ADN COMO MATERIAL GENÉTICO

Maribeb Castro González, MSc, PhD

HISTORIA
30’s. Los cromosomas tienen ADN y proteínas, cada proteína es responsable de un carácter biológico o función en el metabolismo. Proteínas con secuencias de a.a. y diferentes estructuras y por ende con muchas funciones biológicas. Relación gen-proteínas, porque cada mutación se correspondía con una alteración enzimática.

La hipótesis era que el cromosoma tenía moléculas de ADN (considerado el esqueleto) y sobre él estaban las proteínas génicas.

Transformación 1928

de

neumococos,Grifith

transformación permanente y hereditaria a muchas generaciones. Pueden transformar no virulentos en virulentos, introduciendo “el material genético patógeno” aun estando muertas!.

Hersey & Check 1952.Cuál era el principio transformante? Delbruck 1930. resistencia Antibioticos. MacLeod & McCarthy 1944 eliminaron enzimas. coli demostrando que: El material genético del fago es DNA Que el DNA-fago se reproduce dentro de las bacterias atacadas y las proteínas-fago quedan fuera de las células . 1949. RNA y quedo ADN Hotchkiss. virus bacteriófagos líticos T2 que atacan a E. transformó caracteres no relacionados con cápsula. Fagos Avery.

Fraenkel-Conrad & Singer 1957 construyeron virus híbridos in vitro de RNA-proteìnas. .Mirsky & Ris 1950 Midieron cantidad de DNA en células somáticas y gametos: cantidad-ADN era kte y que hay el doble en somáticas vs. Gierer & Schram 1956 Probaron que algunos virus tienen RNA como material genético. VMT –RNA.gametos.

Bases púricas A-G(2 anillos) Bases pirimidínicas C. T = ADN A. C.T. G.U ( 1 anillo) A. C. G. U = ARN .EL ADN-BIOPOLIMERO Kossell & Neumann 1894 bases nitrogenadas.

Hammersten 1900. Levene 1929: Pentosas: desoxiribosa ribosa. nucleósido nucleótido Polímeros de nucleótidos monofosfato = ADN ácida .

Estructura en escalera: Los peldaños y el pasamanos .

Estructura en escalera: Los peldaños y el pasamanos .

Desoxiribonucleótidos del DNA .

Ribonucleótidos del RNA .

A+G/T+C =1 El cociente (A+T)/(G+C) es típico y constante para cada especie. .Regla de Chargaff. 1950 Las bases se encuentran en proporciones iguales A = T. (A+G) = (T+C ). G = C. A/T = G/C = 1.

La variación es mayor entre las bacterias (26% Welchia perfringens. 74% streptococcus griseus) que en los eucariotas (G+C ≈ 50%) .

DIFERENCIAS ENTRE DNA Y RNA DNA Azúcar: Desoxiribosa Bases nitrogenadas: ACGT Cadena doble RNA Azúcar: Ribosa Bases nitrogenadas: ACGU Cadena sencilla A .

.La hebra está polarizada: 5’-P(fosfato) y 3’OH(hidroxilo) y al formarse la hebra las bases N que son planas se apilan como monedas.

Rosalin Franklin 1952.WilliamAstbury 1950. Idéntico: fagos a mamíferos. Aislamiento y cristalizaciónDNA con patrón de difracción. Molécula larga fina de 20Å y 2 hebras enrolladas helicoidalmente dando una vuelta a la hélice c/34Å. .

.

En azul el donador de hidrógenos y en rojo el aceptor. Par de bases A=T de tipo WatsonCrick. En azul el donador de hidrógenos y en rojo el aceptor. Los cambios tautoméricos mutaciones puntuales Par de bases A=T de tipo WatsonCrick reverso. . Nótese que la pirimidina ha sufrido un giro de 180º sobre el eje del carbono 6.ADN con formas tautoméricas de acuerdo a la posición de los dobles enlaces y átomos de H. Existen 28 posibles pares de bases nitrogenadas en forma tautomérica mayoritaria.

Carácterísticas doble hélice: -Antiparalela -Hebras complementarias -Estable: enlaces H y uniones hidrofóbicas -Diámetro constante -Helicoidal -Tridimensionales -Molécula ácida -Superenrollamiento -Diferentes formas .

se encuentra en algunas regiones pequeñas de los cromosomas y sin función clara.Forma Alfa: más compacta que Beta con 11 pb por vuelta y 23Å. 18 Å. 12pb/giro. Forma Beta: Dextrógira con 10 pb/giro. forma+natural y estable Forma Z: levógira. .

ADN cuadruplex por repetición en telomeros .

.Estructura secundaria del ADN Formada por pb dentro de una hebra simple de ADN. Stem and loops en RNA ribosomal “stems y loops” Hairping: Algunos ADN linear tienen estructuras que se forman desde moléculas con repeticiones invertidas.

