of activin A (bAbA dimers) and inhibin A (abA dimers) are signicantly elevated in the circulation of women who have developed preeclampsia (PE) (Petraglia et al., 1995; Muttukrishna et al., 1997a; Fraser et al., 1998), and in women who subsequently develop preeclampsia compared with gestational age-matched control pregnant
European Society of Human Reproduction and Embryology

women (Cuckle et al., 1998; Aquilina et al., 1999; Silver et al., 1999; Muttukrishna et al., 2000). Although circulating levels of follistatin were reported to be unaltered in patients with pre-eclampsia (D'Antona et al., 2000), recently it was reported to be raised modestly in patients with pre-eclampsia compared with controls (Keelan et al., 2002). Several studies have shown that inhibin A and activin A levels are higher in pre-eclamptic patients; the mechanism involved in the rise of these proteins is as yet unclear. Placenta is a source of inhibin/ activin subunits, dimeric proteins, follistatin and activin receptors (Petraglia, 1997; Fowler et al., 1998; Peng et al., 1999; Debieve et al., 2000; Manuelpillai et al., 2001). Pro-inammatory cytokines are potent stimulators of activin A from intrauterine tissues (Keelan et al., 1998). Term placental cells secrete increased levels of inhibin A and activin A in the presence of inammatory cytokines, which are increased in pre-eclampsia (Mohan et al., 2001). Activin A is produced by peripheral mononuclear cells (Tannetta et al., 2001) and endothelial cells (Schneider-Kolsky et al., 2002). Pre-eclampsia is a major cause of maternal and fetal morbidity and mortality. It develops in late pregnancy and the cause is as yet unknown. The only treatment for pre-eclampsia is the delivery of the placenta, after which the symptoms regress rapidly suggesting that it is a placental disease. It is associated with poor placentation with incomplete physiological adaptation of the spiral arteries, which prevents them from dilating to accommodate the increased

199

D.Casagrandi et al. utero-placental blood ow of late gestation (Redman, 1991). It is believed that the maternal syndrome of pre-eclampsia (hypertension, proteinuria, oedema) results from a generalized inammatory response, which causes maternal endothelial dysfunction (Redman et al., 1999). This response is triggered by circulating factor(s), possibly released from the placenta by apoptosis of the syncytiotrophoblast. The placenta expresses inhibin/activin mRNA and activin receptor mRNA (Petraglia et al., 1991; Peng et al., 1999) throughout pregnancy. A recent study reported an increase in inhibin a and inhibin/activin bA subunit protein in placenta from women with preeclampsia (Jackson et al., 2000). Whilst Manuelpillai et al. (2001) reported no change in the bA subunit protein distribution in preeclamptic placenta, dimeric activin A contents were increased in placental homogenates of pre-eclamptic patients. They also reported activin receptor protein levels in pre-eclamptic placenta. We hypothesized that raised maternal circulating levels of inhibin A and activin A in pre-eclampsia are due to increased production and upregulation of the a and bA subunit gene expression in the placenta. The objectives of this study were: (i) to quantify the gene expression of inhibin a and bA subunit in term pre-eclamptic patients and matched controls; and (ii) to study the gene expression of bB, bC subunits, follistatin, and activin receptors and b-glycan to provide more insights into the probable action of these proteins in the placenta in pre-eclampsia.
Table I. Sequence of primers and probes used for real time PCR of inhibin/ activin subunits, follistatin, activin receptors and b-glycan Gene a subunit Sequences of primers and Taqman probes Forward: CTCGGATGGAGGTTACTCTTTCAA Reverse: GAAGACCCCCCACCCTTAGA Probe: TATGAGACAGTGCCCAACCTTCTCACGC Gene accession no. M13144 Forward: GGACATCGGCTGGAATGACT Reverse: GGCACTCACCCTCGCAGTAG Probe: ATCATTGCTCCCTCTGGCTATCATGCC Gene accession no. M13436 Forward: CCTGGGATCCTTCGTGCTT Reverse: GTTGTGTCCTTTCTGGGTCTCTTT Probe: CCTGTCCTTCCATGCCCTTGTCGA Gene accession no. M13437 Forward: TTGATCTGGCCAAGAGAAGCA Reverse: CACAGGGCGGTTCAGTGTT Probe: AGCTGCACCTCACCCAGCGCC Gene accession no. NM_005538 Forward: CAGTAAGTCGGATGAGCCTGTCT Reverse: CAGCTTCCTTCATGGCACACT Probe: TGCCAGTGACAATGCCACTTATGCCA Gene accession no. BCOO4107 Forward: AGGCTGCTTCCAGGTTTATGAG Reverse: TGGCAGCACTCCACAGCTT Probe: AGACCCCGCCGTCCCCTGG Gene accession no. BCO33867 Forward: TACTCTGTGTCTGGCAGGCTACTC Reverse: GCTTTGGTTCCACAGTCTGAGAT Probe: CCCCAGCATCAGCACAGCTCTCCTC Gene accession no. BC000254 Forward: CCTGTTTTAAGAGATTATTGGCAGAA Reverse: TGCGTCGTGATCCCAACAT Probe: TTCACAGAGCATTGCCATTCCAGCAT Gene accession no. M93415 Forward: TTCGATTTGAGCCAGGGAAA Reverse: GAGCACCTCAGGAGCCATGT Probe: ACACCCACGGACAGGTAGGCACGA Gene accession no. U57707 Forward: CAGTAAGTCGGATGAGCCTGTCT Reverse: CAGCTTCCTTCATGGCACACT Probe: TGCCAGTGACAATGCCACTTATGCCA Gene accession no. LO7594

