Vous êtes sur la page 1sur 13

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato.

04 de May de 2013

inicio

Tema 18: ALTERACIONES DEL MATERIAL GENTICO.


1. MUTACIONES. DEFINICIN.s** a. b. c. GNICAS(s***) CROMOSMICAS. GENMICAS. FSICOS.QUMICOS.BIOLGICOS.

2. 3.
1.

AGENTES MUTGENOS (s*). a. CONSECUENCIAS DE LAS MUTACIONES. (POSITIVAS Y NEGATIVAS.)s*** CONTENIDOS MNIMOS SELECTIVIDAD. Alteraciones de la informacin gentica: o Mutaciones: Concepto y tipos de mutaciones gnicas. Define mutaciones Haz una clasificacin de las mutaciones gnicas, indica por qu se producen y cuales son sus consecuencias. o Agentes mutgenos y consecuencia de las mutaciones ( positivas y negativas). consecuencias de las mutaciones y cncer.

1. MUTACIONES.

SON ALTERACIONES DE LA SECUENCIA DE BASES DEL ADN, LO QUE SE TRADUCE EN EL CAMBIO DE LA SECUENCIA DE AMINOCIDOS DE UNA PROTENA. -Si el cambio tiene lugar en un gen estructural, puede cambiar la funcin de la protena sintetizada. - O si el cambio tiene lugar en un gen regulador, lo que puede provocar es una modificacin en la expresin de los genes.

CONSECUENCIAS:

- Las mutaciones pueden tener efecto negativos y pueden llegar a ser letales. El cncer puede ser producido por una mutacin. En
general son recesivas y permanecen ocultas. - Pero tambin tienen un efecto positivo, ya que aportan variabilidad a la poblacin . Ello permite que si se produce un cambio en el ambiente, la existencia de individuos mutantes hace que pueda haber algunos que soporten estas condiciones. Este proceso se denomina seleccin natural. TIPOS: - SEGN LA CLASE DE CLULA AFECTADA:

Podemos clasificarlas segn diversos criterios: Mutaciones somticas: si afectan a clulas no reproductoras. En este caso, salvo que produzcan cncer, no tienen ningn efecto destacable.

Mutaciones germinales: Si afectan a las clulas reproductoras. Estas s son transcendentes, ya que todas las clulas del nuevo organismo llevarn esta mutacin. - SEGN SUS CAUSAS:

Mutaciones espontneas. Si se producen por causas naturales. Mutaciones inducidas. Si son producidas por la accin de agentes mutgenos. - SEGN LA EXTENSIN DEL MATERIAL GENTICO AFECTADO:

Mutaciones gnicas (alteraciones de la secuencia de nucletidos de un gen). Mutaciones cromosmicas (alteraciones de la secuencia de genes de un cromosoma). Mutaciones genmicas (alteraciones en el nmero de cromosomas.

1.a. MUTACIONES GNICAS.


DEFINICIN: Son alteraciones en la secuencias de nucletidos de un gen . Por ello tambin se denomina PUNTUALES. En
general SE PRODUCEN por errores no corregidos durante la replicacin o por la adiccin de agentes fsicos y qumicos que daan el ADN.

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio TIPOS:
A) MUTACIONES GNICAS POR SUSTITUCIN.
Son cambios de una base por otra . Como hay dos tipos de bases. Pricas (A y G) y pirimidnicas ( C y A), se distinguen a su vez dos tipos de mutaciones por sustitucin:

Transiciones. Son sustituciones de una purina por otra purina de una pirimidina por otra pirimidina: Tranversiones. Son sustituciones de una pirimidina por una purina y viceversa:
Consecuencias: Provocan la alteracin de un nico triplete. Generalmente pueden sustituirse por el mismo aminocido ( mutaciones silenciosas) o por otro diferente y, en este caso, salvo que indiquen un triplete de parada, o un aminocido del centro activo de un enzima, no suelen tampoco ser perjudiciales.

b) MUTACIONES POR PRDIDA INSERCIN DE BASES


Se denominan DELECCIONES Y ADICIONES respectivamente. Consecuencias: Como el mensaje gentico se traduce de triplete en triplete, las delecciones y adiciones, salvo que se compensen entre s, producen un CORRIMIENTO EN EL ORDEN DE LECTURA y alteran todos los tripletes siguientes . La protena que se produce es totalmente diferente a la inicial.

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio

CAUSAS QUE PROVOCAN LAS MUTACIONES GNICAS.


