Transient Receptor Potential Melastatin 2 Is Required for Lipopolysaccharide-Induced Cytokine Production in Human Monocytes

This information is current as of April 25, 2011 Janine Wehrhahn, Robert Kraft, Christian Harteneck and Sunna Hauschildt J Immunol 2010;184;2386-2393; Prepublished online 27 January 2010; doi:10.4049/jimmunol.0902474 http://www.jimmunol.org/content/184/5/2386
Downloaded from www.jimmunol.org on April 25, 2011

Supplementary Data References

http://www.jimmunol.org/content/suppl/2010/01/27/jimmunol.09024 74.DC1.html This article cites 51 articles, 21 of which can be accessed free at: http://www.jimmunol.org/content/184/5/2386.full.html#ref-list-1 Article cited in: http://www.jimmunol.org/content/184/5/2386.full.html#related-urls

Subscriptions Permissions Email Alerts

Information about subscribing to The Journal of Immunology is online at http://www.jimmunol.org/subscriptions Submit copyright permission requests at http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at http://www.jimmunol.org/etoc/subscriptions.shtml/

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

The Journal of Immunology

Transient Receptor Potential Melastatin 2 Is Required for Lipopolysaccharide-Induced Cytokine Production in Human Monocytes
Janine Wehrhahn,* Robert Kraft, Christian Harteneck, and Sunna Hauschildt*
Transient receptor potential melastatin 2 (TRPM2) is a Ca2+-permeable nonselective cation channel that is stimulated by oxidative stress and specically activated by intracellular ADP-ribose. Because TRPM2 is highly expressed in immunocytes, a role of this channel in inammation processes has been proposed. The aim of the current study was to determine the function of TRPM2 in LPS-induced cytokine production of human monocytes. Incubation of human primary monocytes with LPS resulted in an upregulation of TRPM2 mRNA, protein, and of ADP-riboseinduced membrane currents. By using short hairpin RNA to downregulate TRPM2 expression in THP-1 monocytes, we demonstrate that TRPM2 is required for the LPS-induced production of IL6, IL-8, IL-10, and TNF-a. Application of LPS led to a time-dependent increase in intracellular Ca2+ concentrations in THP-1 cells that was clearly reduced by downregulation of TRPM2. Omission of extracellular Ca2+ strongly decreased TNF-a production in TRPM2-expressing cells. Thus, TRPM2-mediated Ca2+ entry is a central mechanism for LPS-induced cytokine production in monocytic cells. The identication of TRPM2 as a major player in this LPS-dependent process makes it a promising tool in modulating monocyte functions. The Journal of Immunology, 2010, 184: 23862393. nteraction of human monocytes and macrophages with LPS, the major outer membrane component of Gram-negative bacteria, results in an inammatory response that includes production of reactive oxygen species (ROS),proinammatory cytokines, and chemokines. When released in massive amounts, these mediators can cause multiple organ dysfunction syndromes and lethal septic shock (1, 2). Despite much effort either to neutralize the mediators once formed or to inhibit their production, there is no good therapy for these pathological conditions. Because an increase in intracellular calcium concentrations ([Ca2+]i) is a common mechanism used by cells to initiate production of mediators, one strategy to downregulate their production would be to inhibit calcium entry. With the discovery of transient receptor potential (TRP) channels being major players in facilitating calcium entry into various cell types, much interest has been focused on these channels as pharmacological targets. Transient receptor potential melastatin 2 (TRPM2) is a Ca2+permeable ion channel of the melastatin-related TRP channels (3 5), which represent the most diverse group within the TRP superfamily of cation channels (68). TRPM2 is unique among known ion channels in that it contains an intracellular enzymatic domain that possesses ADP-ribose (ADPR) hydrolase activity (9). Activation of
*Department of Immunobiology, Institute of Biology II and Carl Ludwig Institute of Physiology, University of Leipzig, Leipzig; and Institute of Experimental and Clinical Pharmacology, Toxicology and Interfaculty Center of Pharmacogenomics and Pharmaceutical Research, Eberhard Karls University Tubingen, Tubingen, Germany Received for publication July 29, 2009. Accepted for publication December 18, 2009. C.H. was supported by the Deutsche Forschungsgemeinschaft. Address correspondence and reprint requests to Prof. Sunna Hauschildt, Department of Immunobiology, Institute of Biology II, University of Leipzig, Talstrae 33, 04277 Leipzig, Germany. E-mail address: shaus@rz.uni-leipzig.de The online version of this article contains supplemental material. Abbreviations used in this paper: ACA, N-(p-amylcinnamoyl)anthranilic acid; ADPR, ADP-ribose; cADPR, cyclic ADP-ribose; [Ca2+]i, intracellular calcium concentrations; MDP, muramyl dipeptide; Pam3CysSK4, N-palmitoyl-S-[2, 3-bis(palmitoyloxy)-propyl]R-cysteinyl-(lysyl)3-lysine; ROS, reactive oxygen species; shRNA, short hairpin RNA; TRP, transient receptor potential; TRPM2, transient receptor potential melastatin 2; vitamin D3, 1a,25-dihydroxycholecalciferol; w.c., whole-cell. Copyright 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.0902474

Downloaded from www.jimmunol.org on April 25, 2011

TRPM2 channels is specically triggered by ADPR (9, 10) and is modulated by [Ca2+]i (1113) and temperature (14). Besides ADPR, other intracellular messengers such as NAD, cyclic ADP-ribose (cADPR), NADP, and 29-oxo-acetylated ADPR have been reported as TRPM2 agonists (10, 1518). Extracellular signals known to activate TRPM2 channels include stimuli that mediate oxidative stress, such as H2O2 and TNF-a (17, 19). Therefore, a role of TRPM2-mediated Ca2+ inux in H2O2-induced cell death has been proposed, as reviewed by Miller (20). Generation of intracellular ADPR primarily depends on activation of the ubiquitously expressed poly(ADP-ribose) polymerase (PARP-1) (2123), an enzyme linked to DNA repair upon damage because of chemicals, radiation, and oxidants. It uses NAD+ as a substrate to produce ADPR polymers, which in turn are quickly hydrolyzed into free ADPR by poly(ADPR) glycohydrolase (24). The ectoenzyme CD38, which converts extracellular NAD+ to ADPR (and to a minor extent to cADPR), may also contribute to TRPM2 activation (25). In addition to a variety of tissues (5, 17), a ubiquitous expression of functional TRPM2 channels has been reported in immunocytes, particularly in cells of the monocytic lineage (9, 10, 26, 27). An important function of granulocytes and cells of the monocytic lineage is the generation of ROS, particularly H2O2, to eliminate invading pathogens (28). This process known as the respiratory burst, which is accompanied by an increase in [Ca2+]i mediated by intracellular store depletion and Ca2+ entry from the extracellular space (29), implies that the cells themselves are also exposed to H2O2. Heiner et al. (25) speculated that the Ca2+-dependent release of H2O2 during respiratory burst is enhanced through Ca2+ entry via TRPM2, thus establishing a positive feedback loop by an autocrine/paracrine pathway. As H2O2 initiates a vast range of cellular processes (30) and induces activation of TRPM2, much interest has focused on the role of TRPM2 in modulating H2O2-mediated signal transduction events. Only recently, Yamamoto et al. (31) showed that application of sublethal doses of H2O2 to human monocytic U937 cells results in chemokine production induced by TRPM2-mediated Ca2+ inux. Activation of TRPM2 by H2O2 has also been observed to occur in activated microglia, the host macrophages of the CNS (27).