bA subunit

bB subunit

bC subunit

Follistatin

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 14, 2013

ActR IA

ActR IB

Materials and methods

Placental tissue
Ethical approval was obtained from the local ethics committee for this study. All patients gave informed consent. Ten of these placentas were from control pregnancies at term (b37 weeks of gestation) and seven from women with preeclampsia at term (b37 weeks of gestation). Pre-eclampsia was dened as new, sustained diastolic blood pressure >90 mmHg and new, sustained proteinuria with 500 mg protein/24 h urinary sample in the absence of urinary tract infection. Pre-eclamptic patients in this study tted these criteria. These patients were not on any medication. The maternal age was 30.7 T 4.9 (SD) in the control and 30.8 T 2.7 years in the pre-eclamptic group. There was no difference in fetal weight (no SGA babies). Placentas were obtained from 17 women who had normal spontaneous vaginal deliveries. Labour was uneventful in all cases. Tissue samples were cut randomly from different parts of the placentas within half-hour of delivery, extensively rinsed in sterile saline and snap-frozen in liquid nitrogen and stored at 80C at the John Radcliffe Hospital in Oxford, UK.

ActR IIA

ActR IIB

b-Glycan

(GAPDH) primers. PCR was carried out using the following cycle: 50C for 2 min, 95C for 10 min, followed by 40 cycles of 95C for 15 s and 60C for 1 min. PCR products were run on a 2% agarose gel.

RNA extraction
Trizol reagent (Life Technologies Inc, USA) was used to isolate total RNA according to the manufacturer's protocol. Briey, 100200 mg of placental tissue was homogenized in 500 ml of Trizol. Chloroform (200 ml) was added and the solution was incubated at room temperature for 5 min. It was then centrifuged at 1089 g for 15 min at 4C. The upper aqueous phase was incubated with 500 ml isopropanol at room temperature for 5 min and centrifuged at 1089 g for 10 min. The RNA pellet was washed in 75% ethanol and centrifuged again at 1089 g for 5 min. The resulting pellet was dried and resuspended in 80% ethanol made up in diethylpyrocarbonate (DEPC)-treated water (SigmaAldrich, UK) and stored at 80C. The concentration of RNA was analysed on a spectrophotometer (Jenway Ltd, UK). The ratio between the absorbance at 260 and 280 nm was >1.6.

Real time PCR

Real time PCR was used for relative gene expression using an ABI Prism 7700 Sequence Detection System thermal cycler (Applied Biosystems, USA). Primers and probes were designed using Primer Express 1.5 Software and synthesized commercially (Applied Biosystems Ltd, UK). The sequences for each gene are shown in Table I. All PCR products were 85150 base pairs (bp) in size. The optimal concentrations of all primers and probes were evaluated according to the optimization protocol provided by Applied Biosystems. A stock placental cDNA pool was prepared as a standard stock and used for all real time assays. PCR reaction mixes for each standard and samples were prepared in separate tubes, using TaqMan Universal PCR master mix, primers, probe and cDNA. All samples were assayed in triplicate and an aliquot of 25 ml reaction mix was transferred to each well of a MicroAmp optical 96-well reaction plate (Applied Biosystems, USA). The thermocycler parameters were: 50C for 2 min, 95C for 10 min, followed by 40 cycles of 95C for 15 s and 60C for 1 min. A GAPDH pre-designed assay from Applied Biosystems was used to detect the expression of the housekeeping gene GAPDH in each sample using the same standard preparation. Target gene expression was normalized with

