Doxorubicin induces senescence or apoptosis in rat neonatal cardiomyocytes by regulating the expression levels of the telomere binding factors

1 and 2
Am J Physiol Heart Circ Physiol 297:H2169-H2181, 2009. First published 2 October 2009; doi:10.1152/ajpheart.00068.2009 You might find this additional info useful... This article cites 62 articles, 35 of which can be accessed free at: http://ajpheart.physiology.org/content/297/6/H2169.full.html#ref-list-1 Updated information and services including high resolution figures, can be found at: http://ajpheart.physiology.org/content/297/6/H2169.full.html Additional material and information about AJP - Heart and Circulatory Physiology can be found at: http://www.the-aps.org/publications/ajpheart

Paolo Spallarossa, Paola Altieri, Concetta Aloi, Silvano Garibaldi, Chiara Barisione, Giorgio Ghigliotti, Giuseppina Fugazza, Antonio Barsotti and Claudio Brunelli

Downloaded from ajpheart.physiology.org on June 25, 2012

This information is current as of June 25, 2012.

AJP - Heart and Circulatory Physiology publishes original investigations on the physiology of the heart, blood vessels, and lymphatics, including experimental and theoretical studies of cardiovascular function at all levels of organization ranging from the intact animal to the cellular, subcellular, and molecular levels. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2009 by the American Physiological Society. ISSN: 0363-6135, ESSN: 1522-1539. Visit our website at http://www.the-aps.org/.

Am J Physiol Heart Circ Physiol 297: H2169H2181, 2009. First published October 2, 2009; doi:10.1152/ajpheart.00068.2009.

Doxorubicin induces senescence or apoptosis in rat neonatal cardiomyocytes by regulating the expression levels of the telomere binding factors 1 and 2
Paolo Spallarossa,1* Paola Altieri,1* Concetta Aloi,1 Silvano Garibaldi,1 Chiara Barisione,1 Giorgio Ghigliotti,1 Giuseppina Fugazza,2 Antonio Barsotti,1 and Claudio Brunelli1
Research Center of Cardiovascular Biology, Division of Cardiology, and 2Laboratory of Cytogenetics, Department of Internal Medicine, University of Genoa, Italy
Submitted 21 January 2009; accepted in nal form 28 September 2009
1

Spallarossa P, Altieri P, Aloi C, Garibaldi S, Barisione C, Ghigliotti G, Fugazza G, Barsotti A, Brunelli C. Doxorubicin induces senescence or apoptosis in rat neonatal cardiomyocytes by regulating the expression levels of the telomere binding factors 1 and 2. Am J Physiol Heart Circ Physiol 297: H2169 H2181, 2009. First published October 2, 2009; doi:10.1152/ajpheart.00068.2009.Low or high doses of doxorubicin induce either senescence or apoptosis, respectively, in cardiomyocytes. The mechanism by which different doses of doxorubicin may induce different stress-response cellular programs is not well understood. A recent study showed that the level of telomere dysfunction may induce senescence or apoptosis. We investigated the pathways to both apoptosis and senescence in neonatal rat cardiomyocytes and in H9c2 cells exposed to a single pulsed incubation with low or high doses of doxorubicin. High-dose doxorubicin strongly reduces TRF2 expression while enhancing TRF1 expression, and it determines early apoptosis. Low-dose doxorubicin induces downregulation of both TRF2 and TRF1, and it also increases the senescence-associated--galactosidase activity, downregulates the checkpoint kinase Chk2, induces chromosomal abnormalities, and alters the cell cycle. The involvement of TRF1 and TRF2 with apoptosis and senescence was assessed by short interfering RNA interference. The cells maintain telomere dysfunction and a senescent phenotype over time and undergo late death. The increase in the phase 4N and the presence of micronuclei and anaphase bridges indicate that cells die by mitotic catastrophe. p38 modulates TRF2 expression, whereas JNK and cytoplasmic p53 regulate TRF1. Pretreatment with specic inhibitors of MAPKs and p53 may either attenuate the damage induced by doxorubicin or shift the cellular response to stress from senescence to apoptosis. In conclusion, various doses of doxorubicin induce differential regulation of TRF1 and TRF2 through p53 and MAPK, which is responsible for inducing either early apoptosis or senescence and late death due to mitotic catastrophe. p53; mitogen-activated protein kinases; anthracyclines
THE CLINICAL USE OF ANTHRACYCLINES in anti-cancer treatment is limited by their adverse cardiotoxic effects, which include cardiomyopathy and heart failure (22). At high doses, cardiotoxicity often occurs within a few months, whereas low doses rarely cause deterioration of ventricular function in the rst year after therapy (58). However, there is now increasing evidence that, several years after therapy, one of three patients treated with low-dose anthracyclines develops hypokinetic cardiomyopathy (21). A number of mechanisms have been proposed to explain anthracycline cardiotoxicity. Although the most accredited hypothesis states that anthracyclines induce myocyte loss through oxidative stress and apoptotic cell death

* P. Spallarossa and P. Altieri contributed equally to this work. Address for reprint requests and other correspondence: P. Altieri, Research Center of Cardiovascular Biology, Division of Cardiology, Univ. of Genoa, Viale Benedetto XV, 6, 16132 Genoa, Italy (e-mail: paola.altieri@unige.it). http://www.ajpheart.org

(3, 48), there is controversy whether apoptosis contributes to late onset cardiotoxicity induced by low doses of doxorubicin (4). Maejima et al. (34) recently showed that when cultured neonatal rat cardiomyocytes are exposed to low concentrations of doxorubicin, the cells do not enter apoptotic program but exhibit a senescence-like phenotype. The hallmark of cellular senescence is the cell cycle arrest that is accompanied by important changes in many aspects of cell morphology (20, 38). Senescence is the result of changes in the expression of many proteins that regulates cell cycle, cytoskeletal function, and cellular architecture and causes impairment of cell functions, including the regenerative capacity (19, 30, 53, 57). Studies performed on tumor cells indicate that low doses of doxorubicin, as well as several anti-cancer agents, induce mitotic catastrophe, a phenomenon that is characterized by chromosomal abnormalities and abnormal mitosis that leads to late cell death. It also has been shown that cells that ultimately die of mitotic catastrophe initially show a senescence-like phenotype (18). Therefore, the induction of senescence has been proposed as a novel mechanism of cardiotoxicity induced by low doses of doxorubicin (34). A number of studies suggest that telomere dysfunction plays a main role in the stress-induced senescence program and in apoptosis (29). Telomeres are specialized, repetitive, noncoding sequences of DNA bound by several proteins, including telomere binding factors 1 and 2 (TRF1 and TRF2), which play a crucial role in telomere biology and govern chromosomal stability. The TRF1 multiprotein complex regulates telomere length and specically affects mitotic progression, whereas TRF2 is critical for maintaining the telomere t-loop endcapping structure, whose function is to prevent chromosome end-to-end fusion and chromosome abnormalities (50, 55). It is believed that telomeric dysfunction beyond a certain limit triggers a DNA damage response mediated by p53, a tumor suppressor protein, and by mitogen-activated protein kinases (MAPKs) (23, 47). MAPKs are highly conserved serine/threonine kinases that are activated in response to a wide variety of stimuli and play a role in numerous cell functions including survival, growth, and proliferation (54, 61, 62). Both p53 and MAPKs are involved in doxorubicin-induced cardiotoxicity (31, 49). The signal transduction pathways of doxorubicin-induced senescence and the mechanism by which different doses of the same stressing agent may induce either apoptosis or senescence and mitotic catastrophe are still poorly understood. In the present study we investigated the cellular response to stress that occurs in rat neonatal cardiomyocytes exposed to a pulsed incubation with apoptotic and subapoptotic concentrations of doxorubicin. Our results conrm that subapoptotic
H2169