A) POR ERRORES DE LECTURA.
Los errores de lectura pueden aparecer durante la replicacin del ADN y pueden deberse a varias causas : POR CAMBIOS TAUTOMRICOS:Cada base nitrogenada puede presentarse de dos formas diferentes denominadas fomas tautomricas o tautmeros , una es la normal, y la otra la rara. A veces se pasa de una a la otra, lo que se denomina cambio tautomrico. esto sucede durante la replicacin, implica mutaciones, ya que cambia la base complementaria de la nueva cadena. Por ejemplo la forma normal de la G se complementa con la C, mientras que la forma rara se complementa con la T.

Si CAMBIOS DE FASE. Son deslizamientos de la hebra que se est formando sobre la hebra molde, de forma que quedan bucles al volverse a emparejar. De esta forma se producirn adicciones.

B) LESIONES FORTUITAS
Son alteraciones de la estructura de uno o de varios nucletidos que hace que no se emparejen con sus bases complementarias. Son:

Despurinizacin. Es la prdida de purinas por rotura del enlace entre stas y las desoxirribosas. Desaminacin. Es la prdida de grupos amino en las bases nitrogenadas y stas se emparejan con una distinta a su
complementaria.

Dmero de timina. Es el enlace entre dos timinas contiguas y est provocado por los rayos UV ( por eso los rayos UV
producen mutaciones y pueden provocar cncer). Las timinas unidas entre s no se unen a la hebra complementaria.

Por qu la aparicin por mutacin de un triplete UAA, UGA o UGA tiene consecuencias importantes? 1. (Selectiv Andaluca) Un fragmento gnico tiene la siguiente secuencia: 3A T G G C C A T G A A A A C G G 5 a) Cuntos aminocidos tendr el polipptido que codifica? b) Qu pasara con la secuencia polipeptdica si una mutacin provocase la prdida del primer nucletido (A)? c) Y si la mutacin suprimiera los tres primeros nucletidos ATG?

2. Dado el siguiente segmento de ADN: 5 T C G T C G T C G T C G 3 3A G C A G C A G C A G C 5 Cul es la hebra de ARNm sintetizada?

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio
Cul la cadena polipeptdica? Si se produce una deleccin del segundo par T-A cmo se altera el ARNm y la cadena polipeptdica sintetizada.

1.b. MUTACIONES CROMOSMICAS. DEFINICIN: Son ALTERACIONES EN LA ESTRUCTURA TIPOS:

DE LOS CROMOSOMAS . La secuencia de nucletidos no est

alterada pero s hay cambio en el nmero de genes de un cromosoma o en su posicin. A) ALTERACIONES DEL NMERO DE GENES DE UN CROMOSOMA : menos. CAUSAS. Se producen por un apareamiento meitico errneo, de forma que uno de los cromosomas homlogos queda un trozo de ms y otro de menos. Estos cromosomas homlogos erroneos irn a diferentes gametos. CONSECUENCIA: Suelen tener consecuencias graves, ya que no basta tener los genes propios de la especie, sino el nmero adecuado de ellos para que no se produzcan desequilibrios en la expresin. TIPOS: Un cromosoma tiene genes de ms o de

DEFICIENCIA Y DELECCIN: Consiste en la prdida de un fragmento del cromosoma, ya sea en el extremo ( deficiencias) o en el interior (delecciones). Ejem: el sdrome cri du chat (grito de gato), es consecuencia de una deleccin en el cromosoma 5, los nios afectados por este sndrome emiten sonidos semejantes a los maullidos de gato, presentan milcrocefaila, retraso mental y no suelen vivir hasta adultos.

DUPLICACIN. Es la repeticin de un segmento

dentro de un cromosoma. Las duplicaciones

provocan un

aumento del nmero de genes lo que favorece la aparicin de variaciones de este gen y por tanto la evolucin. B) ALTERACIONES EN EL ORDEN DE LOS GENES. Pueden ser: - INVERSIONES: perjuicios. TRASLOCACIONES. Es el cambio de posicin de un segmento del cromosoma, trasladndose a otro lugar del cromosoma, a su cromosoma homlogo o a otro cromosoma cualquiera. Las traslocaciones no suelen perjudicar al individuo que las ha sufrido, pero s a sus descendencia, ya que sta hereda un cromosoma de cada tipo que puede estar incompleto o duplicado. Es el cambio de sentido de un grupo de genes en el cromosoma. Si el fragmento invertido incluye el centrmero se denomina inversin pericntrica, y si no se denomina inversin paracntrica. Las inversiones no suelen comportar

1.c. MUTACIONES GENMICAS.


Son ALTERACIONES EN EL NMERO DE CROMOSOMAS DE UNA ESPECIE . Son generalmente alteraciones graves, ya que cada cromosoma tiene muchos genes.