cDNA synthesis
Total RNA (2 mg) was reverse-transcribed into cDNA for each RNA sample extracted from placental tissue using TaqMan reverse transcription kit (Applied Biosystems Ltd, UK) according to the manufacturer's protocol. Each cDNA sample obtained was checked by TaqMan (Applied Biosystems Ltd, UK) PCR reaction, using glyceraldehyde phosphate dehydrogenase

200

Inhibin and activin in pre-eclampsia

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 14, 2013

Figure 1. Scatter plots of relative gene expression of (a) inhibin a subunit: GAPDH ratio, (b) inhibin/activin bA subunit: GAPDH ratio, (c) bB subunit:GAPDH ratio, (d) bC:GAPDH ratio and (e) follistatin:GAPDH ratio in term placental tissue from women with pre-eclampsia (PE) and matched controls. Student's t-test was carried out to compare means. *P < 0.05, **P = 0.01, NS = not signicant.

Figure 2. Scatter plot of relative gene expression of activin receptors. (a) ACTRIA: GAPDH ratio, (b) ACTRIB:GAPDH ratio, (c) ACTRIIA:GAPDH ratio, (d) ACTRIIB:GAPDH ratio and (e) b-glycan:GAPDH ratio in term placental tissue from women with pre-eclampsia (PE) and matched controls. Student's t-test was carried out to compare means. *P < 0.05, **P = 0.01, NS = not signicant.

GAPDH gene expression in each sample and the ratio between the target and GAPDH was expressed in all samples.

respectively) although it did not reach statistical signicance (2.6 T 1.42, 4.7 T 1.64 respectively; Figure 1c and d). The mean ratio of follistatin:GAPDH gene expression in pre-eclamptic placentas (6.68 T 5.59) was not altered compared with the controls (8 T 3.04; Figure 1e).

Statistical analysis
All values are expressed as mean T SEM. Data were normally distributed. Log-transformed data were used for Student's t-test (GraphPad Prism, USA). P < 0.05 was considered signicant.

Expression of activin receptors and b-glycan genes

The mean ratio of ACTRIA:GAPDH and ACTRIB:GAPDH in the pre-eclamptic placentas (2.78 T 0.98, 5.23 T 1.86 respectively) was not signicantly altered from the controls (3.03 T 1.9, 4.18 T 1.76 respectively; Figure 2a and b). Although ACTRIIA:GAPDH and ACTRIIB:GAPDH expression in the pre-eclamptic placental tissue (1.68 + 0.53, 6.68 + 2.86 respectively) tended to be lower from the control tissue (3.93 T 1.85, 15.57 T 6.74 respectively; Figure 2c and d), this effect was not statistically signicant. b-glycan:GAPDH ratio was not signicantly altered in preeclamptic placental tissue (0.69 T 0.31) compared with controls (0.84 T 0.69, Figure 2e).

Results
Using real-time PCR, relative expression of activin/inhibin subunits, follistatin, activin receptor and b-glycan genes were calculated by normalizing with GAPDH gene expression in RNA extracted from both control and pre-eclamptic placentas. Mean GAPDH expression in placental tissue from pre-eclamptic patients and controls were not signicantly different (data not shown).

Inhibin/activin subunits and follistatin gene expression

The mean ratio of inhibin a subunit:GAPDH gene expression in preeclamptic placentas (2.06 T 0.59) was ~3-fold higher (P = 0.04) than in the controls (0.67 T 0.20; Figure 1a). The mean ratio of inhibin/ activin bA subunit:GAPDH in pre-eclamptic placental tissue (11.16 T 4.37) was ~4-fold higher (P = 0.01) than the control placental tissue (2.73 T 1.20; Figure 1b). The ratio between inhibin/activin bB:GAPDH and bC subunit:GAPDH in pre-eclamptic placental tissue tended to be lower than the controls (0.73 T 0.27, 2.88 T 2.38

