Vous êtes sur la page 1sur 11

B i o l o g í a

Descripción del epitelio epididimario de Leptonycteris


curasoae (Chiroptera: Phyllostomidae) con base en el índi-
ce espermatogénico

Claudia Karina Torres

Resumen

Una de las funciones del epidídimo es el almacenamiento y la maduración de los


espermatozoides. En este trabajo, se observó que en la región caudal del epidídimo de
Leptonycteris curasoae (Chiroptera: Phyllostomidae), el epitelio de los túbulos epididimarios
y su diámetro varían según el periodo reproductivo. De un epitelio cúbico y diámetro peque-
ño en estado infértil, a uno pseudoestratificado, con vellosidades, células apicales y un diá-
metro luminal mayor –además de presentar espermatozoides en la luz–, en estado fértil. Esta
información puede ser utilizada como un índice del estado reproductivo de un organismo.

Introducción

El aparato reproductor masculino de los Chiroptera: epidídimo y deferente), y un órgano copulador (Fi-
Phyllostomidae está formado por testículos (órga- gura 1). El tamaño y la actividad de las glándulas
nos sexuales primarios); glándulas accesorias –vesí- accesorias y de los conductos son controlados a tra-
culas seminales, próstata y glándulas bulbouretral– vés de hormonas secretadas por los testículos, cuyo
(las cuales participan en la formación del semen o tamaño y actividad varía durante el ciclo anual (au-
plasma seminal); un sistema de conductos (eferentes, mentan durante el periodo reproductivo).

Figura 1. Aparato reproductor de Pipistrellus hesperus. Se distinguen los órganos que lo componen: vesícula seminal (VS), próstata (P),
conducto deferente (D), epidídimo (E), testículo (t) y glándulas de Cowper (GC) (Krutzch, 2000)

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 7


B i o l o g í a

Existen pocos estudios sobre los cambios histológicos Las funciones del epidídimo son:
del epitelio glandular y de los conductos que sufren
los murciélagos a lo largo de su ciclo reproductivo 1) Absorción y modificación de los líquidos
(Krutzch, 2000); por tal motivo, el objetivo de este seminales
trabajo se centra en el estudio de la región caudal
2) Maduración del espermatozoide
del conducto epididimario de Leptonycteris curasoae
(Chiroptera: Phyllostomidae), tomando como refe- 3) Modificación de su perfil metabólico
rencia estudios previos sobre la determinación de
su periodo reproductivo (Torres y Rojas, 2001 y 2002). 4) Modificación del plasmalema (Kirchhof, 1999)

5) Almacenamiento del esperma


El epidídimo es un conducto que poseen los mamí-
feros, ampliamente contorneado, limitado interna- 6) Expulsión del esperma (Borysenko, Borysenko,
mente por un epitelio simple (Figura 2). Su morfo- Beringer y Gustafson, 1985; Toshimori, 1998)
logía varía a lo largo de su superficie, pues presenta
epitelio columnar, cúbico y pseudoestratificado con Los espermatozoides, durante su maduración a tra-
células secretoras ciliadas o con esterocilios (Cooper, vés del epidídimo, adquieren movilidad y capacidad
1999; Estrada y Uribe, 2002). El epitelio está rodea- para unirse a la zona pelúcida mediante receptores
do por capas de músculo liso y tejido conectivo que se expresan sobre la parte del plasmalema que
vascularizado. Macroscópicamente, se divide, por lo rodea el acrosoma (Geneser, 2000).
general, en tres regiones: cabeza, cuerpo y cola. Esta
última porción sirve como almacenamiento. En con-
junto, no corresponden a áreas del conducto histoló-
gicamente diferentes. Objetivo

Determinar algunos cambios citológicos e histológicos


Figura 2. Esquema de un corte transversal del epidídimo. Se ob-
del epitelio de la cola del epidídimo de Leptonycteris
servan el conducto eferente (D) y el conducto epididimario (E) con
células basales (b) y principales (p). Rodeando al epitelio se curasoae a lo largo de dos ciclos anuales.
encuentra el músculo liso (l) (Borysenko et al., 1985) epidídimo de
un organismo infértil (IE 1)