ADN superenrollado .

En bacterias es la DNA girasa ó topoisomerasa II que da SE.En E. . Ventaja o no? Algunos genes se transcriben más activamente con ADN-SE. novobiocina y topoisomerasa I inhiben la girasa en bacterias.en varios pasos El ácido nalidíxico. Cómo sucede? En Eucaria la formación de nucleosoma introduce SE-. mientras la de otros se inhibe.coli el ADN es 1000 veces > que el tamaño de la propia célula .

Antibióticos (actinomicinas). sin dañar los enlaces H. se intercalan y enlazan a la garganta mayor inhibiendo la replicación y la transcripción .Interacciones de químicos con el ADN Algunos químicos se insertan o intercalan entre pb. benzopirona. acridina naranja. Acridinas: acriflavina. pero sí los enlaces fosfato-azúcar alterando la forma de la hélice. agentes cancerígenos o mutagénicos. bromuro de etidio.

los covalentes no >T° de fusión > GC. 60% G+C = Tm 95°C bajo las mismas condiciones experimentales.EFECTO DE TEMPERATURA SOBRE ACIDOS NUCLEICOS Enlaces H se rompen por calor.e ADN con un 40% de G+C = Tm 87°C. T denaturación = 85-95°C T de fusión aumenta 0. A medida que se funde la molécula cambia la absorbancia a 260 nm. Tm = es el punto medio de la transición a la fusión y depende de la cantidad GC. . P.4°C por c/1% más de GC-ADN.

) que permite comparar organismos. Pero. el ADN eucariota aunque complejo se reasocia rápido (COT bajos) porque tiene 3 tipos de secuencias: . etc.Las curvas COT Cinética de la reacción de renaturalización del ADN bajo condiciones físicoquímicas estándar (fuerza iónica.e virus vs. Mide el tiempo entre pasar de una [ ]inicial = 100% de hebras simples a una [ ]final de 0% de hebras simples: moles/L/s. Bacteria. < complejidad > reasociación p. [cationes].

tacattgaacggtctaacaacaaaaaggcttgtaaagagattccaagctagttcgtagaggcatccaatacatgtttggctctcgcattccccttttgtt tagaagtcacaatttcaattgagaaagtctattgcaaaaatttgatccaaatagaaaaagttgatacagattgtattgctaaggcacaccttacatttct tatattgtaatataaataccaagaaatagagttccacatctaaaagaaagaagatctaaagtaatatatgaaagccataaatcattcttccatacgttgg aatcccatgagatataacagtactatatatacaagaaagaaataatacatgtgtatattgataagtagtgTTAAGGGCCTTTGGAGAGCATGTTTTCAAT GGATTCAAGACGCTGGAGAAGAAGCTGATTTCTGAACTTTGTGATGAAAGCTTCTGCGCTCTTGTCCACGTCCATCGATGCCTTCCTTTCCACCTTCTTA TTCATCGTCTCTTTAATAACAATATTAGTGGTACCATTACCACTTTCTTTTGCGGAACTCATCATCATCTTCATGTTCTTGTTGTTGTTCATggtagaga tgtgtgtgtaacagtgcttgtgtttccttaattgattttggagagagggtgaattgttatattttggagatgctcgagacctatgtatttataggggatt ttcatttttttttttatttttttttaataaaaaactgtagttagacatataggaaaggagaagacttatttctctttacgtaaaccatagttgaatgttg aaggaataaaaagaaatggaatcttgaatctcaagttatacacgcgacttattaacaataacaaaaaacgttatatacgagacccatccatagtcagaga ggaatgatctacaaagcaccgtctctactctctactttataatttatatatttcttttttaagaaaaaataaaatatacgttaatcctctattaactatt ggaataacatagcatcaaatctaagattctgcttgaaagaaatgtaaaagaggttgcctaactacatattaaatttgaatttgttaatttggagaaacaa ggatgcaagattctagaaagttatatataatttgaccattcgtcactaaccaaaacaattggctttgttgtttttatataccacacgaattacggcttaa gcattggagattgaactcgttaactcaccgcccactattcccattgtcgccgctccggtaaccggtaccgcttcttctttaccaagaagaacaataaaat aaaagagattatgtggcttaagttagcttataacctaagtacctaactctaaaccgaactaattagttttcggcagattcgttgaatcatgtatgatata ttgatacacatactttttttattaaaatgtatagagaatattggttcaaaattcatttgccgtgatcgaagaataatgcgattatcaaaataaaataaaa taagaagcttcaaagcaaacgtacatggtagagttacaatttgattaattatgaaccgttattggccataaccaaacataaaaattaatgattttgaacc cactagtttaggatgttatttggtaattcaaatttgatttatctattacagtttttaaatttatttttgttattacgtagttggcctgtggtggtggatt gctccggataacatcactaacgcatatttataatcacacgattaaagagtgttttggtagttaatgcatgtaatagattatcttttctttttgtgcaacg gtaatagattacctaaggaatatcacaatcgtattggacagatattggaaactaatcaaactcaaaattattatgttttatgacaacattatctctatag agaatccctgtgttgtcaaaaagaaaaacaattatgtattaggcccaaggaagagcagaactatctcatttctattgggctattaagataataggctgaa agagcgattttaggcccaaggagtcgtatttcaagaaatgacgaccgATGGGACTCCACCGAGACGAAGCGACGGCCATGGAAACCCTTTTCAGAGTCTC ACTTCGTCTACTTCCGGTTTCCGCCGCCGTGACATGTCGCTCGATCCGATTCCCCGTTTCAAGACCCGGTTCCTCACACTTACTGAACCGTAAGCTGTAT AATTTGCCTACTTCTTCTTCCTCCTCTTTGTCGACAAAAGCCGGTTGGTTATTGGGTCTTGGTGAGAAGAAAAAGAAAGTGGATTTACCGGAGATAGTGG CATCTGGTGACCCGGTTCTGCACGAGAAGGCCCGAGAAGTTGACCCGGGAGAAATCGGGTCGGAGCGTATTCAGAAGATAATTGATGATATGATTAAAGT TATGAGATTGGCTCCTGGAGTTGGCCTCGCTGCTCCTCAAATTGGTGTTCCCTTAAGGgtaagtctataaatgcttttcctagtttcacccatttcgaag caaatgattgaattagtgtttcatggtgaatgatgcagATTATTGTATTGGAAGATACAAAAGAGTATATAAGTTACGCACCAAAGGAAGAGATTCTTGC TCAAGAAAGACGTCATTTTGATCTCATGgtaaataatagaatcagagtgcttaagagttgttacaattttcgattagaacaaaaatgttgaagtttgggg .

