Forensic DNA Testing

Forensic DNA Testing
August 21, 2008
Uses and Abuses of Modern DNA Science

BYU Campus Education Week 2008
Forensic DNA Testing:

How Are Crimes Solved with DNA Analysis?
John M. Butler, PhD
August 21, 2008
BYU Campus Education Week 2008 Uses and Abuses of Modern DNA Science
http://www.time.com/time/cartoonsoftheweek/0,29489,1826599_1741794,00.html
August 21, 2008
http://www.innocenceproject.org
218 exonerated as of August 15, 2008
April 11, 2006
Lawyers for Duke Players Say DNA Clears Team
http://www.nytimes.com/2006/04/11/sports/othersports/11duke.html?n=Top%2fReference%2fTime s%20Topics%2fOrganizations%2fD%2fDuke%20University%20
August 21, 2008
Progress Since 1995

O.J. Simpson DNA testing was performed with RFLP
Almost 8 weeks needed to get results
Now <8 hours to get results
Unfortunately, current DNA testing cannot be performed as quickly as a commercial break
Real labs have better lighting but fewer instruments. The instruments on CSI are real they just do not collect data as quickly as shown on TV.
August 21, 2008
We are finding new ways to use DNA
The Field Is Growing Rapidly and Is a Lot of Fun to Be Associated With

1st Edition 2nd Edition 3rd Edition
http://www.freewebs.com/desireealbano/bizarro.jpg
Currently in the process of writing
Jan 2001
335 pp.
Feb 2005
688 pp.
2009
~1000 pages
August 21, 2008
Methods for Human Identification
Fingerprints have been used since 1901
DNA since 1986
DNA in the Cell

The vast majority of DNA is the same from person to person
chromosome cell nucleus
22 pairs + XX or XY
Double stranded DNA molecule ~3 billion total base pairs
Only a Small Varying Region is Targeted and Probed for Each DNA Marker Examined
Individual nucleotides
August 21, 2008
Identification of Information
Printed Information
Library Book Chapter Page Number Line on Page Word Letter
Genetic Information
Body Cell
D13S317
Nucleus Chromosome Locus (part of chromosome) Short DNA sequence DNA nucleotides
Characteristics of DNA
Each person has a unique DNA profile (except identical twins). Each person's DNA is the same in every cell. An individuals DNA profile remains the same throughout life. Half of your DNA comes from your mother and half from your father.
August 21, 2008
Our DNA Comes from our Parents Fathers Sperm
Mothers Egg
Childs Cell
Inheritance Pattern of DNA Profiles
DAD
CHILD
MOM
August 21, 2008
Short Tandem Repeat (STR) Markers

An accordion-like DNA sequence that occurs between genes
TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGA TAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACAT GCTTACAGATGCACAC
= 11 GATA repeats (11 is all that is reported)

7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats
The number of consecutive repeat units can vary between people The FBI has selected 13 core STR loci that must be run in all DNA tests in order to provide a common currency with DNA profiles
Target region
(short tandem repeat)
Core STR Loci for the United States
Position of Forensic STR Markers on Human Chromosomes

TPOX D3S1358 D8S1179 D7S820 TH01 VWA
13 CODIS Core STR Loci
1997
D5S818 FGA CSF1PO
AMEL
Sex-typing
D13S317 D16S539 D18S51 D21S11 AMEL
August 21, 2008
Fluorescent dye-labeled primer

3
Short Tandem Repeat (STR) Typing

STR Repeat Region
1
3
2 3
3 4
4 5
5 6
6 7 8
(Maternal) (Paternal)
reverse primer hybridization region
1
forward primer hybridization region
GATA
(size in bp)
75.80.100.120.140.160.180.200.220.240.260.. 1000 RFUs 500
6 139bp 8 147bp
DNA Separation and Detection
PATERNITY TESTING
PCR product size (bp)
11
14
Fathers Profile?
12 14
Father
11,14
Child #1 Child #2 Child #3
Alleged Father(s) is asked to donate DNA sample
14
11 12
12
Mother
STR Alleles from D13S317
August 21, 2008
PATERNITY TESTING
Family Inheritance of STR Alleles (D13S317)
11
14
Father Me
12
14
Amanda Child #1 Child #2 Marshall Child #3 Katy
14
11 12
12
Mother My Wife
We Have DNA Results to Prove That All These Kids Are Ours!
10
August 21, 2008
TH01 D19 D3 D8 AMEL D5 D21
TPOX D13 FGA
D7 D16 D18
CSF D2
VWA
DNA Size (bp)