8 INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA


B i o l o g í a

Metodología distinguibles, también se observan células apicales. En


la luz se encuentran los espermatozoides (Figura 6).
Se realizó la descripción histológica, al microscopio
óptico, de cortes de la región caudal del epidídimo
de 57 ejemplares de Leptonycteris curasoae –colec- Figura 3. Epidídimo de un organismo con índice espermatogénico
tados en la localidad de Santiago Nochixtlán, cada 1 (infértil) , (1000x) H-E. Se observa un epitelio de tipo cilíndrico
(d) con núcleos basales y en algunos túbulos se distingue un epite-
90 días, de julio del 2000 a mayo del 2002–, los cua- lio cúbico (b). La luz se encuentra vacía (u) y existe abundante teji-
les fueron previamente procesados con la técnica do conectivo (c)
histológica e incluidos en parafina con un punto de
fusión de 56 oC. Los cortes se hicieron de 5 mm de
grosor y fueron teñidos con las técnicas de tinción
H-E y Tricrómica de Gallego (Aguilar, Cautiño y Sali-
nas, 1996).

Los parámetros analizados fueron la descripción del


epitelio epididimario de la región caudal y el diá-
metro de la luz de los túbulos epididimarios, para
lo cual se utilizó el ocular y la reglilla micrométrica,
se midió una muestra de 50 túbulos al azar por
epidídimo de cada ejemplar (Hernández, 1990). Los
resultados fueron procesados estadísticamente me-
Figura 4. Epidídimo de un organismo con índice espermatogénico
diante las medidas de dispersión (Spiegel, 1992) y 3, (1000x) H-E. Se distingue un epitelio pseudoestratificado (ps),
se relacionaron con el índice espermatogénico (IE) células apicales (a) y microvellosidades (v) hacia la luz del túbulo,
en el cual hay espermatozoides (e). Entre los túbulos epididimarios
(Grocock y Clarke, 1973).
se observa tejido conectivo (c) y rodeando a cada uno se localizan
células musculares lisas (l)

Resultados

Descripción histológica de la región caudal del


epitelio epididimario

Los epidídimos correspondientes a organismos


infértiles (IE1 y 2) presentan –en cualquier época
del año– un epitelio cilíndrico, con núcleos ovales
en posición basal; en algunos túbulos se observan
células cúbicas con núcleos redondos, no se distin-
guen microvellosidades y la luz se encuentra vacía
(Figura 3). Figura 5. Epidídimo de un organismo con índice espermatogénico
3 sin espermatozoides, (1000x) H-E. Se puede apreciar un epitelio
pseudoestratificado (ps) rodeando la luz (u) del conducto epidi-
En los organismos fértiles, dependiendo del índi- dimario. También se presentan células apicales (a) y, rodeando el
ce espermatogénico, se distinguen las siguientes conducto, células de músculo liso (l)
características:

Con índice espermatogénico 3, se aprecia un epite-


lio pseudoestratificado, con núcleos redondos, pre-
sencia de microvellosidades y células apicales. La luz
puede presentar espermatozoides (Figura 4) o estar
vacía (Figura 5).

Con índice espermatogénico 4, se distingue un epite-


lio pseudoestratificado con núcleos ovales y en posi-
ción basal con microvellosidades abundantes y

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 9


B i o l o g í a

Con índice espermatogénico 5, se observa un epite- Diámetro de los túbulos epididimarios


lio pseudoestratificado con núcleos ovales y basales,
con presencia de células apicales y pocas microve- Los diámetros de la luz de los túbulos epididimarios
llosidades (Figura 7), en algunas regiones disminu- correspondientes a IE 1 y 2 (infértiles) presentan un
ye el tamaño de las células epiteliales, no se distin- promedio de 24.4 mm ± 4.3: los de IE 3 (fértiles),
guen las células apicales y se presentan pocas uno de 26.7 mm ± 3.1; los túbulos de epidídimo co-
microvellosidades (Figura 8). rrespondiente a IE 4 (fértiles), uno de 48 mm ± 1.3, y
los de IE 5 (fértiles), uno 65 mm ± 1 (Figura 9).
Figura 6. Epidídimo de un organismo con índice espermatogénico
4, (1000x) H-E. Se observa un epitelio cilíndrico (d) en algunos Figura 9. El diámetro del túbulo epididimario de la región caudal,
túbulos y, en otros, epitelios pseudoestratificados (ps). Se obser- aumenta conforme se incrementa el índice espermatogénico (IE), para
van espermatozoides en la luz (e) y en las microvellosidades (v). tener una mayor área de almacenamiento de los espermatozoides
Entre los túbulos se encuentra el tejido conectivo (c)

