Vous êtes sur la page 1sur 188

Chapter 1 PCR, RT-PCR, qPCR and qRT-PCR

PCREnzymes

TransFast Taq DNA Polymerase 005 EasyTaq DNA Polymerase 006 EasyTaq DNA Polymerase for PAGE 007 TransTaq -T DNA Polymerase 009 TransTaq DNA Polymerase High Fidelity (HiFi) 010 TransStart Taq DNA Polymerase 012 TransStart TopTaq DNA Polymerase 014 EasyPfu DNA Polymerase 016 TransStart FastPfu DNA Polymerase 017 TransStart FastPfu Fly DNA Polymerase 019 GC Enhancer 021 PCR Stimulant 022
2EasyTaq PCR SuperMix 024 2EasyTaq PCR SuperMix for PAGE 025 2TransTaq -T PCR SuperMix 026 2TransTaq High Fidelity (HiFi) PCR SuperMix 027 2EasyPfu PCR SuperMix 029 2TransStart FastPfu PCR SuperMix 030

PCR SuperMix

Direct PCR

TransDirect TM Animal Tissue PCR Kit 031 TransDirect TM Plant Tissue PCR Kit 033 TransDirect TM Blood PCR Kit 034 EasyScript Reverse Transcriptase 038 TransScript Reverse Transcriptase 040 TransScript II Reverse Transcriptase 041 EasyScript First-Strand cDNA Synthesis SuperMix 042 TransScript First-Strand cDNA Synthesis SuperMix 044 TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix 045

RT-PCR

Chapter 1 PCRRT-PCRqPCR and qRT-PCR

TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR 046 TransScript All-in-One First-Strand cDNA Synthesis 047 SuperMix for qPCR TransScript II First-Strand cDNA Synthesis SuperMix 048 TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix 049 TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR 050 TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR 051 TransScript Two-Step RT-PCR SuperMix 052 TransScript II Two-Step RT-PCR SuperMix 053 EasyScript One-Step RT-PCR SuperMix 054 TransScript One-Step RT-PCR SuperMix 055 TransScript II One-Step RT-PCR SuperMix 056 Ribonuclease Inhibitor 058
TransStart Green qPCR SuperMix 059 TransStart Green qPCR SuperMix UDG 060 TransStart Top Green qPCR SuperMix 062 TransScript Green Two-Step qRT-PCR SuperMix 063 TransScript II Green Two-Step qRT-PCR SuperMix 064 TransScript Green One-Step qRT-PCR SuperMix 066 TransScript II Green One-Step qRT-PCR SuperMix 068 070 TransStart Probe qPCR SuperMix

qPCR and qRT-PCR SuperMix


TransScript Probe One-Step qRT-PCR SuperMix TransScript II Probe One-Step qRT-PCR SuperMix
High Purity dNTPs

072 073

High Purity dNTPs

075

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PCR Enzymes
PCR enzymes are purified from E.coli strains carrying genes for specific DNA polymerase. The choice of DNA polymerase for PCR application is highly dependent on the characteristics of the system as well as the desired results. The following is PCR Enzyme Selection Guide.

PCR Enzyme Selection Guide Application

routine PCR

high fidelity PCR

high specificity PCR

Easy Taq TransFast Taq

TransTaq series TransStart Taq TransPfu series

TransStart series

Specification

GC/AT-rich complex template

long PCR

PCR inhibitor enriched template

TransTaq HiFi TransStart series GC Enhancer

PCR Enzyme Properties


TransTaq HiFi TransStart series

TransDirect series

PCR Enzyme Amplification Efficiency Specificity Fidelity(vs EasyTaq) Extension Rate Hot start 3-5 exo Product Size (human genomic DNA as template

TransFast Taq

EasyTaq

TransTaq-T

TransTaq HiFi

TransStart Taq

TransStart TopTaq

TransFast Taq =EasyTaqTransTaq-TTransTaq HiFiTransStart TaqTransStart TopTaq TransFast Taq =EasyTaqTransTaq-TTransTaq HiFiTransStart TaqTransStart TopTaq 1 6 kb/min + 4 kb 1 1-2 kb/min + 4 kb 18 1-2 kb/min + + 8 kb 18 1-2 kb/min + + 12 kb 18 1-2 kb/min + + 12 kb 18 1-2 kb/min + + 12 kb

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


3

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

PCR Enzyme Amplification Efficiency Specificity Fidelity (vs EasyTaq) Extension Rate Hot Start 3-5 exo Product Size (human genomic DNA as template) Product Size (plasmid genomic DNA as template)

EasyPfu

TransStart FastPfu

TransStart FastPfu Fly

Chapter 1

EasyPfu< TransStart FastPfu EasyPfu< TransStart FastPfu 18 0.5 kb/min + 6 kb 10 kb 54 2-4 kb/min + 15 kb 20 kb 108 2-6 kb/min + 15 kb 20 kb

Applications
PCR Enzyme
TransFas t Taq DNA Polymerase EasyTaq DNA Polymerase TransTaq -T DNA Polymerase TransTaq HiFi DNA Polymerase TransStart Taq DNA Polymerase TransStar t TopTaq DNA Polymerase EasyPfu DNA Polymerase TransStar t FastPfu DNA Polymerase TransStar t FastPfu Fly DNA Polymerase

Applications
routine PCR; fast PCR routine PCR highly complex templates; TA cloning GC/AT; complex templates; long PCR; TA cloning qPCR; multiplex PCR; TA cloning qPCR; multiplex PCR; TA cloning high fidelity PCR; blunt cloning; site-directed mutagenesis high fidelity PCR; fast PCR; robust PCR; blunt cloning; site-directed mutagenesis high fidelity PCR; fast PCR; robust PCR; blunt cloning; site-directed mutagenesis

High quality products


4

Chapter 1

PCR Enzymes

Chapter 1

TransFast Taq DNA Polymerase


dNTP-free AP101-01 AP101-02 500 units 6500 units dNTPs (2.5 mM) AP101-11 AP101-12 500 units 6500 units

qPCR and qRT-PCR

PCR, RT-PCR,

Concentration
5 units/l

Description
TransFast Taq DNA polymerase is an engineered version of Taq DNA polymerase. The enzyme consists of a single polypeptide with a molecular weight of approximately 94 kDa. TransFast Taq DNA polymerase has 5-3 DNA polymerase activity
and 5-3 exonuclease activity. It lacks 3-5 exonuclease activity. The extension rate is about 6 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. Amplification of DNA fragment up to 4 kb.

Components
TransFast Taq DNA Polymerase 10TransFast Taq Buffer (200 mM Tris-HCl pH 8.4; 100 mM KCl; 100 mM (NH4)2SO4; 20 mM MgSO4; others) 6DNA Loading Buffer

Storage
at -20oC for two years

Unit Definition
One unit of TransFast Taq DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-preceptible material in 30 minutes at 74oC.

Applications
Routine PCR. Fast PCR. Colony PCR.

Quality Control
TransFast Taq DNA polymerase has passed the following quality control assays: functional absence of double-and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each batch of TransFast Taq DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTOCOL
Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransFast Taq Buffer 2.5 mM dNTPs TransFast Taq DNA Polymerase ddH2O Total volume

Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5 -1 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units -

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


5

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

Thermal cycling conditions


94oC 3 min 94oC 5 sec o 50-60 C 15 sec 30-35 cycles TM TM EasyTaq TransFast Taq Comparison Between EasyTaq and TransFast Taq 72oC x sec Amplification Rate 72oC 5-10 min
4 Kb 3 Kb 2 Kb 1 Kb 0 50 100 150
EasyTaq TransFast Taq

Chapter 1

4 Kb 3 Kb 2 Kb 1 Kb 0

Target
0-2 kb 2-3 kb >350 kb

Extension time
10EasyTaq sec/kb TransFast TM Taq 20 sec/kb 150 30 200 250 300 min sec/kb
TM

100

200

250

300 min

TransFast

TM

Taq

Comparison Between EasyTaq and TransFast Taq

M E F E F E F E F E F E F E F E F M

Amplification Rate 4 Kb 3 Kb
EasyTaq TM TransFast TM Taq

2 Kb 1 Kb

EasyTaq TransFast Taq

00

150

200

250

300 min 0 50 100 150 200 250 300 min

M 1Kb Plus DNA Ladder E EasyTaq DNA Polymerase F TransFast Taq DNA Polymerase

F E F E F E F E F E F E F M

EasyTaq DN A Polymerase
M 1Kb Plus DNA Ladder E EasyTaq DNA Polymerase F TransFast Taq DNA Polymerase

AP111-01 dNTP-free AP111-02 AP111-03 AP111-11 AP111-12 AP111-13

500 units 6500 units 42500 units 500 units 6500 units 42500 units

dNTPs (2.5 mM)

Concentration
5 units/l

Description
EasyTaq DNA polymerase is purifed from E. coli expressing a cloned Thermus aquaticus DNA polymerase. The enzyme consists of a single polypeptide with a molecular weight of approximately 94 kDa. EasyTaq DNA polymerase has 5-3 DNA polymerase activity and 5-3 exonuclease activity. lt lacks 3-5 exonuclease activity. EasyTaq DNA polymerase is suitable for routine amplification. PCR products are not suitable for PAGE. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. Amplification of DNA fragments up to 4 kb.

Components
EasyTaq - DNA Polymerase 10EasyTaq Buffer (200mM Tris-HCl pH8.3; 200 mM KCl; 100 mM (NH4)2SO4; 20 mM MgSO4; others) 6DNA Loading Buffer

Storage
at -20oC for two year

Application
Routine PCR.

Unit Definition
One unit of EasyTaq DNA Polymerase incorporates 10 nmol of into acidpreceptible material in 30 minutes at 74oC.

High quality products


6

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Quality Control
EasyTaq DNA polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. EasyTaq DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTCOL
Notes
MgSO 4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most amplifications. If needed, suggested to use the 100 mM MgSO4 stock to prepare a titration from 2.0 mM to 4.0 mM (final concentration) in 0.25 mM increments. 2.5 units of EasyTaq DNA Polymerase is enough for most target amplifications. For some amplifications, up to 5 units/reaction EasyTaq DNA Polymerase can be used.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10EasyTaq Buffer 2.5 mM dNTPs EasyTaq DNA Polymerase ddH2O Total volume

Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

M: 1Kb Plus DNA Ladder 1: CCRD 0.5 kb; 2: BDNF 0.8 kb; 3: Rhod 1.2 kb; 4: Rhod 2 kb; 5: Rhod 4.17 kb. 50 ng of Human Genomic DNA as templates

EasyTaq DNA Polymerase for PAGE


dNTP-free (2.5 mM) dNTPs (2.5 mM) AP112-01 AP112-02 AP112-11 AP112-12 2500 units 42500 units 2500 units 42500 units

Concentration
5 units/l

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


7

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

Description Components
EasyTaq DNA Polymerase for PAGE 10EasyTaq Buffer for PAGE (200mM Tris-HCl pH8.3; 200 mM KCl; 100 mM (NH4)2SO4; 20 mM MgSO4; others) 6DNA Loading Buffer EasyTaq DNA polymerase for PAGE is purifed from E. coli expressing a cloned Thermus aquaticus DNA polymerase. The enzyme consists of a single polypeptide with a molecular weight of approximately 94 kDa. EasyTaq DNA polymerase for PAGE has 5-3 DNA polymerase activity and 5-3 exonuclease activity. lt lacks 3-5 exonuclease activity. EasyTaq DNA polymerase is suitable for routine amplification. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. Amplification of DNA fragments up to 4 kb.

Chapter 1

Storage
at -20oC for two years

Application
Short fragment PCR.

Unit Definition
One unit of EasyTaq DNA Polymerase for PAGE incorporates 10 nmol of deoxyribonucleotide into acid-preceptible material in 30 minutes at 74oC.

Quality Control
EasyTaq DNA polymerase for PAGE has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. EasyTaq DNA Polymerase for PAGE is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTOCOL
Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10EasyTaq Buffer for PAGE 2.5 mM dNTPs EasyTaq DNA Polymerase for PAGE ddH2O Total volume

Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

High quality products


8

Chapter 1

PCR Enzymes

Chapter 1

TransTaq -T DNA Polymerase


dNTP-free dNTPs (2.5 mM)

qPCR and qRT-PCR

PCR, RT-PCR,

AP122-01 AP122-02 AP122-03 AP122-11 AP122-12 AP122-13

250 units 500 units 6500 units 250 units 500 units 6500 units

Concentration
5 units/l

Description
TransTaq-T DNA Polymerase is an engineered version of Taq DNA polymerase. TransTaq-T DNA Polymerase has end transferase activity and exonuclease activity. TransTaq-T DNA Polymerase combines the amplification efficiency of Taq DNA polymerase with the fidelity of Pfu DNA polymerase. Fidelity is 18 times higher than EasyTaq DNA Polymerase. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. The extension rate is about 1-2 kb/min. Amplification of DNA fragment up to 8 kb.

Components
TransTaq -T DNA Polymerase 10TransTaq -T Buffer (200 mM Tris-HCl pH9.0; 100 mM KCl; 100 mM (NH4)2SO4; 20 mM MgSO4; others) 6DNA Loading Buffer

Storage
at -20oC for two years

Applications
Complex PCR. TA cloning.

Unit Definition
One unit of TransTaq-T DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-preceptible material in 30 minutes at 74oC.

Quality Control
TransTaq -T DNA polymerase has passed the following quality control assays: functional absence of double-and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each batch of TransTaq -T DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTOCOL
Notes
MgSO4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most amplifications. If needed, suggested to use the 100 mM MgSO4 stock to prepare a titration from 2.0 mM to 4.0 mM (final concentration) in 0.25 mM increments. 2.5 units of TransTaq -T DNA polymerase is enough for most target amplifications. For some amplifications, up to 5 units/ reaction TransTaq -T DNA polymerase can be used.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransTaq -T Buffer 2.5 mM dNTPs Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units -

TransTaq -T DNA Polymerase


ddH2O Total volume

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


9

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC
M
1 2

Chapter 1

2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min


3 4 5 6

30-35 cycles

M: 1Kb Plus DNA Ladder 1: BDNF 0.8 kb; 2: Rhod 1.2 kb; 3: -globin 1.3 kb; 4: Rhod 2.0 kb ; 5: -globin 3.0 kb; 6: Rhod 4.17 kb; 7: Factor IX 7.5 kb 50 ng of Human Genomic DNA as templates

TransTaq DNA Polymerase High FidelityHiFi


dNTP-free AP131-01 AP131-02 AP131-03 AP131-11 AP131-12 AP131-13 250 units 500 units 6500 units 250 units 500 units 6500 units

dNTPs (2.5 mM)

Concentration
5 units/l

Description
TransTaq DNA Polymerase High Fidelity (TransTaq HiFi DNA Polymerase) is TransTaq-T DNA Polymerase mixed with an 3-5exonuclease. TransTaq HiFi DNA polymerase provides higher specificity and amplification efficiency than TransTaq-T DNA Polymerase. The fidelity of TransTaq HiFi DNA polymerase is similar to EasyPfu DNA Polymerase. Fidelity is 18 times higher than EasyTaq DNA Polymerase. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector Amplification of DNA fragment up to 12 kb.

Components
TransTaq HiFi DNA Polymerase 10TransTaq HiFi Buffer I, II (200 mM Tris-HCl pH 9.0; 100 mM KCl; 100 mM (NH4)2SO4; 20 mM MgSO4; 10% Glycerol,others) 6DNA Loading Buffer GC Enhancer

Storage
at -20oC for two years

Applications
High fidelity. High yield. TransTaq HiFi Buffer I for genomic DNA, TransTaq HiFi Buffer II for DNA, cDNA, Plasmid DNA amplification.

Unit Definition
One unit of TransTaq HiFi DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-preceptible material in 30 minutes at 74oC.

High quality products


10

Chapter 1

PCR Enzymes

Chapter 1

Quality Control
TransTaq HiFi DNA polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each batch of TransTaq HiFi DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Notes
MgSO4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most amplifications. If needed, suggested to use the 100 mM MgSO4 stock to prepare a titration from 2.0 mM to 4.0 mM (final concentration) in 0.25 mM increments. 2.5 units of TransTaq HiFi DNA polymerase is enough for most target amplifications. For some amplifications, up to 5 unit/reaction TransTaq HiFi DNA polymerase can be used.

Reaction Components
Components Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransTaq HiFi Buffer I/II 2.5 mM dNTPs

Volume variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l to 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units Not applicable

TransTaq HiFi DNA Polymerase


ddH2O

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

TransTaq HiFi Buffer I M1: 1Kb Plus DNA Ladder M2: Trans15K DNA Marker Lane 1: BDNF 0.8 kb; Lane 2: Rhod 1.2 kb Lane 3: Rhod 2.0 kb; Lane 4: -globin 3.0 kb Lane 5: Rhod 4.17 kb; Lane 6: Factor IX 7.5 kb Lane 7: Serum albumin 12.4 kb 50 ng Human Genomic DNA as templates

TransTaq HiFi Buffer II M1: 1Kb Plus DNA Ladder M2: Trans15K DNA Marker Lane 1: REPA 1.8 kb; Lane 2: NCBP 2.5 kb; Lane 3: HDP 3.5 kb; Lane 4: VIN 4.6 kb; Lane 5: Pol 6.8 kb; Lane 6: APC 8.5 kb; Lane 7: Dynein 12.3 kb 100 ng Human total RNA as templates

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


11

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

TransStart Taq DNA Polymerase


dNTP-free AP141-01 AP141-02 AP141-03 AP141-11 AP141-12 AP141-13 250 units 500 units 6500 units 250 units 500 units 6500 units dNTPs (2.5 mM)

Chapter 1

Concentration
2.5 units/l

Description
TransStar t Taq DNA Polymerase is a hot start Taq DNA polymerase. At room temperature, one binding protein binds to double-stranded DNA template and another binding protein binds to primers. These unique formulations effectively neutralize the DNA polymerase activity at room temperature. The extension rate for TransStart Taq DNA Polymerase is 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector.

Components
TransStart Taq DNA Polymerase 10TransStar t Taq Buffer (500 mM TrisHCl pH 9.0; 200 mM (NH4)2SO4; 20 mM MgSO4; 10% Glycerol; others) 6DNA Loading Buffer GC Enhancer

Applications
Complex template. GC/AT-rich template. Multiplex PCR.

Storage
at -20oC for two years

Unit Definition
One unit of TransStart Taq DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-insoluble material in 30 min at 74oC.

Quality Control
TransStart Taq DNA polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each batch of TransStart Taq DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTOCOL
Notes
MgSO4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most amplifications. If needed, suggested to use the 100 mM MgSO4 stock to prepare a titration from 2.0 mM to 4.0 mM (final concentration) in 0.25 mM increments. 2.5 units of TransTaq HiFi DNA polymerase is enough for most target amplifications. For some amplifications, up to 5 unit/reaction TransTaq HiFi DNA polymerase can be used.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransTaq HiFi Buffer I/II 2.5 mM dNTPs TransTaq HiFi DNA Polymerase ddH2O Total volume Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5-5 units -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

High quality products


12

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

TransTaq HiFi Buffer I M1: 1Kb Plus DNA Ladder M2: Trans15K DNA Marker 1: BDNF 0.8 kb 2: Rhod 1.2 kb 3: Rhod 2.0 kb 4: -globin 3.0 kb 5: Rhod 4.17 kb 6: Factor IX 7.5 kb 7: Serum albumin 12.4 kb 50 ng of Human Genomic DNA as templates

TransTaq HiFi Buffer II


M1: 1Kb Plus DNA Ladder M2: Trans15K DNA Marker 1: REPA 1.8 kb 2: NCBP 2.5 kb 3: HDP 3.5 kb 4: VIN 4.6 kb 5: Pol 6.8 kb 6: APC 8.5 kb 7: Dynein 12.3 kb Human cDNA as templates

TransStart Hot Start ( Double Blocking )

TransStart double blocking technique blocks primer-dimer formation and polymerase activity at room temperature by blocking primers and DNA templates at room temperature. Blocking proteins are released during the initial denaturation. This double blocking method has higher efficiency than antibody based, or chemical modified hot start PCR.

PROTOCOL
Notes
MgSO4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most amplifications. If needed suggested to use the 100 mM MgSO 4 stock to prepare a titration from 2.0 mM to 4.0 mM (final concentration) in 0.25 mM increments. Choose GC Enhancer for the amplification of GC/AT rich and complex template.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransStart Taq Buffer 2.5 mM dNTPs TransStart Taq DNA Polymerase ddH2O Total volume Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 1.25-2.5 units -

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


13

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC
M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1Numb 0.3 kb2CCRD 0.5 kb3BDNF 0.8 kb4Rhod 1.2 kb 5Rhod 2.0 kb6-globin 3.0 kb7Rhod 4.17 kb 8Factor IX 7.5 kb 9Serum albumin 12.4 kb 50 ng of Human Genomic DNAas templates

Chapter 1

2-5 min 30 sec 30 sec 1-2 kb/min 10 min

30-35 cycles

TransStart TopTaq DNA Polymerase


dNTP-free AP151-01 AP151-02 AP151-03 AP151-11 AP151-12 AP151-13 250 units 500 units 6500 units 250 units 500 units 6500 units dNTPs (2.5 mM)

Concentration
2.5 units/l

Description
TransStart TopTaq DNA Polymerase is an engineered version of Taq DNA Polymerase combined with TransStart Technique. TransStart double blocking technique prevents primer-dimer formation and polymerase activity at room temperature by blocking the primers and DNA templates at room temperature. Blocking proteins are released from primers and templates during the initial denaturation. This double blocking method has higher efficiency than antibody based, or chemical modified hot start PCR. Compare with the TransStart Taq DNA Polymerase, the TransStart TopTaq DNA Polymerase has higher amplification efficiency and sensitivity. Fidelity is 18 times higher than EasyTat DNA Polymerase. The specificity is higher than antibody based chemical or modified hot start DNA polymerases. Reduced nonspecific amplification and primer dimers. Different from Taq antibody, no risk of contamination from mammal DNA. Different from chemical modification , heating step no longer needed. Amplification of DNA fragments up to 12 kb.

Components
TransStart TopTaq DNA Polymerase 10TransStart TopTaq Buffer (500 mM Tris-HCl (pH 9.0); 200 mM (NH4)2 SO4; 20 mM MgSO4; others) 6DNA Loading Buffer GC Enhancer

Storage
at -20oC for two years

Applications

Complex PCR. Multiplex PCR. High fidelity and specificity PCR. High yield.

Unit Definition
One unit of TransStart TopTaq DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-insoluble material in 30 min at 74oC.

Quality Control
TransStart TopTaq DNA polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99 % homogeneous measured by SDS-PAGE gel electrophoresis. Each lot of TransStart TopTaq DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

High quality products


14

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Notes
MgSO 4 is included in the 10PCR Buffer at a final concentration of 2.0 mM, which is sufficient for most targets amplificaiton. For some targets, adjust the Mg2+ from 2.0 mM to 4.0 mM (final concentration) to ensure a good amplification.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10TransStart TopTaq Buffer 2.5 mM dNTPs TransStart TopTaq DNA Polymerase ddH2O Total volume

Volume Variable 1-2 l 1-2 l 5 l 4 l 0.5-1 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 1.25-2.5 units -

Thermal cycling conditions


94oC 2-5 min 30 sec 94oC 30 sec 50-60oC 72oC1-2 kb/min 72oC 5-10 min

30-35 cycles

M: Trans2K Plus II DNA Marker Lane 1: Rhod 1.2 kb Lane 2: Rhod 2.0 kb Lane 3: -globin 3.0 kb Lane 4: -globin 4.1 kb Lane 5: Rhod 4.17 kb Lane 6: -globin 6.1 kb Lane 7: Factor IX 7.5 kb Lane 8: IGF2R 8.9 kb Lane 9: Serum albumin 12.4 kb 50 ng Human Genomic DNA as templates

1 M A T A

2 T A

3 T A

4 T

M: Trans2K Plus DNA Marker Lane 1: DMD1 0.3 kb Lane 2: Numb 0.3 kb Lane 3: P53 0.5 kb Lane 4: P1P2 1.2 kb Lane A: A company hot start polymerase Lane T: TransStart TopTaq DNA Polymerase

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


15

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

EasyPfu DNA Polymerase


AP211-01 dNTP-free AP211-02 AP211-03 dNTPs (2.5 mM) AP211-11 AP211-12 AP211-13 250 units 500 units 6500 units 250 units 500 units 6500 units

Chapter 1

Concentration
2.5 units/l

Description
EasyPfu DNA Polymerase is an engineered version of pfu DNA Polymerase with enhanced yield and higher fidelity. EasyPfu polymerase possesses a proofreading 3'-5' exonuclease activity. Its fidelity is 18 times higher than EasyTaq DNA Polymerase. EasyPfu DNA Polymerase is suitable for blunt-end cloning and site-directed mutagenesis. Amplification of fragment up to 6 kb.

Components
EasyPfu DNA Polymerase 10EasyPfu Buffer(200 mM Tris-HCl pH 8.8; 100 mM (NH 4)2SO4; 100 mM KCl; 20 mM MgSO4; others) 50 mM MgSO4 6DNA Loading Buffer

Applications
High fidelity. Blunt-end cloning. Site-directed mutagensis.

Storage
at -20oC for two years

Unit Definition
One unit of EasyPfu DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-insoluble material in 30 min at 74oC.

Quality Control
EasyPfu polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease a c t i v i t y, > 9 9 % h o m o g e n e o u s m e a s u r e d b y S D S - PA G E g e l electrophoresis. Each batch of EasyPfu DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

PROTOCOL
Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 10EasyPfu Buffer 2.5 mM dNTPs EasyPfu DNA Polymerase ddH2O Total volume Volume Variable 1-2 l 1-2 l 5 l 4 l 1 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.2 mM 2.5 units -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 0.5 kb/min 5-10 min

30-35 cycles

High quality products


16

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

M: 1Kb Plus DNA Ladder 1: CCRD 0.5 kb; 2: BDNF 0.8 kb; 3: Rhod 1.2 kb; 4: -globin 1.3 kb; 5: Rhod 2 kb; 6: -globin 3 kb; 7: Rhod 4.17 kb; 8: -globin 4.1 kb 50 ng of Human Genomic DNAas templates

TransStart FastPfu DNA Polymerase


dNTP-free AP221-01 AP221-02 AP221-03 AP221-11 AP221-12 AP221-13 250 units 500 units 6500 units 250 units 500 units 6500 units

dNTPs (2.5 mM)

Concentration
2.5 units/l

Description
TransStart FastPfu DNA Polymerase is a hot start, high fidelity, and high processivity DNA polymerase. The fidility of TransStart FastPfu DNA polymerase is 54-fold higher than Taq DNA polymerase. TransStart FastPfu DNA polymerase has extension rate up to 4 kb/ min. PCR product amplified by TransStart FastPfu DNA polymerase is blunt end and can be cloned into blunt cloning vector.

Components
TransStar t FastPfu DNA Polymerase 5TransStart FastPfu Buffer (100 mM Tris-SO4 pH 9.2; 50 mM (NH4)2SO4; 200 mM KCl; 10 mM MgSO4 ; 10% Glycerol; others) 50 mM MgSO4 6DNA Loading Buffer PCR Stimulant

Applications
High fidelity PCR. High yield and robust PCR. Blunt end cloning. Site-directed mutagenesis.

Storage
at -20oC for two years

Unit Definition
One unit of TransStart FastPfu DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-insoluble material in 30 min at 74oC.

Quality Control
TransStar t FastPfu DNA Polymerase has passed the following quality control assays: functional absence of double- and single-stranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each lot of TransStar t FastPfu DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


17

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

PROTOCOL
Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 5TransStart FastPfu Buffer 2.5 mM dNTPs TransStart FastPfu DNA Polymerase ddH2O Total volume

Chapter 1

Volume Variable 1-2 l 1-2 l 10 l 5 l 1 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.25 mM 2.5 units -

Suggested conditions
50 l reaction volume
Parameter Targets10 kb 100 ng Genomic DNA Template 5-30 ng Plasmid DNA MgSO4 5-30 ng Plasmid DNA (50-500 ng starting RNA template) Add 1-2 l of 50 mM MgSO4 to a final concentration of 3-4 mM for target larger than 5 kb Targets10 kb 200-500 ng Genomic DNA cDNA Targets 1-2 l cDNA from RT reaction

Thermal cycling conditions


Number of cycles 1 Temperature 95oC 95oC Plasmid or Genomic DNA: 30-35 cDNA: 40 Tm-5oC 72oC 1 72oC Plasmid or Genomic DNA 2 min 20 sec 20 sec 15 sec for targets1 kb 15-30 sec per kb for targets >1 kb 5 min cDNA 1 min 20 sec 20 sec 30 sec for targets1 kb 30 sec per kb for targets>1 kb 5 min

cDNA amplification with TransStart FastPfu DNA Polymerase


M1 1 2 3 4 5 M2 M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1ACTR 3.5 kb; 2 hrs 14 min 2VIN 4.6 kb; 2 hrs 34 min 3Pol 6.8 kb; 3 hrs 09 min 4APC 8.5 kb; 3 hrs 41 min 5Dynein 12.3 kb; 4 hrs 48 min

High quality products


18

Chapter 1

PCR Enzymes

Chapter 1

Genomic DNA amplification with TransStart FastPfu DNA Polymerase


M1 1 2 3 4 5 M2 M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1Rhod 2.0 kb; 1 hrs 19 min 2-globin 3.0 kb; 1 hrs 27 min 3Rhod 4.17 kb; 1 hrs 29 min 4Factor IX 7.5 kb; 3 hrs 25 min 5Serum albumin 12.4 kb; 4 hrs 48 min

qPCR and qRT-PCR

PCR, RT-PCR,

Plasmid DNA amplification with TransStart FastPfu DNA Polymerase


M 1 2 3 M M: Trans15K DNA Marker 1: UDG 7.0 kb; 1 hrs 36 min 2: LN 10.0 kb; 1 hrs 55 min 3: Fang 14.7 kb; 2 hrs 26 min

TransStart FastPfu Fly DNA Polymerase


dNTP-free AP231-01 AP231-02 AP231-03 AP231-11 AP231-12 AP231-13 250 units 500 units 6500 units 250 units 500 units 6500 units

dNTPs (2.5 mM)

Concentration
2.5 units/l

Description
TransStart FastPfu Fly DNA Polymerase is a hot start, high fidelity, and high processivity DNA polymerase. The fidility of TransStart FastPfu Fly DNA polymerase is 108-fold higher than Taq DNA polymerase. TransStart FastPfu Fly DNA polymerase has extension rate up to 6 kb/ min. PCR product amplified by TransStart FastPfu Fly DNA polymerase is blunt end and can be cloned into blunt cloning vector.

Components
TransStart FastPfu Fly DNA Polymerase 5TransStart FastPfu Fly Buffer (100 mM Tris-SO4 pH 9.2; 50 mM (NH4)2SO4; 200 mM KCl; 10 mM MgSO 4 ; 10% Glycerol; others) 50 mM MgSO4 6DNA Loading Buffer PCR Stimulant

Applications
High fidelity PCR. GC rich template and template that has secondary struture. High yield and robust PCR. Blunt end cloning. Site-directed mutagenesis. Long-segment PCR.

Storage
at -20oC for two years

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


19

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

108

108X

Unit Definition
One unit of TransStart FastPfu Fly DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-insoluble material in 30 min at 74oC.

Chapter 1

54

Fidelity

Quality Control
54X

18 18X

1X

EasyTaq

EasyPfu

TranStart FastPfu

TranStart FastPfu Fly

TransStart FastPfu Fly DNA Polymerase has passed the following quality control assays: functional absence of double- and singlestranded endonuclease activity; >99% homogeneous measured by SDS-PAGE gel electrophoresis. Each lot of TransStart FastPfu DNA Polymerase is assayed for amplification efficiency from as little as 10 ng of human genomic DNA.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 5TransStart FastPfu Fly Buffer 2.5 mM dNTPs TransStart FastPfu Fly DNA Polymerase ddH2O Total volume Volume Variable 1-2 l 1-2 l 10 l 5 l 1 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 0.25 mM 2.5 units -

Suggested conditions
50 l reaction volume
Parameter Targets10 kb 100 ng Genomic DNA Template 5-30 ng Plasmid DNA MgSO4 5-30 ng Plasmid DNA (50-500 ng starting RNA template) Add 1-2 l of 50 mM MgSO4 to a final concentration of 3-4 mM for target larger than 5 kb Targets10 kb 200-500 ng Genomic DNA cDNA Targets 1-2 l cDNA from RT reaction

Thermal cycling conditions


Number of cycles 1 Temperature 95oC 95oC Plasmid or Genomic DNA: 30-35 cDNA: 40 Tm-5oC 72oC 1 72oC Plasmid or Genomic DNA 2 min 20 sec 20 sec 15 sec for targets1 kb 15-30 sec per kb for targets >1 kb 5 min cDNA 1 min 20 sec 20 sec 30 sec for targets1 kb 30 sec per kb for targets>1 kb 5 min

High quality products


20

Chapter 1

PCR Enzymes

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Total Reaction Time


10 kb

7 kb Size 4 kb

PCR Time 4 kb: Genomic DNA; 7 kb and 10 kb: Plasmid DNA

GC Enhancer
Storage
at -20oC for two years

AG101-01

200 l

Description
GC Enhancer is used with DNA Polymerase, to optimize PCR of complex templates or GC/AT-rich templates. The stock concentration is 10, and the working concentration can be varied between 0.5- 5.

Application
Amplification of complex templates and/or GC/AT-rich templates.
(50 l reaction mixture as example) GC Enhancers Volume (l) 2.5 5 10 15 20 25 Final Concentration 0.5 1 2 3 4 5

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


21

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR Enzymes

PCR Stimulant
Storage
at -20 C for two years
o

Chapter 1

AG111-01

200 l

Description
PCR Stimulant is used to optimize PCR of complex templates or GC/ AT-rich templates. It is especially suitable for Pfu enzymes. The stock concentration is 5, and the working concentration can be varied between 0.5- 2.5.

Application
Amplification for complex templates and/or GC/AT-rich templates.
(50 l reaction volume as example)

PCR Stimulants Volume (l) 5 10 20 25

Final Concentration 0.5 1 2 2.5

High quality products


22

Chapter 1

PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PCR SuperMixes
PCR SuperMix is a ready-to-use mixture of DNA polymerase, salt, magnesium, dNTPs, and other components for efficient PCR amplification. All you have to do is to add template, primers, and dH2O. If using PCR SuperMixes with dye, dye needs to be removed before sequencing.

