ADN COMO MATERIAL GENÉTICO

Maribeb Castro González, MSc, PhD

HISTORIA
30’s. Los cromosomas tienen ADN y proteínas, cada proteína es responsable de un carácter biológico o función en el metabolismo. Proteínas con secuencias de a.a. y diferentes estructuras y por ende con muchas funciones biológicas. Relación gen-proteínas, porque cada mutación se correspondía con una alteración enzimática.

La hipótesis era que el cromosoma tenía moléculas de ADN (considerado el esqueleto) y sobre él estaban las proteínas génicas.

Transformación 1928

de

neumococos,Grifith

transformación permanente y hereditaria a muchas generaciones. Pueden transformar no virulentos en virulentos, introduciendo “el material genético patógeno” aun estando muertas!.

Fagos Avery. coli demostrando que: El material genético del fago es DNA Que el DNA-fago se reproduce dentro de las bacterias atacadas y las proteínas-fago quedan fuera de las células . Hersey & Check 1952. RNA y quedo ADN Hotchkiss. virus bacteriófagos líticos T2 que atacan a E. 1949.Cuál era el principio transformante? Delbruck 1930. MacLeod & McCarthy 1944 eliminaron enzimas. transformó caracteres no relacionados con cápsula. resistencia Antibioticos.

Mirsky & Ris 1950 Midieron cantidad de DNA en células somáticas y gametos: cantidad-ADN era kte y que hay el doble en somáticas vs. Fraenkel-Conrad & Singer 1957 construyeron virus híbridos in vitro de RNA-proteìnas.gametos. . VMT –RNA. Gierer & Schram 1956 Probaron que algunos virus tienen RNA como material genético.

Bases púricas A-G(2 anillos) Bases pirimidínicas C. C.U ( 1 anillo) A.T. T = ADN A. U = ARN . C.EL ADN-BIOPOLIMERO Kossell & Neumann 1894 bases nitrogenadas. G. G.

nucleósido nucleótido Polímeros de nucleótidos monofosfato = ADN ácida .Hammersten 1900. Levene 1929: Pentosas: desoxiribosa ribosa.

Estructura en escalera: Los peldaños y el pasamanos .

Estructura en escalera: Los peldaños y el pasamanos .

Desoxiribonucleótidos del DNA .

Ribonucleótidos del RNA .

G = C. (A+G) = (T+C ). A/T = G/C = 1.Regla de Chargaff. A+G/T+C =1 El cociente (A+T)/(G+C) es típico y constante para cada especie. 1950 Las bases se encuentran en proporciones iguales A = T. .

La variación es mayor entre las bacterias (26% Welchia perfringens. 74% streptococcus griseus) que en los eucariotas (G+C ≈ 50%) .

DIFERENCIAS ENTRE DNA Y RNA DNA Azúcar: Desoxiribosa Bases nitrogenadas: ACGT Cadena doble RNA Azúcar: Ribosa Bases nitrogenadas: ACGU Cadena sencilla A .

La hebra está polarizada: 5’-P(fosfato) y 3’OH(hidroxilo) y al formarse la hebra las bases N que son planas se apilan como monedas. .

. Molécula larga fina de 20Å y 2 hebras enrolladas helicoidalmente dando una vuelta a la hélice c/34Å. Rosalin Franklin 1952.WilliamAstbury 1950. Idéntico: fagos a mamíferos. Aislamiento y cristalizaciónDNA con patrón de difracción.

.

En azul el donador de hidrógenos y en rojo el aceptor.ADN con formas tautoméricas de acuerdo a la posición de los dobles enlaces y átomos de H. . Nótese que la pirimidina ha sufrido un giro de 180º sobre el eje del carbono 6. Existen 28 posibles pares de bases nitrogenadas en forma tautomérica mayoritaria. En azul el donador de hidrógenos y en rojo el aceptor. Los cambios tautoméricos mutaciones puntuales Par de bases A=T de tipo WatsonCrick reverso. Par de bases A=T de tipo WatsonCrick.

Carácterísticas doble hélice: -Antiparalela -Hebras complementarias -Estable: enlaces H y uniones hidrofóbicas -Diámetro constante -Helicoidal -Tridimensionales -Molécula ácida -Superenrollamiento -Diferentes formas .

. forma+natural y estable Forma Z: levógira. se encuentra en algunas regiones pequeñas de los cromosomas y sin función clara.Forma Alfa: más compacta que Beta con 11 pb por vuelta y 23Å. 12pb/giro. Forma Beta: Dextrógira con 10 pb/giro. 18 Å.

ADN cuadruplex por repetición en telomeros .

Stem and loops en RNA ribosomal “stems y loops” Hairping: Algunos ADN linear tienen estructuras que se forman desde moléculas con repeticiones invertidas. .Estructura secundaria del ADN Formada por pb dentro de una hebra simple de ADN.