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

Se producen por: o o o fusin de dos cromosomas de primates. FISIN Rotura de un cromosoma en dos.

inicio
FUSIN: Unin de dos cromosomas. Este es el posible origen del cromosoma 2 de humanos que proviene de la

SEPARACIN ERRNEA DE LOS CROMOSOMAS DURANTE LA MEIOSIS . Es la ms frecuente. A una clula irn los dos cromosomas homlogos y la otra se quedar sin ninguno.

TIPOS: A) EUPLOIDIAS: es la alteracin en el nmero de juegos completos de cromosomas. Pueden ser: - MONOPLOIDAs: Organismos con un solo juego de cromosomas de forma anormal. POLIPLOIDAS: Organismos con ms de dos juegos de cromosomas. Triploides, tetraploides, poliploides. En animales no suelen ser viables, pero s en plantas donde aumentan el tamao del organismo y suelen seleccionarse para la produccin agrcola. b) ANEUPLODIAS .: falta o hay un cromosoma de ms de una pareja de homlogos . Se producen normalmente porque se ha separado mal un bivalente durante la meiosis; de tal manera que se fabrican gametos con dos cromosomas homologos de un tipo y otros con ninguno, en la fecundacin estos gametos producirn cigotos que slo tengan un cromosoma de un tipo y cigotos que tengan tres cromosomas de ese mismo tipo: Pueden ser: - MONOSOMAS: (2n-1) Falta un cromosoma de una determinada pareja. Ejemplo: Sndrome de Turner., en el que las mujeres, en lugar de tener dos cromosmas X, tienen uno solo XO, tiene 45 cromosmas. Son mujeres con retraso mental, infantilismosexual y esterilidad. TRISOMAS: (2n+1). Cuando en lugar de dos cromosmas hay tres

cromosomas de un tipo en el cariotipo . Ejem: el sndrome de Down (trisoma del cromosoma 21), presentan deficiencia mental, rasgos faciales orientales, cara plana y ancha. Sndrome de Edwards (trisoma del 18). Sndrome del duplo de Y (XYY), hombres con retraso mental, altos y violentos. Sndrome de Klinefelter (XXY), Hombres con genitales pequeos. Ausencia de espermatognesis y retraso mental.

2.
Son aquellos factores que aumentan la frecuencia normal de mutacin y daan la estructura del ADN . Se pueden clasificar en:

AGENTES

MUTGENOS.

a) FSICOS.
RADIACIONES IONIZANTES:

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

Son radiaciones electromagnticas de onda muy corta y muy energticas que provocan la ionizacin de los componentes del ADN. Son: Rayos X, y rayos y rayos , que son emitidos por los procesos nucleares.. Estas radiaciones pueden tener efectos. Fisiolgicos (daan enzimas). Celulares (rompen estructuras de la clula. Producen Mutaciones: Provocan formas tautomercas de las bases, con lo que producen mutaciones gnicas. Pueden romper el ADN (enlaces nucleotdicos) y por tanto los cromosomas.

inicio

Por qu no se utilizan rayos X en las mujeres embarazadas, o se protegen los genitales en estos estudios?

RADIACIONES NO IONIZANTES:
Son los rayos ultravioleta (UV). Radiaciones electromagnticas de muy baja longitud de onda (entre 160-400 nm) y por ello muy energticas. No produce ionizacin. En el ADN provocan: Formacin de dmeros de timina y por tanto mutaciones gnicas. Formas tautmeras de las bases que tambin provocarn sustituciones en las bases .

Qu consecuencias tiene la desaparicin de la capa de ozono?

B) QUMICOS.
Son sustancias que reaccionan qumicamente con el ADN y producen tres tipos de alteraciones: MODIFICACIONES DE LAS BASES NITROGENADAS . Pueden producir cambios qumicos en las bases por desaminacin, alquilacin e hidroxilacin, que provocan emparejamientos errneos y por tanto sustituciones de bases. Ejm: CIDO NITROSO, desamina la citosina y la transforma en uracilo. Cuando el ADN se replica este se empareja con la adenina y no con la guanina. ETILMETILSULFONATO (EMS) o el GAS MOSTAZA que aaden grupos alquilo a las bases, que se emparejan con otras que no sern complementarias. Ejn: SUSTITUCIONES DE BASES. Algunos agentes mutagnicos son sustancias parecidas qumicamente a las bases , que las pueden sustituir y provocar errores en la replicacin al producir emparejamientos errneos. 5-BROMOURACILO (anlogo de la timina) o 2-AMINOPURINA (anlogo de la adenina). A veces se utilizan como antitumorales y antivricos ejm:AZT ( contra infeccin SIDA). INSERCIN DE MOLCULAS EN EL ADN Se producen con molculas similares a un par de bases enlazadas, capaces de introducirse entre los pares de bases del ADN y al duplicarse luego pueden aparecer inserciones o delecciones de un solo par de bases, con el consiguiente corrimiento de la pauta de lectura. Ejm ACRIDINA, PROFLAVINA (colorantes) y el BENZOPIRENO (presente en el humo del tabaco, en los alquitranes y en los alimentos quemados)