Downloaded from ajpheart.physiology.org on June 25, 2012

0363-6135/09 $8.00 Copyright 2009 the American Physiological Society

H2170

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

doses of doxorubicin induce senescence, and, for the rst time, we have demonstrated the following: 1) cardiomyocytes with a senescence-like phenotype undergo late cardiac death by mitotic catastrophe; 2) various doses of doxorubicin induce a differential regulation of TRF1 and TRF2 that is associated with the induction of either apoptosis or senescence; 3) p53 and MAPK activation is not only downstream to telomere dysfunction, as suggested by previous literature, but is also a doxorubicin-induced signal that affects TRF1 and TRF2 expression; and 4) increases in p53 expression levels, as well as the cytoplasmic accumulation of p53, which are the result of low doses of doxorubicin, downregulate TRF1 and play an active role in inducing senescence, whereas the inhibition of p53 results in a transition of the cellular response to doxorubicin treatment from senescence to apoptosis.
MATERIALS AND METHODS

determine the levels of TRF2 (clone 4S794.15; Imgenex), TRF1 (C-19; Santa Cruz Biotechnology), p53 (clone C6A5; BioVision), -tubulin (B-7; Santa Cruz Biotechnology), actin (I-19; Santa Cruz Biotechnology), the phosphorylated MAPK p-p38 (D-8; Santa Cruz Biotechnology), p-ERK (E-4; Santa Cruz Biotechnology), and p-JNK (G-7; Santa Cruz Biotechnology). The quantity of protein was normalized for GAPDH (0411; Santa Cruz Biotechnology). Senescence-Associated -Galactosidase Activity Cells were stained for -galactosidase activity as described by Dimri et al. (16). The number of senescence-associated -galactosidase staining (SA--gal)-positive cells was determined in 100 randomly chosen low-power elds (100) and expressed as a percentage of all counted cells (35). Annexin V-FITC/Propidium Iodide Staining Cells were labeled with annexin V-FITC and propidium iodide (A/PI), and 100 randomly selected elds were counted using a uorescence microscope (48). The number of stained cells was normalized to the total number of cells as counted by phase-contrast microscopy of the same eld. Images from independent elds were captured and processed using MetaMorph software (Universal Imaging, Downingtown, PA). Trypan Blue Exclusion Trypan blue exclusion was used to determine the viability of cardiomyocytes. After treatments as described above, cells were trypsinized and incubated with 0.4% trypan blue dye for 2 min and observed with the use of a hemocytometer under a light microscope. Cells that were able to exclude the stain were considered viable, and the percentage of non-blue cells over total cell number was used as an index of viability. Cell Immunouorescence TRF1, TRF2, and p53 expression were all documented by immunouorescence as described by Verzola et al. (56). Cardiomyocytes were grown on chamber slides to subconuence and incubated for 3 h in the presence or absence of doxorubicin in cells that had been pretreated with or without MAPK inhibitors, after which they were analyzed. Subsequently, the cells were washed with cold PBS and xed in 2% paraformaldehyde for 10 min. After an overnight incubation with anti-TRF1, anti-TRF2, or anti-p53 antibodies at 4C, cells were washed extensively with PBS and exposed to biotinylated conjugated secondary antibody (Vector) for 30 min. After being washed, cells were incubated with FITC-streptavidin (Sigma) for 30 min. Slides were observed under a uorescence microscope. Images from independent elds were captured and processed using the MetaMorph software. Flow Cytometric Analysis Nuclear DNA content. Trypsinized and oating cells were pooled, washed twice with PBS, and resuspended in 400 l of hypotonic

All materials, unless otherwise indicated, were supplied by SigmaAldrich (Poole, UK). Cell and Culture Conditions Ventricular myocytes from 2-day-old Sprague-Dawley rats were purchased (Lonza) and cultured as described (2). H9c2 rat heart-derived embryonic myocytes (American Type Culture Collection) were cultured as previously described (49). Cells were always used at 70% of conuence. Cells were preincubated for 1 h with or without the ERK1/2 pathway inhibitor PD-98059 (50 M; Calbiochem), the JNK inhibitor SP-600125 (20 M), or the p38 MAPK inhibitor SB-203580 (3 M), and with the p53 inhibitor pithrin- (PFT; 5 M) (31). They were then incubated with or without different doses of doxorubicin for 3 h (14) and analyzed at the time indicated for each experiment. To evaluate MAPK phosphorylation, we incubated cells with various doses of doxorubicin for 20 min. Since both PFT and the MAPK inhibitors were dissolved in 0.1% dimethyl sulfoxide, an equivalent amount of vehicle was added to both the control and the drug-treated samples when the experiments were performed with these inhibitors. Reverse Transcriptase-Polymerase Chain Reaction Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed using the previously described procedure (49). The quantity of mRNA was normalized for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Amplication of the cDNA by PCR was performed using the primers shown in Table 1. The PCR products were quantied by a gel documentation system with analysis software (Syngene). Immunoblotting Immunoblotting was performed using the previously described procedure (49). After various treatments, cells were processed to

Downloaded from ajpheart.physiology.org on June 25, 2012

Table 1. PCR primer sequences, PCR product size, and GenBank accession number
Primers PCR Primer Sequences, 5-3 Forward and Reverse PCR Product Size, bp GenBank Accession No.

GAPDH TRF1 TRF2 Bax Bcl-2

GAGGGGCCATCCACAGTCTT TTCATTGACCTCAACTACAT ATCTGGTGTCTCCCTTACGG GTGCAGTGATGTCCGACAAC GGACAGCGAGACACTAAAGGC CTGGATGACAATGTCTGCTTC CCAAGAAGCTGAGCGAGTGTCTC AGTTGCCGTCTGCAAACATGTCA AGCTGCACCTGACGCCCTT CAGCCAGGAGAAATCAAACAGAGG

506 154 250 146 308

XM_221254 RNU65656 NM_031055 NM_017059 NM_016993

TRF1 and TFR2, telomere binding factors 1 and 2. AJP-Heart Circ Physiol VOL
297 DECEMBER 2009

www.ajpheart.org

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

H2171

solution labeled with PI [5 g/ml PI, 0.1% (wt/vol) Na-citrate, and 0.1% Triton X-100 in sterile water]. Cells were incubated on ice for 30 min until DNA content analysis. PI labeling. Trypsinized and oating cells were pooled, washed twice with PBS, and suspended in PI solution. All test cells were monitored by uorescence-activated cell sorting (FACS; BectonDickinson), and data were analyzed using CellQuest software (Becton Dickinson). Chromosome Analysis Twenty-four hours after treatment with doxorubicin, cells were exposed to colcemid (0.04 g/ml) for 90 min at 37C and to hypotonic treatment (0.075 M KCl) for 15 min at room temperature. Cells were xed in a methanol and acetic acid (3:1 by volume) mixture for 15 min and then washed three times in the xative. The slides were air-dried and stained with Giemsa for analysis (37). F-Actin Detection Cardiomyocytes growing on slides were xed, permeabilized, and labeled simultaneously in PBS containing 50 g/ml lysopalmitoylphospatidylcholine, 3.7% formaldehyde, and 5 U/ml uorescent phallotoxin (A-12379 Alexa488 phalloidin; Molecular Probes). Cells were rapidly washed three times with PBS and viewed by uorescent microscopy. To quantify the uorescence and to measure cells area, we performed image analysis using the Leica Q500 MC image analysis system (Leica, Cambridge, UK). Three hundred cells were randomly analyzed for each sample, and the optical density of the signals was quantitated by a computer. The video image was generated by a charge-coupled device camera connected through a frame grabber to a computer. Single images were digitized for image analysis at 256 gray levels. Imported data were quantitatively analyzed using Q500MC Software-Qwin (Leica). The single cells were