ADN superenrollado .

Cómo sucede? En Eucaria la formación de nucleosoma introduce SE-. Ventaja o no? Algunos genes se transcriben más activamente con ADN-SE.En E.coli el ADN es 1000 veces > que el tamaño de la propia célula . novobiocina y topoisomerasa I inhiben la girasa en bacterias.en varios pasos El ácido nalidíxico. . mientras la de otros se inhibe. En bacterias es la DNA girasa ó topoisomerasa II que da SE.

benzopirona. Antibióticos (actinomicinas). acridina naranja. bromuro de etidio. pero sí los enlaces fosfato-azúcar alterando la forma de la hélice. se intercalan y enlazan a la garganta mayor inhibiendo la replicación y la transcripción . sin dañar los enlaces H. agentes cancerígenos o mutagénicos.Interacciones de químicos con el ADN Algunos químicos se insertan o intercalan entre pb. Acridinas: acriflavina.

T denaturación = 85-95°C T de fusión aumenta 0. A medida que se funde la molécula cambia la absorbancia a 260 nm.EFECTO DE TEMPERATURA SOBRE ACIDOS NUCLEICOS Enlaces H se rompen por calor. los covalentes no >T° de fusión > GC. P.e ADN con un 40% de G+C = Tm 87°C. Tm = es el punto medio de la transición a la fusión y depende de la cantidad GC.4°C por c/1% más de GC-ADN. 60% G+C = Tm 95°C bajo las mismas condiciones experimentales. .

Pero. [cationes]. < complejidad > reasociación p.Las curvas COT Cinética de la reacción de renaturalización del ADN bajo condiciones físicoquímicas estándar (fuerza iónica. etc.e virus vs. Mide el tiempo entre pasar de una [ ]inicial = 100% de hebras simples a una [ ]final de 0% de hebras simples: moles/L/s. el ADN eucariota aunque complejo se reasocia rápido (COT bajos) porque tiene 3 tipos de secuencias: . Bacteria.) que permite comparar organismos.

tacattgaacggtctaacaacaaaaaggcttgtaaagagattccaagctagttcgtagaggcatccaatacatgtttggctctcgcattccccttttgtt tagaagtcacaatttcaattgagaaagtctattgcaaaaatttgatccaaatagaaaaagttgatacagattgtattgctaaggcacaccttacatttct tatattgtaatataaataccaagaaatagagttccacatctaaaagaaagaagatctaaagtaatatatgaaagccataaatcattcttccatacgttgg aatcccatgagatataacagtactatatatacaagaaagaaataatacatgtgtatattgataagtagtgTTAAGGGCCTTTGGAGAGCATGTTTTCAAT GGATTCAAGACGCTGGAGAAGAAGCTGATTTCTGAACTTTGTGATGAAAGCTTCTGCGCTCTTGTCCACGTCCATCGATGCCTTCCTTTCCACCTTCTTA TTCATCGTCTCTTTAATAACAATATTAGTGGTACCATTACCACTTTCTTTTGCGGAACTCATCATCATCTTCATGTTCTTGTTGTTGTTCATggtagaga tgtgtgtgtaacagtgcttgtgtttccttaattgattttggagagagggtgaattgttatattttggagatgctcgagacctatgtatttataggggatt ttcatttttttttttatttttttttaataaaaaactgtagttagacatataggaaaggagaagacttatttctctttacgtaaaccatagttgaatgttg aaggaataaaaagaaatggaatcttgaatctcaagttatacacgcgacttattaacaataacaaaaaacgttatatacgagacccatccatagtcagaga ggaatgatctacaaagcaccgtctctactctctactttataatttatatatttcttttttaagaaaaaataaaatatacgttaatcctctattaactatt ggaataacatagcatcaaatctaagattctgcttgaaagaaatgtaaaagaggttgcctaactacatattaaatttgaatttgttaatttggagaaacaa ggatgcaagattctagaaagttatatataatttgaccattcgtcactaaccaaaacaattggctttgttgtttttatataccacacgaattacggcttaa gcattggagattgaactcgttaactcaccgcccactattcccattgtcgccgctccggtaaccggtaccgcttcttctttaccaagaagaacaataaaat aaaagagattatgtggcttaagttagcttataacctaagtacctaactctaaaccgaactaattagttttcggcagattcgttgaatcatgtatgatata ttgatacacatactttttttattaaaatgtatagagaatattggttcaaaattcatttgccgtgatcgaagaataatgcgattatcaaaataaaataaaa taagaagcttcaaagcaaacgtacatggtagagttacaatttgattaattatgaaccgttattggccataaccaaacataaaaattaatgattttgaacc cactagtttaggatgttatttggtaattcaaatttgatttatctattacagtttttaaatttatttttgttattacgtagttggcctgtggtggtggatt gctccggataacatcactaacgcatatttataatcacacgattaaagagtgttttggtagttaatgcatgtaatagattatcttttctttttgtgcaacg gtaatagattacctaaggaatatcacaatcgtattggacagatattggaaactaatcaaactcaaaattattatgttttatgacaacattatctctatag agaatccctgtgttgtcaaaaagaaaaacaattatgtattaggcccaaggaagagcagaactatctcatttctattgggctattaagataataggctgaa agagcgattttaggcccaaggagtcgtatttcaagaaatgacgaccgATGGGACTCCACCGAGACGAAGCGACGGCCATGGAAACCCTTTTCAGAGTCTC ACTTCGTCTACTTCCGGTTTCCGCCGCCGTGACATGTCGCTCGATCCGATTCCCCGTTTCAAGACCCGGTTCCTCACACTTACTGAACCGTAAGCTGTAT AATTTGCCTACTTCTTCTTCCTCCTCTTTGTCGACAAAAGCCGGTTGGTTATTGGGTCTTGGTGAGAAGAAAAAGAAAGTGGATTTACCGGAGATAGTGG CATCTGGTGACCCGGTTCTGCACGAGAAGGCCCGAGAAGTTGACCCGGGAGAAATCGGGTCGGAGCGTATTCAGAAGATAATTGATGATATGATTAAAGT TATGAGATTGGCTCCTGGAGTTGGCCTCGCTGCTCCTCAAATTGGTGTTCCCTTAAGGgtaagtctataaatgcttttcctagtttcacccatttcgaag caaatgattgaattagtgtttcatggtgaatgatgcagATTATTGTATTGGAAGATACAAAAGAGTATATAAGTTACGCACCAAAGGAAGAGATTCTTGC TCAAGAAAGACGTCATTTTGATCTCATGgtaaataatagaatcagagtgcttaagagttgttacaattttcgattagaacaaaaatgttgaagtttgggg .

