ADN COMO MATERIAL GENÉTICO

Maribeb Castro González, MSc, PhD

HISTORIA
30’s. Los cromosomas tienen ADN y proteínas, cada proteína es responsable de un carácter biológico o función en el metabolismo. Proteínas con secuencias de a.a. y diferentes estructuras y por ende con muchas funciones biológicas. Relación gen-proteínas, porque cada mutación se correspondía con una alteración enzimática.

La hipótesis era que el cromosoma tenía moléculas de ADN (considerado el esqueleto) y sobre él estaban las proteínas génicas.

Transformación 1928

de

neumococos,Grifith

transformación permanente y hereditaria a muchas generaciones. Pueden transformar no virulentos en virulentos, introduciendo “el material genético patógeno” aun estando muertas!.

transformó caracteres no relacionados con cápsula. RNA y quedo ADN Hotchkiss.Cuál era el principio transformante? Delbruck 1930. MacLeod & McCarthy 1944 eliminaron enzimas. 1949. Fagos Avery. virus bacteriófagos líticos T2 que atacan a E. resistencia Antibioticos. coli demostrando que: El material genético del fago es DNA Que el DNA-fago se reproduce dentro de las bacterias atacadas y las proteínas-fago quedan fuera de las células . Hersey & Check 1952.

gametos. Gierer & Schram 1956 Probaron que algunos virus tienen RNA como material genético. VMT –RNA. Fraenkel-Conrad & Singer 1957 construyeron virus híbridos in vitro de RNA-proteìnas.Mirsky & Ris 1950 Midieron cantidad de DNA en células somáticas y gametos: cantidad-ADN era kte y que hay el doble en somáticas vs. .

T = ADN A.T.EL ADN-BIOPOLIMERO Kossell & Neumann 1894 bases nitrogenadas. G. U = ARN .U ( 1 anillo) A. Bases púricas A-G(2 anillos) Bases pirimidínicas C. G. C. C.

Levene 1929: Pentosas: desoxiribosa ribosa. nucleósido nucleótido Polímeros de nucleótidos monofosfato = ADN ácida .Hammersten 1900.

Estructura en escalera: Los peldaños y el pasamanos .

Estructura en escalera: Los peldaños y el pasamanos .

Desoxiribonucleótidos del DNA .

Ribonucleótidos del RNA .

A/T = G/C = 1. G = C. A+G/T+C =1 El cociente (A+T)/(G+C) es típico y constante para cada especie. . (A+G) = (T+C ). 1950 Las bases se encuentran en proporciones iguales A = T.Regla de Chargaff.

La variación es mayor entre las bacterias (26% Welchia perfringens. 74% streptococcus griseus) que en los eucariotas (G+C ≈ 50%) .

DIFERENCIAS ENTRE DNA Y RNA DNA Azúcar: Desoxiribosa Bases nitrogenadas: ACGT Cadena doble RNA Azúcar: Ribosa Bases nitrogenadas: ACGU Cadena sencilla A .

La hebra está polarizada: 5’-P(fosfato) y 3’OH(hidroxilo) y al formarse la hebra las bases N que son planas se apilan como monedas. .

. Molécula larga fina de 20Å y 2 hebras enrolladas helicoidalmente dando una vuelta a la hélice c/34Å. Idéntico: fagos a mamíferos. Rosalin Franklin 1952.WilliamAstbury 1950. Aislamiento y cristalizaciónDNA con patrón de difracción.

.

. Los cambios tautoméricos mutaciones puntuales Par de bases A=T de tipo WatsonCrick reverso. Nótese que la pirimidina ha sufrido un giro de 180º sobre el eje del carbono 6. Par de bases A=T de tipo WatsonCrick. Existen 28 posibles pares de bases nitrogenadas en forma tautomérica mayoritaria. En azul el donador de hidrógenos y en rojo el aceptor. En azul el donador de hidrógenos y en rojo el aceptor.ADN con formas tautoméricas de acuerdo a la posición de los dobles enlaces y átomos de H.

Carácterísticas doble hélice: -Antiparalela -Hebras complementarias -Estable: enlaces H y uniones hidrofóbicas -Diámetro constante -Helicoidal -Tridimensionales -Molécula ácida -Superenrollamiento -Diferentes formas .

12pb/giro. 18 Å. se encuentra en algunas regiones pequeñas de los cromosomas y sin función clara. Forma Beta: Dextrógira con 10 pb/giro. forma+natural y estable Forma Z: levógira. .Forma Alfa: más compacta que Beta con 11 pb por vuelta y 23Å.

ADN cuadruplex por repetición en telomeros .

. Stem and loops en RNA ribosomal “stems y loops” Hairping: Algunos ADN linear tienen estructuras que se forman desde moléculas con repeticiones invertidas.Estructura secundaria del ADN Formada por pb dentro de una hebra simple de ADN.

