Original Paper

Intervirology 2003;46:289295 DOI: 10.1159/000073208

Received: March 26, 2003 Accepted after revision: June 16, 2003

E/NS1 Modifications of Dengue 2 Virus after Serial Passages in Mammalian and/or Mosquito Cells
Wei-June Chen a Hsin-Rong Wu a Shyang-Song Chiou a, b
of Public Health and Parasitology, Chang Gung University, Tao-Yuan, b Institutes of Epidemiology, College of Public Health, National Taiwan University, Taipei, Taiwan
a Department

Key Words Dengue 2 virus W Genetic diversity W Serial passage W Virus evolution

Abstract Objective: Dengue viruses are routinely maintained in nature by transmission cycles involving the passage of virus between humans and Aedes mosquitoes. The number of dengue virus lineages has been increasing over time. The aim of this study was to identify the genetic diversity of dengue 2 virus serially transferred in mammalian and/or mosquito cells. Methods: The E/NS1 gene of dengue 2 virus variants derived from serial passages in Vero or C6/36 cells, or alternately in both cell systems, was amplified and sequenced in order to observe gene modification after serial passages. Results: Three nucleotides (two in E and one in NS1) or two amino acids (one each in E and NS1) changed in the virus that was continuously cultured in Vero cells for 20 passages, whereas four nucleotides (two each in E and NS1) or three amino acids (one in E and two in NS1) changed in
The GenBank accession numbers of the sequences reported in this paper are AY237288AY237290 and AY237292AY237295.

the virus cultured for 30 passages. The genome of dengue 2 virus remained stable even when the virus was serially transferred in C6/36 cells for 30 generations. However, there was one amino acid substitution (E46 IV) resulting from a single nucleotide change in the E region of dengue 2 virus alternately transferred in C6/36 and Vero cells for either 20 or 30 passages. In addition, dengue 2 virus obtained from serially cultured Vero cells usually replicated better when it reinfected Vero cells, reflecting its high adaptation fitness to the host cell. Conclusions: It is concluded that genetic changes of dengue 2 virus are constrained in Vero (mammalian) cells, resulting in a variety of genome-related quasispecies populations. Some populations of the virus are subsequently selected by and genetically (at least in the E/NS1 portion of the viral genome) maintained in C6/36 (mosquito) cells during replicative competition.
Copyright 2003 S. Karger AG, Basel

Introduction

Dengue fever is a mosquito-borne viral disease that is becoming increasingly important in many developing tropical countries as a result of increasing but frequently

ABC
Fax + 41 61 306 12 34 E-Mail karger@karger.ch www.karger.com

2003 S. Karger AG, Basel 03005526/03/04650289$19.50/0 Accessible online at: www.karger.com/int

Wei-June Chen, PhD Department of Public Health and Parasitology Chang Gung University Kwei-San, Tao-Yuan 333, Taiwan Tel. +886 3 7118800, Fax +886 3 2118700, E-Mail wjchen@mail.cgu.edu.tw

unplanned urbanization [1]. It has now been found in over 100 countries and territories, causing an estimated 50100 million cases annually [2]. Dengue hemorrhagic fever or dengue shock syndrome is a more severe form responsible for the high mortality of the disease [3]. The etiological agent of dengue fever is one of about 70 members of Flavivirus belonging to the family Flaviviridae [4]. Like other flaviviruses, dengue virus has a positivesense, single-stranded genomic RNA that contains a single open reading frame of 10,233 nucleotides and 3)- and 5)-end noncoding regions of 114585 and 67132 nucleotides, respectively [5, 6]. The genome of flaviviruses lacks a 3)-terminal poly(A) tail, a feature which distinguishes them from all other animal viruses with positive-stranded RNA [6], but has a cap I-type 5)-terminal sequence, in contrast to alphaviruses, which are members of Togaviridae [6, 7]. The genome of flaviviruses encodes three structural proteins, in the order of nucleocapsid (C), membrane (preM/M) and envelope (E), followed by seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) [6]. In nature, dengue viruses are routinely maintained by transmission cycles involving the passage of virus between humans and Aedes mosquitoes [8]. Inefficient proofreading and mismatch repair abilities during replication of RNA viruses have led to genetic variation of flaviviruses [9, 10]; this can occur in prolonged passage of cultured cells [11]. As the human population and the number of dengue epidemics have increased, the number of dengue virus lineages has been increasing over time [12, 13]. More interesting, the occurrence of mutations in flaviviruses (arboviruses utilize RNA genomes in general) is slower than that in other RNA viruses [14]. It has been speculated to be associated with alternating replication of the viruses in a cyclic sequence of vertebrate and invertebrate hosts [15]. Mutations of arboviruses usually display differential effects on different cells, implying the outcome of phenotypic variation among virus variants [16]. Arboviruses usually do not cause the death of mosquito cells [17], but they do induce apoptosis in vertebrate cells [18]. It is suggested that host-virus interactions are different in different combinations of virus and host. Cellular factors such as signal peptidase, protease or translation factors are supposed to contribute to genetic changes, leading to evolution of flaviviruses in the long run [19, 20]. This study investigated the genetic diversity of dengue 2 virus variants when the virus was serially transferred in Vero cells or C6/36 cells, or alternately between the two cell systems.

