Vous êtes sur la page 1sur 18

1 PREGUNTAS DE SELECTIVIDAD PARA EL 2 TRIMESTRE (I) I) CICLO CELULAR, MITOSIS Y MEIOSIS 1.- Referente a la divisin celular: a.

- Qu nombre reciben las parejas de cromosomas apareados? En qu proceso y etapa del mismo se observan dichas parejas? (0,5 p.) b.- Haga un esquema grfico del contenido de ADN a lo largo del ciclo de una clula somtica suponiendo que la cantidad de ADN gamtica es C (1 p.) c.- Explique brevemente el significado de la meiosis respecto a la variabilidad de los seres vivos (0,5 p.). 2.- Con relacin al ciclo celular en clulas somticas: a.- Explique qu es la interfase y qu sucede en cada una de las etapas en las que se subdivide (1 p.). b.- Defina los siguientes trminos: centrmero, cromtidas hermanas, bivalente y telmero (1 p.). 3.- Con referencia al ciclo de divisin celular: a.- Suponga que el valor C es la cantidad de ADN por genoma haploide. Utilizando dicho valor, exprese la variacin que sufre el contenido de ADN en todas y en cada una de las fases del ciclo celular de una clula somtica de un organismo diploide (1p.). b.- Copie y complete la tabla adjunta, indicando en la columna de la derecha a qu corresponden los conceptos de la columna de la izquierda ( 1 p.). Los cromosomas que son similares en dimensiones, forma y contenido gentico se denominan La desaparicin del nucleolo tiene lugar durante Durante la citocinesis vegetal, la constitucin de la pared en las clulas hijas tiene lugar gracias a la formacin de un tabique llamado La sntesis de ADN en un meiocito tiene lugar durante 4.- Referente al ciclo celular en organismos eucariticos: a.- Desde el inicio de la interfase, site secuencialmente los periodos G2, G1 y S. Indique los principales acontecimientos que tienen lugar en cada uno de ellos (0,5p.). b.- Explique las diferencias entre los siguientes conceptos (0,75p.): Ciclo celular / Divisin celular; Mitosis / Citocinesis; Centrmero / Cinetocoro. c.- Describa los principales acontecimientos que tienen lugar durante la profase mittica (0,75p.). 5.- Referido al ciclo celular: a.- Dibuje un esquema de las etapas del ciclo celular, indicando cada una de sus fases en sucesin cronolgica ( 1p.). b.- Defina y explique brevemente el significado biolgico de G0 de S ( 1p.). CIDEAD

2 6.- Con referencia al ciclo celular y a los procesos de divisin: a.- Defina los siguientes trminos: Periodo G1; cromosoma homlogo; sobrecruzamiento; haploide (1 p.) b.- Haga un esquema grfico de una anafase II meitica y de un anafase mittica en una clula vegetal con una dotacin cromosmica 2n = 6 (0,5 p.). c.- Explique el significado biolgico de la mitosis (0,5 p.).
7.- La grfica representa la variacin del contenido de ADN por clula durante un supuesto ciclo celular. Responde razonadamente a las siguientes preguntas: a.- Qu ocurre en el intervalo de tiempo entre 1 y 2? Cmo se denomina esta fase? (0,5 p.
ADN/Clula 5 4 3 2 1 0

b.- Cmo se llaman las fases que tienen lugar en el intervalo compren dido entre 2 y 3 ( 1p.). c.- Nombre la fase en la que el contenido de ADN es mnimo (0,5 p.)

Tiem po

8.- El esquema adjunto representa las distintas fases por las que pasa una clula en su ciclo celular. a.- Sabiendo que el nmero 2 representa la telofase, indique que representaran todos los dems nmeros (1p.)

b.- Indique cuatro procesos celulares que se producen durante la interfase celular (1 p.)

9.- La grfica adjunta representa la variacin del contenido de ADN a lo largo del ciclo de un determinado tipo de clulas. a.- Explique cmo cambia el contenido de ADN desde la fase A hasta la fase G, razonando el tipo de divisin celular que se ha producido (1,5 p.). b.- Nombre la fase a la que corresponde la letra A e indique dos acontecimientos que se producen en dicha fase (0,5 p.).

