Studies on plant DNA isolation, PCR and sequencing of barcode loci in tree species

A Project Report SUBMITTED IN THE PARTIAL FULFILLMENT OF THE REQUREMENTS FOR THE DEGREE OF Master of Science In Nanosciences Submitted byNahid Akhtar M.Sc. (H) Nanosciences Roll No.: 0900142002 Integral University, Uttar Pradesh

Under the Guidance of Dr. Sribash Roy Plant molecular biology &Genetic Engineering Division National Botanical Research Institute

Lucknow

ACKNOWLEDGEMENT

I take this privilege to express my thankfulness to all those people involved in this endeavours. I am bereft of words to find befitting and to show my deep sense of gratitude towards my guide Dr. Sribash Roy. I shall remain ever indebted to him for his creative and expert guidance, constant encouragement, incessant discussion, everlasting moral support, constructive criticism, valuable suggestions, kindness and his trust on me. I learnt many things from him during this course of study. I am greatful to Prof.V.D.Gupta, Head of the department, Nanoscience, Integral University, Lucknow for including me all those qualities, which make so meticulous, and for assisting untiring at each and every stage during my project work. My most sincere thanks are due to Mr.Abhinandan Mani Tripathi and Mr.Antariksh Tyagi for their untiring help and suggestions throughout my studies by sacrificing their golden time during the tenure of this project. I wish to express my sincere gratitude to Dr.Samir Sawant , Dr.Hemant Yadav, Dr.S.N.Jena gave their unstinted support in one way or the other. I would also like to express my thanks to the members of our lab, Mr. Anukool srivastava, Ms. Namrata Singh, Mr.Anuj Maurya Ms. Aastha Gupta ,Mr Ravi Shukla, Shipra and Parul for their guidance, support cooperation, and suggestions throughout the work. My vocabulary is not wide enough to reflect all my sense of regards and infinite gratitude to my mother & my father for their love, affection, blessings, pivotal role in shaping my academic career, guidance for the right path, tremendous moral boosting and sacrifice. I am thankful to them for making me a self-reliant, positive and optimistic human being.

Nahid Akhtar

CERTIFICATE

It is certified that the dissertation report entitled Studies on plant DNA isolation, PCR and sequencing of barcode loci in tree species which is being submitted by Nahid Akthar, Department of Nanosciences, Integral University carried out by her under my supervision and guidance.

Signature of Co-Supervisor

Ms. Tarana Afreen Chandel

Table of Contents-:

CONTENT

PAGE NO.

ABBREVIATIONS

INTRODUCTION

5-11

LITERATURE REVIEW

12-16

MATERIALS AND METHODS

17-28

RESULTS & DISCUSSION

29-34

REFERENCES

35-40

ABBREVIATIONS

bp BME dNTPs DNA EDTA HCl hr kDa min Nm NaCl PCR rpm TBE UV ITS matK rbcL CO1

Base pair - mercapto ethanol Deoxy Nucleotide Tri Phosphates Deoxyribonucleic acid Ethylene Diamine Tetraacetic Acid Hydrochloric acid Hour Kilo Dalton Minute Nanometer Sodium chloride Polymerase chain reaction Rotation per minute Tris-Borate-EDTA Ultra violet Internal transcribed spacer Maturase kinase Ribulose Biophosphate Caboxylase Sub-unit L CytochromeCoxidase1

INTRODUCTION

1. INTRODUCTION:

The number of living species on earth is unknown. There are approximately 1.7 million named species and possibly another 10 million (not counting bacteria and archea) DNA based identification could be vitally important in flagging specimens that represent undescribed taxa .Comprehensive analysis of populations will help in identifying cryptic species ,which may be for more prevalent than commonly realized, even among large animals.DNA sequencing of the same gene (or set of gene )across diverse phyla will help unravel the process that underlie speciation and reveal the diversity of life to an extent that is not now possible .DNA sequences analysis is enormously useful in studies of evolutionary history and origin of species on earth. Extensive sampling of DNA sequences has helped establish the diversity of life and allowed researches to analyse be revolutionary relationships with in groups in details.DNA sequencing has also been applied to identify specimens and resolve species boundaries in populations apparently similar organisms.DNA sequence analysis of uniform target gene to enable species identification has been termed DNA barcoding,by analogy with Uniform product code barcodes on manufacturing goods. DNA bar-coding is the use of a short DNA sequence or sequences from a standardised locus (or loci) as a species identification tool. This method of using short orthologous DNA sequences called DNA barcodes have been proposed and initiated to facilitate biodiversity studies, identify juveniles associate sexes ,enhanced forensic analyses and germplasm conservation. With so much of human interference into environment and changing climatic conditions many plant and animal species are onto the verge of extinction or some had already faced extinction. Climate change and increasingly dramatic shifts in land threaten to exacerbate the existing bio-diversity crisis. Meeting the imperative of environmental stewardship requires support for the scientific endeavours of documenting, predicting and managing ecological change on a global scale. This will require not only a one off description of organism diversity (a formidable challenge in itself), but also the ability to monitor biological communities year after year. Today, this task is carried out mainly by taxonomist applying their specialist skills because the vast majority of other players in the field of conservation and sustainable development are unable to identify any but the most familiar species. The convention on biological diversity affirms that this so called taxonomist impediment pose a serious threat to conservation and management of biological diversity.
8

The urgent need for a rapid, accurate and web-accessible taxonomic resource will require the full utilization of information technology and molecular biology (UK Government., 20004; EPBRS., 2004). To reduce the risk of loss of genetic variability, there is urgent need to conserve tree germplasm for future studies. The conservation needs and strategies can be streamlined by resolving unambiguously between true genetic and phenotypic variability. This has become possible due to recent developments in plant genomics which allow retrieval of true genetic variation by directly examining sequence variation in DNA. Tree DNA isolation, amplification and sequencing of most diversified genes are useful in several applications, example. characterizing true genetic variation in the materials, understanding genetic and evolutionary relationships. Fortunately, a DNA based identification system( i.e.DNA barcoding)operable by non-specialist to complement parallel development in taxonomic informatics is within reach. As a uniform, practical method for species identification ,it appears to have broad scientific applications. It will be great utility on conservation biology for example including biodiversity surveys.DNA barcodes have been proposed as a shortcut that would provide species identifications and as away to accelerate the discovery of new species. DNA Barcode are the short segments of a gene sequence that evolve fast enough to differentiate species, but have flanking regions that are sufficient conserved to enable the barcode region to be serviced as universal primer. DNA bar-coding has already proved useful for identification (and in some cases delimitation) of animal species, but plants (in a broad sense including land plants, algae and lichens) are only beginning to attract the attention, importance of the DNA based plant identification tool can be realized, however, several important scientific and methodological questions must first be addressed. DNA Barcoding promises fast, accurate species identification by focusing analysis on a short standardized segment of the genome. DNA bar-coding involves sequencing a short stretch of DNA that will be universally present in all species, ideally exhibits robust species-specific sequence variation. DNA bar-coding involves sequencing a short stretch of DNA that will be universally present in all species, ideally exhibits robust species-specific sequence variation. DNA bar coding is an exciting new tool for taxonomic research. DNA bar-coding has already proved useful for identification (and in some cases delimitation) of animal species, but plants (in a broad sense including land plants, algae and lichens) are only beginning to attract the attention, importance of the DNA based plant
9