Materials and Methods

Viruses and Cell Cultures The prototype dengue 2 virus (New Guinea C) used in this study was propagated in C6/36 cells (mosquito cells derived from Aedes albopictus) and titrated with BHK-21 cells. To maintain the cell lines, Eagles MEM (GIBCO BRL, USA) containing 10% fetal bovine serum (FBS) was used and prepared as previously described [21]. The C6/36 cells used in this study were grown in a closed system (without CO2 supply) at 28 C, while mammalian cells including BHK-21 and Vero cells were cultured at 37 C in an atmosphere of 5% CO2. Serial Passage of the Virus in Cultured Cells Serial passage of the virus was carried out either solely in Vero or C6/36 cells, or alternately in both cell systems. The first passage (PV1) was initiated in Vero cells with an MOI of 10. Undiluted virus suspension was then used for infection of the next passage. For serial passage, 1 ml of virus suspension harvested from the last passage was added into a 15-ml centrifuge tube containing 2 ! 106 cells. After incubation with gentle shaking every 1520 min at 37 C for 1 h, the cells were transferred with fresh medium into a culture flask. Virus suspension harvested after 3 days of incubation was defined as one passage, representing one virus variant in this study. The procedure was repeated to harvest virus suspension until the end of the experiment. Virus variants used for analysis in this report were PV1, PV20, PV30, PC20, PC30, C20 and C30. Virus Titration The titer of cultured dengue virus was determined by plaque assay, which has been described before [22]. Briefly, BHK-21 cells were seeded into each well of 24-well culture plates. After addition of 70 l of diluted viral suspensions into each well, the plates were incubated at 37 C for 1.5 h with gentle shaking every 1520 min. Monolayers formed in each well were overlaid with 0.5 ml of 1.1% methyl cellulose (Sigma, Mo., USA) in culture medium containing 2% FBS; these were fixed with 10% formaldehyde for 30 min after a 4-day incubation at 37 C, followed by staining with 1% crystal violet for 15 min. The virus titer was calculated and expressed as PFU per milliliter. Growth of Virus Variants in Vero Cells Each dengue variant derived from serial passage in Vero and/or C6/36 cells was inoculated into Vero cells contained in glass tubes (1 cm in diameter ! 8 cm in length) and then incubated at 37 C in an atmosphere of 5% CO2. Inoculated cells in tubes were harvested at day 1, 3 and 5 postinoculation to examine the presence of viral antigen by immunofluorescence assay, while the supernatants were collected for virus titration. Immunofluorescence Assay The method of immunofluorescence assay has been described in one of our previous reports [23]. Briefly, cultured cells were smeared onto wells of 12-well Teflon-coated slides. After fixation in cold acetone (20 C) for 10 min, the monoclonal antibody specific to the dengue 2 virus (Biogenesis, UK) was added to each well. The slides were incubated at 37 C for 30 min and then washed with PBS. One drop of goat anti-mouse IgG antibody conjugated with fluorescein isothiocyanate (Sigma) was added to the wells. After incubation under the same conditions as above, the slides were washed with PBS

