ARTICLE IN PRESS

FOOD MICROBIOLOGY
Food Microbiology 23 (2006) 5259 www.elsevier.com/locate/fm

Prevalence and level of Escherichia coli O157 on beef trimmings, carcasses and boned head meat at a beef slaughter plant
E. Carneya, S.B. OBriena, J.J. Sheridana, D.A. McDowellb, I.S. Blairb, G. Duffya,
a

The National Food Centre, Dunsinea, Castleknock, Teagasc, Ashtown, Dublin 15, Ireland b The University of Ulster, Newtownabbey, Co. Antrim, BT37 OQB, Northern Ireland Received 20 August 2004; accepted 27 December 2004

Abstract This study investigated the prevalence and level of Escherichia coli O157 on samples of beef trimmings (n 1351), beef carcasses (n 132) and bovine head meat (n 132) in a beef slaughter plant in Ireland. The survey also included an assessment of the prevalence of virulence genes in the E. coli O157 isolates obtained. Samples were examined for the presence of E. coli O157 by direct plating on SMAC-CT and by enrichment/immunomagnetic separation (IMS) with plating of recovered immunobeads onto SMACCT agar. Presumptive E. coli O157 isolates were conrmed by PCR targeting a range of genes i.e. vt1, vt2, eaeA, hlyA, iCh7 and portions of the rfb (O-antigen encoding) region of E. coli O157. Enterobacteriaceae on head meat samples were estimated by direct plating onto Violet Red Bile Glucose agar. E. coli O157 was recovered from 2.4% (32/1351) of beef trimmings samples, at concentrations ranging fromo0.701.61 log10 cfu g1. Of the 32 positive isolates, 31 contained the eaeA and hylA genes while 30/32 contained the iCh7 gene and 31/32 contained vt1 or vt2, or both vt genes. E. coli O157 was recovered from 3.0% (4/132) of carcass samples, at concentrations ranging from o0.701.41 log10 cfu g1. All of the carcass isolates contained the eaeA, hylA and iCh7 genes. E. coli O157 was recovered from 3.0% (3/100) of head meat samples, at concentrations of 0.71.0 log10 cfu g1. All of the head meat isolates contained the eaeA, hylA, iCh7 and vt2 genes. No head meat isolates contained the vt1 gene. Head meat samples (n 100) contained Enterobacteriaceae, at concentrations ranging from 0.703.0 log10 cfu g1. Overall, the qualitative and quantitative data obtained for E. coli O157 on beef trimming samples in this study could be employed as part of a quantitative risk assessment model. r 2005 Elsevier Ltd. All rights reserved.
Keywords: Escherichia coli O157:h7; Beef trimmings; Enumeration; Head meat; Enterobacteriaceae

1. Introduction Escherichia coli is a normal and healthy part of the intestinal micro-ora of many animals, including humans. However, some strains can cause diseases. Verocytotoxigenic E. coli including serotype O157:H7 are one such group, causing severe, chronic, and potentially fatal illness, related to their ability to produce one or more toxins known as verotoxin or
Corresponding author. Tel.: +353 1 8059500; fax: +353 1 8059550.

E-mail address: gduffy@nfc.teagasc.ie (G. Duffy). 0740-0020/$ - see front matter r 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2004.12.001

shiga-like toxin (Uhitil et al., 2004). Consumption of raw or undercooked foods of bovine origin, especially undercooked minced beef and unpasteurized cows milk, has been the most common means of transmitting VTEC organisms in sporadic cases and in outbreaks of VTEC infection (De Boer and Heuvelink, 2001). The ease of transmission of this pathogen, and its very low infectious dose i.e. o10 cells (Willshaw et al., 1994), make it of particular signicance as a foodborne pathogen. Numerous investigations on the incidence of E. coli O157:H7 in meat and meat products have reported