The Journal of Immunology Whereas H2O2 has been described as a potent activator of TRPM2 in monocytes, we raised the question whether this channel plays a role in LPS-induced monocyte functions. In this study, we provide evidence that TRPM2-mediated Ca2+ entry is essential for LPSinduced cytokine production in human monocytic cells. Thus, our study describes a new role for TRPM2 channels in the regulation of inammatory responses.

2387
CCCTTTTTGGAAA-39; shRNA_TRPM2 bottom strand, 59-AGCTTTTC CAAAAAGGGCCAAGAACTTCAACATGATCTCTTGAATCATGTTGAAGTTCTTGGCCCGGG-39; shRNA_scrambled top strand, 59-GATCCCCCAATAGACGCAGAGATGCATCTTCAAGAGAGATGCATCTCTGCGTCTATTGTTTTTGGAAA-39; and shRNA_scrambled bottom strand, 59AGCTTTTCCAAAAACAATAGACGCAGAGATGCATCTCTCTTGAAGATGCATCTCTGCGTCTATTGGGG-39. The complementary oligonucleotides (5 pmol/ml) were boiled for 5 min at 95C and ligated overnight at 4C. The double-stranded shRNA oligonucleotides as well as the modied vector pH1-RNA promoter were digested with HindIII and BamHI and then ligated. THP-1 cells were transfected with the shRNA vectors using Amaxa cell line nuclefector kit V (Lonza, Basel, Switzerland) according to the manufacturers instruction. By adding G-418 sulfate at 1 mg/ml to the cell culture medium, stable cell lines were generated. Transfection efciency was routinely controlled by GFP detection on a FACScan ow cytometer (BD Biosciences, San Jose, CA).

Materials and Methods

Reagents
Unless otherwise indicated, materials used in this study were from the following manufacturers: High Fidelity PCR Enzyme Mix, 29-deoxynucleoside 59-triphosphate solution, restriction enzymes (BamHI, HindIII, DraIII, AgeI, and BglII), RevertAid H Minus Moloney murine leukemia virus reverse transcriptase, RNase-free DNase I, shrimp alkaline phosphatase, T4 DNA ligase, and T4 DNA polymerase (Fermentas, St. Leon-Rot, Germany); fura2- acetoxymethyl ester, oligonucleotide synthesis, pCMV-mito-myc, Pluronic F-127, and 100-bp DNA ladder (Invitrogen, Karlsruhe, Germany); PNGase F and Quick Ligation Kit (New England Biolabs, Frankfurt/Main, Germany); G-418 sulfate and RPMI 1640 medium (with L-glutamine, 25 mM HEPES, and phenol red) (PAA, Pasching, Austria); penicillin and streptomycin (Seromed Biochrom, Berlin, Germany); and ADPR, Bradford reagent, FBS, LPS from Escherichia coli 055:B5, mouse anti-human b-actin Ab (clone AC-74), MTT, and peroxidase-conjugated goat anti-mouse Ab (Sigma-Aldrich, Taufkirchen, Germany). Sequencing was performed by GATC Biotech (Konstanz, Germany).

RNA isolation and reverse transcription

Total RNA was isolated from monocytes (4 3 106) and THP-1 cells (3 3 106) using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturers instruction. DNAse I treatment and reverse transcription were performed as described previously (33).

Semiquantitative real-time PCR

Downloaded from www.jimmunol.org on April 25, 2011

Cell separation and cell culture

Human PBMCs from healthy donors were obtained by centrifugation over a Ficoll-Isopaque (Pharmacia, Freiburg, Germany) density gradient. After repeated washing in PBS containing 0.3 mM EDTA, the monocytes were isolated by counterow elutriation using the JE-6B elutriation system (Beckman Instruments, Palo Alto, CA) as described previously (32). The purity of the cell preparation was .90% as assessed by morphological screening and immunouorescence staining with a mAb against CD14 (BL-M/G14; DiaMak, Leipzig, Germany). Human primary monocytes, untransfected THP-1 human myeloid leukemia cells (gift from Dr. M. Rehli, University of Regensburg, Regensburg, Germany), or stably transfected THP-1 cells were cultured in RPMI 1640 containing 100 U/ml penicillin and 100 mg/ml streptomycin in the presence of 10% FBS (5% CO2, 37C). Culture medium for transfected THP-1 cells additionally contained 1 mg/ml G-418 sulfate (Geneticin). Before stimulation, THP-1 cells (1 3 105/ml) were treated for 96 h with 0.1 mM 1a,25dihydroxycholecalciferol (vitamin D3, Ro 21-5535; F. Hoffmann-La Roche, Basel, Switzerland).

The reaction mixture contained 10 ml iQSYBR Green supermix (Bio-Rad, Munich, Germany), 125 nM forward and reverse primers, and 1 ml cDNA template in a nal volume of 20 ml. Expression of mRNA was analyzed with primers (34, 35) listed in Table I. Samples were run in duplicate in the 7300 real-time PCR cycler system (Applied Biosystems, Darmstadt, Germany). The reactions were performed under the following conditions: initial denaturation at 95C for 3 min, followed by 40 cycles of 15 s of denaturation at 95C, 30 s of primer annealing at 60C, and 30 s of extension/synthesis at 72C. Product quantication was optimal at 72C. Negative controls were performed with total RNA and water as template. Following PCR, the melting curve for each product was determined, and its correct size was estimated by agarose gel analysis. All cDNA products

Cell stimulation
Stimulation of monocytes and vitamin D3-treated THP-1 cells was performed in cell culture tubes (2 3 106/ml) for 1, 4, and 16 h, respectively, at 37C and 5% CO2 in cell culture medium in the presence or absence of LPS at 100 ng/ml, N-palmitoyl-S-[2,3-bis(palmitoyloxy)-propyl]-R-cysteinyl(lysyl)3-lysine (Pam3CysSK4; EMC Microcollections, Tubingen, Germany) at 100 ng/ml, and muramyl dipeptide (MDP; InvivoGen, Toulouse, France) at 10 mg/ml or human TNF-a (World Health Organization International Standard, code 88/786; National Institute for Biological Standards and Control, Hertfordshire, U.K.) at 1 ng/ml.