Applications
PCR SuperMix 2EasyTaq PCR SuperMix 2TransTaq-T PCR SuperMix 2TransTaq High Fidelity(HiFi) PCR SuperMix I 2TransTaq High Fidelity(HiFi) PCR SuperMix II 2EasyPfu PCR SuperMix 2TransStart FastPfu PCR SuperMix Application routine PCR complex templates and TA cloning GC/AT-rich templates, complex templates long fragment amplification, genomic DNA amplification (<12 kb) GC/AT-rich templates, complex templates long fragment amplification, DNAcDNA, Plasmid DNA amplification high fidelity PCR amplification, cloning and site-directed mutagenesis high fidelity PCR fast amplification, Blunt cloning and site-directed mutagenesis

PCR Enzyme vs PCR SuperMix PCR Enzyme simple and quick PCR SuperMix

optimize the PCR system

PCR SuperMix Selection Chart PCR SuperMix(+dye) purify electrophoresis cloning and sequencing PCR SuperMix(-dye)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


23

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR SuperMix

2EasyTaq PCR SuperMix


AS111-01 Mix(-dye) AS111-02 AS111-03 Mix(+dye) AS111-11 AS111-12 AS111-13 1 ml 51 ml 151 ml 1 ml 51 ml 151 ml

Chapter 1

Storage
at -20 C for two years
o

Description EasyTaq PCR SuperMix is a ready-to-use mixture of EasyTaq DNA Polymerase, dNTPs, and optimized buffer. This SuperMix is provided at 2 concentration and used at 1 concentration by adding template, primers and H 2O. PCR products are not suitable for PAGE. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector Amplification of DNA fragment up to 4 kb. Application
Routine PCR.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2EasyTaq PCR SuperMix ddH2O Total volume Volume Variable 1-2 l 1-2 l 25 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC
M
1 2

2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min


3 4 5

30-35 cycles

M
M: 1Kb Plus DNA Ladder 1: CCRD 0.5 kb 2: BDNF 0.8 kb 3: Rhod 1.2 kb 4: Rhod 2 kb 5: Rhod 4.17 kb 50 ng of Human Genomic DNAas templates

EasyTaq PCR SuperMix (+dye)

EasyTaq PCR SuperMix (-dye)

High quality products


24

Chapter 1

PCR SuperMix

Chapter 1

2EasyTaq PCR SuperMix for PAGE


AS112-11 Mix (+dye) AS112-12 AS112-13 1 ml 51 ml 151 ml

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20 C for two years
o

Description EasyTaq PCR SuperMix for PAGE is a ready-to-use mixture of EasyTaq DNA Polymerase for PAGE, dNTPs, and optimized buffer. This SuperMix for PAGE is provided at 2 concentration and used at 1 concentration by adding template, primers and H 2O. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector Amplification of DNA fragment up to 3 kb. Application
PCR of short fragments.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2EasyTaq PCR SuperMix for PAGE ddH2O Total volume

Volume Variable 1-2 l 1-2 l 25 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


25

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR SuperMix

2TransTaq -T PCR SuperMix


Mix (-dye) Mix (+dye) AS122-01 AS122-02 AS122-11 AS122-12 1 ml 51 ml 1 ml 51 ml

Chapter 1

Storage
at -20OC for two years

Description
TransTaq -T PCR SuperMix is a ready-to-use mixture of TransTaq-T DNA Polymerase, dNTPs, and optimized buffer. This SuperMix is provided at 2 concentration and used at 1 concentration by adding template, primers and H2O. Fidelity is 18 times higher than EasyTaq DNA Polymerase. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. The extension rate is about 1-2 kb/min. Amplification of DNA fragment up to 8 kb.

Applications
Complex template. TA cloning.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2TransTaq -T PCR SuperMix ddH2O Total volume

Volume Variable 1-2 l 1-2 l 25 l Variable 50 l

Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94 94 50-60 72 72

2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min


M: 1Kb Plus DNA Ladder 1: BDNF 0.8 kb; 2: Rhod 1.2 kb; 3: -globin 1.3 kb; 4: Rhod 2.0 kb; 5: -globin 3.0 kb; 6: Rhod 4.17 kb; 7: Factor IX 7.5 kb 50 ng of Human Genomic DNAas templates

30-35 cycles

M1 2 3 4 5 6 7 M 1 2 3 4 5 6 7 M

TransTaq -T DNA Polymerase

TransTaq -T PCR SuperMix

High quality products


26

Chapter 1

PCR SuperMix

Chapter 1

2TransTaq High FidelityHiFiPCR SuperMix


Mix I(-dye) Mix II(-dye) AS131-01 AS131-02 AS131-21 AS131-22 1 ml 51 ml 1 ml 51 ml

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20 C for two years
o

Description
TransTaq High Fidelity (HiFi) PCR SuperMix I or II is a ready-touse mixture of TransTaq High Fidelity(HiFi) DNA polymerase (a hot start DNA polymerase ), with a proofreading 3-5 exonuclease, dNTPs, and optimized buffer. TransTaq High Fidelity (HiFi) PCR SuperMix I is designed for the amplification of genomic DNA, and TransTaq High Fidelity (HiFi) PCR SuperMix II is designed for the amplification of DNA, cDNA, or plasmid DNA. The fidelity is 18 fold higher than EasyTaq DNA polymerase. This SuperMix is provided at 2 concentration and can be used at 1 concentration by adding template, primers and H2O. Fidelity is 18 times higher than EasyTaq DNA Polymerase. The extension rate is about 1-2 kb/min. Template-independent A can be generated at the 3 end of the PCR product. PCR products can be cloned in TA cloning vector. Amplification of DNA fragment up to 12 kb.

Applications
High fidelity. High yield.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2TransTaq HiFi PCR SuperMix ddH2O Total volume Volume Variable 1-2 l 1-2 l 25 l Variable 50 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

30-35 cycles

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


27

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR SuperMix

M1 1

M2 M1 1

7 M2

Chapter 1

TransTaq HiFi DNA Polymerase

TransTaq HiFi PCR SuperMix I

M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1: BDNF 0.8 kb; 2: Rhod 1.2 kb; 3: Rhod 2.0 kb; 4: -globin 3.0 kb; 5: Rhod 4.17 kb; 6: Factor IX 7.5 kb; 7: Serum albumin 12.4 kb 50 ng of Human Genomic DNAas templates

M1 1

7 M2 M1 1

7 M2

TransTaq HiFi DNA Polymerase

TransTaq HiFi PCR SuperMix II

M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1: REPA 1.8 kb; 2: NCBP 2.5 kb; 3: HDP 3.5 kb; 4: VIN 4.6 kb; 5: Pol 6.8 kb; 6: APC 8.5 kb; 7: Dynein 12.3 kb Human cDNAas templates

High quality products


28

Chapter 1

PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

2EasyPfu PCR SuperMix


Mix (-dye) AS211-01 AS211-02 1 ml 51 ml

Storage
at -20 C for two years
o

Description
EasyPfu PCR SuperMix is a ready-to-use mixture of EasyPfu DNA polymerase , dNTPs, and optimized buffer. This SuperMix is provided at 2 concentration and used at 1 concentration by adding template, primers and H2O. PCR products can be cloned into pEASY -Blunt cloning vector series.

Applications
High fidelity PCR amplification. Blunt end cloning. Site-directed mutagenesis.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2EasyPfu PCR SuperMix ddH2O Total volume Volume Variable 1-2 l 1-2 l 25 l Variable 50 l Final Concentration <0.5 g 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94oC 94oC 50-60 C 72oC 72oC
M
1 2 3
o

2-5 min 30 sec 30 sec 0.5 kb/min 5-10 min


4 5 6 7 8

30-35 cycles

EasyPfu DNA Polymerase

2xEasyPfu PCR SuperMix

M: 1Kb Plus DNA Ladder 1: CCRD 0.5 kb; 2: BDNF 0.8 kb; 3: Rhod 1.2 kb; 4: -globin 1.3 kb; 5: Rhod 2 kb; 6: -globin 3 kb; 7: Rhod 4.17 kb; 8: -globin 4.1 kb 50 ng of Human Genomic DNAas templates

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


29

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

PCR SuperMix

2TransStart FastPfu PCR SuperMix


Mix (-dye) AS221-01 AS221-02 1 ml 51 ml

Chapter 1

Storage
at -20 C for two years
o

Description
TransStart FastPfu PCR SuperMix is a ready-to-use mixture of TransStart FastPfu DNA polymerase, dNTPs, and optimized buffer. This SuperMix is provided at 2 concentration and can be used at 1 concentration by adding template, primers and H2O. PCR product amplified by TransStart FastPfu DNA polymerase can be cloned into pEASY -Blunt cloning vector series. Extension rate up to 4 kb/min. High fidelity, robust, and high speed amplification.

Applications
High fidelity amplification. Site-directed mutagenesis. Long or complex template amplification.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Component Template DNA Forward Primer (10 M) Reverse Primer (10 M) 2 TransStartt FastPfu PCR SuperMix ddH2O Total volume Volume Variable 1-2 l 1-2 l 25 l Variable 50 l Final Concentration <0.5 g 0.2-0.4 M each 0.2-0.4 M each 1 -

Thermal cycling conditions


94oC 94oC 50-60oC 72 C 72oC
M
1 2 3
o

2-5 min 20 sec 20 sec 2-4 kb/min 5-10 min


4 5 6 7 8

30-35 cycles

TransStart FastPfu DNA Polymerase

2xTransStart FastPfu PCR SuperMix

M: 1Kb Plus DNA Ladder 1: CCRD 0.5 kb; 2: BDNF 0.8 kb; 3: Rhod 1.2 kb; 4: -globin 1.3 kb; 5: Rhod 2 kb; 6: -globin 3 kb; 7: Rhod 4.17 kb; 8: -globin 4.1 kb 50 ng Human Genomic DNA as templates

High quality products


30

Chapter 1

Direct PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Direct PCR
TransDirect PCR uses a propriety formulated lysis reagent to release nucleic acids from a variety of animal tissues(fresh,frozen), plant tissues. Unpurified DNA is used as template for PCR using 2TransDirectTM PCR SuperMix which has extremely high resistance to many PCR inhibitors found in animal tissues, plant tissues and blood.
Direct PCR Application mammalian cells, saliva, hair shaft, animal tissues Non polysaccharides and polyphenols in plant tissue Fresh and frozen blood sample stored in EDTA, heparin, or citric acid Blood sample and dried blood without the anticoagulant

TransDirect TM Animal Tissue PCR Kit TransDirect TM Plant Tissue PCR Kit TransDirect TM Blood PCR Kit

TransDirect TM Animal Tissue PCR Kit


AD201-01 AD201-02

100 rxns20 l system 500 rxns20 l system

Storage
at -20 C for two years
o

Description
TransDirect TM Animal Tissue PCR Kit uses a propriety formulated lysis reagent to release nucleic acids from a variety of animal tissues(fresh,frozen). Unpurified DNA is used as template for PCR using 2 TransDirect TM PCR SuperMix which has extremely high resistance to many PCR inhibitors found in animal tissues.

Applications
Propriety formulated lysis reagent to release nucleic acids from a variety of animal tissues like mammalian cells, saliva, hair shaft, animal . Extremely high animal tissue inhibitor resistance 2 TransDirect TM PCR SuperMix for direct PCR from unpurified DNA. Amplifications up to 3 kb.

Kit Components
Component AD1 Buffer AD2 Preparation Buffer AD3 Buffer 2TransDirectTM PCR SuperMix(+dye) ddH2O AD201-01 12 ml 3 ml 12 ml 1 ml 5 ml AD201-02 55 ml 15 ml 512 ml 51 ml 25 ml

Amount of Starting Material


Material Mammalian Cell Animal Tissues Mouse Tail Mouse Ear Saliva Hair shaft Amount 1-5106 cell 10-30 mg 0.5-1 cm sections 0.5-0.7 cm disk 10-30 l 30 mg

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


31

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

Direct PCR

PROTOCOL
Chapter 1
Notes
Completely thaw the contents in the tube before each use.

Procedure
A:Add 25 l of AD2 buffer into 100 l of the AD1 Buffer, mix thoroughly by pipetting up and down (where substantial extracted sample, AD1 buffer to AD2 Buffer at ratio of 4:1, pre-mixed, and use within two hours). B:For different samples, the following processing methods: Mammalian Cells From collected cells, thoroughly remove the culture broth, add the mixture of AD1 and AD2, mix thoroughly by pipetting up and down. Animal Tissues Cut using clean, sterile scissors or blade, add the mixture of AD1 and AD2, mix thoroughly by pipetting up and down. Saliva Directly add saliva into the mixture of AD1 and AD2, mix thoroughly by pipetting up and down. Hair Shafts Cut hair into pieces, add the mixture of AD1 and AD2, mix thoroughly by pipetting up and down. C:Incubate for 10 minutes at room temperature (for difficult to lyse cells such as hair, 55oC incubated for 10 minutes, followed by 95oC incubated for 10 minutes). After incubation, 3 minutes at 95 oC. D: Adding 100 ul AD3 Buffer, mix directly as template for PCR, or placed and stored at 4oC or -20oC.
Components Tissue Extract 2TransDirect TM PCR SuperMix (+dye) Forward Primer (10 M) Reverse Primer (10 M) ddH2O Volume 4 l 10 l 0.4-0.8 l 0.4-0.8 l to 20 l Final Concentration as required 1 0.2-0.4 M each 0.2-0.4 M each Not applicable

Thermal cycling conditions


94 94 50-60 72 72 5-10 min 30 sec 30 sec 1-2 kb/min 5-10 min

35-40 cycles

10

11

12

13

14

M: Trans 2K Plus II DNA Marker Lane 1: Hair 0.8 kb Lane 2: Saliva 0.8 kb Lane 3: HeLa 0.8 kb Lane 4: HeLa 2 kb Lane 5: HeLa 3 kb Lane 6: Mouse ear0.86 kb Lane 7: Mouse ear1.8 kb

Lane 8: Mouse ear3 kb Lane 9: Drosophila0.42 kb Lane 10: Drosophila2 kb Lane 11: Nematode0.9 kb Lane 12: Shrimp1.1 kb Lane 13: Crab1 kb Lane 14: Razor clan0.56 kb

High quality products


32

Chapter 1

Direct PCR

Chapter 1

TransDirect TM Plant Tissue PCR Kit


AD301-01 AD301-02 100 rxns20 l system 500 rxns20 l system

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20 C for two years
o

Description
TransDirect TM Plant Tissue PCR Kit uses a propriety formulated lysis reagent to release nucleic acids from a variety of plant tissues. Unpurified DNA is used as template for PCR using 2TransDirectTM PCR SuperMix which has extremely high resistance to many PCR inhibitors found in plant tissues.

Applications
Propriety formulated lysis reagent to release nucleic acids from a variety of plant tissues Extremely high plant tissue inhibitor resistance 2 TransDirect TM PCR SuperMix for direct PCR from unpurified DNA or PCR from cell culture without DNA extraction. Amplifications up to 2 kb.

Kit Components
Components PD1 Buffer PD2 Buffer 2TransDirect TM PCR SuperMix (+dye) ddH2O AD301-01 12 ml 12 ml 1 ml 5 ml AD301-02 55 ml 55 ml 51 ml 25 ml

PROTOCOL
Notes
Completely thaw the contents in the tube before each use. Incubate the bottle for PD1 at 55oC until it becomes clear, if it is viscous A: Genomic DNA Extraction 1.Cut up 10-30 mg or 1cm2 plant tissue and add it to a tube containing 100 l of PD1 buffer, Vortex. 2.Incubate at 95C for 10 min. 3.Add 100 l of PD2 Buffer and vortex to mix. DNA is ready for PCR or storage (Tissue Extract can be stored at 4oC for six months, or at -20oC one year) . B:PCR amplification
Components Tissue Extract 2TransDirect TM PCR SuperMix (+dye) Forward Primer (10 M) Reverse Primer (10 M) ddH2O Volume 2-4 l 10 l 0.4-0.8 l 0.4-0.8 l to 20 l Final Concentration as required 1 0.2-0.4 M each 0.2-0.4 M each Not applicable

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


33

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

Direct PCR

Thermal cycling conditions

Chapter 1

94 94 50-60 72 72
M
1 2 3

2-5 min 20 sec 20 sec 2-4 kb/min 5-10 min


4 5 6 7 8

30-35 cycles

9 10 11 12 13 14 15 16 17 18 19 20

M: Trans 2K Plus II DNA Marker Lane 1: Corn 0.4 kb Lane 8: Soybean 1.5 kb Lane 2: Corn 0.8 kb Lane 9: Arabidopsis 0.5 kb Lane 3: Corn 1.5 kb Lane 10: Arabidopsis 0.9 kb Lane 4: Wheat 0.4 kb Lane 11: Arabidopsis 1.5 kb Lane 5: Wheat 0.9 kb Lane 12: Tobacco 0.5 kb Lane 6: Wheat 1.5 kb Lane 13: Tobacco 0.9 kb Lane 7: Soybean 0.9 kb Lane 14: Tobacoo 1.5 kb

Lane 15: Cotton 0.3 kb Lane 16: Cotton 1 kb Lane 17: Cotton 1.6 kb Lane 18: Rice 0.3 kb Lane 19: Rice0.9 kb Lane 20: Rice 1.9 kb

TransDirect TM Blood PCR Kit


Mix (-dye) AD401-01 AD401-02 100 rxns20 l system 500 rxns20 l system

Storage
at -20 C for two years
o

Description
Trans Blood PCR SuperMix is a ready-to-use mixture of Trans BD Taq DNA Polymerase, dNTPs, and optimized buffer. This SuperMix is provided at 2 concentration and can be used at 1 concentration by adding blood, primers and H2O.

Applications
Fresh and frozen blood sample stored in EDTA, heparin, or citric acid. Blood sample and dried blood without the anticoagulant. PCR from cell culture without DNA extraction. Amplification upto 4 kb.

Kit Components
Components 2TransDirect TM PCR SuperMix (+dye) ddH2O AD401-01 1 ml 5 ml AD401-02 51 ml 25 ml

High quality products


34

Chapter 1

Direct PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Components Template Forward Primer (10 M) Reverse Primer (10 M) 2TransDirectTM PCR SuperMix (+dye) ddH2O Volume 0.2-0.8 l 0.4-0.8 l 0.4-0.8 l 10 l to 20 l Final Concentration as required 0.2-0.4 M each 0.2-0.4 M each 1 Not applicable

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 5 min 30 sec 30 sec 1-2 kb/min 5-10 min 30-40 cycles

human frozen EDTA anticoagulated blood

Hela cells were used to amplify the Hdt gene (0.32 kb) in 25 l PCR reaction M: Trans2K DNA Marker Lane 1: 104 cells Lane 2: 103 cells Lane 3: 102 cells Lane 4: 10 cells

Human oral cavity epithelial tissue was used to amplify the Hdt gene (0.32 kb) in 25 l reaction M: Trans2K DNA Marker

human frozen heparin anticoagulated blood

human fresh blood sample without the anticoagulant 0.5 l of blood sample was used in 25 l PCR reaction.

0.5 l of diluted chicken sodium citrate anticoagulated blood was used to amplify a 0.25 kb fragment in 25 l reaction M: Trans2K DNA Marker Lane 1: Blood Lane 2: 1:10 dilution Lane 3: 1:100 dilution

0.5 l of 1:40 diluted mouse heparin anticoagulated blood was used in 25 l reaction . M: Trans2K DNA Marker Lane 1: Neo 0.25 kb Lane 2: MAP 0.6 kb

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


35

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

RT-PCR
Trans reverse transcriptases
Site mutation to have a higher thermostability Site mutation conveying higher synthesis ability Site mutation to destroy RNase H activity

Chapter 1

Trans reverse transcriptase series include EasyScript RT, TransScript RT and TransScript II RT.

TransScript II RT TransScript RT EasyScript RT

Products
EasyScript RT TransScript RT TransScript II RT EasyScript First-Strand cDNA Synthesis SuperMix TransScript First-Strand cDNA Synthesis SuperMix TransScript One-Step gDNA Removal and cDNA
Synthesis SuperMix TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR

Size of production 8 kb 12 kb 15 kb 8 kb 12 kb 12 kb 12 kb 12 kb 15 kb 15 kb 15 kb 15 kb 12 kb 15 kb 4 kb 8 kb 8 kb

Sensitivity

Fidelity

Complex or GC-rich template

TransScript II First-Strand cDNA Synthesis SuperMix TransScript II One-Step gDNA Removal and cDNA
Synthesis SuperMix TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR TransScript Two-Step RT-PCR SuperMix TransScript II Two-Step RT-PCR SuperMix EasyScript One-Step RT-PCR SuperMix TransScript One-Step RT-PCR SuperMix TransScript II One-Step RT-PCR SuperMix

High quality products


36

Chapter 1

RT-PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Tradtional RT vs Trans RT Traditional Trans


Add all components without thermal denaturation and ice-bath

Traditional First-Strand cDNA Synthesis vs Trans First -Strand cDNA Synthesis SuperMix Tradtional
Primer RNA Buffer 2RT Reaction Mix dNTPs

Trans
Primer RNA

Mix RNA and primers

Denature 5 min at 65oC, place on ice Add bufferRNase InhibitordNTPs M-MLV RT Add RNAprimers bufferRNase Inhibitor dNTPsTrans RT, in one tube Incubate at 42oC/50oC for 30 min , then 5 min at 85oC to inactive the enzyme

RT Enzyme RT/RI Enzyme Mix RNase Inhibitor

Incubate at 42o C for 50 min , then 15 min at 70oC to inactive the enzyme

Trans RT products (except one-step kits) use Anchored Oligo(dT) to increase cDNA yield and full length cDNA

products TraditionalOligo(dT)12-18 Primer Anchored Oligo(dT) Primer


U A NNNNGAAAAAAAAAAAAAAA+GTTTTTTTTTTTT C C NNNNUAAAAAAAAAAAAAAAA ATTTTTTTTTTTT U NNNNCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA G TTTTTTTTTTTT NNNNCAAAAAAAAAAAAAAAA GTTTTTTTTTTTT NNNNGAAAAAAAAAAAAAAAA CTTTTTTTTTTTT

U NNNNCAAAAAAAAAAAAAAAA+TTTTTTTTTTTT G

Poly(A) tail can be a few hundreds bp long and oligo(dT) binds randomly. Difficult to synthesize long poly(A) tail. Lower yield and less full length cDNA.

Anchored oligo(dT) binds specific site. Higher cDNA yield and more full length cDNA.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


37

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

EasyScript Reverse Transcriptase[M-MLV,RNase H]


AE101-02 AE101-03 10000 units 510000 units

Chapter 1

Concentration
200 units/l

Description
EasyScript Reverse Transcriptase is an engineered version of M-MLV reverse transcriptase with reduced RNase H activity. The enzyme is purified to near homogeneity from E.coli containing the modified M-MLV RT gene. Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)18 for higher yield and more full length cDNA. cDNA up to 8 kb.

Components
EasyScript RT 5ES RT Buffer (375 mM KCl; 15 mM MgCl2; 100 mM Tris-HCl pH 8.4) Anchored Oligo(dT)18

Storage
at -20oC for one year

Application
First strand cDNA synthesis. Multiple copy gene.

Unit Definition
One unit of EasyScript is the amount of enzyme required to incorporate 1 nmol of deoxyribonucleotide into acid precipitable material in 10 minutes at 37oC using Poly(A)Oligo(dT) as template primer.

PROTOCOL
First Strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA Anchored Oligo(dT)18 (0.5 g /l) or Random Primer(N9) (0.1 g/l) or GSP 10 mM dNTPs 5 ES RT Buffer Ribonuclease Inhibitor (50 units/l) EasyScript RT RNase-free Water Volume Variable 1 l 1 l 2 pmol 1 l 4 l 0.5 l 1 l to 20 l

2Incubation For anchored oligo(dT)18 primer or GSP, incubate at 42oC for 30 min. For random primer, incubate at 25oC for 10 min, then at 42oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme.

High quality products


38

Chapter 1

RT-PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

RT-PCR
Reaction Components
Component cDNA Forward Primer (10 M) Reverse Primer (10 M) 10TransTaq HiFi Buffer II (Mg ) 2.5 mM dNTPs
2+

Volume Variable 1 l 1 l 5 l 4 l 0.5 l Variable 50 l

Final Concentration as required 0.2 M 0.2 M 1 0.2 mM 2.5 units -

TransTaq HiFi DNA Polymerase


ddH2O Total volume

Thermal cycling conditions


94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min

35-40 cycles

M 1 2 3 4 5 6 7 M 1 2 3 4 5 6 7 M
M1Kb Plus DNA Ladder Lanes 1-700.010.11101001000 pg Human total RNA

NCBP

Human DNA Polymerase

M
M1Kb Plus DNA Ladder 1GAPDH 0.5 kb2GAPDH 0.9 kb 3REPA 1.8 kb 4ACTR 3 kb 5ACTR 3.5 kb 6VIN 4.6 kb 7TSC 5.3 kb8Pol 6.8 kb Human cDNAas template

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


39

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

TransScript Reverse Transcriptase[M-MLV,RNase H]


AT101-02 AT101-03 10000 units 510000 units

Chapter 1

Concentration
200 units/l

Description
TransScrip t Reverse Transcriptase is a recombinant M-MLV reverse transcriptase with reduced RNase H activity. Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)18 for higher yield and more full length cDNA. cDNA up to 12 kb.

Components
TransScript RT 5TS RT Buffer (250 mM KCl; 15 mM MgCl2; 100 mM Tris-HCl pH 8.4) Anchored Oligo(dT)18

Storage
at -20 C for one year
o

Application
First strand cDNA synthesis. Multiple copy and low-copy genes.

Unit Definition
One unit of TransScrip t is the amount of enzyme required to incorporate 1 nmol of deoxyribonucleotide into acid-precipitable material in 10 minutes at 37oC using Poly(A)Oligo(dT) as template primer.

PROTOCOL
The condition for the first strand cDNA synthesis is the same as for EasyScrip t Reverse Transcriptase ( P39 ).

M 1 2 3 4 5 6 7 M 1 2 3 4 5 6 7 M
M1Kb Plus DNA Ladder Lanes 1-700.010.11101001000 pg Human total RNA

NCBP

Human DNA Polymerase

M 1

M
MTrans15K DNA Marker 1GAPDH 0.9 kb2REPA 1.8 kb 3ACTR 3 kb 4HDP 3.5 kb 5: VIN 4.6 kb6TSC 5.3 kb 7Pol 6.8 kb8FIB 9.4 kb 9Dynein 12.3 kb Human cDNA as template

High quality products


40

Chapter 1

RT-PCR

Chapter 1

TransScript II Reverse Transcriptase[M-MLV,RNase H] (High Temperature RT)


AH101-02 10000 units

qPCR and qRT-PCR

PCR, RT-PCR,

Concentration
200 units/l

Description
TransScrip t II Reverse Transcriptase is a recombinant M-MLV reverse transcriptase with reduced RNase H activity and increased thermostability. The enzyme is active up to 55oC. It provides higher specificity, higher yield and more full-length cDNA products. Increased thermostability for more full-length cDNA products. Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)20 for higher yield and more full length cDNA. cDNA up to 15 kb.

Components
TransScrip t II RT 10TS II RT Buffer (500 mM KCl; 30 mM MgCl2; 200 mM Tris-HCl pH 8.4) Anchored Oligo(dT)20

Storage
at -20oC for one year

Application
First strand cDNA synthesis. Multiple copy and low-copy genes. GC rich or comlex secondary-structure RNA template.

Unit Definition
One unit of TransScrip t II is the amount of enzyme required to incorporate 1 nmol of deoxyribonucleotide into acid-precipitable material in 10 minutes at 37oC using Poly(A)Oligo(dT) as template primer .

PROTOCOL
First Strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA Anchored Oligo(dT)20(0.5 g /l) or Random Primer(N9) (0.1 g/l) or GSP 10 mM dNTPs 10TS II RT Buffer Ribonuclease Inhibitor (50 units/l) TransScript II RT RNase-free Water Volume Variable 1 l 1 l 2 pmol 1 l 2 l 0.5 l 1 l to 20 l

2Incubation For anchored oligo(dT)20 primer or GSP, incubate at 50oC for 30 min. For random primer, incubate at 25oC for 5-10 min then at 50oC for 30 min. For GC-rich or complex secondary structure RNA template, incubate at 55oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


41

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

The condition for the PCR is the same as for EasyScrip t Reverse Transcriptase(P37) .
M1 1 2 3 4 5 6 7 8 M2

Chapter 1

M11Kb Plus DNA Ladder M2Trans15K DNA Marker 1: REPA 1.8 kb; 2: NCBP 2.5 kb; 3: HDP 3.5 kb; 4: VIN 4.6 kb; 5: Pol 6.8 kb; 6: APC 8.5 kb; 7: Dynein 12.3 kb; 8: FAL 15.1 kb Human cDNA as templates

EasyScript First-Strand cDNA Synthesis SuperMix


AE301-02 AE301-03 50 rxns20 l system 100 rxns20 l sytecm

Storage
at -20 C for one year
o

Description
EasyScrip t First-Strand cDNA Synthesis SuperMix provides all the necessary components for cDNA synthesis from total or poly(A) + RNA. The first-strand cDNA products generated by the supermix are suitable for cloning, PCR or qPCR applications. Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)18 for higher yield and more full length cDNA. cDNA up to 8 kb.

Application
First strand cDNA synthesis.

Kit Components
AE301-02 AE301-03 250 l 2500 l 100 l 100 l 1 ml

EasyScrip t RT/RI Enzyme Mix


2ES Reaction Mix Random Primer (0.1 g/l) Anchored Oligo(dT)18 Primer (0.5 g/l) RNase-free Water

50 l 500 l 50 l 50 l 500 l

High quality products


42

Chapter 1

RT-PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
the First Strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA Anchored Oligo(dT)18 (0.5 g /l) or Random Primer(N9) (0.1 g/l) or GSP 2ES Reaction Mix EasyScript RT/RI Enzyme Mix RNase-free Water Volume Variable 1 l 1 l 2 pmol 10 l 1 l to 20 l

2Incubation For anchored oligo(dT)18 primer or GSP, incubate at 42oC for 30 min. For random primer, incubate at 25oC for 10 min then at 42oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase ( P39 ).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


43

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

TransScrip t First-Strand cDNA Synthesis SuperMix


AT301-02 AT301-03 50 rxns20 l system 100 rxns20 l system

Chapter 1

Storage
at -20oC for one year

Description
TransScript First-Strand cDNA Synthesis SuperMix provides all the necessary components for cDNA synthesis from total or poly(A)+ RNA. The first-strand cDNA products generated by this supermix are suitable for cloning, PCR or qPCR applications. Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)18 for higher yield and more full length cDNA. cDNA up to 12 kb.

Application
First strand cDNA synthesis.

Kit Components
AT301-02 AT301-03 250 l 2500 l 100 l 100 l 1 ml

TransScrip t RT/RI Enzyme Mix


2TS Reaction Mix Random Primer (0.1 g/l) Anchored Oligo(dT)18 Primer (0.5 g/l) RNase-free Water

50 l 500 l 50 l 50 l 500 l

PROTOCOL
First Strand cDNA synthesis
1 Reaction Components
Total RNA/mRNA Anchored Oligo(dT)18 (0.5 g /l) or Random Primer(N9) (0.1 g/l) or GSP 2TS Reaction Mix TransScrip t RT/RI Enzyme Mix RNase-free Water Volume Variable 1 l 1 l 2 pmol 10 l 1 l to 20 l

2Incubation For anchored oligo(dT)18 primer or GSP, incubate at 42oC for 30 min. For random primer, incubate at 25oC for 10 min, then at 42oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase( P39 ).

High quality products


44

Chapter 1

RT-PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix


AT311-02 AT311-03 50 rxns20 l system 100 rxns20 l sytecm

Storage
at -20oC for one year

Description
Unique genomic DNA remover is combined with First-Strand cDNA synthesis SuperMix to achieve simultaneous genomic DNA remove and cDNA synthesis. After cDNA synthesis, gDNA remover and reverse transcriptase are inactivated by heating at 85oC for 5 minutes. Simultaneous genomic DNA removal and cDNA synthesis. cDNA up to 12 kb.

Application
First strand cDNA synthesis.

Kit Components
AT311-02 AT311-03 250 l 250 l 2500 l 100 l 100 l 1 ml

TransScrip t

RT/RI Enzyme Mix

50 l 50 l 500 l 50 l 50 l 500 l

gDNA Remover 2TS Reaction Mix Random Primer (0.1 g/l) Anchored Oligo(dT)18 Primer (0.5 g/l) RNase-free Water

PROTOCOL
First Strand cDNA synthesis
1 Reaction Components
Volume Total RNA/mRNA Anchored Oligo(dT)18 Primer (0.5 g/l) or Random Primer (0.1 g/l) or GSP 2TS Reaction Mix TransScript RT/RI Enzyme Mix gDNA Remover RNase-free Water

Variable 1 l 1 l 2 pmol 10 l 1 l 1 l to 20 l

2Incubation For anchored oligo(dT)18 primer or GSP, incubate at 42oC for 30 min. For random primer, incubate at 25oC for 10 min then at 42oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase( P39 ).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


45

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

Chapter 1

TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR


AT321-01 50 rxns20 l system

Storage
at -20oC for one year

Description
TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR provides all the necessary components for cDNA synthesis from total or poly(A)+ RNA. The SuperMix is provided at 5 concentration and used at 1 concentration by adding template and H2O. cDNA generated with the SuperMix are suitable for regular PCR. The kit is not suitable for qPCR. 1-tube format for simple and fast setup and reduce pipetting variability. Fast 30 min cDNA synthesis protocol. cDNA up to 12 kb.

Kit Components
AT321-01 5TransScript All-in-One SuperMix for PCR RNase-free Water 200 l 1 ml

PROTOCOL
First Strand cDNA synthesis
1. Reaction Components
Volume Total RNA/mRNA 5TransScript All-in-One SuperMix for PCR RNase-free Water 50 ng-5 g/5-500 ng 4 l to 20 l

2. Incubate at 42oC for 30 min. 3. Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase( P39 ).

High quality products


46

Chapter 1

RT-PCR

Chapter 1

TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR


AT331-01 50 rxns 20 l system

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20 C for one year
o

Description
TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR provides all the necessary components for cDNA synthesis from total or poly(A)+ RNA. The SuperMix is provided at 5 concentration and used at 1 concentration by adding template and H2O. cDNA generated by the SuperMix are suitable for qPCR. The kit is not suitable for regular PCR. 1-tube format for simple and fast setup and reduced pipetting variability. Fast 10 min cDNA synthesis protocol. High compatibility with qPCR reagent.

Kit Components
AT331-01 5TransScrip t All-in-One SuperMix for qPCR 5TransScript All-in-One No-RT Control SuperMix for qPCR RNase-free Water 200 l 20 l 1 ml

PROTOCOL
First Strand cDNA synthesis
1. Reaction Components
Volume Total RNA/mRNA 5TransScript All-in-One SuperMix for qPCR RNase-free Water Variable 4 l to 20 l

2. Incubate at 42oC for 10 min. 3. Incubate at 85oC for 5 sec to inactive enzyme.

qRT-PCR

It is suggested to use 2-4 l reverse transcription products as qPCR templates. The suggested reaction condition is the same as for TransStart Green qPCR SuperMix ( P60 ).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


47

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

TransScrip t II First-Strand cDNA Synthesis SuperMix


AH301-02 AH301-03 50 rxns20l system 100 rxns20 l sytecm

Chapter 1

Storage
at -20 C for one year
o

Description
TransScrip t II First-Strand cDNA Synthesis SuperMix provides all the necessary components for cDNA synthesis from total or Poly(A)+ RNA. It is an optimized cDNA synthesis kit with TransScrip t II RT. First-Strand cDNA can be synthesized at higher temperature resulting higher yield and more full-length cDNA products.
Reduced RNase H activity to reduce RNA template degradation during the first-strand cDNA synthesis. Anchored oligo(dT)20 for higher yield and more full length cDNA. cDNA up to 15 kb.

Application
First strand cDNA synthesis.