identification tool can be realized, however, several important scientific and methodological questions must first be addressed. The preferred gene for animal bar-coding, cytochrome oxidase1 (CO1 or cox1) is not suitable for plant bar-coding because low rates of substitution in this gene have caused a lack of sequence variation among plant species. Plants also pose unique challenges to barcoding: prevalent hybridization, polyploidy and apomixis may undermine the utility of even an ideal bar-code locus. Thus, a pre requisite to a universal plant bar-coding procedure is a period of rigorous experimentation to determine how indeed, if DNA bar-coding at a floristic scale can succeed. A desirable locus for DNA barcoding should be standardized (so that large databases of sequences for that locus can be developed), present in most of the taxa of interest and sequencable without species-specific PCR primers short enough to be easily sequenced with current technology and provide a large variation between species yet a relatively small amount of variation within a species. Although several loci have been suggested, a common set of choices are:

For animals and many other eukaryotes, the mitochrondrial CO1 gene For land plants, the concatenation of the rbcL , matK chloroplast genes, ITS ,trnH and psbA.

Consortium for the Barcode of Life (CBOL) is an international collaborative effort which aims to develop a mechanism capable of generating a unique genetic barcode for every species of life on earth .The science behind the Consortium's initiative has met with considerable controversy, with responses ranging from enthusiastic endorsement to strident rejection. More work needs to be done to determine to what extent barcoding can complement existing taxonomic methods in cataloguing the planet's biodiversity. In pursuing this mission CBOL promotes1- The rapid compilation of DNA barcode record in a public library of DNA sequence. 2- The development of new instrument and processes that will make bar-coding cheaper, faster and portable.

10

3- The participation of taxonomist and taxonomic research organization in all regions and countries. 4- The use of DNA bar-coding for the benefit of science and society. Four barcoding primer selected for this work viz rbcl, trnH-psbA, matK and ITS in which first three are taken from chloroplast genome and ITS were taken from Internal transcribed spacer (ITS) region of nuclear region of genome. Like mitochondria cytochrome oxidase 1 gene (CO1) of animal kingdom there were no any single locus reported in plant which act completely as barcode. Due to this region we were taken four loci for our study. Keeping above problems in mind we have taken following objectiveI) II) III) IV) DNA isolation of plants PCR amplification with all four loci Sequencing of these amplified product Phylogenetic analysis

Until now the biological specimens were identified using morphological keys but in most cases an experienced professional taxonomist is needed. If a specimen is damaged or is in an immature stage of development, even specialist may be unable to make identification. Barcoding solves these problems because non-specialist can obtain bar-code from tiny amount of tissues. This is not to say that traditional taxonomy has become less important but rather that DNA bar-coding can serve a dual purpose as a new tool in the taxonomist tool box supplementing his/her knowledge well as being an innovative device for non experts who need to make a quick identification.

1.2 GENES USED FOR BAR-CODING: In animals a portion of mitochondrial gene cox 1(CO1) is standardarised as potential barcode.In land plants this mitochondrial gene cox 1 will not succeed to low levels of variability in the mitochondrial DNA of land plants. The closest equivalent source of a plant bar-coding region is the Plastid Genome. This genome shares many of the desirable attributes of animal

11

mitochondrial DNA for bar-coding such as conserved gene order and high copy number in each cell enabling easy retrieval DNA for PCR and Sequencing. One problem with plastid DNA however, is its generally slow rate of evolution and challenge has been to find a plastid region that is sufficiently variable for DNA bar-coding. A suitable region should ideally show enough variation within it to discriminate among species, yet to be conserved enough to be present and routinely retrievable across the >400 million years of evolutionary divergence represented by extent land plant diversity. This is a non- trival problem; finding a marker or perhaps set of marker for which primer binding sites are conserved but which shows high levels of variability across all groups of land plants represent a set of contradictory targets. If markers have highly conserved primer binding sites they tend to also be internally more conservative, whereas for the most variable regions it is difficult to identify sites for reasonably conserved primers.An additional desirable trait for potential bar-coding region is to have a reading frame so that the presence of non- sense substitutions could be used as a criterion to evaluate how good sequencing reactions/ editing have been. For a non- coding region (introns or intergenic spacer) to represent a viable altenative it is necessary for it to have-

1- Universal primers and standard PCR protocols. 2- Consistently higher variation than coding region. 3- A non- coding complicated pattern of molecular evolution.

Plastid genes used for barcoding area) rbcL- Ribulose Biophosphate Caboxylase Sub-unit L b) psbA- trnH spacer c) mat k- Maturation Kinase

a) rbc L - Ribulose Biophosphate Caboxylase Sub-unit L it is a protein encoding plastid gene. It has been proposed as a potential barcode by several sets of researchers ( Chase et al., 2005; Newmaster et al., 2006 ). This region has shown a fair degree of success in discriminating species and is regarded as benchmark locus in phylogenetic investigation

12

by providing a reliable placement of taxon into a plant family and /or genus (W. John Kress et al., 2007). b) trnH- psbA spacer- is a non-coding intergenic spacer region found in plastid DNA (Kress et al., 2005; Shaw et al., 2007). This region is one of the most variable non-coding regions of the plastid genome in angiosperms in terms of having the highest percentage of variable site (Shaw et al., 2007). This variation means that this inter-genic spacer can offer high levels of species discrimination (Kress et al., 2005; Shaw et al., 2007).

These are many problems with alignment for this locus caused by high rates of insertion/ deletions; alignment of the trnH- psb A spacer across larger families of angiosperms is highly ambiguous. It appears that even within closely related taxa, great length differences exist, such that at greater taxonomic distance no shared sequence remains. Further more in some groups of plants, the trnH -psbA spacer is exceedingly short (less than 300bp; Kress et al., 2006) and in some groups of plans it is much longer. Despite of these problems trn H- psb A spacer is considered as suitable for barcoding.