290

Intervirology 2003;46:289295

Chen/Wu/Chiou

Table 1. Primer pairs for gene fragmentation and editing of the E/NS1 segment from the genome of dengue 2

variants Primer pair Sequence (5)-3)) Nucleotide position in the genome 20312051 942 D2-2952C D2-2845S D2-3527C D2-810S D2-1240C D2-1203S D2-1830C D2-810S D2-1535C D2-1535S D2-2143C D2-1830S D2-2474C ACATCCTGCTTTTCTCTCAAC AGAATGCCCCAACACAAAC ATGCCATTCCCAAGACTCC AACCTGGATCTTGAGACATC TAATCCACATCCATTTCC GTTCCTCTGCAAACACTCCA TTCCTGTACACATAGAGTAT AACCTGGATCTTGAGACATC CCAAGCTTTGTCTTCCATCT AGATGGAAGACAAAGCTTGG CGCTCCTCTCATTGTTGTCTC TTCCTGTACACATAGAGTAT TGTGCACGTTATCTGTGATGAAGATCC 29522972 28452863 701 35273545 810829 448 12401257 12031222 647 18301849 810829 745 15351554 15351554 635 21432169 18301859 671 24742500 Size of PCR product, bp

D2-2031S

CAACATAGAAGCAGAACCTCC

S = Sense primer; C = complementary primer. Primer pairs designed by Duangchanda et al. [25].

again, then mounted with a mixture of PBS and glycerol (3:7). The slides were examined and photographed under an epifluorescent microscope (Olympus BX50, Japan). Extraction of Viral RNA The viral RNA extraction procedure was performed using QIAamp spin columns (Qiagen, Germany) in accordance with the manufacturers instructions. In brief, 140 l of the virus suspension was added to a 1.5-ml Eppendorf tube. The extracted RNA was stored in a deep freezer (86 C) until use. Mock-infected C6/36 cells were used as the control. Reverse Transcriptase-Polymerase Chain Reaction The method of reverse transcriptase-polymerase chain reaction (RT-PCR) followed the description in one of our previous reports [24]. The primer pairs listed in table 1, originally designed by Duangchanda et al. [25], were used to edit the sequence of viral RNA. For each run of RT-PCR, 20 pmol of complementary primer and 4 l of RNase-free water were added to 3 l of extracted RNA in a microtube. The mixture was kept in a water bath at 75 C for 10 min for hybridization, and then chilled in ice for 5 min. Then, 20 pmol of sense primer and 20 l of RT-PCR reaction buffer [13.85 l of double-distilled water, 2.8 l of 10! PCR buffer, 2.2 l of 2.5 mM dNTP, 2.63 l of 0.5 M DTT, 0.5 l of RNAsin (100,000 U), 0.15 l of MMLV (200 U), 0.5 l of Taq (500 U)] were added to a microtube. The reaction was run at 42 C for 1 h in a thermocycler (Hybaid,

UK). Synthesized cDNAs were denatured at 94 C for 4 min and then run for 40 cycles with the following settings: 94 C for 30 s; 55 C for 1 min, and 72 C for 1 min. An additional 10 min at 72 C was set for elongation after the cycling reaction was complete. Detection of Amplified DNA Fragments PCR products were analyzed electrophoretically on a 2% (w/v) agarose gel containing 10 l of ethidium bromide (1 mg/ml in RNasefree water). Band patterns on the gel were photographed using a Polaroid camera upon a UV-illuminated board. Sequencing For genomic sequencing, the band corresponding to the interesting DNA fragment was excised and purified using a Viogene gel extraction kit (Viogene, Calif., USA). It was then sequenced directly with the RT-PCR primers from Applied Biosystems (Foster City, Calif., USA). All procedures were performed using a Prism automated DNA sequencing kit and sequencer following the instructions provided by the manufacturer.

E/NS1 Changes of Dengue 2 Virus after Serial Passages

Intervirology 2003;46:289295

291

Table 2. Number of nucleotide changes in E/NS1 (2,541 nucleo-

Results

tides) of dengue 2 virus serially transferred in mammalian and/or mosquito cells Passage PV1 PV20 PV30 C20 C30 PC20 PC30 PV1 3 4 1 1 0 0 PV20 PV30 C20 C30 PC20 PC30

1 4 4 3 3

5 5 4 4

0 1 1

1 1

Table 3. Number of amino acid substitutions in E/NS1 (847 amino

acids) of dengue 2 virus serially transferred in mammalian and/or mosquito cells Passage PV1 PV20 PV30 C20 C30 PC20 PC30 PV1 2 3 1 1 0 0 PV20 PV30 C20 C30 PC20 PC30