Short hairpin RNA vector design and stably transfection of THP-1 cells
The basic plasmid (pH1-RNA promoter) used to design TRPM2-specic and scrambled short hairpin RNA (shRNA) vectors contains a human H1 RNA promoter and was a gift from Dr. M. Niere (University of Bergen, Bergen, Norway). The basic shRNAvector pH1-RNA promoter was modied by adding a GFP expression cassette (multiple cloning site wasremovedby BglII and AgeI digestion), which was amplied from pEGFP-N1 (BD Clontech, Mountain View, CA) with specic primers, additionally encoding a DraIII restriction site (forward, 59-AAAAAACACTACGTGGATAACCGTATTACCGC-39, and reverse, 59-AAAAAACACGTAGTGGGACAAACCACAACTAG-39). Double-stranded oligonucleotides encoding for the TRPM2-specic shRNA (shRNA_TRPM2) and the respective control shRNA (shRNA_ scrambled; unspecic sequence derived from shRNA_TRPM2 by scrambling) were designed as follows: shRNA_TRPM2 top strand, 59-GATCCCCGGGCCAAGAACTTCAACATGATTCAAGAGATCATGTTGAAGTTCTTGG-

FIGURE 1. TRPM2 mRNA levels in stimulated human primary monocytes. Human primary monocytes were incubated in the presence or absence of LPS (100 ng/ml) (A) or in the presence and absence of Pam3CysSK4 (100 ng/ml), MDP (10 mg/ml), and TNF-a (1 ng/ml) (B) for the times indicated (A) and for 16 h (B) at 37C. After incubation, total RNA was isolated, and mRNAwas reverse transcribed after DNAse I digestion. TRPM2 mRNAwas quantied by performing a semiquantitative real-time PCR using the IQ SYBR Green Supermix (Bio-Rad). Relative mRNA levels (DDCt method) were standardized to the expression of the GAPDH housekeeping gene. Bars represent means 6 SEM (n = 37). pp # 0.05; ppp # 0.01.

2388

TRPM2 CHANNELS IN LPS-ACTIVATED MONOCYTES

Downloaded from www.jimmunol.org on April 25, 2011

FIGURE 2. TRPM2 protein levels in stimulated human primary monocytes. A, Human primary monocytes were incubated in the presence or absence of LPS (100 ng/ml), Pam3CysSK4 (100 ng/ml), MDP (10 mg/ml), and TNF-a (1 ng/ml) for the times indicated. Cells were lysed in permeabilization buffer and sonicated. Proteins (80 mg) were separated by SDS-PAGE and subjected to immunoblot analyses using a polyclonal rabbit anti-human TRPM2 serum and a mouse anti-human b-actin Ab, respectively. B, Cell lysates were incubated in the presence or absence of PNGase F (60,000 U/ml) for 1 h at 37C before performing SDS-PAGE and Western blot analysis. Specicity of TRPM2 detection was ascertained by performing a peptide competition assay (data not shown) and by specic TRPM2 knockdown via shRNA (Fig. 4). Shown is one representative experiment out of three. were conrmed by sequencing to check their identity. Calculations (DDCt method) were carried out as described previously (36).

FIGURE 3. TRPM2 currents activated by ADPR in LPS-stimulated human primary monocytes. A, Time-dependent changes of inward currents (at 2100 mV) elicited by obtaining the whole-cell (w.c.) conguration and infusion of a pipette solution containing 1 mM ADPR in a cultured unstimulated monocyte. The current-voltage relationships were obtained from responses during voltage ramps from 2100 to +100 mVat the time points indicated. NMDG+-containing bath solution suppressed inward currents and ACA (20 mM) blocked inward and outward currents. B, Statistical analysis of ADPR-induced current responses measured at 2100 mV in different monocyte preparations and under conditions as shown in A. In some cases, ADPR was not added to the pipette solution. Bars represent means 6 SEM. ppp # 0.01. of PNGase F (60,000 U/ml) according to the manufacturers instructions before performing Western blot analysis.

Calcium imaging
Measurements of the LPS-induced changes in [Ca2+]i in stably transfected THP-1 monocytes were carried out using the uorescent indicator fura-2 in combination with a monochromator-based imaging system (T.I.L.L. Photonics, Grafelng, Germany) attached to an inverted microscope (BX51WI; Olympus, Hamburg, Germany). Emitted uorescence was collected by a charge-coupled device camera. After addition of LPS, THP-1 cells were stored in culture medium at 37C. Every 30 min, 50 ml of each cell suspension (shRNA_scrambled and shRNA_TRPM2 transfected) was plated on poly-L-lysinecoated coverslips in 24-well microplates containing standard bath solution (140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 10 mM glucose, 10 mM HEPES, adjusted to pH 7.4 with NaOH), supplemented with 5 mM fura-2 and 0.01% Pluronic F-127. Cells were stored for 20 min at 2022C and were used for experiments 515 min after loading with fura2-acetoxymethyl ester. For measurements of [Ca2+]i, fura-2 uorescence was excited at 340 and 380 nm, and emission from single cells was acquired in intervals of 2 s for at least 60 s. After correction for the individual background uorescence, the uorescence ratio R = F340/F380, representing [Ca2+]i values, was calculated.

Western blot analysis

Western blot analysis was carried out as described previously (37) with some modications. Briey, cells (24 3 107/ml) were suspended in lysis buffer containing 10 mM Tris/HCl, 1 mM EDTA, 4 mM MgCl2 (pH 7.8), and Complete protease inhibitor mixture (Roche, Mannheim, Germany) and sonicated after 20 min on ice. Samples for TRPM2 detection were run on a 7.5%, samples for TNF-a detection on a 15% SDS-polyacrylamide gel (Protean II; Bio-Rad) and transferred to polyvinylidene diuoride membranes (Amersham Biosciences, Munich, Germany). Following blocking, membranes were probed with a polyclonal rabbit anti-human TRPM2 serum (1/500) or a goat anti-human TNF-a Ab (1/500; R&D Systems, Minneapolis, MN) overnight at 4C and with a mouse anti-human b-actin Ab (1/5000) for 1 h at room temperature, respectively. Subsequently, membranes were washed and then incubated with the respective secondary Ab (peroxidaseconjugated goat anti-rabbit Ab, 1/60,000, Dianova, Hamburg, Germany; HRP-conjugated donkey anti-goat IgG, 1/8,000, Santa Cruz Biotechnology, Santa Cruz, CA; peroxidase-conjugated goat anti-mouse Ab, 1/20,000) at room temperature for 1 h. After washing, the proteins were visualized by using Western lightning chemiluminescence (PerkinElmer, Boston, MA). To ascertain specicity of TRPM2 protein, a peptide competition assay was carried out. For this purpose, the polyclonal rabbit anti-human TRPM2 serum (1/500) was preincubated for 30 min with the respective peptide used for rabbit immunization (132 mg/ml Ab solution) before performing Western blot analysis. For PNGase F treatment (deglycosylation), whole-cell lysate (80 mg) of freshly isolated human monocytes was incubated in the presence or absence

Electrophysiology
Whole-cell patch clamp experiments were performed in primary monocytes and THP-1 cells placed on coverslips mounted in a recording chamber (chamber volume 0.5 ml) connected to a solution drain driven by gravity feed at a rate of 4 ml/min. Membrane currents were recorded using an EPC-8 amplier (HEKA, Lambrecht, Germany), subsequently low-pass ltered at 1 kHz, digitized with a sampling rate of 5 kHz, and analyzed using pCLAMP software (version 8.0; Axon Instruments, Union City, CA). The pipette resistance varied between 4 and 5 MV. Currents were elicited by voltage ramps from 2100 mV to +100 mV (400-ms duration) applied every 2 s from a holding potential of 0 mV. Pipettes were lled with a solution composed of 50 mM CsCH3O3S, 25 mM CsCl, 10 mM BAPTA, 8.3 mM CaCl2, 4 mM

The Journal of Immunology

2389
(38). After stimulation of THP-1 cells, 0.3 mg/ml MTT was added to the cell culture for 2 h. Cells were lysed overnight at 37C by adding equal volumes of a buffer containing 20% (w/v) SDS in 50% (v/v) N,N-dimethyl formamide solution. Extinctions were determined in quadruplicates at 570 nm. Apoptosis or necrosis of monocytes was assessed using the TACS Annexin VFITC apoptosis detection kit (R&D Systems), in which apoptotic cells are labeled with annexin V conjugated to FITC, and necrotic cells are labeled with propidium iodide. The test was performed according to the manufacturers instruction on a FACScan ow cytometer (BD Biosciences).