13

REVIEW OF LITERATURE

14

2. Review of Literature
DNA barcoding the recently proposed DNA based project for specie identification ,has attracted much attention and controversy. Proponents envision that a short fragment of DNA can be used to diagnose taxa , increasing the speed ,objectivity and efficiency of specie identification. Initial tests of genetic barcoding using mitochondrial markers on animal reported near 100% accuracy , indicating that the method can be highly accurate under certain condition. DNA barcoding promises fast ,accurate species identifications by focusing analysis on a short standardized segment of the genome (Herbert et al 2003).Several studies have now established that sequence diversity in a approx.650 bp region near the 5 end of mitochondrial cytochrome oxidase subunit I(cox I, also referred to as COI)gene provides strong species level resolution for varied animal groups including birds(Herbert et al ,2004),fishes (Ward et al ,2005),springtails(Hogg and Hebert,2005),spiders(Barrett and Hebert,2005 )and moths (Hebert et al ,2003,Janzen et al 2005).These early results have provoked larger scale barcoding efforts and global projects for fishes and birds have now been initiated (Marshall,2005).These projects represent the first way in series of initiatives which will demand the capability to assemble barcode rapidly and cost effectively .As one looks further to the future the need for substantial analytical capacity looms. For e.g. an effort to barcode the 1.7 millions described species (Hawksworth,1995) would require the assembly of some 20 million barcodes, given a target of about 10 barcodes per species. This total will rise 5 fold if barcode coverage is desired for all 10 million eukaryote species(eg.Hammond,1992) producing a sequence library of 65 billion base pairs ,Approximately twice current size of genebank (april,2005).This task could be completed within decade by establishing 50 core laboratories, each producing 200000 barcode record per year .When viewed from the perspective of major genomic facilities, some of which generate more than 50 million sequence a year, the production goals for barcode facilities may seem modest.

15

This technique of species identification have recently been proposed as solutions to the crisis of taxonomy and received significant attention from scientific journals, grant agencies , natural history museums, and mainstream media. Meier et al, tested two key claims of molecular taxonomy using 1333 mitochondrial COI sequences for 449 species of Dipterans and investigated whether sequences can be used for species identification (DNA bar-coding) and find a relatively low success rate (<70%) based on tree-based and newly proposed species identification criteria. Mis-identifications are due to wide overlap between intra- and inter specific genetic variability, which causes 6.5% of all query sequences to have allospecific or a mixture of allo- and co specific (3.6%) best-matching barcodes. Even when two COI sequences are identical, there is a6% chance that they belong to different species. ( Meier et al .,2006) also found that 21% of all species lack unique barcodes when consensus sequences of all nonspecific sequences are used. It was tested whether DNA sequences yield unambiguous species-level taxonomy when sequence profiles are assembled based on pair wise distance thresholds. Many sequence triplets were found, for which two of the three pair wise distances remain below the threshold, whereas the third exceeds it i.e., it is impossible to consistently delimit species based on pair-wise distances. Furthermore, for species profiles based on a 3%threshold, only 47% of all profiles are consistent with currently accepted species limits, 20% contain more than one species, and 33% only some sequences from one species; i.e., adopting such a DNA taxonomy would require the redescription of a large proportion of the known species, thus worsening the taxonomic impediment. (Meier et al., 2007) DNA bar-coding has become a promising means for identifying organisms of all life stages. Currently, phenetic approaches and tree-building methods have been used to define species boundaries and discover cryptic species. However, a universal threshold of genetic distance values to distinguish taxonomic groups cannot be determined. As an alternative, DNA bar-coding approaches can be character based, whereby species are identified through the presence or absence of discrete nucleotide substitutions (character states) within a DNA sequence. Rach et al (2007) demonstrated the potential of characterbased DNA barcodes by analyzing 833 odonate specimens from 103 localities belonging to 64 species. A total of 54 species and 22 genera could be discriminated reliably through unique combinations of character states within only one mitochondrial gene region (NADH dehydrogenase 1). Character-based DNA barcodes were further successfully established at a population level discriminating seven population-specific entities out of a total of 19
16

populations belonging to three species. Thus, for the first time, DNA barcodes have been found to identify entities below the species level that may constitute separate conservation units or even species units. Rach et al (2007) findings suggest that character-based DNA barcoding can be a rapid and reliable means for (i) the assignment of unknown specimens to a taxonomic group, (ii) the exploration of diagnosability of conservation units, and (iii) complementing taxonomic identification systems. (Rach et al., 2007) Cornman et al (2007) investigated the phylogeography of Iris missouriensis (Iridaceae), which is widely distributed in western North America. R. Scott and Cornman et al utilized transposon display and DNA sequencing to quantify nuclear and chloroplast genetic structure. Their objectives were (i) to characterize the geographic structure of genetic variation throughout the species range, (ii) to test whether both margins of the range show reduced genetic diversity as predicted by north south expansion and contraction associated with climate change, and (iii) to determine whether the subspecies Iris missouriensis ssp. longipetala is genetically distinct. Cornman et al (2007) found that genetic diversity was significantly lower in the northern part of the range but was not significantly different between the central and southern regions, indicating greater stability of the southern margin vs. the northern. Among-population differentiation was high (PT = 0.52). The largest divisions in each marker set were concordant and separated the southern Rocky Mountains and Basin and Range provinces from the remainder of the range. The boundaries of this phylogeographic break do not coincide with gaps in present-day distributions or phylogeographic breaks identified in other species, and may indicate a measure of reproductive isolation. Consistent with current treatments, Cornman et al (2007) did not find support for the taxonomic placement I. missourienis ssp. longipetala as a distinct species. Although transposon display has been used to investigate relationships among crop accessions and their wild relatives, to their knowledge, this is the first use of these markers for population-level phylogeography of a nonmodel species and further demonstrates their utility in species recalcitrant to amplified fragment length polymorphism protocols. (Cornman et al., 2007) The evolution rates of mtDNA in early metazoans hold important implications for DNA bar-coding. Huan et al (2007) present a comprehensive analysis of intra- and inter specific COI variabilities in Porifera and Cnidaria (separately as Anthozoa, Hydrozoa, and Scyphozoa) using a data set of 619 sequences from 224 species. Huan et al (2007) found variation within and between species to be much lower in Porifera and Anthozoa compared to
17