C) BIOLGICOS.
VIRUS: Algunos virus que en su ciclo se insertan en el ADN de la clula husped. Esta insercin puede provocar mutaciones, inactivando algunos genes o alterando los mecanismo de control de la divisin celular con lo que la clula se trasforma en cancergena. Ejm: virus tumorales de ARN (retrovirus, SIDA), o virus tumorales de ADN como virus del herpes, papovavirus... TRASPOSONES. Son trozos de ADN mviles que pueden cambiar de posicin en los cromosomas y pueden provocar la inactivacin de genes estructurales, reguladores e incluso de cncer.

4. CONSECUENCIAS DE LAS MUTACIONES. S*


a) POSITIVAS.
Las mutaciones SON UNA FUENTE DE VARIACIN GENTICA dentro de las poblaciones lo que favorece el proceso de seleccin natural y de evolucin.

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

Los principales agentes de variabilidad gentica en las poblaciones son la recombinacin gentica y las mutaciones. Las MUTACIONES (alteraciones de la secuencia de ADN ), permiten la aparicin de genes que antes no existan y amplan ms la variabilidad gentica. Si una mutacin es beneficiosa, se ir seleccionando paulatinamente en la poblacin. Si se produce un cambio en el ambiente y las nuevas condiciones son adversas para los individuos normales, la existencia de individuos mutantes, hace que si estos se adaptan mejor, en estas condiciones de competencia, los mejor adaptados se reproduzcan ms y las especies evolucionen. Es lo que se conoce como seleccin natural. Entre las mutaciones que contribuyen a la evolucin: Las MUTACIONES CROMOSMICAS por duplicacin, que aumentan el nmero de copias de un gen, sobre el que pueden actuar distintas mutaciones posteriores (varios ensayos evolutivos de un gen). Las MUTACIONES GENMICAS, como es el caso de las poliploidias en vegetales que hacen que sus rganos estn mejor desarrollados que los de especies diploides y por ello se seleccionan en agricultura. Otro ejemplo es la unin de cromosomas como el caso del cromosoma 2 de humanos que procede de una fusin de dos cromosoma de primates. Las MUTACIONES GNICAS por sustituciones de bases. stas se acumulan en el material gentico a un ritmo casi constante. Este tipo de mutaciones se utiliza como reloj evolutivo y permite calcular el momento en el que se produjo la separacin entre dos especies.

inicio

B) NEGATIVAS.

Muchas mutaciones son perjudiciales y provocan incluso efectos letales, cuando no provocan enfermedades : trisomas, monosomas, o inactivacin de determinadas enzimas que provocan trastornos en el metabolismo : fenilcetonuria, anemia falciforme, hemofilia, daltonismo, albinismo......

Tambin, y aunque en el desencadenamiento del cncer intervienen diversos factores, se sabe que que los agentes mutagnicos lo producen tambin.

la aparicin de

determinadas mutaciones como alteraciones cromosmicas, delecciones, traslocaciones etc estn asociadas al CNCER y

MUTACIN Y CNCER. Un CNCER es una enfermedad que consiste en una multiplicacin desordenada de determinadas clulas que son capaces de migrar a otros puntos por la sangre y la linfa, lo que se denomina metstasis . Si el tumor est localizado y no crece indefinidamente se denomina tumor benigno. Si invade los tejidos y crece indefinidamente se le clasifica como maligno. Las clulas cancerosas se diferencian de una normal en que:

Se originan a partir de una clula que se ha transformado en cancerosa. se dividen a gran velocidad e indefinidamente (regeneran los telmeros de sus cromosomas), poseen protenas de membranas diferentes a las clulas del organismo y son reconocidas como extraas por presentan distinta forma a las clulas normales. Carecen de inhibicin por contacto y tienden a crecer unas sobre otras formando capas e invadiendo tejidos.

el sistema inmunitario,

CAUSAS DEL CNCER: En la formacin del cncer intervienen distintos factores, pero la principal causa son cambios en el material gentico. La formacin de cnceres estn asociados a alteraciones cromosmicas (delecciones, traslocaciones..) y los ahumados), nitritos (embutidos),derivados pirolticos del triptfano (aceites alimentarios reutilizados). agentes mutagnicos (radiaciones ionizantes, virus, anilinas (colorantes industriales), Nitrosaminas(humo del tabaco y alimentos