Diámetro del túbulo epididimario

Serie 1
70

60

50
Figura 7. Epidídimo de un organismo con índice espermatogénico
5 H-E, (1000x). Se observan espermatozoides (e) en la luz, el epitelio
Diámetro (micras)

es pseudoestratificado (ps) con microvellosidades (v) y la presencia


de células apicales (a). Rodeando a los túbulos se encuentran células
40
de músculo liso (l) y tejido conectivo (c)

30

20

10

0
Figura 8. Epidídimo de un organismo con índice espermatogénico IE 1,2 IE 3 IE 4 IE 5
5, (1000x) Tricrómica de Gallego. Se observan luces grandes llenas
de espermatozoides (e), rodeados por tejido conectivo (c), y deli-
Índice espermatogénico
mitadas por un epitelio cilíndrico (d), el cual descansa en una mem-
brana basal (mb)

Discusión

Se eligió analizar la región caudal del epidídimo,


porque es la zona donde se almacenan los es-
permatozoides, lo que puede utilizarse como un ín-
dice del periodo de reproducción de un organismo.
En el epitelio epididimario de la región caudal de
Leptonycteris curasoae se encontraron algunas simi

10 INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA


B i o l o g í a

litudes con el epitelio epididimario del humano, como Referencias


la presencia de un epitelio pseudoestratificado y la
variación de la altura del epitelio. En el caso del hu- Aguilar, M. M., Cautiño, B. y Salinas, P. (1996). Manual
general de técnicas histológicas y citoquímicas.
mano, el epitelio disminuye desde columnar alta de México: la Prensa de Ciencias, UNAM.
las células principales con largas microvellosidades en
la cabeza, hasta células cuboideas con microvello- Borysenko, M., Borysenko, J., Beringer, T. y Gustafson, A.
sidades algo más cortas en la cola (Borysenko et al., (1985). Histología funcional. México: Limusa.
1985), sin embargo en Leptonycteris curasoae se ob-
Cooper, T. G. (1999). Epididymis. En Enciclopedia of Re-
servó que estas variaciones se localizan en la región production (pp.15-24). New York: Academic Press.
caudal y están relacionadas con la madurez sexual
del organismo, observandose un epitelio cúbico en Estrada, E. y Uribe, M. C. (2002). Atlas de histología de
vertebrados. México: UNAM.
organismos infértiles, el cual va cambiando a pseudo-
estratificado en organismo fértiles con IE 4 y 5, ade- Geneser, F. (2000). Histología. México: Editorial Médica
más en estos últimos se distinguen células apicales Panamericana.
con núcleos picnóticos, lo cual nos indica que esas cé-
lulas tienen una mayor actividad; otra característica GrococK, C. A. y Clarke, R. (1973). Photoperiodic control
of testis activity in the vole. Microtus Agestis. J.
distintiva de este estado es la abundancia de las Reprod. Fert., 39: 337-347.
microvellosidades. Cuando el almacenamiento de
espermatozoides es mayor, las células epiteliales tien- Hernández, S. M. (1990). Manual de laboratorio,
de a disminuir en altura para permitir el acomodo de citología y citogenética. México: Trillas.
los mismos.
Kirchhof, C. (1999). Gene expression in the epididymis.
Int. Rev. Cytol., 188: 133-202.
Si relacionamos las características histológicas con
el diámetro del túbulo epididimario, se observa Krutzch, P. H. (2000). Anatomy physiology and cyclicity of
the male reproductive tract. En Crichton, E. G y Krutzch,
una correlación entre ambas, el diámetro tiende
P. H, Reproductive biology of bats (pp. 92-155).
a ser mayor, al aumentar el índice espermatogé- London: Academic Press.
nico lo que permite un mayor almacenamiento de
espermatozoides. Spiegel, M. R. (1992). Estadística. México: Mc Graw Hill,
serie “Schaum”.