ARTICLE IN PRESS
E. Carney et al. / Food Microbiology 23 (2006) 5259 53

prevalences of 2.8% (Cagney et al., 2004), 0.12% (Vernozy-Rozand et al., 2002), 2.3% (Fantelli and Stephan, 2001), 1.1% (Chapman et al., 2000) and 1.1% (Heuvelink et al., 1999) in a range of retail meats, but little recent information is available on its prevalence on beef trimmings and head meat, both of which are components of a range of comminuted meat products such as mince/ground meat, and beef burgers. Previous studies on the bovine hide and the beef carcass have shown that E. coli O157:H7 can be transferred to the carcass pre-evisceration, during hide removal operations (Elder et al., 2000; McEvoy et al., 2003). Once on the carcass surface, the pathogen can be spread by the handling and trimming operations to the beef trimmings (Gill and McGinnis, 2000) and head meat. The head, as the lowest part of the animal during the early stages of dressing, is at particular risk of contamination from other parts of the carcass by splash, draining of surface water and contact with operatives and surfaces. The contamination of head meat with E. coli O157:H7 may pose a signicant risk during processing and slaughter procedures (Gill et al., 1999b). Contaminated end products ultimately present higher risks to consumers. The incidence and numbers of Enterobacteriaceae on head meat is an effective indicator of hygiene and quality, particularly in relation to contamination of faecal origin (Tornadijo et al., 2001). Ireland has had an incidence of clinical cases of E. coli O157:H7 of 2.1, 1.4, 0.9, 1.3 and 1.7 per 100,000 population between 1998 and 2002 (NDSC (National Disease Surveillance Centre) 2002)). It is important to know the prevalence and numbers of the pathogen on comminuted beef products and the role they play in the transmission of the pathogen to humans. Part of such work involves the development and application of quantitative risk assessment schemes to assess and manage risk associated with E. coli O157:H7. However, these can only be based on adequate quantitative and epidemiological data on such pathogens in food and the food processing environment ( Gill, 1995; Jericho et al., 1997; Cassin et al., 1998a; De Swarte and Donker, 2003; Fegan et al., 2003, 2004). As part of an exposure assessment of E. coli O157 previous studies have been conducted on the incidence and numbers of the pathogen on the bovine hide (OBrien et al., 2004) and on minced beef at retail (Cagney et al., 2004). The aim of this study was to determine the incidence and numbers of E. coli O157 on beef trimmings, beef carcass and head meat in a licensed export abattoir, the survey also included assessment of the prevalence of virulence genes in the isolates obtained.

2. Materials and methods 2.1. E. coli O157:H7 A ProtectTM (Protect, Technical Consultants Limited, UK) bead coated with E. coli O157:H7 (ATCC 43895) strain was placed into 10 ml of Brain Heart Infusion broth (BHI) (Oxoid, Basingstoke, UK) and incubated for 24 h at 37 1C. The resulting culture was streaked out on Sorbitol MacConkey agar (SMAC) (Oxoid) supplemented with Cexime tellurite SelectavialTM (CT) (Mast Diagnostics, Bootle, UK) (SMAC-CT) agar and incubated for 24 h at 37 1C. This was used as a control in the analysis of each batch of samples examined. 2.2. Samples All sampling was carried out in an export abattoir which processed animals from a wide geographical region in Ireland. This facility was considered representative of an export abattoir in Ireland. 2.2.1. Beef trimmings Beef trimmings (beef pieces derived from the carcass during deboning) used in the production of comminuted beef products were sampled (n 1351). Approximately 30 samples (25 g) per week were collected from an Irish export abattoir, between October 2001 and March 2003. Trimmings were transported from their point of separation from carcasses on a common conveyor belt, and subsequently separated into batches dened as being 90% visual leanness (vl) or 70% vl, a classication related to their future usage in various minced beef products. Each type of trimmings was separately boxed in 27.5 kg quantities in the boning hall, and one sample was taken from each box. Samples were transported to the laboratory within 1 h of collection and processed within 1 h of receipt. Each sample was stomached [260 rpm] for 1 min in 225 ml of E. coli Broth (EC Broth) (Difco Laboratories, USA), and examined for the presence of E. coli O157:H7 as described below. 2.2.2. Beef carcass Samples (n 132) were taken between April 2003 and July 2003 from beef carcasses on the slaughter/dressing line immediately before carcasses were placed in the chill (n 6/week) and also immediately after subsequent removal (n 6/week) from the chill store (approx. 0 1C for 1824 h). Each sample consisted of four pooled 5 cm2 subsamples, excised from the carcass at the rump, ank, brisket and neck. Samples were transported back to the laboratory and processed within 2 h. Each sample was stomached for 30 s in a stomacher bag with 10 ml of Maximum Recovery Diluent (MRD) (Oxoid). The stomached samples were examined for the presence of E. coli O157:H7 as described below.