Detection of cytokines in culture supernatants

Culture supernatants were collected from THP-1cells for measurement of TNF-a, IL-6, IL-8 and IL-10 concentrations. The concentrations of TNF-a were determined by ELISA. Primary anti-TNF-a Abs as well as the secondary puried rabbit polyclonal TNF-a Abs were provided by W. Buurman (Maastricht University, Maastricht, The Netherlands). The peroxidase-labeled goat anti-rabbit Ab was from Dianova. TNF-a standard was purchased from NIBSC (World Health Organization International Standard, human, natural, code: 88/786; National Institute for Biological Standards and Control). The peroxidase substrate tetramethylbenzidine was from Calbiochem (Merck, Darmstadt, Germany). Secreted IL-6, IL-8, and IL-10 were detected by the BD Cytometric Bead Array (Human IL-6, IL-8, and IL-10 Flex Set and Human Soluble Protein Master Buffer Kit; BD Biosciences) on a BD FACSArray bioanalyzer, according to the manufacturers instructions.

Downloaded from www.jimmunol.org on April 25, 2011

Statistical analyses
All data concerning levels of gene expression or secretion are expressed as means 6 SEM from at least three independent experiments. Data from patch-clamp and calcium-imaging experiments are expressed as means 6 SEM of at least ve cells from at least three independent experiments. Statistical signicance was evaluated with unpaired Student t test.

Results
TRPM2 expression in human primary monocytes is induced by diverse stimuli
FIGURE 4. Characterization of a stable TRPM2 knockdown THP-1 cell line. Human THP-1 cells were stably transfected with a plasmid-based shRNA specic for TRPM2 (shRNA_TRPM2) and a scrambled shRNA control (shRNA_scrambled), respectively, using the Amaxa cell line nuclefector kit V and G418-resistance. A, To control whether TRPM2 knockdown was successful and whether LPS affects TRPM2 expression in THP-1 cells, shRNA_TRPM2and shRNA_scrambled-transfected and untransfected cells were incubated in the presence or absence of LPS (100 ng/ml) at 37C for 16 h. Cells were lysed in permeabilization buffer and sonicated. Proteins (60 mg) were separated by SDS-PAGE and subjected to immunoblot analyses using a polyclonal rabbitanti-TRPM2 serum and a mouse anti-human b-actin Ab, respectively. Shown is one representative experiment out of three. B, Currents in shRNA_TRPM2- and shRNA_scrambled-transfected THP-1 cells were evoked by obtaining the whole-cell (w.c.) conguration and infusion of a pipette solution containing 1 mM ADPR. Both cell lines were stimulated with 100 ng/ml LPS. The time course of currents at 2100 mV and the current-voltage relationships were obtained from responses during voltage ramps from 2100 to +100 mV. C, Averaged current responses measured at 2100 mV in shRNA_TRPM2- and shRNA_scrambled-transfected THP-1 cells in the presence or absence of LPS represent means 6 SEM (n = 57 cells each). ppp # 0.01; pppp # 0.001. Na2ATP, 2 mM MgCl2, and 10 mM HEPES (pH 7.2 with 52 mM CsOH). The concentration of free Ca2+ in this solution was calculated to be 600 nM using the software WinMAXC (version 2.05; C. Patton, Stanford University, Stanford, CA). To induce activation of TRPM2 channels, the pipette solution contained 1 mM ADPR. For extracellular Na+- and Ca2+-free conditions, the standard bath solution was exchanged for a solution containing 140 mM Nmethyl-D-glucamine-Cl, 1 mM MgCl2, and 10 mM HEPES (pH 7.4 with HCl). ADPR was dissolved in distilled water, and N-(p-amylcinnamoyl) anthranilic acid (ACA; obtained from Tocris Cookson, Bristol, U.K.) was dissolved in DMSO giving stock solutions of 100 and 50 mM, respectively.

Incubating human primary monocytes for 16 h in the presence of LPS led to a strong upregulation of TRPM2 mRNA expression (Fig. 1A, Table I). To test whether other ligands than LPS known to activate monocytes also share this effect, cells were incubated with Pam3CysSK4, MDP and TNF-a. Pam3CysSK4 is a synthetic analog derived from the N terminus of bacterial lipoprotein (39) and MDP has been identied as the minimal active structure of peptidoglycan (40). Signal transduction initiated by the four stimuli differs in so far as LPS and Pam3CysSK4 bind to TLR4 and TLR2, respectively. MDP interacts with the intracellular nucleotide-binding oligomerization domain-like receptors (40) and TNF-a binds to TNF-a receptors.
Table I. List of primers used in real-time PCR
Primer Sequence (5939)

Assays of cell viability

Viability of THP-1 cells was assessed by using the colorimetric MTT assay, based on the fact that viable cells are able to reduce MTT to purple formazan

GAPDH real time forward (34) GAPDH real time reverse (34) TRPM2 real time forward TRPM2 real time reverse TNF-a real time forward TNF-a real time reverse IL-6 real time forward (35) IL-6 real time reverse (35) IL-8 real time forward IL-8 real time reverse IL-10 real time forward IL-10 real time reverse

CAGTCCATGCCATCACTGCCACCCAG CAGTGTAGCCCAGGATGCCCTTGAG GAAGAGCATTTTCCGCAGAG ATGAGCTCGCCTTCCTTGTA TCAGCCTCTTCTCCTTCCTG GGCTACAGGCTTGTCACTCG GGATTCAATGAGGAGACTTGC GTTGGGTCAGGGGTGGTTAT ACCACCGGAAGGAACCAT TTCCTTGGGGTCCAGACA CCCAAGCTGAGAACCAAGAC AAGGCATTCTTCACCTGCTC

2390

TRPM2 CHANNELS IN LPS-ACTIVATED MONOCYTES

FIGURE 5. Effects of LPS on cytokine mRNA and protein levels in shRNA-treated THP-1 cells. Transfected (shRNA_TRPM2, shRNA _scrambled) and untransfected THP-1 cells were incubated in the presence or absence of LPS (100 ng/ml) for 1 h (A), 4 h (E) or 16 h (BD and FH) at 37C. AD, After incubation, total RNA was isolated, and mRNA was reverse transcribed after DNAse I digestion. TNF-a, IL-6, IL-8, and IL-10 mRNAs were quantied by performing a semiquantitative real-time PCR using the IQ SYBR Green Supermix (Bio-Rad). Relative mRNA levels (DDCt method) were standardized to the expression of the GAPDH housekeeping gene. EH, The concentrations of TNF-a in the culture supernatants were determined by ELISA and those of IL-6, IL-8, and IL-10 by the BD Cytometric Bead Array according to the manufacturers instructions. Bars represent means 6 SEM from (n = 38). pp # 0.05; ppp # 0.01; pppp # 0.001.