alto COT.Tipos de Secuencias: Clase homogénea:1vez/genoma. ADN inestable . Ternera 60% genoma. Ternera 20% genoma. Clase muy hetereogénea: repiten 100’s o 1000’s de veces (moderadamente repetidas).

Secuencias altamente repetitivas o de reasociación muy rápida COT <10-2 . secuencias de 4-6 pb. . Número de repeticiones y longitud difiere entre individuos. que se repiten en tandem hasta 1 millón de veces en una zona concreta del genoma intercalados en las regiones no codificantes: minisatélites y microsatélites.

.

MADAM I’M ADAM.Palíndromos: Secuencias que se leen igual en cualquier dirección COT = 10-2 ó 10-4 o renaturalizan en tiempo 0. . Renaturalizan por debajo de la T de fusión y existen miles de palíndromos en el genoma.

. unidades de información La secuencia del ADN está estructurada en codones de 3 nucleótidos.Los genes. INTRONES) Genoma es el conjunto de todos los genes de un organismo. EXONES. que contienen la infomación para sintetizar proteínas. •Secuencias no codificantes. que incluyen secuencias reguladoras de la expresión (promotores. Se pueden distinguir: •Genes o secuencias codificantes.

000 13.409.3 x 109 115.221 100.Tamaño del genoma en diferentes especies Especie Phi-X 174/ virus Bacilus subtilis / bacteria Escherichia coli / bacteria Caenorhabditis elegans / gusano Drosophila melanogaster / insecto Homo sapiens / hombre Arabidopsis thaliana/ brasicacea Oryza sativa / arroz No.498 ~60.779 4.214.379 ~25.000 25.814 4.3 x 108 No.000 .377 ~19. nucleotidos 5.639.171 122. genes 10 4.386 4.258.653.949 4.977 3.

2008 Mosquito: Science Oct 2002 mosquito Chimp: Nature Sep 2005 Mouse: Nature Dec 2002 Chicken: Nature Dec 2004 Honey bee: in preparation Rat: Nature Apr 2004 .5 75 310MY 450MY 600-1200MY? ? 370MY 40 human chimp mouse rat chicken fish worm bee fruit fly 250MY Human: Nature Feb 2001.

250 letras  Single nucleotide polymorphisms (SNPs)  .Variación entre individuos La variación individual solo representa el 0.01%=1.

El ADN es la molécula de la vida  Compartimos el 98. El genoma del bonobo (Junio 2012) y del chimpance son idénticos en el 99.6% y bonobo y humano somos idénticos en el 98. El genoma del bonobo muestra que más del 3% del genoma humano está más cercanamente relacionado con el de bonobos y con el de los chimpancés que el genoma de estos entre sí. .4% del DNA con los chimpances.7% de los nucleótidos.

Sign up to vote on this title
UsefulNot useful