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

La mayora de los cnceres derivan de una sla clula anormal que ha sufrido una mutacin que le permite crecer ms que sus vecinas. Para que una clula se transforme en cancerosa es necesario una acumulacin de mutaciones en genes implicados en los procesos de divisin celular. CAUSAS GENTICAS: a. Hoy se conocen distintos genes cuyas MUTACIONES en distintos genes que provocan cncer. Entre estos genes:
PROTOONCOGENES: Son genes normales presentes en todas las clulas, estn implicados en mecanismos del control del

inicio

crecimiento de las clulas . Una mutacin en uno solo de los dos alelos de un protoncogn lo trasforman en ONCOGN capaz de provocar un cncer. Los ONCOGENES provocan un aumento de las seales que estimulan la divisin celular. Tienen un patrn autosmico dominante.
GENES SUPRESORES DE LOS TUMORES : se denominan tambin antioncogenes y codifican para protenas inhibidoras de

la divisin celular. La mutacin en estos genes aumenta el ritmo de la divisin celular. Tienen un patrn autosmico recesivo.

GENES DE REPARACIN DE ADN Son los que impiden la acumulacin de mutaciones de stos en el ADN, una desactivacin

de estos genes est relacionada con la aparicin de cnceres. CAUSAS AMBIENTALES: b. Existen numerosos VIRUS que provocan tumores en muchos animales. Entre estos se encuentran los virus tumorales de ARN (retrovirus) y los virus tumorales de ADN ( virus del herpes, papovavirus, adenovirus.) Estos virus transforman las clulas en cancergenas al insertarse en su material gentico y variar el mecanismo de divisin de la clula husped. c. Tambin el cncer es provocado por AGENTES MUTGENOS, como las radiaciones UV y X, las radiaciones nucleares, el alquitrn, los ahumados, el pan tostado chamuscado, el amianto, el cloruro de vinilo, las anilinas, algunos conservantes como los nitritos de los embutidos, los edulcorantes artificiales, las bebidas alcohlicas y el tabaco. Los agentes mutgenos actan mutando protoncogenes y transformndolos en oncogenes activos que estimulan la divisin celular, sobre los genes supresores de los tumores, disminuyendo la accin de protenas inhibidoras del crecimiento y sobre los genes correctores de errores, que evitan que se repare el ADN mutado. En cualquier caso se cree que adems del agente mutgeno se necesita una incapacidad de las defensas del organismo por neutralizar clulas con estructuras extraas (cancergenas).

VOCABULARIO
FRAGMENTOS DE OKAZAKI. Son cortas secuencias de ADN producidas sobre la hebra retrasada durante la replicacin del ADN. Son rpidamente unidas por uuna ADN ligasa formando una hebra continua de ADN. Son necesarias puesto que las ADN pol slo fabrican ADN en la direccin 3-5. Al ser las dos cadenas que forman el ADN antiparalelas, una de ellas debera sintetizarse en la direccin 5-3. Puesto que esto no es posible, esta hebra (la denominada retardada) se sintetiza en trozos (fragmentos de Okazaki) en la direccin 3-5 conforme se va abriendo la horquilla de replicacin TOPOISOMERASAS. Enzima que hace de forma reversible cortes en una molcula molcula de ADN facilitando la eliminacin de vueltas excesivamente enroladas que se forman durante la separacin de las dos hebras por las helicasas en la replicacin del ADN HELICASA. Enzima que rompe los puentes de H entre las bases nitrogenadas que unen las cadenas de ADN para separarlas durante la replicacin del ADN . PRIMASA. Enzima que se encarga de fabricar el cebador o primer, pequea cadena (de unos 10 nucletidos) complementaria al comienzo (extremo 5) de una cadena de ADN, para comenzar su replicacin. Esto es necesario puesto que ninguna ADNpol es capaz de colocar ningn nucletido si no hay uno anterior. HEBRA RETARDADA. Es una de las cadenas de ADN recin sintetizada que se haya en la horquilla de replicacin, y que puesto uque sta se abre en el sentido contrario a la actuacin de la ADN pol se sintetiza en pequeos fragmentos denominados fragmentos de Okazaki.