Medusozoa (Hydrozoa and Scyphozoa), which has divergences similar to typical metazoans. Given that recent evidence has shown that fungi also exhibit limited COI divergence, slowevolving mtDNA is likely to be plesiomorphic for the Metazoa. Higher rates of evolution could have originated independently in Medusozoa and Bilateria or been acquired in the Cnidaria + Bilateria clade and lost in the Anthozoa. Low identification success and substantial overlap between intra- and interspecific COI distances render the Anthozoa unsuitable for DNA bar-coding. Caution is also advised for Porifera and Hydrozoa because of relatively low identification success rates as even threshold divergence that maximizes the bar-coding gap does not improve identification success. (Huang et al., 2008) The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal bar-coding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. Kress et al (2005) therefore propose the nuclear internal transcribed spacer region and the plastid trnHpsbA intergenic spacer as potentially usable DNA regions for applying bar-coding to flowering plants. The internal transcribed spacer is the most commonly sequenced locus used in plant phylogenetic investigations at the species level and shows high levels of inter specific divergence. The trnH-psbA spacer, although short (450-bp), is the most variable plastid region in angiosperms and it is easily amplified across a broad range of land plants. Comparison of the total plastid genomes of tobacco and deadly nightshade enhanced with trials on widely divergent angiosperm taxa, including closely related species in seven plant families and a group of species sampled from a local flora encompassing 50 plant families (for a total of 99 species, 80 genera, and 53 families), suggest that the sequences in this pair of loci have the potential to discriminate among the largest number of plant species for barcoding purpose. (Kress et al., 2005) Newmaster et al (2007) determined the relative utility of six coding (Universal Plastid Amplicon UPA, rpoB, rpoc1, accD, rbcL, matK) and one noncoding (trnH-psbA) chloroplast loci for bar-coding in the genus Compsoneura using both single region and multiregion approaches. Five of the regions we tested were predominantly invariant across species (UPA, rpoB, rpoC1, accD, and rbcL). Two of the regions (matK and trnH-psbA) had significant variation and show promise for bar-coding in nutmegs. Newmaster et al (2007) demonstrate that a two-gene approach utilizing a moderately variable region (matK) and a more variable region (trnH-psbA) provides resolution among all the Compsonuera species. Newmaster et al (2007) sampled including the recently evolved C. sprucei and C. mexicana.
18

Newmaster et al (2007) classification analyses based on nonmetric multidimensional scaling ordination, suggest that the use of two regions results in a decreased range of intraspecific variation relative to the distribution of interspecific divergence with 95% of the samples correctly identified in a sequence identification analysis. (Newmaster et al, .2007)

MATERIALS AND METHODS

19

3. Material and Methods-:

3.1. Source of experimental materials Green leaves were collected and identified in their flowering stage on the basis of in their leaf morphology and floral structure from different location of Uttar Pradesh (Table-1). These samples were stored either in silica gel or in -80c. These leaves were used for isolation, PCR amplification and for sequencing. 3.2. Chemicals used All the chemicals used in the present investigations were of analytical grade. Where as all the chemicals of molecular biological grade were supplied by Bangalore Genie and Applied Bioscience.

3.2.A. Buffer and Stock solution for DNA isolation-:

1. Extraction Buffer CTAB (4%) Tris (100mM) EDTA (20 mM) NaCl (1.4M) 100 ml

20

2.

M Tris buffer (pH 8.0)

100ml

Weighed 12.11 g Tris base and dissolved in 80 ml Milli -Q water. Adjusted the pH to 8.0 with 0.1 N HCl and made up volume to 100 ml. Autoclaved and stored at room temperature. 3. 0.5 M EDTA (pH 8.0) 100ml

Weighed 18.61g Na2EDTA and dissolved in 80 ml Milli-Q water. Adjusted the pH to 8.0 with 1N NaOH. Shaken vigorously on a magnetic stirrer for some time to ensure that all the solutes have dissolved. Made up to the volume 100 ml. Autoclaved and stored at room temperature. 4. 5 M NaCl 100 ml

Weighed 29.2 g of NaCl and dissolved in 80 ml distilled water. Made up the volume 100 ml. Autoclaved and stored at room temperature. 5. CTAB extraction buffer (pH 8.0) 100 ml ml) and 0.5

Weighed CTAB powder 2.5 g, added 1M Tris buffer (10 ml), 5M NaCl (30 at room temperature. 6. 70% Ethanol 100 ml

M EDTA (5 ml). pH was adjusted to 8.0 with 0.1N HCl. Made up the volume 100 ml. Stored

Mixed 70 ml absolute ethyl alcohol in 30 ml distilled water. Stored at 0C. 7. Isopropanol Stored at -20C in dark colored bottle. 8. TE buffer 100ml 100ml

Added 1 M Tris (pH 8.0) (1 ml), 0.5 M EDTA (0.1 ml), and distilled water (98.90 ml). Adjusted pH to 8.0. Autoclaved and stored at room temperature.

3.2. B. Solution for DNA purification

1. Polyvinylpyrolidone (PVP)

21

2. Chloroform: Isoamyl alcohol (24:1) 50 ml Added 2 ml of Isoamyl alcohol into 48 ml of Chloroform. Stored it in a brown colored bottle at RT. Note: Mixing chloroform with other solvents may cause serious hazard. Do not mixes chloroform with acetone and strong base.Isoamyl alcohol should be handled carefully. Vapours are poisonous.

3. RNase

1 ml

Took 10 mg of RNase A and dissolved in 1 ml of distilled water. Dispensed into aliquots and stored at -200C.

3.2.C Solutions for gel electrophoresis

1. DNA loading dye (6X) 10ml

Weighed bromophenol blue (0.25% w/v) (0.0025 g), xylene cyanol FF (0.25% w/v) (0.025 g) and added 30% glycerol (3 ml) and double distilled water (8 ml). Made up the volume to 10 ml in distilled H2O and set pH 8.0 with 1 N NaOH. The dye is aliquoted into eppendorf tubes and stored at 4C. We also used the Red Taq Polymerase which contains red dye which do not required any more dye from outside.
2. Electrophoresis buffer (10X TBE) pH 8.0

1 litre

Weighed 108 g Tris base, 55 g boric acid and 9.5g EDTA, disodium salt. All the constituents were dissolved in 750 ml double Milli -Q water. Adjusted pH to 8.0 with sodium hydroxide. Filtered and adjusted final volume to 1 L. Autoclaved and kept at room temperature.
3.

Ethidium bromide (10X)

10 ml

Weighed 10 mg Ethidium bromide (EtBr) and dissolved in 10ml Milli-Q water. Stored at RT. Note: Ethidium bromide is highly carcinogenic. Use gloves

22

Genomic DNA isolation-:

For genomic DNA isolation CTAB method (Doyle and Doyle, 1987) with slight modification was used for the present study. In this method cetyl trimethyl ammonium bromide buffer (CTAB) is used in the extraction of DNA, which serves as a detergent to lyase the wall of cells for release of DNA.

Principle-:
The efficiency of isolation of genomic DNA depends upon the lysis of cells to release cells contents. In order to prepare a cell extract, Tris buffer is the actual buffering component. mercaptoethanol acts as reducing agent and reduces disulphides and thus disrupts the tertiary structure of proteins and denatures them. EDTA chelates Mg++ ions that are essential for overall structure of cell envelope and for DNase activity. Cetyl trimethyl ammonium bromide (CTAB) forms insoluble CTAB-DNA complex when added in cell extract. DNA-CTAB complex get precipitated leaving other component in supernatant. Sample in Solution is then neutralized with potassium acetate solution, centrifuged to remove this insoluble cell debris. Isopropanol precipitates nucleic acids (both DNA and RNA). RNAcontamination can be removed by RNase treatment. Ethanol precipitates nucleic acids and proteins along with other components in solution

Protocol-:

1gm of fresh leaves was ground to fine powder in liquid nitrogen by using mortar and pestle.