Discussion
This study shows that inhibin a and inhibin/activin bA subunit genes are up-regulated in term pre-eclamptic placenta. Using real-time PCR, we have shown for the rst time, the expression of inhibin a subunit, bA, bB and bC subunits, follistatin, b-glycan and activin receptor genes (ActR IA, ActR IB, ActR IIA and ActR IIB), in placental tissue from both uncomplicated term pregnancies and term pregnancies with preeclampsia. These results support our previous observations in maternal serum (Muttukrishna et al., 2000) and placental homogenate

201

D.Casagrandi et al. (Bersinger et al., 2002) of elevated levels of inhibin A and activin A in pre-eclampsia. Expression of some of these genes in reproductive tissues has been examined in previous studies either by using RTPCR in ovarian and placental samples (Peng et al., 1999), or by using real-time PCR in endometrial samples collected at all stages of the menstrual cycle and early pregnancy (Jones et al., 2002). A recent study by Silver et al. (2002) has reported an ~2-fold signicant rise with pre-eclampsia in a:GAPDH ratio and bA:GAPDH ratio using semi-quantitative RTPCR and densitometry measurements of the bands. Our results using real-time PCR, a sensitive and precise quantitative method, are consistent with the above study. It has been known for a few years that inhibin A levels are increased in pregnant women with pre-eclampsia (Muttukrishna et al., 1997b, 2000). Since there is no evidence of another likely source of inhibin A during pregnancy, this placental a subunit gene up-regulation may play an important, if not the most important, role in increasing the levels of inhibin A in women with pre-eclampsia. The magnitude of rise in the expression of bA subunit gene in preeclamptic placental samples compared with those obtained from uncomplicated pregnancies found in the present study is similar to the increase in activin A measured in the maternal circulation in preeclamptic women (Petraglia et al., 1995; Muttukrishna et al., 1997b, 2000). Follistatin levels in pre-eclamptic patients were reported to be unaltered by D'Antona et al. (2000) and raised by Keelan et al. (2002). In this study we found that follistatin gene expression was not altered signicantly in term pre-eclamptic patients. The exact origin of the increased levels of activin A and inhibin A during normal and pre-eclamptic pregnancies has been subject to great controversy. It is generally accepted that the placenta is the major source of circulating activin A in normal pregnancy (Muttukrishna et al., 1997a) and it has been assumed that the source of activin A and inhibin A in pre-eclampsia is predominantly from placental tissue, reecting abnormal placentation and trophoblast function (Aquilina et al., 1999; Silver et al., 1999). Moreover, the observation by Jackson et al. (2000) of increased inhibin a subunit (~50%) and bA subunit (~100%) protein expression in term pre-eclamptic placental tissue is supported by our present observation. There is some evidence that activins are released early in the cascade of circulatory cytokines during systemic inammatory episodes (Phillips et al., 2001). The source(s) of activins in such conditions is not yet established, but prime candidates include monocytes and macrophages (Yu and Dolter, 1997; Phillips et al., 2001). Since pre-eclampsia is characterized by a systemic and intense inammatory response, it is possible that activin A production by monocytes may contribute to elevated circulating levels (Yu and Dolter, 1997). There is emerging evidence in the literature that the vascular endothelium is a potent source of activin A (Phillips, 2001), and because both endothelial cells and monocytes undergo activation in pre-eclampsia, a signicant contribution from these sources cannot be discounted (Yu and Dolter, 1997; Phillips, 2001). Several studies have led to