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio
HEBRA CONDUCTORA. Es una de las cadenas de ADN recin sintetizada que se haya en la horquilla de replicacin, y que puesto que sta se abre en el sentido a la actuacin de la ADN pol (5-3) se sintetiza en esta direccin de forma continua. PROMOTOR. Secuencia de una de las cadenas de ADN por la que la ARN polimerasa inicia la transcripcin. Esta regin tiene una serie de secuencias consenso como son : TATAAT (en procariotas) y CAAT y TATA (en eucariotas) INTRON. Regin que no codifica para ninguna protena de un gen de eucariota que se transcribe a molculas de RNA pero que no se traduce puesto que se elimina durante la maduracin del ARN. Parece que la funcin de estas secuencias sin sentido en eucariotas es aumentar la posibilidad de recombinacin gentica durante la meiosis, aumentando la variablilidad gentica de la especie. CDIGO GENTICO. Juego de reglas que especfica la correspondencia entre los tripletes de nucletidos (codones) del ARNm y los aminocidos de las protenas. CODON. Secuencia de tres nucletidos de una molcula de ARNm que representa la instruccin para incorporar un determinado aminocido en la protena que se est sintetizando. Esta correlacin viene determinada por el cdigo gentico. ANTICODON. Secuencia de tres nucletidos de una molcula de ARN de transferencia, complementaria a la secuencia de tres nucletidos del codn de una molcula de ARN mensajero. Esta secuencia se sita en el brazo central de la molcula de ARNt. El anticodon determina el aminocido que el ARNt va a transportar desde el citoplasma hasta el ribosoma donde tiene lugar la sntesis de protenas. PEPTIDIL TRANSFERASA Enzima localizada en la subunidad mayor de un ribosoma y que cataliza la formacin de un enlace peptidco entre el nuevo aminocido que entra en el ribosoma y la cadena de aminocidos en formacin. OPERON. En un cromosoma bacteriano, grupo de genes constituido por una serie de genes estructurales que codifican para enzimas involucrados en una misma ruta metablica y por sus genes reguladores que codifican proteinas cuya misin es controlar la actividad de los genes estructurales. Estas protenas se denominan represores. Los genes que forman parte de un operon son: gen regulador (que lleva informacin para fabricar el opern)/ gen promotor (donde se une la ARNpol)/ gen operador (donde se une el represor) y los diferentes genes estructurales.

DIBUJOS Y ESQUEMAS CLAVES.


-DIBUJO DE LA HORQUILLA DE REPLICACIN. -DIBUJO DEL PROCESO DE TRADUCCIN. -DIBUJO ESTRUCTURA ARNt / DIBUJO DE LA ESTRUCTURA DEL ARNM EN EUCARIOTAS Y PROCARIOTAS. -ESQUEMA DE LAS DIFERENTES MUTACIONES GNICAS.

DIFERENCIAS Y COMPARACIONES.
REPLICACIN EN EUCARIOTA Y PROCARIOTA. TRADUCCIN EN PROCARIOTA Y EUCARIOTA. ARNM EUCARIOTA /PROCARIOTA.

ALGUNAS PREGUNTAS DE SELECTIVIDAD.


Sep 94 Op A,3.a) Arnm, ARNt, aminoacil ARN sintetasa, aminocidos, factores de iniciacin GTP, peptidil transferasa, ARNr, protenas que forman parte
del ribosoma, protena. b)1: ARNm 2Polirribosoma 3. Protena formada. 4. Subuidad grande del ribosoma.

Sep 95. Op B, 4.Es un opern. Define el concepto. No est muy claro, pero parece un sistema de represor inducible como el de la lactosa. Se da en procariotas. Junio 96. Transcripcin...muy fcil: Defnela primero, describe la naturaleza de la ARNpol y seala sus fases. Sep 96. Es la experiencia de Melsseson y Stahl.

Sep 96. Concepto de mutacin. Haz un esquema sealando las caracterticas de los diferentes tipos. Explica por qu son importante para la evolucin las mutaciones. Junio 97. A) La cadena complementaria sera 3ATG TACTGTATAAAAAAATTTGCTGTAG5' a) recuerda que tienes que lerer la cadena de ADN en el sentido 3-5y que en lugar de T tienes que colocar U. Hazlo a partir de la hebra complementaria. El ARN transcrito sera: 5UAC AUG ACA UAU UUU UUA AAC GAC ACA UC3 a) A partir del codn AUG saca los complementarios que seran los anticodon. b) 8, puesto que cada codon indica un aminocido. Aunque el primero que significa metionina se elimina en la mayora de las protena suna vez sintetizadas. Junio 97. Estrctura y funcin ARNt ..muy fcil. Ilustra con un dibujo. Juno 98. Indica las tres hiptesis de duplicacin de ADN indicando cul es la correcta. Junio 99. Funcin de ARN, muy fcil... Sep 99. Se hace igual que la de Junio 97. d) es una mutacin del tipo sustitucin transcin, ya que se cambia una pirimidina por otra pirimidina. Esta mutacin puede n