ARTICLE IN PRESS
54 E. Carney et al. / Food Microbiology 23 (2006) 5259

2.2.3. Head meat Samples (n 100) of bovine head meat (40 g) were taken between September and December 2002. Heads were removed after skinning but before evisceration, placed on hooks and moved by conveyer to a head meat removal room. The tongue and lips were removed separately. Head, cheek and neck meat was removed and placed in the same tray. Samples (25 g) of this composite head meat were taken from the trays (usually 10/week) transported back to the laboratory and processed within 2 h. Samples were stomached for 1 min in 225 ml of EC Broth and tested for E. coli O157:H7 while 10 g samples were stomached for 1 min in 90 ml of MRD and were examined for Enterobacteriaceae as described below. 2.3. Microbiological methods 2.3.1. Enumeration: direct count of E. coli O157 Aliquots (1.0 ml) of the stomached sample were plated in duplicate onto SMAC-CT agar plates. The plates were placed in a microbial safety cabinet to dry, under aseptic conditions. The plates were incubated at 37 1C for 2224 h and examined for typical E. coli O157 colonies. Five suspect colonies (where present) from each duplicate plate were identied, subcultured onto Tryptone Soya Agar (TSA) (Oxoid), and subjected to conrmatory tests as described below. 2.3.2. Enrichment and IMS: presence or absence of E. coli O157 The remaining contents of the stomacher bags were incubated at 41.5 1C for 24 h. Immunomagnetic separation (IMS) was performed using immunomagnetic beads coated with an anti-E. coli O157 antibody (Dynabeadss anti-E. coli O157, Dynal A.S., Oslo, Norway). The recovered IMS bead complex was spread in duplicate onto SMAC-CT using a sterile cotton swab, and incubated at 37 1C for 22 h. Five colonies (where present) exhibiting typical presumptive positive characteristics from each duplicate plate were identied, subcultured onto TSA, incubated for 24 h at 37 1C and subjected to conrmatory tests as described below. 2.3.3. Conrmatory tests: E. coli O157:H7 Suspect colonies were streaked onto Levines Eosin Methylene Blue agar (EMB)(Oxoid) and Phenol Red Sorbitol agar with 4-methylumbelliferyl-B-D-Glucuronide agar (PRS-MUG)(Oxoid), and incubated overnight at 37 1C. Colonies displaying a green metallic sheen on EMB and no uorescence on PRS-MUG illuminated with UV light, were identied as colonies exhibiting typical characteristics of E. coli O157 species. 2.3.4. O157 and H7 antigen determination All sorbitol non-fermenting, MUG-negative colonies were cultured on TSA and incubated at 37 1C for 24 h.

The isolates were examined by latex agglutination with antisera against the O157 and H7 antigens (Wellcolex, Merseyside, UK). Colonies giving a positive precipitation reaction with the O157 and H7 antigens were subjected to PCR. 2.3.5. Enumeration and identication of Enterobacteriaceae Duplicate aliquots (1.0 ml) of the stomached suspension were mixed as pour plates with 15 ml of Violet Red Bile Glucose Agar (VRBGA)(Oxoid). When these plates had solidied, a further 15 ml overlay of VRBGA was added. After solidication, plates were incubated at 37 1C for 2224 h and examined for suspect (i.e. purple) Enterobacteriaceae colonies. Five suspect colonies from each duplicate plate were identied (where present), subcultured onto TSA, and subjected to conrmatory tests including oxidase test (Oxoid), glucose fermenta rieux, sa tion test (Oxoid), and API 20 E test (BioMe 69280 Marcy, lEtoile, France). 2.3.6. Serotype conrmation and virulence factor determination of E. coli O157 isolates by PCR Analysis by PCR was used to detect the presence of the verotoxin genes (vt1, vt2), the attaching and effacing gene (eaeA), enterohaemorrhagic E. coli gene (hlyA), portions of the rfb (O-antigen encoding) region of E. coli O157 and the iCh7 gene. DNA was extracted from the isolates using a DNeasy extraction kit and methods (QiagenTM, Crawley, UK) following the animal tissues protocol, with the following adjustments. Each positive colony was inoculated in 10 ml of BHI and incubated for 24 h at 37 1C. Bacterial cells were recovered from each culture by centrifugation of 1.5 ml of culture at 7500 rpm for 10 min. The supernatant was discarded and the procedure repeated. The recovered cells were resuspended in 180 ml of Tissue Lysis Buffer (ATL) and 20 ml of proteinase K was added instead of 40 ml and lysed by incubation at 55 1C in a water bath for 3 h. The primers and PCR conditions used in this study (Assay I to III) are detailed in Table 1. Assay I was a modied version of the Paton and Paton (1998) multiplex PCR, while assay II was a modied version of the Fitzmaurice et al. (2004) multiplex PCR. Assay III is a modied version of the Fratamico et al. (2000) multiplex PCR assay. Assay IV, which used all the above primers in a single PCR assay, was only used if the other assays (I, II or III) yielded unclear or ambiguous results. In Assay I, 10 ml of genomic DNA was used in each 50 ml PCR reaction. The primer concentrations were as follows: vt1 10 pmol ml1; vt2 10 pmol ml1; eaeA 12.5 pmol ml1 and hlyA 25 pmol ml1 (MWGBiotech AG, Ebersberg, Germany). For Assay II, 5 ml of genomic DNA was used in each 50 ml PCR reaction. The primer concentration for pO157 was 12.5 pmol ml1. For each assay (I and II), the PCR