23

The powder was suspended in 12 ml of ice cold CTAB extraction buffer (2%, w/v CTAB; 50 mM Tris-base, 20 mM EDTA, 1.4 NaCl and 0.1% v/v, ME) and homogenized.

The mixture was kept at 65oC in water-bath for 3 hrs for lysis. After incubation, the temperature of lysate was brought down to the room temperature.

The lysate was extracted with 0.7 volume chloroform: isoamyl alcohol (24:1) and gently mixed.

The mixture was centrifuged at 10,000 rpm for 10 min at room temp. The aqueous layer was collected in a fresh polycarbonate tube and the supernatant was discarded after centrifugation.

Then 0.7 volume of chilled isopropanol was added gently mixed and keep it at -20C for overnight.

Then centrifuge at 8000 rpm for 10 min at 4C. Supernatant was decanted by inverting the tube on paper towel to remove any residual liquid.

The pellet was washed with 70% ethanol and dried at room temperature. The nucleic acids containing genomic DNA were dissolved in 1ml TE buffer containing DNase free RNase and incubate for 30 min at RT for RNA degradation.

The genomic DNA was extracted once with phenol: chloroform (1:1) and twice with chloroform: isoamyl alcohol (24:1).

DNA was precipitated with 0.7 volume isopropanol, keep it at-20C for 1 hr. Then centrifuge at 8,000 rpm for 10 min and supernatant was decanted by inverting the tube, dried at room temp.

Dissolved in Milli- Q water and quantified on Nano drop spectrophotometer.

24

Quantification of genomic DNA-:

The genomic DNA dissolved in Milli-Q water was taken for quantification by UV absorbance at 260 nm. To measure the concentration, Eppendorf Biophotometer was used. Reference was set against sterile Milli -Q water and then after absorbance of the sample was measured at 260 nm and 280 nm. The concentration in ng/ l was recorded on the screen along with the optical density at 260 nm, 280 nm and ratio of OD 260/280. An O.D. of 1.0 at 260 nm is equivalent to 50 g/l of double stranded DNA. The ratio of OD 260/280 gave an indication of the amount of RNA or protein contamination in the preparation. A value of 1.8 is optimum for best DNA preparation. A value of the ratio below 1.8 indicates the presence of protein in the preparation and a value above 1.8 indicates that our sample has RNA contamination.

Agarose gel electrophoresis of the genomic DNA-:

Agarose gel electrophoresis of the isolated genomic DNA was performed to know about the quality and quantity of DNA. Larger molecules migrate slower because of greater frictional drag and they form their way through the pores of the gel less efficiently than smaller molecules. As the size of genomic DNA is quite big, a 0.8% gel was used to visualize the genomic DNA. A 0.8% gel resolves DNA molecules in the range of 0.7-8.5 kb (Fig-1).

3.3. PCR amplification

Following primers were selected for PCR amplification and Sequencing Gene or spacer region psbA-trnH psbA3'f TrnHf rbcL 1.1F 724.1R matK 5GTTATGCATGAACGTAATGCTC3 5CGCGCATGGTGGATTCACAATCC 3 5ATGTCACCACAAACAG3 5ATGTACCTGCAGTAGC3 Primer sequence

25

matK NBRI F1 matK 3.2r ITS ITS5A(F) ITS4(R)

5TCCCCATCCATCTGGAA3 5CTTCCTCTGTAAAGAATTC3

5CCTTATCATTTAGAGGAAGGAG3 5TCCTCCGCTTATTGATATGC3

Genomic DNA isolated from the leaf sample was subjected to PCR amplification using the forward and reverse primers of rbcL, matK, trnH- psbA and ITS. PCR amplification was performed in 50 l volume in a thermocycler (Gene Amp 9700, Perkin Elmer, and USA).

PCR reaction was set up as following in a 0.2 ml PCR tube-:

Template DNA (20-100ng) DNA Taq buffer (10X) dNTPs mixture (4mM) Primer F (10 pmol) Primer R (10 pmol) Taq DNA Polymerase (5U/l) Milli-Q water Total

: : : : : : : :

1 l 5.0 l (1X) 2.5 l (.2mM) 2.0 l (10-20 pmol) 2.0 l (10-20 pmol) .5l(2.5U) 37 l 50.0 l

PCR Programme -:
Cycle for amplification of rbcL, matK, trnH-psbA & ITS

26

Cycle First cycle 34 Cycle Last cycle

Denaturation 94C 94C 4 min 40 second -

Annealing 48-58 C 45 second -

Polymerization 72C 72C 1 min 7 min

Annealing temperature was variable according to the melting temperature of the primers.

27

3.3.1 Agarose gel electrophoresis of the PCR Amplicons-:

The horizontal electrophoresis system was used to separate, identify and purify DNA fragments using different concentration of agarose gel matrix and appropriate electrophoresis buffer (Sam brook et al., 1989). The edges of the gel-casting tray supplied with the electrophoresis assembly (Bangalore Genei, India) were sealed with adhesive tape to form an enclosed chamber and the comb of appropriate thickness was adjusted on sides of the chamber. Desired amount of agarose (Sigma, USA) was dissolved in desired volume of 0.5x TBE buffer (90 mM Tris base, 90 mM boric acid, 2 mM EDTA, pH 8.0) to get required concentration of agarose gel matrix by heating in microwave oven, until the agarose was completely dissolved. The solution was allowed to cool at 50-55oC . Ethidium bromide solution (0.5g/ml) was added and poured into casting tray and allowed to solidify. The comb and side tape were removed from the casting tray and gel was transferred to electrophoretic chamber filled with sufficient amount 0.5x TBE buffer. The DNA samples were mixed with gel loading dye (0.25% bromophenol blue in 4% w/v sucrose) in 4:1 ratio and loaded in wells. Electrophoresis was performed at desired constant voltage by connecting the chamber with electric power supply instrument (Pharmacia EPS 500, Bio-Rad 200/2.0) to allow the DNA to migrate from the cathode to anode. The gel was allowed to run for about 80% of its length. The gels was examined on UV transilluminator (Fotodyne) and documented on gel documentation system (Bio-Rad, USA). Amplified DNA was then eluted by PCR clean up kit or by Gel Extraction.