ADN superenrollado .

en varios pasos El ácido nalidíxico. .En E. En bacterias es la DNA girasa ó topoisomerasa II que da SE. Ventaja o no? Algunos genes se transcriben más activamente con ADN-SE. novobiocina y topoisomerasa I inhiben la girasa en bacterias. Cómo sucede? En Eucaria la formación de nucleosoma introduce SE-.coli el ADN es 1000 veces > que el tamaño de la propia célula . mientras la de otros se inhibe.

benzopirona. agentes cancerígenos o mutagénicos. Antibióticos (actinomicinas). acridina naranja. Acridinas: acriflavina. bromuro de etidio. pero sí los enlaces fosfato-azúcar alterando la forma de la hélice. sin dañar los enlaces H. se intercalan y enlazan a la garganta mayor inhibiendo la replicación y la transcripción .Interacciones de químicos con el ADN Algunos químicos se insertan o intercalan entre pb.

4°C por c/1% más de GC-ADN.e ADN con un 40% de G+C = Tm 87°C. 60% G+C = Tm 95°C bajo las mismas condiciones experimentales.EFECTO DE TEMPERATURA SOBRE ACIDOS NUCLEICOS Enlaces H se rompen por calor. . A medida que se funde la molécula cambia la absorbancia a 260 nm. P. los covalentes no >T° de fusión > GC. T denaturación = 85-95°C T de fusión aumenta 0. Tm = es el punto medio de la transición a la fusión y depende de la cantidad GC.

< complejidad > reasociación p. Mide el tiempo entre pasar de una [ ]inicial = 100% de hebras simples a una [ ]final de 0% de hebras simples: moles/L/s. Bacteria. Pero. [cationes]. etc.) que permite comparar organismos.Las curvas COT Cinética de la reacción de renaturalización del ADN bajo condiciones físicoquímicas estándar (fuerza iónica.e virus vs. el ADN eucariota aunque complejo se reasocia rápido (COT bajos) porque tiene 3 tipos de secuencias: .

tacattgaacggtctaacaacaaaaaggcttgtaaagagattccaagctagttcgtagaggcatccaatacatgtttggctctcgcattccccttttgtt tagaagtcacaatttcaattgagaaagtctattgcaaaaatttgatccaaatagaaaaagttgatacagattgtattgctaaggcacaccttacatttct tatattgtaatataaataccaagaaatagagttccacatctaaaagaaagaagatctaaagtaatatatgaaagccataaatcattcttccatacgttgg aatcccatgagatataacagtactatatatacaagaaagaaataatacatgtgtatattgataagtagtgTTAAGGGCCTTTGGAGAGCATGTTTTCAAT GGATTCAAGACGCTGGAGAAGAAGCTGATTTCTGAACTTTGTGATGAAAGCTTCTGCGCTCTTGTCCACGTCCATCGATGCCTTCCTTTCCACCTTCTTA TTCATCGTCTCTTTAATAACAATATTAGTGGTACCATTACCACTTTCTTTTGCGGAACTCATCATCATCTTCATGTTCTTGTTGTTGTTCATggtagaga tgtgtgtgtaacagtgcttgtgtttccttaattgattttggagagagggtgaattgttatattttggagatgctcgagacctatgtatttataggggatt ttcatttttttttttatttttttttaataaaaaactgtagttagacatataggaaaggagaagacttatttctctttacgtaaaccatagttgaatgttg aaggaataaaaagaaatggaatcttgaatctcaagttatacacgcgacttattaacaataacaaaaaacgttatatacgagacccatccatagtcagaga ggaatgatctacaaagcaccgtctctactctctactttataatttatatatttcttttttaagaaaaaataaaatatacgttaatcctctattaactatt ggaataacatagcatcaaatctaagattctgcttgaaagaaatgtaaaagaggttgcctaactacatattaaatttgaatttgttaatttggagaaacaa ggatgcaagattctagaaagttatatataatttgaccattcgtcactaaccaaaacaattggctttgttgtttttatataccacacgaattacggcttaa gcattggagattgaactcgttaactcaccgcccactattcccattgtcgccgctccggtaaccggtaccgcttcttctttaccaagaagaacaataaaat aaaagagattatgtggcttaagttagcttataacctaagtacctaactctaaaccgaactaattagttttcggcagattcgttgaatcatgtatgatata ttgatacacatactttttttattaaaatgtatagagaatattggttcaaaattcatttgccgtgatcgaagaataatgcgattatcaaaataaaataaaa taagaagcttcaaagcaaacgtacatggtagagttacaatttgattaattatgaaccgttattggccataaccaaacataaaaattaatgattttgaacc cactagtttaggatgttatttggtaattcaaatttgatttatctattacagtttttaaatttatttttgttattacgtagttggcctgtggtggtggatt gctccggataacatcactaacgcatatttataatcacacgattaaagagtgttttggtagttaatgcatgtaatagattatcttttctttttgtgcaacg gtaatagattacctaaggaatatcacaatcgtattggacagatattggaaactaatcaaactcaaaattattatgttttatgacaacattatctctatag agaatccctgtgttgtcaaaaagaaaaacaattatgtattaggcccaaggaagagcagaactatctcatttctattgggctattaagataataggctgaa agagcgattttaggcccaaggagtcgtatttcaagaaatgacgaccgATGGGACTCCACCGAGACGAAGCGACGGCCATGGAAACCCTTTTCAGAGTCTC ACTTCGTCTACTTCCGGTTTCCGCCGCCGTGACATGTCGCTCGATCCGATTCCCCGTTTCAAGACCCGGTTCCTCACACTTACTGAACCGTAAGCTGTAT AATTTGCCTACTTCTTCTTCCTCCTCTTTGTCGACAAAAGCCGGTTGGTTATTGGGTCTTGGTGAGAAGAAAAAGAAAGTGGATTTACCGGAGATAGTGG CATCTGGTGACCCGGTTCTGCACGAGAAGGCCCGAGAAGTTGACCCGGGAGAAATCGGGTCGGAGCGTATTCAGAAGATAATTGATGATATGATTAAAGT TATGAGATTGGCTCCTGGAGTTGGCCTCGCTGCTCCTCAAATTGGTGTTCCCTTAAGGgtaagtctataaatgcttttcctagtttcacccatttcgaag caaatgattgaattagtgtttcatggtgaatgatgcagATTATTGTATTGGAAGATACAAAAGAGTATATAAGTTACGCACCAAAGGAAGAGATTCTTGC TCAAGAAAGACGTCATTTTGATCTCATGgtaaataatagaatcagagtgcttaagagttgttacaattttcgattagaacaaaaatgttgaagtttgggg .