Torres, C. K. y Rojas, A. (2002). Determinación del


periodo reproductivo de Leptonycteris curaosae
Conclusión (Chiroptera: Phyllostomidae) por medio de la
relación entre la morfología macroscópica y
microscópica del testículo y epidídimo. Investigación
El epitelio epididimario de Leptonycteris curasoae, Universitaria Multidisciplinaria, Universidad Simón
correspondiente a la región caudal con una función Bolívar, 1: 7-13
de almacenamiento de espermatozoides, presenta
Torres, C. K. y Rojas, A. (2001). Descripción histológica
un epitelio que varía de acuerdo con el estado repro-
estacional del epitelio seminífero de Leptonycteris
ductivo del organismo. En los organismo infértiles curasoae (Chiroptera: Phyllostomidae). Imaggen
es de tipo cúbico simple, sin vellosidades aparentes (número especial dedicado a la investigación),
Universidad Simón Bolívar, 54: 18-25.
y sin células apicales, y en organismos fértiles, se mo-
difica a cúbico y pseudoestratificado con vellosidades Toshimori, K. (1998). Maturation of mammalian
abundantes y células apicales, con una tendencia a spermatozoa: modifications of the acrosome and
disminuir su altura en organismos con IE 5. Otra ca- plasma membrane leading to fertilization. Cell. Tissue
Res., 293: 177-187.
racterística indicativa del cambio de actividad del
epidídimo caudal es el aumento del diámetro de la
luz de los túbulos epididimarios, el cual es directa-
mente proporcional con el aumento del índice
espermatogénico.

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 11


B i o l o g í a

Identificación y caracterización parcial del gen de la enzima


profenoloxidasa en Dactylopius coccus

Fernando García, Patricia Aguilar, Ana Beatriz Celma,


Humberto Lanz, Ignacio del Río y Fidel Hernández

Resumen

La profenoloxidasa (proFO) es la enzima clave de la ruta bioquímica de la fenoloxidasa, la cual


es responsable de activar varios mecanismos de defensa de los invertebrados, tanto para evitar
la entrada de microorganismos invasores, como para realizar la coagulación y cierre de heridas.
En este trabajo se obtuvo la secuencia parcial del gen de la proFO del insecto Dactylopius
coccus o grana fina del nopal, la cual presentó alto grado de homología con la enzima de
dípteros. Por otra parte, se observó que el RNA mensajero (RNAm) de la proFO se expresa en las
ninfas de primer y segundo estadio, así como en las hembras oviplenas del insecto.

Introducción melanina (Ashida y Brey, 1995); b) encapsulación y


melanización de microorganismos extraños, reac-
En los insectos, el sistema de la profenoloxidasa es ciones que forman estructuras que inmovilizan
un mecanismo regulador del sistema inmune cuya microorganismos invasores, y c) la producción de
activación depende de reacciones en cascada en quinonas citotóxicas, compuestos capaces de ma-
las que participan enzimas tipo serina proteasas, tar agentes infecciosos (Sugumaran y Nellaiappan,
las cuales son activadas por la presencia de compo- 1991).
nentes micóticos y bacterianos como los lipopoli-
sacáridos (LPS) y β1-3 glucanos (Zymosan). La acti- El sistema inmune de la grana fina (Dactylopius
vación del sistema de la fenoloxidasa desencade- coccus Costa) –insecto parásito del nopal que se cul-
na mecanismos de defensa de la integridad corporal tiva para obtener ácido carmínico (colorante rojo
del insecto, incluyendo la síntesis de melanina, polí- de uso comercial) (Llanderal y Nieto, 1999)– ha sido
mero capaz de recubrir el cuerpo de organismos poco estudiado. Las células originadas en el cuer-
invasores y de participar en el cierre de heridas, po graso de esta especie son portadoras de gránu-
entre otras funciones. los de ácido carmínico (Maza, 1999), y cuando en-
tran en contacto con azúcares propios de la pared
La melanización consiste en una serie de reaccio- celular bacteriana y de hongos –como el zymosan
nes que se inician con la hidroxilación de tirosina y la laminarina, entre otros–, se produce degranu-
para formar L-hidroxifenilalanina (L-DOPA) la cual, lación y ennegrecimiento del pigmento de los grá-
a su vez, se oxida y da lugar a diferentes compues- nulos, lo que sugiere una reacción similar a la
tos llamados dopacromos, y éstos, por su parte, melanización, la cual podría depender de la ruta
producen indolquinonas que se polimerizan y for- de la fenoloxidasa. También se ha observado que
man la melanina como producto final (Söderhall e cuando a la hemolinfa (HL) de D. coccus se le agre-
Iwanaga, 1996). La molécula clave en esta ruta es gan zymosan o péptidoglicanos, se presenta cierto
la proFO, la cual es una enzima bifuncional que consumo de carmín durante la reacción. Por otra
posee actividad de oxidoreductasa y de mono- parte, en la HL tratada con feniltiourea (FTU), un
oxigenasa y presenta, además, dos sitios de unión inhibidor específico de la proFO, se inhibe el con-
al cobre. La proFO está asociada a tres procesos sumo de carmín y no ocurre obscurecimiento de la
fisiológicos diferentes pero interrelacionados: a) HL, esto sugiere que el carmín podría ser meta-
endurecimiento de la exocutícula, proceso donde bolizado por la proFO (García, Lanz, Rojas y
se añaden a esta estructura las moléculas quitina y Hernández, 2002).