ARTICLE IN PRESS
E. Carney et al. / Food Microbiology 23 (2006) 5259 Table 1 Oligonucleotide primers sequences Primer Sequence (50 -30 ) Reference Amplication product size (bp) 55

Assay I vt1F vt1R vt2F vt2R eaeAF eaeAR hlyAF hlyAR Assay II O157F O157R Assay III iCh7-F iCh7-R bpbase pairs.

ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT CGGACATCCATGTGATATGG TTGCCTATGTACAGCTAATCC GCGCTGTCGAGTTCTATCGAGC CAACGGTGACTTTATCGCCATTCC

Paton and Paton (1998) modied by Fitzmaurice et al. (2004) Paton and Paton (1998) modied by Fitzmaurice et al. (2004) Paton and Paton (1998) Paton and Paton (1998)

180 255 384 534

Paton and Paton (1998)

259

Fratamico et al. (2000)

625

mixture consisted of 50 mM KCL (Promega, Madison, Wisconsin, USA), 2.0 mM MgCl2 (Promega), 400 mM (each) of the four deoxynucleoside tri-phosphates (dNTPs)(Promega), 2.5 U Taq DNA polymerase, thermophilic DNA polymerase 1 buffer, magnesium free (Promega). Samples from Assays I and II were subjected to 35 PCR cycles, each consisting of 1 min denaturation at 95 1C and 2 min of annealing at 65 1C for the rst 10 cycles. Then decreasing to 60 1C by cycle 15; and 1.5 min of elongation at 72 1C, increasing to 2.5 min from cycles 25 to 35. In Assay III, 5 ml of genomic DNA was used in each 50 ml PCR reaction. The primer concentration of iCh7 (MWGBiotech AG) in a 50 ml reaction was 25 pmol. The primer mixture consisted of 50 mM KCL (Promega), 3.0 mM MgCl2 (Promega), 400 mM (each) of the four deoxynucleoside tri-phosphates (dNTPs) (Promega), 2.5 U Taq DNA polymerase, thermophilic DNA polymerase 1 buffer, magnesium-free (Promega). The PCR samples were then subjected to 94 1C for 2 min and then 35 cycles of denaturation at 94 1C for 20 s, annealing at 57 1C for 1 min, and extension at 72 1C for 1 min. Following the 35 cycles, a nal extension for 10 min at 72 1C was carried out. In Assay IV, the PCR mixture per 50 ml reaction consisted of 3 ml of genomic DNA, 1 ml of each primer pair at a nal concentration of 0.10.5 mM and 25 ml of Taq PCR Master Mix (QiagenTM). The PCR samples were then subjected to an initial denaturation period at 94 1C for 2 min and then an additional cycle of 94 1C for 1 min, followed by annealing at 62 1C for 1 min and

elongation at 72 1C for 3 min. Excluding the initial denaturation, the programme was repeated for 35 cycles with a nal extension of 72 1C for 8 min. Negative controls were included in all assays (replacing DNA with sterile distilled water) and positive controls (replacing isolate DNA with DNA from known positive organisms). 2.3.7. Gel electrophoresis PCR products were detected by electrophoresis of 10 ml of the amplication mixture supplemented with 2.0 ml tracking dye (Sigma), loaded on to a 2.0% agarose gel containing 2.0 ml of ethidium bromide (Gibco, UK). A 100 bp DNA ladder molecular weight marker (Pharmica Biotech, UK.) was included in each electrophoretic run to allow identication of the amplied products. PCR products were visualized under UV illumination and catalogued with a gel documentation system (Stratagene EE 2, Germany). The sizes of the PCR products were compared with the 100 bp marker DNA ladder (Promega). PCR products of the required size indicated a presence of the target gene.

