ADN  –  ARN  -­‐  PROTEÍNAS  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  

1  

Biotecnología  
El  uso  de  organismos  vivos  o  de  compuestos   obtenidos  de  organismos  vivos  para  obtener   productos  de  valor  para  el  hombre  
   No  es  ciencia.  

   Enfoque  multidisciplinario  que  involucra  varias  disciplinas  y  

ciencias:      

   Biología,  bioquímica,  genética,  virología,  agronomía,  

ingeniería,  química,  medicina,  veterinaria,  farmacia,   microbiología,  bacteriología,  etc.  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  

2  

Una  vieja  amiga!!!  
  Preparación  de  pan  (6000  años  –  Egipcios)     Preparación  de  bebidas  alcohólicas  
  Cerveza  (8000  años  –  Sumerios  y  Babilónicos)     Vino  

  Preparación  de  derivados  lácteos  (6000  años  –  

China)  

  Quesos     Yogurt  

  Compostaje     Inoculación  (1701)  y  vacunación  (1798)  para  prevenir  

viruela     Antibióticos  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  

3  

La  era  biotecnológica  
  1976  
  Robert  Swanson  y  Herbert  Boyer  fundan  la  

compañía  Genetic  Engineering  Tech,  Inc.   (Genentech,  Inc.).  

  1977  
  Producción  de  somatostatina  producida  en  una  

bacteria  

  1978  
  Producción  de  Insulina  en  una  bacteria  por  medio  

de  ADN  recombinante.  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  

4  

 Ph.D.   5   .  Alméciga  Díaz  QF.Biotecnología  en  salud   Algo  mas  que  insulina     Proteínas  recombinantes           Vacunas  contra  Hepatitis  B   Factores  de  crecimiento  =  Regeneración  celular   Hormona  de  crecimiento   Citoquinas  (inmunomodulares)     Interferones  y  Factor  de  Necrosis  Tumoral     Anticuerpos  monoclonales     Pruebas  diagnósticas  (ELISA)     Análisis  patológicos     Anticuerpos  anticancerígenos   Carlos  J.

 Alméciga  Díaz  QF.  Ph.Biotecnología  en  salud   Algo  mas  que  insulina     Animales  genéticamente  modificados     Células  madre     Transgénicos  =  producción  de  proteínas     Knock-­‐out  =  generación  de  modelos  de  enfermedad     Terapia  regenerativa     Transplantes  de  médula  ósea     Ingeniería  de  tejidos     Terapia  génica     Diagnóstico  genético     Mutaciones     Identificación  de  patógenos   Carlos  J.   6   .D.

 etc.   Carlos  J.      Enfoque  multidisciplinario  que  involucra  varias  disciplinas  y   ciencias:          Biología.  farmacia.  genética.Biotecnología   El  uso  de  organismos  vivos  o  de  compuestos  obtenidos   de  organismos  vivos  para  obtener  productos  de  valor   para  el  hombre      No  es  ciencia.  agronomía.  medicina.  virología.   bacteriología.  Alméciga  Díaz  QF.  bioquímica.  Ph.  microbiología.   química.   8   .  veterinaria.D.  ingeniería.

Biología  Molecular   “Estudio  de  los  procesos  que  se  desarrollan  en   los  seres  vivos  desde  un  punto  de  vista   molecular”   “El  estudio  de  la  estructura.D.  Ph.   9   .  función  y   composición  de  las  moléculas  biológicamente   importantes”     Carlos  J.  Alméciga  Díaz  QF.

 Ph.  Alméciga  Díaz  QF.   10   .D.Biología  Molecular     Estudio  de  interacciones  entre  los  diferentes   sistemas  de  la  célula     Proteínas     Carbohidratos     Lípidos     Ácidos  Nucleicos  (ADN  y  ARN)     Explicar  las  funciones  biológicas  del  ser  vivo   por  estas  propiedades  a  nivel  molecular   Carlos  J.

Nacimiento  Biología  Molecular     Gregor  Mendel     Leyes  de  la  herencia     Combinación   independiente     Principio  de  segregación     Uniformidad  (dominancia)     Friedrich  Miescher     Descubrimiento  del   ácido  nucléico     Material  ácido  con  alto   contenido  de  fosfatos   (nucleina)   13   .

 Ph.   14   .  Alméciga  Díaz  QF.Dogma  Central  (Crick  1961)   Carlos  J.D.

  15   .ADN  -­‐  Propiedades     Estable     Replicación     Capacidad  de  aceptar  alteraciones  (limitada)     Direccionalidad     Formado  por  cuatro  nucleótidos  presentes  en   todos  los  organismos   Carlos  J.D.  Alméciga  Díaz  QF.  Ph.