1 3 3 3 3

4 4 3 3

0 1 1

1 1

Table 4. Nucleotide changes and amino acid substitutions among dengue 2 variants in comparison with the parent virus (PV1)

Passage

Nucleotide change E159 TC E557 CT NS1541 TC E159 TC E557 CT NS1532 TC NS1541 TC E136 AG E136 AG

Amino acid substitution (domain in E) E53 LL E186 SP (I) NS1181 SP E53 LL E186 SP (I) NS1178 FL NS1181 SP E46 IV (I) E46 IV (I)

PV20

PV30

E/NS1 cDNAs and Encoded Amino Acids Derived from Various Passages of Dengue 2 Virus The E/NS1 region, consisting of 2,541 nucleotides in length, was sequenced in order to compare RNA modifications among dengue 2 virus variants. Seven sequences were obtained from serial passages of dengue 2 virus in Vero cells or C6/36 cells, or alternately between the two cell systems. Of these passages, PV1 represented the first passage of the virus in Vero cells, while PV20 and PV30 were derived from 20 and 30 passages, respectively, after PV1 was further transferred in Vero cells. Both PC20 and PC30 were obtained from 20 and 30 passages, respectively, after PV1 was further transferred in C6/36 cells. The virus variants C20 and C30 were eventually obtained after PV1 had been alternately transferred in Vero and C6/36 cells for 20 and 30 passages, respectively. The GenBank accession numbers representing the sequences of these virus variants are AY237288 (PV1), AY237289 (PV20), AY237290 (PV30), AY237292 (PC30), AY237293 (C20), AY237294 (C30) and AY237295 (PC20). In comparison with PV1, the virus variants that were serially transferred in C6/36 cells (PC20 and PC30) did not have any change in the E/NS1 of their nucleotide sequences. However, nucleotide changes did occur in virus variants that were serially transferred in Vero cells only (PV20 and PV30) or alternately in both cell systems (C20 andC30) (table 2). A number of, but not all, nucleotide changes may result in amino acid substitutions (table 3). There were three nucleotide changes in PV20 (E159 TC, E557 CT, NS1543 TC), whereas four changes appeared in PV30 (E159 TC, E557 CT, NS1534 TC, NS1543 TC). The amino acid substitutions of PV20 included E53 (LL), E186 (SP) and NS1181 (SL). There was an additional substitution at NS1178 (FL) of PV30 (table 4). The virus variants with alternating replication in Vero and C6/36 cells possessed only one nucleotide change at E136 (AG), resulting in an amino acid substitution at E46 (IV) (table 4). Productivity of Dengue 2 Virus Variants in Vero Cells The difference in productivity, representing phenotypic variation, was assessed by reinoculation of the virus variants into Vero cells. The growth of all virus variants was variable, although their titers did increase gradually over the 5-day period of observation. The results showed that the titer of PV1 was 2.68 ! 104 PFU/ml on day 5 after infection, whereas those of PV20, PV30, C20 and

C20 C30 PC20 PC30

292

Intervirology 2003;46:289295

Chen/Wu/Chiou

C30 were 3.78 ! 105, 1.06 ! 106, 3.64 ! 106 and 2.60 ! 106 PFU/ml, respectively (fig. 1). These virus variants (all of which underwent transfer in Vero cells) always produced higher titers in comparison with PV1 (the parent virus). Virus variants that were restricted to passage in C6/36 cells (PC20, PC30) produced lower titers (fig. 1), i.e. 4.44 ! 102 and 2.54 ! 103 PFU/ml for PC20 and PC30, respectively.

