Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  


El  uso  de  organismos  vivos  o  de  compuestos   obtenidos  de  organismos  vivos  para  obtener   productos  de  valor  para  el  hombre  
   No  es  ciencia.  

   Enfoque  multidisciplinario  que  involucra  varias  disciplinas  y  


   Biología,  bioquímica,  genética,  virología,  agronomía,  

ingeniería,  química,  medicina,  veterinaria,  farmacia,   microbiología,  bacteriología,  etc.  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  


Una  vieja  amiga!!!  
  Preparación  de  pan  (6000  años  –  Egipcios)     Preparación  de  bebidas  alcohólicas  
  Cerveza  (8000  años  –  Sumerios  y  Babilónicos)     Vino  

  Preparación  de  derivados  lácteos  (6000  años  –  


  Quesos     Yogurt  

  Compostaje     Inoculación  (1701)  y  vacunación  (1798)  para  prevenir  

viruela     Antibióticos  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  


La  era  biotecnológica  
  1976  
  Robert  Swanson  y  Herbert  Boyer  fundan  la  

compañía  Genetic  Engineering  Tech,  Inc.   (Genentech,  Inc.).  

  1977  
  Producción  de  somatostatina  producida  en  una  


  1978  
  Producción  de  Insulina  en  una  bacteria  por  medio  

de  ADN  recombinante.  

Carlos  J.  Alméciga  Díaz  QF,  Ph.D.  


Biotecnología  en  salud   Algo  mas  que  insulina     Proteínas  recombinantes           Vacunas  contra  Hepatitis  B   Factores  de  crecimiento  =  Regeneración  celular   Hormona  de  crecimiento   Citoquinas  (inmunomodulares)     Interferones  y  Factor  de  Necrosis  Tumoral     Anticuerpos  monoclonales     Pruebas  diagnósticas  (ELISA)     Análisis  patológicos     Anticuerpos  anticancerígenos   Carlos  J.  Alméciga  Díaz  QF.   5   .D.  Ph.

  6   .D.  Ph.  Alméciga  Díaz  QF.Biotecnología  en  salud   Algo  mas  que  insulina     Animales  genéticamente  modificados     Células  madre     Transgénicos  =  producción  de  proteínas     Knock-­‐out  =  generación  de  modelos  de  enfermedad     Terapia  regenerativa     Transplantes  de  médula  ósea     Ingeniería  de  tejidos     Terapia  génica     Diagnóstico  genético     Mutaciones     Identificación  de  patógenos   Carlos  J.

  química.  Ph.  agronomía.  virología.  Alméciga  Díaz  QF.D.      Enfoque  multidisciplinario  que  involucra  varias  disciplinas  y   ciencias:          Biología.  ingeniería.  bioquímica.Biotecnología   El  uso  de  organismos  vivos  o  de  compuestos  obtenidos   de  organismos  vivos  para  obtener  productos  de  valor   para  el  hombre      No  es  ciencia.  microbiología.   Carlos  J.  farmacia.  genética.  etc.   8   .  veterinaria.   bacteriología.  medicina.

 Alméciga  Díaz  QF.  Ph.Biología  Molecular   “Estudio  de  los  procesos  que  se  desarrollan  en   los  seres  vivos  desde  un  punto  de  vista   molecular”   “El  estudio  de  la  estructura.   9   .  función  y   composición  de  las  moléculas  biológicamente   importantes”     Carlos  J.D.

Biología  Molecular     Estudio  de  interacciones  entre  los  diferentes   sistemas  de  la  célula     Proteínas     Carbohidratos     Lípidos     Ácidos  Nucleicos  (ADN  y  ARN)     Explicar  las  funciones  biológicas  del  ser  vivo   por  estas  propiedades  a  nivel  molecular   Carlos  J.D.   10   .  Ph.  Alméciga  Díaz  QF.

Nacimiento  Biología  Molecular     Gregor  Mendel     Leyes  de  la  herencia     Combinación   independiente     Principio  de  segregación     Uniformidad  (dominancia)     Friedrich  Miescher     Descubrimiento  del   ácido  nucléico     Material  ácido  con  alto   contenido  de  fosfatos   (nucleina)   13   .

 Alméciga  Díaz  QF.   14   .  Ph.Dogma  Central  (Crick  1961)   Carlos  J.D.

ADN  -­‐  Propiedades     Estable     Replicación     Capacidad  de  aceptar  alteraciones  (limitada)     Direccionalidad     Formado  por  cuatro  nucleótidos  presentes  en   todos  los  organismos   Carlos  J.   15   .  Ph.  Alméciga  Díaz  QF.D.