3. Statistical analysis All bacterial counts were converted to log10 cfu g1 before performing statistical analysis. The positive samples were compared with each other to determine if there was any effect on the prevalence of E. coli O157 caused by the fat content (70 vl/90 vl). In addition, month data were assigned as DecemberMay

ARTICLE IN PRESS
56 E. Carney et al. / Food Microbiology 23 (2006) 5259

(the period when animals go to slaughter from indoor housing) (FI) or JuneNovember (coming from pasture) (FP). A 95% condence level was employed to determine if categories were signicantly different. Results were analysed using Genstat 5, Release 3.2 (Rothamsted, UK). Differences in percentage positive samples between sample types were determined using a chi-squared analysis. Where the data did not conform to the assumptions behind chisquared analysis, Fishers Exact Probability Test was applied. The overall likely population prevalence of E. coli O157 on beef trimmings in the Republic of Ireland was calculated from the total number of positive samples in the 1351 samples taken.

4.2. Beef carcass samples Of positive samples, 3/4 were recovered from carcasses before chilling. The pathogen was found at a prevalence of 3.0% (4/132) on beef carcass samples, by IMS and direct plating at concentrations ranging from 0.70 and 1.41 log10 cfu g1. All the beef carcass isolates contained the eaeA, hylA, iCh7 genes. One isolate contained both the vt1 and vt2 genes, 2 contained the vt1 gene only and 1 contained the vt2 gene only. 4.3. Head meat 3.0% (3/100) of head meat samples contained the pathogen at concentrations of 0.71.0 log10 cfu g1. All of the head meat isolates contained the eaeA, hylA, iCh7 and vt2 genes. None of the isolates possessed the gene encoding vt1. All of the head meat samples (100/100) contained Enterobacteriaceae. Fig. 1 presents the numbers and range of Enterobacteriaceae on the head meat samples. The numbers present on the head meat were between 0.70 and 3.0 log10 cfu g1.

4. Results 4.1. Beef trimmings The survey detected E. coli O157 in 2.4% (32/1351) of the beef trimmings samples at concentrations ranging from 0.70 to 1.61 log10 cfu g1. There was no signicant difference between the prevalence of the pathogen in 70 vl (18/699) and 90 vl (14/620) samples. There was a signicant difference between the prevalence of the pathogen in ex-pasture animals (1.22%, 7/576) and the prevalence of ex-housed animals (3.22%, 25/775). Table 2 presents the ndings in relation to detection and/or enumeration of E. coli O157 on 32 positive beef trimmings samples. Direct plating detected the pathogen in 7/32 samples at concentrations ranging from 0.70 to 1.61 log10 cfu g1. In the remaining 25/32 positive samples, the pathogen was detectable by enrichment only i.e.o0.70 log units. Table 3 details the genes detected in the 32 E. coli O157 positive samples. Of the 32 positive isolates, 31 contained the eaeA and hylA genes while 30/32 contained the iCh7 gene and 31/32 contained vt1 or vt2, or both vt genes.

Table 3 The virulence prole of E. coli O157 isolates recovered from beef trimmings 90 vla (n 14) or 70 vl (n 18) Visual leanness No. of isolates Virulence prole genes hlyA 90 90 90 90 70 70 70 70 7 5 1 1 9 6 2 1 + + + + + + + eaeA + + + + + + + vt1 + + + + vt2 + + + + iCh7 + + + + + +

+ positive. negative. a vl visual leanness.

Table 2 Detection and/or enumeration of E. coli O157 (log10 cfu g1) on beef trimmings, carcass and head meat samples Sample type Beef trimmings Beef trimmings Beef trimmings Beef carcass Beef carcass Head meat No. of samples tested 1351 1351 1351 132 132 100 No. positive samples (%) 25 (1.85) 6 (0.44) 1 (0.07) 3 (2.30) 1 (0.76) 3 (3.00) Range of count E 0.71.00 1.01.61 0.71.00 1.01.41 0.71.00 Mean count 0.83 0.87 0.70

Results are averaged values. E recovered by enrichment/IMS only.