randomly selected by the operators by using the cursor, and then positive areas were automatically estimated. Constant optical threshold and lter combination were used. TRF1 and TRF2 siRNA Transfection ON-TARGETplus SMARTpool short interfering RNAs (siRNA), for silencing the expression of target genes TRF1 and TRF2, and ON-TARGETplus Non-targeting Pool as a control were purchased from Dharmacon. All transfections were carried out using the manufacturers protocol with DharmaFECT1 transfection reagent (Dharmacon). Briey, cardiomyocytes were trypsinized, counted, and plated at a density of 104 cells/cm2. After 24 h, cells were transfected with 10, 50, or 100 nM of SMARTpool siRNA or control siRNA using DharmaFECT1 reagent and analyzed after 24, 48, or 72 h with A/PI staining, SA--gal activity, and Western blot analysis. Statistical Analysis Data are means SE of four independent experiments. Statistical analysis was performed by one-way ANOVA followed by the Bonferroni post hoc test and Wilcoxon signed rank test when appropriate.
RESULTS

Downloaded from ajpheart.physiology.org on June 25, 2012

Low and High Doses of Doxorubicin Have Different Effects on Plasma Membrane Integrity and Bax-/Bcl-2 Protein Ratio Twenty-four and forty-eight hours after having been exposed to doxorubicin for 3 h, A/PI double staining revealed the typical pattern of early-stage apoptosis [A()/PI(-)] and late-stage apoptosis [A()/PI()] only in cells that had been exposed to 1 M doxorubicin (Fig. 1, A and B). After

Fig. 1. Low-dose doxorubicin induces nonapoptotic cardiac damage. A: representative photographs of annexin-V (A)/ propidium iodide (PI) staining of neonatal rat cardiomyocytes treated with 2 different doses (0.1 or 1 M) of doxorubicin. ct, Control. B: percentage of A and/or PI-positive () cells at the indicated doses and time points (magnication, 200). C: mRNA Bax and Bcl-2 expression 6 h after treatment with 0.1 or 1 M doxorubicin. Histograms illustrate the mRNA Bax/Bcl-2 expression ratio. *P 0.05 vs. ct.

AJP-Heart Circ Physiol VOL

297 DECEMBER 2009

www.ajpheart.org

H2172

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

treatment with 0.1 M doxorubicin, we observed that the percentage of A() cells was lower, and that 86% of the A() cells were PI() at 24 h, suggesting that the integrity of the plasma membrane was precociously lost. As a further apoptosis index, we measured the Bax-Bcl-2 ratio, which increased threefold after treatment with 1 M doxorubicin, whereas it remained unchanged in cells treated with 0.1 M doxorubicin (Fig. 1C). Enhancement of the ratio indicates that cells underwent apoptosis. Thus these results suggest that 0.1 M doxorubicin induces nonapoptotic cardiac damage.

Low Doses of Doxorubicin Induce Abnormal Mitosis Associated With a Senescent-Like Phenotype and Alterations of Cytoskeletal Protein Levels Senescent cells can be identied by the expression of enzymatic SA--gal activity at pH 6.0 and by an enlarged, attened phenotype (16). Forty-eight hours after having been exposed to doxorubicin for 3 h, SA--gal activity expression was 34, 20, and 8% in cells treated with 0.1, 0.05, and 0.01 M doxorubicin, respectively, whereas it remained unchanged in cells treated with higher doses (Fig. 2A). Cells treated with 0.1 M

Downloaded from ajpheart.physiology.org on June 25, 2012

Fig. 2. A: quantitation of senescence-associated -galactosidase (SA--gal) activity in cardiomyocytes treated with different doses of doxorubicin (left). *P 0.05 vs. ct. Representative images are shown at right (magnication, 200). B: representative images showing the morphological changes and SA--gal activity in cardiomyocytes treated with 0.1 and 1 M doxorubicin. Cells were counterstained with Giemsa solution (magnication, 400). C: representative image showing anaphase bridges in cardiomyocytes treated with 0.1 M doxorubicin and stained with 4,6-diamidino-2-phenylindole (magnication, 1,000). D: bar graph showing cell viability determined by trypan blue exclusion analysis after exposure to 0.1, 1, and 10 M doxorubicin. ^P 0.05 vs. day 0. P 0.05 vs. day 1. P 0.05 vs. day 2. #P 0.05 vs. day 3. E: representative images showing phalloidin staining for F-actin laments in cardiomyocytes treated with 0.1 and 1 M doxorubicin (magnication, 1,000). Bar graphs show changes in F-actin density and cell size in cardiomyocytes treated with 0.1 or 1 M doxorubicin. *P 0.05 vs. ct. F: Western blot analysis showing the levels of actin and -tubulin in cells incubated with 0.1 M doxorubicin. *P 0.05 vs. ct.

AJP-Heart Circ Physiol VOL

297 DECEMBER 2009

www.ajpheart.org

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

H2173

doxorubicin showed enlarged volume, attened morphology, and the appearance of vacuolated cells (Fig. 2B). Some cells also contained several nuclei of unequal size, including micronuclei (Fig. 2B), whereas nuclei staining documented the presence of anaphase bridges (Fig. 2C). Cells treated with 1 M doxorubicin exhibited condensed nuclei, which are characteristic of apoptotic cells, (Fig. 2B). Cell viability, determined by trypan blue exclusion analysis, was maintained for the rst 4 days after exposure to 0.1 M doxorubicin, whereas it decreased in a dose-dependent manner after exposure to 1 and 10 M doxorubicin (Fig. 2D). We then examined how pulsed incubation with doxorubicin affects cytoskeletal remodeling. Phalloidin staining showed that at a dose of 0.1 M, doxorubicin increased cell size and both the length and density of the cytoplasmic actin bers, whereas at a dose of 1 M, it led to the disruption of the actin bers (Fig. 2E). Western blot analysis showed a 300% increase in actin levels and a 50% reduction in -tubulin levels in cells incubated with 0.1 M doxorubicin (Fig. 2F). Flow cytometric analysis was used to assess changes in DNA content. At 48 h, cells treated with 1 M doxorubicin demonstrated an increase in the sub-G1 phase and a decrease in the G2/M phase, whereas cells treated with 0.1 M doxorubicin showed an increase in the S phase and in the hyperploid (4N DNA) cell population (Fig. 3A). In 0.1 M doxorubicin-treated cells, we also observed both a downregulation of the expression of the DNA damage-induced checkpoint kinase Chk2, which normally prevents the induction of mitosis, and polyploid metaphases with several chromosomal abnormalities, including dicentric chromosome, end-to-end fusion, and ring and string conguration (Fig. 3, B and C). These ndings indicate the presence of mitotic catastrophe.