Discussion

High mutation rates and short replication times allow RNA viruses, including dengue viruses, to evolve at rates several orders of magnitude faster than DNA-based organisms [26, 27]. The recent increase in the genetic diversity of dengue viruses is likely correlated with increased frequency of virus transmission between humans [28]. The gene encoding for E protein on the surface of flaviviruses is known to be the major site of mutations [29]. An estimated rate of nonsynonymous substitutions in the dengue envelope gene of 7.5 ! 10 5 subs/site/year has been obtained [30]. In addition, the NS1 gene was included in this analysis, as this protein is also involved in determination of viral virulence on the basis of its significance for virus entry and assembly [31]. In this study, changes in three nucleotides (two in E and one in NS1) or two amino acids (one each in E and NS1) were seen in dengue 2 virus serially cultured in Vero cells for 20 passages, and changes in four nucleotides (two each in E and NS1) or three amino acids (one in E and two in NS1) were seen in virus cultured for 30 passages. On the other hand, the genome of dengue 2 virus remained relatively stable even when the virus was serially transferred in C6/36 cells for as many as 30 generations. The virus that underwent alternating passage in C6/36 and Vero cells had one amino acid substitution (E46 IV), resulting from a single nucleotide change in the E gene. As with eastern equine encephalitis virus, the evolutionary rate of dengue 2 virus may have been constrained by alternating host transmission cycles [15], and mammalian cells (Vero cells in this case) apparently played a more important role in modulating genetic changes of the virus. In turn, heterogeneous populations of closely related genomes known as quasispecies may thus appear in nature [27, 32]. In the passage of dengue 2 virus involving Vero cells, single host cell adaptation resulted in a higher degree of genetic change compared to that from alternating passages, indicating that host factors were involved in the virus evolution [15]. In fact, changes in both the genotype

Fig. 1. The titer changes of dengue 2 virus variants that were reinoculated into Vero cells.

and phenotype of the related viruses have been observed after extensive passages in cell culture [33]. Moreover, mutations can be fixed and accumulated, resulting in changes in the genome, as the virus that was maintained in cells through the same way tended to keep their own mutation(s). Genomic changes, perhaps in the direction of viral evolution as well, evidently occurred in response to specific host-virus interactions [19, 34]. However, mosquito cells apparently have less effect on dengue viruses, insuring stability of the genomic structure. Although flavivirus mutants have been known to arise in the course of persistent infection in infected mosquito cell cultures [22, 35], the sequence in the E/NS1 region of dengue 2 virus was usually unchanged after serial passaging in C6/36 cells [36]. The present study also showed that dengue 2 virus remained stable at least in the region of E/NS1 after serial transfers in C6/36 cells for 30 times. Most flaviviruses have 57 days of extrinsic incubation in blood-feeding arthropods such as mosquitoes or ticks before they can be transmitted from one host to the other. This reduces the opportunity of exposing them to vertebrates in comparison with non-arboviruses, leading to a lower impact of host factors on the virus. As a result, the lower level of genetic variation in virus variants from alternating passage between Vero and C6/36 cells likely resulted from a lower frequency of host-virus interactions [20]. The slow rate of arbovirus evolution may result from

E/NS1 Changes of Dengue 2 Virus after Serial Passages

Intervirology 2003;46:289295

293

very different environments provided by disparate hosts, the mammalian host and the insect host [37]. However, it was recently reported that differences between the replication strategy in the insect vector (persistent/noncytolytic) and the mammalian host (productive, cytolytic) may be more important in this respect since insect and mammalian cells can constitute similar environments for viral replication [27]. The degree of mutability in dengue 2 virus variants derived from passages in mammalian cells is higher than in mosquito cells, which eventually leads to changes in virulence and probably disease severity as well [38]. It seems that different selective pressures exist for virus replication within each period of the two-host life cycle [19]. More interesting, mosquito-borne flaviviruses usually evolve faster than tick-borne ones in nature [39]. Perhaps the difference in passage frequency of the virus in the mammalian host is rather critical since the virus in ticks is usually maintained for longer than in mosquitoes during an extrinsic incubation period. Although mutations of flaviviruses mostly occur in mammalian cells, some mutants may be selected by and maintained in invertebrate cells. Furthermore, dengue 2 virus obtained from contin-

uous culture in Vero cells usually replicates better, reflecting its higher degree of adaptation fitness in Vero cells in comparison with those from the two other culture systems. A similar result was also shown with continuous replication of a wild-type strain of vesicular stomatitis virus in cultured sand fly cells for 10 months; that profoundly decreased virus replicative fitness in BHK-21 cells but greatly increased fitness in sand fly cells [34]. In conclusion, evolution of dengue 2 virus is probably constrained by innate properties of its replication in Vero (mammalian) cells, resulting in a variety of genome-related quasispecies populations; some of them could be selected by and genetically maintained in C6/36 (mosquito) cells during replicative competition [34].