6FAM (blue) D8S1179 D21S11 D7S820 CSF1PO
TH01 VIC (green) D3S1358 D13S317 D16S539 D2S1338
TPOX NED (yellow) D19S433 VWA D18S51
AMEL PET (red)
D5S818
FGA
1 in 837 trillion
(probability of this profile occurring at random)
GS500 LIZ size standard LIZ (orange)
Applications of Forensic DNA Typing

Forensic cases -- matching suspect with
evidence
Paternity testing -- identifying father Missing persons investigations Military DNA dog tag Convicted felon DNA databases Mass disasters -- putting pieces back together Historical investigations
Involves Involvesgeneration generationof ofDNA DNAprofiles profilesusually usuallywith with the same core STR (short tandem repeat) markers the same core STR (short tandem repeat) markers and andthen thenMATCHING MATCHINGTO TOREFERENCE REFERENCESAMPLE SAMPLE
11
August 21, 2008
DNA Testing Requires a Reference Sample

A DNA profile by itself is fairly useless because it has no context DNA analysis for identity only works by comparison you need a reference sample
Crime Scene Evidence compared to Suspect(s) (Forensic Case) Child compared to Alleged Father (Paternity Case) Victims Remains compared to Biological Relative (Mass Disaster ID) Soldiers Remains compared to Direct Reference Sample (Armed Forces ID)
Butler, J.M. (2005) Forensic DNA Typing, 2nd Edition, Box 1.3, p. 9
August 17, 1998 FBI Report on Analysis of Stain on Monica Lewinskys Blue Dress
http://www.law.umkc.edu/faculty/projects/ftrials/clinton/lewinskydress.html
12
August 21, 2008
December 14, 2003
We got him!
DNA Profile Saddam was known to have many stunt doubles that acted as decoys for his own safety
Saddam Husseins capture was verified with DNA testing conducted in Rockville, MD at the Armed Forces DNA Identification Laboratory
Source: www.cnn.com; The Scientist Dec 19, 2003
Biological Relatives Served as References

Captured December 13, 2003
Matching Y-STR Haplotype Used to Confirm Identity

(along with allele sharing from autosomal STRs)
Uday and Qusay Hussein Is this man really Sadaam Hussein?

Butler, J.M. (2005) Forensic DNA Typing, 2nd Edition, Box 23.1, p. 534
Killed July 22, 2003
13
August 21, 2008
Tomb of the Unknown Soldier
Armed Forces DNA Identification Laboratory (AFDIL) (Rockville, MD) In June 1998 AFDIL identified Michael J. Blassie as the Vietnam Unknown in the Tomb of the Unknown Soldier (located in Arlington National Cemetery)
There will be no more unknown soldiers.

Butler, J.M. (2005) Forensic DNA Typing, 2nd Edition, Box 10.1, pp. 250-251
National DNA Index System (NDIS)

No names are associated with DNA profiles uploaded to NDIS If my profile was entered for searching: 16,17-17,18-21,22-12,14-28,30-14,16-12,13-11,14-9,9-9,11-6,6-8,8-10,10
http://www.fbi.gov/hq/lab/codis/index1.htm
Combined DNA Index System (CODIS)

Launched in October 1998 and now links all 50 states Used for linking serial crimes and unsolved cases with repeat offenders Convicted offender and forensic case samples along with a missing persons index Requires 13 core STR markers
>65,000 investigations aided nationwide as of Aug 2008
Contains more than 6.0 million DNA profiles

14
August 21, 2008
World Trade Center Towers (Sept 11, 2001)
Wreckage at Ground Zero
Highly Highlydegraded degradedDNA DNAwas wasrecovered recovered
World Trade Center Victim Identification Efforts Without DNA 736 Victims Identified Finished May 2002
Feb 23, 2005: Announcement that DNA identification efforts have been exhausted. Only 1,585 victims (58%) were identified from the 2,749 killed at the WTC site. Some DNA work is still on-going with WTC victim remains.
Source: Mecki Prinz (OCME) ISFG presentation, Sept 11, 2003
15
August 21, 2008
Using Personal Effects to Identify Remains

D7S820 D5S818 D13S317 D16S539
CSF1PO Penta D
DNA profile from toothbrush

(believed to belong to victim)
DNA profile from mass disaster victim
Personal Effects from victims are collected (toothbrushes, hairbrushes, dirty clothes, etc.)
Identifying Victims of Mass Disasters

Butler, J.M. (2005) Forensic DNA Typing, 2nd Edition, Chapter 24
Science (2005) 310: 1122-1123 Largest Forensic Case in History