Downloaded from www.jimmunol.org on April 25, 2011

Stimulation with Pam3CysSK4, MDP, and TNF-a resulted in an increase in TRPM2 mRNA expression (Fig. 1B), indicating that upregulation of TRPM2 mRNA seems to be a common event associated with monocyte activation. To determine whether regulation at the mRNA level was reected by TRPM2 protein expression Western blot analysis was carried out. Treatment of human primary monocytes with LPS markedly enhanced TRPM2 protein expression. This up-regulation also occurred after incubation of the cells with Pam3CysSK4, MDP, and TNF-a (Fig. 2A). The Ab used to detect TRPM2 recognized two proteins with molecular weights of 160 and 175 kDa. Assuming that the difference in m.w. is due to glycosylation of the protein (TRPM2 is predicted to have ve glycosylation sites), we incubated cell lysates with PNGase F, an enzyme that cleaves the amide bonds between GlcNAc and asparagine residues of Nlinked glycoproteins (41). As seen in Fig. 2B, the higher m.w. protein disappeared after PNGase F treatment and the amount of the lower m.w. protein increased, indicating the presence of asparagine-linked glycosyl moieties on TRPM2. TRPM2 currents are upregulated in LPS-treated primary monocytes Because expression of both TRPM2 mRNA and protein was increased in LPS-stimulated monocytes compared with unstimulated cells, we investigated whether this upregulation is also reected by ion channel activity. We therefore recorded whole-cell currents in human primary monocytes by using an intracellular pipette solution appropriate to full ADPR-induced activation of TRPM2 channels. TRPM2-mediated inward currents were evoked by infusion of the specic channel agonist ADPR (1 mM) (Fig. 3A). Indeed, omission of ADPR from the pipette solution prevented the activation of currents (Fig. 3B). To quantify the contribution of unspecic leak conductance to the ADPR-induced inward currents, we used an extracellular solution containing the TRPM2-impermeable cation NMDG+ instead of Na+ and Ca2+, or we applied the TRPM2 inhibitor ACA (42). Thus, ADPR-evoked inward currents reect activity of TRPM2 cation channels. TRPM2 inward currents normalized to the cell capacitance were 254 6 5 pA/pF (n = 10) in freshly isolated mononocytes. Cells stored for 16 h in culture

medium showed inward current densities of 229 6 5 pA/pF (n = 10) and 262 6 5 pA/pF (n = 10) in the absence and presence of LPS, respectively (Fig. 3B). This increase in current density suggests a functional upregulation of TRPM2 channels in LPStreated human primary monocytes, which is in agreement with the effect of LPS on TRPM2 mRNA and protein expression. TRPM2 expression and activity is reduced in shRNA-treated cells To address the question whether TRPM2 has a role in the inammatory response, the human monocytic cell line THP-1 was used for additional experiments. Its stage of differentiation, that is closest to human monocytes, and its molecular manipulability make THP-1 cells an appropriate cell model for our purpose. Comparable with the effect of LPS on TRPM2 expression in primary monocytes, stimulation of THP-1 cells with LPS resulted in an upregulation of TRPM2 mRNA (Supplemental Fig. 1). THP-1 cells were stably transfected with shRNA to downregulate TRPM2 expression. As shown in Fig. 4A, knockdown of TRPM2 led to a drastic reduction of detectable protein in unstimulated and LPS-treated cells. By contrast, transfection of THP-1 cells with the respective scrambled shRNA did not result in any signicant modication of TRPM2 expression. The cell viability of the shRNA_TRPM2-transfected cells, incubated for 4 and 16 h in the presence or absence of LPS, did not differ from shRNA_scrambled-transfected or untransfected cells as determined by an MTT test (data not shown). Next, we investigated whether the decrease in TRPM2 protein expression was mirrored by TRPM2 activity. ADPR-evoked wholecell currents in shRNA_scrambled-transfected THP-1 cells showed densities of 271 6 13 pA/pF (n = 5) and 2131 6 27 pA/pF (n = 7) in the absence and presence of LPS, respectively (Fig. 4B). However, transfection with shRNA_TRPM2 resulted in inward current densities of 211 6 2 pA/pF in the absence of LPS (n = 5) and of 28 6 2 pA/pF after LPS stimulation (n = 7), indicating a functional downregulation of TRPM2 under both conditions (Fig. 4C). Ca2+ inux via TRPM2 plays a key role in LPS-induced cytokine production Given the importance of Ca2+ signaling for immunocyte functions, we asked whether TRPM2-mediated Ca2+ inux contributes to

The Journal of Immunology

2391 peptide, which is derived from the precursor form by proteolytic cleavage (43, 44). After incubating the cells for 4 h in the absence or presence of LPS, cell lysates were analyzed by Western blotting using a polyclonal goat anti-human TNF-a Ab (Fig. 6). LPS increased the level of proTNF-a in both untransfected and shRNA_scrambledtransfected but not in shRNA_TRPM2-transfected cells. The same holds true for the LPS-induced expression of the 17-kDa TNF-a. The presence of the 17-kDa TNF-a most likely reects the binding of soluble TNF-a from the culture supernatant to TNF-a receptors on the cell surface and can therefore be detected in the cell lysates. Because both forms of the TNF-a protein are hardly expressed in shRNA_TRPM2-transfected cells, a defect in producing the 17-kDa TNF-a protein can be excluded. To assess the role of Ca2+ inux in TNF-a production, THP-1 cells were incubated for 4 h in culture medium containing the chelating agent EGTA to remove extracellular Ca2+. EGTA led to a concentration-dependent decrease in LPS-mediated TNF-a production of untransfected as well as shRNA_scrambled-transfected cells and to a minor extent also of shRNA_TRPM2-transfected cells (Fig. 7A). Treatment with EGTA did not affect the viability as assessed by the use of an annexin V apoptosis test (data not shown). Having shown the crucial role of extracellular Ca2+ for TNF-a production, we next tested the effect of TRPM2 channel activation on [Ca2+]i in LPS-treated cells. Therefore, [Ca2+]i was measured in shRNA_TRPM2 and shRNA_scrambled THP-1 cells at different time points up to 5 h after the addition of LPS. In control cells (shRNA_scrambled), LPS caused a gradual increase in [Ca2+]i, which peaked after 2 h and then returned to values slightly exceeding normal levels (Fig. 7B). According to the kinetics, elevated Ca2+ concentrations can already be observed at time points (30 min) that precede maximum RNA (Supplemental Fig. 2A) and protein expression (Supplemental Fig. 2B) of the cytokines studied in this article. Although LPS also induced a continuous yet small increase in [Ca2+]i in shRNA_TRPM2-transfected cells, Ca2+ values leveled off after 3 h without having reached a peak. These

FIGURE 6. Expression of proTNF-a in lysates of shRNA-treated THP-1 cells. Transfected (shRNA_TRPM2 and shRNA_scrambled) and untransfected THP-1 cells were incubated in the presence or absence of LPS (100 ng/ml) at 37C. After 4 h, cells were lysed in permeabilization buffer and sonicated. Proteins (120 mg) were separated by SDS-PAGE and subjected to immunoblot analyses using a polyclonal goat anti-human TNF-a Ab and a mouse anti-human b-actin Ab, respectively. Shown is one representative experiment out of three.