ARTICLE IN PRESS
E. Carney et al. / Food Microbiology 23 (2006) 5259
40 35 30 Number of samples 25 20 15 10 5 0 0.7 - 1.0 1.0 - 1.5 1.5 - 2.0 Log10 cfu g 1 2.0 - 2.5 2.5 - 3.0

57

Fig. 1. The number (log10 cfu g1) of Enterobacteriaceae on head meat samples (n 100).

5. Discussion 5.1. Beef trimmings This study established a prevalence of 2.4% (32/1351) and counts of E. coli O157 (0.701.61 log10 cfu g1) in beef trimmings samples. This is the rst detailed report of the occurrence of this pathogen on beef trimmings (which are subsequently used in comminuted beef products) from a slaughter plant. This study observed no signicant difference between the incidence (or numbers) of the pathogen on 90 vl (14/32) or 70 vl (18/32) beef trimmings. This nding is in agreement with a previous study, which reported no signicant difference in the levels of generic E. coli on beef trimmings with 10, 20, 30, 40, and 50% fat (Scanga et al., 2000). This study recorded a consistently higher prevalence of E. coli O157:H7 on beef trimmings from housed animals (3.22%) than from animals from pasture (1.22%). This is most probably related to the closer contacts among housed animals, which provide increased opportunities for inter-animal cross-contamination. In most (25/32) of the beef trimmings samples which were demonstrated to carry E. coli O157, the pathogen was only detectable by enrichment, suggesting that pathogen numbers are low, i.e. o0.70 log10 units (the detection limit of the direct plating method). In those samples where the pathogen was detected by direct plating (7/32), counts ranged from 0.70 to 1.61 log10 cfu g1. This pattern of contamination, with relatively low numbers of E. coli O157:H7, is similar to that previously reported for non pathogenic E. coli on beef trimmings (Scanga et al., 2000). Of the 32 isolates recovered, 29 possessed the eaeA, hylA and iCh7 genes, 14/32 (43.7%) had genes encoding vt1, 15/32 (46.8%) had genes encoding for vt2 and 2/32 (6.25%) had genes encoding for both. The ndings

compare with those of a parallel study carried out on the prevalence and numbers of the pathogen on the bovine hide, which found the most common virulence prole in the isolates to be the hylA, eaeA, iCh7 and vt2 (OBrien et al., 2004). However, the ndings are at variance with a study into E. coli O157:H7 in Irish retail minced beef products, which found 41/43 (95.3%) of the positive isolates possessed genes encoding for both vt1 and vt2 (Cagney et al., 2004). Such differences may reect changes in virulence/pathogenic patterns during storage and processing, but should, however, be interpreted with care, as E. coli O157 isolates have been reported to lose genes, including VT-encoding genes, during subcultivation (Karch et al., 1992). 5.2. Carcass samples The study detected E. coli O157:H7 on 3.0% of beef carcasses at concentrations up to 1.41 log10 cfu g1. The ndings are in agreement with a previous study (McEvoy et al., 2003) which reported an E. coli O157:H7 prevalence of 3.2% beef carcasses in an Irish commercial abattoir. The majority of the positive isolates were recovered from samples taken before chilling; this is not surprising as chilling may stress bacterial cells due to the synergistic effect of low aw and temperature. Subsequent growth of stressed cells may be inhibited by the presence of bile salts and antibiotics in selective enrichment media (Stephens and Joynson, 1998; Hara-Kudo et al., 2000). However, a study carried out on contamination of beef trimmings with E. coli during carcass deboning found that numbers of the bacteria on the meat can increase after carcass chilling (Gill and McGinnis, 2000). The most likely sources of this contamination are detritus in large items of equipment (saws and conveyor belts) and personal equipment such as mesh gloves (Gill and McGinnis, 2000).