Acknowledgements
We thank Shu-Hwa Lee and Mei-Hwei Fan-Chiang for their technical assistance. This work was supported by a grant from the Department of Health, ROC (DOH86-054), and in part by the National Science Council, ROC (NSC 81-0412-B037-502).

References
1 TDR research on dengue: Recommendations of a scientific working group. TDR News 2000; 62:3. 2 Monath TP: Yellow fever and dengue the interactions of virus, vector, and host in the reemergence of epidemic disease. Semin Virol 1994;5:133145. 3 Monath TP, Heinz FX: Flaviviruses; in Fields BN, Knipe DM, Howley PM (eds): Fields Virology. Philadelphia, Lippincott-Raven, 1996, pp 9611034. 4 Martin MS, Zanotto PM, Gritsum TS, Gould EA: Phylogeny of TYU, SRE, and CFA virus: Different evolutionary rates in the genus Flavivirus. Virology 1995;206:11331139. 5 Chambers TJ, Hahn CS, Galler R, Rice CM: Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 1990;44: 649688. 6 Chang GJ: Molecular biology of dengue viruses; in Gubler DJ, Kuno GK (eds): Dengue and Dengue Hemorrhagic Fever. New York, CAB International, 1996, pp 175198. 7 Vezza AC, Rosen L, Repik P, Dalrymple J, Bishop DHL: Characterization of the viral RNA species of prototype dengue viruses. Am J Trop Med Hyg 1980;29:643652. 8 Lam SK: Emerging infectious diseases Southeast Asia. Emerg Infect Dis 1998;4:145 147. 9 Steinhauer DA, Domingo E, Holland JJ: Lack of evidence for proofreading mechanisms associated with an RNA virus polymerase. Gene 1992;122:281288. 10 Domingo E, Escarmis C, Sevilla N, Moya A, Elena SF, Quer J, Novella IS, Holland JJ: Basic concepts in RNA virus evolution. FASEB J 1996;10:859864. 11 Marchette NJ, Dubois DR, Larsen LK, Summers PL, Kraiselburd EG, Gubler DJ, Eckels KH: Preparation of an attenuated dengue 4 (341750 Carib) virus vaccine. I. Pre-clinical studies. Am J Trop Med Hyg 1990;43:212 218. 12 Holland JJ: Evolving virus plaques. Proc Natl Acad Sci USA 1996;93:545546. 13 Rico-Hesse R, Harrison LM, Salas RA, Tovar D, Nisalak A, Ramos C, Boshell J, de Mesa MT, Nogueira MR, da Rosa AT: Origins of dengue type 2 viruses associated with increased pathogenicity in the Americas. Virology 1997; 230:244251. 14 Weaver SC, Rico-Hesse R, Scott TW: Genetic diversity and slow rates of evolution in New World alphaviruses. Curr Top Microbiol Immunol 1992;176:99117. 15 Weaver SC, Brault AC, Kang W, Holland JJ: Genetic and fitness changes accompanying adaptation of an arbovirus to vertebrate and invertebrate cells. J Virol 1999;73:43164326. 16 Lim HY, Ng ML: A different mode of entry by dengue-2 neutralisation escape mutant virus. Arch Virol 1999;144:989995. 17 Karpf AR, Brown DT: Comparison of Sindbis virus-induced pathology in mosquito and vertebrate cell cultures. Virology 1998;240:193 201. 18 Su HL, Lin YL, Yu HP, Tsao CH, Chen LK, Liu YT, Liao CL: The effect of human bcl-2 and bcl-X genes on dengue virus-induced apoptosis in cultured cells. Virology 2001;282:141 153. 19 Cooper LA, Scott TW: Differential evolution of eastern equine encephalitis virus populations in response to host cell type. Genetics 2001; 157:14031412. 20 Schneider WL, Roossinck ML: Genetic diversity in RNA virus quasispecies is controlled by host-virus interactions. J Virol 2001;75:6566 6571. 21 Chen WJ, Chen SL, Chien LJ, Chen CC, King CC, Harn MR, Hwang KP, Fang JH: Silent transmission of the dengue virus in southern Taiwan. Am J Trop Med Hyg 1996;55:1216. 22 Chen WJ, Chen SL, Fang AH: Phenotypic characteristics of dengue 2 virus persistently infected in a C6/36 clone of Aedes albopictus cells. Intervirology 1994;37:2530.