12 INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA


B i o l o g í a

Objetivo

La finalidad de este trabajo es identificar y secuenciar el gen de la proFO de la grana fina Dactylopius coccus,
así como analizar su expresión en diferentes estadios del ciclo de vida de este insecto.

Metodología

Reactivos. Los reactivos utilizados en este trabajo fueron de la más alta calidad y se obtuvieron de las compa-
ñías Sigma Chem (St. Louis Missouri), Invitrogen y PE Applied Biosystems. Los reactivos para electroforesis
provinieron de Gibco-BRL (Life Technologies).

Insectos. Se utilizaron insectos de la especie D. coccus cultivados en módulos de experimentación tipo cober-
tizo, ubicados en Coyotepec, Oaxaca, en terrenos de la compañía productora de grana Tlapanochestli.

Obtención de DNA genómico y amplificación de un fragmento de proFO. Para extraer el DNA de D. coccus
se utilizaron tres hembras adultas oviplenas. El tejido que se obtuvo fue homogenizado en un tubo de
microcentrífuga con 700 µl de DNAzol (Life Technologies, Rockville, Maryland) Las muestras fueron
centrifugadas a 4,000 x g durante 10 min a 4 °C. Se recuperó el sobrenadante (fase viscosa) y se agregaron
0.5 vol de etanol absoluto para precipitar el DNA. Posteriormente, se centrifugaron a 4,000 x g durante 3 min
a 4 °C. La pastilla recuperada se lavó dos veces con etanol a 75% y se resuspendió en 100 µl de NaOH 8 mM
(Ausubel et al., 1989).

Un fragmento del gen de la proFO fue amplificado por PCR usando iniciadores degenerados (amplifican un
dominio fuertemente conservado de la proFO en dípteros) usados previamente en Anopheles gambiae (Müller,
Dimopoulos, Blass y Kafatos, 1999):

PO-CuA 2.5mM

(5'CAICA(TC)TGGCA(TC)TGGCA(TC)CTIGT(GATC)TA(TC)CC-3')

PO-CuB 2.5 mM

(5'-CITGCCAAICG(AG)TA(AG)AAIAA(ACT)CG)GG(AG)TCIC(TG)CAT3')

Las reacciones se obtuvieron mediante 25 ciclos de 2 min a 94 °C, 1.5 min a 50 °C y 1 min a 72 °C. Las
reacciones de PCR incluyeron 0.2 U de TaqPolimerasa, d´NTPs 10 mM, MgCl2 2.5 mM y se llevaron a cabo en
un termociclador PE-2400.

Los fragmentos de DNA obtenidos por PCR se analizaron a través de electroforesis en geles de agarosa (Gibco-
BRL) a 1.5%, en amortiguador Tris-acetato-EDTA (TAE 1X: tris-acetatos 40 mM, EDTA 1 mM pH 8.0), como
marcador de tamaño molecular se utilizó una escalera de moléculas de DNA en múltiplos de 100 pb.

Análisis de expresión por RT-PCR. La expresión del gen de la proFO en los diferentes estadios del ciclo de vida
de D. coccus fue examinado mediante transcripción reversa y reacción en cadena de la polimerasa (RT-PCR).
Para esta prueba, el RNA total de ninfas de primer estadio, ninfas de segundo estadio y hembras adultas fue
purificado usando TrizolMR (Life Technologies, Rockville, Maryland). Se utilizó un microgramo de RNA para
sintetizar cDNA, para la cual sirvió como iniciador oligo(dT17), también se usó la enzima SUPERSCRIPT IIMR
(purificada de E. coli recombinante que contenía el gen de la retrotranscriptasa del virus de leucemia murina).