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio
o tener mucho efecto si slo se cambia un aminocido por otro, salvo que nuevo codon incorporado sea uno de finalizacin, en cuyo caso la protena se acorta bruscamente. Sep 00, Opo b, 4. 5ATGCAAGATCTGTGTAG3 Es muy fcil slo tienes que tener en cuenta que se lee en el sentido 3-5)que es en el que te la dan) y utilizar U en lugar de T. Puesto que es muy fcil puedes introducir el proceso comentando las enzimas que intervienen y la definicin de trascripcin,. Junio 01. Transcripcin en eucariotas. Una introduccin: te puede servir la definicin Septiembre 01. Importancia y mecanismo de replicacin ADN (muy fcil). Junio 02 Describa, brevemente, el mecanismo de traduccin ( biosntesis) de las protenas. Sep 2003: Funcin del ARNt en la sntesis de protenas. (En esta pregunta explica la estructura de ARNt y su funcin a grande rasgos. Puedes tambin comentar como se produce la traduccin) Sep 2003: Establezca las diferencias ms significativas, del proceso de transcripcin entre las clulas procariotas y eucariotas. a) b)

Junio 03. Funcin del ARNt en la sntesis de protenas. Junio 2003. Establezca las diferencia sms significativas del proceso entre las clulas de transcripcin entre las clulas eucariotas y procariotas. Septiembre 2003. Describa, brevemente, el proceso de replicacin del ADN. Junio 2004. Responda a las siguientes cuestiones sobre las mutaciones: a) Concepto, b) Mutaciones gnicas. Junio 2004. Dada la siguiente secuencia de ADN: 3T A C C T A C A C A G A T C T T G C 5 a) Escriba la cadena complementaria. B) Escriba la secuencia de ARN m de la cadena dada. Septiembre 2004. Describa el proceso de transcripcin de ADN. Septiembre 2004. La siguiente cadena de ADN: 5 T A C A T G A C A T A T T C T T T A A A C G A C 3 codifica para la sntesis de un polipptido. Se pregunta: a) El ARNm resultante de la trascripcin de esta cadena. B) El nmero de aminocidos de la cadena polipeptdica resultante en el proceso de traduccin. Junio 2005. Conteste a las siguientes cuestione ssobre el cdigo gentico: a) concepto, b) Enumera sus principales caractersticas. Junio 2005. Establezca las diferencias ms significativas entre el proceso de trasncripcin entre las clulas procariotas y eucariotas. Septiembre 2005,. Describa las etapas ms importantes del proceso de trasncripcin en eucaritoas.

EJERCICIOS DE GENTICA MOLECULAR.


1. Observa la secuencia de bases nitrogenadas del siguiente fragmento de ADN:
5A A A T T A T G C C C C C G T T A A T G T G A T 3 3T T T A A T A C G G G G G C A A T T A C A C T A 5 a) b) c) d) e) f) antes transcrito. g) cul de las dos hebras (superior o inferior) dar lugar a la hebra conductora y cul a la retardada.

MUY IMPORTANTE SABERLOS HACER HAN SALIDO VARIAS VECES EN SELECTIVIDAD

Suponiendo que el punto OriC se encuentra a la izquierda de la secuencia escrita, indica, en una replicacin del ADN, Indica el nombre de algunas enzimas que intervengan en la replicacin de este fragmento de ADN Suponiendo que el promotor de un gen presente en el fragmento escrito est a la izquierda de la secuencia Cul de las dos hebras podr transcribirse? Indica el nombre de la enzima que podr realizar la trtanscripcin, en el caso de tratarse de una clula procariota y en el caso de tratarse de una eucariota. Escribe la secuencia del ARN producido por la transcripcin del fragmento de ADN, suponiendo el promotor a la izquierda de la secuencia escrita. Suponiendo que se trata de una clula procariota, escribe ahora la secuencia de aminocidos codificados por el gen Si se tratara de una clula eucariota, Qu mas cosas necesitaras saber para conocer la secuencia del polipptido codificado por el gen?.

10

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

h)

Escribe los anticodones de las molculas de ARNt que intervendrn en la traduccin del gen transcrito.

inicio

2. (Sep 99)La siguiente cadena de ADN codifica para la sntesis de un polipptido.


5T A C A T G A C* A T A T T T T T T A A A C G A C A T C 3 Teniendo en cuenta que el codn de iniciacin en el ARNm es el AUG. Represente: a) b) c) d) e) La cadena complementaria. El ARN mensajero resultante de la transcripcin. Los anticodones presentes en la ARNt de trasferencia para la sntesis de polipptido. De cuntos aminocidos estar formado el polipptido? Si en la hebra dada se produce una sustitucin de la base sealada con un asterisco (C+) por T Qu repercusiones tendra dicha mutacin para la protena?Cmo se denomina dicha mutacin?

3. (Sep 2000) Dada la siguiente secuencia de ADN:


3 T A C G T T C T A G A C A C A T C 5 A) B) consultando la tabla del cdigo gentico indicar: a) b) La secuencia del ARNm trascrito. A estructura primaria del fragmento de protena sintetizado. Esvcriba la cadena complementaria. Escriba la secuencia de ARNm de la cadena dada.