28

3.3.2. PCR Clean up from Kit (Nucleospin extract II, MACHEREYNAGEL)

Adjust DNA binding condition. Volume of PCR reaction is 50 ml. Make it upto 100ml by adding distilled water. Mix 1 volume of sample with 2 volumes of buffer NT (Binding Buffer). Load the sample on the Qiagen quick spin column, placed in a 2ml collection tube and centrifuge at 1000 rpm for 1 min discard flow through. Wash silica membrane. Add 600l Buffer NT3 (Wash Buffer), centrifuge at 11000 rpm for 1 min discard flow through. Give the blank spin at 13,000 rpm for 1 min. Dry the column (silica membrane) at room temperature for 5-10 min. For DNA elution, place the column in clean 1.5 ml eppendrof tube. Add 25lof MQ. Keep at room temperature for 5 min. centrifuge at 10,000 rpm for 1 min. DNA is been collected in the tube.

3.4 Sequencing PCR and Clean up-:

Samples are prepared for sequencing after clean up 200- 300ng DNA is required for sequencing. Template was lyophilized. PCR Reaction- Total reaction volume- 5l Template (100-200ng) Buffer Primer (10pmol/ l) : : : 2 l 1.75 2l
29

Big Dye Reaction Mixture Milli-Q water Total

: : :

.5l 5.75 10

3.4. Sample Sequencing and Analysis:

Samples are prepared for sequencing after clean up. 200- 300ng DNA is required for sequencing. Sequencing PCR set up reaction- Total reaction volume- 10l

Master Mix-: Template (100-200ng) Dilution buffer Primer (10pmol/ l) Ready Reaction Mix (2.5x) Milli-Q water Total 1 l 1.75l 0 .5 l 0 .5 l 6.25 10 l

PCR Programme set up : Step 1: Rapid thermal ramp to 96Cfor 1 min. Initial denaturation at 96C for 10sec Step2: Repeat the following for 25 cycle: Rapid thermal ramp to 96C Denaturation at 96C for 10 sec Rapid thermal ramp to 50C Primer annealing at 50C for 5 secs. Rapid thermal ramp to 60C.

30

Extension for 5mins. Step:3 Rapid thermal ramp 4C and hold until ready to purify.

Protocol for purification of Sequencing PCR Product: Ethanol/EDTA Plate Precipitation method:
Add 12 l of Sol-I having 125mM EDTA to pcr reaction product and mixed. Add 52 l of Sol-II containing 200 l of 3M sodium acetate (4.8pH) and 5 ml absolute ethanol mixed it by inversion. Incubate at RT for 15 min. Spin at a speed 3,850 rpm for 30 min at RTC. Decant the supernatant and add 100 l 70% ethanol. Spin at 3,850 rpm for 30 min at RT. Dry the pellet by centrifuging it in invert condition and then kept it at 37C for 10 minutes.

Denaturation with HI-Dye

1Add 10 l Hi-Dye formamide in each tube then kept in PCR at 98 C And keep it on ice Kept it for sequencing in ABI- capillary sequencer. Sequencing was performed bidirectionally.

After 1hr sequence is obtained.

31

RESULTS AND DISCUSSION

.

32

Results and Discussion-:

Genomic DNA Isolation: Genomic DNA of tree species: Genomic DNA was isolated from leaves of tree species collected from different parts of UP following CTAB method as described in materials and methods. Quantity of genomic DNA was measured using nanodrop spectrophotometer and quality was checked on ethidium bromide stained 0.8% agarose gel electrophoresis. Quality of genomic DNA was quiet good as revealed in Fig. 1.

Figure 1: Ethidium stained agarose gel showing gDNA from tree samples

33

The quality and the yield of gDNA varied depending on tree species. Some tree species have high phenolic substances which hindered isolation of good quality DNA. Quality of DNA also depends on age of the leaf materials used for DNA extraction. In general we observed that fresh and young leaves yielded good quality DNA as compared to preserved and old leaves. Genomic DNA could not be isolated following standard CTAB method because of very high content of phenolic substances. We need to modify the protocol to isolate gDNA from these species.

PCR amplification of genomic DNA with selected barcode loci Four different barcode loci viz. ITS, matK, rbcL and trnH-psbA were tested in different tree species to check the PCR amplification efficiency. The PCR success rate of different loci are given in table 1. The highest PCR success was observed with rbcL (97%) followed by ITS (92%), trnH-psbA ( 85%) and matK (66%). Other studies have also reported that rbcL is a good barcode locus as far as PCR amplification rate is concerned. Similarly our results also support the finding of others that matK is the least successful barcode locus as far as PCR amplification is concerned. Quality of PCR amplification of trees genomic DNA was quiet good. A representative agarose gel of PCR product with rbcL, ITS and trnH-psba and matK primers are shown in Fig 2, 3, 4 and 5 respectively

Figure 2: Agarose gel electrophoresis of PCR products using rbcL primers

34

Figure 3: Agarose gel electrophoresis of PCR products using ITS primers

Figure 4: Agarose gel electrophoresis of PCR products using trh-psbA primers

Figure 5: Agarose gel electrophoresis of PCR products using matK primers

PCR clean up and Sequencing of PCR products-: The samples which showed positive PCR reactions were cleaned up using commercially available kits. This step removes the unused dNTPS and other chemicals. The cleaned up PCR product was again quantified using nanodrop spectrophotometer and checked on agarose gel. The quality and quantity of the cleaned up products were very good. This ensures that the sequencing of the PCR products will be off good quality. After cleaned up, 20 -30 ng of template DNA was used for sequencing reaction following manufacturers protocol as described in materials and methods. The representative eltrophorogram of sequences is shown in Fig 7. The sequencing success rate of different loci
35

is predicted in Table 1. Sequencing success ranged from 85% for rbcL to 50% for matK (Table 1). The alignment of sequences was straight forward except in case of trnH-psbA, due to high variation in sequence length. The mean sequence lengths of ITS (ITS1+5.8S+ITS2), matK, rbcL and trnH-psbA were 602.2, 488.1, 479.0 and 410.0bp, respectively (Table 1). This lower success rate of PCR using matK may be due to the instability and the uniqueness of the primer 3'-end in matK sequences of as reported in other cases.

Figure 7: The representative electropherogram of sequences

# species Locus

Mean sequence length

%PCR success

% success

Mean distances (k2p) 0.0100.001 0.0030.001 0.0010.0004 0.0070.002

Mean intraspecific distances(k2p) 0.0020.001 0.0010.001 0.00010.0002 0.00070.001

sequencing interspecific

ITS matK Rbcl trnHpsbA

60 60 60 60

602.2 478.1 469.0 410

92 66 97 85

71 50 85 72

Table 1: Results for four loci tested in species of the representatives species-:

36

In most of the recent plant barcoding studies, the coding regions of matK and rbcL and the non-coding plastid intergenic spacer of trnH-psbA have been suggested as prime candidates for barcoding. Following the first suggestion by Kress et al. (2005) several subsequent reports projected trnH-psbA as a strong candidate for plant barcoding. However, Consortium for the Barcoding of Life (CBOL) disregarded trnH-psbA as it does not consistently provide bidirectional unambiguous sequences reads Erstwhile studies have focused predominantly on plastid regions for barcoding. Chase et al. (2005) and Kress et al. (2005) recovered highest mean percentage sequence divergence (2.81 and 5.7% respectively) for nrITS region for plant barcoding. However, the use of ITS region as barcode locus has often been considered unfavourable because of the presence of paralogues in several plant taxa. Yet, in other studies, ITS has been used successfully as barcode locus. More recently, ITS2 has been projected as an important plant barcode locus. In the present study, we attempted to extract good quality gDNA from diverse group of tree species. Following gDNA isolation, PCR and sequencing success rate were evaluated using different barcode loci. The sequences were corrected and aligned. However, detailed analysis for barcoding purposes remains to be worked out.