3 10.- En relacin con los cromosomas: a.- Realice un esquema de un cromosoma en metafase mittica y seale las partes principales del mismo ( 1p.). b.- Cmo se clasifican en relacin con la posicin que ocupa la constriccin primaria? Defina o dibuje cada uno de ellos (1p.). 11.- Con referencia a los procesos de divisin celular: a.- En el ser humano y otros mamferos, tiene lugar una meiosis gametognica o cigtica? Razone la respuesta (0,5 p.). b.- Dibuje un cromosoma submetacntrico, indicando el nombre de cada una de las partes del mismo (0,5 p.). c.- Indique cul de las dos partes de la meiosis es reduccional. Explique los principales acontecimientos que tienen lugar durante la misma (1 p.). 12.- En relacin con la determinacin gentica del sexo: a.- Explique brevemente en qu consiste la determinacin cromosmica del sexo (0,5 p.). b.- Explique el sistema de determinacin cromosmica del sexo en mamferos (0,5 p.). c.- Indique dos sistemas de determinacin cromosmica del sexo diferente al de mamferos. Poner un ejemplo (1 p.). 13.- Una determinada especie animal tiene tres pares de cromosomas: a.- Indique cuntos cromosomas tendr un espermatozoide; cuntos tendr un vulo? Razone la respuesta (0,5 p.). b.- Haga un esquema de la metafase mittica de una clula de ese organismo(0,5 p.). c.- Indique en qu tipo de clulas de ese animal se llevara a cabo la mitosis; y la meiosis? (0,5 p.). d.- Qu tipo de espermatozoide puede formar ese animal en funcin de los cromosomas sexuales? Razone la respuesta (0,5 p.). 14.- Cuando en el laboratorio se cultivan clulas se observa que pasan por una primera etapa de crecimiento donde su actividad metablica es muy intensa y posteriormente por una segunda etapa donde sus clulas presentan su estructura interna muy modificada (material gentico visible en forma de cromosomas). a.- Cmo se denominan cada una de las etapas anteriormente descritas (0,5 p.). b.- Si las clulas cultivadas tuvieran cuatro cromosomas, aumentara el nmero de cromosomas en la fase donde se duplica la cantidad de ADN? Razone la respuesta (0,5 p.). c.- La tubulina es una protena sintetizada en la etapa de gran actividad metablica para formar el huso mittico Qu funcin desempea el huso acromtico y en qu fase comienza a observarse en las clulas? (1 p.). 15.- En relacin con los cromosomas metafsicos:
a.- Defina qu son los telmeros, e indique cuntos tendra un cromosoma metacntrico en la metafase mittica (0,5 p.). b.- Explique que se entiende por centrmero y por cinetocoro (0,5 p.). c.- Cuntos brazos y cuntas cromtidas tendra un cromosoma metacntrico? Y uno telocntrico? (0,5 p.). d.- Realice una representacin grfica de una pareja de cromosomas metacntricos y otra de telocntricos en metafase mittica. Seale la presencia de una constriccin secundaria en la pareja de metacntricos (0,5 p.).

4 16.- Los esquemas del dibujo adjunto representan clulas de la raz de un vegetal en diversas fases de la mitosis: a.- Nombre la fase en la que se encuentran las clulas numeradas, razonando la respuesta (1,5 p.). b.- De dnde parten las fibras del huso mittico en este tipo de clulas? (0,5 p.).

17.- El genoma de una especie animal diploide est formado por cuatro cromosomas, de los cuales un par posee estructura metacntrica y otra estructura acrocntrica: a.- Dibuje dos anafases mitticas una animal y otra vegetal, e indique todas las estructuras caractersticas de esta fase (1 p.). b.- Dibuje la dotacin cromosmica de un gameto de esta especie y cite cmo se denomina el proceso que conduce a la formacin de los gametos (0,5 p.). c.- Respecto a la variabilidad gentica, explique la importancia de la meiosis en la evolucin de las especies (0,5 p.). 18.- Con relacin a la divisin celular por mitosis: a.- Cite de forma secuencial las diferentes etapas del proceso. Para ello escriba en orden adecuado las letras asignadas a los diferentes dibujos (0,5 p.).

b.- Describe cuatro acontecimientos que estn ocurriendo en la fase representadas en el dibujo C (1 p.). c.- Razone si se trata de una clula animal o vegetal (0,5 p.).
19.- En relacin con los procesos de mitosis y meiosis de los organismos pluricelulares: a.- En cul de estos procesos se produce recombinacin gentica? Mencione el mecanismo responsable de la recombinacin (0,5 p.). b.- En qu tipos de clulas tiene lugar la mitosis y la meiosis? (0,5 p.). c.- Cuntas clulas hijas se producen en cada uno de ellos? (0,5 p.). d.- Explique el significado biolgico del proceso de la meiosis (0,5 p.). 20.- Con relacin a la divisin celular: a.- Respecto a la citocinesis (1) en qu consiste? (2) Cundo ocurre? (3) Qu diferencia bsica existe entre la citocinesis de una clula animal y de una vegetal? y (4) Cmo se denominan las estructuras que facilitan la citocinesis en ambos tipos de clulas? ( 1p.). b.- Respecto a la anafase: (1) qu regiones cromosmicas interactan con los microtbulos? (2) qu les sucede a esos microtbulos? (3) que estructuras migran a polos opuestos en la anafase I de la meiosis?, y (4) qu estructuras migran en la anafase II de la meiosis? ( 1p.).

5
21.- Los dibujos representan diferentes etapas de la divisin de una clula:

a.- Explique de que divisin se trata y por qu, ordenando la secuencia correcta de las etapas (1p.) b.- Explique si se trata de una clula vegetal o animal, aportando al menos dos razones (0,5 p.). c.- Qu diferencias existen entre las clulas resultantes de una mitosis y de una meiosis? (0,5p) 22.- Con referencia a los ciclos de divisin celular: a.- El esquema adjunto representa cromosomas eucariticos que se encuentran en mitosis. Indique la fase o las fases en las que se podran observar estos cromosomas. Podra ser tambin una metafase I meitica? Razone las respuestas (1 p.). b.- Con referencia al mismo esquema, indique su ploidia. Se trata de una clula somtica o de un gameto? (0,5 p.). c.- Explique el significado de la meiosis en relacin a la variabilidad gentica(0,5 p.). 23.- Con referencia a los procesos de divisin celular: a.- Indique las dos diferencias ms aparentes entre la telofase de una mitosis astral y la de una anastral. Mencione un tipo de organismos en los que se da cada una de ellas (0,5 p.). b.- Indique los acontecimientos que tienen lugar durante la telofase mittica (0,5p.). c.- Puede una clula haploide sufrir meiosis? Y un organismo haploide en alguna parte de su ciclo? Razone la respuesta (0,5 p.) d.- Explique en qu se diferencia la metafase mittica de la metafase I de la meiosis (0,5 p.).