Downloaded from www.jimmunol.org on April 25, 2011

LPS-induced cytokine production in monocytic cells. We exposed shRNA_TRPM2- and shRNA_scrambled-transfected as well as untransfected THP-1 cells to LPS and measured TNF-a, IL-6, IL-8, and IL-10 expression at the mRNA (Fig. 5AD, Table I) and protein level (Fig. 5EH). As a result, TNF-a, IL-6, IL-8, and IL-10 mRNA expression was signicantly reduced in shRNA_TRPM2-transfected cells compared with shRNA_scrambled-transfected cells (Fig. 5A D). The decrease in mRNA expression was mirrored by a diminished cytokine production (Fig. 5EH). To analyze the TRPM2-induced decrease in TNF-a secretion in shRNA_TRPM2-transfected cells in more detail, we next studied the expression of the precursor form of TNF-a (proTNF-a), a 26-kDa transmembrane type II polypeptide, and the soluble 17-kDa poly-

FIGURE 7. TRPM2-mediated Ca2+ inux is required for LPS-induced TNF-a-secretion. A, Transfected (shRNA_TRPM2, shRNA_scrambled) and untransfected THP-1 cells were incubated in the presence or absence of LPS (100 ng/ml) and EGTA (05 nM) for 4 h at 37C. Culture supernatants were collected from stimulated THP1cells. The concentrations of TNF-a in the culture supernatants were determined by ELISA. Bars represent means 6 SEM from (n = 3). pp # 0.05; ppp # 0.01. Statistical difference within each cell population was tested between EGTA-treated and -untreated cells. B, LPS-induced changes of basal [Ca2+]i indicated by the ratio of uorescence intensities (F340/F380) in fura 2-loaded, transfected (shRNA_TRPM2, shRNA_scrambled) THP-1 cells. Data points are means 6 SEM (n = 3161 cells from three independent experiments). ppp # 0.01, shRNA_TRPM2 versus shRNA_scrambled cells.

2392 data clearly indicate that Ca2+ inux through TRPM2 channels contributes to the LPS-induced increase in [Ca2+]i, which appears to be necessary for cytokine production.

TRPM2 CHANNELS IN LPS-ACTIVATED MONOCYTES strongly depend on the type of immune cells studied, the stimulus used, and the timescale of Ca2+ signaling. At present it is unknown which second messengers link LPS to TRPM2 activation and Ca2+ entry. Possible candidates are ADPR, NAD+, cADPR, and nicotinic acidadenine dinucleotide phosphate. In neutrophils stimulated with fMLP, ADPR has been identied as the activating molecule, which in cooperation with Ca2+ ions released from intracellular stores, enables Ca2+ inux through TRPM2 (50). Data showing that the fMLP-induced Ca2+ response and in vitro migration are suppressed in TRPM2-decient neutrophils point to an important role of TRPM2 in the activation process of these cells (31). Another well-described activator of TRPM2 is H2O2 (17, 19, 22, 51), an experimental paradigm of oxidative stress. Because granulocytes and monocytic cells at sites of inammation not only generate reactive oxygen intermediates, including H2O2, but are also exposed to H2O2, much interest has focused on the biological signicance of H2O2-induced TRPM2 activation. Whereas in most experiments the role of TRPM2 in H2O2-mediated cell death has been studied [review by Miller (20)], Yamamoto et al. (31) could demonstrate that the application of moderate amounts of H2O2 induced TRPM2-dependent IL-8 production in monocytes. Although using a different stimulus, the data of Yamamoto et al. (31) are in line with the results presented in this study. Furthermore, the authors found that TRPM2-knockout mice were largely protected from dextran sulfate sodium-induced experimental colitis, an ROS-associated inammatory model, suggesting that TRPM2 has major roles in the progressive severity of inammation. In summary, we have identied TRPM2 at the mRNA, protein, and functional levels in human peripheral blood monocytes. By silencing protein expression in THP-1 cells using TRPM2-specic shRNA, we demonstrated that TRPM2 channels regulate LPS-induced cytokine production by allowing Ca2+ entry across the plasma membrane. Considering its involvement in inammatory processes, TRPM2 could serve as an important target for therapeutic intervention in diseases such as sepsis or rheumatoid arthritis.

Discussion
In this study, we show that the Ca2+-permeable channel TRPM2 plays a key role in LPS-induced cytokine production in human monocytes. When analyzing the TRPM2 expression at the mRNA and protein level, we found strong signals in freshly isolated monocytes. The signals further increased when the cells were exposed to LPS and by far exceeded those detected in unstimulated controls. In addition to the enhanced protein synthesis, another means to regulate protein activity involves posttranslational protein modication such as glycosylation. We could show that monocytes express TRPM2 in a glycosylated and nonglycosylated version, whereas a regulation of TRPM2 protein by stimuli such as LPS could only be shown for the nonglycosylated form of TRPM2. Dietrich et al. (45) suggested a role of N-linked protein glycosylation as a major determinant for basal activity of TRPC3 and TRPC6 channels, which raises the possibility that the Nglycosylation state may be associated with differences in functional activities. Besides LPS, other potent monocyte activators, including Pam3CysSK4, MDP, and TNF-a, affect TRPM2 expression. Although the stimuli do not act by the same signal transduction mechanism, they all seem to initiate biochemical reactions, resulting in enhanced levels of TRPM2 protein synthesis. Thus, expression of sufcient functionally active TRPM2 channels seems to be one mean by which activated monocytes are enabled to fulll some of their multiple functions. We could indeed show that downregulation of TRPM2 results in an impaired TNF-a, IL-6, IL-8, and IL-10 secretion. These data together with the nding that THP-1 cells produce little TNF-a in the absence of extracellular Ca2+ clearly demonstrate that the uptake of extracellular Ca2+ via TRPM2 plays an important role in LPS-induced cytokine production. However, as TRPM2 knockdown and omission of extracellular Ca2+ did not completely block LPS-induced TNF-a production, the involvement of additional Ca2+-mobilizing pathways may account for the residual TNF-a response. Treatment of monocytic cells with LPS has been reported to cause an increase in [Ca2+]i, which is related to the production of TNF-a (46, 47). These Ca2+ signals appeared within minutes after addition of micromolar LPS (46, 47). When extending the time course of Ca2+ measurements, we found the most dramatic changes in basal Ca2+ to take place in the rst 2 h after exposure of 100 ng/ml LPS. A similar LPS-dependent kinetics of [Ca2+]i has been observed in mouse microglial cells (48). Having shown that the elevation in [Ca2+]i after LPS exposure was strongly reduced in shRNA_TRPM2-transfected cells, we suggest that TRPM2 represents one of the so far unknown channels that mediate Ca2+ uptake in LPS-stimulated monocytic cells. The extended transient Ca2+ increase after LPS exposure observed in our study occurs in a time frame that would allow for regulating long-term effects such as cytokine production. Longterm effects of other immune cells, such as activation and differentiation of B and T cells, that require transcriptional programming also depend on sustained Ca2+/calcineurin signaling, whereas brief activation of Ca2+ sufces for acute secretory processes such as mast cell degranulation (49). In contrast, a rapid transient rise in [Ca2+]i induced in monocytes by the application of H2O2 has been reported to trigger chemokine production in monocytes (31). Thus, the physiological responses induced by Ca2+