37

REFERENCES-:
Adams ,K.L and Palmer, J.D. 2003 .Mol.Phylogenet. Evol. 29: 380-395. Ahuja, P.S. (2003). In Medicinal Plants in India: Report and Directory, Institute of Economic and Market Research, New Delhi. Ali, M. and Ansari, S. M. (1998). Studies of some herbal drugs used as hair tonic. Hamdard Medicus. 41(2):107-108. Amarger, V. and Mercier, L. (1995). Biochimie. 72:931-936. Anon. (1982). Markets for Selected Medicinal Plants and their Derivatives. International Trade Centre UNCTAD/GATT, Geneva, Switzerland. Anon. (1987). Rare and Endangered Plants of China. Shanghai Educational Press, Shanghai, China (in Chinese). Anon. (1993). Medicinal Plants of Nepal. Bulletin of the Department of Medicinal Plants No. 3. His Majestys Government of Nepal, Ministry of Forests and Soil Conservation, Department of Medicinal Plants,Thapathali,Kathmandu, Nepal Anon. (1997b). IUCN Analyses of the proposals to amend the CITES Appendices. Prepared by the IUCN Species Survival Commission and the TRAFFIC Network for the tenth meeting of the Conference of the Parties to CITES. IUCN The World Conservation Union, Gland, Switzerland. Anonymous, (1966). The Wealth of India: Raw Material, CSIR, New Delhi, vol. VII. Anonymous, (1996). Medicinal Plants Source Book of India, Natraj Publishers, Dehradun. Avise, J.C. and Hamrick, J.L. (1996). Conservation genetics, case histories from nature. Chapman and Hall, New York, USA, pp 1-9. Barth, S., Melchinger, A. E. and Lubberstedt, T. (2002). Mol. Ecol. 11:495-505.

38

Barton, K.A., Binns, A.N., Matzke, A.Z.M. and Chilton, M.D. (1983). Regeneration of intact tobacco plants containing ful lenth copies of genetically engineered T-DNA, and transmission of T-DNA to R1 progeny. Cell. 32:1033-1043. Bennet, S.S.R. and Gaur, R.D. (1983). A few highly exploited species needing special attention of conservationists. In: SK Jain and RR Rao (Eds.) An Assessment of Threatened Plants of India. BSI. Howrah. pp. 283-286. Bhakuni, D.S., Maheswari, M.L., Dhawan, B.N. and Mehrotra, B.N. (1969). Indian J Chem. 9:250. Buldewo, S. and Jaufeerally-Fakim, Y.F. (2002). Isolation of clean and PCR-amplifiable DNA from Anthurium andreanum. Plant Molecular Biology Reporter, March 2002. 20(1):71a-71g. Chase, M.W., Salamin ,N., Wilkinson ,M., Dunwell, J. M. And Kesanakurti.,R.P.2005. Land plants and DNA barcode: short- term and long- term goals. Philostrans., Ser B .360: 1889- 1895. Chase, W. Mark., Cowan, S. Robyn., Hollingsworth, M. Peter., Berg den ,van Cassio., Madrinan, Santiago., Peterson Gitte., Seberg ,Ole., Jorgsensen Tina., Cameron, M. Kenneth., Carine, Mark., Pedersen, Niklas., Hedderson J.A., Conrad ,Ferozah., Salazar ,A. Gerardo., Richardson E.James., Hollingsworth, L. Michelle., Barraclough ,G., Kelly ,Laura., and Wilkinson ,Mike .2007. A proposal for a standardized protocol to barcode all land plants. Taxon 56(2):295-299 Cho, Y., Qiu, Y.L., Kuhlman, P., and Palmer, J.D., 1998. Proc. Natl. Acad. Sci. USA 95, 14244- 14294. CAMP, Workshop Proceedings, WWF India, Z00/CBSG, UP Forest Department, 1997. Chauhan, R.S. (2004). Ecophysiology, agro-technology and trade of an endangered medicinal herb Nardostachys jatamansi DC, D Phil thesis, HNB Garhwal University, Srinagar Garhwal, Dhar, U. (2002). Conservation implication of plant endemism in high altitude Himalayan. Curr. Sci. 82:141-148.

39

Dhar, U., Manjkhola, S., Joshi, M., Bhatt, A., Bisht, A.K. and Joshi, M. (2002). Current status and future strategy for develpoment of medicinal plants sector in Uttaranchal, India. Current Science. 83(8):956-964. Dhar, U., Rawal, R.S. and Upreti, J. (2000). Biol. Conserv. 95:5765.. Doyle, J.J., Doyle, J.L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19:1115. Deguilloux, M.F., Pemonge, M.H., and Petit, R.J., 2002. Proc. R. Soc. London Ser. B269, 1039-1046. Fang, G., Hammer, S. and Grumet, R. (1992). A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13(1):52-54. Francisco-Ortega, J., Santos-Guerra, A., Kim, S.C. and Crowford, D.J. (2000). Plant genetic diversity in the Canary Island: A conservation perpective. Am.J. Bot. 87:909. Hamrick, J.L. (1983). The distribution of genetic variation within and among natural plant populations. In: Schonewald-Cox CM, Chambers SM, McBryde B, Thomas WL (Eds) Genetics and Conservation. Benzamin/ Cummings, Menlo Park, CA, USA, pp.335 348. Heslop-Harrison, J. (1974). Genetic resource conservation: the end and the means. Journal of the Royal Society of Arts. February 1974: 157-69. Hebert, P.D.N., Cywinska A., Ball ,SL., and de Waard, J.R., 2003. Proc.R. Soc. London Ser. B 270, 313-321. Hebert ,P.D.N., Ratnasingham, S., and de Warrd, J.R.2003. Proc. R.Soc. London Ser. B 270, Suppl. 1, S 96-S99 Hebert, P.D.N., Stoeckle, M Y., Zemlak, T.S., and Francis, C.M. 2004.Plos Biol. 2, e312. Hebert ,P.D.N., Penton ,E.H., Burns, J.M., Jansen, D.H .,and Hallwachs, W. 2004. Proc Natl. Acad. Sci. USA 101, 14812-14817. Hofreiter, M., Poinar, H.N., Spaulding, W.G., Bauer, K., Martin, P.S., Possnert, G., and Paabo, S. 2000. Mol.Ecol. 9, 1975-1984.