24.- Con referencia al ciclo celular de una clula eucariota:


a.- Dibuje un cromosoma metacntrico y otro acrocntrico, cada uno de ellos en metafase y anafase mitticas, indicando en cada caso sus diversas partes o componentes (1p.). b.- Indique cules son las diferencias ms notables entre el significado biolgico de la mitosis y de la meiosis ( 1p.). 25.- Con referencia a las divisiones celulares de los organismos eucariticos: a.- Explique razonadamente las diferencias entre los cromosomas metafsicos mitticos y los de ambas metafases meiticas ( 0,75 p.)

b.- Para una clula animal con 2n = 4, indique: (1) clulas resultantes de la mitosis y de la meiosis; (2) nmero de cromtidas en un ncleo hijo mittico y en un ncleo hijo meitico; (3) nmero de citocinesis en mitosis y en meiosis; (4) nmero de bivalentes en mitosis y en meiosis. ( 0,75 p.). c.- Realice un esquema de una clula con 2n = 4 en anafase mittica (0,5 p.).

6
26.- En relacin con los procesos de meiosis y mitosis: a.- En cul de los dos procesos se producen bivalentes? En qu fase se separan los bivalentes? Dibuje un bivalente (0,75 p.). b.- Explique qu acontecimientos tienen lugar durante la metafase mittica (0,5 p.). c.- Dibuje la anafase I meitica de un organismo 2n = 6 cromosomas (0,5 p.). d.- Seale cuatro diferencias entre mitosis y meiosis (0,5 p.).

27.- Con referencia a los procesos de divisin celular eucaritica:


a.- Establezca tres diferencias entre los acontecimientos que tienen lugar durante la profase mittica y la profase I meitica ( 1p.). b.- Qu representa al meiosis en la reproduccin y variabilidad de las especies? (0,5 p. c.- Haga un esquema de un bivalente, indicando sus componentes (0,5 p.). 28.- Respecto a la divisin celular: a.- Cite cuatro sucesos que ocurren en la profase de una clula somtica ( 0,5p.). b.- Identifique y explique los dos tipos de anafase que aparecen representados a continuacin, teniendo en cuenta que las clulas tienen dos cromosomas telocntricos ( 1p.).

c.- Qu diferencias existen entre la anafase y la telofase? (0,5 p.)

29.- La figura adjunta representa clulas de un organismo diploide en divisin: a.-Estas clulas estn en divisin meitica o mittica Razone la respuesta (1 p.). b.-En qu etapa de la mitosis o de la meiosis se encuentran. Razone la respuesta (1 p.). 30.- Referente a los procesos de divisin celular: a.- Suponga que los cromosomas del esquema adjunto corresponden a una pareja de homlogos. Qu ha acontecido entre ellos y como se denomina el proceso? (0,5 p b.-Copie y complete el siguiente cuadro (1 p.).: 1.- La divisin del citoplasma se denomina 2.-Los cromosomas homlogos se apean entre si, originndose en la zona de contacto una estructura que se llama 3.- La desespiralizacin de los cromosomas ocurre en 4.- La sntesis de ADN se produce durante 31.- Con referencia a los procesos de divisin celular y reproduccin de los organismos: a.- Indique la importancia biolgica del proceso mittico (0,5 p.).

7 b.-Defina los siguientes conceptos: cromatina, cromtida, cromtidas hermanas y cromosomas homlogos (1p.). c.- Suponiendo la dotacin cromosmica 2n = 6, represente una telofase mittica (0,5). 32.-Suponga una clula vegetal con tres pares de cromosomas (2n = 6) que sufre una mitosis. Cada una de las clulas resultantes sufre, posteriormente, una meiosis: a.- Cuntas clulas se han producido al final de ambos procesos? Razone la respuesta b.- Indique la dotacin cromosmica que tiene cada una de ellas. Razone la respuesta c.- Realice un esquema sencillo de la telofase meitica II (0,5). 33.-En un organismo eucaritico de reproduccin sexual, con un nmero cromosmico 2n = 4 y todos los cromosomas telocntricos: a.- Dibuje un esquema de una anafase II (1 p.). b.- Explique qu es la meiosis cigtica y la meiosis gametognica. Indique en cada caso en qu tipo de organismos se lleva a cabo (1p.). 34.- Con relacin a la meiosis: a.- Qu sucesos especficos ocurren durante la profase de la primera divisin meitica (0,5 p.). b.- Qu es un quiasma? Cundo se visualiza? (0,5 p.). c.-En la representacin mostrada en el dibujo aparece un bivalente al final de la profase de la primera divisin meitica. Qu error presenta ese esquema? Realice un esquema en el que el error est subsanado (1 p.). 35.- Con relacin a la meiosis: a.- Explique cmo se genera la variabilidad gentica (0,5 p.). b.- Indique cundo se produce el reparto de las cromidas hermanas entre los ncleos hijos. Razone la respuesta (0,5 p.). c.- Teniendo en cuenta un organismo con 2n = 4, copie y complete el siguiente cuadro (1 p.). Metafase meitica I Metafase meitica II Nmero de cromosomas Nmero de bivalentes Nmero de cromtidas por cromosoma Ploida de la clula 36.- El siguiente dibujo representa una pareja de cromosomas homlogos durante la meiosis, y las letras representan los genes presentes en estos cromosomas. a.- Si se produce un sobrecruzamiento en el lugar indicado con una cruz, dibuje todos los gametos posibles formados tras el proceso de meiosis (0,75 p.). b.- En qu fase de la divisin meitica se produce el sobrecruzamiento. Explique las consecuencias biolgicas que conlleva este proceso (0,75 p.). c.- Indique una similitud y una diferencia entre una anafase mittica y una anafase II meitica (0,5 p.).