La amplificación de la secuencia de la proFO se hizo con los oligos PO-CuA y POCuB con el cDNA de D. coccus,
como se mencionó anteriormente. Para controlar el experimento de RT-PCR se usó el gen de actina, conside-
rado de expresión constante. Para la amplificación de la actina se utilizaron los iniciadores:

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 13


B i o l o g í a

ActFOR 5´- ACATGGAAAATCTGTGCACCACA-3´ y

ActREV 5´- ACAGCTTTTCTTTGATGTCGCGAA -3´

que amplifican un fragmento de actina de Anopheles albimanus. La amplificación se realizó a través de 28 ciclos
de 3 min a 94 °C, 1 min a 50 °C y 2 min a 72 °C (oligos amablemente donados por el D. en C. J. Martínez
Barnetche).

Secuenciación de los fragmentos de cDNA y DNA genómico amplificados. Los productos amplificados que
presentaron el tamaño esperado fueron purificados y clonados mediante el sistema TA CloningMR (Invitrogen),
de acuerdo con las instrucciones del proveedor. Los fragmentos de DNA de las clonas obtenidas se secuenciaron
con el método de amplificación por PCR en presencia de dideoxinucleótidos como terminadores de la reacción
(Big DyeMR Applied Biosystems). Como iniciadores de la reacción de secuenciación se usaron los oligonucleótidos
M13 (forward y reverse). Las reacciones fueron analizadas con el secuenciador automático ABI-PRISMMR (PE
Biosystems).

Análisis de secuencias. Las secuencias de DNA obtenidas se tradujeron en los marcos de lectura posibles por
medio del programa Sixframe, y las secuencias de DNA y productos de traducción deducidos se compararon
con las secuencias almacenadas en los bancos de datos GenBank Invertebrates y Swissprot mediante los pro-
gramas BlastX y BlastN. El alineamiento de las secuencias de aminoácidos de las clonas (proFO 900 y proFO
680) de D. coccus se hizo utilizando el programa de alineamiento múltiple CLUSTALW (Múltiple Sequence
Alignment). Basados en las similitudes de secuencia entre las proFO, se construyeron árboles filogenéticos
utilizando el programa PHYLIP (Felsenstein, 1993). Estos programas y bases de datos se encuentran dispo-
nibles en los portales de internet del National Center for Biotechnology Information (NCBI) http://
ncbi.nlm.nih.gov y San Diego Supercomputing Center (SDSC) http:// workbench.sdsc.edu.

Resultados Figura 1. Amplificación por PCR de la proFO de D.coccus a partir


de DNA genómico

Amplificación y análisis de un fragmento de la proFO


de D. coccus. A partir del DNA genómico de D.
coccus, se amplificó un fragmento de aproxima-
damente 900 pb (proFO-900) de la enzima PROFO
(Figura 1). Por otra parte, utilizando el cDNA de
D. coccus como molde, se obtuvo un producto de
680 pb (proFO-680) (Figura 5). Los dos fragmentos
fueron secuenciados.

Ambas amplificaciones poseen un marco de lectu-


ra abierto (ORF) que puede codificar para un seg-
mento de proteína de 295 aminoácidos (Figura 2).
El amplificado proFO-900 mostró, además, una se-
cuencia no codificante de 165 pb (Figura 4). Al com-
parar la proFO de D. coccus con las bases de datos
de invertebrados, se observó que posee una
homología de 23.6% con la proFO-A1 de Drosophila El DNA genómico de D. coccus fue usado como molde para ampli-
melanogaster (Fujimoto et al., 1995); 21.1% con la ficar mediante PCR un fragmento de la proFO, para la cual se uti-
proFO-2 de Bombyx mori (Ashida et al., 1998); 35.3% lizaron los oligos PO-CuA y PO-CuB del modo descrito en el apar-
tado de Metodología. Carril 1: escalera de moléculas de DNA en
con la proFO-2 de hemocitos de larvas de Sarcophaga múltiplos de 100 pb, utilizada como marcador de tamaño molecular.
bullata (Chase, Raina, Bruno y Sugumaran, 2000), y Carril 2: amplificación en la cual se usó como molde DNA genómico
18% con la proFO-8 de Anopheles gambiae (Müller de D. coccus. Carril 3: reacción de control negativo de PCR, carente
de DNA molde. Las muestras fueron analizadas en un gel de agarosa
et al., 1999). a 1.5% preparado en amortiguador TAE 1X.