Doxorubicin Regulates Expression of TRF1 and TRF2 Doxorubicin at 0.1 M decreased protein and mRNA levels of TRF1 and TRF2, whereas at 1 M, it reduced TRF2 and enhanced TRF1 expression (Fig. 4, A and B). These results were conrmed by uorescence analysis (Fig. 4C). To analyze the inuence of TRF1 and TRF2 levels on cellular response, we selectively silenced TRF1 or TRF2 using the siRNA transfection technique. By performing transfection with various doses of siRNA targeting TRF2, we obtained a dose-dependent downregulation of the TRF2 protein levels (Fig. 5A). The 10 nM siRNA induced 18% knockdown of TRF2 protein that was associated with senescent morphology changes, including SA--gal positivity, marked increase in cell size, attened morphology, and early PI positivity, whereas the 100 nM siRNA induced a 55% knockdown of the TRF2 protein that was associated with apoptosis. siRNA at a dose of 50 nM produced a 35% knockdown of TRF2 protein that was associated with the presence of both senescent and apoptotic cells (Fig. 5C), which is likely the result of the various levels of TRF2 silencing in each cell. By performing transfection with 100 nM siRNA targeting TRF1, we obtained a 60% knockdown of the TRF1 protein (Fig. 5B). As shown in Fig. 5C, the transfection with siRNA targeting TRF1 did not alter the cells. Doxorubicin Regulates TRF1 and TRF2 Expression Through MAPK- and p53-Mediated Pathways We observed that 0.1, 1, and 10 M doxorubicin induced dose-dependent phosphorylation of p38 and JNK, whereas ERK 1/2 was only activated by 10 M doxorubicin. We found no changes in total MAPK protein levels (Fig. 6A). Using specic inhibitors, we analyzed the role played by p38, JNK, and p53 in mediating the effect of doxorubicin on TRF1 and TRF2 expres-

Downloaded from ajpheart.physiology.org on June 25, 2012

Fig. 3. A: changes in DNA content following treatment with 0.1 or 1 M doxorubicin. Cells were cultured for 24 h after treatment, followed by ethanol permeabilization and PI staining for cell cycle analysis. B: mRNA checkpoint kinase Chk2 expression evaluated 6 h after doxorubicin treatment. *P 0.05 vs. ct. P 0.05 vs. 1 M doxorubicin. C: metaphase spread in cardiomyocytes analyzed 24 h after treatment with 0.1 M doxorubicin. Giemsa staining shows chromosomal abnormalities and endoreduplications (magnication, 1,000).

AJP-Heart Circ Physiol VOL

297 DECEMBER 2009

www.ajpheart.org

H2174

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

Fig. 4. Dose-dependent effects of doxorubicin on the expression of telomere binding factors 1 and 2 (TRF1 and TRF2) as analyzed by Western blot (A), RT-PCR (B), and immunouorescence (C; magnication, 200). Immunouorescence and Western blot analysis were performed 24 h after treatment; RT-PCR analysis was performed 6 h after treatment. *P 0.05 vs. ct.

Downloaded from ajpheart.physiology.org on June 25, 2012

sion (Fig. 6B). Pretreatment with the p38 inhibitor SB-203580 attenuated the downregulation of TRF2 induced by both 0.1 and 1 M doxorubicin but did not modify the effects of doxorubicin on the TRF1 expression. Conversely, pretreatment with the JNK inhibitor SP-600125 did not inuence the effects of doxorubicin on the expression of TRF2 but blunted both the 1 M doxorubicin-induced TRF1 upregulation and the 0.1 M doxorubicininduced TRF1 downregulation. Pretreatment with the p53 inhibitor PFT did not inuence the effects of doxorubicin on the expression of TRF2 but did modulate the effects on TRF1 expression. PFT abolished the downregulation of TRF1 in cells incubated with 0.1 M doxorubicin and increased the TRF1 upregulation in cells incubated with 1 M doxorubicin. We then analyzed whether pretreatment with these inhibitors inuenced the effects of doxorubicin on the number of SA-gal and A() cells (Fig. 6, C and D). We observed that in cells exposed to 1 M doxorubicin, pretreatment with SB-203580 drastically reduced the number of A() cells, specically the number of cells in late apoptosis characterized by A()/PI() double positivity, whereas pretreatment with SP-600125 or PFT did not produce any effects. When we used 0.1 M doxorubicin, we found that pretreatment with SB-203580, SP-600125, and PFT reduced the number of SA--gal cells from 34% to 7, 18, and 16% respectively. Pretreatment with SB-203580 decreased the number of A()/PI() cells, whereas pretreatment with SP-600125 and PFT not only increased the number of damaged cells but also induced the appearance of the A()/PI() cell population. These results indicate that when doxorubicin is used at subapoptotic doses,
AJP-Heart Circ Physiol VOL

pretreatment with SP-600125 or PFT switches the cell response to the stress from senescence to apoptosis. Since pretreatment with PFT and SP-600125 on cells treated with 0.1 M doxorubicin produced similar effects on TRF1 expression, such as senescence-like phenotype and A()/PI() staining, this prompted us to investigate the relationship between p53 and JNK. We observed that the 0.1 M doxorubicin-induced expression of p53 is JNK dependent (Fig. 7A). Fluorescence microscopy conrmed these results and showed that p53 accumulation occurs in the cytoplasm and not in the nucleus, where it is considered a marker of p53-mediated apoptosis (Fig. 7B). This result further conrms that the 0.1 M doxorubicin dose is not apoptotic. Together, these data prove that TRF1 and TRF2 are at the center of the pathways that lead to senescence or apoptosis in response to doxorubicin. Figure 8 shows the putative signaling pathways involved in doxorubicin-induced senescence or apoptosis. Effects of a Single Pulsed Incubation With Low-Dose Doxorubicin Are Still Detectable 21 Days Later Neonatal rat cardiomyocytes cannot be cultured at length; therefore, in an attempt to examine the long-term effects (21 days) of a 3-h pulsed exposure to low-dose doxorubicin, we used H9c2 cardiomyocytes. We repeated all the experiments described in the previous paragraphs and obtained the same results that we had found with neonatal rat cardiomyocytes. FACS analysis showed that the percentage of PI() cell population increased from 8 to 58% at day 6 and decreased to 53% at day 15 and to 24% at day
www.ajpheart.org

297 DECEMBER 2009

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

H2175

Downloaded from ajpheart.physiology.org on June 25, 2012

Fig. 5. Effects of silencing of the TRF1 and TRF2 genes using specic short interfering RNAs (siRNAs). Cardiomyocytes were transfected with 100, 50, and 10 nM siRNA-targeting TRF2 or with 100 nM siRNA-targeting TRF1. Western blot analysis at 72 h of TRF2 (A) and TRF1 (B) expression levels was performed. Cells not transfected (No Trfx) were used as the endogenous control for transfection. C: representative images showing, from left to right, SA--gal activity (magnication, 200), SA--gal activity/counterstaining with Giemsa (magnication, 400), and A/PI staining (magnication, 200) in cells analyzed after 48 h of treatment. Bar graphs show percentage of SA--gal-positive cells (D) and percentage of A/PI-positive cells (E). *P 0.05 vs. ct.