Kit Components
Components AH301-02 50 l 500 l 50 l 50 l 500 l AH301-03 250 l 2500 l 100 l 100 l 1 ml

TransScrip t II RT/RI Enzyme Mix


2TS II Reaction Mix Random Primer(N9) (0.1 g/l) Anchored Oligo(dT)20 Primer (0.5 g/l) RNase-free Water

PROTOCOL
First Strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA Anchored Oligo(dT)20 (0.5 g /l) or Random Primer(N9) (0.1 g/l) or GSP 2TS II Reaction Mix TransScipt II RT/RI Enzyme Mix RNase-free Water Volume Variable 1 l 1 l 2 pmol 10 l 1 l to 20 l

2. Incubation For anchored oligo(dT)20 primer or GSP, incubate at 50oC for 30 min. For random primer, incubate at 25oC for 5-10 min, then at 50oC for 30 min. For GC-rich or complex secondary structure RNA template, incubate at 55oC, 30 min. 3. Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR

It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase ( P39 ).

High quality products


48

Chapter 1

RT-PCR

Chapter 1

TransScrip t II One-Step gDNA Removal and cDNA Synthesis SuperMix


AH311-02 AH311-03 50 rxns20 l system 100 rxns20 l system

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20oC for one year

Description
Unique genomic DNA remover is combined with First-Strand cDNA synthesis SuperMix to achieve simultaneous genomic DNA remove and cDNA synthesis. After cDNA synthesis, gDNA remover and reverse transcriptase are inactivated by heating at 85oC for 5 minutes. Simultaneous genomic DNA removal and cDNA synthesis. cDNA up to 15 kb.

Kit Components
Components AH311-02 50 l 50 l 500 l 50 l 50 l 500 l AH311-03 250 l 250 l 2500 l 100 l 100 l 1 ml

TransScrip t II RT/RI Enzyme Mix


gDNA Remover 2TS II Reaction Mix Random Primer(N9) (0.1 g/l) Anchored Oligo(dT)20 Primer (0.5 g/l) RNase-free Water

PROTOCOL
First Strand cDNA synthesis
1 Reaction Components
Volume Total RNA/mRNA Anchored Oligo(dT)20 Primer (0.5 g/l) or Random Primer (0.1 g/l) or GSP 2TS II Reaction Mix TransScript II RT/RI Enzyme Mix gDNA Remover RNase-free Water

Variable 1 l 1 l 2 pmol 10 l 1 l 1 l to 20 l

2. Incubation For anchored oligo(dT)20 primer or GSP, incubate at 50oC for 30 min. For random primer, incubate at 25oC for 5-10 min, then at 50oC for 30 min. 3. Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase( P39 ).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


49

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

Chapter 1

TransScrip t II All-in-One First-Strand cDNA Synthesis SuperMix for PCR


AH321-01 50 rxns20 l system

Storage
at -20oC for one year

Description
TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR provides all the necessary components for cDNA synthesis from total RNA or poly(A)+ RNA. This SuperMix is provided at 5 concentration and used at 1 concentration by adding template and H2O. cDNA products generated by this SuperMix are suitable for PCR. The kit is not suitable for qPCR. 1-tube format for simple and fast setup and reduced pipetting variability. Fast 30 min cDNA synthesis protocol. cDNA up to 15 kb.

Application
first-strand cDNA synthesis.

Kit Components
AH321-01 5TransScrip t II All-in-One SuperMix for PCR RNase-free Water

200 l 1 ml

PROTOCOL
First Strand cDNA synthesis
1 Reaction Components
Volume Total RNA/mRNA 5TransScript II All-in-One SuperMix for PCR RNase-free Water

Variable 4 l to 20 l

2. Incubation at 50oC for 30 min. 3. Incubate at 85oC for 5 min to inactive enzyme.

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. The suggested reaction condition is the same as for EasyScript Reverse Transcriptase( P39 ).

High quality products


50

Chapter 1

RT-PCR

Chapter 1

TransScrip t II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR


AH331-01 50 rxns20 l sysecm

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20oC for one year

Description
TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR provides all the necessary components for cDNA synthesis from total RNA or poly(A)+ RNA. This SuperMix is provided at 5 concentration and used at 1 concentration by adding template and H2O. cDNA products generated by this SuperMix are suitable for qPCR. The kit is not suitable for PCR. 1-tube format for simple and fast setup and reduced pipetting variability. Fast 10 min cDNA synthesis protocol.

Kit Components
AH331-01 5TransScript II All-in-One SuperMix for qPCR 5 TransScript II All-in-One No-RT Control SuperMix for qPCR RNase-free Water

200 l 20 l 1 ml

PROTOCOL
First Strand cDNA synthesis
1 Reaction Components
Volume Total RNA/mRNA 5TransScript II All-in-One SuperMix for qPCR RNase-free Water

Variable 4 l to 20 l

2. Incubate at 50oC for 10 min. 3. Incubate at 85oC for 5 sec to inactive enzyme.

qRT-PCR
It is suggested to use 2-4 l reverse transcription products as qPCR templates. The suggested reaction condition is the same as for TransStart Green qPCR SuperMix ( P60 ).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


51

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

TransScript Two-Step RT-PCR SuperMix


AT401-01 RT system / PCR system 50rxns20 l/80rxns50 l

Chapter 1

Storage
at -20oC for one year

Description
TransScript Two-Step PCR performs the reverse transcription and first-strand cDNA synthesis in two steps. Two-Step RT-PCR is useful for detecting multiple genes from the same RNA sample.Oligo(dT), random primers or gene-specific primers can be used for the reverse transcription. TransScript RT is used for reverse transcription and TransTaq HiFi PCR SuperMix II is included for PCR.

Applications
cDNA synthesis. Multiple genes can be detected from the same RNA sample.

Kit Components
Components 5TransScript All-in-One SuperMix for PCR 2TransTaq HiFi PCR SuperMix II RNase-free Water

AT401-01 200 l 21 ml 1 ml

PROTOCOL
First strand cDNA synthesis is the same as TransScrip t First-Strand cDNA Synthesis SuperMix ( P44 ).

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. Reaction Components
Components cDNA Forward Primer (10 M) Reverse Primer (10 M) 2TransTaq HiFi PCR SuperMix II ddH2O Volume 2 l 1 l 1 l 25 l to 50 l Final Concentration as required 0.2 M each 0.2 M each 1 Not applicable

PCR condition is the same as for EasyScrip t Reverse Transcriptase (P39).

High quality products


52

Chapter 1

RT-PCR

Chapter 1

TransScript II Two-Step RT-PCR SuperMix


AH401-01 RT system / PCR system 20 l50rxns/50 l80rxns

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20oC for one year

Description
TransScript II Two-Step PCR performs the reverse transcription and first-strand cDNA synthesis in two steps. Two-Step RT-PCR is useful for detecting multiple genes from the same RNA sample.Oligo(dT), random primers or gene-specific primers can be used for the reverse transcription. TransScript II RT is used for reverse transcription and TransTaq HiFi PCR SuperMix II is included for PCR.

Applications
cDNA synthesis. Multiple genes can be detected from the same RNA sample.

Kit Components
Components 5TransScript ll All-in-One SuperMix for PCR 2TransTaq HiFi PCR SuperMix II RNase-free Water

AH401-01 200 l 21 ml 1 ml

PROTOCOL
First strand cDNA synthesis is the same as TransScript II FirstStrand cDNA Synthesis SuperMix ( P48).

RT-PCR
It is suggested to use 2-4 l reverse transcription products as PCR templates. Reaction Components
Components cDNA Forward Primer (10 M) Reverse Primer (10 M) 2TransTaq HiFi PCR SuperMix II ddH2O Volume 2 l 1 l 1 l 25 l to 50 l Final Concentration as required 0.2 M each 0.2 M each 1 Not applicable

PCR condition is the same as EasyScript Reverse Transcriptase (P39).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


53

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

EasyScript One-Step RT-PCR SuperMix


AE411-02 200 rxns 20 l system

Chapter 1

Storage
at -20oC for one year

Description
One-Step RT-PCR combines the first-strand cDNA synthesis with PCR in the same tube to simplify reaction setup and reduce the possibility of contamination. Only gene-specific primers can be used for One-Step RT-PCR. EasyScript RT and TransTaq HiFi DNA Polymerase are included in the kit.

Application
cDNA synthesis and PCR.

Kit Components
AE411-02 EasyScript One-Step Enzyme Mix 2One-Step Reaction Mix RNase-free Water 80 l 21 ml 21 ml

PROTOCOL
Reaction Components Notes
Only gene-specific primers can be used for One-Step RT-PCR.
Component RNA Template Forward GSP (10 M) Reverse GSP (10 M) 2One-Step Reaction Mix EasyScript One-Step Enzyme Mix RNase-free Water Volume x l 0.4 l 0.4 l 10 l 0.4 l to 20 l Final Concentration 1 pg~1 g 0.2 M 0.2 M 1 Not applicable

Thermal cycling conditions


45oC15-30 min 94oC 2-5 min 94oC 30 sec 50-60oC 30 sec 72oC 1-2 kb/min 72oC 5-10 min
M 1 2 3 4 5

35-40 cycles

RT-PCR with EasyScript One-step RT-PCR SuperMix M11Kb Plus DNA Ladder 1: -actin 0.5 kb 2: BACH1 1.0 kb REPA 1.8 kb 4: ACTR 3.0 kb 5: VIN 4.6 kb

RT-PCR with EasyScript One-step RT-PCR SuperMix to amplify -actin from Human total RNA MTrans2K DNA Marker (Lanes 1-9: 0 pg, 0.1 pg, 1 pg, 10 pg, 100 pg, 1000 pg, 10 ng, 100 ng, 1000 ng )

High quality products


54

Chapter 1

RT-PCR

Chapter 1

TransScript One-Step RT-PCR SuperMix


AT411-02 200 rxns 20 l system

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20oC for one year

Description
One-Step RT-PCR combines the first-strand cDNA synthesis with PCR in th e same tube to simplify reaction setup and reduce the possibility of contamination. Only gene-specific primers can be used for One-Step RT-PCR. TransScript RT and TransTaq HiFi DNA Polymerase are included in the kit.

Application
cDNA synthesis and PCR.

Kit Components
AT411-02 TransScript One-Step Enzyme Mix 2One-Step Reaction Mix RNase-free Water

80 l 21 ml 21 ml

PROTOCOL
Reaction Components Notes
Only gene-specific primers can be used for One-Step RT-PCR.
Component RNA Template Forward GSP (10 M) Reverse GSP (10 M) 2One-Step Reaction Mix TransScript One-Step Enzyme Mix RNase-free Water Volume x l 0.4 l 0.4 l 10 l 0.4 l to 20 l Final Concentration 1 pg~1 g 0.2 M 0.2 M 1 -

Thermal cycling conditions


45oC15-30 min 94oC 94oC 50-60oC 72oC 72oC 2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min 35-40 cycles

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


55

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

Chapter 1

RT-PCR with TransScript One-step RT-PCR SuperMix M1Kb Plus DNA Ladder 1: -actin 0.5 kb 2: BACH1 1.0 kb REPA 1.8 kb 4: ACTR 3.0 kb 5: VIN 4.6 kb 6: GNE 5.9 kb M 1 2 3 4 5 6 7 8 9

RT-PCR with TransScript One-step RT-PCR SuperMix to amplify -actin from Human total RNA M: Trans2K DNA Marker TransScript One-Step RT-PCR SuperMix picture for sensitity. Lanes 1-9: 0 pg, 0.1 pg, 1 pg, 10 pg, 100 pg, 1000 pg, 10 ng, 100 ng, 1000 ng

TransScript II One-Step RT-PCR SuperMix


AH411-02 200 rxns 20 l system

Storage
at -20oC for one year

Description
One-Step RT-PCR combines the first-strand cDNA synthesis with PCR in the same tube to simplify reaction setup and reduce the possibility of contamination. Only gene-specific primers can be used for One-Step RT-PCR.TransScript II RT and TransTaq HiFi DNA Polymerase are included in the kit.

Application
cDNA synthesis and PCR.

Kit Components
AH411-02 TransScript II One-Step Enzyme Mix 2One-Step Reaction Mix RNase-free Water

80 l 21 ml 21 ml

High quality products


56

Chapter 1

RT-PCR

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Reaction Components Notes
Only gene-specific primers can be used for One-Step RT-PCR.
Component RNA Template Forward GSP (10 M) Reverse GSP (10 M) 2One-Step Reaction Mix TransScript II One-Step Enzyme Mix RNase-free Water Volume x l 1 l 1 l 25 l 1 l to 20 l Final Concentration 1 pg~1 g 0.2 M 0.2 M 1 Not applicable

Thermal cycling conditions


50oC15-30 min 94oC 94 C 50-60oC 72oC 72oC
M 1 2 3
o

2-5 min 30 sec 30 sec 1-2 kb/min 5-10 min


4 5 6 7 M

35-40 cycles

M11Kb Plus DNA Ladder 1: GAPDH 0.9 kb 2: REPA 1.8 kb NCBP 2.5 kb 4: HDP 3.5 kb 5: VIN 4.6 kb 6: Pol 6.8 kb 7: APC 8.5 kb

MTrans2K DNA Marker TransScript II One-Step RT-PCR SuperMix picture for sensityoy. Lanes 1-90 pg, 0.1 pg, 1 pg, 10 pg, 100 pg, 1000 pg, 10 ng, 100 ng, 1000 ng Human total RNA

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


57

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

RT-PCR

Ribonuclease Inhibitor
Concentration
50 units/l

AI101-01 AI101-02

2000 units 52000 units

Chapter 1

Description
Ribonuclease Inhibitor is a recombinant protein purified from E. coli strain carrying human placenta ribonuclease gene. It specifically inhibits RNase A, RNase B, RNase C. It is not effective against RNase 1, RNase T4, S4 nuclease RNase H. It has no inhibition effect on DNA Polymerase, AMV, M-MLV, SP6, T7 and T3 RNA Polymerase.

Storage
at -20oC for one year

Unit Definition
One unit is defined as of polymerase volume inhibiting 5 ng RNaseA activity of 50%.

Application
In vitro inhibition of ribonuclease. Suitable for cDNA synthesis, RT-PCR, and in vitro transcription and translation.

qPCR and qRT-PCR SuperMix


Basic principle of real-time quantitative PCR
Real-time qPCR is a PCR method used to amplify and simultaneously quantify target DNA molecules. Two methods are frequently used for qPCR: double-stranded cDNA-binding dyes (like SYBR Green) or fluorescent reporter probes (like TaqMan). In both cases, fluorescence signals are detected during the exponential phase.

High quality products


58

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

TransStart Green qPCR SuperMix


AQ101-01 AQ101-02 AQ101-03 1 ml 51 ml 151 ml

qPCR and qRT-PCR

PCR, RT-PCR,

Components
TransStart Green qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50)

Description
TransStart Green qPCR SuperMix is a ready-to-use qPCR cocktail containing all components, except primers and template, for real-time quantification PCR. It contains TransStart Taq DNA Polymerase, SYBR Green I, dNTPs, PCR enhancer, stabilizers. qPCR SuperMix is provided at 2 concentration and can be used at 1 concentration by adding template, primer, passive reference dye or PCR enhancer and H2O. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Storage
at -20oC for one year in dark

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

PROTOCOL
Notes
Completely thaw the contents in the tube before each use.

Reaction Components
Volume Forward Primer (10 M) Reverse Primer (10 M) 2TransStart Green qPCR SuperMix Passive Reference Dye/PCR Enhancer(50) Template ddH2O Total volume 0.4 l 0.4 l 10 l 0.4 l x l Variable 20 l Final Concentration 0.2 M 0.2 M 1 1 as required -

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


59

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

Thermal cycling conditions (three-step)

Chapter 1

94oC 30 sec 94oC 5 sec 50-60oC 15 sec* 72oC 10 sec Dissociation Stage 94oC 30 sec 94oC 5 sec 60oC 30 sec* Dissociation Stage

40-45 cycles

Thermal cycling conditions (two-step)


40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

TransStart Green qPCR SuperMix UDG


AQ111-01 AQ111-02 AQ111-03 1 ml 51 ml 151 ml

Components
TransStart Green qPCR SuperMix UDG (2) Passive Reference Dye/PCR Enhancer (50)

Description
TransStart Green qPCR SuperMix UDG is a ready-to-use qPCR cocktail containing all components, except primers and template for real-time quantification PCR. It contains TransStart Taq DNA Polymerase, UDG, SYBR Green I, dNTPs, PCR enhancer, stabilizers. qPCR SuperMix is provided at 2 concentration and can be used at 1 concentration by adding template, primer, passive reference dye or PCR enhancer and H2O.
The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer. UDG is used to prevent DNA carry-over contamination.

Storage
at -20oC for one year in dark

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

High quality products


60

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Notes
Thaw completely and make homogeneous before use.

Reaction Components
Component Forward Primer (10 M) Reverse Primer (10 M) 2TransStart Green qPCR SuperMix UDG Passive Reference Dye/PCR Enhancer (50) Template ddH2O Total volume Volume 0.4 l 0.4 l 10 l 0.4 l x l Variable 20 l Final Concentration 0.2 M 0.2 M 1 1 as required -

Thermal cycling conditions (three-step)


50oC 2 min (UDG Incubation) 94oC 10 min (UDG Inactivation) 94oC 5 sec 50-60oC 15 sec* 40-45 cycles 72oC 10 sec Dissociation Stage

Thermal cycling conditions (two-step)


50oC 2 min (UDG lncubation) 94oC 10 min (UDG lnactivation) 94oC 5 sec 40-45 cycles 60oCsec* Dissociation Stage For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


61

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

TransStart Top Green qPCR SuperMix


AQ131-01 AQ131-02 AQ131-03 1 ml 51 ml 151 ml

Chapter 1

Components
TransStart Top Green qPCR SuperMix (2) Passive Reference Dye / PCR Enhancer (50)

Description
TransStart Top Green qPCR SuperMix is a ready-to-use qPCR cocktail containing all components, except primers and template for real-time quantification PCR. It contains TransStart TopTaq DNA Polymerase, SYBR Green I, dNTPs, PCR enhancer, stabilizers. qPCR SuperMix is provided at 2 concentration and can be used at 1 concentration by adding template, primer, passive reference dye or PCR enhancer and H2O. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Storage
at -20oC for one year in dark

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

PROTOCOL
Notes
It is recommended to use 10 pg-1 g genomic DNA or 10-107 copy plasmid DNA as templates. For optimized qPCR, amplicon size should be in the range of 80-250 bp.

Reaction Components
Component Forward Primer (10 M) Reverse Primer (10 M) 2TransStart Top Green qPCR SuperMix Passive Re ference Dye/PCR Enhancer (50) Template ddH2O Total volume Volume 0.4 l 0.4 l 10 l 0.4 l x l Variable 20 l Final Concentration 0.2 M 0.2 M 1 1 as required -

PCR condition is the same as for TransStart Green qPCR SuperMix (P60).

High quality products


62

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

TransScript Green Two-Step qRT-PCR SuperMix


AQ201-01 RT system / qPCR system 50 rxns20 l/300 rxns20 l

qPCR and qRT-PCR

PCR, RT-PCR,

Storage
at -20oC for one year in dark

Description
TransScript Green Two-Step qRT-PCR SuperMix contains all the necessary reagents for cDNA synthesis and qPCR. TransScript RT is provided for RT and TransScript Green qPCR SuperMix is provided for qPCR. Oligo(dT), random primers, or gene-specific primers can be used for the reverse transcription. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

Kit Components
Components 5TransScript All-in-One SuperMix for qPCR 5TransScrip t All-in-One No-RT Control SuperMix 20 l for qPCR TransStart Green qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50) RNase-free Water 31 ml 120 l 1 ml

AQ201-01 200 l

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


63

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

PROTOCOL
First Strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA 5TransScript All-in-one Supermix for qPCR RNase-free Water Volume 1 g / 100 ng 4 l to 20 l

Chapter 1

2Incubation Incubate at 42oC for 10 min. 3Incubate at 85oC for 5 min to inactive enzyme. Suggested reaction mixture set up and PCR condition are the same as for TransStar t Green qPCR SuperMix (P60).

TransScript II Green Two-Step qRT-PCR SuperMix


AQ301-01 RT system / qPCR system 50rxns20 l/300 rxns20 l

Storage
at -20 C for one year in dark
o

Description
TransScrip t II Green Two-Step qRT-PCR SuperMix contains all the necessary reagents for cDNA synthesis and qPCR. TransScrip t RT II is provided for RT and TransScrip t Green qPCR SuperMix is provided for qPCR. Oligo(dT), random primers, or gene-specific primers can be used for the reverse transcription. RT can be performed at 50oC. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

High quality products


64

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Kit Components
Components 5TransScript ll All-in-One SuperMix for qPCR 5TransScrip t II All-in-One No-RT Control SuperMix for qPCR TransStart Green qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50) RNase-free Water

AQ301-01 200 l 20 l 31 ml 120 l 1 ml

PROTOCOL
first strand cDNA synthesis
1Reaction Components
Component Total RNA/mRNA 5TransScript All-in-one Supermix for qPCR RNase-free Water Volume 1 g / 100 ng 4 l to 20 l

2Incubation Incubate at 50oC for 30 min. 3Incubate at 85oC for 5 min to inactive enzyme. Suggested reaction mixture set up and PCR condition are the same as for TransStart Green qPCR SuperMix (P60).

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


65

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

TransScript Green One-Step qRT-PCR SuperMix


AQ211-01 AQ211-02 100 rxns20 l system 400 rxns20 l system

Chapter 1

Storage
at -20oC for one year in dark

Description
TransScript Green One-Step qRT-PCR SuperMix contains all the necessary reagents for cDNA synthesis and qPCR. It contains TransScript reverse transcriptase and TransStart DNA polymerase. The SuperMix is optimized for one-step, one-tube RNA quantification. Reduced sample manipulation. High sensitivity and specificity. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/ Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50):Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

Kit Components
AQ211-01 TransScript One-Step RT/RI Enzyme Mix TransStart Green qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50) RNase-free Water

AQ211-02 160 l 4 x1 ml 160 l 4 ml

40 l 1 ml 40 l 1 ml

High quality products


66

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Reaction Components
Component RNA Template Forward GSP(10 M) Reverse GSP(10 M) 2TransStart Green qPCR SuperMix TransScript One-Step RT/RI Enzyme Mix Passive Reference Dye/PCR Enhancer (50) RNase-free Water Total volume

Volume Variable 0.4 l 0.4 l 10 l 0.4 l 0.4 l Variable 20 l

Final Concentration 1 pg-1 g 0.2 M 0.2 M 1 1 -

Thermal cycling conditions (three-step)


45oC 5 min 94oC 30 sec 94oC 5 sec 50-60oC 15 sec* 72oC 10 sec Dissociation Stage

40-45 cycles

Thermal cycling conditions (two-step)


45oC 5 min 94oC 30 sec 94oC 5 sec 60oC 30 sec* Dissociation Stage

40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


67

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

TransScript II Green One-Step qRT-PCR SuperMix


AQ311-01 AQ311-02 100 rxns20 l system 400 rxns20 l system

Chapter 1

Storage
at -20oC for one year in dark

Description
TransScrip t II Green One-Step qRT-PCR SuperMix contains all the necessary reagents for cDNA synthesis and qPCR. It contains TransScript II reverse transcriptase and TransStart DNA polymerase. The SuperMix is optimized for one-step, one-tube RNA quantification. Increased thermo-stability for higher specificity and higher cDNA yield. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

Kit Components
AQ311-01 TransScript II One-Step RT/RI Enzyme Mix TransStart Green qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50) RNase-free Water 40 l 1 ml 40 l 1 ml AQ311-02 160 l 4x1 ml 160 l 41 ml

High quality products


68

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

PROTOCOL
Reaction Components
Component RNA Template Forward GSP(10 M) Reverse GSP(10 M) 2TransStart Green qPCR SuperMix TransScript II One-Step RT/RI Enzyme Mix Passive Reference Dye/PCR Enhancer (50) RNase-free Water Total volume

Volume Variable 0.4 l 0.4 l 10 l 0.4 l 0.4 l Variable 20 l

Final Concentration 1 pg-1 g 0.2 M 0.2 M 1 1 -

Thermal cycling conditions (three-step)


50oC 5 min 94oC 30 sec 94oC 5 sec 50-60oC 15 sec* 72oC 10 sec Dissociation Stage

40-45 cycles

Thermal cycling conditions (two-step)


50oC 5 min 94oC 30 sec 94oC 5 sec 60oC 30 sec* Dissociation Stage

40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


69

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

TransStart Probe qPCR SuperMix


AQ401-01 AQ401-02 AQ401-03 1 ml 51 ml 151 ml

Chapter 1

Components
TransStart Probe qPCR SuperMix (2) Passive Reference Dye/PCR Enhancer (50)

Description
TransStar t Probe qPCR SuperMix is a ready-to-use qPCR cocktail containing all components, except primers and template for real time quantification PCR. It contains TransStar t Taq DNA Polymerase, dNTPs, PCR enhancer, stabilizers. qPCR SuperMix is provided at 2 concentration can be used at 1 concentration by adding template, primer, probe, passive reference dye or PCR enhancer and H2O. The kit can be used with a variety of real-time PCR instruments by using instrument specific passive reference dyes or instrument specific enhancer.

Storage
at -20oC for one year

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

PROTOCOL
Reaction Components
Component Forward Primer (10 M) Reverse Primer (10 M) Probe (10 M) 2TransStart Probe qPCR SuperMix Passive Reference Dye/PCR Enhancer(50) Template ddH2O Total volume Volume 0.4 l 0.4 l 0.4 l 10 l 0.4 l Variable Variable 20 l Final Concentration 0.2 M 0.2 M 0.2 M 1 1 as required -

High quality products


70

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Thermal cycling conditions (three-step)


94oC 94oC 50-60oC 72oC 30 sec 5 sec 15 sec* 10 sec

40-45 cycles

Thermal cycling conditions (two-step)


94oC 94oC 60oC 30 sec 5 sec 30 sec* 40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


71

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

TransScript Probe One-Step qRT-PCR SuperMix


AQ221-01 AQ221-02 100 rxns20 l system 400 rxns20 l system

Chapter 1

Storage
at -20oC for one year

Description
TransScript Probe One-Step qRT-PCR SuperMix is a one-step RTPCR kit. cDNA synthesis and PCR are performed in a single tube using gene-specific primers with total RNA or mRNA.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

Kit Components
AQ221-01 TransScript One-Step RT/RI Enzyme Mix TransStart Probe qPCR SuperMix(2) Passive Reference Dye/PCR Enhancer(50) RNase-free Water

AQ221-02 160 l 4x1 ml 160 l 4 ml

40 l 1 ml 40 l 1 ml

PROTOCOL
Reaction Components
Component Forward GSP (10 M) Reverse GSP (10 M) Probe (10 M) 2TransStart Probe qPCR SuperMix TransScript Probe One-Step RT/RI Enzyme Mix Passive Reference Dye or PCR Enhancer(50) RNA Template RNase-free Water Total volume

Volume 0.4 l 0.4 l 0.4 l 10 l 0.4 l 0.4 l Variable Variable 25 l

Final Concentration 0.2 M 0.2 M 0.2 M 1 1 1pg~1g -

High quality products


72

Chapter 1

qPCR and qRT-PCR SuperMix

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Thermal cycling conditions (three-step)


45oC 94oC 94oC 50-60oC 72oC 5 min 30 sec 5 sec 15 sec* 10 sec

40-45 cycles

Thermal cycling conditions (two-step)


45oC 94oC 94oC 60oC 5 min 30 sec 5 sec 30 sec*

40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

TransScript II Probe One-Step qRT-PCR SuperMix


AQ321-01 AQ321-02 100 rxns20 l system 400 rxns20 l system

Storage
at -20 Cfor one year
o

Description
TransScript II Probe One-Step qRT-PCR SuperMix is a one-step RTPCR kit. cDNA synthesis and PCR are performed in a single tube using gene-specific primers with total RNA or mRNA.

Passive Reference Dye/Enhancer


Passive Reference Dye I (50): ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One, ABI Step One Plus. Passive Reference Dye II (50): ABI Prism7500, ABI Prism7500 Fast, Stratagene Mx3000/Mx3005P, MJ Research Chromo4, Opticon (II), Corbett Rotor Gene 3000. Passive Reference Dye III (50): Bio-Rad iCycler iQ, iQTM 5. PCR Enhancer (50): Roche Light Cycler480. No Passive Reference Dye: Corbett Rotor Gene 6000, Bio-Rad CFX96.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


73

qPCR and qRT-PCR

PCR, RT-PCR,

Chapter 1

qPCR and qRT-PCR SuperMix

Kit Components
AQ321-01 AQ321-02 160 l 4x1 ml 160 l 41 ml TransScript II One-Step RT/RI Enzyme Mix TransStart Probe qPCR SuperMix(2) Passive Reference Dye/PCR Enhancer(50) RNase-free Water

Chapter 1

40 l 1 ml 40 l 1 ml

PROTOCOL
Reaction Components
Component Forward GSP (10 M) Reverse GSP (10 M) Probe (10 M) 2TransStart Probe qPCR SuperMix TransScript II One-Step RT/RI Enzyme Mix Passive Reference Dye or PCR Enhancer(50) RNA Template RNase-free Water Total volume

Volume 0.4 l 0.4 l 0.4 l 10 l 0.4 l 0.4 l Variable Variable 20 l

Final Concentration 0.2 M 0.2 M 0.2 M 1 1 1pg~1g -

Thermal cycling conditions (three-step)


50oC 94oC 94oC 50-60oC 72oC 5 min 30 sec 5 sec 15 sec* 10 sec

40-45 cycles

Thermal cycling conditions (two-step)


50oC 94oC 94oC 60oC 5 min 30 sec 5 sec 30 sec*

40-45 cycles

For ABI Prism7700/7900, the extension time is 30 sec. For ABI Prism7000/7300, the extension time is 31 sec. For ABI Prism7500, extension time is 34 sec. Two-step method is suitable for high specific qPCR. Three-step method is suitable for high efficiency qPCR.

High quality products


74

Chapter 1

High Purity dNTPs

Chapter 1

qPCR and qRT-PCR

PCR, RT-PCR,

Hight Purity dNTPs

2.5 mM each 10 mM each

AD101-01 AD101-02 AD101-11 AD101-12

1 ml 51 ml 1 ml 51 ml

Storage
at -20 C for two years
o

Description
Hight Purity dNTPs is an equal molar solution of high quality dATP, dCTP, dGTP, and dTTP. Suitable for routine and long PCR, DNA sequencing, and cDNA synthesis.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


75

Chapter 2 DNA Molecular Weight Standards


Trans2K DNA Marker 078 Trans2K Plus DNA Marker 078 Trans2K Plus II DNA Marker 078 Trans4K DNA Marker 079 Trans5K DNA Marker 079 Trans8K DNA Marker 079 Trans15K DNA Marker 080 1Kb DNA Ladder 080 1Kb Plus DNA Ladder 080 100bp DNA Ladder 081 100bp Plus DNA Ladder 081 100bp Plus II DNA Ladder 081 Trans DNA Marker I 082 Trans DNA Marker II 082

DNA Marker

Chapter 2

TransGen provides a wide range of double-stranded DNA molecular weight markers for conventional electrophoresis. All DNA Markers are completely digested plasmid. DNA markers are in ready-to-load format.

DNA Marker Selection Guide


DNA Marker Trans2K DNA Marker Trans2K Plus DNA Marker Trans2K Plus II DNA Marker Trans4K DNA Marker Trans5K DNA Marker Trans8K DNA Marker Trans15K DNA Marker
Trans2K DNA Marker

Agarose 1.5% 1.5% 1.5% 1.5% 1.5% 1.0% 0.8%

DNA Marker 1Kb DNA Ladder 1Kb Plus DNA Ladder 100bp DNA Ladder 100bp Plus DNA Ladder 100bp Plus II DNA Ladder TransDNA Marker I Trans DNA Marker II
Trans4K DNA Marker
(bp) 4000

Agarose 1.0% 1.0% 2.0% 2.0% 2.0% 2.0% 2.0%


Trans5K DNA Marker
(bp) 5000 3000

Chapter 2

Trans2K Plus DNA Marker

Trans2KPlus II DNA Marker


(bp) 8000 5000 3000 2000

DNA Marker

(bp) 5000 (bp) 2000 3000 2000

2000 1500

2000 1500 1000

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1000 800 500 300


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

800 500 300


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Trans8K DNA Marker

Trans15K DNA Marker


(bp) 15000 10000 7500 5000 3000

1Kb DNA Ladder


(bp) 10000 8000 6000 5000 4000 3000 2000

1Kb Plus DNA Ladder


(bp) 10000 8000 6000 5000 4000 3000 2000 1500 1000 800

100bp DNA Ladder

(bp) 8000 5000 3000 1500 1000 500

(bp) 1500 1000 800 600 500 400 300 200 100
2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

900 700

1500 1000 1000 500

500 300

1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

0.8% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

100bp Plus DNA Ladder


(bp) 5000 3000 2000 1500 1000 800 600 700 900

100bp Plus II DNA Ladder

Trans DNA Marker I


DNA MASS(5 l)
(bp) (ng)

Trans DNA Marker II


DNA MASS(5 l) (bp) (ng)
1500 90 900 90 700 70 500 125 400 40 200 40

(bp) 1500 1200 1000 900 700 500 300 200 100
2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

700 70 600 60 500 50 400 40

800 600 400

300 30 200 40

400 500 200 100 300

100 60

100 60

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


77

Chapter 2

DNA Marker

Trans2K DNA Marker

BM101-01 BM101-02
Trans2K DNA Marker

500 l 5500 l

Concentration
0.07 mg/ml
(bp) 2000

Band Size

DNA Marker

100 bp, 250 bp, 500 bp, 750 bp (100 ng/5 l, double intensity ) 1000 bp, 2000 bp.

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Storage
at 4oC for six months; -20oC for two years

Chapter 2

Trans2K Plus DNA Marker

BM111-01 BM111-02
Trans2K Plus DNA Marker

500 l 5500 l

Concentration
0.09 mg/ml

(bp) 5000 3000 2000

Band Size
100 bp, 250 bp, 500 bp, 750 bp (100 ng/5 l, double intensity ) 1000 bp, 2000 bp, 3000 bp, 5000 bp.

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Storage
at 4 C for six months; -20 C for two years
o o

Trans2K Plus II DNA Marker

BM121-01 BM121-02

500 l 5500 l

Trans2K Plus II DNA Marker


(bp)

Concentration
0.10 mg/ml

8000 5000 3000 2000

Band Size
100 bp, 250 bp, 500 bp, 750 bp (100 ng/5 l, double intensity ) 1000 bp, 2000 bp, 3000 bp, 5000 bp, 8000 bp.

1000 750 500 250 100


1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Storage
at 4oC for six months; -20oC for two years

High quality products


78

DNA Marker

Chapter 2

Trans4K DNA Marker

BM131-01 BM131-02

500 l 5500 l

Trans4K DNA Marker


(bp) 4000

Concentration
0.083 mg/ml
2000

Chapter 2

Band Size
300 bp, 500 bp, 800 bp, 1000 bp, 1500 bp, 2000 bp, 4000 bp.

1500 1000 800 500


o

Storage
at 4 C for six months; -20 C for two years
o

300

1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

DNA Marker

Trans5K DNA Marker

BM141-01 BM141-02

500 l 5500 l

Trans5K DNA Marker


(bp) 5000 3000

Concentration
0.095 mg/ml

2000 1500 1000 800 500 300

Band Size
300 bp, 500 bp, 800 bp, 1000 bp, 1500 bp, 2000 bp, 3000 bp, 5000 bp.