14 INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA


B i o l o g í a

La secuencia de la proFO de D. coccus mostró características típicas de las proFO descritas: los residuos del
aminoácido 393 al aminoácido 418, que forman uno de los sitios de unión al cobre, son similares, en especial
las posiciones para los residuos metionina-arginina-ác. aspártico y prolina, que están conservados en las cua-
tro especies de insectos descritas anteriormente (Figura 2) (Chase et al., 2000). Al generar el árbol filogenético
mediante el programa PHYLIP, la proFO de D. coccus fue agrupada próxima a la proFO de S. bullata en una
rama independiente a las otras proFO (Figura 3).

Figura 2. Alineamiento de las secuencias de aminoácidos de proFO de diferentes insectos

La secuencia de aminoácidos deducida de las clonas proFO de D. coccus se alineó, mediante el programa CLUSTAL W, con las proFOs indicadas
de B. mori, An. gambiae, S. bullata y D. melanogaster. Los números señalados sobre los alineamientos corresponden a la numeración de
aminoácidos de la proFO de S. bullata tomada como referencia. = indica el sitio de unión al cobre; * = residuos idénticos; := grupos
fuertemente conservados; .= grupos débilmente conservados.. —— = “Gap” entre las secuencias.

Figura 3. Relaciones de parentesco entre las proFOs de diferentes insectos

Los alineamientos entre las proFOs de insectos fueron procesados mediante el paquete de programas PHYLIP para generar un árbol filogenético.

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 15


B i o l o g í a

Figura 4. Secuencia del producto proFO-900 de D. coccus

Las letras subrayadas indican la presencia de un probable intrón; las letras en tono claro, codones que bloquean el marco de lectura.

Figura 5. Expresión de la proFO en los diferentes estadios del ciclo de vida de D. coccus

El cDNA de ninfas I y II y hembras adultas oviplenas de D. coccus se usó como molde para amplificar a través de PCR un fragmento de la proFO,
para lo cual se utilizaron los oligos PO-CuA y PO-CuB del modo descrito en el apartado de Metodología. Como control de calidad del cDNA,
se amplificó el gen de actina. Las muestras fueron analizadas en un gel de agarosa a 1.5% preparado en amortiguador TAE 1X.

Análisis de expresión de la proFO de D. coccus. Para conocer la expresión del gen proFO-680 en diferentes
estadios del ciclo de vida de D. coccus, se preparó cDNA de ninfa I, ninfa Il y hembras adultas, y esto se ampli-
ficó por PCR. El fragmento amplificado fue del tamaño esperado (680 pb) en todos los casos, aunque con
diferente intensidad (Figura 5). Como control de calidad del cDNA, se usaron oligonucleótidos que amplifican
el gen de actina considerado de expresión constante (Figura 5).

16 INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA


B i o l o g í a

Discusión Referencias

En este trabajo se identificó, a través de la amplifica- Ashida, M., Brey P. T., Lee, W. J., Ahmed, A., De la Torre, A. y
Kobayashi, A. (1998) Molecular cloning and chromosomal
ción por PCR y secuencia del producto, la presencia localization of a prophenoloxidase cDNA from the malaria
de un gen que codifica para la proFO de D. coccus. vector Anopheles gambiae. Insect. Biochem. Mol. Biol. 7: 41-50.

El análisis de la secuencia de aminoácidos deducida Ashida, M. y Brey P. (1995). Role of the integument in insect
defense: prophenoloxidase cascade in the cuticular matrix.
de proFO-680 mostró identidad de 17-43% con las Proc. Nat. Acad. Sci. USA 92: 10698-10702.
proFOs descritas para B. mori, An. gambiae, S. bullata
y D. melanogaster. La secuencia de proFO-900, am- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman,
J. G., Smith, J. A. y Struhl, K. (1989). Current Protocols in
plificada a partir de DNA genómico, mostró la mis-
Molecular Biology. Wiley Interscience. Vol. 2. Part 10.
ma identidad de los genes de proFO de las especies
de insectos mencionados anteriormente. Sin embar- Chase, M., Raina, K., Bruno, J. y Sugumaran, M. (2000).
go, el tamaño de proFO fue mayor en comparación Purification, characterization and molecular cloning of
prophenoloxidases from Sarcophaga bullata. Insect.
con la secuencia obtenida a partir de cDNA, lo cual Biochem. Mol. Biol., 30: 953-967.
indicó la existencia de un intrón, éste fue localiza-
do y, a la manera típica, presentó codones de paro Felsenstein, J. (1993). PHYLIP (Phylogeny inference package)
(Figura 4). Versión 3.5C. Distributed by the author. Department of
genetics. University of Washington, Seattle.