21, a percentage that was three times the basal value (Fig. 9A). Both cell size (Fig. 9, A and B) and the percentage of SA--galpositive cells (Fig. 9C) increased following doxorubicin treatment and peaked at day 6, still remaining above the basal values at day 21. TRF1 and TRF2 protein expression remarkably decreased at day 6 and was still lower than the basal value at day 21 (Fig. 9D). No signicant differences were observed in cells incubated without doxorubicin. These experiments show that brief exposure to low-dose doxorubicin induces cell damage that lasts over time.
AJP-Heart Circ Physiol VOL

DISCUSSION

Different Doses of Doxorubicin Induce Senescence or Apoptosis Through Different Modulation of TRF1 and TRF2 Expression Levels This study, which investigated the physiological bases of doxorubicin-induced senescence, was conceived moving from two lines of evidence. The rst arises from the study by Eom et al. (18), who found that chronic exposure of hepatoma cells
www.ajpheart.org

297 DECEMBER 2009

H2176

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

Fig. 6. A: effects of exposure to various doses of doxorubicin on MAPKs. Total cell lysates were analyzed after 20 min of exposure to doxorubicin by Western blotting (top), using antibodies specic for phosphorylated (Ph) and total forms of MAPK. Bar graph (bottom) shows values for ph-MAPK normalized to the amount of total enzyme and expressed as the relative increase above control value, which was set at 100. BD: effects of the p38 MAPK inhibitor SB-203580 (SB), the JNK inhibitor SP-600125 (SP), and the p53 inhibitor pithrin- (PFT) on TRF1 and TRF2 protein expression levels (B), the percentage of SA--gal active positive cells (C), and the percentage of A/PI-positive cells (D). Dox, doxorubicin. Western blot analysis was performed 24 h after treatment; SA--gal activity and A/PI staining were assessed 48 h after treatment. *P 0.05 vs. ct. P 0.05 vs. 0.1 M doxorubicin. P 0.05 vs. 1 M doxorubicin. #P 0.05 vs. SB.

Downloaded from ajpheart.physiology.org on June 25, 2012

to high doses of doxorubicin induced apoptosis, whereas lower doses induced senescence and late death by mitotic catastrophe, and from the study by Maejima et al. (34), who were the rst to demonstrate that low doses of doxorubicin induced senescence in neonatal cardiomyocytes. The second line of evidence is represented by the study of Lechel et al. (29), who demonstrated that low and high levels of TRF2 inhibition are respectively associated with senescence and apoptosis. The

data of the present study indicate that different doses of doxorubicin affect the expression of the telomeric binding proteins TRF1 and TRF2 differently and that these, in turn, decide the type of response to the stress, i.e., senescence or apoptosis. Our data also show that TRF2 plays a prominent role in deciding the type of cellular response. Using the siRNA technique, we have conrmed that high levels of TRF2 downregulation induce apoptosis and low levels of TRF2 downregu-

Fig. 7. Effects of 0.1 M doxorubicin on p53 protein expression levels evaluated by Western blot analysis (A) and immunouorescence (B) after pretreatment with or without SB or SP. Analyses were performed 24 h after treatment. *P 0.05 vs. ct. P 0.05 vs. 0.1 M doxorubicin.

AJP-Heart Circ Physiol VOL

297 DECEMBER 2009

www.ajpheart.org

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

H2177

Fig. 8. Proposed signaling pathways involved in apoptosis and senescence induced by doxorubicin in cardiac myocytes.

lation induce senescence, and we also found that the selective knockdown of TRF1 induces neither senescence nor apoptosis. These results are in agreement with a number of studies nding that a dominant negative allele of human TRF1 does not affect the growth and viability of a variety of primary and transformed human cells (12, 25, 26, 55). We documented that if doxorubicin induces high levels of TRF2 downregulation, apoptosis occurs regardless of the level of TRF1 expression. Conversely, if the stress induces a moderate level of TRF2 downregulation, as it does with 0.1 M doxorubicin, TRF1 is crucial for deciding cell response. A consensual reduction of TRF1 expression induces senescence; otherwise, apoptosis occurs. This nding is in line with previous studies demonstrating that in particular cellular conditions, TRF1 can affect cell cycle progression and is an important signal for cell survival. Lu et al. (33) observed that TRF1 inhibition suppresses the ability of the mitotic kinase NIMA to induce premature mitotic entry and apoptosis. Kishi et al. (27) found that TRF1 overexpression can induce apoptosis in cells with short telomeres but not in those containing long telomeres. The similarity between our and Kishis data may be better appreciated by keeping in mind that short telomeres and TRF2 downregulation have similar effects on cell biology (24). Doxorubicin-induced senescent cardiomyocytes show morphologically attened and enlarged cell shapes associated with cytoskeleton remodeling that is characterized by a signicant increase in the level of actin protein with clearly visible polymerized F-actin laments crossing the whole cell and by a decrease in tubulin levels. Cytoskeletal components are key regulators of cellular architecture. Functionally, the enhanced actin bers may construct a frame structure that is needed to support the enlarged cells (1, 9). Cytoskeletal components also are involved in cellular processes such as cell differentiation and cell cycle regulation and are essential mediators of the cell signaling pathways that regulate senescence (38, 39). The reduction of -tubulin levels in senescent cells has been viewed as a process that impairs cellular microtubule integrity and may disrupt the normal mitotic processes (51). Some structural alterations of senescent cells are specic for the cell type. For example, whereas our data and those of Alexander et al. (1) document an association between the senescent phenotype and overexpression of actin in cardiomyAJP-Heart Circ Physiol VOL

ocytes and human osteosarcoma cells, Nishio and Inoue (39) documented a reduction in the levels of actin protein in senescent broblasts. Differently from neonatal cardiomyocytes that do not express vimentin (28, 42), senescent broblasts show an extraordinary production of vimentin (38) that, by anchoring cytoplasmic p53, prevents nuclear import of p53 and p53-dependent apoptosis (39). We found that a pulsed, brief incubation with doxorubicin at 1 M induced apoptosis through a p53-independent pathway. This result is in agreement with previous studies that employed similar doses of doxorubicin (60) but contrasts with other studies that used higher concentrations of doxorubicin and/or for a longer amount of time, leading to the discovery that apoptosis occurs through a p53-dependent pathway (11, 46). Accordingly, we think that the role of p53 in doxorubicininduced apoptosis in cardiac muscle cells may vary depending on the concentration and duration of treatment. We also found that doxorubicin at 0.1 M induces a senescent phenotype, accompanied by an increase in the p53 levels that accumulate in the cytoplasm. Many studies have demonstrated that cytoplasmic p53 may contribute to apoptosis through transcription-independent mechanisms by amplifying the transcription-dependent apoptotic signals triggered by nuclear p53 (46). However, there also are studies that suggest a protective role for cytoplasmic p53. In agreement with the above-mentioned study by Nishio and Inoue (39), Qu et al. (43) also demonstrated that p53 cytoplasmic accumulation induced by endoplasmic reticulum stress prevents p53 stabilization and p53-mediated apoptosis upon DNA damage. Nithipongvanitch et al. (40) found nuclear, cytoplasmic, and mitochondrial accumulation of p53 following acute doxorubicin treatment and demonstrated that the loss of mitochondrial p53 renders mitochondrial DNA more susceptible to oxidative stress, thus suggesting that mitochondrial p53 accumulation may participate in mitochondrial DNA repair as a rapid adaptive response to oxidative stress in cardiomyocytes. Our data show that p53 plays an active, protective role. In fact, if the incubation of low, prosenescent doses of doxorubicin was preceded by pretreatment with PFT, the p53 inhibitor, then cells underwent apoptosis rather than showing a senescence phenotype. This nding is in agreement with a study by Elmore et al. (17), who found that breast tumor cells that are acutely exposed to doxorubicin exhibit an increase in p53 activity and a dramatic increase in -galactosidase. They also found that inactivation of wild-type p53 results in a transition of the cellular response to doxorubicin treatment from replicative senescence to delayed apoptosis (17). Both the literature as well as our own experimental data collectively suggest that the following mechanisms may be involved in doxorubicin-induced senescence. Doxorubicin induces TRF2 downregulation, which causes telomere uncapping and ultimately cell death. At low doses, doxorubicin also induces TRF1 knockdown. Although TRF1 inhibition does not play a crucial role in unstressed cells, it is of great importance in cells treated with low doses of doxorubicin, because it prevents premature mitotic entry and apoptosis. p53 plays a key role in downregulating TRF1 in cells treated with low doses of doxorubicin. If p53 activity is inhibited by PFT, the exposure to low doses of doxorubicin produces TRF1 overexpression; thus the cellular response program to doxorubicin shifts from senescence to apoptosis. How p53 regulates TRF1
www.ajpheart.org