40

Jackson, R.B., Moore, L.A., Hoffman, W.A., Pockman, W.T., and Linder, C.R.1999.Proc. Natl. Acad. Sci. USA 96, 11387-11392. Jain, S.K., Sastry, A.R.K. (1984). The Indian Plant Red Data Book-I Botanical, Survey of India, Department of Environment, New Delhi, India. Jayaram, K. and Prasad, M.N.V. (2008). Genetic diversity in Oroxylum indicum (L.) Vent. (Bignoniaceae), a vulnerable medicinal plant by random amplified polymorphic DNA marker.African. Journal of Biotechnology 7(3):254-262. Jenkins, D.W. and Ayensu, E.S. (1975). One-tenth of our plant species may not survive. Smithsonian 5(10):92 96. Kim Young-Dong., and Jansen K. Robert .1998 .Chloroplast DNA restriction site variation and phylogeny of the Berberidaceae. American journal of Botany 85(12): 1766-1778 Kress W.J., Wudrack K.J., Zimmer E.A., Weigt b. A and Jansen D.H. 2005. Use of DNA barcode to identify flowering plants. Proc. Natl. Acad. Sci. U.S.A. 102: 8369-8374 Karki, M.B. (2002). Organic Conservation & Certification: A strategy for Improved ValueAddition and Marketing of Medicinal Plants Products in the Himalayas; Paper presented at the Regional Workshop at Wise Practices and Experimental Learning in the Conservation and Management of Himalayan Medicinal Plant; December 15-20, 2002; Kathmandu, Nepal. Katterman, F.R.H. and Shattuck, V.I. (1983). An effective method of DNA isolation from the mature leaves of Gossypium species that contain large amounts of phenolics, terpeniodes and tannins. Preparative Biochemistry 13:347-359. Keb Llanes, M., Gonzalez, G., Chi-manzanero, B. and Infante, D. (2002). A rapid and simple method for small scale DNA extraction in Agavaceae and other tropical plants. Plant Molecular Biology Reporter 20(3):299a-299e. Khanuja, S.P.S., Shasany, A.K., Darokar, M.P. and Kumar, S. (1999). Rapid isolation of DNA from dry and fresh samples of plants producing large amounts of secondary metabolites and essential oil. Plant Molecular Biology Reporter 17(1):74. Melville, R. (1970a). Plant conservation and the Red Book. Biological Conservation 2:185-8.

41

Murashige, T. (1974). Plant propagation through tissue culture, Ann. Rev. Plant Physiol. 25: 135-65.. Nautiyal, B.P., Chauhan, R.S., Vinay Prakash, Purohit, H. and Nautiyal, M.C. (2003). Population studies for the evaluation of germplasm and threat status of the alpine medicinal herb Nardostachys, Jatamansi. Plant Genet. Resour Newsl. 136:34-39. Nei M, Li, W.H. (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci, 76:5269-5273 Newmaster S.G., Fazeska, Ragupathy S (2006) Botany 85 DNA barcoding in land plants: evaluation of rbcL in a miltugene tiered approach. Can J Bot 84: 335-441. Pionar, H.N., Hofreiter, M., Spaulding, W.G., Martin, P.S., Stankiewicz, B.A., Bland, H., Evershed, R.P., Possnert, G. and Paabo.S. (1998) Sci. 281, 402-406. Padmalatha, K., Prasad, M.N.V. (2007). Inter and intra population genetic variation in Raulvolfia serpentine Benth.ex.Kurz- an endangered medicinal plant.Med. Arom. Plant Sci. Biotechnol. 1:118-123. Polunin, O. and Stainton. A. (1984). Flowers of the Himalaya, 580 pp. Oxford University Press, Delhi. Porebski, S., Bailey, L.G. and Baum, B.R. (1997). Modification of a CTAB DNA extraction protocol for plant containing high polysaccharide and polyphenol components. Plant Mol. Biol. Reptr. 15:8-15. Scotland R., Hughes C., Bailey D. and Wortley A. (2003) Syst. Biodiv. 1,139-143 Samant, S. S., Dhar, U. and Palni, L. M. S. (1998). Medicinal Plants of Indian Himalaya Diversity, Distribution and Potential Values, Gyanodaya Prakashan, Nainital, 1998. Schluter, C. and Punja, Z. K. (2002). Genetic diversity among natural and cultivated feild populations and seed lots of American ginseng (Panax quinquefolius L.) in Canada. International J Plant Sci. 163 (3):427-439. Scott, K.D. and Playford, J. (1996). DNA extraction technique for PCR in rain forest plant species. Biotechniques 20(6):974-978.

42

Sharma, A.D., Gill., P.K. and Singh, P. (2002). DNA isolation from dry and fresh samples of polysaccharide-rich plants. Plant Molecular Biology Reporter, December 2002, vol. 20, no. 4, p. 415a-415f. Shasany, A. K., Darokar, M.P., Saikia, D., Rajkumar, S., Sundersan, V. and Khanuja, S.P.S. (2003). Genetic diversity and species relationship in Asparagus spp. using RAPD analysis. J Medicinal and Aromatic Plant Sciences. 25 (3):698-704. Seberg, O., Humphries, C.J., Knapp, S., Stevenson, D.W., Peterson, G., Scharff, N. and Andersen, N.M. (2003) Trend Plant Sci.7: 642-644. Shaw J., Lickely E.B., Schilling E.E., and Small R.L. (2007). Comparison of whole chloroplast genome sequences to choose non coding regions for phylogenetic studies in angiosperms. The tortoise and the hare III. Amer.J. Bot. 94:275-288 Singh, M., Bandana, and Ahuja, P.S. (1999). Isolation and PCR amplification of genomic DNA from market samples of dry tea. Plant Mol Biol Rep. 17:171-178. Starling, R. (1985). Saving endangered species. Agric.Rep. 5.6. Tandon, V. (1996). Med Plant Conser. Newl. 2:12-13 Wachira, F.N., Waugh, R., Hackett, C.A. & Powell, W. (1995). Detection of genetic diversity in tea (Camellia sinensis) using RAPD markers. Genome. 38: 201-210. Warude, D., Chavan, P., Kalpana, J. and Patwardhan, B. (2003). Plant Mol. Biol. Rep. 21: 1. Weishing, K., Nybom, H., Wolf, K. and Meyer, W. (1995). DNA isolation and purification.In: DNA fingerprinting in plants and fungi. pp 44-59. Welsh, J. and McClelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucl. Acids Res. 18: 7213-7218. Welsh, J. and McClelland, M. (1991). Genomic fingerprints produced by PCR with consensus tRNA gene primers. Nucleic Acids Res 19: 861-866.

43