the conclusion that gene expression is altered in pre-eclampsia, and hypoxia may play a role in cases of placental gene up-regulation (Rajakumar et al., 2001; Tsoi et al., 2001; Sagawa et al., 2002). It has been said that oxygen tension regulates the expression of several genes that are critical to the proliferation and differentiation of cytotrophoblasts, which is proposed to contribute to the pathogenesis of pre-eclampsia (Mise et al., 1998). Placental hypoxia in the second half of gestation, as a consequence of reduced utero-placental blood ow, may result in aberrant expression of genes that contribute to the pathophysiology of pre-eclampsia. Some of these up-regulated genes might encode certain cytokines and vasoactive molecules (Graham et al., 2000). The reason for up-regulation of the inhibin/activin subunit RNA is unclear. It could be due to increased reactive oxygen species (ROC), due to oxidative stress in pre-eclampsia and/or an alteration in the promoter region of the a and bA gene which has caused an increase in the synthesis of RNA. However, there is controversial evidence for the regulation of activin A under hypoxia. Jenkin et al. (2001) has reported that feto-placental hypoxaemia is an acute trigger for increased activin secretion, most probably from the feto-placental unit in late pregnancy in sheep. By contrast, recent in-vitro studies have reported human placental explants cultured under hypoxic conditions (2 or 6%) secrete lower levels of activin A compared with explants cultured at normal oxygen tension (20%) (Blumenstein et al., 2002; Manuelpillai et al., 2003). The discrepancy between the in-vivo and in-vitro studies could be due to species variation and/or in-vitro culture conditions. Clearly further studies have to be carried out to unravel the mechanisms involved in up-regulating inhibin a and bA subunit RNA in term pre-eclamptic placental tissue. The expression of the subunits, receptors and binding proteins in the same tissue suggests tightly controlled local action for the proteins. Although specic actions of these proteins in the placenta are yet unclear, there is evidence for activin A to promote invasion in early pregnancy (Caniggia et al., 1997). However, in other tissues these proteins are known to have specic effects. Follistatin is a promoter of angiogenesis and is up-regulated during endothelial cell proliferation (Kozian et al., 1997) and activin A is an inhibitor of angiogenesis (McCarthy and Bicknell, 1993). The evidence for follistatin in serum is controversial, with D'Antona et al. (2000) reporting unaltered levels and Keelan et al. (2002) reporting raised levels of follistatin in the circulation of pre-eclamptic patients. The evidence so far regarding pre-eclampsia suggests that activin A subunits and protein are upregulated in the disease with little or no changes in the binding protein (follistatin) expression. Therefore, we could speculate that there is an increased level of `free activin A' in the tissue that could be biologically active. However, inhibin A is also known to antagonize activin A binding to its receptors. Hence, an increased level of inhibin A in pre-eclamptic placenta could provide a regulatory mechanism for activin action in the same tissue. In conclusion, the present study on activin/inhibin subunits, follistatin and activin receptor gene expression provides further pathophysiological evidence of abnormal gene expression in preeclamptic compared with uncomplicated pregnancies. These ndings strengthen the hypothesis that differential gene expression may be one of the aetiologies of increased production of these proteins in pregnancies complicated with pre-eclampsia. There is a need for further studies with a larger number of patients; to determine the factors that may alter this abnormal expression for understanding the pathophysiology of this disease.