 Alméciga  Díaz  QF.  Ph.   16   .Composición  ADN     Polímero  de  nucleótidos   Enlace  fosfato-­‐azucar   involucradrados  en   estructura  del  ADN   Base  nitrogenada   involucrada  en  la   información   Carlos  J.D.

D.  Ph.Bases  nitrogenadas   Carlos  J.  Alméciga  Díaz  QF.   17   .

 Ph.   AGCTAGCTAGCT   Carlos  J.   18   .  Alméciga  Díaz  QF.El   ADN   (ARN)   se   escriben   y   leen   en   sentido  5’-­‐3’.D.

 Alméciga  Díaz  QF.     En  todos  los  organismos  el  número  de  A  =  T  y  el   de  G  =  C   Carlos  J.   19   .D.     La  composición  no  varia  con  la  edad.Moléculas  de  ADN  tienen   distintas  composiciones     La  composición  del  ADN  (relación  de  los  cuatro   nucleótidos)  varia  de  un  organismo  a  otro.     ADNs  aislados  de  diferentes  tejidos  de  un   mismo  organismo  tienen  la  misma   composición.  estado   nutricional  o  cambios  ambientales.  Ph.

 Ph.D.ADN  FORMADO  POR  DOS  HÉLICES   ANTIPARALELAS  COMPLEMENTARIAS   Carlos  J.   20   .  Alméciga  Díaz  QF.

 Alméciga  Díaz  QF.REPLICACIÓN  SEMICONSERVATIVA     Dos  copia  de  ADN  son  generadas  cada  una  con   una  copia  del  ADN  original  y  otra  del  nuevo.  Ph.D.       Bases  nitrogenadas  están  unidas  por  puentes  de   hidrógeno     Fácil  apertura  de  las  dos  hebras     Doble  hélice  se  abre  en  puntos  específicos     Replicación  se  lleva  a  cabo  en  las  dos  hebras.     Los  nucleótidos  son  adicionados  siguiendo   complementariedad  postulada  por  Watson  y   Crick   Carlos  J.   21   .

  •   Inicio  con  una  secuencia  digitalizada  que  luego   fue  transplantada  a  una  célula  de  Mycoplasma   capricolum  para  crear  una  nueva  Mycoplasma   mycoides.   Carlos  J.D.  Alméciga  Díaz  QF.•   Diseño.08  Mpb  de  Mycoplasma  mycoides.     Creation  of  a  Bacterial  Cell   Controlled  by  a  Chemically  Synthesized   Genome   •   Nueva  célula  controlodada  exclusivamente  por  el   genoma  sintético   •   Nueva  célula  tiene  el  fenotipo  esperado  y   capacidad  de  autoreplicación.  Ph.  síntesis  y  ensamblaje  de  un  genoma  de   1.   23   .

 Alméciga  Díaz  QF.ADN  se  hibridiza  por   complementariedad   Carlos  J.D.  Ph.   24   .

  25   .Organización  del  ADN   GENOMA   Gen   Cromosoma   Locus:  posición  específica  en  donde  se  ubica  un  gen  dentro  del  cromosoma   Alelos:  formas  diferenes  del  mismo  gen  (en  organismos  diploides)   Carlos  J.  Ph.D.  Alméciga  Díaz  QF.

 Ph.D.  Alméciga  Díaz  QF.GEN   Secuencia  de  ADN  que  codifica  para  un   producto  (polipéptido  o  ARN)  con  una  función   catalítica  o  estructural   •   Genes  Constitutivos  (housekeeping)   •   Genes  regulados   Carlos  J.   26   .

  27   .  Un  gran  número  de  genes  no  codifican  para   proteínas.     Sitios  de  terminación  de  transcripción   alternativos.     Algunos  genes  pueden  estar  sobrelapados   (muñeca  rusa).     Splicing  alternativo.  Alméciga  Díaz  QF.  Ph.   Carlos  J.     Un  mismo  gen  puede  codificar  diferentes   productos:     Sitios  de  inicio  de  transcripción  alternativos.D.

 Ph.Procariotes   Genes  policistrónicos   Carlos  J.D.   28   .  Alméciga  Díaz  QF.

D.   29   .Eucariotes   Carlos  J.  Alméciga  Díaz  QF.  Ph.

 Alméciga  Díaz  QF.  Ph.     ARN  de  transferencia     ARN  Ribosomal     Ribosimas  =  ARN  con  capacidad  catalítica     Reducido  tiempo  de  vida  media  (baja   estabilidad)   Carlos  J.   32   .     Funciones:     Intermediario  entre  información  del  ADN  y  la   secuencia  de  la  proteína  (ARNm).D.ARN  -­‐  Propiedades     Uracilo  por  timina.