Storage
at 4oC for six months; -20oC for two years

1.5% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Trans8K DNA Marker

BM151-01 BM151-02
Trans8K DNA Marker

500 l 5500 l

(bp)

Concentration
0.07 mg/ml

8000 5000 3000 1500 1000

Band Size
500 bp, 1000 bp, 1500 bp, 3000 bp, 5000 bp, 8000 bp.

Storage
at 4oC for six months; -20oC for two years

500

1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


79

Chapter 2

DNA Marker

Trans15K DNA Marker

BM161-01 BM161-02

500 l 5500 l

Trans15K DNA Marker


(bp) 15000 10000 7500 5000 3000

Concentration
0.09 mg/ml

DNA Marker

Band Size
500 bp, 1000 bp, 1500 bp, 3000 bp, 5000 bp, 7500 bp, 10000 bp, 15000 bp.

1500 1000

Storage
at 4 C for six months; -20 C for two years
o o

500

Chapter 2

0.8% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1Kb DNA Ladder

BM201-01 BM201-02

500 l 5500 l

1Kb DNA Ladder


(bp) 10000 8000

Concentration
0.09 mg/ml

6000 5000 4000 3000 2000

Band Size
1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, 6000 bp, 8000 bp, 10000 bp.

Storage
at 4oC for six months; -20oC for two years
1000

1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

1Kb Plus DNA Ladder

BM211-01 BM211-02

500 l 5500 l

1Kb Plus DNA Ladder


(bp) 10000 8000 6000 5000 4000 3000 2000 1500 1000 800 500
o

Concentration
0.13 mg/ml

Band Size
300 bp, 500 bp, 800 bp, 1000 bp, 1500 bp, 2000 bp,3000 bp, 4000 bp, 5000 bp, 6000 bp, 8000 bp, 10000 bp.

Storage
at 4 C for six months; -20 C for two years
o

300
1.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

High quality products


80

DNA Marker

Chapter 2

100bp DNA Ladder

BM301-01 BM301-02

500 l 5500 l

100bp DNA Ladder

Concentration
0.12 mg/ml

Band Size
100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1500 bp.

(bp) 1500

Chapter 2

1000 800 600 500 400 300 200 100

900 700

Storage
at 4oC for six months; -20oC for two years

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

DNA Marker

100bp Plus DNA Ladder

BM311-01 BM311-02

500 l 5500 l

100bp Plus DNA Ladder


(bp) 5000 3000 2000 1500 1000 800 600 700 900

Concentration
0.15 mg/ml

Band Size
100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1500 bp, 2000 bp, 3000 bp, 5000 bp.

400 500 200 100 300

Storage
at 4oC for six months; -20oC for two years

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

100bp Plus II DNA Ladder

BM321-01 BM321-02

500 l 5500 l

100bp Plus II DNA Ladder

Concentration
0.13 mg/ml

(bp) 1500 1200 1000 900 700 500 300 200 100 800 600 400

Band Size
100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1200 bp, 1500 bp.

Storage
at 4oC for six months; -20oC for two years

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


81

Chapter 2

DNA Marker

TransDNA Marker I
Concentration
0.07 mg/ml

BM401-01 BM401-02

500 l 5500 l
Trans DNA Marker I
DNA MASS(5 l)
(bp) (ng)

Band Size

700 70 600 60 500 50 400 40 300 30 200 40

DNA Marker

100 bp (60 ng), 200 bp (40 ng), 300 bp (30 ng), 400 bp (40 ng), 500 bp (50 ng), 600 bp (60 ng), 700 bp (70 ng), 700 bp is lightest.

Storage
at 4oC for six months; -20oC for two years

100 60

Chapter 2

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

Trans DNA Marker II

BM411-01 BM411-02

500 l 5500 l
Trans DNA Marker II

Concentration
0.103 mg/ml

DNA MASS(5 l) (bp) (ng)


1500 90 900 90 700 70 500 125 400 40 200 40 100 60

Band Size
100 bp (60 ng), 200 bp (40 ng), 400 bp (40 ng), 500 bp (125 ng), 700 bp (70 ng), 900 bp (90 ng), 1500 bp (90 ng), 500 bp is lightest.

Storage
at 4oC for six months; -20oC for two years

2.0% TAE agarose gel stained with ethidium bromide (loading volume: 5 l)

High quality products


82

Chapter 3 Cloning and Mutagenesis System


pEASY Cloning Vector

pEASY -T1 Cloning Kit 086 pEASY -T1 Simple Cloning Kit 089 pEASY -T3 Cloning Kit 090 pEASY -T5 Zero Cloning Kit 091 pEASY -Blunt Cloning Kit 092 pEASY -Blunt Simple Cloning Kit 093 pEASY -Blunt Zero Cloning Kit 094

Cloning Competent Cells


Trans10 Chemically Competent Cells095 Trans5 Chemically Competent Cells095 Trans109 Chemically Competent Cells 096 Trans110 Chemically Competent Cells 096 Trans1-Blue Chemically Competent Cells 096 Trans2-Blue Chemically Competent Cells 097 Trans1-T1 Phage Resistant Chemically Competent Cells 097 DMT Chemically Competent Cells097

Mutagenesis System

Easy Mutagenesis System Fast Mutagenesis System

098 099

Chapter 3

Cloning Vector

pEASY -T1 3928 bp

pEASY 38

pEASY -T1 3928 bp

pEASY -T1 3928 bp

pEASY -T1 Simple pEAS Y -T1 Simple pEASY -Blunt 3829 bp 3829 bp
3929 bp

pEASY -T3 3039 bp

pEASY -Blunt Simple 3830 bp

Pme I

Spe I

T3

Spe I

Pme I

Pst I

Not I

T3

T7

pEASY -Blunt 3929 bp

pEASY -Blunt 3929 bp

pEASY -Blunt Simple 3830 bp

pEASY -Blunt Simple 3830 bp

pEASY -E1 (5715 bp)

pEASY -E1 (5715 bp)

mple

pEASY -T3 pEASY -T1 3039 bp

pEASY -Blunt Zero 3954 bp

pEASY - M1 (5437 bp)

3928 bp

pEASY -T1 3928 bp


Pme I Spe I Not I Spe I Pst I
T3 T3

pEAS Y -T5 Zero pEASY -T1 Simple pEASY -T1 Simple 3953 bp 3829 bp 3829 bp
Pme I Not I Pst I

Not I

Pst I

&09

V5 epito

Pme I

Cloning and Mutagenesis System

Spe I

Not I Spe I

Pme I

Pst I

Pst I

T3

T3

T7

Not I

&09

myc epito

T7

&09

V5 epitope

stop

V5epitope

pEASY -Blunt Zero 3954 bp

pEASY -Blunt Zero 3954 bp

pEASY -E1 (5715 bp)

Chapter 3

(5437 bp) pEASY -Blunt 3929 bp

pEASY -T5 Zero pEASY -T5 Zero 3953 bp 3953 bp pEASY - M1


pEASY -Blunt 3929 bp pEASY -Blunt Simple 3830 bp

pEASY -E2 (5393 bp)

pEASY -E2 (5393 bp)

pEASY - M2 (5425 bp)

pEASY -Blunt Simple 3830 bp

pEASY -E1 (5715 bp)

pEASY (5715 bp

Pme I

Pme I

Spe I

Not I Spe I

Pst I

T3

T3

Pme I

Not II Spe

Pme I

Spe I

Pst I

Pst I

T3

T3
Not I

T7

Not I

T7

pEASY -E2 (5393 bp)

T3

pEASY - M2 (5425 bp)

Pme I

Spe I

Pst I

pEASY -Blunt Zero 3954 bp

pEASY -Blunt Zero 3954 bp

pEASY -T5 Zero 3953 bp

pEASY -Blunt Zero 3954 bp

Not I

Pst I

&09

myc epitope

stop

pEASY -T5 Zero 3953 bp

pEASY -E2 (5393 bp)

pEASY (5393

High quality products


84

Cloning Vector

Chapter 3

pEASY cloning vectors (MCS=multi-cloning site)


Amp+ pEASY -T1 pEASY -T1 Simple + Kan+ + In vitro transcription T7 Promoter Sequencing primer M13FM13R T7 Promoter M13FM13R T7 Promoter M13FM13R T7 Promoter SP6 Promoter Characteristics Dual resistance; MCS Application TA cloning

T7 Promoter

Dual resistance;No MCS

TA cloning

pEASY -T3

T7/SP6 Promoter

Dual EcoRI, Dual NotI restriction enzyme cut sites

TA cloning

pEASY -T5 Zero

T3/T7 Promoter

M13FM13R M13FM13R T7 Promoter M13FM13R T7 Promoter

Dual resistance; Zero background;

TA cloning

pEASY -Blunt

T7 Promoter

Dual resistance; MCS

Blunt cloning

pEASY -Blunt Simple

T7 Promoter

Dual resistance; No MCS

Blunt cloning

pEASY -Blunt Zero

T3/T7 Promoter

M13FM13R

Dual resistance; Zero background;

Blunt cloning

Chapter 3

General Notes for pEASY Vectors

Do not add 5 phosphorylated group to the PCR primers. PCR products with 5 phosphorylated group will not be cloned into pEASY vector. Choose the right PCR enzymes for TA cloning or blunt cloning. To ligate diluted PCR products, increase the amount of PCR products or concentrate the PCR products. For cloning PCR products with multi-bands, gel purify the products before ligation. Cloning reaction time can not be greater than 30 minutes.

Cloning and Mutagenesis System

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


85

Chapter 3

Cloning Vector

pEASY -T1 Cloning Kit


Dual resistance, Fast Cloning
CT101-01 CT101-02 20 rxns 60 rxns

Storage
Trans 1 - T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months.

Kit Components
CT101-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 100 l10 CT101-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 100 l30

pEASY - T1 Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13F (10 M) M13R (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEASY -T1 Cloning Vector suitable for TA cloning. pEASY -T1 Cloning Kit is designed for cloning and sequencing Taq amplified PCR products. pEASY -T1 Cloning Kit includes:

Cloning and Mutagenesis System

3-T overhangs for fast ligation of Taq-amplified PCR products. Kanamycin and Ampicillin resistance genes for your choice of selection. Easy blue/white selection. Multi-cloning site. T7 promoter , M13 forward and M13 reverse primers for sequencing. T7 promoter for in vitro transcription. High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.
LacZ fragment: bases 1-547 M13 reverse priming site: bases 205-221 Multiple cloning site: bases 234-357 T7 promoter priming site: bases 361-380 M13 forward priming site: bases 387-403 f1 origin: bases 545-982 pEASY -T1 Simple Kanamycin resistance ORF: 3829 bp bases 1316-2110 Ampicillin resistance ORF: bases 2128-2988 pUC origin: bases 3133-3806

Chapter 3

pEASY -T1 Cloning Vector Map


pEASY -T1 3928 bp

M13 Reverse Primer

Hind III

Kpn I

Sac I

BamH I

Spe I

Bst X I

CAG GAA ACA GCT ATG ACC ATG ATT ACG CCA AGC TTG GTA CCG AGC TCG GAT CCA CTA GTA ACG GCC GCC AGT GTG CTG GAA TTG GTC CTT TGT CGA TAC TGG TAC TAA TGC TGT TCG AAC CAT GGC TCG AGC CTA GGT GAT CAT TGC CGG CGG TCA CAC GAC CTT AAC
Eco R V Bst X I Not I Xho I Nsi I Xba I Apa I

CCC TT GGG AA

PCR Product

pEASY -Blunt pEASY -Blunt Simple AA GGG CAA TTC TGC AGA 3929 bp TAT CCA TCA CAC TGG CGG CCG CTC GAG CAT GCA TCT AGA GGG CCC AAT 3830 bp TT CCC GTT AAG ACG TCT ATA GGT AGT GTG ACC GCC GGC GAG CTC GTA CGT AGA TCT CCC GGG TTA
M13 Forward Primer

pEASY -E1 (5715 bp)

T7 Promoter

TCG CCC TAT AGT GAG TCG TAT TAC AAT TCA CTG GCC GTC GTT TTA CAA CGT CGT GAC TGG GAA AAC AGC GGG ATA TCA CTC AGC ATA ATG TTA AGT GAC CGG CAG CAA AAT GTT GCA GCA CTG ACC CTT TTG
Pme I Spe I

Spe I

Pme I

Pst I

Not I

High quality products


R T3 T7 F

T3

86
pEASY -Blunt Zero 3954 bp
pEASY -E2 (5393 bp)

Not I

Pst I

Cloning Vector

Chapter 3

PROTOCOL
Suggested cloning reaction condition
1. Optimized volume of insert Molar ratio of vector to fragment = 1:7 2. Optimized volume of vector : 1 l 3. Optimized reaction volume is about 3~5 l. 4. The optimized incubation time: (1) 0.1~1 kb (including 1 kb): 5~10min. (2) 1~2 kb (including 2 kb): 10~15min. (3) 2~3 kb (including 3 kb): 15~20min. 5. Optimized temperature: for most PCR insert, the optimized reaction temperature is about 25oC; for some PCR inserts, optimized results can be achieved with higher temperature (up to 37oC).

Transformation
1. Add 2-4 l of the ligated products to 50 l of Trans1-T1 Competent Cells and mix gently ( Do not mix by pipetting up and down). 2. Incubate on ice for 20-30 minutes. 3. Heat-shock the cells for 30 seconds at 42oC. 4. Immediately place the tubes on ice. 5. Add 250 l of room temperature SOC or LB medium. Shake the tubes at 37oC (200 rmp) for 1 hour. 6. In the meantime, mix 8 l of 500 mM IPTG with 40 l of 20 mg/ml X-gal. Spread them evenly onto a LB plates. Place the plate at 37oC for 30 minutes. 7. Spread 10-200 l transformant on the prewarmed plate. Incubate overnight at 37oC.

Chapter 3
Cloning and Mutagenesis System

Analyze Positive Clones by Colony PCR


1. Transfer 2-6 white or light blue colonies into 10 l dH2O. 2. Use 1 l of the mixture as template for 25 l. PCR using M13 forward and M13 reverse primers. 3. PCR Conditions: 94oC 10 min 94oC 55oC 72oC 30 sec 30 sec x min* 30 cycles

* (depends on the insert length and PCR enzymes) the PCR product size for vector only is 199 bp.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


87

Chapter 3

Cloning Vector

PCR for control insert (700 bp)


Components Control Template Control Primers (10 M) 10EasyTaq Buffer (withMg ) 2.5 mM dNTPs

Volume Variable 1 l
2+

Final Concentration <0.5 g 0.2 M 1 0.2 mM 2.5 units -

5 l 4 l 0.5 l Variable 50 l

EasyTaq DNA Polymerase


ddH2O Total volume

Thermal cycling conditions for control insert


94oC 94oC 55oC 72oC 72oC 2-5 min 30 sec 30 sec 1 min 10 min

30 cycles

Ligate 1 l of control PCR insert to 1 l vector. Hundreds of colonies should be produced with efficiency over 90%.

Chapter 3

Cloning and Mutagenesis System

High quality products


88

Cloning Vector

Chapter 3

pEASY -T1 Simple Cloning Kit


CT111-01 CT111-02 20 rxns 60 rxns

Storage
Trans 1-T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months.

Kit Components
CT111-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 50 l 100 l x 10 CT111-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 150 l 100 l x 30

pEASY - T1 Simple Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13F (10 M) M13R (10 M) SR Primer (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEASY -T1 Simple Cloning vector eliminates the multi-cloning sites of pEASY -T1 Cloning vector. It is designed for cloning and sequencing Taq amplified PCR products. pEASY -T1 Simple Cloning Kit includes: 3-T overhangs for fast ligation of Taq-amplified PCR products. Kanamycin and Ampicillin resistance genes for your choice of selection. Easy blue/white selection. SR Primer and M13 forward Primer for sequencing. T7 promoter for in vitro transcription. High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.
LacZ fragment: bases 1-448
M13 reverse priming site: bases 205-221 T7 promoter priming site: bases 262-281 M13 forward priming site: bases 288-304

Chapter 3
Cloning and Mutagenesis System

pEASY-T1 Simple
pEASY -T1 Cloning 3928 bp

Vector Map

pEASY -T1 Simple 3829 bp

Y -T3 f1 origin: basespEAS 446-883 3039 bp Kanamycin resistance ORF: bases 1217-2011
Ampicillin resistance ORF: bases 2029-2889 pUC origin: bases 3034-3707

SR Primer

M13 Reverse Primer


stop
V5epitope

CAG GCT TTA CAC TTT ATG CTT CCG GCT CGT ATG TTG TGT GGA ATT GTG AGC GGA TAA CAA TTT CAC ACA GGA AAC AGC TAT GAC CAT GAT TAC GCC AAG CTG &09 CGG TTC GAC V5 epitope GTC CGA AAT GTG AAA TAC GAA GGC CGA GCA TAC AAC ACA CCT TAA CAC TCG CCT ATT GTT AAA GTG T GT CCT TTG TCG ATA CTG GTA CTA ATG
T7 Promoter M13 Forward Primer

CCC TT GGG AA

PCR Product

AA GGG CAG CTT CAA TTC GCC CTA TAG TGA GTC GTA TTA C AA TTC ACT GGC CGT CGT TTT AC A ACG TCG TGA CTG GGA AAA C TT CCC GTC GAA GTT AAG CGG GAT ATC ACT CAG CAT AAT GTT AAG TGA CCG GCA GCA AAA TG T TGC AGC ACT GAC CCT TTT G

pEASY -Blunt 3929 bp

pEASY -Blunt Simple 3830 bp

pEASY -E1 (5715 bp)

pEASY - M1 (5437 bp)

PROTOCOL
Pme I Spe I Not I Pst I

General protocols for cloning, transformation, confirmation are the same as given in P85, except the PCR product size for vector only is 100 bp.
T3

Spe I

Pme I

Pst I

Not I

&09

myc epitope

stop

T3

T7

Order: 0086-010-51296890
pEASY -Blunt Zero 3954 bp

Hot line: 0086-400-898-0321


pEASY -E2 (5393 bp) pEASY - M2 (5425 bp)

89

pEASY -T5 Zero 3953 bp

Chapter 3

Cloning Vector

pEASY -T3 Cloning Kit


Storage
Trans 1-T1 Phage Resistant Chemically C o m p e t e n t C e l l s a t - 7 0 oC f o r s i x months; others at -20oCfor six months

CT301-01 CT301-02

20 rxns 60 rxns

Kit Components
CT301-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 100 l x 10 CT301-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 100 l x 30

pEASY -T3 Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13F (10 M) M13R (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEAS Y -T3 Cloning Vector provides dual- EcoR I and dual- Not I enzyme digestion site, convenient for enzyme digestion. Application to TA cloning. pEASY -T3 Cloning Kit includes: 3-T overhangs for fast ligation of Taq-amplified PCR products. Ampicillin resistance genes for your choice of selection. Easy blue/white selection. Multi-cloning site. T7 promoter,SP6 promoter M13 forward and M13 reverse primers for sequencing. T7 promoter for in vitro transcription. High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.
Lac operon sequence: bases 2857-3017,187-416 Multiple cloning site: bases 10-149 SP6 priming site: bases 160-179 M13 reverse priming site: bases 197-213 LacZ start codon: bases 201 Lac operator: bases 221-237 Ampicillin resistance ORF: bases 1358-2218 f1 origin: bases 2401-2856 M13 forward priming site: bases 2997-3013 T7 promoter priming site: bases 3020-3

Chapter 3

Cloning and Mutagenesis System

pEASY -T3 Vector Map


pEASY -T3 3039 bp

pEASY -T1 Simple Cloning 3829 bp

Bst Z I
M13 Forward Primer T7 Promoter

Apa I

Aat II

Sph I

Bst Z I

Nco I

Not I

Sac II

GTA AAA CGA CGG CCA GT TGT AAT ACG ACT CAC TAT AGG GCG AAT TGG GCC CGA CGT CGC ATG CTC CCG GCC GCC ATG GCG GCC GCG G V5epitope &09 CGC TTA ACC V5 epitope stop GCA GCG TAC GAG CAT TTT GCT GCC GGTCA ACA TTA TGC TGA GTG ATA TCC CGG GCT GGC CGG CGG TAC CGC CGG CGC C
Eco R I Spe I Eco R I Bst Z I

Not I GAA TTC GAT TGG ATC GCC CTT AAG GGC GAT CCC AAT CAC TAG TGA ATT CGC GGC CGC PCR Product CTT AAG CTA ACC TAG CGG GAA TTC CCG CTA GGG TTA GTG ATC ACT TAA GCG CCG GCG

3830 bp

Y -Blunt Simple
Pst I Sal I

pEASY -E1 (5715 bp)


Nde I

Sac I

Bst X I

pEASY - M1 (5437 bp)


Nsi I

SP6 Promoter

M13 Reverse Primer

CTG CAG GTC GAC CAT ATG GGA GAG CTC CCA ACG CGT TGG ATG CAT AGC TTG AGT ATT CTA TAG TGT CAC CTA AAT GTC ATA GCT GTT TCC TG GAC GTC CAG CTG GTA TAC CCT CTC GA G GGT TGC GCA ACC TAC GTA TCG AAC TCA TAA GAT ATC ACA GTG GAT TTA CAG TAT CGA CAA AGG AC

PROTOCOL
Not I

General protocols for cloning, transformation, confirmation are the same as given in P87, except the PCR product size for &09 myc epitope stop vector only is 253 bp.

High quality products


90
pEASY -E2 (5393 bp) pEASY - M2 (5425 bp)

-Blunt Zero 954 bp

Cloning Vector

Chapter 3

pEASY -T5 Zero Cloning Kit


CT501-01 CT501-02 20 rxns 60 rxns

Storage
Trans 1-T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months

Kit Components
CT501-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 100 l x 10 CT501-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 100 l x 30

pEASY -T5 Zero Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13 F (10 M) M13 R (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEASY -T5 Zero Cloning Vector contains a suicide gene. Ligation of PCR fragment disrupts this expression of the gene. Cells that contain non-recombinant vector are killed upon plating. Therefore, blue/white screening is not required. Fast cloning (5 minutes). High cloning efficiency. Positive rate close to 100%. Almost zero background. No blue/white selection needed. Suitable for larger franment cloning. Kanamycin and ampicillin resistance genes for choice of selection.
Pme I Spe I Pst I Not I
R T3 T7 F

Chapter 3
Cloning and Mutagenesis System

pEASY -T5 Zero 3953 bp

LacZ fragment: bases 217-807 M13 reverse priming site: bases 205-221 T7 promoter priming site: bases 325-344 M13 Forward priming site: bases 351-367 Kanamycin resistance ORF: bases 1156-1950 Ampicillin resistance ORF: bases 2200-3060 pUC origin: bases 3158-3831

pEASY -T5 Cloning Vector Map


M13 Reverse Primer T3 Promoter

Spe I

Pst I

Pme I

TTC ACA CAG GAA ACA GCT ATG ACC ATG ATT ACG CCA AGC T CA GAA TTA ACC CTC ACT AAA GGG ACT AGT CCT GCA GGT TTA AAC AAG TGT GTC CTT TGT CGA TAC TGG TAC TAA TGC GGT TCG AGT CTT AAT TGG GAG TGA TTT CCC TGA TCA GGA CGT CCA AAT TTG
Not I

T7 Promoter

GAA TTG CCC TT CTT AAC GGG AA

PCR Product

AA GGG CAA TTC TT CCC GTT AAG

GCG GCC GCT AAA TTC AAT TCG CCC TAT AGT GAG TCG TAT TAC AAT TC CGC CGG CGA TTT AAG TTA AGC GGG ATA TCA CTC AGC ATA ATG TTA AG

M13 Forward Primer

A CTG GCC GTC GTT TTA CAA T GAC CGG CAG CAA AAT GTT

PROTOCOL
General protocols for cloning, transformation, confirmation are the same as given in P85.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


91

Chapter 3

Cloning Vector

pEASY -Blunt Cloning Kit


Storage
Trans 1-T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months

CB101-01 CB101-02

20 rxns 60 rxns

Kit Components
CB101-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 100 l x 10 CB101-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 100 l x 30

pEASY - Blunt Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13F (10 M) M13R (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEASY - Blunt Cloning Kit is designed for cloning and sequencing Pfu amplified PCR products. pEASY - Blunt Cloning Kit includes: Blunt-end vector for direct ligation of Pfu-amplified PCR products. Kanamycin and Ampicillin resistance genes for your choice of selection.

Cloning and Mutagenesis System

Easy blue/white selection. Multi-cloning site.


pEASY -T1 pEASY -T1 Simple 3928 bp , M13 forward and M13 reverse primers T7 promoter for sequencing. 3829 bp

T7 promoter for in vitro transcription. High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.
LacZ fragment: bases 1-548 Multiple cloning site: bases 234-358 M13 reverse priming site: bases 205-221 T7 promoter priming site: bases 362-381 M13 forward priming site: bases 388-404 f1 origin: bases 546-983 Kanamycin resistance ORF: bases 1317-2111 pEAS Y -Blunt Simple Ampicillin resistance ORF: bases 2129-2989 3830 bp pUC origin: bases 3134-3807

Chapter 3

pEASY -Blunt Cloning Vector Map


pEASY -Blunt 3929 bp

pEAS (571

M13 Reverse Primer

Hind III

Kpn I

Sac I

Bam H I

Spe I

Bst X I

CAG GAA ACA GCT ATG ACC ATG ATT ACG CCA AGC TTG GTA CCG AGC TCG GAT CCA CTA GTA ACG GCC GCC AGT GTG CTG GAA TTG T3 TGC CGG CGG TCA CAC GAC CTT AAC GTC CTT TGT CGA TAC TGG TAC TAA TGC TGT TCG AAC CAT GGC TCG AGC CTA GGT GAT CAT

Pme I

Spe I

Pme I

Spe I

Not I

Pst I

F T7 R T3 CCC TT AA GGG CAA TTC TGC AGA TAT CCA TCA CAC TGG CGG CCG CTC GAG CAT GCA TCT AGA GGG CCC AAT PCR Product GGG AA TT CCC GTT AAG ACG TCT ATA GGT AGT GTG ACC GCC GGC GAG CTC GTA CGT AGA TCT CCC GGG TTA
T7 Promoter M13 Forward Primer

Eco R V

Bst X I

Not I

Xho I

Nsi I

Xba I

Apa I

TCG CCC TAT AGT GAG TCG TAT TAC AAT TCA CTG GCC GTC GTT TTA CAA CGT CGT GAC TGG GAA AAC AGC GGG ATA TCA CTC AGC ATA ATG TTA AGT GAC CTG CAG CAA AAT GTT GCA GCA CTG ACC CTT TTG

pEASY -Blunt Zero 3954 bp

Not I

Pst I

pEASY -T5 Zero 3953 bp

pE (5

PROTOCOL

General protocols for cloning, transformation, confirmation are the same as given in P87, except the PCR product size for vector only is 253 bp.

High quality products


92

Cloning Vector

Chapter 3

pEASY -Blunt Simple Cloning Kit


Dual resistant, Fast Blunt Subcloning
CB111-01 CB111-02 20 rxns 60 rxns

Storage
Trans 1-T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months

Kit Contents
CB111-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 50 l 100 l x 10 CB111-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 150 l 100 l x 30

pEASY - Blunt Simple Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13 F (10 M) M13 R (10 M) SR Primer (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEASY -Blunt Simple Cloning Kit is designed for cloning and sequencing Pfu amplified PCR products. pEASY -Blunt Simple Cloning Kit includes: Blunt-end vector for direct ligation of Pfu-amplified PCR products. Kanamycin and Ampicillin resistance genes for your choice of selection.
pEASY -T1 3928 bp

Chapter 3
Cloning and Mutagenesis System

Easy blue/white selection. pEASY -T1 Simple 3829 bp forward for sequencing. SR Primer and M13 T7 promoter for in vitro transcription.

pEASY -T3 3039 bp

High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.

pEASY -Blunt Simple Cloning Vector Map


pEASY -Blunt 3929 bp pEASY -Blunt Simple 3830 bp

LacZ fragment: bases 1-449 M13 reverse priming site: bases 205-221 T7 promoter priming site: bases 263-282 M13 forward priming site: bases 289-305 f1 origin: bases 447-884 Kanamycin resistance ORF: bases 1218-2012 pEASY -E1 Ampicillin resistance ORF: bases 2030-2890 (57153035-3708 bp) pUC origin: bases

&09

V5 epitop

pEASY - M1 (5437 bp)

SR Primer

M13 Reverse Primer

Pme I

Spe I

Spe I

Pme I

T3

Pst I

Not I

CCC TT GGG AA

PCR Product

AA GGG CAG CTT CAA TTC GCC CTA TAG TGA GTC GTA TTA C AA TTC ACT GGC CGT CGT TTT AC A ACG TCG TGA CTG GGA AAA C TT CCC GTC GAA GTT AAG CGG GAT ATC ACT CAG CAT AAT GTT AAG TGA CCG GCA GCA AAA TG T TGC AGC ACT GAC CCT TTT G F T7

T3

T7 Promoter

Not I

CAG GCT TTA CAC TTT ATG CTT CCG GCT CGT ATG TTG TGT GGA ATT GTG AGC GGA TAA CAA TTT CAC ACA GGA AAC AGC TAT GAC CAT GAT TAC GCC AAG CTG GTC CGA AAT GTG AAA TAC GAA GGC CGA GCA TAC AAC ACA CCT TAA CAC TCG CCT ATT GTT AAA GTG TGT CCT TTG TCG ATA CTG GTA CTA ATG CGG TTC GAC

Pst I

M13 Forward Primer

&09

myc epitop

PROTOCOL
Y -Blunt Zero Generall protocols for cloning, transformation, pEAS confirmation are the same as given in P87, except the PCR product size for pEASY -E2 3954 bp vector only is 101 bp. (5393 bp) pEASY -T5 Zero 3953 bp Order: 0086-010-51296890 Hot line: 0086-400-898-0321
pEASY - M2 (5425 bp)

93

Chapter 3

Cloning Vector

pEASY -Blunt Zero Cloning Vector Kit


CB501-01 CB501-02 20 rxns 60 rxns

Storage
Trans 1-T1 Phage Resistant Chemically C o m p e t e n t C e l l s a t - 7 0 oC f o r s i x months; others at -20oC for six months

Kit Components
CB501-01 (20 rxns) 20 l 5 l 5 l 50 l 50 l 100 l x 10 CB501-02 (60 rxns) 320 l 5 l 5 l 150 l 150 l 100 l x 30

pEASY - Blunt Zero Cloning Vector (10 ng/l) Control Template (5 ng/l) Control Primers (10 M) M13F (10 M) M13R (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEAS Y -Blunt simple cloning Kit is designed for blunt cloning, pEAS Y Blunt simple cloning vector eliminates the multi-cloning site of pEAS Y Blunt Cloning vector

Cloning and Mutagenesis System

Fast cloning (5 minutes). High cloning efficiency. Positive rate close to 100%. Near zero background. No blue/white selection needed. Suitable for larger fragment cloning. Kanamycin and ampicillin resistance genes for choice of selection.

Chapter 3

pEASY -Blunt Zero Cloning Vector

Pme I

Spe I

T3

Not I

Pst I

pEASY -Blunt Zero 3954 bp

LacZ fragment: bases 217-808 M13 reverse priming site: bases 205-221 T7 promoter priming site: bases 326-345 M13 Forward priming site: bases 352-368 Kanamycin resistance ORF: bases 1157-1951 Ampicillin resistance ORF: bases 2201-3061 pUC origin: bases 3159-3832

M13 Reverse Primer

T3 Promoter

Spe I

Pst I

Pme I

TTC ACA CAG GAA ACA GCT ATG ACC ATG ATT ACG CCA AGC TCA GAA TTA ACC CTC ACT AAA GGG ACT AGT CCT GCA GGT TTA AAC AAG TGT GTC CTT TGT CGA TAC TGG TAC TAA TGC GGT TCG AGT CTT AAT TGG GAG TGA TTT CCC TGA TCA GGA CGT CCA AAT TTG
Not I
T7 Promoter

GAA TTG CCC TT AA GGG CAA TTC GCG GCC GCT AAA TTC AAT TCG CCC TAT AGT GAG TCG TAT TAC AAT TC PCR Productt PCR Produc CTT AAC GGG AA TT CCC GTT AAG CGC CGG CGA TTT AAG TTA AGC GGG ATA TCA CTC AGC ATA ATG TTA AG
M13 Forward Primer

A CTG GCC GTC GTT TTA CAA T GAC CGG CAG CAA AAT GTT

PROTOCOL
General protocols for cloning, transformation, confirmation are the same as given in P87.

High quality products


94

Cloning Competent Cells

Chapter 3

Competent Cells for cloning


Selection Guide
Name Cat.No. Transformation Efficiency 108 cfu/g DNA 108 cfu/g DNA 10 cfu/g DNA 106 cfu/g DNA 10 cfu/g DNA 109 cfu/g DNA 10 cfu/g DNA 10 cfu/g DNA
8 9 8 8

Blue/White Selectionl(acZ15)

Low Recombination Rate (recA)

High Quality Plasmid DNA Prepared(endA1)

Cloning of Toxin Gene

Phage Resistance

Trans10 Trans5 Trans109 Trans110 Trans1-Blue Trans2-Blue Trans1-T1 DMT

CD101 CD201 CD301 CD311 CD401 CD411 CD501 CD511

Trans10 Chemically Competent Cells


CD101-01 CD101-02 10100 l 20100 l

Chapter 3

Storage
at -70 C for six months
o

Characteristics
High transformation efficiency: >108 cfu/g DNA( pUC19). StrR. Blue/white selection.

Cloning and Mutagenesis System

Genotype
F- mcrA (mrr-hsdRMS-mcrBC) 80lacZM15 lacX74 recA1 araD139 (ara-leu)7697 galU galK rpsL (StrR) endA1 nupG

Trans5 Chemically Competent Cells


CD201-01 CD201-02 10100 l 20100 l

Storage
at -70oC for six months

Characteristics
High transformation efficiency: >108 cfu/g DNA( pUC19). Ensured insert stable. Blue/white selection.

Genotype
F-80 lac ZM15 (lac ZYA-arg F) U169 end A1 rec A1 hsd R17 (rk-, mk+) sup E44- thi -1 gyr A96 rel A1 pho A

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


95

Chapter 3

Cloning Competent Cells

Trans109 Chemically Competent Cells


CD301-01 CD301-02 CD301-03 5100 l 10100 l 20100 l

Storage
at -70 C for six months
o

Characteristics
High transformation efficiency: >108 cfu/g DNA( pUC19). Suitable for routine cloning. Blue/white selection.

Genotype
end A1 rec A1 gyr A96 thi -1 hsd R17 (rk-, mk+) rel A1 sup E44 (lac-pro AB) [Ftra D36 pro AB lacI qZM15]

Trans110 Chemically Competent Cells


CD311-01 CD311-02 5100 l 10100 l

Cloning and Mutagenesis System

Storage
at -70 C for six months
o

Characteristics
High transformation efficiency: >106 cfu/g DNA( pUC19). Unmethylates or Unmethylated DNA due to dam-/dcm-. StrR. Blue/white selection. Only suitable for tranformation of plasmid DNA.

Genotype
rpsL (StrR) thr leu thi-1 lacY galK galT ara tonA tsx dam dcm supE44 (lac-proAB) /F [traD36 proAB lacIq lacZM15]

Chapter 3

Trans1-Blue Chemically Competent Cells


CD401-01 CD401-02 CD401-03 5100 l 10100 l 20100 l

Storage
at -70oC for six months

Characteristics
High transformation efficiency: >108 cfu/g DNA( pUC19). TetR. Blue/white selection.