8 II) METABOLISMO: 37.- Entre las funciones de la membrana plasmtica se encuentra el transporte de molculas a travs de la misma. a.- Indique los tipos de transporte que conoce y explique sus caractersticas (1,25 p.). b.- En algunos tipos de clulas, la membrana se especializa para cumplir determinadas funciones. Cite tres especializaciones de membrana e indique su funcin especfica (0,75 p.). 38.- Relacionado con el metabolismo celular: a.- Defina anabolismo y catabolismo. Cite un ejemplo de ruta anablica (0, 5 p.). b.- Indique la finalidad de las rutas catablicas y ponga un ejemplo (0, 5 p.). b.- De acuerdo con la forma de obtener el carbono, indique cmo se clasifican los organismos. Razone la respuesta (0,5 p.). c.-Segn la fuente de energa que emplean, indique los tipos de organismos y relacinelos con la respuesta del apartado anterior (0, 5 p.). 39.- En el metabolismo de los seres vivos:
a.- Indique qu es un coenzima y qu papel desempea (0,5 p.) b.- Ponga un ejemplo de un coenzima oxidado e indique una ruta metablica en la que acte (0,5 p.). c.- Explique qu ocurre con los coenzimas reducidos en la cadena respiratoria (0,5 p.). d.- Cite dos procesos catablicos, localizndolos a nivel celular y en el orgnulo (0, 5 p.).

40.- En relacin con el metabolismo celular: a.- Explique la diferencia fundamental entre organismo aerbico y anaerbico (0, 5 p.). b.- Cite un proceso catablico que se realice en aerobiosis y otro en anaerobiosis. Indique la localizacin celular de cada ejemplo citado (0, 5 p.). c.- Nombre el sustrato inicial y el producto final de la gluclisis e indique si se trata de una va anablica o catablica y el compartimento celular donde se realiza (0, 5 p.). d.- Nombre el sustrato inicial y el producto final de la gluconeognesis e indique si se trata de una va anablica o catablica (0,5 p.). 41.- Defina los siguientes trminos: a.- Organismos fotoauttrofos o fotosintticos (0,5 p.). b.- Organismos quimioauttrofos o quimiosintticos (0, 5 p.). c.- Respiracin y fermentacin (0, 5 p.). d.- Diferencias entre el rendimiento energtico en los procesos del apartado c (0,5 p.). 42.- Respecto al ATP ( 3 p).:
a..- Indique el grupo de molculas al que pertenece, sus componentes y cul es su papel metablico (0,5 p.) b.- Explique las posibles formas de sntesis del ATP (0,75 p.). c.- Para cada mecanismo de sntesis de ATP, cite un proceso biolgico e indique su localizacin celular y a nivel de orgnulo (0,75 p.). d.- Indique dos rutas metablicas donde se obtenga ATP (0,5 p.). e.-Indique en cules de las siguientes rutas metablicas se obtiene ATP y en cuales se gasta: fosforilacin oxidativa, biosntesis de cidos grasos, fotofosforilacin y ciclo de Calvin (0,5 p.).

9
43- Referente al metabolismo celular: a.- Segn la fuente de carbono que utilicen los seres vivos para su desarrollo, explique los tipos de metabolismo (0,5 p.). b.- Las molculas que se citan a continuacin: FAD, NAD+, NADP y O2 tienen relacin con reacciones de los procesos fotosinttico y respiratorio. Indique la relacin de cada molcula con cada proceso (1p.). c.- Relacione los procesos anteriormente citados (fotosinttico y respiratorio) con los tipos de metabolismo aludidos en el primer apartado (0,5 p.). 44.- El NAD es un compuesto esencial en el metabolismo: a.- Indique la naturaleza qumica del mismo y explique brevemente su funcin (1p.). b.- Escriba las formas reducida y oxidada del NAD y ponga un ejemplo de una reaccin metablica en la que esta molcula se obtenga en forma reducida y otra en la que se obtenga de forma oxidada (1 p.). 45.- Algunos organismos obtienen energa por oxidacin total de la glucosa, que se convertir en CO2 y H2O. El proceso se realiza en cuatro fases o etapas claramente diferenciadas. a.- Qu nombre recibe cada una de ellas? (1 p.) b.- En qu lugar de la clula ocurre cada una de ellas? (0,5 p.). c.- Indique dos mecanismos distintos mediante los cuales se sintetiza ATP a lo largo de esas etapas (0,5 p.) 46.- Con relacin a la gluclisis: a.- Indica a que tipo de reacciones del metabolismo pertenece. Razona la respuesta b.- Indica en que compartimento celular se lleva a cabo el proceso (0,5 p.). c.- Menciona los productos iniciales y finales de la ruta (0,5 p.). d.- Indica qu molculas colaboran en esta ruta para captar los electrones (poder reductor) y la energa (0,5 p.). 47.- Con referencia al ciclo de Krebs o ciclo de los cidos tricarboxlicos de una clula eucariota: a.- Indica el compartimento celular donde tiene lugar y diga si se trata de una ruta anablica, catablica o anfiblica y cite el sustrato que se incorpora a dicho ciclo (0,5 p.). b.- Nombre dos rutas de las que puede proceder el acetil-CoA que se incorpora al ciclo (0,5 p.). c.- Nombre los coenzimas que participan en el ciclo recogiendo el poder reductor e indique si se obtienen oxidados o reducidos (0,5 p.). d.- Indique la finalidad del ciclo y diga si se trata de una va aerobia o anaerobia (0,5 p.). 48.- En relacin con el metabolismo celular: a.- Explique la finalidad (significado fisiolgico) del ciclo de Krebs e indique su localizacin a nivel de orgnulo (0,75 p.). b.- Explique la finalidad (significado fisiolgico) del ciclo de Calvin e indique su localizacin a nivel de orgnulo (0,75 p.). c.- Indique en qu tipo de clula animal y/o vegetal se producen los ciclos citados (0,5

49.- En relacin con el metabolismo celular: a.-Nombre la ruta metablica anaerbica por la que las clulas obtienen ATP a partir de la glucosa. Indique cul es el producto final de dicha ruta y el compartimento celular en el que transcurre (0,75 p.). b.- Nombre las etapas que seguir dicho producto final en una clula eucaritica en condiciones aerobias (0,75 p.). c.- Indique el destino que seguir dicho producto final en condiciones anaerobias. Nombre un organismo o una clula capaces de seguir este proceso (0,5 p.).