Las proFO descritas son moléculas con regiones con- Fujimoto, K., Okino, N., Kawabata, S., Iwanaga, S. y Ohnishi, E.
servadas evolutivamente. La proFO descrita en este (1995) Nucleotide sequense of the cDNA encoding the
proenzyme of phenol oxidase A1 of Drodophila
trabajo mostró características comunes de proFO,
melanogaster. Proc. Nat. Acad. Sci. (USA), 92: 7769-7773.
incluyendo la presencia de residuos de aminoácidos
conservados en el sitio de unión al cobre, además García Gil, F., Lanz, H., Rojas, A. y Hernández, F. (2002). Efecto de
de otras dos posiciones conservadas hacia el extre- los inhibidores de la síntesis de prostaglandinas en la
coagulación del homóptero Dactylopius coccus (cochinilla
mo C- terminal. Estos residuos se conservan princi- del nopal). Investigación Universitaria Multidisciplinaria,
palmente en las proFO de diversos dípteros (Chase Universidad Simón Bolívar, 1: 15-19.
et al., 2002; Müller et al., 1999; Jiang et al., 1997;
Ashida et al., 1998 y Hall et al., 1995). Hall, M., Scott, T., Sugumaran, M., Söderhall, K. y Law, J. (1995)
Proenzyme of Manduca sexta phenol oxidase: Purification,
activation, substrate specifity of the active enzyme, and
La proFO se expresó en los estadios analizados del molecular cloning. Proc. Nat. Acad. Sci. (USA), 92: 7754-7768.
ciclo de vida de D. coccus, aunque mostró intensi-
Jiang, H., Wang, Y., Korochkina, S., Benes, H. y Kanost, M. (1997)
dades diferentes en las fases de ninfa I y II respecto
Molecular cloning of cDNAs for two pro-phenol oxidase
al control de actina, lo que sugiere que la expresión subunits from the malaria vector, Anopheles gambiae. Insect
de este gen varía durante el ciclo de vida. Por otra Biochem. Mol. Biol., 27: 693-9.
parte, dado que se sabe que las proFOs son una fa-
Llanderal, C. y Nieto, R. (1999). Características biológicas de la
milia multigénica en todos los grupos de insectos grana cochinilla del nopal (Dactylopius coccus Costa). En
estudiados a la fecha, resulta difícil saber si la ex- Llanderal, C y Nieto, R. (Eds.). Cría de la grana cochinilla del
presión observada durante los diferentes estadios nopal para la producción de su pigmento (pp. 23-30).
México: Instituto de Fitosanidad, Colegio de Posgraduados.
correspondió a la de un solo gen o a la de varios.
Maza, B. L. (1999). Aspectos biológicos de la grana cochinilla del
Actualmente, trabajamos para obtener la secuencia nopal (Dactylopius coccus Costa) y métodos de infestación.
completa del gen de la proFO de D. coccus, con el fin Memoria de residencia profesional. ITA No. 29: 27 DGETA.
SEP. Xocoyucan, Tlaxcala, México.
de estudiar sus funciones en el sistema inmune de
este insecto y, por otra parte, también investigamos Müller, M. H., Dimopoulos, G., Blass, C. y Kafatos, F. C. (1999). A
si esta enzima modifica al ácido carmínico.* Hemocyte Cell Line established from the malaria vector
Anopheles gambiae Express Six Prophenoloxidase Genes. J.
Biol. Chem., 274: 11727-11735.

Söderhall, K. y Iwanaga, S. (1996). New Directions in Invertebrate


Immunology. USA: SOS Publications.

* Agradecemos el apoyo brindado por la Coordinación de Investi- Sugumaran, M. y Nellaiappan, K. (1991). Lysolecithin a potent
gación de la Universidad Simón Bolívar, del Laboratorio de Ento- activator of prophenoloxidase from the hemolymph of the
mología Molecular del Cinvestav-IPN y de la Fundación Tlapano- lobster, Homarus americanus. Biochem. Biophys. Res.
chestli para la elaboración de este trabajo. Commun., 176: 1371-1376.

INVESTIGACIÓN UNIVERSITARIA MULTIDISCIPLINARIA 17