  16   .D.  Alméciga  Díaz  QF.  Ph.Composición  ADN     Polímero  de  nucleótidos   Enlace  fosfato-­‐azucar   involucradrados  en   estructura  del  ADN   Base  nitrogenada   involucrada  en  la   información   Carlos  J.

 Alméciga  Díaz  QF.  Ph.   17   .D.Bases  nitrogenadas   Carlos  J.

D.  Ph.   AGCTAGCTAGCT   Carlos  J.El   ADN   (ARN)   se   escriben   y   leen   en   sentido  5’-­‐3’.   18   .  Alméciga  Díaz  QF.

    La  composición  no  varia  con  la  edad.   19   .D.  estado   nutricional  o  cambios  ambientales.     En  todos  los  organismos  el  número  de  A  =  T  y  el   de  G  =  C   Carlos  J.     ADNs  aislados  de  diferentes  tejidos  de  un   mismo  organismo  tienen  la  misma   composición.Moléculas  de  ADN  tienen   distintas  composiciones     La  composición  del  ADN  (relación  de  los  cuatro   nucleótidos)  varia  de  un  organismo  a  otro.  Alméciga  Díaz  QF.  Ph.


 Alméciga  Díaz  QF.  Ph.       Bases  nitrogenadas  están  unidas  por  puentes  de   hidrógeno     Fácil  apertura  de  las  dos  hebras     Doble  hélice  se  abre  en  puntos  específicos     Replicación  se  lleva  a  cabo  en  las  dos  hebras.   21   .REPLICACIÓN  SEMICONSERVATIVA     Dos  copia  de  ADN  son  generadas  cada  una  con   una  copia  del  ADN  original  y  otra  del  nuevo.     Los  nucleótidos  son  adicionados  siguiendo   complementariedad  postulada  por  Watson  y   Crick   Carlos  J.D.

  •   Inicio  con  una  secuencia  digitalizada  que  luego   fue  transplantada  a  una  célula  de  Mycoplasma   capricolum  para  crear  una  nueva  Mycoplasma   mycoides.D.   Carlos  J.•   Diseño.     Creation  of  a  Bacterial  Cell   Controlled  by  a  Chemically  Synthesized   Genome   •   Nueva  célula  controlodada  exclusivamente  por  el   genoma  sintético   •   Nueva  célula  tiene  el  fenotipo  esperado  y   capacidad  de  autoreplicación.  síntesis  y  ensamblaje  de  un  genoma  de   1.08  Mpb  de  Mycoplasma  mycoides.  Ph.  Alméciga  Díaz  QF.   23   .

 Ph.   24   .ADN  se  hibridiza  por   complementariedad   Carlos  J.  Alméciga  Díaz  QF.D.

Organización  del  ADN   GENOMA   Gen   Cromosoma   Locus:  posición  específica  en  donde  se  ubica  un  gen  dentro  del  cromosoma   Alelos:  formas  diferenes  del  mismo  gen  (en  organismos  diploides)   Carlos  J.  Ph.  Alméciga  Díaz  QF.   25   .D.

 Alméciga  Díaz  QF.   26   .GEN   Secuencia  de  ADN  que  codifica  para  un   producto  (polipéptido  o  ARN)  con  una  función   catalítica  o  estructural   •   Genes  Constitutivos  (housekeeping)   •   Genes  regulados   Carlos  J.  Ph.D.

 Alméciga  Díaz  QF.     Sitios  de  terminación  de  transcripción   alternativos.     Algunos  genes  pueden  estar  sobrelapados   (muñeca  rusa).   27   .     Un  mismo  gen  puede  codificar  diferentes   productos:     Sitios  de  inicio  de  transcripción  alternativos.   Carlos  J.     Splicing  alternativo.  Un  gran  número  de  genes  no  codifican  para   proteínas.D.  Ph.

D.  Alméciga  Díaz  QF.  Ph.   28   .Procariotes   Genes  policistrónicos   Carlos  J.

  29   .  Alméciga  Díaz  QF.D.Eucariotes   Carlos  J.  Ph.

  32   .     ARN  de  transferencia     ARN  Ribosomal     Ribosimas  =  ARN  con  capacidad  catalítica     Reducido  tiempo  de  vida  media  (baja   estabilidad)   Carlos  J.ARN  -­‐  Propiedades     Uracilo  por  timina.D.  Alméciga  Díaz  QF.  Ph.     Funciones:     Intermediario  entre  información  del  ADN  y  la   secuencia  de  la  proteína  (ARNm).

D.     Silenciamiento  exógeno:     Cancer  (oncogenes)     Infecciones  virales     Carlos  J.   33   .  Alméciga  Díaz  QF.ARN  de  interferencia     Proceso  natural  por  el  cual  células  eucariotes   regulan  la  expresión  de  genes  mediante  la   union  de  siRNA  a  ARNm.     La  unión  con  el  ARNm  blanco  produce  su   degradación  lo  cual  evita  su  trandución.  Ph.