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 14, 2013

Acknowledgement
S.Muttukrishna acknowledges the nancial support from the Wellcome Trust.

References
Aquilina, J., Barnett, A., Thompson, O. and Harrington, K. (1999) Secondtrimester maternal serum inhibin A concentration as an early marker for preeclampsia. Am. J. Obstet. Gynecol., 181, 131136. Attisano, L., Wrana, J.L., Montalvo, E. and Massague, J. (1996) Activation of signalling by the activin receptor complex. Mol. Cell. Biol., 16, 10661073. Bersinger, N.A., Groome, N.P. and Muttukrishna, S. (2002) Pregnancyassociated and placental proteins in the placental tissue of normal and preeclamptic women at delivery. Eur. J. Endocrinol., 147, 785793.

202

Inhibin and activin in pre-eclampsia

Blumenstein, M., Mitchell, M.D., Groome, N.P. and Keelan, J.A. (2002) Hypoxia inhibits activin A production by term villous trophoblast in vitro. Placenta, 23, 735741. Caniggia, I., Lye, S.J. and, Cross J.C. (1997) Activin is a local regulator of human cytotrophoblast cell differentiation. Endocrinology, 138, 3976-3986. Carcamo, J., Weis, F.M., Ventura, F., Wieser, R., Wrana, J.L., Attisano, L. and Massague, J. (1994) Type I receptors specify growth-inhibitory and transcriptional responses to transforming growth factor beta and activin. Mol. Cell. Biol., 14, 38103821. Cuckle, H., Sehmi, I. and Jones, R. (1998) Maternal serum inhibin A can predict pre-eclampsia. Br. J. Obstet. Gynecol., 105, 11011103. D'Antona, D., Reis, F.M., Benedetto, C., Evans, L.W., Groome, N.P., de Kretser, D.M., Wallace, E.M. and Petraglia, F. (2000) Increased maternal serum activin A but not follistatin levels in pregnant women with hypertensive disorders. J. Endocrinol., 165, 157162. Debieve, F., Pampfer, S. and Thomas, K. (2000) Inhibin and activin production and subunit expression in human placental cells cultured in vitro. Mol. Hum. Reprod., 6, 743749. Fowler, P.A., Evans, L.W., Groome, N.P., Templeton, A. and Knight, P.G. (1998) A longitudinal study of maternal serum inhibin-A, inhibin-B, activin-A, activin-AB, pro-alphaC and follistatin during pregnancy. Hum. Reprod., 13, 35303536. Fraser, R.F., McAsey, M.E. and Coney, P. (1998) Inhibin-A and pro-alpha C are elevated in preeclamptic pregnancy and correlate with human chorionic gonadotropin. Am. J. Reprod. Immunol., 40, 3742. Graham, C.H., Postovit, L.M., Park, H., Canning, M.T. and Fitzpatrick, T.E. (2000) Adriana and Luisa Castellucci award lecture 1999: role of oxygen in the regulation of trophoblast gene expression in invasion. Placenta, 21, 443450. Jackson, N., Biddolph, S.C., Ledger, W., Groome, N.P. and Manek, S. (2000) Inhibin expression in normal and pre-eclamptic placental tissue. Int. J. Gynecol. Pathol., 19, 219224. Jenkin, G., Ward, J., Hooper, S.B., O'Connor, A.E., de Kretser, D.M. and Wallace, E.M. (2001) Feto-placental hypoxemia regulates the release of fetal activin A and prostaglandin E2. Endocrinology, 142, 963966. Jones, R.L., Salamonsen, L.A., Zhao, Y.C., Ethier, J.F., Drummond, A.E. and Findlay, J.K. (2002) Expression of activin receptors, follistatin and betaglycan by human endometrial stromal cells; consistent with a role for activin during decidualization. Mol. Hum. Reprod., 8, 363374. Keelan, J.A., Groome, N.P. and Mitchell, M.D. (1998) Regulation of activin A production by human amnion, decidua and placenta in vitro by proinammatory cytokines. Placenta, 19, 429434. Keelan, J.A., Taylor, R., Schellenberg, J.C., Groome, N.P. Mitchell, M.D. and North, R.A. (2002) Serum activin A, inhibin A and follistatin concentrations in preeclampsia or small for gestational age pregnancies. Obstet. Gynecol., 99, 267274. Kozian, D.H., Ziche, M. and Augustin, H.G. (1997) The activin-binding protein follistatin regulates autocrine endothelial cell activity and induces angiogenesis. Lab. Invest., 76, 267276. Lewis, K.A., Gray, P.C., Blount, A.L., MacConell, L.A., Wiater, E., Bilezikjian, L.M. and Vale, W. (2000) Betaglycan binds inhibin and can mediate functional antagonism of activin signaling. Nature, 404, 411414. Manuelpillai, U., Schneider-Kolsky, M., Dole, A. and Wallace, E.M. (2001) Activin A and activin receptors in gestational tissue from preeclamptic pregnancies. J. Endocrinol., 171, 5764. Manuelpillai, U., Schneider-Kolsky, M., Thirunavukarasu, P., Dole, A., Waldron, K. and Wallace, E.M. (2003) Effect of hypoxia on placental activin A, inhibin A and follistatin synthesis. Placenta, 24, 7783. McCarthy, S.A. and Bicknell, R. (1993) Inhibition of vascular endothelial cell