D.     La  unión  con  el  ARNm  blanco  produce  su   degradación  lo  cual  evita  su  trandución.ARN  de  interferencia     Proceso  natural  por  el  cual  células  eucariotes   regulan  la  expresión  de  genes  mediante  la   union  de  siRNA  a  ARNm.  Ph.     Silenciamiento  exógeno:     Cancer  (oncogenes)     Infecciones  virales     Carlos  J.   33   .  Alméciga  Díaz  QF.

D.Transcripción     Síntesis  de  ARN  a  partir  de  un  molde  de  AND     ARN  polimerasas     Procariotes:  ARN  polimerasa     Eucariotes:     ARN  pol  I  (ARN  ribosomal)     ARN  pol  II  (ARN  mensajero)     ARN  pol  III  (ARN  transferencia)   Carlos  J.   34   .  Alméciga  Díaz  QF.  Ph.

 Ph.Carlos  J.D.   35   .  Alméciga  Díaz  QF.

 Ph.D.Procesamiento  ARNm   Carlos  J.  Alméciga  Díaz  QF.   36   .

  37   .PROTEÍNAS     Proceso  de  traducción     Polímero  de  aminoácidos     20  aminoácidos  son  los  constituyentes  de  las   proteínas     L-­‐α-­‐amino  ácidos   Carlos  J.D.  Alméciga  Díaz  QF.  Ph.

 Alméciga  Díaz  QF.   38   .Código  Genético  (1965)   Carlos  J.  Ph.D.

 Ph.Propiedades  aminoácidos     Poseen  carga  positiva.  Alméciga  Díaz  QF.   39   .D.  negativa  o  neutra     Punto  isoeléctrico     El  grupo  R-­‐  determina  las  propiedades  del  amino   ácido     Polar     Cargados     No  cargados     Hidrofóbicos   Carlos  J.

 Alméciga  Díaz  QF.  Ph.Carlos  J.   40   .D.

 Pauling  y  R.Enlace  peptídico   (L.  Alméciga  Díaz  QF.  Corey  1930)   Extremo          N-­‐ terminal   •   Perdida  de  una  carga  negativa  y  una  positiva   •   Carga  neta  de  la  proteína  es  determinada  por  los  grupos  R-­‐   •   Cargados  a  pH  fisiológico   •   Punto  isoeléctrico   Carlos  J.   Extremo            C-­‐ terminal   41   .D.  Ph.

  43   .  Ph.  Alméciga  Díaz  QF.D.Clasificación  proteínas                     Solubles   Citosólicas   De  membrana   Globulares   Fibrosas   Lipoproteínas   Glicoproteínas   Metaloproteínas   Enzimas   Carlos  J.

 Ph.Estructura  primaria   Secuencia  lineal  de  aminoácidos  codificados  por  la  secuencia   del  gen   Carlos  J.D.   44   .  Alméciga  Díaz  QF.

 Alméciga  Díaz  QF.D.Estructura  primaria   Como  sabemos  la  secuencia?     Degradación  de  Edman  (1950)   Carlos  J.   45   .  Ph.

Estructura  primaria   Como  sabemos  la  secuencia?     Usando  la  información  del  ADN   ATGTATATCAAACCATTCATCCTTCCTGCC   ATG-­‐TAT-­‐ATC-­‐AAA-­‐CCA-­‐TTC-­‐ATC-­‐CTT-­‐CCT-­‐GCC    Met    Tyr        Iso      Lys          Pro    Phe      Iso        Leu      Pro    Ala     Herramientas  computacionales     http://expasy.org/tools/dna.  Ph.   46   .D.  Alméciga  Díaz  QF.html     Carlos  J.

a.D.  Alméciga  Díaz  QF.  Ph.   47   .   Carlos  J.Estructura   secundaria   Plegamiento  de   pequeños  fragmentos   3-­‐30  a.

 Alméciga  Díaz  QF.  Ph.   48   .D.Estructura  terciaria   (Estructura  tridimensional)   Carlos  J.

 Alméciga  Díaz  QF.  Ph.Estructura  Cuaternaria   Carlos  J.   49   .D.

 Ph.D.  Alméciga  Díaz  QF.     Adición  de  grupos  funcionales           Acetato   Fosfato   Lípidos   Carbohidratos     Enlaces  disulfuro     Remoción  proteolítica  de  extremos  N-­‐  u  O-­‐ terminal   Carlos  J.Modificaciones  Post-­‐ transduccionales     Modificación  química  después  del  proceso  de   traducción.   50   .

 Ph.Enfermedades     Metabólicas:     Perdida  de  actividad  enzimática     Error  en  la  localización  intracelular     Cancer     Ganancia  de  actividad     Ausencia  de  proteían  reguladora     Enfermedad  de  Alzheimer     Alteraciones  en  el  plegamiento     Resistencia  a  antibióticos     Ganancia  de  función   Carlos  J.D.   51   .  Alméciga  Díaz  QF.

 Alméciga  Díaz  QF.  Ph.Carlos  J.   52   .D.