D.Transcripción     Síntesis  de  ARN  a  partir  de  un  molde  de  AND     ARN  polimerasas     Procariotes:  ARN  polimerasa     Eucariotes:     ARN  pol  I  (ARN  ribosomal)     ARN  pol  II  (ARN  mensajero)     ARN  pol  III  (ARN  transferencia)   Carlos  J.  Alméciga  Díaz  QF.  Ph.   34   .

Carlos  J.   35   .  Alméciga  Díaz  QF.D.  Ph.

Procesamiento  ARNm   Carlos  J.  Alméciga  Díaz  QF.  Ph.D.   36   .

PROTEÍNAS     Proceso  de  traducción     Polímero  de  aminoácidos     20  aminoácidos  son  los  constituyentes  de  las   proteínas     L-­‐α-­‐amino  ácidos   Carlos  J.  Ph.D.  Alméciga  Díaz  QF.   37   .

Código  Genético  (1965)   Carlos  J.   38   .D.  Alméciga  Díaz  QF.  Ph.

Propiedades  aminoácidos     Poseen  carga  positiva.  Ph.  Alméciga  Díaz  QF.   39   .D.  negativa  o  neutra     Punto  isoeléctrico     El  grupo  R-­‐  determina  las  propiedades  del  amino   ácido     Polar     Cargados     No  cargados     Hidrofóbicos   Carlos  J.

Carlos  J.   40   .D.  Alméciga  Díaz  QF.  Ph.

 Pauling  y  R.   Extremo            C-­‐ terminal   41   .  Alméciga  Díaz  QF.Enlace  peptídico   (L.D.  Ph.  Corey  1930)   Extremo          N-­‐ terminal   •   Perdida  de  una  carga  negativa  y  una  positiva   •   Carga  neta  de  la  proteína  es  determinada  por  los  grupos  R-­‐   •   Cargados  a  pH  fisiológico   •   Punto  isoeléctrico   Carlos  J.

Clasificación  proteínas                     Solubles   Citosólicas   De  membrana   Globulares   Fibrosas   Lipoproteínas   Glicoproteínas   Metaloproteínas   Enzimas   Carlos  J.   43   .  Ph.  Alméciga  Díaz  QF.D.

 Ph.D.  Alméciga  Díaz  QF.   44   .Estructura  primaria   Secuencia  lineal  de  aminoácidos  codificados  por  la  secuencia   del  gen   Carlos  J.

D.Estructura  primaria   Como  sabemos  la  secuencia?     Degradación  de  Edman  (1950)   Carlos  J.  Alméciga  Díaz  QF.  Ph.   45   .

org/tools/dna.  Ph.  Alméciga  Díaz  QF.Estructura  primaria   Como  sabemos  la  secuencia?     Usando  la  información  del  ADN   ATGTATATCAAACCATTCATCCTTCCTGCC   ATG-­‐TAT-­‐ATC-­‐AAA-­‐CCA-­‐TTC-­‐ATC-­‐CTT-­‐CCT-­‐GCC    Met    Tyr        Iso      Lys          Pro    Phe      Iso        Leu      Pro    Ala     Herramientas  computacionales     http://expasy.D.   46   .html     Carlos  J.

 Ph.  Alméciga  Díaz  QF.Estructura   secundaria   Plegamiento  de   pequeños  fragmentos   3-­‐30  a.   47   .a.D.   Carlos  J.

 Ph.D.  Alméciga  Díaz  QF.   48   .Estructura  terciaria   (Estructura  tridimensional)   Carlos  J.

  49   .Estructura  Cuaternaria   Carlos  J.  Alméciga  Díaz  QF.  Ph.D.

    Adición  de  grupos  funcionales           Acetato   Fosfato   Lípidos   Carbohidratos     Enlaces  disulfuro     Remoción  proteolítica  de  extremos  N-­‐  u  O-­‐ terminal   Carlos  J.  Alméciga  Díaz  QF.   50   .Modificaciones  Post-­‐ transduccionales     Modificación  química  después  del  proceso  de   traducción.  Ph.D.

D.   51   .  Ph.Enfermedades     Metabólicas:     Perdida  de  actividad  enzimática     Error  en  la  localización  intracelular     Cancer     Ganancia  de  actividad     Ausencia  de  proteían  reguladora     Enfermedad  de  Alzheimer     Alteraciones  en  el  plegamiento     Resistencia  a  antibióticos     Ganancia  de  función   Carlos  J.  Alméciga  Díaz  QF.

 Alméciga  Díaz  QF.   52   .D.Carlos  J.  Ph.

Sign up to vote on this title
UsefulNot useful