~20,000 bone fragments were processed >6,000 family reference samples and personal effects samples were analyzed
16
August 21, 2008
The Romanovs Russias Royal Family (1913)

http://upload.wikimedia.org/wikipedia/en/thumb/9/9f/The_Romanovs,_1913.jpg/330px-The_Romanovs,_1913.jpg
Olga
Tatiana
Maria Anastasia
Tsarina Alexandra
Tsar Nicolas II
Alexei
Photo taken five years before they were killed
The Romanovs were Imprisoned by the Bolsheviks and Held in Ekaterinburg, Russia (Siberia)
Abdicated throne in March 1917; in Ekaterinburg from April 30 July 17, 1918
http://www.freewebs.com/rememberingtheromanovs/linksandextras.htm
The Romanov Family in captivity (left to right Tatiana, Tsarvitch Alexei, Maria (standing) Tsar Nickolas II, Anastasia, Olga)
17
August 21, 2008
On July 17, 1918, the Romanov family and their servants were taken into their basement where they were brutally murdered
http://img.photobucket.com/albums/v237/Otmafan1/ROAs/deathcellar.gif
The family execution was ordered by Lenin (leader of the Russian Revolution) because the opposing White Army was coming to free them.
History of the Bodies and Bones

July 1918 the Romanovs (Tsar, Tsarina, and five children) along with their doctor and three other servants were executed with bullets and bayonets by Bolsheviks in a basement of a house in Ekaterinburg The 11 bodies were stripped of their clothing and thrown down a mine shaft. Grenades were exploded to try and collapse the mine. These explosions likely fragmented the bodies. The Bolsheviks decided to move the bodies to a deeper mine shaft but their truck broke down so they buried 9 of the bodies in a shallow grave and poured sulfuric acid on the bodies to make them further unrecognizable. Planks were placed over the shallow grave and a truck driven over it to crush the bones further. Two of the bodies (Alexei and one of his sisters) were removed, burned, and buried separately.
18
August 21, 2008
Truck broke down
Four Brothers Mine x Mineshaft for x first burial Pigs Meadow Shallow grave from 1918-1991
Where Romanovs were killed
Slide courtesy of Mike Coble (Armed Forces DNA Identification Laboratory)
On a Road Just Outside of Ekaterinburg, Russia

Photo taken by Investigator Sokolov
In 1991, 9 bodies were found underneath these planks of wood
19
August 21, 2008
A Soldier Poses Near the Grave Site
Originally discovered in 1979, the grave site was not uncovered until after the Soviet Union fell in 1991
The Original Excavation (1991)

Draft of skeletons position in the grave : (1: Demidova - 2: Dr Botkin - 3: Olga 4: Nkolai - 5: Maria - 6: Tatiana 7: Aleksandra - 8: Kharitonov - 9: Trupp)
http://www.romanov-memorial.com/Pic/Final_Skelet.gif
Began working on the burial site on July 11 of 1991 and discovered about 1000 bone fragments but only 9 skulls whereas 11 people had been murdered
20
August 21, 2008
Identifications results comparison

of Russian (Abramov) and U.S. (Mapple) teams
Skeleton # 1 2 3 4 5 6 7 8 9 Sex F M F M F F F M? M Age 40-50 50-60 20-24 45-55 ~20 ~20 45-50 40-50 +60 Size 161-168 171-177 158-165 165-170 166-171 162-171 163-168 ? 172-181 Tatiana Anastasia Abramov conclusion Mapple conclusion
Demidova Botkin Olga Nikolai Maria Tatiana
Aleksandra Kharitonov Trupp
Missing bodies ->
Alexei and Maria
Alexei and Anastasia
http://www.romanov-memorial.com/Final_Chapter.htm
The Four Romanov Grand Duchesses

http://www.freewebs.com/rememberingtheromanovs/anastasia.htm http://www.freewebs.com/rememberingtheromanovs/tatiana.htm http://www.freewebs.com/rememberingtheromanovs/olga.htm
Olga
born Nov 3, 1895 22 years old
Tatiana
born May 29, 1897 21 years old
Maria
born June 14, 1899 19 years old
Anastasia
born June 5, 1901 17 years old
Ages at death in July 1918
21
August 21, 2008
Gill et al. (1994) Nature Genet. 6(2):130-135
Follow-up article:
Ivanov et al. (1996) Mitochondrial DNA sequence heteroplasmy in the Grand Duke of Russia Georgij Romanov establishes the authenticity of the remains of Tsar Nicholas II. Nature Genet. 12(4):417-420
The Romanovs (Last Russian Czar)