Downloaded from ajpheart.physiology.org on June 25, 2012

297 DECEMBER 2009

H2178

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

Fig. 9. Time-response analysis of the effects of a single treatment of 0.1 M doxorubicin on H9c2 cells. A: representative uorescence-activated cell sorting (FACS) dot plots of PI staining. B: representative FACS histograms of cell size (top). Gray shaded area, day 0; red line, day 6; blue line, day 15; and green line, day 21. Table (bottom) shows median and coefcient of variation values for the same experiment. C: percentage of SA--gal-positive cells. D: Western blot analysis of TRF1 and TRF2 expression. *P 0.05 vs. day 0. P 0.05 vs. day 4. P 0.05 vs. day 6.

Downloaded from ajpheart.physiology.org on June 25, 2012

expression is an open question. We hypothesize that p53 may function in the cytoplasm by relaying a negative regulator of TRF1 transcription. The present study shows that p53 and MAPK activation is a doxorubicin-induced signaling that regulates TRF1 and TRF2 expression: p38 mediates the effects on TRF2, whereas JNK regulates TRF1 through p53 activation at low doses of doxorubicin and in a p53-independent manner at high doses of the drug. Previous studies have shown that p38 and p53 are senescence-executing molecules that are activated by telomere dysfunction (23, 25). We do not believe that the previous observations conict with our present results, since the point of MAPK and p53 activation can be either upstream or downstream from telomere dysfunction. This is in agreement with the study by Iwasa et al. (23), who found that p38 is activated by H2O2 and that p38 activation persists after H2O2 removal. It may be argued that doxorubicin directly induces MAPK and p53 activation, which determines telomere dysfunction, which in turn increases their activation.
AJP-Heart Circ Physiol VOL

Cells With Doxorubicin-Induced Senescent Like Phenotype May Die of Mitotic Catastrophe In an attempt to better understand the mechanism involved in doxorubicin-induced late cardiac toxicity, we chose to expose cells to a pulsed, short-term incubation with doxorubicin, because it has been shown that prolonged treatment is lethal even if the doses of the drug are low (18). We observed that whereas 1 M doxorubicin led to rapid death through apoptosis, 0.1 M doxorubicin induced a senescent-like phenotype and caused death through mitotic catastrophe of a lower number of treated cells. In addition, we found that a relevant number of surviving myocytes had a senescent phenotype that was documented 21 days after treatment by the increase of cell volume, the presence of SA--gal activity, and the downregulation of TRF2 and TRF1 expression. Mitotic catastrophe is a mode of death slower than apoptosis that results from DNA damage coupled with altered functions of the various checkpoint mechanisms whose role is to arrest progression into mitosis until repair (7). In the present study we
www.ajpheart.org

297 DECEMBER 2009

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY

H2179

observed the typical biochemical and morphological features of mitotic catastrophe, which include the presence of multinucleated cells with micronuclei and/or nuclei of unequal size (likely arising through abnormal mitosis), anaphase bridges, changes in DNA content (4N), and evidence of chromosomal abnormalities (18, 29, 59). In agreement with Castedo et al. (8), who found that the doxorubicin-induced inhibition of Chk2 facilitates the induction of mitotic catastrophe, we observed a downregulation of the Chk2, a cell cycle checkpoint that governs the order and timing of cell cycle transition to ensure completion of one cellular event before the commencement of another and therefore acts as a negative regulator of mitotic catastrophe. It is well-known that polyploidy and chromosomal aberrations are the consequence of TRF2 downregulation. In fact, TRF2 downregulation determines the molecular disassembly of the telomere complex and causes the deprotection of chromosome ends, which then become the substrate of repair activities, resulting in covalent fusion of two chromosomes and the appearance of anaphase bridges, which must be torn away to allow the mitosis to proceed. As a result, each daughter cell will inherit a chromosome with a double-strand break at one end that will be fused to another uncapped end, perpetuating a cycle of breakage-fusion-bridge that may lead to cell death (13). If cells do not escape from this cycle, cell death may occur even much later on and several mitoses after the application of the stress (32). Do Telomere Dysfunction and Senescence Play a Role in Doxorubicin-Induced Heart Failure Cardiomyopathy? Until a few years ago, the prevailing belief was that the heart is a terminally differentiated organ whose response to pathological loads or cell death can only be accomplished by hypertrophy of differentiated cells. In the past few years, a number of studies have demonstrated that the heart contains a pool of stem cells that are able to create new myocytes (5, 36, 41). More recently, it has been shown that the heart is characterized by a heterogeneous population of myocytes and that small, immature dividing myocytes can be found together with the old, hypertrophied nonreplicating ones (10). There is currently increasing evidence of a slow, on-going turnover of cardiomyocytes in the normal heart involving the death of cardiomyocytes and the generation of new cardiomyocytes (6, 19, 53). A number of studies have demonstrated that the heart contains a pool of resident progenitor cells (36) and a population of small, immature dividing p16INK4a-negative myocytes with long telomeres (45) that have been considered the link between progenitor cells and more differentiated, nonreplicating cardiomyocytes. Conceptually, heart failure may now be considered a myocyte-deciency disease in which pump dysfunction supervenes when cell loss is not compensated by hypertrophy of the existing myocytes and regeneration of new myocytes. It must be kept in mind that we are already well aware of a model in which the impaired function of regenerative cells contributes to myocardial dysfunction, i.e., aging. This is a process in which the impaired function of progenitor cells signicantly contributes to the dysregulation of endogenous repair mechanisms and explains the increased severity of cardiovascular pathophysiology that is observed in the geriatric population (15, 19, 44, 52). Neonatal rat cardiomyocytes share some characteristics with the population of small, immature replicating cells that are present
AJP-Heart Circ Physiol VOL