10

50.- El metabolismo es el conjunto de reacciones qumicas que se producen en los organismos vivos: a.- Diga de qu proceso se trata e indique cul de los participantes es el agente reductor en la siguiente reaccin (0,5 p.): Piruvato + NADH+ + H+ Lactato + NAD+ b.-Las levaduras llevan a cabo una reaccin en la que tambin interviene el piruvato. Proponga la ecuacin de la misma (0,75 p.). c.- Indique la ruta metablica de la que procede el piruvato, as como el precursor de la misma. Considera que se trata de una ruta anablica o catablica? Razone la respuesta (0,75 p.). 51.-El siguiente esquema representa procesos importantes en el metabolismo animal: a.- Diga como se denominan los compuestos indicados con los nmeros 1 y 2, as como los procesos con las letras A, B y C (1 p.). b.- En qu compartimentos celulares se desarrollan dichos procesos? (0,5 p.). c.- Aparte de los productos finales, en qu se diferencian los procesos B y C? (0,5 p.).
52.-En una clula muscular: a.- Indique (I) qu principio inmediato le proporciona energa para realizar la contraccin; (II) a travs de qu rutas metablicas se obtiene y (III) cmo se denomina el proceso (1p b.- Cuando el aporte de oxgeno al msculo es insuficiente y ste debe continuar la contraccin, indique: (I) qu ruta metablica utilizara?; (II) el producto final de dicha ruta y (III) la relacin que este tiene con la aparicin de las agujetas (1 p.). 53.- En el catabolismo de la glucosa (3 p.): a.- Seale la ruta metablica comn a los procesos de respiracin aerobia y fermentacin, el producto final de dicha ruta y su localizacin celular (0,75 p.). b.- Compare el rendimiento energtico de ambos procesos y explique por qu existe esa diferencia (0, 75 p.). c.- Seale un tipo de fermentacin, un microorganismo capaz de realizarla y el producto final (0,75 p.).

d.- Explique que le ocurre en la fermentacin al coenzima NADH+ + H+ obtenido en la gluclisis (0,75 p.). 54.-Los esquemas siguientes (A) y (B), estn relacionados con dos procesos catablicos que tienen lugar en los seres vivos: (A)GLUCOSA PIRUVATO LACTATO (B) GLUCOSA PIRUVATO Acetil-CoA

a.- A qu proceso corresponde cada esquema? (0,5 p.).


b.- Cite las etapas del proceso representado en el esquema (A) (0,5 p.).

11
c.- En el esquema (B) indique, a nivel subcelular, dnde se forma el Acetil-CoA, las etapas que sigue hasta finalizar el proceso metablico y la localizacin de cada una de ellas tambin a nivel subcelular (1 p.).

55.- El esquema siguiente est relacionado con procesos catablicos fundamentales en los seres vivos: GLUCOSA PIRUVATO + NADH+ + H+ + ATP a.- De qu proceso biolgico se trata? De qu tipo de clula es caracterstico, de la clula animal o vegetal? Indique su localizacin a nivel celular (0,75 p.).
b.- Explique el mecanismo de sntesis de ATP en el proceso mencionado en el apartado anterior (0,5 p.). c.- Indique los productos que se pueden originar a partir del piruvato (0,75 p.).

56.- Los cidos grasos se degradan por la va metablica conocida como la beta-oxidacin o
hlice de Lynen. a.- En qu compartimento celular tiene lugar esta va en clulas eucariotas? b.- Cul es el producto final de la degradacin de los cidos grasos? (0,5 p.). c.- A qu proceso metablico, orientado a la obtencin de energa, se incorpora este producto final (0,5 p.). d.- En qu compartimento celular tiene lugar este ltimo proceso metablico? (0,5 p.).

57.- Respecto del catabolismo de un triacilglicrido en clulas animales: a.- Indique las cuatro molculas que se obtienen de su hidrlisis y la localizacin celular del proceso (0,5 p.).
b.- Nombre la ruta metablica que permite la degradacin de las tres molculas similares obtenidas por hidrlisis y su localizacin a nivel celular a nivel de orgnulo (0,5 p.). c.- En la ruta metablica indicada en el apartado b cite qu productos se incorpora al ciclo de Krebs para continuar su degradacin y qu dos coenzimas reducidas se obtienen (0, 5 p.). d.- En dicho ciclo la sustancia se oxida por completo.Qu productos finales se obtienen y en qu compartimento subcelular ocurre esta va? (0,5 p.).

58.- En el laboratorio se est trabajando con plantas medicinales, utilizando hojas como material de estudio y en las que se observa una alarmante disminucin de clorofila: a.- Cite el proceso fisiolgico y anablico que se vera afectado de forma directa con la disminucin del citado pigmento, mencione las fases del mismo e indique los productos que se originan en cada una de ellas (0,75 p.). b.- Realice un esquema rotulado del orgnulo donde se realizan las fases aludidas en el aparato anterior y seale sus componentes ( 0,5p.). c.- Cmo podra afectar a nivel ecolgico la disminucin de clorofila? Y a nivel econmico? Razone las respuestas (0,75 p.). 59.- Con relacin a la fotosntesis: a.- A qu tipo de proceso metablico pertenece la fotosntesis? Razone la respuesta (0,5 p). b.- Cite las fases del ciclo de Calvin e indique su localizacin a nivel de orgnulo ( 0,5p.). c.- Indique la composicin y el papel que desempean los fotosistemas, sealando su localizacin a nivel de orgnulo (0,5 p.). d.- Indique el mecanismo de obtencin de ATP en tal proceso y su localizacin a nivel de orgnulo (0,5 p.).