growth by activin-A. J. Biol. Chem., 268, 2306623071. Mise, H., Sagawa, N., Matsumoto, T., Yura, S., Nanno, H., Itoh, H., Mori, T., Masuzaki, H., Hosoda, K., Ogawa, Y. et al. (1998) Augmented placental production of leptin in preeclampsia: possible involvement of placental hypoxia. J. Clin. Endocrinol. Metab., 83, 32253229. Mohan, A., Asselin, J., Sargent, I.L., Groome, N.P. and Muttukrishna, S. (2001) Effect of cytokines and growth factors on the secretion of inhibin A, activin A and follistatin by term placental villous trophoblasts in culture. Eur. J. Endocrinol., 145, 505511. Muttukrishna, S., George, L., Fowler, P.A., Groome, N.P. and Knight, P.G. (1995) Measurement of serum concentrations of inhibin-A (alphabeta A dimer) during human pregnancy. Clin. Endocrinol., 42, 391397. Muttukrishna, S., Child, T.J., Groome, N.P. and Ledger, W.L. (1997a) Source of circulating levles of inhibin A, pro alpha C-containing inhibins and activin A in early pregnancy. Hum. Reprod., 12, 10891093. Muttukrishna, S., Knight, P.G., Groome, N.P., Redman, C.W.G and Ledger, W.L (1997b) Inhibin A and activin A: new endocrine markers for preeclampsia? Lancet, 349, 12851288. Muttukrishna, S., North, R.A., Morris, J., Schellenberg, J.C., Taylor, R.S., Asselin, J., Ledger, W., Groome, N. and Redman, C.W. (2000) Serum inhibin and activin A are elevated prior to the onset of pre-eclampsia. Hum. Reprod., 15, 16401645. Peng, C., Ohno, T., Koh, L.Y., Chen, V.T. and Leung, P.C. (1999) Human ovary and placenta express messenger RNA for multiple activin receptors. Life Sci., 64, 983994. Petraglia, F. (1997) Inhibin, activin and follistatin in the human placentaa new family of regulatory proteins. Placenta, 18, 38. Petraglia, F., Garuti, G.C., Calza, L., Roberts, V., Giardino, L., Genazzani, A.R., Vale, W. and Meunier, H. (1991) Inhibin subunits in human placenta: localization and messenger ribonucleic acid levels during pregnancy. Am. J. Obstet. Gynecol., 165, 750758. Petraglia, F., Aguzzoli, L., Gallinelli, A., Florio, P., Zonca, M., Benedetto, C. and Woodruff, K. (1995) Hypertension in pregnancy: changes in activin A maternal serum concentration. Placenta, 16, 447454. Phillips, D.J., Jones, K.L., Scheerlinck, J.Y., Hedger, M.P. and de Kretser, D.M. (2001) Evidence for activin A and follistatin involvement in the systemic inammatory response. Mol. Cell. Endocrinol., 180, 155162. Rajakumar, A., Whitelock, K.A., Weissfeld, L.A., Daftary, A.R., Markovic, N. and Conrad, K.P. (2001) Selective overexpression of the hypoxia-inducible transcription factor, HIF-2alpha, in placentas from women with preeclampsia. Biol. Reprod., 64, 499506. Redman, C.W. (1991) Current topic: pre-eclampsia and the placenta. Placenta, 12, 301308. Redman, C.W., Sacks, G.P. and Sargent, I.L. (1999) Preeclampsia: an excessive maternal inammatory response to pregnancy. Am. J. Obstet. Gynecol., 180, 499506. Sagawa, N., Yura, S., Itoh, H., Mise, H., Kakui, K., Korita, D., Takemura, M., Nuamah, M.A., Ogawa, Y., Masuzaki, H. et al. (2002) Role of leptin in pregnancya review. Placenta, 23, 8086. Schneider-Kolsky, M.E., Manuelpillai, U., Waldron, K., Dole, A. and Wallace, E.M. (2002) The distribution of activin and activin receptors in gestational tissues across human pregnancy and during labour. Placenta, 23, 294302. Silver, H.M., Lambert-Messerlian, G.M., Star, J.A., Hogan, J. and Canick, J.A. (1999) Comparison of maternal serum total activin A and inhibin A in normal, preeclamptic, and nonproteinuric gestationally hypertensive pregnancies. Am. J. Obstet. Gynecol., 180, 11311137. Silver, H.M., Lambert-Messerlian, G.M., Reis, F.M., Diblasio, A.M., Petraglia, F. and Canick, J.A. (2002) Mechanism of increased maternal serum total activin A and inhibin A in pre eclampsia. J. Soc. Gynecol. Invest., 9, 308312. Tannetta, D., Muttukrishna, S., Redman, C.W.G. and Sargent, I.L. (2001) Peripheral blood mononuclear cells (PBMCs) are a potential source of extra placental activin A in pre-eclampsia. Placenta, 22, abstract no. P206. Tsoi, S.C., Zheng, J., Xu, F. and Kay, H.H. (2001) Differential expression of lactate dehydrogenase isozymes (LDH) in human placenta with high expression of LDH-A(4) isozyme in the endothelial cells of pre-eclampsia villi. Placenta, 22, 317322. Yu, J. and Dolter, K.E. (1997) Production of activin A and its roles in inammation and hematopoiesis. Cytok. Cell. Mol. Ther., 3, 169177. Submitted on November 28, 2002; accepted on January 8, 2003

Downloaded from http://molehr.oxfordjournals.org/ by guest on January 14, 2013

203