in the adult heart and that are reminiscent of a fetal/neonatal phenotype (10). Thus our experimental model may be considered a convenient indicator of what might happen to these young and cardioregenerative cells when the heart is exposed to doxorubicin. Current research in the eld of cardioregenerative medicine is mainly focused on ways to stimulate and strengthen the regenerative capacity of progenitor cells in response to stress. Future research also should look into the possibility of protecting progenitor cells themselves from dangerous stress.
DISCLOSURES No conicts of interest are declared by the author(s). REFERENCES 1. Alexander K, Yang HS, Hinds PW. Cellular senescence requires CDK5 repression of Rac1 activity. Mol Cell Biol 24: 2808 2819, 2004. 2. Antos CL, McKinsey TA, Dreitz M, Hollingsworth LM, Zhang CL, Schreiber K, Rindt H, Gorczysnki RJ, Olson EN. Dose-dependent blockade to cardiomyocyte hypertrophy by histone deacetylase inhibitors. J Biol Chem 278: 28930 28937, 2003. 3. Arola OJ, Saraste A, Pulkki K, Kallajoki M, Parvinen M, VoipioPulkki LM. Acute doxorubicin cardiotoxicity involves cardiomyocyte apoptosis. Cancer Res 60: 1789 1792, 2000. 4. Auner HW, Tinchon C, Linkesch W, Halwachs-Baumann G, Sill H. Correspondence re: O. J. Arola et al., acute doxorubicin cardiotoxicity involves cardiomyocyte apoptosis. Cancer Res 60: 1789 1792, 2000. Cancer Res 61: 23352336, 2001. 5. Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114: 763776, 2003. 6. Boni A, Urbanek K, Nascimbene A, Hosoda T, Zheng H, Delucchi F, Amano K, Gonzalez A, Vitale S, Ojaimi C, Rizzi R, Bolli R, Yutzey KE, Rota M, Kajstura J, Anversa P, Leri A. Notch1 regulates the fate of cardiac progenitor cells. Proc Natl Acad Sci USA 105: 15529 15534, 2008. 7. Castedo M, Perfettini JL, Roumier T, Andreau K, Medema R, Kroemer G. Cell death by mitotic catastrophe: a molecular denition. Oncogene 23: 28252837, 2004. 8. Castedo M, Perfettini JL, Roumier T, Yakushijin K, Horne D, Medema R, Kroemer G. The cell cycle checkpoint kinase Chk2 is a negative regulator of mitotic catastrophe. Oncogene 23: 4353 4361, 2004. 9. Chen QM, Tu VC, Catania J, Burton M, Toussaint O, Dilley T. Involvement of Rb family proteins, focal adhesion proteins and protein synthesis in senescent morphogenesis induced by hydrogen peroxide. J Cell Sci 113: 4087 4097, 2000. 10. Chen X, Wilson RM, Kubo H, Berretta RM, Harris DM, Zhang X, Jaleel N, MacDonnell SM, Bearzi C, Tillmanns J, Tromova I, Hosoda T, Mosna F, Cribbs L, Leri A, Kajstura J, Anversa P, Houser SR. Adolescent feline heart contains a population of small, proliferative ventricular myocytes with immature physiological properties. Circ Res 100: 536 544, 2007. 11. Chua CC, Liu X, Gao J, Hamdy RC, Chua BH. Multiple actions of pithrin-alpha on doxorubicin-induced apoptosis in rat myoblastic H9c2 cells. Am J Physiol Heart Circ Physiol 290: H2606 H2613, 2006. 12. Cooley C, Baird KM, Faure V, Wenner T, Stewart JL, Modino S, Slijepcevic P, Farr CJ, Morrison CG. Trf1 is not required for proliferation or functional telomere maintenance in chicken DT40 cells. Mol Biol Cell 20: 25632571, 2009. 13. de Lange T. Protection of mammalian telomeres. Oncogene 21: 532540, 2002. 14. de Magalha es JP, Chainiaux F, Remacle J, Toussaint O. Stress-induced premature senescence in BJ and hTERT-BJ1 human foreskin broblasts. FEBS Lett 523: 157162, 2002. 15. Dimmeler S, Leri A. Aging and disease as modiers of efcacy of cell therapy. Circ Res 102: 1319 30, 2008. 16. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O, Peacocke M, Campisi J. A biomarker that identies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92: 93639367, 1995. 17. Elmore LW, Rehder CW, Di X, McChesney PA, Jackson-Cook CK, Gewirtz DA, Holt SE. Adriamycin-induced senescence in breast tumor www.ajpheart.org

Downloaded from ajpheart.physiology.org on June 25, 2012

297 DECEMBER 2009

H2180

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY 40. Nithipongvanitch R, Ittarat W, Velez JM, Zhao R, St Clair DK, Oberley TD. Evidence for p53 as guardian of the cardiomyocyte mitochondrial genome following acute adriamycin treatment. J Histochem Cytochem 55: 629 639, 2007. 41. Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, Mishina Y, Pocius J, Michael LH, Behringer RR, Garry DJ, Entman ML, Schneider MD. Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci USA 100: 1231312318, 2003. 42. ie E, Vinge LE, Andersen G, Yndestad A, Krobert KA, Sandberg C, Ahmed MS, Haug T, Levy FO, Skomedal T, Attramadal H. RAMP2 and RAMP3 mRNA levels are increased in failing rat cardiomyocytes and associated with increased responsiveness to adrenomedullin. J Mol Cell Cardiol 38: 145151, 2005. 43. Qu L, Huang S, Baltzis D, Rivas-Estilla AM, Pluquet O, Hatzoglou M, Koumenis C, Taya Y, Yoshimura A, Koromilas AE. Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53dependent apoptosis by a pathway involving glycogen synthase kinase3beta. Genes Dev 18: 261277, 2004. 44. Rota M, LeCapitaine N, Hosoda T, Boni A, De Angelis A, PadinIruegas ME, Esposito G, Vitale S, Urbanek K, Casarsa C, Giorgio M, Luscher TF, Pelicci PG, Anversa P, Leri A, Kajstura J. Diabetes promotes cardiac stem cell aging and heart failure, which are prevented by deletion of the p66shc gene. Circ Res 99: 4252, 2006. 45. Rota M, Hosoda T, De Angelis A, Arcarese ML, Esposito G, Rizzi R, Tillmanns J, Tugal D, Musso E, Rimoldi O, Bearzi C, Urbanek K, Anversa P, Leri A, Kajstura J. The young mouse heart is composed of myocytes heterogeneous in age and function. Circ Res 101: 38799, 2007. 46. Sarda o VA, Oliveira PJ, Holy J, Oliveira CR, Wallace KB. Doxorubicin-induced mitochondrial dysfunction is secondary to nuclear p53 activation in H9c2 cardiomyoblasts. Cancer Chemother Pharmacol 64: 811 827, 2009. 47. Smogorzewska A, de Lange T. Different telomere damage signaling pathways in human and mouse cells. EMBO J 21:4338 4348, 2002. 48. Spallarossa P, Garibaldi S, Altieri P, Fabbi P, Manca V, Nasti S, Rossettin P, Ghigliotti G, Ballestrero A, Patrone F, Barsotti A, Brunelli C. Carvedilol prevents doxorubicin-induced free radical release and apoptosis in cardiomyocytes in vitro. J Mol Cell Cardiol 37: 837 846, 2004. 49. Spallarossa P, Altieri P, Garibaldi S, Ghigliotti G, Barisione C, Manca V, Fabbi P, Ballestrero A, Brunelli C, Barsotti A. Matrix metalloproteinase-2 and -9 are induced differently by doxorubicin in H9c2 cells: the role of MAP kinases and NAD(P)H oxidase. Cardiovasc Res 69: 736 745, 2006. 50. Stansel RM, de Lange T, Grifth JD. T-loop assembly in vitro involves binding of TRF2 near the 3 telomeric overhang. EMBO J 20: 55325540, 2001. 51. Tierno MB, Kitchens CA, Petrik B, Graham TH, Wipf P, Xu FL, Saunders WS, Raccor BS, Balachandran R, Day BW, Stout JR, Walczak CE, Ducruet AP, Reese CE, Lazo JS. Microtubule binding and disruption and induction of premature senescence by disorazole C1. J Pharmacol Exp Ther 328: 71522, 2009. 52. Torella D, Rota M, Nurzynska D, Musso E, Monsen A, Shiraishi I, Zias E, Walsh K, Rosenzweig A, Sussman MA, Urbanek K, NadalGinard B, Kajstura J, Anversa P, Leri A. Cardiac stem cell and myocyte aging, heart failure, and insulin-like growth factor-1 overexpression. Circ Res 94: 514 524, 2004. 53. Urbanek K, Torella D, Sheikh F, De Angelis A, Nurzynska D, Silvestri F, Beltrami CA, Bussani R, Beltrami AP, Quaini F, Bolli R, Leri A, Kajstura J, Anversa P. Myocardial regeneration by activation of multipotent cardiac stem cells in ischemic heart failure. Proc Natl Acad Sci USA 102: 8692 8697, 2005. 54. Valledor AF, Comalada M, Xaus J, Celada A. The differential timecourse of extracellular-regulated kinase activity correlates with the macrophage response toward proliferation or activation. J Biol Chem 275: 74037409, 2000. 55. van Steensel B, de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature 385: 740 743, 1997. 56. Verzola D, Gandolfo MT, Salvatore F, Villaggio B, Gianiorio F, Traverso P, Deferrari G, Garibotto G. Testosterone promotes apoptotic damage in human renal tubular cells. Kidney Int 65: 12521261, 2004. 57. Vigneron A, Roninson IB, Gamelin E, Coqueret O. Src inhibits adriamycin-induced senescence and G2 checkpoint arrest by blocking the induction of p21waf1. Cancer Res 65: 8927 8935, 2005. www.ajpheart.org

18.