Genotype
rec A1 end A1 gyr A96 thi -1 hsd R17 sup E44 rel A1 lac [F pro AB lacI qZM15: Tn10 (TetR)]

High quality products


96

Cloning Competent Cells

Chapter 3

Trans2-Blue Chemically Competent Cells


CD411-01 CD411-02 CD411-03 5100 l 10100 l 20100 l

Storage
at -70 C for six months
o

Characteristics
High transformation efficiency: >109 cfu/g DNA( pUC19). Suitable for larger plasmid transformation. TetR and CamR. Blue/white selection.

Genotype
TetR(mcr A)183 Hte[F {pro AB lac Iq lac ZM15 Tn 10(TetR) Amy CamR}] (mcr CB-hsd SMR-mrr )173 end A1 sup E44 thi -1 rec A1 gyr A96 rel A1

Trans1-T1 Phage Resistant Chemically Competent Cells


CD501-01 CD501-02 CD501-03 5100 l 10100 l 20100 l

Chapter 3

Storge
at -70oC for six months

Characteristics
High transformation efficiency: >109 cfu/g DNA( pUC19). Fast-growing, doubling time about 50 minutes and colonies are visible in 8~9 hours. Resistance to T1 and T5 phage. Blue/white selection.

Cloning and Mutagenesis System

Genotype
F- 80(lac Z)M15 lac X74 hsd R(rK-, mK+) rec A1398 end A1 ton A

DMT Chemically Competent Cells


CD511-01 CD511-02 550 l 2050 l

Storage
at -70 C for six months
o

Characteristics
High transformation efficiency: >108 cfu/g DNA( pUC19). Resistance to T1 and T5 phage. In vivo digestion of methylated DNA, suitable for site-directed mutagenesis. Blue/white selection.

Genotype
F- 80 lac ZM15 (lac ZYA-argF)U169 rec A1 end A1 hsd R17(rK-, mK+) pho A sup E44 thi -1 gyr A96 rel A1 ton A

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


97

Chapter 3

Mutagenesis System

Easy Mutagenesis System


FM101-01 FM101-02 5 rxns 20 rxns

Application
Site-directed mutagenesis for plasmid10 kb

Kit Components
FM101-01 (5 rxns) FM101-02 (20 rxns) 60 units 200 l 50 l 50 l 22 l 25 l 25 l 20 tube (50 l/tube)

Storage
DMT Chemically Competent Cells at -70oC for six months; others at -20oC for one year

EasyPfu DNA Polymerase (2.5 units/l)


10EasyPfu Buffer (with Mg ) 10 mM dNTPs 50 mM MgSO4 DMT Enzyme (10 units/l) Control Plasmid (5 ng/l) Control Primers (100 ng/l ) DMT Chemically Competent Cells
2+

20 units 50 l 15 l 50 l 6 l 5 l 5 l 5 tube (50 l/tube)

Cloning and Mutagenesis System

PROTOCOL
Principle
EasyPfu DNA Polymerase used for generating PCR product. DMT enzyme in vitro digests non-mutate plasmid sample and DMT Competent Cell in vitro digests non-mutate plasmid sample, leaving only unmethylated, mutated product.
Mutagenesis by PCR amplification with two overlapping primers. Both primers contain the target mutations.

Primer Design
Both primers (forward and reverse) should be approximately 30 nucleotides in length. Primers should have an overlapping region at the 5ends of 15-20 nucleotides, for efficient end-joining of mutagenesis product. The mutation site should be located on both primers.
mutation site overlapping region
DMT enzyme digests and DMT competent cell further digests parental plasmids.

Chapter 3

Features
Mutant on both primers to increase the mutation efficiency. Partially overlapped primers to exponential amplify DNA. Double digestions (in vitro and in vivo) to enhance efficiency.

Extend region

Extend region overlapping region

Principle

Mutagenesis by PCR amplification with two overlapping primers. Both primers contain the target mutations.

DMT enzyme digests and DMT competent cell further digests parental plasmids.

High quality products


98

Mutagenesis System

Chapter 3

Fast Mutagenesis System


FM111-01 FM111-02 5 rxns 20 rxns

Application
Site-directed mutagenesis with plasmid 15 kb

Kit Components
FM111-01 (5 rxns) FM111-02 (20 rxns) 60 units 400 l 50 l 50 l 22 l 25 l 25 l 20 (50 l/ )

Storage
DMT Chemically Competent Cells at -70oC for six months; others at -20oC for one year

TransStart FastPfu DNA Polymerase (2.5 units/l)


5TransStart FastPfu Buffer (with Mg ) 10 mM dNTPs 50 mM MgSO4 DMT Enzyme (10 units/l) Control Plasmid (5 ng/l) Control Primers (100 ng/l ) DMT Chemically Competent Cells
2+

20 units 100 l 15 l 50 l 6 l 5 l 5 l 5 (50 l/ )

PROTOCOL
Principle
TransStart Fast Pfu DNA Polymerase used for generating PCR product.

Primer Design
Both primers (forward and reverse) should be approximately 30 nucleotides in length,not including the mutation site on the mutagenic primer. Primers should have an overlapping region at the 5ends of 15-20 nucleotides, for efficient end-joining of mutagenesis product. Th e mu ta ti o n si te sh o u l d b e l o ca te d o n o n l y o n e o f th e primers,downstream from fron and adjacent to the overlapping region, and can be up to 21 bases.

Chapter 3

DMT enzyme in vitro digests non-mutate plasmid sample and DMT Competent Cell in vitro digests non-mutate plasmid sample, leaving only unmethylated, mutated product.

Cloning and Mutagenesis System

mutation site overlapping region Extend region

Extend region overlapping region

Features
TransFast Pfu DNA Polymerase has the extension rate of 4 kb/min and the error rate is 54x better than Taq DNA Polymerase. Mutant on both primers to increase the mutation efficiency. Partially overlapped primers to exponential amplify DNA. Double digestions (in vitro and in vivo) to enhance the efficiency.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


99

Chapter 4

Nucleic Acid Purification


101 102

BloodZol PlantZol

EasyPure Genomic DNA Kit 103 EasyPure Plant Genomic DNA Kit 105 EasyPure Blood Genomic DNA Kit 106 EasyPure Marine Animal Genomic DNA Kit 107 EasyPure Plasmid MiniPrep Kit 108 EasyPure HiPure Plasmid MaxiPrep Kit 109 ArtMedia Plasmid Culture 110 EasyPure PCR Purification Kit 111 EasyPure Quick Gel Extraction Kit 112 TransZol 113 TransZol Up 114 TransZol Plant 115 EasyPure RNA Kit 116 EasyPure Viral DNA/RNA Kit 117 EasyPure Plant RNA Kit 118 EasyPure Blood RNA Kit 119 RNAhold TM 120

Nucleic Acid Purification

Chapter 4

BloodZol
Blood Genomic DNA Extraction (0.1-20 ml)
EE131-01 EE131-02 For 50 ml blood For 200 ml blood

Storage
Proteinase K solution at -20oC for one year; Others at room temperature (15-25oC) for one year

Description
BloodZol provides an easy and fast method to isolate high quality genomic DNA from 0.1-20 ml of fresh or frozen blood. Isolated DNA is free from contaminants and enzyme inhibitors. Red Cell Lysis Buffer is provided to remove non-nucleated red cells and reduce hemoglobin contamination. Genomic DNA is precipitated with isopropanol. Simple and fast. High quality DNA, free of contaminants and PCR inhibitors. DNA size range of 20-50 kb. Suitable for fresh blood, EDTA-/citrate-/ACE, heparin-anticoagulated blood, and frozen blood. No organic solvents. High volume, up to 20 ml of starting materials can be used.

Procedures

Kit Components
Red Cell Lysis Buffer (RCL) Lysis Buffer 3 (LB3) Elution Buffer (EB) Proteinase K (20 mg/ml)
M 1 2

EE131-01 125 ml 30 ml 30 ml 250 l

EE131-02 2250 ml 120 ml 60 ml 1 ml

MTrans8K DNA Marker Lane 1andLane 2mouse total blood

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


101

Chapter 4

Nucleic Acid Purification

PlantZol
EE141-01 100 ml

Storage
at room temperature (15-25oC) for one year

Description
PlantZol provides a simple reagent to isolate high quality plant genomic DNA. Plant tissue is disrupted by grinding in liquid nitrogen. DNA is released with detergent. DNA is separated from other components by centrifugation. Purify high quality genomic DNA. Isolated DNA is suitable for cloning, PCR, restriction enzyme digestion, and Southern blotting. DNA size range of 20-50 kb.

Procedures

Grind tissues

M Mix with Plantzol

10

Add RNase A, Incubation at 55oC for 15 min Add phenol/chloroform, separate DNA from others by centrifugation Lane M: Trans2K Plus II DNA Marker Lane 1, 2: tobacco Lane 3, 4: soybean leaf Lane 5, 6: wheat leaf Lane 7, 8: rice leaf Lane 9, 10: corn leaf Leaf (100 ng) tobacco soybean wheat rice corn DNA gield (g) ~18 ~12 ~20 ~29 ~22

Precipitate DNA with isopropanol

Wash DNA

Dissolve DNA

Nucleic Acid

Chapter 4

Purification

High quality products


102

Nucleic Acid Purification

Chapter 4

EasyPure Genomic DNA Kit


EE101-01 EE101-02 50 rxns 200 rxns

Storage
RNase A and Proteinase K solutions at -20 o C for one year; others at room temperature (15-25oC) for one year

Description
EasyPure Genomic DNA Kit provides a simple and convenient way to isolate high quality genomic DNA from a variety of cells and tissues. Cells and tissues are enzymatically lysed. DNA is bound to silica-based column. The isolated DNA is suitable for cloning, PCR, restriction enzyme digestion, and Southern blotting. Rapid purification of high-quality, ready-to-use total DNA from a variety of cell and tissue types. Complete removal of contaminants and inhibitors Isolated DNA range is 20-50 kb . Column based purification, no organic extraction or ethanol precipitation.
lysate using Proteinase K KitPrepare Components and BB5 with Carrier RNA

Procedures

e uffer 4 (BB4) nol

Components Lysis Buffer 2 (LB2)

EE101-01 (50 rxns) 6 ml 28 ml 55 ml 12 ml 25 ml 1 ml 1 ml 50each

EE101-02 (200 rxns) 24 ml 110 ml 2110 ml 222 ml 80 ml 4 ml 4 ml 200 each

Binding Buffer 2 (BB2) Clean Buffer 2 (CB2) Wash Buffer 2 (WB2) Elution Buffer (EB) RNase A (20 mg/ml)

Add ethanol and mix thoroughly

mn

Add sample an mg/ml) Proteinase Kto (20 EasyPure Spin Column

ce with )

Spin Columns with Collection Tubes

Wash the column twice with Wash Buffer 5 (WB5)

ce with ) Elute RNA with RNase-free Water

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


103

Chapter 4

Nucleic Acid Purification

Amount of Starting Material


Material Mammalian Cells Mammalian Tissues Mouse Tail Amount 1-5106 cells 25 mg 0.5 cm sections 2109 cells 5107 cells

E.coli Cells
Yeast Cells

M MTrans15K DNA Marker Lane 1andLane 2 HeLa cell Lane 3andLane 4mouse tissue

Nucleic Acid

Chapter 4

Purification

High quality products


104

Nucleic Acid Purification

Chapter 4

EasyPure Plant Genomic DNA Kit


EE111-01 EE111-02 50 rxns 200 rxns

Storage
RNase A solution at -20 C for one year; others at room temperature (15-25oC) for one year
o

Description
EasyPure Plant Genomic DNA Kit provides a simple and convenient way to isolate high quality plant genomic DNA. Plant tissue is disrupted by grinding in liquid nitrogen, and DNA is released with detergent. Proteins, polysaccharides, and cell debris are eliminated by precipitation. Plant genomic DNA is bound to silica-based column. The extracted genomic DNA is suitable for PCR, restriction enzyme digestion, and Southern blotting. No organic solvents. Pure plant genomic DNA, free from contaminants and enzyme inhibitors. Simple and fast. DNA range of 20-50 kb. Isolated DNA is suitable for cloning, PCR, restriction enzyme digestion, and Southern blotting.

Procedures

Kit Components
Components Resuspension Buffer 1 (RB1) Precipitation Buffer 1 (PB1) Binding Buffer 1 (BB1) Clean Buffer 1 (CB1) Wash Buffer 1 (WB1) Elution Buffer (EB) RNase A (10 mg/ml) 10% SDS Spin Columns with Collection Tubes M 1 2 3 4 5 6 7 8 EE111-01 (50 rxns) 15 ml 6 ml 8 ml 30 ml 12 ml 25 ml 800 l 2 ml 50 each M MTrans15K DNA Marker Lane 1 and 2tobacco Lane 3 and 4wheat leaf Lane 5 and 6sweet potato leaf Lane 7 and 8cayenne leaf EE111-02 (200 rxns) 60 ml 25 ml 32 ml 110 ml 222 ml 80 ml 4800 l 10 ml 200 each

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


105

Chapter 4

Nucleic Acid Purification

EasyPure Blood Genomic DNA Kit


EE121-01 EE121-02 50 rxns 200 rxns

Storage
RNase A and Proteinase K solutions at -20 o C for one year; others at room temperature (15-25oC) for one year

Description
EasyPure Blood Genomic DNA Kit provides a simple and convenient way to isolate high quality genomic DNA from fresh or frozen blood. Whole blood is incubated with lysis buffer to release DNA. DNA is bound to silica-based column. The isolated DNA is suitable for cloning, PCR, restriction enzyme digestion, and Southern blotting. Simple and fast. High quality DNA, free of contaminants and PCR inhibitors. DNA size range of 20-50 kb. Suitable for fresh blood, EDTA-/citrate-/ACE, heparin-anticoagulated blood, and frozen blood.

Total blood amount


100 l-1 ml

Procedures
Prepare lysate using RCL and Proteinase K

Kit Components
EE121-01 (50 rxns) 70 ml 15 ml 6 ml 12 ml 25 ml 500 l 1 ml 50 each EE121-02 (200 rxns) 2125 ml 60 ml 24 ml 222 ml 80 ml 2 ml 4 ml 200 each

Add Binding Buffer 3 (BB3) and ethanol to the lysate

Red Cell Lysis Buffer (RCL) Binding Buffer 3 (BB3) Clean Buffer 3 (CB3) Wash Buffer 3 (WB3) Elution Buffer (EB) RNase A (20 mg/ml) Proteinase K (20 mg/ml) Spin Columns with Collection Tubes

Apply sample to an EasyPure Spin Column

MTrans15K DNA Marker Lane 1andLane 2mouse total blood


Wash the column with Clean Buffer 3 (CB3)

Wash the column twice with Wash Buffer 3 (WB3)

Nucleic Acid

Chapter 4

Purification

Elute DNA with Elution Buffer (EB) or Water

High quality products


106

Nucleic Acid Purification

Chapter 4

EasyPure Marine Animal Genomic DNA Kit


EE151-01 50 rxns

Storage
RNase A and Proteinase K solutions at -20 C for one year; others at room temperature (15-25oC) for one year
o

Description
EasyPure Marine Animal Genomic DNA Kit provides a simple and convenient way to isolate high quality genomic DNA from marine animals. DNA is bound to silice-based column. The islated DNA is suitable for cloning PCR, restriction enzyme digestion, and Southern blotting. Complete removal of contaminants and inhibitors. Column based purification, No organic extraction or ethanol precipitation.

Kit Components
Lysis Buffer 8 (LB8) Binding Buffer 8 (BB8) Clean Buffer 8 (CB8) Wash Buffer 8 (WB8) Elution Buffer (EB) RNase A (10 mg/ml) Proteinase K (20 mg/ml) Spin Column with Collection Tubes EE151-01 (50 rxns) 12 ml 12 ml 12 ml 12 ml 25 ml 1 ml 1 ml 50 each

Lane M: Trans2K Plus II DNA Marker Lane 1: Clam Lane 2: Razor clam Lane 3: Oyster Lane 4: Crab Lane 5: Prawn Lane 6: Scallop Lane 7: Southern Flounder

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


107

Chapter 4

Nucleic Acid Purification

EasyPure Plasmid MiniPrep Kit


EM101-01 EM101-02 50 rxns 200 rxns

Storage
RNase A at -20oC for one year; others at room temperature (15-25oC) for one year

Description
The EasyPure Plasmid MiniPrep Kit uses a modified alkaline lysis method to isolate high-quality plasmid DNA from 1-4 ml bacterial culture. Unique formulated lysis buffer and neutralization buffer permit error-free visual identification of complete bacterial cell lysis and neutralization. The purified plasmid DNA is suitable for a variety of molecular biology, including automated fluorescent DNA sequencing, restriction enzyme digestion, or transformation. Simple and fast: the whole procedure can be performed in 20 minutes. High yield: DNA yield up to 20 g . Error-free visualization: colored buffers to visualize lysis and neutralization.

Procedures

Kit Components
EM101-01 (50 rxns) Resuspension Buffer (RB) Lysis Buffer (LBBlue) Neutralization Buffer (NBYellow) Wash Buffer (WB) Elution Buffer (EB) RNase A (10 mg/ml ) Spin Columns with Collection Tubes 15 ml 15 ml 20 ml 10 ml 5 ml 150 l 50 each EM101-02 (200 rxns) 60 ml 60 ml 80 ml 220 ml 10 ml 600 l 200 each

pUC19 was isolated from 2ml overnight culture and eluted in 50 l of TE. 5l of the elution was loaded on each lane. MTrans2K Plus DNA Marker

Nucleic Acid

Chapter 4

Purification

High quality products


108

Nucleic Acid Purification

Chapter 4

EasyPure HiPure Plasmid MaxiPrep Kit


High Purity, Low Endotoxin
EM111-01 10 rxns

Storage
RNase A at -20oC for one year; others at room temperature (15-25oC) for one year

Description
The EasyPure HiPure Plasmid MaxiPrep Kit uses a modified alkaline lysis method to isolate high-quality plasmid DNA from 0-100 ml bacterial culture. Unique formulated lysis buffer and neutralization buffer permit error-free visual identification of complete bacterial cell lysis and neutralization. Endotoxin is removed by a simple incubation with a novel buffer. The purified DNA is suitable for a variety of experiments in molecular biology, applications including automated fluorescent DNA sequencing, restriction enzyme digestion, or transformation. Simple and fast. High yield and low endotoxin. DNA yield up to 1 mg. Error-free visualization, colored buffers to visualize lysis and neutralization.

Procedures

Add Resuspension Buffer (RB)/ Lysis Buffer (LB)/ Neutralization Buffer (NB)

Kit Components
EM111-01 (10 rxns) Resuspension Buffer (RB)
Apply sample to an EasyPure Spin Column

120 ml 120 ml 160 ml 60 ml 25 ml 30 ml 1.2 ml 10 each

Lysis Buffer (LBBlue) Neutralization Buffer (NBYellow) ToxinOut Buffer (TB) Wash Buffer (WB) Elution Buffer (EB) RNase A (10 mg/ml )

Add ToxinOut Buffer (TB)

Spin Columns with Collection Tubes

Wash the column twice with Wash Buffer (WB)

Chapter 4

Elute DNA with Elution Buffer (EB) or Water

Purification

Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


109

Chapter 4

Nucleic Acid Purification

ArtMedia TM Plasmid Culture


EM201-01 95ml+5ml

Storage
at 2-8 C for six months
o

Description
ArtMedia TM Plasmid Culture is an unique enriched bacteria growth medium. It improves the rate of bacterial growth, increases cell density, obtains high yields of plasmid DNA. ArtMedia TM Plasmid Culture produces three to seven times more plasmid DNA than traditional LB medium.

Kit Components
EM201-01 AM1 AM2 95 ml 5 ml

Strains
Trans1-T1,Trans5,Trans10,Trans109,Trans110,Trans1-Blue,Trans2Blue ,etc.

Comparisons
Medium LB ArtMedia ArtMedia
TM TM

Volume 1 Plasmid Culture Plasmid Culture 0.5 1 2

DNA yield 2 7 14 28

ArtMediaTM Plasmid Culture

Note
AM2 may have a slight precipitate, which will not affect product performance. If precipitate is observed, warm the bottle in a 37oC water bath to dissolve the precipitate. To make complete media immediately before use, add the entire volume of AM2 to AM1. Store the complete media at 4oC up to 1 month.

Nucleic Acid

Chapter 4

Purification

High quality products


110

Nucleic Acid Purification

Chapter 4

EasyPure PCR Purification Kit


EP101-01 EP101-02 50 rxns 200 rxns

Storage
at room temperature(15-25oC) for one year

Description
EasyPure PCR Purification Kit provides a rapid and efficient way to remove PCR primers, short primer-dimers, dNTPs, enzymes from PCR products. Simple and fast: remove primers, primer-dimers, dNTPs in less than 10 minutes. Suitable for fragment range of 100 bp-10 kb.

Procedures

Kit Components
EP101-01 (50 rxns) Binding Buffer (BB) Wash Buffer (WB) Elution Buffer (EB) Spin Columns with Collection Tubes 30 ml 10 ml 5 ml 50 each EP101-02 (200 rxns) 120 ml 220 ml 10 ml 200 each

Lane 1: before purification Lane 2: after purification

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


111

Chapter 4

Nucleic Acid Purification

EasyPure Quick Gel Extraction Kit


EG101-01 EG101-02 50 rxns 200 rxns

Storage
at room temperature(15-25 C) for one year
o

Description
EasyPure Quick Gel Extraction Kit is designed to rapid purification and concentration of DNA from TAE or TBE agarose gel. Gel slice is dissolved in Gel Solubilization Buffer. DNA is purified in a spin column format. Simple and fast: remove primers, primer-dimers, dNTPs in less than 20 minutes. Suitable for fragment range of 100 bp-10 kb.

Procedures

Kit Components
EG101-01 (50 rxns) Gel Solubilization Buffer (GSBYellow) Wash Buffer (WB) Elution Buffer (EB) Spin Columns with Collection Tubes 30 ml 10 ml 5 ml 50 each EG101-02 (200 rxns) 120 ml 220 ml 10 ml 200 each

100 bp 500 bp 1000 bp 2 000 bp


100, 500, 1000, 2000bp of Trans2k DNA Marker was purified from agarose gels.

Nucleic Acid

Chapter 4

Purification

High quality products


112

Nucleic Acid Purification

Chapter 4

TransZol
Total RNA from cells and tissues
ET101-01 100 ml

Components
TransZol , RNA dissolution Buffer

Description
TransZol is a ready-to-use reagent for the isolation of total RNA from cells and tissues. TransZol combines phenol and guanidine thiocyanate in a mono-phase solution to inhibit RNase. After lysis, and centrifugation, RNA remains in the aqueous phase and others in the interphase or organic phase. RNA is precipited by addition of isopropanol. Isolate RNA from a variety of species: animal, plant, yeast, bacterial and virus. The entire procedure can be completed in one hour. Simultaneous isolation of RNA, DNA, and protein from the same sample.

Storage
at 4oC for one year in the dark

Procedures

Sample preparation

Mix samples with TransZol reagent

Separate (About 20 min)

RNA percipitation (About 20 min)

total RNA from mouse liver

Wash and dissolve (About 10 min)


total RNA from tobacco leaves

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


113

Chapter 4

Nucleic Acid Purification

TransZol Up
from cells and tissues
ET111-01 100 ml

Components
TransZol Up RNA dissolution buffer

Description
TransZol Up is a ready-to-use reagent for the isolation of total RNA from cells and tissues. In the process of lysis, TransZol Up keeps the RNA intact. Addition of chloroform will separate the solution into a colorless aqueous phase which is colourless and a pink organic phase. RNA remains in the aqueous phase and can be recovered by precipitation with isopropanol. Protein remains in the organic phase and can be recovered by precipitation with isopropanol. Isolate RNA from a variety of species: animal, plant, yeast, bacterial and virus. The entire procedure can be completed in one hour. Simultaneous isolation of RNA, DNA, and protein from the same sample.

Storage
at 4oC for one year in dark

Procedures

Sample preparation

Mix samples with TransZol Up reagent

Separate (About 20 min)

RNA precipitation (About 20 min)

Wash and dissolve (About 10 min)

TransZol Up isolates RNA from E.coli cell

Nucleic Acid

Chapter 4

Purification

TransZol Up isolates RNA from HeLa cell

High quality products


114

Nucleic Acid Purification

Chapter 4

TransZol Plant
Total RNA from high levels of polysaccharide and/or polyphenol plant tissues
ET121-01 100 ml

Components
TPI buffer (100 ml); TPII buffer (100 ml); RNA dissolution buffer (15 ml)

Description
TransZol Plant is a ready-to-use reagent for the isolation of total RNA from high level of polysaccharide and/or polyphenol plant tissues, such as champignon, banana fruit, mango fruit, potato, carrot, sansevieria trifasciataprain. TransZol Plant is a modified CTAB method. Phenol/ chloroform is used to remove protein. The isolated RNA is suitable for downstream applications, such as RT and RT-qPCR. Superior lysis capability. Isolate RNA in less than 1 hour. Colored dye used to visualize different phase. High quality RNA.

Storage
at room temperature for six months

Procedures

Sample preparation

Mix samples with TransZol Plant (About 5 min)

Separate (About 20 min)

RNA precipitation (About 20 min)

Potato Banana fruit


Wash and dissolve (About 10 min)

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


115

Chapter 4

Nucleic Acid Purification

EasyPure RNA Kit


Total RNA from animal cell, animal tissues and bacteria
ER101-01 50 rxns

Storage
Proteinase K and DNase I at -20oC for one year; others at room temperature for one year

Description
EasyPure RNA Kit provides a simple column based method to isolate total RNA from animal cells, animal tissues, bacteria, and yeast. Cells and tissues are enzymatically lysed. DNA is digested with DNase. RNA is bound to silice-based column. The isolated RNA is suitable for reverse transcription, RT-PCR, and RT-qPCR.

Procedure Kit Components


Lyse and homogenize sample in Binding Buffer 4 (BB4) with 2-mercaptoethanol

Components Binding Buffer 4 (BB4) Clean Buffer 4 (CB4) Wash Buffer 4 (WB4)

ER101-01 (50 rxns) 40 ml


Prepare lysate using Proteinase K 12 ml and BB5 with Carrier RNA

60 ml

Add ethanol, mix thoroughly

Proteinase K (20 mg/ml) DNase I (3 units/l) DNase I Reaction Buffer RNase-free Water RNase-free Tube (1.5 ml) Spin Columns with Collection Tubes

1 ml 1500 units
Add ethanol and mix thoroughly

4 ml

10 ml 50 each 50 each

Add sample to an EasyPure Spin Column

M
Wash the column once with Clean Buffer 4 (CB4)

Add sample to an EasyPure Spin Column

M:Trans2K Plus II DNA Marker Lane 1: Brain tissue of mouse Lane 2: Kidney tissue of mouse Wash the column Lane 3: HeLa cell twice with Wash Buffer 5 (WB5) Lane 4: E.coli cell

Wash the column twice with Wash Buffer 4 (WB4) Elute RNA with RNase-free Water Elute RNA with RNase-free Water

Nucleic Acid

Chapter 4

Purification

High quality products


116

Nucleic Acid Purification

Chapter 4

EasyPure Viral DNA/RNA Kit


Viral DNA/RNA from plasma, serum, and other cell culture supernatants
ER201-01 50 rxns

Storage
Carrier RNA and Proteinase K at -20oC for one year; others at room temperature for one year

Description
EasyPure Viral DNA/RNA Kit provides a quick and easy way to isolate viral RNA/DNA from a variety of fresh or frozen samples. Samples are lysed with detergent to inactive RNase. DNA/RNA is bound to silicamembrane. After washing, high quality DNA/RNA is eluted and the isolated DNA/RNA is ready for downstream applications. Complete solution for both viral DNA and RNA. High-quality and high yield. Consistent results.

Procedure
Prepare lysate using Proteinase K and BB5 with Carrier RNA

Kit Components
Components
Add ethanol and mix thoroughly

ER201-01 (50 rxns) 15 ml 12 ml 1 ml 310 l 10 ml 50 each 50 each

Binding Buffer 5 (BB5) Wash Buffer 5 (WB5) Proteinase K (20 mg/ml) Carrier RNA (1 g/l) RNase-free Water

Add sample to an EasyPure Spin Column

RNase-free Tube (1.5 ml) Spin Columns with Collection Tubes

Wash the column twice with Wash Buffer 5 (WB5)

Elute RNA with RNase-free Water

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


117

Chapter 4

Nucleic Acid Purification

EasyPure Plant RNA Kit


ER301-01 50 rxns

Storage
DNase I at -20oC for one year; others at room temperature for one year

Description
EasyPure Plant RNA Kit provides a quick and easy way to isolate RNA from plant tissue. Samples are lysed with detergent to inactive RNase. RNA is bound to silica-membrane. After washing, high quality RNA is eluted and the isolated RNA is ready for downstream applications. Complete solution RNA. High quality and high yield. Consistent results.

Procedure

Kit Components
Prepare lysate using BB6 with -Mercaptoethanol

Components Binding Buffer 6 (BB6) Wash Buffer 6 (WB6)

ER301-01 (50 rxns) 60 ml 12 ml 60 ml 1500 U 4 ml 10 ml 50 each 50 each

Add ethanol and mix thoroughly

Clean Buffer 6 (CB6) DNase I (3 units/l) DNase I Reaction Buffer RNase-free Water RNase-free Tube (1.5 ml) Spin Columns with Collection Tubes

Add sample to an EasyPure Spin Column

Wash the column with Clean Buffer 6 (CB6)

M M:Trans2K Plus II DNA Marker Lane 1: Corn leaves Lane 2: Wheat leaves Lane 3: Soybean leaves

Wash the column twice with Wash Buffer 6 (WB6)

Elute RNA with RNase-free Water

Nucleic Acid

Chapter 4

Purification

High quality products


118

Nucleic Acid Purification

Chapter 4

EasyPure Blood RNA Kit


ER401-01 50 rxns

Storage
DNase I and DNase I Reaction Buffer at -20 o C for one year; others at room temperature (15-25oC) for one year

Description
EasyPure Blood RNA Kit provides a fast, easy method for the preparation of total RNA from up to 50 l-1.5 ml of human whole blood. Contaminants such as DNA and protein are completely removed. Purified RNA is ready for downstream use applications such as RT-PCR, RT-qPCR, and Northern blotting.

Procedure

Kit Components
Components Red Cell Lysis Buffer 2 (RCL2)
2 2

ER401-01 (50 rxns) 125 ml 40 ml 60 ml 12 ml 1500 U 4 ml 10 ml 50 each 50 each

Binding Buffer 7 (BB7) Clean Buffer 7 (CB7) Wash Buffer 7 (WB7) DNase I (3 units/l) DNase I Reaction Buffer RNase-free Water Spin Columns with Collection Tubes RNase-free Tube 1.5 ml

Chapter 4
Purification Nucleic Acid

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


119

Chapter 4

Nucleic Acid Purification

RNAholdTM
ER501-01 100ml

Storage
at room temperature for one year

Description
RNAhold TM is an aqueous, nontoxic tissue reservation solution. Cells and tissues can be stored at this solution for one week at room temperature without RNA degradation. Immediate RNase inactivation. At room temperature up to 1 week,4oC for 1 month, -20oC or -80oC for long term storage. Ideal for field sample collection.
M 1 2 3 M M: Trans2K Plus II DNA Marker Lane 1: Hela cells stored at 37oC for 1 day Lane 2: Hela cells stored at room temperature for 1 week Lane 3: control without RNAholdTM room temperature for 1 week

Note
Tissues stored in RNAholdTM solution can repeat freeze and thaw at least 20 times without significantly affecting the amount or the integrity of the recoverable RNA.

Nucleic Acid

Chapter 4

Purification

High quality products


120

Chapter 5 Expression
Prokaryotic Expression Vectors

pEASY -E1 Expression Kit pEASY - E2 Expression Kit

Expression Competent Cells


BL21(DE3) Chemically Competent Cells BL21(DE3) pLysS Chemically Competent Cells Transetta(DE3) Chemically Competent Cells TransB(DE3) Chemically Competent Cells BL21 Chemically Competent Cells

Mammal Expression Vectors


pEASY - M1 Expression Kit pEASY - M2 Expression Kit ArtMediaTM Protein Expression

pEASY -T1 3829 bp

pEASY -Blunt 3929 bp Simple

pEASY -Blunt Simple pEAS Y -T3 3830 bp bp 3039

pEASY -E1 (5715 bp)

pEASY - M1 (5437 bp)

Chapter pEASY -T1 Simple 3829 bp


Spe I
T3

pEAS Y -T3 Prokaryotic Expression Vectors

3039 bp

Pme I

Not I

Pst I

Pme I

Spe I

Not I

Pst I

T3

T7

&09

V5 epitope

stop

V5epitope

&09

myc epitope

&09

V5 epitope

stop

V5epitope

3830 bp

Y -Blunt Simple

pEASY -T5 Zero 3953 bp pEAS Y -T3 pEAS Y -Blunt Simple

pEASY -E1 (5715 bp)

pEASY -Blunt Zero pEASY - M1 3954 bp (5437 bp)


pEASY -E1 (5715 bp)

pEASY -E2 (5393 bp) pEASY - M1 (5437 bp)

pEASY - M2 (5425 bp)

bp 3039 3830 bp

Not I

Pme I

Spe I

&09

T3

Not I

Pst I

myc epitope

stop

&09

V5 epitope

stop

V5epitope

&09

myc epitope

stop

T7

Y -Blunt Zero 3954 bp


pEASY -E1 (5715 bp)

ro

pEASY -Blunt Zero pEASY - M1 3954 bp (5437 bp)

pEASY -E2 (5393 bp)

pEASY - M2 (5425 bp) pEASY -E2 (5393 bp) pEASY - M2 (5425 bp)

&09

myc epitope

stop

Chapter 5

Expression

pEASY -E2 (5393 bp)

pEASY - M2 (5425 bp)

High quality products


122

Prokaryotic Expression Vectors

Chapter 5

pEASY -E1 Expression Kit


CE101-01 10 rxns

Storage
Trans 1 - T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months

Kit Components
Components pEASY -E1 Expression Vector(15 ng/l)

CE101-01(10 rxns) 10 l 10 l 10 l 10 l 50 l 50 l 100 l x 5

EControl Template (5 ng/l) EControl Forward Primer (10 M) EControl Reverse Primer (10 M) T7 Promoter Primer(10 M) T7 Terminator Primer(10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

Description
pEAS Y - E1 Expression Vector is designed for cloning and prokaryotic expression of Tag-amplified PCR products. It includes: 3-T overhangs for fast ligation of Tag-amplified PCR products. Ampicillin resistance. Bacteriophage T7 lac promoter for high level expression. N-terminal 6xHis tag for easy purification. High efficiency Trans1-T1 Competent Cells.
pEASY -T1 Simple 3829 bp
pEASY -T3 3039 bp

pEASY-E1 Prokaryotic Expression Vector


pEASY -Blunt Simple 3830 bp

pEASY -E1 (5715 bp)

T7 promoterbases 209-225 T7 transcription startbases &09 V5 226 epitope stop Lac operator(lacO)bases 228-252 RBSbases 282-288 HisTag coding sequencebases 309-326 T7 terminatorbases 435-481 bases 906-1766 Ampicillin resistance ORF pEASY - M1 pBR322 originbases 1911 (5437 bp) ROP ORFbases 2952-3143 LacI ORFbases 4455-5546

Chapter 5
Experssion

V5epitope

T7 Promoter

T7 Transcription Start

lac operator

Xba I

RBS

Pme I

Spe I

T3

CGCGAAATTA ATACGACTCA CTATAGGGGA ATTGTGAGCG GATAACAATT CCCCTCTAGA AATAATTT TGTTTAACTTTAAGAAGGAGAT ATA


Nde I Polyhistidine region Nhe I

Not I

Pst I

&09

myc epitope

stop

T7

CAT ATG CGG GGT TCT CAT CAT CAT CAT CAT CAT GGT ATG GCT AGC GAA TTG GCC CTT AAG GGC CAA TTC PCR Product Met Arg Gly Ser His His His His His His Gly Met Ala Ser CTT AAC CGG GAA TTC CCG GTT AAG
Sac I

GAGCTCAACG ATCCGGCTGC TAACAAAGCC CGAAAGGAAG CTGAGTTGGC


terminator primer pEASY -BluntT7 Zero pEASY -E2 3954 bp GCTGAGCAAT AACTAGCATAA CCCCTT GGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG TGCTGCCACC (5393 bp) T7 terminator

pEASY - M2 (5425 bp)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


123

Chapter 5

Prokaryotic Expression Vectors

PROTOCOL
Suggested cloning reaction conditions
1. The optimized volume of insert Molar ratio of vector and fragment = 1:7 2. The optimized volume of vector: 1 l 3. The optimized reaction volume is about 3~5 l, ddH 2 O can be used to add the reaction vol. up to 5 l. 4. The optimized incubation time: (1)0.1~1 kb (including 1 kb): 5~10min. (2)1~2 kb (including 2 kb): 10~15min. (3)2~3 kb (including 3 kb): 15~20min. use the maximal reaction time when the fragment is gel purified PCR product. 5. The optimized temperature: for most PCR inserts, the optimized reaction temperature is about 25 o C; for some PCR inserts, optimized results can be achieved with higher temperature (up to 37oC)

I. Transformation
1. Add 2-4 l of the ligated products to 50 l of Trans1-T1 Competent Cells and mix gently ( Do not mix by pipetting up and down). 2. Incubate on ice for 20-30 minutes. 3. Heat-shock the cells for 30 seconds at 42oC. 4. Immediately transfer the tubes on ice. 5. Add 250 l of room temperature SOC or LB medium. Shake the tubes at 37oC (200 rmp) for 1 hour. 6. In the meantime, mix 8 l of 500 mM IPTG with 40 l of 20 mg/ml X-gal. Spread evenly onto an LB plate. Place the plate at 37oC for 30 minutes. 7. Spread 10-200 l transformant on the prewarmed plate. Incubate overnight at 37oC

II. Analyze Positive Clones by Clony PCR


1. Transfer 2-6 white or light blue colonies into 10 l dH2O. 2. Use 1 l of the mixture as template for 25 l. PCR using M13 forward and M13 reverse primers. 3. PCR reaction condition for control insert 94oC 2-5 min 30 cycles 94oC 30 sec 55oC 30 sec 72oC X min* (depends on the insert length and PCR enzymes)

Notes
Pfu amplified DNA fragments can not be directly cloned into T-vector .