Ternera 60% genoma. Ternera 20% genoma. ADN inestable . Clase muy hetereogénea: repiten 100’s o 1000’s de veces (moderadamente repetidas).Tipos de Secuencias: Clase homogénea:1vez/genoma. alto COT.

que se repiten en tandem hasta 1 millón de veces en una zona concreta del genoma intercalados en las regiones no codificantes: minisatélites y microsatélites. secuencias de 4-6 pb. Número de repeticiones y longitud difiere entre individuos.Secuencias altamente repetitivas o de reasociación muy rápida COT <10-2 . .

.

. Renaturalizan por debajo de la T de fusión y existen miles de palíndromos en el genoma.Palíndromos: Secuencias que se leen igual en cualquier dirección COT = 10-2 ó 10-4 o renaturalizan en tiempo 0. MADAM I’M ADAM.

.Los genes. que contienen la infomación para sintetizar proteínas. que incluyen secuencias reguladoras de la expresión (promotores. Se pueden distinguir: •Genes o secuencias codificantes. •Secuencias no codificantes. INTRONES) Genoma es el conjunto de todos los genes de un organismo. unidades de información La secuencia del ADN está estructurada en codones de 3 nucleótidos. EXONES.

639.3 x 108 No.779 4.653.977 3.000 25.000 .377 ~19.3 x 109 115.386 4.000 13.409.258.949 4. genes 10 4.Tamaño del genoma en diferentes especies Especie Phi-X 174/ virus Bacilus subtilis / bacteria Escherichia coli / bacteria Caenorhabditis elegans / gusano Drosophila melanogaster / insecto Homo sapiens / hombre Arabidopsis thaliana/ brasicacea Oryza sativa / arroz No.498 ~60.214.171 122.379 ~25. nucleotidos 5.814 4.221 100.

5 75 310MY 450MY 600-1200MY? ? 370MY 40 human chimp mouse rat chicken fish worm bee fruit fly 250MY Human: Nature Feb 2001. 2008 Mosquito: Science Oct 2002 mosquito Chimp: Nature Sep 2005 Mouse: Nature Dec 2002 Chicken: Nature Dec 2004 Honey bee: in preparation Rat: Nature Apr 2004 .

01%=1.250 letras  Single nucleotide polymorphisms (SNPs)  .Variación entre individuos La variación individual solo representa el 0.

6% y bonobo y humano somos idénticos en el 98.7% de los nucleótidos. El genoma del bonobo (Junio 2012) y del chimpance son idénticos en el 99.El ADN es la molécula de la vida  Compartimos el 98. .4% del DNA con los chimpances. El genoma del bonobo muestra que más del 3% del genoma humano está más cercanamente relacionado con el de bonobos y con el de los chimpancés que el genoma de estos entre sí.