19.

20. 21.

22.

23. 24. 25. 26. 27. 28.

29.

30.

31. 32. 33. 34. 35.

36.

37. 38. 39.

cells involves functional p53 and telomere dysfunction. J Biol Chem 277: 35509 35515, 2002. Eom YW, Kim MA, Park SS, Goo MJ, Kwon HJ, Sohn S, Kim WH, Yoon G, Choi KS. Two distinct modes of cell death induced by doxorubicin: apoptosis and cell death through mitotic catastrophe accompanied by senescence-like phenotype. Oncogene 24: 4765 4777, 2005. Gonzalez A, Rota M, Nurzynska D, Misao Y, Tillmanns J, Ojaimi C, Padin-Iruegas ME, Mu ller P, Esposito G, Bearzi C, Vitale S, Dawn B, Sanganalmath SK, Baker M, Hintze TH, Bolli R, Urbanek K, Hosoda T, Anversa P, Kajstura J, Leri A. Activation of cardiac progenitor cells reverses the failing heart senescent phenotype and prolongs lifespan. Circ Res 102: 597 606, 2008. Hayick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res 25: 585 621, 1961. Hequet O, Le QH, Moullet I, Pauli E, Salles G, Espinouse D, Dumontet C, Thieblemont C, Arnaud P, Antal D, Bouaa F, Coifer B. Subclinical late cardiomyopathy after doxorubicin therapy for lymphoma in adults. J Clin Oncol 22: 1864 71, 2004. Hershman DL, McBride RB, Eisenberger A, Tsai WY, Grann VR, Jacobson JS. Doxorubicin, cardiac risk factors, and cardiac toxicity in elderly patients with diffuse B-cell non-Hodgkins lymphoma. J Clin Oncol 26: 3159 3165, 2008. Iwasa H, Han J, Ishikawa F. Mitogen-activated protein kinase p38 denes the common senescence-signalling pathway. Genes Cells 8: 131 144, 2003. Jacobs JJ, de Lange T. p16INK4a as a second effector of the telomere damage pathway. Cell Cycle 4: 1364 1368, 2005. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 283: 13211325, 1999. Karlseder J, Smogorzewska A, de Lange T. Senescence induced by altered telomere state, not telomere loss. Science 295: 2446 2449, 2002. Kishi S, Wulf G, Nakamura M, Lu KP. Telomeric protein Pin2/TRF1 induces mitotic entry and apoptosis in cells with short telomeres and is down-regulated in human breast tumors. Oncogene 20: 14971508, 2001. LaFramboise WA, Guthrie RD, Scalise D, Elborne V, Bombach KL, Armanious CS, Magovern JA. Effect of muscle origin and phenotype on satellite cell muscle-specic gene expression. J Mol Cell Cardiol 35: 13071318, 2003. Lechel A, Satyanarayana A, Ju Z, Plentz RR, Schaetzlein S, Rudolph C, Wilkens L, Wiemann SU, Saretzki G, Malek NP, Manns MP, Buer J, Rudolph KL. The cellular level of telomere dysfunction determines induction of senescence or apoptosis in vivo. EMBO Rep 6: 275281, 2005. Lin AW, Barradas M, Stone JC, van Aelst L, Serrano M, Lowe SW. Premature senescence involving p53 and p16 is activated in response to constitutive MEK/MAPK mitogenic signaling. Genes Dev 12: 3008 3019, 1998. Liu X, Chua CC, Gao J, Chen Z, Landy CL, Hamdy R, Chua BH. Pithrin- protects against doxorubicin-induced apoptosis and acute cardiotoxicity in mice. Am J Physiol Heart Circ Physiol 286: H933H939, 2004. London o-Vallejo JA. Telomere instability and cancer. Biochimie 90: 73 82, 2008. Lu KP, Hanes SD, Hunter T. A human peptidyl-prolyl isomerase essential for regulation of mitosis. Nature 380: 544 547, 1996. Maejima Y, Adachi S, Ito H, Hirao K, Isobe M. Induction of premature senescence in cardiomyocytes by doxorubicin as a novel mechanism of myocardial damage. Aging Cell 7: 125136, 2008. Martin-Ruiz C, Saretzki G, Petrie J, Ladhoff J, Jeyapalan J, Wei W, Sedivy J, von Zglinicki T. Stochastic variation in telomere shortening rate causes heterogeneity of human broblast replicative life span. J Biol Chem 279: 17826 17833, 2004. Messina E, De Angelis L, Frati G, Morrone S, Chimenti S, Fiordaliso F, Salio M, Battaglia M, Latronico MV, Coletta M, Vivarelli E, Frati L, Cossu G, Giacomello A. Isolation and expansion of adult cardiac stem cells from human and murine heart. Circ Res 95: 911921, 2004. Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA, Pathak S. Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss. Neoplasia 2: 339 345, 2000. Nishio K, Inoue A, Qiao S, Kondo K, Mimura A. Senescence and cytoskeleton: overproduction of vimentin induces senescent-like morphology in human broblasts. Histochem Cell Biol 116: 321327, 2001. Nishio K, Inoue A. Senescence-associated alterations of cytoskeleton: extraordinary production of vimentin that anchors cytoplasmic p53 in senescent human broblasts. Histochem Cell Biol 123: 263273, 2005. AJP-Heart Circ Physiol VOL

Downloaded from ajpheart.physiology.org on June 25, 2012

297 DECEMBER 2009

TRF1, TRF2, AND DOXORUBICIN CARDIOTOXICITY 58. Von Hoff DD, Layard MW, Basa P, Davis HL Jr, Von Hoff AL, Rozencweig M, Muggia FM. Risk factors for doxorubicin-induced congestive heart failure. Ann Intern Med 91: 710 717, 1979. 59. Walen KH. Origin of diplochromosomal polyploidy in near-senescent broblast cultures: heterochromatin, telomeres and chromosomal instability (CIN). Cell Biol Int 31: 14471455, 2007. 60. Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, Kalyanaraman B. Doxorubicin induces apoptosis in normal and tumor cells

H2181

via distinctly different mechanisms: intermediacy of H2O2- and p53dependent pathways. J Biol Chem 279: 2553525543, 2004. 61. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270: 1326 1331, 1995. 62. Yujiri T, Sather S, Fanger CR, Johnson GL. Role of MEKK1 in cell survival and activation of JNK and ERK pathways dened by targeted gene disruption. Science 282: 19111914, 1998.

Downloaded from ajpheart.physiology.org on June 25, 2012

AJP-Heart Circ Physiol VOL

297 DECEMBER 2009

www.ajpheart.org