16169T/C Louise Louise of of Hesse-Cassel Hesse-Cassel
16169T/C Georgij Georgij Romanov Romanov
Tsar Nicholas II
Tsarina Alexandra
Xenia Xenia CheremeteffCheremeteffSfiri Sfiri
Mitotype 16126C 16169T 16294T 16296T 73G 263G 315.1C
Mitotype 16111T 16357C 263G 315.1C
Prince Prince Philip Philip Duke Duke of of Edinburgh Edinburgh
SOURCES: Gill et al. (1994) Nature Genetics, 6, 130-135.; Ivanov et al. (1996) Nature Genetics, 12, 417-420; Stone, R. (2004) Science, 303, 753.
D.N.A. Box 10.2, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition 2005 Elsevier Academic Press
22
August 21, 2008
Romanov Remains Laid to Rest on July 17, 1998 (80 years to the day they were killed)
http://lh3.ggpht.com/_CwF_BQN9cGE/Rs9SOTqiDJI/AAAAAAAACsA/AcA6wwwPSJ0/Russia+trip+June+2007+118.jpg
Buried in St. Petersburg, Russia

the last Czar of Russia and his family were buried in the crypt of St Petersburg's St Peter and Paul Cathedral
http://en.wikipedia.org/wiki/Image:Tsar_Nicholas_II_Family_Remains.jpg
In 1998 the remains of Tsar Nicholas II and his family (excluding Maria and Alexei) were placed here after having been exhumed from a 'grave' near the Ural Mountains. Analysis of DNA recovered from the remains was used to confirm their identities. This photograph was taken in 2004.
23
August 21, 2008
A Mystery Made for Movie(s)

http://www.totalfilm.com/__data/assets/thumbnail/616806/varieties/3.jpg
http://img518.imageshack.us/img518/8191/clipboard02zr6.jpg
Anastasia: Princess
Special Edition DVD (2006)
Disney Animation Movie (1997)
Anna Anderson Manahan was actually Franziska Schanzkowska

http://en.wikipedia.org/wiki/Anna_Anderson
http://en.wikipedia.org/wiki/Image:Annaan.JPG
The DNA tests showed that Anderson's DNA did not match the Romanov remains or Prince Philip, Duke of Edinburgh (a relative of the Romanovs), but was consistent with the mitochondrial DNA profile of Karl Maucher, a great-nephew of Franziska Schanzkowska
Gill et al. (1995) Establishing the identity of Anna Anderson Manahan. Nature Genet. 9(1):9-10
24
August 21, 2008
As Paul Harvey
http://www.paulharvey.com
And Now
Would Say
The Rest of the Story
http://www.foxnews.com/story/0,2933,294360,00.html
Remains of Czar Nicholas II's Son May Have Been Found

FRIDAY, AUGUST 24, 2007 MOSCOW The remains of the last czar's hemophiliac son and heir to the Russian throne, missing since the royal family was gunned down nine decades ago by Bolsheviks in a basement room, may have been found, an archaeologist said Thursday.
Prince Alexei, aged 8 or 9, in a detail from an official Russian royal-family photograph taken in 1913. His sister Grand Duchess Anastasia's hand drapes over his shoulder.
25
August 21, 2008
Photo from Grave Site Discovered in July 2007 (containing 2 bodies)
Original grave site (with 9 bodies) uncovered in 1991
Some of the Recovered Remains from Grave Site Discovered in July 2007
http://forum.alexanderpalace.org/index.php?topic=10115.msg282450
A few of the charred bone fragments + one nail
26
August 21, 2008
One Sample is Male and the Other Female

Sample 146
Sample 147
Can These Remains be Children of Tsar Nicholas II and Tsarina Alexandra?
Gill et al. (1994)
27
August 21, 2008
Tsar
146.1
Tsarina
Tsar
147
Tsarina
28
August 21, 2008
Tsar Nicholas II
Tsarina Alexandra
Olga
Tatiana
Maria 147
Anastasia
Alexei 146
It is 4.36 trillion times more likely IF samples 146.1 and 147 belong to this family pedigree than if these samples were from two unrelated individuals selected from the population.
A Living Male Relative Was Found to Confirm Y-Chromosome Testing Results

Tsar Nicholas I
Mikhail Nikolaevich Alexander Mikhailovich (Sandro) Andrei Alexandrovich
Tsar Alexander II
Tsar Alexander III
Tsar Nicholas II
Andrew Andreevich (Romanov)
Tsarevich Alexei
29
August 21, 2008
Alexei
Tsar Nicholas II
Andrew Romanov
Y-STRs
Tsar Nicholas II
Tsarina Alexandra
Mitochondrial DNA
Olga
Tatiana
Maria
Anastasia
Alexei
Forensic STRs
30
August 21, 2008
Forensic DNA testing will continue to play an increasing role in the future
http://www.manastungare.com/publications/genetic/dna.gif
31

Forensic DNA Testing

Transféré par

Informations du document

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Forensic DNA Testing

Transféré par

Droits d'auteur :

Formats disponibles

Forensic DNA Testing

August 21, 2008

Uses and Abuses of Modern DNA Science