12 60.- Con relacin a la fotosntesis: a.- Defina fotosntesis oxignica y fotosntesis anoxignica (0,5 p.). b.- Defina fotofosforilacin cclica y fotofosforilacin acclica en los vegetales (0,5 p). c.- Indique el nombre de la ruta metablica en la que ocurre la fijacin del carbono y el compartimento celular en que se lleva a cabo (0,5 p.). d.- Indique la reaccin global de la ruta referida en el apartado anterior (0,5 p.). 61.- Relacionado con el metabolismo de los seres auttrofos: a.- Indique dos procesos por los que los diferentes seres vivos pueden realizar un anabolismo auttrofo (0,5 p.).
b.- Nombre un organismo capaz de realizar cada uno de los procesos citados en el apartado anterior (0,5 p.). c.- Nombre las dos etapas que constituyen el anabolismo auttrofo de cualquiera de los organismos citados anteriormente (0,5 p.). d.- En una de las etapas ocurre el ciclo de Calvin: indique la molcula que se regenera en el ciclo, el coenzima reducido que se requiere y la molcula que aporta energa al ciclo (0,5 p.).

62.-El esquema adjunto representa un proceso esencial en la biosfera. a.- Identifique qu proceso se trata y cite el tipo de seres vivos que lo llevan a cabo (0,5 p.). b.-Indique la denominacin de las dos partes del proceso (sealadas como A y como B) y cite la localizacin subcelular donde se realizan (0,5 p.). c.- Considera que se trata de un proceso anablico o catablico? Razone la respuesta (0,5 p.). d.- En la parte B del proceso participa un enzima considerado el ms abundante del planeta. Indica de qu enzima se trata y escriba la reaccin que cataliza (0,5 p.). 63.- Las clulas eucariotas poseen diversos orgnulos: a.-Identifique el orgnulo cuyo esquema aparece en la figura adjunta, as como las distintas partes sealadas con nmeros (1p.). b.- Indique el tipo de organismos en los que se encuentra este orgnulo y exprese, mediante la ecuacin general del proceso, la funcin principal del mismo (0, 5 p.). c.- Indique los lugares concretos dentro del orgnulo en los que se llevan a cabo las distintas fases del proceso (0, 5 p.).

13

III) GENTICA MOLECULAR Y MENDELIANA


64.- El siguiente esquema muestra la secuencia de procesos conocida como el DOGMA CENTRAL DE LA BIOLOGA MOLECULAR:

a.- Indique y describa brevemente cada uno de los procesos biolgicos que se indican con las letras a, b, c y d en el esquema ( 1p.). b.- Cada uno de los elementos que se citan a continuacin actan en los procesos que ha indicado en la pregunta anterior. Haga una lista colocando cada elemento en el proceso que le corresponde: ARN polimerasa dependiente de ADN, ribosomas, ADN polimerasa, anticodn, transcriptasa inversa, promotor, aminocidos, ARNt y cebadores ( 1p.). 65.- En relacin con el material hereditario: a.- Indique semejanzas y diferencias en cuanto a la composicin qumica del ADN y ARN ( 1p.). b.- Defina el concepto de gen a nivel molecular e indique en que se diferencian los genes de procariotas y eucariotas (0,5 p.). c.- Defina los trminos de exn e intrn (0,5 p.). 66.- Relativo a la gentica mendeliana: a.- Defina monohbrido (0,5 p). b.- Defina cruzamiento prueba y describa , utilizando trminos genticos un ejemplo del mismo (0,5 p). c.- Usando trminos gnicos, indica las proporciones genotpicas y fenotpicas de los descendientes de un cruce entre dihbridos (heterocigoto para dos caracteres)(1 p.). 67.- En relacin con la determinacin gentica del sexo:

a.- Explique brevemente en que consiste la determinacin cromosmica del sexo (0,5 p.). b.- Explique el sistema de determinacin cromosmica del sexo en mamferos (0,5 p.). c.- Indique dos sistemas de determinacin cromosmica del sexo diferente al de mamferos. Poner un ejemplo (1p.)
68.- En relacin con las aportaciones de Mendel al estudio de la herencia: a.- Una pareja de personas de fenotipo no albino tienen un hijo albino. Explique el modo de herencia del albinismo e indique los genotipos de los padres y del hijo (1 p.). b.- Que proporcin de hijos no albinos se puede esperar en la descendencia? Razone la respuesta (0,5 p.). c.- Que proporcin de hijos albinos se puede esperar en la descendencia? Razone la respuesta (0,5 p.).