4. A partir de la siguiente secuencia de nucletidos que se transcribe, y que codifica un fragmento de una determinada protena,

5.

Un fragmento gnico tiene la secuencia siguiente: 3A T G G C C A G A T G A A A A C G C 5 Cuntos aminacidos tendr el poliptido que codifica? Qyu pasara con la secuencia polipetidica si una mutacin provocase la prdida del primer nucletido (A)? Y si la mutacin suprimiese los tres primeros nucletidos (ATG)?

6.

La secuencia de genes de una molcula de ARNm es:

5A A U U U G C C A 3 Escribe la doble cadena de nucletidos de el ADN de la que se copi. Indica cual de las dos sirvi de molde. Escribe cules son los anticodones correspondientes.

7.

Una cadena de ADN tiene la siguiente secuencia:

5 A T G A A A G C A G T A 3 Indica el ARNm que producir y la secuencia de aminocidos. 8. En cierta cepa bacteriana se sabe que a partir de la secuencia nucleotdica que se indica: ATGATTACACCCATA TGAATCAT TACTAATGTGGGTATACTT AGTA Se produce un oligoptido de ocho aminocidos. Adems se detecta una variante de la cepa que produce oligoptidos de cinco aminocidos. Considerando todos estos datos: a) b) Determina la secuencia de ARNm y la secuencia de aminocidos del octaptido. Explicar cmo pudo producirse la variante y la modificacin que tuvo que sufrir la secuencia de nucletidos para que se forme una protena de cinco aminocidos.

Dada la dibujar las bandas polaridad y si son como los RNA

9. 14-

burbuja de replicacin mostrada abajo, de DNA de nueva sntesis indicando su de sntesis continua o discontinua, as iniciadores. 11

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio

Dada la siguiente secuencia de ARN mensajero: 5' - UUACGUAUCGAUCCC - 3' Escribe la cadena de ADN a partir de la cual se ha formado: -

Escribe la cadena complementaria a la anterior: - 3'

Escribe los anticodones correspondientes del ARNt

- GCA -

- CUA -

Escribe la cadena polipeptdica que se origina:

1. 2. 3. 4. 5. 6. 7. 8.

Dnde tiene lugar el proceso (h) en las clulas eucariotas Cmo se denomina el proceso est teniendo lugar entre las molculas (a) y (b)? Qu nombre recibe el proceso (g) de formacin de la molcula (f) Qu nombre recibe la molcula con la letra (a) Qu nombre recibe la molcula con la letra (d Qu nombre recibe la estructura con la letra (c) Qu nombre recibe la molcula con la letra (b Dnde tiene lugar el proceso (h) en las clulas eucariotas

Di si se trata de un proceso en eucariota o procariota: El ARNm lleva una metil guanosina Trifosfato en el extremo 5' El lugar de transcripcin se encuentra separado del de traduccin Los ARN m son policistrnicos El primer aminocido es siempre metionina Los ARNm son menos estables Traduccin y transcripcin se realizan en el mismo espacio Los ARN m llevan informacin para varias protenas

12

Tema 17. ALTERACIONES DEL MATERIAL GNETICO.. Biologa. 2 bachillerato. 04 de May de 2013

inicio Comenta qu tipo de mutacin es: Se duplica un fragmento del cromosoma cambio en la posicin de un fragmento cromosmico Tripletes que codifican para aminocidos equivalentes distintos. AAA(lys)AGA(arg). Ambos son aminocidos bsicos Afecta a un solo gen Aparece un triplete de terminacin o FIN: CAG(gln)UAG(FIN) No se transmiten a la descendencia Son las mutaciones que afectan slo a un nmero de ejemplares de un cromosoma Adicin o delecin de un nico par de nucletidos o de varios pares de nucletidos, siempre que no sean mltiplo de tres mutaciones que provocan una disminucin en el nmero de juegos de cromosomas Aparece un nuevo triplete que codifica para un aminocido de distinto tipo. La protena pierde su funcin se produce de forma natural o normal en los individuos aumento del nmero normal de juegos de cromosomas cambio de sentido de un fragmento del cromosoma. prdida de un fragmento cromosmico sustitucin de un par AT por un par GC Afectan a las celulas reproductoras afecta a un segmento cromosmico que incluye varios genes. se produce como consecuencia de la exposicin a agentes mutagnicos qumicos o fsicos Dentro de la secuencia del ADN se introducen nucletidos adicionales mutacin que afecta a cromosomas completos secuencia de nucletidos se pierde uno sustitucin del par AT por TA Tripletes que codifican para el mismo aminocido

De qu proceso se trata? Pon nombres a los nmeros.

13