Downloaded from www.jimmunol.org on April 25, 2011

Acknowledgments
We thank Dr. Marc Niere from the University of Bergen for supporting us with the basic shRNA vector pH1-RNA promoter. IL-6, IL-8, and IL-10 cytometric bead arrays were performed by Dr. Manja Kamprad (Fraunhofer Institute for Cell Therapy and Immunology, Leipzig, Germany). Vitamin D3 was a gift from F. Hoffmann-La Roche. We also thank Prof. Stefan Feske (New York University Langone Medical Center, New York, NY) for critically reading the manuscript.

Disclosures
The authors have no nancial conicts of interest.

References
1. Marshall, J. C. 2001. Inammation, coagulopathy, and the pathogenesis of multiple organ dysfunction syndrome. Crit. Care Med. 29(Suppl. 7): S99S106. 2. Shen, F. M., Y. F. Guan, H. H. Xie, and D. F. Su. 2004. Arterial baroreex function determines the survival time in lipopolysaccharide-induced shock in rats. Shock 21: 556560. 3. Fleig, A., and R. Penner. 2004. The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol. Sci. 25: 633639. 4. Kraft, R., and C. Harteneck. 2005. The mammalian melastatin-related transient receptor potential cation channels: an overview. Pugers Arch. 451: 204211. 5. Nagamine, K., J. Kudoh, S. Minoshima, K. Kawasaki, S. Asakawa, F. Ito, and N. Shimizu. 1998. Molecular cloning of a novel putative Ca2+ channel protein (TRPC7) highly expressed in brain. Genomics 54: 124131. 6. Pedersen, S. F., G. Owsianik, and B. Nilius. 2005. TRP channels: an overview. Cell Calcium 38: 233252. 7. Ramsey, I. S., M. Delling, and D. E. Clapham. 2006. An introduction to TRP channels. Annu. Rev. Physiol. 68: 619647. 8. Venkatachalam, K., and C. Montell. 2007. TRP channels. Annu. Rev. Biochem. 76: 387417. 9. Perraud, A. L., A. Fleig, C. A. Dunn, L. A. Bagley, P. Launay, C. Schmitz, A. J. Stokes, Q. Zhu, M. J. Bessman, R. Penner, et al. 2001. ADP-ribose gating

The Journal of Immunology

of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411: 595599. Sano, Y., K. Inamura, A. Miyake, S. Mochizuki, H. Yokoi, H. Matsushime, and K. Furuichi. 2001. Immunocyte Ca2+ inux system mediated by LTRPC2. Science 293: 13271330. McHugh, D., R. Flemming, S. Z. Xu, A. L. Perraud, and D. J. Beech. 2003. Critical intracellular Ca2+ dependence of transient receptor potential melastatin 2 (TRPM2) cation channel activation. J. Biol. Chem. 278: 1100211006. Tong, Q., W. Zhang, K. Conrad, K. Mostoller, J. Y. Cheung, B. Z. Peterson, and B. A. Miller. 2006. Regulation of the transient receptor potential channel TRPM2 by the Ca2+ sensor calmodulin. J. Biol. Chem. 281: 90769085. Du, J., J. Xie, and L. Yue. 2009. Intracellular calcium activates TRPM2 and its alternative spliced isoforms. Proc. Natl. Acad. Sci. USA 106: 72397244. Togashi, K., Y. Hara, T. Tominaga, T. Higashi, Y. Konishi, Y. Mori, and M. Tominaga. 2006. TRPM2 activation by cyclic ADP-ribose at body temperature is involved in insulin secretion. EMBO J. 25: 18041815. Beck, A., M. Kolisek, L. A. Bagley, A. Fleig, and R. Penner. 2006. Nicotinic acid adenine dinucleotide phosphate and cyclic ADP-ribose regulate TRPM2 channels in T lymphocytes. FASEB J. 20: 962964. Grubisha, O., L. A. Rafty, C. L. Takanishi, X. Xu, L. Tong, A. L. Perraud, A. M. Scharenberg, and J. M. Denu. 2006. Metabolite of SIR2 reaction modulates TRPM2 ion channel. J. Biol. Chem. 281: 1405714065. Hara, Y., M. Wakamori, M. Ishii, E. Maeno, M. Nishida, T. Yoshida, H. Yamada, S. Shimizu, E. Mori, J. Kudoh, et al. 2002. LTRPC2 Ca2+-permeable channel activated by changes in redox status confers susceptibility to cell death. Mol. Cell 9: 163173. Kolisek, M., A. Beck, A. Fleig, and R. Penner. 2005. Cyclic ADP-ribose and hydrogen peroxide synergize with ADP-ribose in the activation of TRPM2 channels. Mol. Cell 18: 6169. Wehage, E., J. Eisfeld, I. Heiner, E. Jungling, C. Zitt, and A. Luckhoff. 2002. Activation of the cation channel long transient receptor potential channel 2 (LTRPC2) by hydrogen peroxide: a splice variant reveals a mode of activation independent of ADP-ribose. J. Biol. Chem. 277: 2315023156. Miller, B. A. 2006. The role of TRP channels in oxidative stress-induced cell death. J. Membr. Biol. 209: 3141. Buelow, B., Y. Song, and A. M. Scharenberg. 2008. The poly(ADP-ribose) polymerase PARP-1 is required for oxidative stress-induced TRPM2 activation in lymphocytes. J. Biol. Chem. 283: 2457124583. Fonfria, E., I. C. Marshall, C. D. Benham, I. Boyeld, J. D. Brown, K. Hill, J. P. Hughes, S. D. Skaper, and S. McNulty. 2004. TRPM2 channel opening in response to oxidative stress is dependent on activation of poly(ADP-ribose) polymerase. Br. J. Pharmacol. 143: 186192. Perraud, A. L., C. L. Takanishi, B. Shen, S. Kang, M. K. Smith, C. Schmitz, H. M. Knowles, D. Ferraris, W. Li, J. Zhang, et al. 2005. Accumulation of free ADP-ribose from mitochondria mediates oxidative stress-induced gating of TRPM2 cation channels. J. Biol. Chem. 280: 61386148. Woodhouse, B. C., and G. L. Dianov. 2008. Poly ADP-ribose polymerase-1: an international molecule of mystery. DNA Repair (Amst.) 7: 10771086. Heiner, I., J. Eisfeld, and A. Luckhoff. 2003. Role and regulation of TRP channels in neutrophil granulocytes. Cell Calcium 33: 533540. Heiner, I., J. Eisfeld, C. R. Halaszovich, E. Wehage, E. Jungling, C. Zitt, and A. Luckhoff. 2003. Expression prole of the transient receptor potential (TRP) family in neutrophil granulocytes: evidence for currents through long TRP channel 2 induced by ADP-ribose and NAD. Biochem. J. 371: 10451053. Kraft, R., C. Grimm, K. Grosse, A. Hoffmann, S. Sauerbruch, H. Kettenmann, G. Schultz, and C. Harteneck. 2004. Hydrogen peroxide and ADP-ribose induce TRPM2-mediated calcium inux and cation currents in microglia. Am. J. Physiol. Cell Physiol. 286: C129C137. Babior, B. M. 2000. Phagocytes and oxidative stress. Am. J. Med. 109: 3344. Granfeldt, D., M. Samuelsson, and A. Karlsson. 2002. Capacitative Ca2+ inux and activation of the neutrophil respiratory burst: different regulation of plasma membrane- and granule-localized NADPH-oxidase. J. Leukoc. Biol. 71: 611617. Droge, W. 2002. Free radicals in the physiological control of cell function. Physiol. Rev. 82: 4795. Yamamoto, S., S. Shimizu, S. Kiyonaka, N. Takahashi, T. Wajima, Y. Hara, T. Negoro, T. Hiroi, Y. Kiuchi, T. Okada, et al. 2008. TRPM2-mediated Ca2+ inux induces chemokine production in monocytes that aggravates inammatory neutrophil inltration. Nat. Med. 14: 738747.