14
69.- Con relacin a las aportaciones de Mendel al estudio de la herencia, suponga que en la especie humana la herencia del color del pelo y de los ojos es sencilla y esta determinada por dos genes autosmicos con las siguientes relaciones: Color marrn de los ojos (A) dominante sobre el azul (a) y cabello oscuro (B) dominante sobre el cabello rubio (b). a.- Un hombre de ojos marrones y cabello oscuro se casa con una mujer de ojos azules y de cabello oscuro. Tienen dos hijos: uno de ojos marrones y pelo rubio y otro de ojos azules y pelo oscuro. Indique razonadamente los genotipos de los padres y de los hijos ( 1p.). b.- Si el hombre del apartado anterior de ojos marrones y cabello oscuro se casara con una mujer de ojos azules y pelo rubio, que genotipos y fenotipos podran tener los hijos de la pareja? ( 1p.). 70.- Con relacin a las aportaciones de Mendel al estudio de la herencia: El insomnio familiar fatal (IFF) es una enfermedad humana debida a una mutacin en un gen R situado en el cromosoma 20. La enfermedad muestra una herencia dominante. Un pareja, ambos con la enfermedad, tiene una hija que no la padece. a.- Indique los genotipos de todos los miembros de esta familia (0,5 p.). b.- Puede transmitir la enfermedad la hija sana? Razone la respuesta (0,5 p.). c.- Puede tener esta pareja otro hijo sano? Razone la respuesta (0,5 p.). d.- Puede tener esta pareja un hijo con la enfermedad? Razone la respuesta (0,5 p.). 71.- En los conejos, el pelo corto (A) es dominante sobre el pelo largo (a). Se llevan a cabo los siguientes cruzamientos que producen la siguiente progenie: Parentales Progenie a.Corto x Largo Cortos y Largos (0,5 p.). b.Corto x Corto Todos cortos (0,5 p.). c.Corto x Largo Todos cortos (0,5 p.). d.Largo x Largo Todos largos (0,5 p.). Nombre todos los genotipos posibles de los parentales de cada cruzamiento. Razone los resultados. 72.- En la mosca de la fruta (Drosophila melanogaster), existen individuos de cuerpo negro y otros que presentan cuerpo gris. a.- Se cruzan dos moscas grises y se obtiene una descendencia compuesta por 30 moscas grises y 10 negras. Indique los genotipos de los parentales, razonando la respuesta ( 1p.). b.- Entre las moscas grises de la descendencia del cruce anterior, como averiguara que individuos son homocigticos? Razone la respuesta (1 p.). 73.- Se cruzan dos cobayas homocigticos, uno de ellos tiene pelaje liso de color negro y el otro tiene pelaje rizado y color blanco. El rizado domina sobre el liso, mientras el blanco es recesivo. a.- Utilizando smbolos genticos para los caracteres definidos, indique los genotipos de ambos parentales (0,5 p.). b.- Indique el genotipo y el fenotipo que tienen los individuos de la F1 (0,5 p.). c.- Calcule las proporciones genotpicas y fenotpicas de la F2 (1 p.). 74.- En el guisante, el tallo largo (planta alta) es dominante sobre el tallo corto (planta enana). Si una planta de guisantes homocigtica para el carcter dominante se cruza con una planta enana: a.- Indicar los genotipos y fenotipos de los progenitores y de la F1 (0,5 p). b.- Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta de la F1 con el progenitor alto (0,5 p). c.- Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta de la F1 con el progenitor enano (0,5 p). d.- Indicar los genotipos, fenotipos y proporciones de la descendencia del cruzamiento de dos plantas heterocigticas (0,5 p).

15

75.- El pedigr de la figura muestra la herencia de la alcaptonuria, un trastorno bioqumico. Los individuos afectados, indicados en crculos y cuadrados negros, son incapaces de degradar el cido homogentsico, que da color negro a la orina y tie los tejidos corporales. (Los hombres se representan con un cuadrado y las mujeres con un crculo). a.- Indique si el alelo responsable de esa enfermedad es dominante o recesivo. Razone la respuesta (0,5 p.). b.- Copie el rbol genealgico en su hoja de examen e indique los posibles genotipos de todos los individuos (1,5 p.). Utilice las letras (A) y (a) para los alelos, 76.- Una vaca de pelo retinto (rojizo), cuyos padres son de pelo negro, se cruza con un toro de pelo negro, cuyos padres tienen pelo negro, uno de ellos, y pelo retinto el otro. a.- Cul es el genotipo de los animales que se cruzan? (1 p.). b.- Y el fenotipo de la descendencia? Razonar las dos respuestas (1 p.). 77.- Con relacin al proceso de replicacin del ADN: a.- Nombre las protenas y enzimas que intervienen en la etapa del desenrollamiento y apertura de la doble hlice y explique sus funciones (0,5 p.). b.- Explique dos diferencias en el proceso de replicacin del ADN en organismos procariticos y eucariticos (0,5 p.). c.- Explique de forma razonada cual es el significado de la replicacin semiconservativa y semidiscontnua del ADN (0,5p.). d.- Indique que es un cebador y que enzima es la encargada de su sntesis (0,5 p.). 78.- Con relacin a la expresin gnica: a.- Cita y define los procesos necesarios para la expresin de la informacin gentica (0,75 p.) b.- Indica la secuencia y la polaridad del ARNm que se transcribira utilizando como molde la secuencia inferior del siguiente ADN: 5ATCGAAGTT 3 3TAGCTTCAA 5 (0,5 p.) c.- Si la molcula de ARNm obtenido en la cuestin anterior, comienza a leerse por el primer nucletido del extremo 5 se obtienen tres tripletes o cdones distintos. Escriba para cada codon su anticodon correspondiente en el ARNt (0,75 p.). 79.- El esquema adjunto corresponde a un importante proceso biolgico relacionado con el ADN: a.- Qu proceso representa? En qu parte del ciclo celular se produce? (0,5 p.) b.- Qu finalidad tiene este proceso? (0,5 p.). c.- A y B son las cadenas de nueva sntesis. Indique la denominacin de cada una de ellas. Qu representa C y D? (0,5 p.). d.- Por qu tiene que producirse la estructura marcada como D? Cmo se uniran los fragmentos para dar lugar a B (0,5 p.). . 80.- Con relacin al proceso de replicacin del ADN:

16
a.- Cul es el significado biolgico (0,5 p.). b.- Si una cadena de un fragmento de ADN tiene la secuencia: 3`ATTGGCATAGC 5` Cul es la secuencia y polaridad de la otra cadena de la doble hlice (0,75 p.). c.- Cite las etapas que tienen lugar en el proceso de la replicacin del ADN (0,75p.). 81.- Referente a la expresin de la informacin hereditaria: a.- Defina el proceso de transcripcin e indique las etapas del mismo (0,5 p.) b.- Cite el nombre de la enzima implicada en este proceso. Como se denominan las secuencias de ADN donde se une este enzima para el comienzo de la transcripcin (0,5 p.). c.- Asocie a los procesos de transcripcin y traduccin los siguientes trminos: ARNm; ARNt; ARN polimerasa; ribosoma; codon;; aminocido; sitio P; anticodon; procesamiento o maduracin; sitio A; intrn (1p.). 82- En relacin con la expresin gnica: a.- Explica en que consiste el proceso de traduccin y cita en qu estructuras de la clula se realiza (0,5p). b.- Indica que papel desempea en este proceso los sitios P y A del ribosoma y la enzima aminoacil-ARNt-sintetasa (0,75p). c.- Indica cmo se denomina el triplete de bases que en el ARNm codifica para un aminocido especfico, como se denomina el triplete de bases complementarias en el ARNt e indica cul sera el triplete de bases del ARNt si su complementario para el aminocido valina en el ARNm es GUA (0,75p). 83.- Referente a la expresin gnica: a.- Realiza la replicacin del segmento de ADN 3 TACTTTAAACCCGGGCCCAAA 5 b.- Realiza su transcripcin. A qu molcula da lugar? (0,75p). c.- Realiza su traduccin empleando el cdigo gentico existente en el siguiente problema (0,75p). 84.- Referente al cdigo gentico y a partir de la siguiente secuencia de bases correspondiente a un fragmento de un gen: 5 TAT ATA CAA TTT 3 3 ATA TAT GTT AAA 5 a.- Indique cul ser la secuencia del ARNm correspondiente a la cadena inferior de este fragmento, indicando su polaridad (0,75p). b.- Ayudndose de la tabla del cdigo gentico escriba la secuencia de aminocidos del polipptido codificado por ese fragmento de gen, indicando los extremos amino y carboxilo (0,75p). c.- Explique por qu el cdigo gentico es degenerado (0,5p).

85.- Referente a la expresin en eucariotas:

17
a.- El esquema adjunto representa los procesos de transcripcin, procesamiento o maduracin y traduccin. Identifique los distintos elementos de la figura representados por letras (1,25 p.). b.- Explique qu es un exn e indique la funcin de los ARNt y de las enzimas AminoacilARNt sintetasas (0,75 p.). 86.- Teniendo en cuenta el cdigo gentico existente en la pregunta 84: a.- Defina cdigo gentico y cite cuatro caractersticas del mismo (1p.). b.- Para la sntesis del pptido Tyr-Leu-Met-Phe se han utilizado los siguientes ARNt: 3 UAC 5 ; 3 AAU 5 ; 3 AAA 5 y 3 AUA 5. Teniendo en cuenta el orden de la secuencia de los cuatro aminocidos anteriores, escriba la secuencia de nucletidos del ARNm cuya traduccin da lugar al pptido indicado y la secuencia de la cadena molde del ADN del gen correspondiente (1p.). 87.- En la imagen de la izquierda se representa un proceso importante. a.- Indique qu proceso representa este esquema e identifique todas las estructuras y las molculas que aparecen marcadas con las letras A,B,C,D,E,F y G en el dibujo (1p.). b.- Explique brevemente el proceso representado (fase del proceso general) (1p.).

88.- Considera el siguiente segmento de ADN perteneciente a un organismo procaritico:


...5ATTCGCGATGGG 3 ...3TAAGCGCTACCC 5 Si la cadena inferior es la cadena molde utilizada por la enzima ARN polimerasa... a.- Escribe la secuencia de nucletidos del ARN transcrito y marque sus extremos 5 y 3 b.- Qu papel desempeara este ARN transcrito en el proceso de traduccin? (0,5p.). c.- En qu compartimentos celulares se localizara el proceso de transcripcin y traduccin? Define los trminos de transcripcin y traduccin.(1p.). 89.- Con relacin a la etapa de iniciacin de la sntesis de una cadena polipeptdica (primera etapa de la traduccin): a.- Qu elementos constituyen el complejo de iniciacin? ( 1p.). b.- Qu elementos constituyen un ribosoma completo y funcional? ( 1p.) 90.- Referente a replicacin, expresin y mutacin a.- Explica como se mantiene y se transmite la informacin gentica en los seres vivos. Describe brevemente cada uno de los procesos implicados (1 p.) b.- Indica en qu direccin son sintetizadas siempre las nuevas cadenas de ADN y cita cmo se denomina a la hebra de ADN que se transcribe en ARN (0,5p). 91.- En relacin con la informacin gentica y sus alteraciones: a.- Si un polipptido tiene 450 aminocidos, indica cuntos ribonucletidos tendr el fragmento del ARN que codifica esos aminocidos. Razona la respuesta (0,5p). b.- 5GUU-UUC-GCA-UGG 3 son cuatro cdones de una molcula de ARNm. Indica cules sern los anticodones de las molculas de ARNt. (0,5p). c.- Dada la siguiente secuencia de ADN 3GGCAATATCCGA 5, Cul sera la secuencia de nucletidos de su ARNm y la polaridad de la secuencia A cuntos aminocidos dar lugar (1p.).

18