III. Plasmid DNA Miniprep V. Target gene expression


(1) Take single colony and transfer into 5 ml of LB/Amp+ medium. Incubate at 37oC (250 rpm) until OD600 close to 0.5. (2) Add IPTG to a final concentration of 0.5-1 mM. (3) Remove a 500 l aliquot during different time course. Centrifuge at the maximum speed. Aspirate the supernatant and the pellets can be used for SDS-PAGE Gel. Expression

Chapter 5

IV. Transform into Expression Competent Cells

High quality products


124

Prokaryotic Expression Vectors

Chapter 5

pEASY -E2 Expression Kit


CE111-01 10 rxns

Storage
Trans 1 - T1 Phage Resistant Chemically Competent Cells at -70oC for six months; others at -20oC for six months
pEASY -T1 Simple 3829 bp

Kit Components
Components pEASY -E2 Expression Vector (15 ng/l)

CE111-01(10 rxns) 10 l 10 l 10 l 10 l 50 l 50 l 100 l x 5

EControl Template (5 ng/l) EControl Forward Primer (10 M)Y -T3 pEAS T7 Promoter Primer (10 M) T7 Terminator Primer (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells

3039 EControl Reverse Primer (10 M) bp

Description

pEASY -Blunt Simple 3830 bp

pEAS Y -E2 Expression Vector is designed for cloning and prokaryotic expression of Tag-amplified PCR products. It ineludes: 3-T overhangs for fast ligation of Tag-amplified PCR products. Ampicillin resistance. pEASY -E1 pEASY - M1 Bacteriophage T7 lac promoter for(5437 highbp) level expression. (5715 bp) N-terminal 6xHis tag for easy purification. High efficiency Trans1-T1 Phage Resistant Chemically Competent Cells.

&09

V5 epitope

stop

V5epitope

Pme I

Spe I

T3

Not I

Pst I

T7

pEASY -E2 Prokaryotic Expression Vector

&09T7

pEASY -Blunt Zero 3954 bp

pEASY -E2 (5393 bp)

T7 promoterbases 5117-5133 transcription startbases 5134 myc epitope stop Lac operator(lacO)bases 5136-5160 RBSbases 5190-5197 HisTag coding sequencebases 5237-5251 T7 terminatorbases 5322-5368 LacI ORF bases pEAS Y - M23651-4739 pBR (5425 origin bases 1614-2233 bp) Ampicillin resistance ORFbases 599-1459 f1 originbases 11-428

Chapter 5
Experssion

T7 Promoter

T7 Transcription Start

lac operator

Xba I

TAA TAC GAC TCA CTA TAG GGG AAT TGT GAG CGG ATA ACA ATT CCC CTC TAG AAA TAA TTT
RBS Nde I PCR Product Xho I Polyhistidine region

TGTTTAACTTTAA GAAGGAGA TATA CAT ATG GAA TTG GCC CTT GTA TAC CTT AAC CGG GAA

AAG GGC CAA TTC CTC GAG CAC CAC CAC CAC CAC CAC TGAGATCCGGCTGCTAAC TTC CCG Gln Phe Leu Glu His His His His His His ACTCTAGGCCGACGATTG
T7 Terminator

T7 Terminator Primer

AAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCAC CGCTGAGCAATAA CTAGCATAA CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG CTGAAAGGAGGAACTATATCCGGAT

Notes
CMV Forward Primer Binding Site TGA CGC AAA TGG GCG GTA GGC GTG TAC GGT GGG AGG TCT ACT GCG TTT ACC CGC CAT CCG CAC ATG CCA CCC TCC AGA TAT ATT CGT CTC GAG CAA

Transformation and identification of positive recombinant are the same for pEASY -E1 Expression Kit (P124). ATA TAA GCA GAG as CTC GTT

TAG TGA ACC GTC AGA TCG CCT GGA GAC GCC ATC CAC GCT GTT TTG ACC TCC ATA GAA GAC ACC GGG ACC GAT CCA GCC TCC GGA CTC TAG AGG ATC ATC ACT TGG CAG TCT AGC GGA CCT CTG CGG TAG GTG CGA CAA AAC TGG AGG TAT CTT CTG TGG CCC TGG CTA GGT CGG AGG CCT GAG ATC TCC TAG

Order: 0086-010-51296890
PCR Product

Hot line: 0086-400-898-0321

V5 epitope GCC CTT CGG GAA AAG GGC GAT CCG GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG TTC CCG CTA GGC CCA TTC GGA TAG GGATTG GGA GAG GAG CCA GAG CTA AGA TGC TK PolyA Reverse Primer Binding Site

125

Chapter 5

Expression Medium

ArtMediaTM Protein Expression


CP101-01 95 ml+5ml

Storage
at 2-8oC for six months

Description
ArtMediaTM Protein Expression is designed for higher protein yield with much less hands-on time. It does not require the time-consuming OD monitoring and IPTG induction steps. Simply inoculate prepared ArtMediaTM with colonies, grow the culture overnight and harvest cells for protein purification.
Components AM3 AM4 CP101-01 95 ml 5 ml

Suitable Expression Vectors


Lactose operons expression vectors: pEASY -E1, pEASY -E2, pET, pGEX, pMAL.

Strains
BL21BL21(DE3)BL21(DE3)pLysSTransetta(DE3)
M 1 2 3 M 1 2 3

Expression

Chapter 5

Target protein:70 kDa Vector: pEASY -E1 (T7lac promoter) Strain:Transetta(DE3) M: ProteinRuler I Lane 1: LB, uninducecd Lane 2: LB,OD600=0.5, Induced with imm IPTG Lane 3: ArtMediaTM Protein Expression,37oC express for 12 hours

Target protein:30 kDa Vector:pGEX-5X-3 (tac promoter) Strain:BL21 MProteinRuler I Lane 1LB,compare Lane 2LBOD600=0.5 Induced with imm IPTG Lane 3: Protein expression with ArtMediaTMArtmeds for 12 hours

Notes
AM4 may have a slight precipitate, which will not affect product performance. If precipitate is observed, warm the bottle in a 37oC water bath to dissolve the precipitate. To make complete media immediately before use, add the entire volume of AM4 to AM3. Store the complete media at 4oC up to 1 month.

High quality products


126

Experssion Competent Cells

Chapter 5

Competent Cells
Selection Guide
Name BL21(DE3) BL21(DE3) pLysS Transetta(DE3) TransB(DE3) BL21 Cat.No CD601 CD701 CD801 CD811 CD901 Transformation Efficiency 107 cfu/g DNA 10 cfu/g DNA 107 cfu/g DNA 107 cfu/g DNA 107 cfu/g DNA
7

Application High expression of non-toxic protein High expression of toxic protein and non-toxic protein, low background Contains tRNAs corresponding to 6 rare codons, application to Eukaryotic gene expression Conducive to the formation of the correctly folded protein with disulfide, enhance the solubility of the protein High expression of toxic protein

BL21(DE3) Chemically Competent Cells


CD601-01 CD601-02 CD601-03 5100 l 10100 l 20100 l

Characteristics Storage
at -70 C for six months
o

Transformation efficiency: >107 cfu/l DNA( pUC19). T7 expression strain. DE3 for strains contains the DE3 lysogen that carries the gene for T7 RNA polymerase.

Genotype
F- ompT hsdSB(rB-mB-) gal dcm(DE3)

Chapter 5

BL21(DE3)pLysS Chemically Competent Cells


CD701-01 CD701-02 CD701-03 5100 l 10100 l 20100 l

Experssion

Storage
at -70oC for six months

Characteristics
Transformation efficiency: >107 cfu/l DNA( pUC19). T7 Expression strain. DE3 for strains contains the DE3 lysogen that carries the gene for T7 RNA polymerase under control of the lacUV5 promoter. CamR. Contains pLysS plasmid that expresses the T7 lysozyme gene to reduce the background of the target genes expression without disturbing IPTG functioning.Suitable for non-toxic and toxic proteins expression.

Genotype
F-ompT hsdSB(rB-mB-) dcm(DE3) gal pLysS(CamR)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


127

Chapter 5

Experssion Competent Cells

Transetta(DE3) Chemically Competent Cells


CD801-01 CD801-02 CD801-03 5100 l 10100 l 20100 l

Storage
at -70 C for six months
o

Characteristics
Transformation efficiency: >107 cfu/l DNA( pUC19). CamR. tRNAs for 6 rare codons AUA, AGG, AGA, CUA, CCC, GGA. Enhance the expression level of proteins in the prokaryotic system.

Genotype
F-ompT hsdSB(rB-mB-)gal dcm(DE3) pRARE(argUargWileXglyTleu WproL)(CamR)

TransB(DE3) Chemically Competent Cells


CD811-01 CD811-02 CD811-03 5100 l 10100 l 20100 l

Storage
at -70 C for six months
o

Characteristics
Transformation efficiency: >107 cfu/l DNA( pUC19). KanR and TetR. DE3 for strains contains the DE3 lysogen that carries the gene for T7 RNA polymerase under control of the lacUV5 promoter. trxB and gor mutation greatly facilitates cytoplasmic disulfide bond formation.

Expression

Genotype
F- ompT hsdSB(rB- mB-) gal dcm lacY1 ahpC (DE3) gor522::Tn10 trxB (KanRTetR)

Chapter 5

BL21 Chemically Competent Cells


CD901-01 CD901-02 CD901-03 5100 l 10100 l 20100 l

Storage
at -70oC for six months

Characteristics
Transformation efficiency: >107 cfu/l DNA( pUC19). TetR. Tight expression control ideal for toxic protein expression.

Genotype
E. coli B F dcm ompT hsdS(rB mB) gal araB::T7RNAP-tetA

High quality products


128

Mammal Expression Vectors

Chapter 5

pEASY -M1 Expression Kit


CM101-01 10 rxns

Storage
Trans1-T1 Phage Resistant Chemically Competent Cells at -70oC for 6 months; others at -20oC for 6 months

Kit Components
Components pEASY -M1 Expression Vector (15 ng/l) MControl Template (5 ng/l) MControl Forward Primer (10 M) MControl Reverse Primer (10 M) CMV Forward Primer (10 M) TK PolyA Reverse Primer (10 M) Trans1-T1 Phage Resistant Chemically Competent Cells CM101-01 (10 rxns) 10 l 10 l 10 l 10 l 50 l 50 l 100 l x 5

Description
pEAS Y -M1 Expression Vector is designed for cloning and mammalian expression of Tag-amplified PCR products. Enhanced CMV promoter for higher protein yield. Fast cloning. N-terminal V-5 tag for protein detection. Neomycin resistance gene for stable cell line selection.

-T1 Simple 29 bp

pEASY -T3 3039 bp

T7 Promoter

T7 Transcription Start

lac operator

Xba I

CMV promoterbases 4751-5338 Polyhistidine region CMV forward primer binding site:bases 5288-5307 TGTTTAACTTTAA GAAGGAGA TATA CAT ATG GAA TTG GCC CTT AAG GGC CAA TTC CTC GAG CAC CAC CAC CAC CAC CAC TGAGATCCGGCTGCTAAC PCR Product Cloning site:bases 7 Mammal Expression Vector GTA TAC CTT AAC CGG GAA TTC CCG Gln Phe Leu Glu His His His His His His ACTCTAGGCCGACGATTG TK polyA reverse primer binding site:bases 84-102 T7 Terminator Primer T7 Terminator TK polyadenylation signal:bases 77-384 f1 replication origin:bases 384-812 AAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCAC CGCTGAGCAATAA CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG CTGAAAGGAGGAACTATATCCGGAT pEASY -E1 pEASY - CTAGCATAA M1 SV40 early promoter:bases 817-1186 (5715 bp) (5437 bp) Neomycin resistance gene:bases 1222-2016 SV40 polyadenylation signal:bases 2192-2322 pUC origin(c):bases 2705-3378 CMV Forward Primer Binding Site Ampicillin (bla) resistance gene(c):bases 3523-4383 TGA CGC AAA TGG GCG GTA GGC GTG TAC GGT GGG AGG TCT ATA TAA GCA GAG CTC GTT bla promoter(c):bases 4384-4482 ACT GCG TTT ACC CGC CAT CCG CAC ATG CCA CCC TCC AGA TAT ATT CGT CTC GAG CAA V5 epitope:bases 18-59

TAA TAC GAC TCA CTA TAG GGG AAT TGT GAG CGG ATA ACA ATT CCC CTC TAG AAA TAA TTT &09 V5 epitope stop RBS Nde I

pEASY -M1

V5epitope Xho I

Chapter 5
Experssion

myc epitope stop TAG TGA ACC GTC AGA TCG CCT GGA GAC GCC&09 ATC CAC GCT GTT TTG ACC TCC ATA GAA GAC ACC GGG ACC GAT CCA GCC TCC GGA CTC TAG AGG ATC ATC ACT TGG CAG TCT AGC GGA CCT CTG CGG TAG GTG CGA CAA AAC TGG AGG TAT CTT CTG TGG CCC TGG CTA GGT CGG AGG CCT GAG ATC TCC TAG

V5 epitope GCC CTT CGG GAA


PCR Product -E2

pEASY (5393 bp)

AAG GGC GAT CCG GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG TTC CCG CTA GGC CCA TTC GGA TAG GGATTG GGA GAG GAG CCA GAG CTA AGA TGC

TK PolyA

(5425 bp) TK PolyA Reverse Primer Binding Site

pEASY - M2

TAG TAA TGA GTT TAA ACG GGG GAG GCT AAC TGA AAC ACG GAA GGA GAC AAT ACC GGA AGG AAC CCG CGTAG C ATC ATT ACT CAA ATT TGC CCC CTC CGA TTG ACT TTG TGC CTT CCT CTG TTA TGG CCT TCC TTC CTT GGATC G

Order: 0086-010-51296890 CMV Forward Primer Binding Site


TGA CGC AAA TGG GCG GTA GGC GTG TAC GGT GGG AGG TCT ATA TAA GCA GAG CTC GTT ACT GCG TTT ACC CGC CAT CCG CAC ATG CCA CCC TCC AGA TAT ATT CGT CTC GAG CAA

Hot line: 0086-400-898-0321


129

TAG TGA ACC GTC AGA TCG CCT GGA GAC GCC ATC CAC GCT GTT TTG ACC TCC ATA GAA GAC ACC GGG ACC GAT CCA GCC TCC GGA CTC TAG AGG ATC ATC ACT TGG CAG TCT AGC GGA CCT CTG CGG TAG GTG CGA CAA AAC TGG AGG TAT CTT CTG TGG CCC TGG CTA GGT CGG AGG CCT GAG ATC TCC TAG

Chapter 5

Mammal Expression Vectors

PROTOCOL
Suggested cloning reaction conditions
1. Optimized volume of insert : Molar ratio of vector to fragment = 1:7 2. Optimized volume of vector : 1 l 3. Optimized reaction volume is about 3~5 l. 4. The optimized incubation time: (1) 0.1~1 kb (including 1 kb): 5~10min. (2) 1~2 kb (including 2 kb): 10~15min. (3) 2~3 kb (including 3 kb): 15~20min. 5. Optimized temperature: For most PCR inserts, the optimized reaction temperature is about 25oC. For some PCR inserts, optimized results can be achieved with higher temperature (up to 37oC).

Cloning Reaction
(1) PCR Primer Design Do not add 5 phosphates to PCR primers . Forward Primer with Kozak consensus sequence is (G/A)NNATGG. Using Taq polymerase (2) Add the products and vector in a tube, mix reaction gently and incubate for 5 minutes at room temperature (20-37oC).

Transformation
1. Add 2-4 l of the ligated products to 50 l of Trans1-T1 Competent Cells and mix gently (Do not mix by pipetting up and down). 2. Incubate on ice for 20-30 minutes. 3. Heat-shock the cells for 30 seconds at 42oC. 4. Immediately transfer the tubes on ice. 5. Add 250 l of room temperature SOC or LB medium. Shake the tubes at 37oC (200 rmp) for 1 hour. 6. In the meantime, mix 8 l of 500 mM IPTG with 40 l of 20 mg/ml X-gal. Spread evenly onto LB plates. Place the plate at 37oC for 30 minutes. 7. Spread 10-200 l transformant on the prewarmed plate. Incubate overnight at 37oC.

Expression

Analysis of Positive Clones


1. Transfer 2-6 white or light blue colonies into 10 l dH2O. 2. Use 1 l of the mixture as template for 25 l. PCR using M13 forward and M13 reverse primers. Thermal cyding conditions for control insert 3. 94oC 2-5 min 94oC 30 sec 55oC 30 sec 30 cycles 72oC X min* (depends on the insert length and PCR enzymes) 4. Analyze the plasmids for insertion and orientation by restriction analysis or by sequencing. 5. Sequencing: The CMV Forward Primer and TK PolyA Reverse sequencing primers are included to help you sequence your insert. 6. Transfection 7. Using Anti-V5 to detect proteins with V5 tag. 8. Stable Cell Lines: use G418 selecting stable cell lines.

Chapter 5

High quality products


130

Mammal Expression Vectors

Chapter 5

PCR for control insert (700 bp)


Component Control Template Control Primers (10 M) 10EasyTaq Buffer (withMg ) 2.5 mM dNTPs

Volume Variable 1 l
2+

Final Concentration <0.5 g 0.2 M 1 0.2 mM 2.5 units -

5 l 4 l 0.5 l Variable 50 l

EasyTaq DNA Polymerase


ddH2O Total volume

Thermal cyding conditions for control insert


94 94 55 72 72 2-5 min 30 sec 30 sec 1 min 10 min

30 cycles

Ligate 1 l of control PCR insert to 1 l vector. Hundreds of colonies should be produced with efficiency over 90%.

Chapter 5
Experssion

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


131

Chapter 5

Mammal Expression Vectors

pEASY -M2 Expression Kit


CM111-01 10 rxns

Storage
Trans 1-T1 Phage Resistant Chemically Competent Cells at -70 o C for 6 months,
o

Kit Components
Components CM111-01 (10 rxns) 10 l 10 l 10 l 10 l 50 l 50 l

pEASY -T1 Simple others at -20 C for 6 months 3829 bp


T7 Promoter T7 Transcription Start lac operator

pEASY -T3 pEASY -M2 Expression Vector (15 ng/l) 3039 bp MControl Template (5 ng/l)
Xba I MControl Forward Primer (10 M)

TAA TAC GAC TCA CTA TAG GGG AAT TGT GAG CGG ATA ACA ATT CCC CTC TAG AAA TAA TTT MControl Reverse
RBS Nde I

Primer (10 M)
Xho I

TGTTTAACTTTAA GAAGGAGA TATA CAT ATG GAA TTG GCC CTT GTA TAC CTT AAC CGG GAA

CMV Forward Primer (10 M)


PCR Product

Polyhistidine region

V5epitope V5 epitope stop Resistant T7 Terminator Trans1-T1 Phage 100 l x 5 Chemically Competent Cells AAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCAC CGCTGAGCAATAA CTAGCATAA CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG CTGAAAGGAGGAACTATATCCGGAT

T7 Terminator Primer

TTC CCG Gln PhePrimer Leu Glu (10 His M His) TK PolyA Reverse

AAG GGC CAA TTC CTC GAG CAC CAC CAC CAC CAC CAC TGAGATCCGGCTGCTAAC His His His His ACTCTAGGCCGACGATTG

&09

Description
pEASY -E1 (5715 bp)

Simple

CMV Forward Primer Binding Site

pEASY -M2 Expression Vector is designed for cloning and mammalian pEASY - M1 expression (5437 bp) of Tag-amplified PCR products. Enhanced CMV promoter for higher protein yield. Fast cloning. N-terminal Myc-tag for protein detection. Neomycin resistance gene stable cell line selection. CAC GCT GTT TTG ACC TCC ATA GAA GAC ACC GGG for ACC GAT CCA GCC TCC GGA CTC TAG AGG ATC

TGA CGC AAA TGG GCG GTA GGC GTG TAC GGT GGG AGG TCT ATA TAA GCA GAG CTC GTT ACT GCG TTT ACC CGC CAT CCG CAC ATG CCA CCC TCC AGA TAT ATT CGT CTC GAG CAA

Not I

TAG TGA ACC GTC AGA TCG CCT GGA GAC GCC ATC ATC ACT TGG CAG TCT AGC GGA CCT CTG CGG TAG GTG CGA CAA AAC TGG AGG TAT CTT CTG TGG CCC TGG CTA GGT CGG AGG CCT GAG ATC TCC TAG

GCC CTT CGG GAA

t Zero

Chapter 5

5276-5296 Cloning site: bases 7 pEASY -M2 TK PolyA Reverse Primer Binding Site TK polyA reverse primer binding site: bases 73-93 TK PolyA TK polyadenylation signal: bases 65-336 TAG TAA TGA GTT TAA ACG GGG GAG GCT AAC TGA AAC ACG GAA GGA GAC AAT ACC GGA AGG AAC CCG CGTAG C Mammal Expression Vector ATC ATT ACT CAA ATT TGC CTG TGG CCT TCC TTC f1 CTT GGATC G bases 372-800 replication origin: pEAS Y TTA -E2 CTC CGA TTG ACT TTG TGC CTT CCT - M2 pEAS Y CCC (5425 bp) SV40 early promoter: bases 805-1174 (5393 bp) Neomycin resistance gene: bases 1210-2004 SV40 polyadenylation signal: bases 2180-2310 pUC origin(c): bases 2693-3366 Ampicillin (bla) resistance gene(c): bases 3511-4371 CMV Forward Primer Binding Site bla promoter(c): bases 4372-4470 TGA CGC AAA TGG GCG GTA GGC GTG TAC GGT GGG AGG TCT ATA TAA GCA GAG CTC GTT Myc epitope: bases 18-47 ACT GCG TTT ACC CGC CAT CCG CAC ATG CCA CCC TCC AGA TAT ATT CGT CTC GAG CAA
PCR Product

V5 epitope CMV promoterbases 4739-5326 &09 myc epitope stop AAG GGC GAT CCG GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CMV forward primer binding site: bases TTC CCG CTA GGC CCA TTC GGA TAG GGATTG GGA GAG GAG CCA GAG CTA AGA TGC

Expression

TAG TGA ACC GTC AGA TCG CCT GGA GAC GCC ATC CAC GCT GTT TTG ACC TCC ATA GAA GAC ACC GGG ACC GAT CCA GCC TCC GGA CTC TAG AGG ATC ATC ACT TGG CAG TCT AGC GGA CCT CTG CGG TAG GTG CGA CAA AAC TGG AGG TAT CTT CTG TGG CCC TGG CTA GGT CGG AGG CCT GAG ATC TCC TAG

Myc epitope GCC CTT CGG GAA


PCR Product

AAG GGC GAT CCG GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG TTC CCG CTA GGC CTT GTT TTT GAG TAG AGT CTT CTC CTA GAC TK PolyA Reverse Primer Binding Site

TK PolyA

TAG TAA TGA GTT TAA ACG GGG GAG GCT AAC TGA AAC ACG GAA GGAGAC AAT ACC GGA AGG AAC CCG CGTAG C ATC ATT ACT CAA ATT TGC CCC CTC CGA TTG ACT TTG TGC CTT CCT CTG TTA TGG CCT TCC TTC CTT GGATC G

High quality products


132

Mammal Expression Vectors

Chapter 5

PROTOCOL
Cloning Reaction
(1)PCR Primer Design Do not add 5 phosphates to your primers for PCR. Forward Primer with Kozak consensus sequence is (G/A)NNATGG. Using Taq polymerase Add the products and vector in a tube, mix reaction gently and incubate for 5 minutes at room temperature (20-37oC).

Transformation
1. Add 2-4 l of the ligated products to 50 l of Trans1-T1 Competent Cells and mix gently (Do not mix by pipetting up and down). 2. Incubate on ice for 20-30 minutes. 3. Heat-shock the cells for 30 seconds at 42oC. 4. Immediately transfer the tubes on ice. 5. Add 250 l of room temperature SOC or LB medium. Shake the tubes at 37oC (200 rmp) for 1 hour. 6. In the meantime, mix 8 l of 500 mM IPTG with 40 l of 20 mg/ml X-gal. Spread evenly onto LB plates. Place the plate at 37oC for 30 minutes. 7. Spread 10-200 l transformant on the prewarmed plate. Incubate overnight at 37oC.

Analysis of Positive Clones


1. Transfer 2-6 white or light blue colonies into 10 l dH2O. 2. Use 1 l of the mixed as template for 25 l. PCR using M13 forward and M13 reverse primers. 3. Thermal cyding conditions for control insert 94oC 2-5 min 94oC 30 sec 55oC 30 sec 72 C
o

30 cycles

Chapter 5

X min*

(depends on the insert length and PCR enzymes) 4. Analyze the plasmids for insertion and orientation by restriction analysis or by sequencing. 5. Sequencing: The CMV Forward Primer and TK PolyA Reverse sequencing primers are included to help you sequence your insert. 6. Transfection 7. Using antibodies of the Myc epitope, to detect the fusion protein by western blot. 8. Stable Cell Lines: use G418 selecting stable cell lines.

Experssion

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


133

Chapter 6 Protein Molecular Weight Standards and Related Products


Unstained Protein Marker

ProteinRuler I ProteinRuler II ProteinRuler III ProteinRuler IV

136 136 137 137

Pre-Stained Protein Marker


Blue Plus Protein Marker 138 Blue Plus II Protein Marker 138 Blue Plus III Protein Marker 139

Western Blot Protein Marker


EasySee Western Marker 140 EasySee II Western Marker 141 EasySee Western Blot Kit 142 142 6Protein Loading Buffer Easy Protein Quantitative Kit 143
144 Protein IsoTM Ni-NTA Resin TM ProteinIso Ni-IDA Resin 146 Protein IsoTM GST Resin 148 TM ProteinIso Protein A Resin 150 ProteinIsoTM Protein G Resin 152

Related Products

Protein Purification

Protein Molecular Weight Standards and Related Products

Chapter 6

Selection Guide
Type Name Cat.No
SDS-PAGE Western Blot

Monitor migration in MW Range SDS-Page Gel


12-80 kDa 12-100 kDa 25-120 kDa 30-200 kDa 14-100 kDa 14-120 kDa 14-160 kDa 20-90 kDa 30-150 kDa

ProteinRuler I Unstained Protein Marker ProteinRuler II ProteinRuler III ProteinRuler IV Blue Plus Pre-Stained Protein Marker

DR101 DR201 DR301 DR401 DM101 DM111 DM121 DM201 DM211

Protein Marker Blue Plus II Protein Marker Blue Plus III Protein Marker EasySee Western Marker EasySee II Western Marker

Western Protein Marker

Chapter 6

ProteinRuler I
(12-80 kDa) kDa 80 60 40 30

ProteinRuler II
(12-100 kDa) kDa 100 80 60 50 40 30

ProteinRuler III
(25-120 kDa) kDa 120 100 80 65 50

ProteinRuler IV
(30-200 kDa) kDa 200 150 100 80 60

Blue Plus Protein Marker


(14-100 kDa)
kDa

Protein Molecular Weight Standards and Related Products

100 70 50 40 30 25

40

20

20

40 14

12

12

25

30

12% SDS-PAGEgel (5 l/well)

12% SDS-PAGEgel (5 l/well)

10% SDS-PAGEgel (5 l/well)

8% SDS-PAGEgel (5 l/well)

10% SDS-PAGEgel (5 l/well)

Blue Plus II Protein Marker


(14-120 kDa) kDa 120 100 70 50 40 30 25 14

Blue Plus III Protein Marker


(14-160 kDa) kDa 160 120 100 70 50

EasySee Western Marker


(20-90 kDa) kDa 90 75 60 kDa 85
prestained protein with orange dye

EasySee II Western Marker


(30-150 kDa) kDa 150 120 90 kDa 120
prestained protein with orange dye

45 40 30 25 25 20 14 X-ray film 10% SDS-PAGEgel (5 l/well) 10% SDS-PAGEgel (5 l/well) PVDF 10% SDS-PAGEgel (5 l/well)
prestained protein with blue dye

40

prestained protein with orange dye

60

40 30 X-ray film
prestained protein with blue dye

PVDF

10% SDS-PAGEgel (5 l/well)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


135

Chapter 6

Unstained Protein Marker

ProteinRuler I
(12-80 kDa)
Concentration
2 g/5 l for 12 kDa band; 1 g/5 l for 40 kDa band; 0.5 g/5 l for each of other bands
DR101-01 DR101-02 250 l 2250 l

Description
ProteinRuler I consists five unstained recombinant proteins (20 kDa, 30 kDa, 40 kDa, 60 Da, 80 kDa) and one prestained recombinant protein (12 kDa). It is supplied in ready-to-use format. Five unstained proteins and one prestained protein. Range from 12 kDa to 80 kDa. No mixing or reducing required.
ProteinRuler I
(12-80 kDa) kDa 80 60

Storage
at -20oC for two years

40 30

20

12

12% SDS-PAGEgel (5 l/well)

Protein Molecular Weight Standards and Related Products

ProteinRuler II
(12-100 kDa)
Concentration
2 g/5 l for 12 kDa band; 1 g/5 l for 50 kDa band; 0.5 g/5 l for each of other bands
DR201-01 DR201-02 250 l 2250 l

Chapter 6

Description
ProteinRuler II consists seven unstained recombinant proteins (20 kDa, 30 kDa, 40 kDa, 50 kDa, 60 Da, 80 kDa, 100 kDa) and one prestained recombinant protein (12 kDa). It is supplied in ready-to-use format. Seven unstained proteins and one prestained protein. Range from 12 kDa to 100 kDa. No mixing or reducing required.

ProteinRuler II
(12-100 kDa) kDa 100 80 60 50 40 30

Storage
at -20oC for two years

20

12

12% SDS-PAGEgel (5 l/well)

High quality products


136

Unstained Protein Marker

Chapter 6

ProteinRuler III
(25-120 kDa)
Concentration
2 g/5 l for 25 kDa band; 1 g/5 l for 65 kDa band; 0.5 g/5 l for each of other bands
DR301-01 DR301-02 250 l 2250 l

Description
ProteinRuler III consists six unstained recombinant proteins (40 kDa, 50 kDa, 65 kDa, 80 kDa, 100 Da, 120 kDa) and one prestained recombinant protein (25 kDa). It is supplied in ready-to-use format. Six unstained proteins and one prestained protein. Range from 25 kDa to 120 kDa. No mixing or reducing required.
ProteinRuler III
(25-120 kDa) kDa 120 100 80 65 50

Storage
at -20oC for two years

40

25

prestaincd protein with blue dye

10% SDS-PAGE gel (5 l/well)

Chapter 6
Protein Molecular Weight Standards and Related Products

ProteinRuler IV
(30-200 kDa)
Concentration
2 g/5 l for 30 kDa band; 1 g/5 l for 100 kDa band; 0.5 g/5 l for each of other bands
DR401-01 DR401-02 250 l 2250 l

Description
ProteinRuler IV consists six unstained recombinant proteins (40 kDa, 60 kDa, 80 kDa, 100 kDa, 150 Da, 200 kDa) and one prestained recombinant protein (30 kDa). It is supplied in ready-to-use format. Six unstained proteins and one prestained protein. Range from 30 kDa to 200 kDa. No mixing or reducing required.

ProteinRuler IV
(30-200 kDa) kDa 200 150 100 80 60

Storage
at -20oC for two years

40
prestained protein with blue dye

30

8% SDS-PAGEgel (5 l/well)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


137

Chapter 6

Pre-Stained Protein Marker

Blue Plus Protein Marker


(14-100 kDa)
Concentration
about 2 g/5 l for each of bands
DM101-01 DM101-02 250 l 2250 l

Description
Blue Plus Protein Marker Protein Marker consists seven recombinant proteins ranging from 14 kDa to 100 kDa. The protein of 50 kDa is covalently coupled to orange dye. The protein of 14 kDa is covalently coupled to yellow dye. The other five proteins are covalently coupled to blue dye. After SDS-PAGE gel electrophoresis, transferred to PVDF or NC membrane, five clear blue protein bands and an orange protein bands are gained and show the direction at the same time. Five blue bands and one orange band. Range from 14 kDa to 100 kDa. No mixing or reducing required.