Clase muy hetereogénea: repiten 100’s o 1000’s de veces (moderadamente repetidas).Tipos de Secuencias: Clase homogénea:1vez/genoma. Ternera 20% genoma. alto COT. Ternera 60% genoma. ADN inestable .

que se repiten en tandem hasta 1 millón de veces en una zona concreta del genoma intercalados en las regiones no codificantes: minisatélites y microsatélites. . Número de repeticiones y longitud difiere entre individuos.Secuencias altamente repetitivas o de reasociación muy rápida COT <10-2 . secuencias de 4-6 pb.

.

.Palíndromos: Secuencias que se leen igual en cualquier dirección COT = 10-2 ó 10-4 o renaturalizan en tiempo 0. MADAM I’M ADAM. Renaturalizan por debajo de la T de fusión y existen miles de palíndromos en el genoma.

INTRONES) Genoma es el conjunto de todos los genes de un organismo. que incluyen secuencias reguladoras de la expresión (promotores. . que contienen la infomación para sintetizar proteínas. Se pueden distinguir: •Genes o secuencias codificantes. unidades de información La secuencia del ADN está estructurada en codones de 3 nucleótidos. EXONES.Los genes. •Secuencias no codificantes.

000 13.639.221 100.3 x 109 115.000 .498 ~60.386 4.949 4. nucleotidos 5.814 4.3 x 108 No.379 ~25.977 3.653.214.779 4.000 25.377 ~19.171 122. genes 10 4.409.Tamaño del genoma en diferentes especies Especie Phi-X 174/ virus Bacilus subtilis / bacteria Escherichia coli / bacteria Caenorhabditis elegans / gusano Drosophila melanogaster / insecto Homo sapiens / hombre Arabidopsis thaliana/ brasicacea Oryza sativa / arroz No.258.

5 75 310MY 450MY 600-1200MY? ? 370MY 40 human chimp mouse rat chicken fish worm bee fruit fly 250MY Human: Nature Feb 2001. 2008 Mosquito: Science Oct 2002 mosquito Chimp: Nature Sep 2005 Mouse: Nature Dec 2002 Chicken: Nature Dec 2004 Honey bee: in preparation Rat: Nature Apr 2004 .

01%=1.250 letras  Single nucleotide polymorphisms (SNPs)  .Variación entre individuos La variación individual solo representa el 0.

.6% y bonobo y humano somos idénticos en el 98.4% del DNA con los chimpances.7% de los nucleótidos. El genoma del bonobo (Junio 2012) y del chimpance son idénticos en el 99.El ADN es la molécula de la vida  Compartimos el 98. El genoma del bonobo muestra que más del 3% del genoma humano está más cercanamente relacionado con el de bonobos y con el de los chimpancés que el genoma de estos entre sí.

Sign up to vote on this title
UsefulNot useful