2393
32. Grage-Griebenow, E., D. Lorenzen, R. Fetting, H. D. Flad, and M. Ernst. 1993. Phenotypical and functional characterization of Fc g receptor I (CD64)-negative monocytes, a minor human monocyte subpopulation with high accessory and antiviral activity. Eur. J. Immunol. 23: 31263135. 33. Grahnert, A., M. Friedrich, M. Pster, F. Haag, F. Koch-Nolte, and S. Hauschildt. 2002. Mono-ADP-ribosyltransferases in human monocytes: regulation by lipopolysaccharide. Biochem. J. 362: 717723. 34. Ercolani, L., B. Florence, M. Denaro, and M. Alexander. 1988. Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene. J. Biol. Chem. 263: 1533515341. 35. Hanley, P. J., B. Musset, V. Renigunta, S. H. Limberg, A. H. Dalpke, R. Sus, K. M. Heeg, R. Preisig-Muller, and J. Daut. 2004. Extracellular ATP induces oscillations of intracellular Ca2+ and membrane potential and promotes transcription of IL-6 in macrophages. Proc. Natl. Acad. Sci. USA 101: 94799484. 36. Grahnert, A., S. Richter, F. Siegert, A. Berndt, and S. Hauschildt. 2008. The orthologue of the acatalytic mammalian ART4 in chicken is an argininespecic mono-ADP-ribosyltransferase. BMC Mol. Biol. 9: 86. 37. Thiele, A., M. Wasner, C. Muller, K. Engeland, and S. Hauschildt. 2001. Reg ulation and possible function of b-catenin in human monocytes. J. Immunol. 167: 67866793. 38. Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65: 55 63. 39. Reitermann, A., J. Metzger, K. H. Wiesmuller, G. Jung, and W. G. Bessler. 1989. Lipopeptide derivatives of bacterial lipoprotein constitute potent immune adjuvants combined with or covalently coupled to antigen or hapten. Biol. Chem. Hoppe Seyler 370: 343352. 40. Girardin, S. E., I. G. Boneca, L. A. Carneiro, A. Antignac, M. Jehanno, J. Viala, K. Tedin, M. K. Taha, A. Labigne, U. Zahringer, et al. 2003. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan. Science 300: 15841587. 41. Maley, F., R. B. Trimble, A. L. Tarentino, and T. H. Plummer, Jr. 1989. Characterization of glycoproteins and their associated oligosaccharides through the use of endoglycosidases. Anal. Biochem. 180: 195204. 42. Kraft, R., C. Grimm, H. Frenzel, and C. Harteneck. 2006. Inhibition of TRPM2 cation channels by N-(p-amylcinnamoyl)anthranilic acid. Br. J. Pharmacol. 148: 264273. 43. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al. 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-a from cells. Nature 385: 729733. 44. Moss, M. L., S. L. Jin, M. E. Milla, D. M. Bickett, W. Burkhart, H. L. Carter, W. J. Chen, W. C. Clay, J. R. Didsbury, D. Hassler, et al. 1997. Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factora. Nature 385: 733736. 45. Dietrich, A., M. Mederos y Schnitzler, J. Emmel, H. Kalwa, T. Hofmann, and T. Gudermann. 2003. N-linked protein glycosylation is a major determinant for basal TRPC3 and TRPC6 channel activity. J. Biol. Chem. 278: 4784247852. 46. Watanabe, N., J. Suzuki, and Y. Kobayashi. 1996. Role of calcium in tumor necrosis factor-a production by activated macrophages. J. Biochem. 120: 1190 1195. 47. Zhou, X., W. Yang, and J. Li. 2006. Ca2+- and protein kinase C-dependent signaling pathway for nuclear factor-kB activation, inducible nitric-oxide synthase expression, and tumor necrosis factor-a production in lipopolysaccharidestimulated rat peritoneal macrophages. J. Biol. Chem. 281: 3133731347. 48. Beck, A., R. Penner, and A. Fleig. 2008. Lipopolysaccharide-induced downregulation of Ca2+ release-activated Ca2+ currents (I CRAC) but not Ca2+-activated TRPM4-like currents (I CAN) in cultured mouse microglial cells. J. Physiol. 586: 427439. 49. Feske, S., H. Okamura, P. G. Hogan, and A. Rao. 2003. Ca2+/calcineurin signalling in cells of the immune system. Biochem. Biophys. Res. Commun. 311: 11171132. 50. Heiner, I., N. Radukina, J. Eisfeld, F. Kuhn, and A. Luckhoff. 2005. Regulation of TRPM2 channels in neutrophil granulocytes by ADP-ribose: a promising pharmacological target. Naunyn Schmiedebergs Arch. Pharmacol. 371: 325333. 51. Zhang, W., X. Chu, Q. Tong, J. Y. Cheung, K. Conrad, K. Masker, and B. A. Miller. 2003. A novel TRPM2 isoform inhibits calcium inux and susceptibility to cell death. J. Biol. Chem. 278: 1622216229.

10.

11.

12.

13. 14.

15.

16.

17.

18.

Downloaded from www.jimmunol.org on April 25, 2011

19.

20. 21.

22.

23.

24. 25. 26.

27.

28. 29.

30. 31.