Blue Plus Protein Marker


(14-100 kDa) kDa

Storage
at -20oC for two years

100 70 50 40 30 25 14

12% SDS-PAGEgel (5 l/well)

Protein Molecular Weight Standards and Related Products

Blue Plus II Protein Marker


(14-120 kDa)
Concentration
about 2 g/5 l for each of bands
DM111-01 DM111-02 250 l 2250 l

Chapter 6

Description
Blue Plus II Protein Marker consists eight recombinant proteins ranging from 14 kDa to 120 kDa. The protein of 50 kDa and 120 kDa are covalently coupled to orange dye. The proteins of 14 kDa is covalently coupled to yellow dye. The other five proteins are covalently coupled to blue dye. After SDS-PAGE gel electrophoresis, transferred to PVDF or NC membrane, clear color protein bands are gained and show the direction at the same time. Five blue bands, two orange bands and one yellow band. Range from 14 kDa to 120 kDa. No mixing or reducing required.

Blue Plus II Protein Marker


(14-120 kDa) kDa 120 100 70 50 40 30 25 14

Storage
at -20 C for two years
o

12% SDS-PAGEgel (5 l/well)

High quality products


138

Pre-Stained Protein Marker

Chapter 6

Blue Plus III Protein Marker


(14-160 kDa)
Concentration
about 2 g/5 l for each of bands
DM121-01 DM121-02 250 l 2250 l

Description
The Blue Plus III Protein Marker consists nine recombinant proteins ranging from 14 kDa to 160 kDa. The protein of 50 kDa,120 kDa and 160 kDa are covalently coupled to orange dye. The proteins of 14 kDa is covalently coupled to yellow dye. The other five proteins are covalently coupled to blue dye. After SDS-PAGE gel electrophoresis, transferred to PVDF or NC membrane, clear color protein bands are gained and show the direction at the same time. Five blue bands, and two orange bands,and one yellow band. Range from 14 kDa to 160 kDa. No mixing or reducing required.
Blue Plus III Protein Marker
(14-160 kDa) kDa 160 120 100 70 50 40 30 25 14

Storage
at -20 C for two years
o

10% SDS-PAGE(5 l/well)

Chapter 6
Protein Molecular Weight Standards and Related Products

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


139

Chapter 6

Western Blot Protein Marker

EasySee Western Marker


(20-90 kDa)
DM201-01 DM201-02 withEasySee Western Blot Kit DM201-11 DM201-12 250 l 2250 l 250 l+100 ml 2250 l+200 ml

Storage
at -20 C for two years
o

Description
EasySee Western Marker consists eight recombinant proteins ranging from 20 kDa to 90 kDa. Protein bands of 20, 45 and 85 kDa are prestained allowing easy identification and monitoring of your proteins during electrophoresis. Other five proteins contain several IgG binding sites, allowing marker visualization using the same reagents and protocol for your target proteins. These no-dye-detached proteins result in more accurate molecular weight estimation. Prestained bands for monitoring electrophoresis. Visualizing molecular weight mark on western blots with the commonly used immuno-detection method. Ready-to-use format.
EasySee Western Marker
(20-90 kDa) kDa 90 75 60 kDa 85
prestained protein with orange dye

45 40
prestained protein with orange dye

25 20
prestained protein with blue dye

Protein Molecular Weight Standards and Related Products

X-ray film

PVDF 10% SDS-PAGEgel (5 l/well)

Chapter 6

High quality products


140

Western Blot Protein Marker

Chapter 6

EasySee II Western Marker


(30-150 kDa)
withEasySee Western Blot Kit DM211-01 DM211-02 DM211-11 DM211-12 250 l 2250 l 250 l+100 ml 2250 l+200 ml

Storage
at -20oC for two years

Description
EasySee II Western Marker consists seven recombinant proteins ranging from 30 kDa to 150 kDa. Protein bands of 30 kDa and 120 kDa are prestained allowing easy identification and monitoring of your proteins during electrophoresis. Other five proteins contain several IgG binding sites, allowing marker visualization using the same reagents and protocol for your target proteins. These no-dyedetached proteins result in more accurate molecular weight estimation. Prestained bands for monitoring electrophoresis. Visualizing molecular weight mark on western blots with the commonly used immuno-detection method. Ready-to-use format.

EasySee II Western Marker


(30-150 kDa) kDa 150 120 90 kDa 120
prestained protein with orange dye

60

40 30
prestained protein with blue dye

X-ray film

PVDF

10% SDS-PAGEgel (5l/well)

Chapter 6
Protein Molecular Weight Standards and Related Products

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


141

Chapter 6

Related Products

EasySee Western Blot Kit


Kit Components
Solution A Luminol Solution B Oxidant Solution C Light intensifier

DW101-01 DW101-02

100 ml 200 ml

Description
EasySee Western Blot Kit is optimized for enhanced chemiluminescence detection of western blots. Kit can be used in conjugation with chemiluminescence peroxidase enzyme HRP and related antigen. High sensitivity luminal reagent. Extended exposure time.

Storage
at 4oC in dark for two years

PROTOCOL
Procedures
1.After electrophoresis, transfer proteins onto PVDF or NC membrane. Probe membrane with primary antibody followed by HRP-conjugated secondary antibody. Wash membrane three times. 2. Mix equal volume of Solution A with Solution B. Add 0.05%-0.1% (v/ v) of Solution C to the mix (for example 1-2 l of Solution C to 2 ml of Solution A + Solution B). 3. Add the mixed solution to the membrane (0.125 ml of reagent per cm2 membrane). Incubate at room temperature for 1 minute. 4. Drain off excess solution from the blot. Do not let the membrane dye. Wrap the membrane with plastic wrap. 5. Expose the membrane to x-ray file for 1 minute. Develop the film.

Chapter 6

Protein Molecular Weight Standards and Related Products

Other company Trans


15 l 24 l 33 l 42 l

6Protein Loading Buffer


GL101-01 1 ml

Storage
at 4oC for two years

Description
6Protein Loading Buffer is used to prepare protein markers and samples for SDS-PAGE gel electrophoresis.

High quality products


142

Related Products

Chapter 6

Easy Protein Quantitative Kit


DQ101-01 100ml

Components
Coomassie brilliant blue dye solution 100 ml BSA solution (0.22 mg/ml): 41 ml

Description
Easy Protein Quantitative Kit is for measuring protein concentration using Bradford method in which a differential color change of Coomassie Brilliant Blue G-250 dye occurs in response to various concentrations of protein.

Storage
B S A s o l u t i o n a t - 2 0 oC f o r t w o y e a r s ; Coomassie brilliant blue dye ( protect from light) at 4oC for one year

PROTOCOL
Procedures
1. Warm Coomassie brilliant blue dye to room temperature. 2. Prepare dilutions of BSA standards in microfuge tubes as described in the table BSA (l) 0 10 30 50 70 90 100 dH2O (l) 100 90 70 50 30 10 0 3. Prepare a few sample dilutions. 4. Add 1.0 ml Coomassie brilliant blue dye to each tube, and vortex. Incubate at room temperature for 5-10 minutes. 5. Measure absorbance at 595 nm and note the numerical value.
OD595 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1  0.099 0 5 10 g/ml 15 20 25 0.268 y = 0.042x 2 R = 0.99 0.756 0.603 0.432

Chapter 6
Protein Molecular Weight Standards and Related Products

0.829

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


143

Chapter 6

Related Products

ProteinIsoTM Ni-NTA Resin


Storage
at 2~8oC (20% ethanol) for two years

DP101-01 DP101-02

5 ml 25 ml

Description
ProteinIso TM Ni-NTA Resin is used for one-step purification of Histagged proteins. The His-Tagged proteins bind to Ni2+ cations, which are immobilized on the Ni-NTA Resin. After unbound proteins are washed away, the target proteins are recovered by elution. The kit is suitable for both native or denatured condition.

Resin Specifications
Norm Resin Ligand Sharp Pore size Binding capacity 6% agarose NTA sphere 45-165 m 10-20 mg of proteis/ml <300 cm/h 0.3 Mpa 3-13

Protein Molecular Weight Standards and Related Products

Flow rate Highest resistance of atmospheric pressure pH stability

PROTOCOL
Chapter 6
Notes
Samples should be centrifuged and filtrated before loading. Equilibration Buffer for soluble protein: 300 mM NaCl; 50 mM sodium phosphate buffer;10 mM imidazole, 0.01 M Tris-Cl pH 8.0. Equilibration Buffer for inclusion body: 6 M GuHCl; 0.1 M sodium phosphate buffer; 8 M urea; 0.1 M sodium phosphate buffer; 0.01 M Tris-Cl pH 8.0.

Procedures
1. Prepare cell lysis 2. Prepare Ni-NTA column (a) Resuspend the Ni-NTA resin in its bottle by inverting. (b) Transfer the resin into a purification column. Allow the resin to settle. (c) Wash the column with 5~10 bed volume of equilibration buffer. 3. Prepare samples Mix cell lysis with equilibration buffer. To avoid blocking column, samples should be centrifuged and filtrated before loading. 4. Loading samples and washing. 5. Elution. 6. Resin Regeneration.

High quality products


144

Related Products

Chapter 6

(1) 2 bed volumes of 6 M GuHCl, 0.2 M acetic acid (2) 5 bed volumes of deionized water (3) 3 bed volumes of 2% SDS (4) 1 bed volumes of 25% ethanol (5) 1 bed volumes of 50% ethanol (6) 1 bed volumes of 75% ethanol (7) 5 bed volumes of 100% ethanol (8) 1 bed volumes of 75% ethanol (9) 1 bed volumes of 50% ethanol (10) 1 bed volumes of 25% ethanol (11) 1 bed volumes of deionized water (12) 5 bed volumes of 100 mM EDTA, pH 8.0 (13)10 bed volumes of deionized water (14) 5 bed volumes of 100 mM NiSO4
1 2 M 3 4 5 6 7 8 Target Protein

Chapter 6
Protein Molecular Weight Standards and Related Products

M: ProteinRuler III Lane 1: Crude lysis Lane 2: Lysis after filtration Lane 3: Flow-through liquid of wash Lane 4: Flow-through liquid of elution (imidazole 40mM) Lane 5: Flow-through liquid of elution (imidazole 80mM) Lane 6: Flow-through liquid of elution (imidazole 120mM) Lane 7: Flow-through liquid of elution (imidazole 160mM) Lane 8: Flow-through liquid of elution (imidazole 200mM)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


145

Chapter 6

Related Products

ProteinIsoTM Ni-IDA Resin


Storage
at 2~8 C (20% ethanol) for two years
o

DP111-01 DP111-02

5 ml 25 ml

Description
ProteinIso TM Ni-IDA Resin is used for one-step purification of Histagged proteins. The His-Tagged proteins bind to Ni2+ cations, which are immobilized on the Ni-IDA Resin. After unbound proteins are washed away, the target proteins are recovered by elution. The kit is suitable for both native and denatured protein purification.

Resin Specifications
Norm Resin Ligand Sharp Pore size Binding capacity Flow rate 6% agarose IDA sphere 90 m 20-40 mg of proteis/ml <300 cm/h 0.3 Mpa 2-14

Protein Molecular Weight Standards and Related Products

Highest resistance of atmospheric pressure pH stability

PROTOCOL
Notes
Samples should be centrifuged and filtrated before loading. Equilibration Buffer for soluble protein: 300 mM NaCl; 50 mM sodium phosphate buffer;10 mM imidazole, 0.01 M Tris-Cl pH 8.0. Equilibration Buffer for inclusion body: 6 M GuHCl; 0.1 M sodium phosphate buffer; 8 M urea; 0.1 M sodium phosphate buffer; 0.01 M Tris-Cl pH 8.0.

Chapter 6

Procedures
1.Prepare cell lysis 2.Prepare Ni-IDA column (a)Resuspend the Ni-IDA resin in its bottle by inverting. (b)Transfer the resin into a puriication column. Allow the resin to settle. (c)Wash the column with 5~10 bed volume of equilibration buffer. 3.Prepare samples Mix cell lysis with equilibration buffer. To avoid blocking column. samples should be centrifuged and filtrated before loading. 4.Loading samples and washing. 5.Elution. 6.Resin Regeneration.

High quality products


146

Related Products

Chapter 6

(1) 2 bed volumes of 6 M GuHCl, 0.2 M aceti (2) 5 bed volumes of deionized water (3) 3 bed volumes of 2% SDS (4) 1 bed volumes of 25% ethanol (5) 1 bed volumes of 50% ethanol (6) 1 bed volumes of 75% ethanol (7) 5 bed volumes of 100% ethanol (8) 1 bed volumes of 75% ethanol (9) 1 bed volumes of 50% ethanol (10) 1 bed volumes of 25% ethanol (11) 1 bed volumes of deionized water (12) 5 bed volumes of 100 mM EDTA, pH 8.0 (13)10 bed volumes of deionized water (14) 5 bed volumes of 100 mM NiSO4

Target Protein

Chapter 6
Protein Molecular Weight Standards and Related Products

Lane 1: Crude lysis Lane 2: Lysis after filtration M: ProteinRuler II Lane 3: Flow-through liquid of wash Lane 4: Flow-through liquid of elution (imidazole 40mM) Lane 5: Flow-through liquid of elution (imidazole 80mM) Lane 6: Flow-through liquid of elution (imidazole 120mM) Lane 7: Flow-through liquid of elution (imidazole 160mM) Lane 8: Flow-through liquid of elution (imidazole 200mM)

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


147

Chapter 6

Related Products

ProteinIsoTM GST Resin


DP201-01 10 ml

Storage
at 2-8 C(20% ethanol)for two year
o

Description
ProteinIso TM GST Resin is designed for one-step purification of GSTtagged proteins. GST fusion proteins expressed in E.coli, insect cells and mammalian cells can be purified with ProteinIsoTM GST Resin.

Resin Specifications
Resin Ligand Sharp Bead diameter Support density Binding capacity Maximum flow rate Recommended flow rate Maximum pressure pH stability Cross-linked 4% agarose glutathione sphere 90 m 8 mg GSH/ml wet gel 10-12 mg/ml wet gel(MW 42 kDa) 3.5 mg/ml wet gel(rat liver) 450 cm/h <150 cm/h 0.3 Mpa 3-10

Protein Molecular Weight Standards and Related Products

Procedures
1 .Equilibration Equilibrate the resin with 5-10 columes of equilibration buffer. 2. Prepare sample Prepare sample by mixing protein extract with Equilibration Buffer. To avoid blocking column, sample should be centrifuged and filtrated . 3. Wash Wash the resin with five-ten resin-bed volumes of Equilibration Buffer, collect the flow-through in a tube. 4. Elute Elute GST-tagged proteins from the resin with elution buffer. 5. Resin Regeneration (1). 2 bed volumes of 6 M GuHCl, 0.2 M acetic acid and 5 bed volumes of deionized water or PBS buffer. (2). 3-4 bed volumes of 70% ethanol or 30% isopropanol and 3-5 bed volumes of deionized water. (3). 2 bed volumes of 10-100 mM NaOH and 10 bed volumes of deionized water.

Chapter 6

High quality products


148

Related Products

Chapter 6

PROTOCOL
Notes
To avoid blocking column, sample should be centrifuged, and filtrate with filter before loading To avoid cross-contamination, we suggest not using the same medium for purification of different proteins. Equilibration Buffer: 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3 Elution Buffer: 50 mmTris-Cl pH 8.0, 10 mM reduced glutathione (GSH concentration needs adjustment according to the adhesion strength of the target protein.Glutathione needs configuration before use)
1 2 M 3 4 5 6 7

Lane 1Crude lysis Lane 2Lysis after filtration M: ProteinRuler II Lane3Flow-through liquid of wash Lane4-7Flow-through liquid of elution(10 mM GSH)

Chapter 6
Protein Molecular Weight Standards and Related Products

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


149

Chapter 6

Related Products

ProteinIsoTM Protein A Resin


D301-01 5 ml

Storage
at 2-8oC(20% ethanol)for two years

Description
ProteinIsoTM Protein A Resin is an affinity chromatography medium designed for easy, one-step purification of classes, subclasses and fragments of IgGs. The recombinant protein G ligand is coupled to 4% of highly cross-linked agarose.
Parameters Resin Ligand Sharp Bead diameter Support density Binding capacity Maximum flow rate(45oC) Recommended flow rate Maximum pressure pH stability Storage Indicators Cross-linked 4% agarose r-Protein A sphere 90 m (45-165) 6 mg Protein A/ml wet gel 40-50 mg h-IgG /ml wet gel 300 cm/h <150 cm/h 0.3 Mpa (3 bar) 3-10 (for long time);2-11(for short time) 2-8oC (20% ethanol)

Protein Molecular Weight Standards and Related Products

PROTOCOL
Procedures
1 .Equilibration Equilibration the resin with 5-10 column volumes of equilibration buffer (20 mM PB, 0.15 M KCl, pH7.0) to stable conductance and PH of effluent (consistent to equilibration buffer ). 2. Prepare sample. Prepare sample by mixing protein extract with equilibration buffer. To avoid blocking column, sample should be centrifuged or filtrated through a 0.45m filter before using. 3. Wash Wash the resin with five-ten beds volumes of equilibration buffer, and collect the flow-through in a tube. 4. Elute Elute antibodies with elution buffer (20 mM citric acid, pH 3.0-4.0;or 0.1 M glycocoll,pH 3.0;or 20 mM sodium acetate,pH 3.0-4.0). Collect the neutralize containing the target immunoglobulin and immediately neutralized to pH>7.0 with Neutralization Buffer (such as 1M Tris-HCl, pH 9.0). The elution conditions are closely related with binding strength and stability of antibody. Optimize the elution buffer if needed.

Chapter 6

High quality products


150

Related Products

Chapter 6

5. Resin Regeneration (1). 3-5 beds volumes of 0.1 M citric acid or 0.1 M citric acid /20% ethanol and 5 beds volumes of PBS buffer(pH=7.0). (2). or 3-5 beds volumes of 0.05 M NaOH +1 M NaCl or 6 M guanidine hydrochloride, and 3-5 beds volumes of deionized water.
M 1 2 3 4

lgG Heavy chain

lgG Light chain

M: ProteinRuler II Lane11 l Horse Serum Lane2100 l Horse Serum20 l Protein A Lane 3200 l Horse Serum with20 l Protein A Lane4400 l Horse Serum with20 l Protein A

Chapter 6
Protein Molecular Weight Standards and Related Products

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


151

Chapter 6

Related Products

ProteinIsoTM Protein G Resin


D401-01 5 ml

Storage
at 2-8oC(20% ethanol)for two years

Description
ProteinIsoTM Protein G Resin is an affinity chromatography medium. The recombinant protein G ligand is coupled to highly cross-linked agarose. This coupling is optimized to give high binding capacity for IgGs. ProteinIsoTM Protein G Resin is suitable for easy, one-step purification of classes, subclasses and fragments of IgGs, such as IP CoIP . etc.
Parameters Resin Ligand Sharp Bead diameter Support density Binding capacity Indicators Cross-linked 4% agarose r-Protein G sphere 90 m (45-165) -3mg Protein G/ml wet gel 20-25 mg h-IgG/ ml wet gel 300 cm/h <150 cm/h 0.3Mpa (3 bar) 3-10 (for long time);2-11(for short time) 2-8oC (20% ethanol)

Protein Molecular Weight Standards and Related Products

Maximum flow rate(25oC) Recommended flow rate Maximum pressure pH stability Storage

Chapter 6

PROTOCOL
Procedures
1 .Equilibration E quilibration the resin with 5-10 column volumes of equilibration buffer(20 mM PB, 0.15 M KCl, pH7.0) to stable conductance and pH of effluent (consistent to equilibration buffer ). 2. Prepare sample. Prepare sample by mixing protein extract with equilibration buffer. To avoid blocking column, sample should be centrifuged or filtrated through a 0.45m filter before using. 3. Wash Wash the resin with five-ten beds volumes of equilibration buffer and collect the flow-through in a tube. 4. Elute Elute antibodies with elution buffer(20 mM citric acid, pH 3.0-4.0;or 0.1 M glycocoll,pH 3.0;or 20 mM sodium acetate,pH 3.0-4.0).Collect the eluate containing the target immunoglobulin and immediately neutralize to pH>7.0 with Neutralization Buffer (such as 1M TrisHCl,pH 9.0). The elution conditions are closely related with binding strength and stability of antibody, when necessary, optimize the elution buffer.

High quality products


152

Related Products

Chapter 6

5. Resin Regeneration (1). 3-5 beds volumes of 0.1 M citric acid or 0.1 M citric acid /20% ethanol and 5 beds volumes of PBS buffer(pH=7.0). (2). or 3-5 beds volumes of 0.05 M NaOH +1 M NaCl or 6 M guanidine hydrochloride, and 3-5 beds volumes of deionized water.

lgG Heavy chain

lgG Light chain

M: ProteinRuler II Lane11 l Horse Serum Lane2100 l Horse Serum20 l Protein A Lane 3200 l Horse Serum with20 l Protein A Lane4400 l Horse Serum with20 l Protein A

Chapter 6

Resources

IgGsubclasses IgG1 IgG2 IgG3 IgG4 IgG1 IgG2a IgG2b IgG3 IgG IgG IgG IgG IgG IgG IgG

human

mice

rabbit goat horse dog cattle pig monkey

Protein A binding capacity ++++ ++++ ++++ + ++++ +++ ++ ++++ ++ ++ ++ +++ ++++

Protein G binding capacity ++++ ++++ ++++ ++++ ++++ ++++ +++ +++ +++ ++ ++++ + ++++ +++ ++++

Protein Molecular Weight Standards and Related Products

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


153

Chapter 7 Cell Biology

TransSerum Fetal Bovine Serum 155 TransLipid TM Transfection Reagent 156 Penicillin-Streptomycin (100) 158
L-Glutamine (100)
158

Trypsin (0.25%,with EDTA and Phenol Red) 158 G418 158 Single-Luciferase Reporter Assay Kit 159 Doubel-Luciferase Reporter Assay Kit 160

Cell Biology

Chapter 7

TransSerum Fetal Bovine Serum


FS101-01 FS101-02 100 ml 5100 ml

Storage
at -20oC for five years

Description
TransSerum Fetal Bovine Serum is the most widely used undefined supplement in mammalian cell culture. The raw material used in this product is collected from healthy fetal blood, followed by filtration through 0.1 M filters, three times.

Physical Properties
pH Osmolality Total proteins Albumin Endotoxin IgG Hemoglobin Test of germ, mycete, bacteria phage Test of mycoplasma Test of virus 7.0-7.5 280-340 mOsmol/kg 3.0-3.5 g/dl 1.8-2.45 g/dl <10 EU/ml <100 ug/ml <20 mg/dl Negative Negative Negative

Chapter 7
Cell Biology

Notes
This product is not heat inactivated. If needed, incubate thawed FBS at 56oC, water bath for 30 minutes to inactivate complement.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


155

Chapter 7

Cell Biology

TransLipid TM Transfection Reagent


High efficient , Low toxin
Description
TransLipidTM Transfection Reagent is a proprietary formulated cationic lipid that offers superior transfection efficiency across a broad range of mammalian cell lines. High transfection. Transfect DNA and/or RNA. Adherent or suspension cells. Can be used in the presence of serum.
FT101-01 FT101-02 0.75 ml 20.75 ml

Storage
at 2-8oC for one year(Avoid freezing)

Chapter 7

Cell Biology

PROTOCOL
Plasmid DNA Transfection
Use 24-well format as example. To transfect cells in other formats, see the table on the next page. 1. Adherent cells: One day before transfection, plate 0.5-2105cells in 500 l of growing medium without antibiotics so that cells well be 9095% confluent at the time of transfection. Suspension cells: Just prior to preparing complexes, plate 4-8105 cell in 500 l of growing medium without antibiotics. 2. For each transfection sample, prepare complexes as follow: a. Dilute 0.8 g DNA in 50 l of Opti-MEM I Reduced Serum Medium without serum. Mix gently. b. Mix TransLipidTM gently before use, then dilute 2l TransLipidTM in 50 l of Opti-MEM I Medium. Incubate for 5 minutes at room temperature. c. After the 5 minutes incubation, combine the diluted DNA with diluted TransLipidTM. Mix gently and incubate for 20 minutes at room temperature. 3. Add the DNA- TransLipidTM complexes to each well containing cells and medium. Mix gently by rocking the plate back and forth. 4. Incubate cells at 37oC in a CO2 incubator for 18-48 hours prior to testing for transgene expression. Medium may be changed after 4-6 hours. 5. For stable cell lines: Passage cells at 1:10 into fresh growth medium 24 hours after transfection. Add selective medium in the following day.

High quality products


156

Cell Biology

Chapter 7

siRNA Transfection
1. One day before transfection, plate cells in 500 l of growing medium without antibiotics so that cells well be 30-50% confluent at the time of transfection. 2. For each transfection sample, prepare complexes as follows: a. Dilute 20 pmol siDNA oligomer in 50 l of Opti-MEM I Reduced Serum Medium without serum. Mix gently. b. Mix TransLipidTM gently before use, then dilute 1 l TranslipidTM in 50 l of Opti-MEM I Medium. Mix gently and incubate for 5 minutes at room temperature. c. After the 5 minutes incubation, combine the diluted DNA with diluted TranslipidTM. Mix gently and incubate for 20 minutes at room temperature. 3. Add the oligomer- TranslipidTM complexes to each well containing cells and medium. Mix gently by rocking the plate back and forth. 4. Incubate cells at 37oC in a CO2 incubator for 24-96 hours until you are ready to assay for gene knockdown. Medium may be changed after 4-6 hours.

Chapter 7
Cell Biology

Notes
For high transfection efficiency, use of high cell density (90%- 95%) is suggested.

Dosage of culture medium, nucleic acid and TransLipid in transfection of different cell culture plate.
Culture Vessel 96-well 24-well 12-well 6-well 35-well 60-mm 10-cm Surface Area per Well (cm2) 0.3 2 4 10 10 20 60 Relative Surface Area (vs. 24-well) 0.2 1 2 5 5 10 30 Volume of Plating Medium 100 l 500 l 1 ml 2 ml 2 ml 5 ml 15 ml DNA (g) and Dilution Volume (l) 0.2 g in 25 l 0.8 g in 50 l 1.6 g in 100 l 4.0 g in 250 l 4.0 g in 250 l 8.0 g in 0.5 ml 24 g in 1.5 ml

TransLipid TM
2000 (l) and Dilution Volume (l) 0.5 l in 25 l 2.0 l in 50 l 4.0l in 100 l 10 l in 250 l 10 l in 250 l 20 l in 0.5 ml 60 l in 1.5 ml

siRNA (g) and Dilution Volume (l) 5 pmol 20 pmol 40 pmol 100 pmol 100 pmol 200 pmol 600 pmol

TransLipid TM
2000 (l) and Dilution Volume (l) 0.5 l in 25 l 2.0 l in 50 l 4.0l in 100 l 10 l in 250 l 10 l in 250 l 20 l in 0.5 ml 60 l in 1.5 ml

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


157

Chapter 7

Cell Biology

Penicillin-Streptomycin (100)
Storage
-20C for one year

FG101-01

100 ml

Description
Penicillin-Streptomycin(100) including penicillin 10 kU/ml and streptomycin 10mg/ml can be used for cell culture. It has been filter-sterilized, and its final working concentration is 1.

Note
Packing after thawing: avoiding repeated freezing and thawing. 4C storage time is not more than two weeks. Cell Biology

L-Glutamine (100)
Storage
-20C for one year

FG201-01

100 ml

Description
L- Glutamine (100) including L- Glutamine 200 mM can be used for cell culture. It has been filter-sterilized, and its final working concentration is 1.

Chapter 7

Note
Packing after thawing, avoiding repeated freezing and thawing. 4 C storage time is not more than two weeks.

Trypsin (0.25%,with EDTA and Phenol Red)


FG301-01 100 ml

Storage
-20C for 18 months

Description
Trypsin use porcine trypsin (2.50 g/L) as the main raw material, together with the EDTA 0.38 g / L and phenol red, does not contain calcium and magnesium ions. Product which has been filter-sterilized, can be directly used for the dissociation of organization and cell monolayer. This product has been porcine parvovirus and mycoplasma assayed, digests fast and with low toxicity.

Note
Optimal digestion time should be determined depending on the nature of the different tissues and cells, digestion time not too long, so as not to affect cell activity. Packing after thawing, avoiding repeated freezing and thawing. 4C storage time is not more than two weeks.

G418
Storage
2-8C for two years

FG401-01

5 ml

Description
G418 is aminoglycoside used as a selective agent of transfected mammalian, yeast, plant and bacteria cells. G418 blocks polypeptide synthesis by inhibiting the elongation step in both prokaryotic and eukaryotic cells. G418 also known as geneticin, is a broad-spectrum antibiotic that will select mammalian cells expressing the neomycin protein (encoded by the neomycin gene). Selection in mammalian cells is usually achieved in three to seven days with concentrations ranging from 400 to 1000 g/ml.

High quality products


158

Cell Biology

Chapter 7

Single-Luciferase Reporter Assay Kit


FR101-01 FR101-02 50 rxns 200 rxns

Storage
at -20 C in the dark for one year. Reconstituted luciferase assay reagent (Substrate in Reaction Buffer) should be stored in aliquots at -20oC for one month and at -70oC for one year
o

Description
Firefly luciferase has been widely used as a reporter for studying gene regulation and function in mammalian cells and tissues due to its sensitivity and the absence of endogeneous luciferase activity in mammalian cells. Single-Luciferase Reporter Assay Kit is an improved version of conventional luciferase assay with high sensitivity.
Components Luciferase Reaction Buffer Luciferase Reaction Substrate (Lyophilized) Cell Lysis Buffer (5) FR101-01 (50 rxns) 5 ml 1 vial 5 ml FR101-02 (200 rxns) 20 ml 4 vials 20 ml

Chapter 7
Cell Biology

Procedures:
1. Prepare 1xCell Lysis Buffer Add one volume of 5xCell Lysis Buffer to 4 volume of dH2O. 1xCell Lysis Buffer can be stored at 4oC for 1 month. 2. Prepare Luciferase Reaction Reagent Dissolve the lyophilized Luciferase Reaction Substration(whole vial) by adding 5 ml of Luciferase Reaction Buffer to the vial. The prepared Luciferase Reaction Reagent should be used within one day. 3. Prepare Cell Lysate Wash cells twice with PBS. Add 1xCell Lysis Buffer. Well 6 12 24 48 96 Lysis Buffer / well 500 l 250 l 100 l 60 l 20 l

Incubate at room temperature for 10 minutes. Scrape the cells. Centrifuge at 12,000xg for 10 minutes at 4oC. Transfer the supernatant to a new tube. 4. Assay Mix 20 l lysate with 100 l of Luciferanse Reaction Reagent. Place the tube in luminometer to measure luciferase. Record the assay.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


159

Chapter 7

Cell Biology

Double-Luciferase Reporter Assay Kit


FR201-01 FR201-02 50rxns 200rxns

Storage
at -20 C in the dark for one year; Reconstituted luciferase assay reagent (Substrate in Reaction Buffer) should be stored in aliquots at -20oC for one month and -70oC for one year
o

Description
Double-Luciferase Reporter Assay Kit provides an efficient means of performing dual-reporter assays. In the assay, the activities of firefly (Photinus pyralis) and Renilla (sea pansy) luciferases are measured sequentially from a single sample. The firefly luciferase reporter is measured first by adding Luciferase Reaction Reagent to generate a stabilized luminescent signal. After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is simultaneously initiated by adding Luciferase Reaction Reagent II to the same tube.
Components Luciferase Reaction Buffer Luciferase Reaction Substrate (Lyophilized) Luciferase Reaction Buffer II Luciferase Reaction Substrate II (50x) Cell Lysis Buffer (5x) FR201-01 (50 rxns) 5 ml 1 vial 5 ml 100 l 5 ml FR201-02 (200 rxns) 20 ml 4 vials 20 ml 400 l 20 ml

Chapter 7

Cell Biology

Procedures
1. Prepare Luciferase Reaction Reagent Dissolve the lyophilized Luciferase Reaction Substration (whole vial) by adding 5 ml of Luciferase Reaction Buffer to the vial. The prepared Luciferase Reaction Reagent should be stored in the dark. 2. One volume of Luciferase Reaction Substrate II to 50 volume of Luciferase Reaction Buffer II. Luciferase Reaction Reagent II can be stored in the dark. 3. Prepare 1xCell Lysis Buffer One volume of 5xCell Lysis Buffer to 4 volume of dH2O.1xCell Lysis Buffer can be stored at 4oC for 1 month. 4. Prepare Cell Lysate Wash cells twice with PBS. Add 1xCell Lysis Buffer. Incubate at room temperature for 10 minutes. Scrape the cells. Centrifuge at 12,000xg for 10 minutes at 4oC. Transfer the supernatant to a new tube. 5. Mix 20 l lysate with 100 l of Luciferanse Reaction Reagent. Place the tube in luminometer to measure the firefly luciferase. Record the assay. Then, add Luciferanse Reaction Reagent II to the tube, place the tube in luminometer to measure the Renilla luciferase.

High quality products


160

Chapter 8 Antibodies
Primary Antibodies

Anti-c-Myc Mouse Monoclonal Antibody Anti-Flag Mouse Monoclonal Antibody Anti-HA Mouse Monoclonal Antibody Anti-V5 Mouse Monoclonal Antibody Anti-His Mouse Monoclonal Antibody Anti-GST Mouse Monoclonal Antibody Anti-MBP Mouse Monoclonal Antibody Anti-GFP Mouse Monoclonal Antibody

Control Antibodies

Anti--Tubulin Mouse Monoclonal Antibody Anti--Actin Mouse Monoclonal Antibody Anti-GAPDH Mouse Monoclonal Antibody

Secondary Antibodies

Goat Anti-Rabbit IgG(H+L), HRP Conjugate Goat Anti-Rabbit IgG(H+L), FITC Conjugate Goat Anti-Rabbit IgG(H+L), PE Conjugate Goat Anti-Rabbit IgG(H+L), AF488 Conjugate Goat Anti-Mouse IgG(H+L), HRP Conjugate Goat Anti-Mouse IgG(H+L), FITC Conjugate Goat Anti-Mouse IgG(H+L), PE Conjugate Goat Anti-Mouse IgG(H+L), AF488 Conjugate

Antibodies

Chapter 8

Primary Antibodies

Chapter 8

Anti-c-Myc Mouse Monoclonal Antibody


HT101-01 HT101-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-c-Myc Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the EQKLISEEDL human c-Myc 10 amino acid sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60 40

1:1000 1:2000 1:5000 1:10000

25 M: EasySee Western Marker

Anti-Flag Mouse Monoclonal Antibody


HT201-01 HT201-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-Flag Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the DYKDDDK human Flag amino acid sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. IP: 1:100-500 dilution.

High quality products


162

Chapter 8

Primary Antibodies

Chapter 8

Antibody dilution

Antibodies

kDa
90 75 60

1:1000 1:2000 1:5000 1:10000

40

25 M: EasySee Western Marker

Anti-HA Mouse Monoclonal Antibody


HT301-01 HT301-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-HA Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the YPYDVPDYA human HA amino acid sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. IP: 1:100-500 dilution.