294

Intervirology 2003;46:289295

Chen/Wu/Chiou

23 Chen WJ, Dong CF, Chiu LY, Chuang WL: Potential role of Armigeres subalbatus (Diptera: Culicidae) in the transmission of Japanese encephalitis virus in the absence of rice culture on Liu-Chiu, Taiwan. J Med Entomol 2000;37: 108112. 24 Chiou SS, Chen WJ: Mutations in the NS3 gene and 3)-NCR of Japanese encephalitis virus isolated from an unconventional ecosystem and implications for natural attenuation of the virus. Virology 2001;289:129136. 25 Duangchanda S, Tanaka M, Morita K, Rojanasuphot S, Igarashi A: Comparative nucleotide and deduced amino acid sequence of the envelope glycoprotein gene among three dengue virus type 2 strains isolated from patients with different disease severities in Maha Sarakham, northern Thailand. Southeast Asian J Trop Med Public Health 1994;25:243251. 26 Henchal EA, Putnak AR: The dengue virus. Clin Microbiol Rev 1990;3:376396. 27 Novella IS, Hershey CL, Escarmis C, Domingo E, Holland JJ: Lack of evolutionary stasis during alternating replication of an arbovirus in insect and mammalian cells. J Mol Biol 1999; 287:459465. 28 Twiddy SS, Holmes EC, Rambaut A: Inferring the rate and time-scale of dengue virus evolution. Mol Biol Evol 2003;20:122129.

29 Lobigs M, Usha R, Nestorowicz A, Marshall ID, Weir RC, Dalgarno L: Host cell selection of Murray Valley encephalitis virus variants altered at an RGD sequence in the envelope protein and in mouse virulence. Virology 1990; 176:587595. 30 Zanotto PMA, Gould EA, Gao GF, Harvey PH, Holmes EC: Population dynamics of flaviviruses revealed by molecular phylogenies. Proc Natl Acad Sci USA 1996;93:548553. 31 Thant KZ, Morita K, Igarashi A: Detection of the disease severity-related molecular differences among new Thai dengue-2 isolates in 1993, based on their structural proteins and major non-structural protein NS1 sequences. Microbiol Immunol 1996;40:205216. 32 Wang WK, Lin SR, Lee CM, King CC, Chang SC: Dengue type 3 virus in plasma is a population of closely related genomes: Quasispecies. J Virol 2002;76:46624665. 33 Bradt WE: Development of dengue and Japanese encephalitis vaccines. J Infect Dis 1990; 162:577583.

34 Novella IS, Clarke DK, Quer J, Duarte E, Lee CH, Weaver SC, Elena SF, Moya A, Domingo E, Holland JJ: Extreme fitness differences in mammalian and insect hosts after continuous replication of vesicular stomatitis virus in sandfly cells. J Virol 1995;69:68056809. 35 Randolph VB, Hardy JL: Phenotypes of St. Louis encephalitis virus mutants produced in persistently infected mosquito cell cultures. J Gen Virol 1988;69:21992207. 36 Thayan R, Morita K, Vijayamalar B, Zainah S, Chew TK, Oda K, Sinniah M, Igarashi A: Comparison of sequences of E/NS1 gene junction of dengue type 3 virus following culture subpassage in C6/36 cells to study the possible occurrence of mutations. Southeast Asian J Trop Med Public Health 1997;28:380386. 37 Steele GM, Nuttall PA: Differences in vector competence of two species of sympatric ticks, Amblyomma variegatum and Rhipicephalus appendiculatus, for Dugbe virus (Nairovirus, Bunyaviridae). Virus Res 1989;14:7384. 38 Kuno G: Review of the factors modulating dengue transmission. Epidemiol Rev 1995;17: 321335. 39 Ruiz BH, Sanchez I, Ortega G, Lopez I, Rosales L, Medina G: Phylogenetic comparison of the DEN-2 Mexican isolate with other flaviviruses. Intervirology 2000;43:4854.

E/NS1 Changes of Dengue 2 Virus after Serial Passages

Intervirology 2003;46:289295

295