Antibody dilution

kDa
90 75 60 40 25

M 1:1000

1:2000 1:5000 1:10000

M: EasySee Western Marker

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


163

Antibodies

Chapter 8

Primary Antibodies

Chapter 8

Anti-V5 Mouse Monoclonal Antibody


HT401-01 HT401-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-V5 Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the CGKPIPNPLLGLDST human V5 amino acid sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60 40 25

1:1000 1:2000 1:5000 1:10000

M: EasySee Western Marker

Anti-His Mouse Monoclonal Antibody


HT501-01 HT501-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-His Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the 6xHis peptide (HHHHHH) sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60 40 25

1:1000 1:2000 1:5000 1:10000

M: EasySee Western Marker

High quality products


164

Chapter 8

Primary Antibodies

Chapter 8

Anti-GST Mouse Monoclonal Antibody


HT601-01 HT601-02 50 l 250 l

Antibodies

Concentration
1 mg/ml

Description
Anti-GST Mouse Monoclonal Antibody is purified monoclonal antibody against yeast Y258 GST recombinant proteins that detects recombinant proteins containing the GST peptide sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60

1:1000

1:2000

1:5000

1:10000

M: EasySee Western Marker 40

25

Anti-MBP Mouse Monoclonal Antibody


HT701-01 HT701-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-MBP Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the MBP peptide sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60

1:1000

1:2000

1:5000

1:10000

M: EasySee Western Marker 40

25

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


165

Antibodies

Chapter 8

Control Antibodies

Chapter 8

Anti-GFP Mouse Monoclonal Antibody


HT801-01 HT801-02 50 l 250 l

Concentration
1 mg/ml

Description
Anti-GFP Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the human GFP amino acid sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IP: 1:100-500 dilution.
Antibody dilution

kDa
90 75 60

1:1000

1:2000

1:5000

1:10000

M: EasySee Western Marker 40 25

Anti--Tubulin Mouse Monoclonal Antibody


HC101-01 HC101-02 50 l 250 l

Concentration
1 mg/ml

Storage
at 2-8oC for one month; at-20oC for one year

present in various mammalian cells,mainly as the components of -tubulin and -tubulin.The expression level of -tubulin is relatively

Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. kDa
90 75 60

1:1000 1:2000 1:5000 1:10000

40

25 M: EasySee Western Marker

High quality products


166

Chapter 8

Control Antibodies

Chapter 8

Anti--Actin Mouse Monoclonal Antibody


HC201-01 HC201-02 50 l 250 l

Antibodies

Concentration
1 mg/ml

Description
Actin is an important component of the cytoskeleton. It is widely present in various mammalian cells, mainly as the components of the - Actin. The expression level of - Actin is relative stable, it is widely used as expression control. Anti--Actin Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the Actin peptide sequence.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IP: 1:100-500 dilution. kDa
90 75 60 40

1:1000 1:2000 1:5000 1:10000

M: EasySee Western Marker

Anti-GAPDH Mouse Monoclonal Antibody


HC301-01 HC301-02 50 l 250 l

Concentration
1 mg/ml

Description
GAPDH (glyceraldehyde - 3-phosphate dehydrogenase) is involved in glycolysis process as a key enzyme, and has a high level of expression in almost all organizations. It is widely used as expression control. Anti-GAPDH Mouse Monoclonal Antibody is purified monoclonal antibody that detects recombinant proteins containing the GAPDH peptide sequence come from human, mouse and rabbit.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution
Western Blot: 1:500-10000 dilution. ELISA: 1:500-5000 dilution. IF: 1:100-500 dilution. kDa
90 75 60 40 25 M: EasySee Western Marker

1:1000 1:2000 1:5000 1:10000

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


167

Antibodies

Chapter 8

Secondary Antibodies

Chapter 8

Goat Anti-Rabbit IgG(H+L), HRP Conjugate


HS101-01 100 l

Concentration
1 mg/ml

Description
Affinity purified goat anti-rabbit IgG(H+L) antibody conjugated to horseradish peroxidase. This product has been optimized for use as a secondary antibody in Western blotting application.

Storage
at 2-8oC for one month; at -20oC for one year

Suggested Dilution

Western Blot: 1: 1000-10000 dilution. ELISA: 1: 1000-5000 dilution.


Antibody dilution
1:1000 1:2500 1:5000 1:10000

EasySee Western Marker(5 l/well)

Goat Anti-Rabbit IgG(H+L), FITC Conjugate


HS111-01 100 l

Concentration
2 mg/ml

Description
FITC(Fluorescein Isothiocyanate) with the molecular weight of 389.4 is the most commonly used fluorescent dye. FITC has has a maximum absorption wavelength of 490~495 nm and a greatest emission wavelength of 520~530 nm, with the bright yellow green fluorescence. Affinity purified goat anti-mouse IgG(H+L) antibody conjugated to FITC. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC in dark for one year

Suggested Dilution

IF: 1:100-200 dilution. FCM: 1:100-200 dilution.

High quality products


168

Chapter 8

Secondary Antibodies

Chapter 8

Goat Anti-Rabbit IgG(H+L), PE Conjugate


HS121-01 100 l

Antibodies

Concentration
0.4 mg/ml

Description
PE (phycoerythrin) is a natural fluorescent dye extracted from the red algae. PE has a maximum absorption wavelength of 488 nm and a greatest emission wavelength of 575 nm, with the orange red fluorescence. Affinity purified goat anti-rabbit IgG(H+L) antibody conjugated to PE. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC in dark for one year

Suggested Dilution

IF: 1:100-500 dilution. FCM: 1:100-500 dilution.

Goat Anti-Rabbit IgG(H+L), AF488 Conjugate


HS131-01 100 l

Concentration
1 mg/ml

Description
The Alexa Fluor family of fluorescent dyes is very bright and light stabile.The fluorescent dye of AF488(Alexa Fluor 488) has a maximum absorption wavelength of 495 nm and a greatest emission wavelength of 519 nm, with the bright yellow green fluorescence. Compared with most green fluorescent probes, the AF488 has higher brightness, stronger specificity, and lower quenching . Affinity purified goat anti-rabbit IgG(H+L) antibody conjugated to AF488. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC in dark for one year

Suggested Dilution

IF: 1:100-500 dilution. FCM: 1:100-500 dilution.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


169

Antibodies

Chapter 8

Secondary Antibodies

Chapter 8

Goat Anti-Mouse IgG(H+L), HRP Conjugate


HS201-01 100 l

Concentration
1 mg/ml

Description
The Alexa Fluor family of fluorescent dyes is very bright and light stability.The fluorescent dye of AF488(Alexa Fluor 488) has a maximum absorption wavelength of 495 nm and a greatest emission wavelength of 519 nm, with the bright yellow green fluorescence. Compared with most green fluorescent probes, the AF488 has higher brightness, stronger specificity, and lower quenching . Affinity purified goat anti-rabbit IgG(H+L) antibody conjugated to AF488. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC for one month, at -20oC for one year

Suggested Dilution

Western Blot: 1: 1000-10000 dilution. ELISA: 1:1000-5000 dilution.


Antibody dilution
1:1000 1:2500 1:5000 1:10000

EasySee Western Marker(5 l/well)

High quality products


170

Chapter 8

Secondary Antibodies

Chapter 8

Goat Anti-Mouse IgG(H+L), FITC Conjugate


HS211-01 100 l

Antibodies

Concentration
2 mg/ml

Description
FITC (Fluorescein Isothiocyanate), with molecular weight of 389.4, is the most commonly used fluorescent dye. FITC has a maximum absorption wavelength of 490~495 nm and greatest emission wavelength of 520~530 nm, with bright yellow green fluorescence. Affinity purified goat anti-mouse IgG(H+L) antibody conjugated to FITC. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC for one month, at -20oC for one year

Suggested Dilution

IF: 1:100-200 dilution. FCM: 1:100-200 dilution.

Goat Anti-Mouse IgG(H+L), PE Conjugate


HS221-01 100 l

Concentration
0.4 mg/ml

Description
PE (phycoerythrin) is a natural fluorescent dye extracted from red algae. PE has a maximum absorption wavelength of 488 nm and greatest emission wavelength of 575 nm, with orange red fluorescence. Affinity purified goat anti-mouse IgG(H+L) antibody conjugated to PE. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry. Suggested Dilution

Storage
at 2-8oC in dark for one year

Suggested Dilution

IF: 1:100-500 dilution. FCM: 1:100-5 00dilution.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


171

Antibodies

Chapter 8

Secondary Antibodies

Chapter 8

Goat Anti-Mouse IgG(H+L), AF488 Conjugate


HS231-01 100 l

Concentration
1 mg/ml

Description
The Alexa Fluor family of fluorescent dyes is very bright and light stable. The fluorescent dye of AF488 (Alexa Fluor 488) has a maximum absorption wavelength of 495 nm and greatest emission wavelength of 519 nm, with bright yellow green fluorescence. Compared with most green fluorescent probes, the AF488 has higher brightness, stronger specificity, and lower quenching . Affinity purified goat anti-mouse IgG(H+L) antibody conjugated to AF488. This product has been optimized for use as a secondary antibody in application of immunofluorescence and flow cytometry.

Storage
at 2-8oC in dark for one year

Suggested Dilution

IF: 1:100-500 dilution. FCM: 1:100-500 dilution.

High quality products


172

Chapter 9

Other Products

T4 DNA Ligase 174 DMT Enzyme 175 DNase I (RNase-free) 175 RNase A 176 Proteinase K 176 IPTG 176 X-gal 177 Ampicillin 177 Kanamycin 177 Chloramphenicol 177 6xDNA Loading Buffer 178 ddH2O 178 RNase-free Water 178 GelStain 179 Agarose 179

Chapter 9

Other Products

T4 DNA Ligase
Rapid ligation
Concentration
200 units/l
FL101-01 FL101-02 10000 units 210000 units

Description
T4 DNA Ligase catalyzes the formation of a phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl termini in duplex DNA or RNA with blunt or cohesive-end termini. The enzyme repairs single-strand nicks in duplex DNA, RNA or DNA/RNA hybrids but has no activity on single-stranded nucleic acids. T4 DNA Ligase requires ATP as cofactor.

Components
T4 DNA Ligase (200 units/l) 5T4 DNA Ligase Buffer

Storage
at -20oC for one year

Source
E.coli strain carrying T4 ligase gene

Unit Definition
Other Products One unit is defined as the amount of enzyme required to give 50% ligation of Hind III fragments of DNA (5 DNA termini concentration of 0.12 M, 300- g/ml) in a total reaction volume of 20 l in 30 minutes at 16C in 1T4 DNA Ligase Reaction Buffer.

Quality Control
Functional absence of endonucleases and exonucleases activities

Applications

Chapter 9

Cloning blunt-end or cohesive-end fragments. Ligating linkers or adapters to blunt-ended DNA.

PROTOCOL
Notes
It is recommended to use 3:1-10:1 insert to vector molar ratio.

Reaction Components
Vector DNA Insert DNA 5T4 DNA Ligase Buffer T4 DNA Ligase ddH2O x l x l 2 l 0.5-1 l to 10 l

Reaction Conditions
Cohesive End Ligation: Incubate at 25oC for 10 minutes. Blunt Ends Ligation: Incubate at 25oC for 2 hours, or overnight at 16oC. Cohesive and Blunt Ends Ligation: Incubate 25oC for 2 hours.

High quality products


174

Other Products

Chapter 9

DMT Enzyme
GD111-01 200 units

Concentration
10 units/l

Description
DMT can cut the sequence GmATC (A is methylated) and cannot cut the sequence GATC (A is not methylated). This enzyme can cut DNA prepared from E. coli strains (dam+ strain) commonly used, but not PCR product.

Storage
at -20oCfor one year

Source
An E.coli strain that carries the cloned DMT enzyme gene from Diplococcus pneumoniae.

Unit Definition
One unit is the amount of enzyme required to completely digest 1 g of pBR322 DNA (prepared from dam+ strain) in 50 l of reaction mixture in 1 hour at 37oC.

Chapter 9

Quality Control
Functional absence of endonucleases and exonucleases activities

Application
Cut GmATC (A is methylated) DNA. Other Products

DNase I (RNase-free)
GD201-01 1500 units

Concentration
3 units/l

Description
Deoxyribonuclease I (DNase I) digests single- and double-stranded DNA to oligodeoxyribonucleotides containing a 5 phosphate. Ribonuclease has been reduced to non-detectable levels. DNase I is suitable for removing DNA from protein preparations, nick translating DNA, and generating random fragments for dideoxy sequencing.

Components
200 mM EDTA

Storage
at 20oC for one year

Source
DNase I is purified from bovine pancreas.

Unit Definition
One unit increases the absorbance of a high molecular weight DNA solution at a rate of 0.001 A260 units/min/ml of reaction mixture at 25oC.

Applications
DNase I footprinting. Nick translation. Remove DNA from RNA preparations.

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


175

Chapter 9

Other Products

RNase A
GE101-01 1 ml

Concentration
20 mg/ml

Description
RNase A is ribonclease that cleaves a single-strand RNA .

Storage
at -20oC for one year

Source
Bovine pancreas

Unit Definition
>60 U/mg

Applications
Remove RNA from DNA samples. RNase protection assay.

Other Products

Proteinase K
Concentration
20 mg/ml

GE201-01

1 ml

Description
Proteinase K is a nonspecific serine protease. It is not inactivated by metal ions, chelating agents (e.g., EDTA), or detergents such as SDS. It is active over a wide range of pH(4-12.5). The optimal temperature is 55-65oC.

Chapter 9

Storage
at -20oC for one year

Source
Purified from Tritirachium album

Unit Definition
One unit is described as that amount of enzyme that liberates 1 mole of Folin-positive amino acid in one minute at 37C using hemoglobin as a substrate.

Application
Preparation of RNA or DNA.

IPTG
GF101-01 1 ml

Concentration
500 mM

Description
IPTG (isopropylthio--galactoside) is an inducer of -galactosidase activity in bacteria and is suitable for use with X-gal or bluo-gal to detect lac gene activity in cloning procedures.

Storage
at 20C for six months

High quality products


176

Other Products

Chapter 9

X-Gal
Concentration
20 mg/ml

GF201-01

1 ml

Description
X-Gal, in conjugation with IPTG, is used to detect -galactoside activity. It is commonly used in cloning procedures.

Storage
at 20C for six months

Ampicillin
GG101-01 1 ml

Chapter 9

Concentration
100 mg/ml

Description
Ampicillin is commonly used as a selective antibiotic for resistant bacteria.

Storage
at -20oC for one year

Other Products

Kanamycin
GG201-01 1 ml

Concentration
50 mg/ml

Description
Kanamycin is commonly used as a selective antibiotic for resistant bacteria.

Storage
at -20oC for one year

Chloramphenicol
GG301-01 1 ml

Concentration
34 mg/ml

Description
Chloramphenicol is commonly used as a selective antibiotic for resistant bacteria.

Storage
at -20oC for one year

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


177

Chapter 9

Other Products

6DNA Loading Buffer


GH101-01 51 ml

Storage
at -20oC for two years

Description
6XDNA Loading Buffer is used to prepare DNA markers and samples for on agarose gel electrophoresis.

ddH2O
Gl101-01 25 ml

Other Products

Storage
room temperature for one year

Description
Double distilled water, Suitable for molecular biology applications.

Chapter 9

RNase-free Water
Gl201-01 25 ml

Storage
room temperature for one year

Description
RNase-free water, Suitable for molecular biology applications.

High quality products


178

Other Products

Chapter 9

GelStain
Concentration
10000

GS101-01

500 l

Description
GelStain uses the same wavelength as ethidium bromide (EB), and it is more sensitive than EB.

Storage
at 4oC in dark for one year

Characteristics
Non toxicity: GelStain is a specific form of oily macromolecules, which are incapable of entering cells via the cell membrane. High sensitivity: GelStain is suitable for different sizes of DNA. It has less influence to the migration rate than SYBR Green. Exceptional stability: GelStain can be heated or microwaved. Signal to noise ratio: Strong fluorescent signal from samples, weak from background. Like EB, GelStain can be used before electrophoresis gel, or stain after electrophoresis. No destaining is needed. No optical setting change: Standard EB filter and SYBR filter can be used.

Chapter 9

Agarose
Storage
room temperature for two years

GS201-01

100 g

Other Products

Description
High concentration of agarose, with no DNA enzymes, RNA, nor protease. Stained with ethidium, with low bromide background. Strong electrophoretic separability, and clear bands. Suitable for a variety of DNA and RNA electrophoreses.

Characteristics
Non toxicity: GelStain is a kind of special oily macromolecules, which cant enter cells via the cell membrane. Shown by Ames test, it is a much lower mutagenic material than EB. High sensitivity: GelStain is suitable for different sizes of DNA. It has less influence to the migration rate than SYBR Green. Exceptional stability: GelStain can be heated or microwaved. Signal to noise ratio: Strong fluorescent signal from samples, weak from background. Like EB, GelStain can be used before electrophoresis gel, or stain after electrophoresis. No destaining is needed. No optical setting change: Standard EB filter and SYBR filter can be used. % of Agrose 0.5% 0.7% 1.0% 1.2% 1.5% 2.0% Resolution (bp) 1,00030,000 80012,000 50010,000 4007,000 2003,000 502,000

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


179

Chapter 10

Price List

PCR, RT-PCR, qPCR and qRT-PCR


Products Name
TransFast Taq DNA Polymerase TransFast Taq DNA Polymerase (with 2.5 mMdNTPs) EasyTaq DNA Polymerase

Catalog Number
AP101-01 AP101-02 AP101-11 AP101-12 AP111-01 AP111-02 AP111-03

Quantity
500 units 6500 units 500 units 6500 units 500 units 6500 units 42500 units 500 units 6500 units 42500 units 2500 units 42500 units 2500 units 42500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units

Page

EasyTaq DNA Polymerase (with 2.5 mMdNTPs) EasyTaq DNA Polymerase for PAGE EasyTaq DNA Polymerase for PAGE (with 2.5 mMdNTPs) TransTaq -T DNA Polymerase
Price List

AP111-11 AP111-12 AP111-13 AP112-01 AP112-02 AP112-11 AP112-12 AP122-01 AP122-02 AP122-03 AP122-11 AP122-12 AP122-13 AP131-01

TransTaq -T DNA Polymerase (with 2.5 mMdNTPs)

Chapter 10

TransTaq DNA Polymerase High Fidelity (HiFi)

AP131-02 AP131-03

10

TransTaq DNA Polymerase High Fidelity (HiFi) (with 2.5 mMdNTPs)

AP131-11 AP131-12 AP131-13 AP141-01

TransStart Taq DNA Polymerase

AP141-02 AP141-03

TransStart Taq DNA Polymerase (with 2.5 mMdNTPs)

AP141-11 AP141-12 AP141-13 AP151-01

12

TransStart Top Taq DNA Polymerase

AP151-02 AP151-03

TransStart Top Taq DNA Polymerase (with 2.5 mM dNTPs)

AP151-11 AP151-12 AP151-13

14

High quality products


180

Price List

Chapter 10

Products Name
EasyPfu DNA Polymerase

Catalog Number
AP211-01 AP211-02 AP211-03 AP211-11

Quantity
250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 250 units 500 units 6500 units 200 l 200 l 1 ml 51 ml 151 ml 1 ml 51 ml 151 ml 1 ml 51 ml 151 ml 1 ml 51 ml 1 ml 51 ml 1 ml 51 ml 1 ml 51 ml 1 ml 51 ml 1 ml 51 ml 100rxns20 l system 500rxns20 l system 100rxns20 l system 500rxns20 l system

Page

16

EasyPfu DNA Polymerase (with 2.5 mMdNTPs)

AP211-12 AP211-13 AP221-01 AP221-02 AP221-03 AP221-11 AP221-12 AP221-13 AP231-01 AP231-02 AP231-03 AP231-11 AP231-12 AP231-13 AG101-01 AG111-01 AS111-01 AS111-02 AS111-03 AS111-11

TransStart FastPfu DNA Polymerase

17

TransStart FastPfu DNA Polymerase (with 2.5 mMdNTPs)

TransStart FastPfu Fly DNA Polymerase

19

TransStart FastPfu Fly DNA Polymerase (with 2.5 mMdNTPs)


GC Enhancer PCR Stimulant 2EasyTaq PCR SuperMix (-dye)

21 22

Chapter 10

24

2EasyTaq PCR SuperMix (+dye)

AS111-12 AS111-13 AS112-11

Price List

2EasyTaq PCR SuperMix for PAGE (+dye)

AS112-12 AS112-13 AS122-01 AS122-02 AS122-11 AS122-12 AS131-01 AS131-02 AS131-21 AS131-22 AS211-01 AS211-02 AS221-01 AS221-02 AD201-01 AD201-02 AD301-01 AD301-02

25

2TransTaq -T PCR SuperMix (-dye) 2TransTaq -T PCR SuperMix (+dye) 2TransTaq High Fidelity (HiFi) PCR SuperMix I (-dye) 2TransTaq High Fidelity (HiFi) PCR SuperMix II (-dye) 2EasyPfu PCR SuperMix (-dye) 2TransStart FastPfu PCR SuperMix (-dye)

26

27

28 29 30 32

TransDirect TM Animal Tissue PCR Kit TransDirect TM Plant Tissue PCR Kit

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


181

Chapter 10

Price List

Products Name
TransDirect
TM

Catalog Number
AD401-01 AD401-02 AE101-02 AE101-03 AT101-02 AT101-03 AH101-02 AE301-02 AE301-03 AT301-02 AT301-03 AT311-02 AT311-03 AT321-01 AT331-01 AH301-02 AH301-03 AH311-02 AH311-03 AH321-01 AH331-01 AT401-01 AH401-01 AE411-02 AT411-02 AH411-02 Al101-01 Al101-02 AQ101-01 AQ101-02 AQ101-03 AQ111-01 AQ111-02 AQ111-03 AQ131-01 AQ131-02 AQ131-03

Quantity
100rxns20 l system 500rxns20 l system 10000 units 510000 units 10000 units 510000 units 10000 units 50rxns20 l system 100rxns20 l system 50rxns20 l system 100rxns20 l system 50rxns20 l system 100rxns20 l system 50rxns20 l system 50rxns20 l system 50rxns20 l system 100rxns20 l system 50rxns20 l system 100rxns20 l system 50rxns20 l system 50rxns20 l system RT system/ PCR system 50 rxns20 l/80 rxns50 l RT system/ PCR system 50 rxns20 l/80 rxns50 l 200 rxns20 l system 200 rxns20 l system 200 rxns20 l system 2000 units 52000 units 1 ml 51 ml 151 ml 1 ml 51 ml 151 ml 1 ml 51 ml 151 ml RT system/ qPCR system 50 rxns20 l/300 rxns20 l RT system/ qPCR system 50 rxns20 l/300 rxns20 l 100 rxns20 l system 400 rxns20 l system

Page
33 37 39 40 41 43 44 45 46 47 48 49 50 51 52 53 54 55 56 58

Blood PCR SuperMix

EasyScrip t Reverse Transcriptase TransScrip t Reverse Transcriptase TransScrip t II Reverse Transcriptase EasyScrip t First-Strand cDNA Synthesis SuperMix TransScrip t First-Strand cDNA Synthesis SuperMix TransScrip t One-Step gDNA Removal and cDNA Synthesis SuperMix TransScrip t All-in-One First-Strand cDNA Synthesis SuperMix for PCR TransScrip t All-in-One First-Strand cDNA Synthesis SuperMix for qPCR TransScrip t II First-Strand cDNA Synthesis SuperMix
TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for PCR TransScript II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR TransScript Two-Step RT-PCR SuperMix TransScript II Two-Step RT-PCR SuperMix EasyScript One-Step RT-PCR SuperMix TransScript One-Step RT-PCR SuperMix TransScript II One-Step RT-PCR SuperMix Ribonuclease Inhibitor TransStart Green qPCR SuperMix

Chapter 10

Price List

TransStart Green qPCR SuperMix UDG

59

TransStart Top Green qPCR SuperMix

60

TransScript Green Two-Step qRT-PCR SuperMix TransScript II Green Two-Step qRT-PCR SuperMix TransScript Green One-Step qRT-PCR SuperMix

AQ201-01 AQ301-01 AQ211-01 AQ211-02

62 63 66

High quality products


182

Price List

Chapter 10

Products Name
TransScript II Green One-Step qRT-PCR SuperMix

Catalog Number
AQ311-01 AQ311-02 AQ401-01 AQ401-02 AQ401-03 AQ221-01 AQ221-02 AQ321-01 AQ321-02 AD101-01 AD101-02 AD101-11 AD101-12

Quantity
100 rxns20 l system 400 rxns20 l system 1 ml 51 ml 151 ml 100 rxns20 l system 400 rxns20 l system 100 rxns20 l system 400 rxns20 l system 1 ml 51 ml 1 ml 51 ml

Page
68

TransStart Probe qPCR SuperMix

70

TransScript Probe One-Step qRT-PCR SuperMix TransScript II Probe One-Step qRT-PCR SuperMix High Pure dNTPs (2.5 mM each) High Pure dNTPs (10 mM each)

72 73

75

DNA Molecular Weight Standards


Products Name
Trans2K DNA Marker Trans2K Plus DNA Marker Trans2K Plus II DNA Marker Trans4K DNA Marker Trans5K DNA Marker Trans8K DNA Marker Trans15K DNA Marker 1Kb DNA Ladder 1Kb Plus DNA Ladder 100bp DNA Ladder 100bp Plus DNA Ladder 100bp Plus II DNA Ladder Trans DNA Marker I Trans DNA Marker II

Catalog Number
BM101-01 BM101-02 BM111-01 BM111-02 BM121-01 BM121-02 BM131-01 BM131-02 BM141-01 BM141-02 BM151-01 BM151-02 BM161-01 BM161-02 BM201-01 BM201-02 BM211-01 BM211-02 BM301-01 BM301-02 BM311-01 BM311-02 BM321-01 BM321-02 BM401-01 BM401-02 BM411-01 BM411-02

Quantity
500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l 500 l 5500 l

Page
78 78

Chapter 10

78 79 79

Price List

79 80 80 80 81 81 81 82 82

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


183

Chapter 10 Cloning and Mutagenesis System


Products Name
pEASY -T1 Cloning Kit pEASY -T1 Simple Cloning Kit pEASY -T3 Cloning Kit pEASY -T5 Zero Cloning Kit pEASY -Blunt Cloning Kit pEASY -Blunt Simple Cloning Kit pEASY -Blunt Zero Cloning Kit

Price List

Catalog Number
CT101-01 CT101-02 CT111-01 CT111-02 CT301-01 CT301-02 CT501-01 CT501-02 CB101-01 CB101-02 CB111-01 CB111-02 CB501-01 CB501-02 CD101-01 CD101-02 CD101-03 CD201-01 CD201-02 CD201-03 CD301-01 CD301-02 CD301-03 CD311-01 CD311-02 CD401-01 CD401-02 CD401-03 CD411-01 CD411-02 CD411-03 CD501-01 CD501-02 CD501-03 CD511-01 CD511-02 FM101-01 FM101-02 FM111-01 FM111-02

Quantity
20 rxns 60 rxns 20 rxns 60 rxns 20 rxns 60 rxns 20 rxns 60 rxns 20 rxns 60 rxns 20 rxns 60 rxns 20 rxns 60 rxns 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 550 l 2050 l 5 rxns 20 rxns 5 rxns 20 rxns

Page
86 89 90 91 92 93 94

Trans10 Chemically Competent Cell

95

Trans5 Chemically Competent Cell Price List

95

Trans109 Chemically Competent Cell

Chapter 10

Trans110 Chemically Competent Cell

96

Trans1-Blue Chemically Competent Cell

Trans2-Blue Chemically Competent Cell

Trans1-T1 Phage Chemically Comptent Cell

97

DMT Chemically Competent Cell Easy Mutagenesis System Fast Mutagenesis System

98 99

High quality products


184

Price List

Chapter 10

Nucleic Acid Purification


Products Name
BloodZol

Catalog Number
EE131-01 EE131-02 EE141-01 EE101-01 EE101-02 EE111-01 EE111-02 EE121-01 EE121-02 EE151-01 EM101-01 EM101-02 EM111-01 EM201-01 EP101-01 EP101-02 EG101-01 EG101-02 ET101-01 ET111-01 ET121-01 ER101-01 ER201-01 ER301-01 ER401-01 ER501-01

Quantity
treating 50 ml blood treating 200 ml blood 100 ml 50 rxns 200 rxns 50 rxns 200 rxns 50 rxns 200 rxns 50 rxns 50 rxns 200 rxns 10 rxns 95ml+5ml 50 rxns 200 rxns 50 rxns 200 rxns 100 ml 100 ml 100 ml 50 rxns 50 rxns 50 rxns 50 rxns 100 ml

Page
101 102 103 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

Plantzol
EasyPure Genomic DNA Kit EasyPure Plant Genomic DNA Kit EasyPure Blood Genomic DNA Kit

EasyPure Marine Animal Genomic DNA Kit


EasyPure Plasmid MiniPrep Kit EasyPure HiPure Plasmid MaxiPrep Kit ArtMedia Plasmid Culture EasyPure PCR Purification Kit EasyPure Quick Gel Extraction Kit

TransZol TransZol Up TransZol Plant EasyPure RNA Kit EasyPure Viral DNA/RNA Kit EasyPure Plant RNA Kit EasyPure Blood RNA Kit RNAholdTM

Chapter 10
Price List

Expression
Products Name
pEASY -E1 Expression Kit pEASY -E2 Expression Kit ArtMediaTM Protein Expression BL21(DE3) Chemically Competent Cell

Catalog Number
CE101-01 CE111-01 CP101-01 CD601-01 CD601-02 CD601-03 CD701-01 CD701-02 CD701-03 CD801-01 CD801-02 CD801-03 CD811-01 CD811-02 CD811-03 CD901-01 CD901-02 CD901-03

Quantity
10 rxns 10 rxns 95 ml+5 ml 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l 5100 l 10100 l 20100 l

Page
123 125 126

127

BL21(DE3)pLysS Chemically Competent Cell

Transetta(DE3) Chemically Competent Cell

TransB(DE3) Chemically Competent Cell

128

BL21 Chemically Competent Cell

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


185

Chapter 10

Price List

Products Name
pEASY -M1 Expression Kit pEASY -M2 Expression Kit

Catalog Number
CM101-01 CM111-01

Quantity
10 rxns 10 rxns

Page
129 130

Protein Molecular Weight Standards and Related Products


Products Name
ProteinRuler I (12-80 kDa)

Catalog Number
DR101-01 DR101-02 DR201-01

Quantity
250 l 2250 l 250 l 2250 l 250 l 2250 l 250 l 2250 l 250 l 2250 l

Page

136

ProteinRuler

II (12-100 kDa) DR201-02 DR301-01 DR301-02 DR401-01 DR401-02 DM101-01 DM101-02

ProteinRuler III (25-120 kDa)

137

ProteinRuler

(30-200 kDa)

Blue Plus Protein Marker (14-100 kDa)

138 Blue Plus Price List

DM111-01 II Protein Marker(14-120 kDa) DM111-02

250 l 2250 l 250 l 139 2250 l 250 l 2250 l 140 250 l+100 ml 2250 l+200 ml 250 l 2250 l 250 l+100 ml 2250 l+200 ml 100 ml 200 ml 1 ml 100 ml 5 ml 144 25 ml 5 ml 146 25 ml 10 ml 5 ml 5 ml 148 150 152 143 142 141

Blue Plus III Protein Marker(14-160 kDa)

DM121-01 DM121-02

Chapter 10

EasySee Western Marker (20-90 kDa) EasySee Western Marker (with EasySee Western Blot Kit) EasySee II Western Marker (30-150 kDa) EasySee II Western Marker with EasySee Western Blot Kit) EasySee Western Blot Kit 6 Protein Loading Buffer Easy Protein Quantitative Kit ProteinIsoTM Ni-NTA Resin

DM201-01 DM201-02 DM201-11 DM201-12 DM211-01 DM211-02 DM211-11 DM211-12 DW101-01 DW101-02 DL101-01 DQ101-01 DP101-01 DP101-02

ProteinIso TM Ni-IDA Resin


ProteinIsoTM GST Resin

DP111-01 DP111-02 DP201-01 DP301-01 DP401-01

ProteinIso ProteinIso

TM TM

Protein A Resin Protein G Resin

High quality products


186

Price List

Chapter 10

Cell Biology
Products Name
TransSerum Fetal Bovine Serum

Catalog Number
FS101-01 FS101-02 FT101-01 FT101-02 FG101-01 FG201-01 FG301-01 FG401-01 FR101-01 FR101-02 FR201-01 FR201-02

Quantity
100 ml 5100 ml 0.75 ml 20.75 ml 100 ml 100 ml 100 ml 5 ml 50 rxns 200 rxns 50 rxns 200 rxns

Page
155 156

TransLipid TM Transfection Reagent


Penicillin-Streptomycin (100) L-Glutamine (100) Trypsin (0.25%,with EDTA and Phenol Red) G418 Sing-Luciferase Reporter Assay Kit Double-Luciferase Reporter Assay Kit

158

159 160

Antibodies
Products Name
Anti-c-Myc Mouse Monoclonal Antibody Anti-Flag Mouse Monoclonal Antibody Anti-HA Mouse Monoclonal Antibody Anti-V5 Mouse Monoclonal Antibody Anti-His Mouse Monoclonal Antibody Anti-GST Mouse Monoclonal Antibody Anti-MBP Mouse Monoclonal Antibody Anti-GFP Mouse Monoclonal Antibody Anti--Tubulin Mouse Monoclonal Antibody Anti--Actin Mouse Monoclonal Antibody Anti-GAPDH Mouse Monoclonal Antibody Goat Anti-Rabbit IgG(H+L),HRP Conjugate Goat Anti-Rabbit IgG(H+L), FITC Conjugate Goat Anti-Rabbit IgG(H+L), PE Conjugate Goat Anti-Rabbit IgG(H+L), AF488 Conjugate Goat Anti-Mouse IgG(H+L),HRP Conjugate Goat Anti-Mouse IgG(H+L), FITC Conjugate Goat Anti-Mouse IgG(H+L), PE Conjugate Goat Anti-Mouse IgG(H+L), AF488 Conjugate

Catalog Number
HT101-01 HT101-02 HT201-01 HT201-02 HT301-01 HT301-02 HT401-01 HT401-02 HT501-01 HT501-02 HT601-01 HT601-02 HT701-01 HT701-01 HT801-01 HT801-01 HC101-01 HC101-02 HC201-01 HC201-02 HC301-01 HC301-02 HS101-01 HS111-01 HS121-01 HS131-01 HS201-01 HS211-01 HS221-01 HS231-01

Quantity
50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 50 l 250 l 100 l 100 l 100 l 100 l 100 l 100 l 100 l 100 l

Page
162

Chapter 10

163

164

Price List

165

166

167

168 169 170 171 172

Order: 0086-010-51296890

Hot line: 0086-400-898-0321


187

Chapter 10

Price List

Other Products
Products Name
T4 DNA Ligase DMT Enzyme DNase I (RNase-free) RNase A Proteinase K IPTG X-gal Ampicillin Kanamycin Chloramphenicol 6xDNA Loading Buffer ddH2O RNase-free Water GelStain Agarose

Catalog Number
FL101-01 FL101-02 GD111-01 GD201-01 GE101-01 GE201-01 GF101-01 GF201-01 GG101-01 GG201-01 GG301-01 GH101-01 Gl101-01 Gl201-01 GS101-01 GS201-01

Quantity
10000 units 210000 units 200 units 1500 units 1 ml 1 ml 1 ml 1 ml 1 ml 1 ml 1 ml 51 ml 25 ml 25 ml 500 l 100 g

Page
174 175

176

177

179

Chapter 10

Price List

High quality products


188