ARTICLE IN PRESS
58 E. Carney et al. / Food Microbiology 23 (2006) 5259

The prevalence of the pathogen on the beef carcass in this study, constitutes a potentially signicant public health risk, especially because of its low infectious dose and the severe sequelae of such infections (Willshaw et al., 1994; Coia et al., 2001). Many controls and risk management strategies have been targeted at controlling the pathogen in the abattoir environment (Dorsa et al., 1996; Gill and Bryant, 1997; Nutsch et al., 1997; Phebus et al., 1997; Nutsch et al., 1998; McEvoy et al., 2001). Additional efforts are also needed to understand the processes involved in the initial transfer of the VTEC to the carcass, and to reduce or limit such a transfer (McEvoy et al., 2001). The E. coli O157:H7 isolated from the beef carcass produced three separate virulence proles, which did not follow the same trend as the virulence proles observed in a similar carcass survey (McEvoy et al., 2003). 5.3. Head meat To the best of the authors knowledge this is the rst survey carried out on E. coli O157 on head meat. The microbial condition of head meat is of interest as it is used in the production of minced beef products such as beef burgers (Booren and Weiss, 1988). The prevalence and numbers of E. coli O157:H7 found on head meat in this study (3.0%) pose a considerable risk to the consumer as unlike the carcass meat, head meat in Ireland is often not washed and trimmed. The ndings of a study carried out on the microbial condition of head meat at two beef-packing plants indicated that washing operations helped to reduce the bacterial load (Gill et al., 1999b). Such operations would clearly be of benet in reducing the numbers of the pathogen on head meat. Enterobacteriaceae are often used as a hygiene indicator on foods of animal origin. Their presence on processed food may give a better indication than coliforms of inadequate treatment or post-process contamination from the environment, and may help to indicate the extent of faecal contamination (PHLS, 2002). However, the greatest application of Enterobacteriaceae and other indicator organisms is in assessment of the overall quality of a food and the hygiene conditions present during the food processing. The prevalence and numbers of Enterobacteriaceae found on head meat in this study reafrm the need for a washing step to reduce the bacterial load on the meat. However, the numbers of Enterobacteriaceae found on head meat in this study are deemed to be acceptable under the guidelines set out by the Food Safety Authority of Ireland (FSAI). The guidelines state that Enterobacteriaceae numbers must not exceed log10 5.0 g1 on 3/5 raw meat samples and log10 57 g1 on 2/5 samples. Studies on E. coli O157 isolates recovered from farm and abattoir samples regularly report that the majority

of isolates contain the attaching and effacing eaeA and vt2 gene, but not the vt1 gene (Omisakin et al., 2003; McEvoy et al., 2003). This compares favourably with data obtained from clinical isolates in Ireland (NDSC (National Disease Surveillance Centre) 2002)) and Scotland (Omisakin et al., 2003) in 2002, which found that the majority of E. coli O157 isolates contained vt2 but not vt1. The nding suggests that many of the isolates obtained in this study are capable of causing human illness and provides further evidence that cattle are a source of human E. coli O157 infections. While the number of beef trimmings samples taken was greater than those taken from the beef carcass or head meat, the results indicate the need for more stringent control measures to reduce the spread of the pathogen in the abattoir. The introduction of organic acid washes (Sheridan, 2004) used in synergistic combination with other interventions such as steam pasteurization (Gill et al., 1999a) have been shown to reduce the bacterial load on the carcass. The qualitative and quantitative data obtained about E. coli O157 on beef trimmings provide a sound microbiological basis for the development of accurate risk assessment models, which are essential but currently rare in this area (Cassin et al., 1998b).

References
Booren, A.M., Weiss, G.M., 1988. Lean skeletal meat trimmings incidental to slaughter. In: Pearson, A.M., Dutson, T.R. (Eds.), Advances in Meat Research, rst ed. Elsevier Applied Sciences, London, pp. 219230. Cagney, C., Crowley, H., Duffy, G., Sheridan, J.J., OBrien, S.B., Carney, E., Blair, I.S., McDowell, D.A., Bishop, R.H., 2004. Prevalence and numbers of Escherichia coli O157:H7 in minced beef and beef burgers from butcher shops and supermarkets in the Republic of Ireland. Food Microbiol. 21, 203212. Cassin, M.H., Lammerding, A.M., Todd, E.C.D., Ross, W., McColl, R.S., 1998a. Quantitative risk assessment for Escherichia coli O157:H7 in ground beef hamburgers. Int. J. Food Microbiol. 41, 2144. Cassin, M.H., Paoli, G.M., Lammerding, A.M., 1998b. Simulation modeling for microbial risk assessment. J. Food Prot. 61, 15601566. n Malo, A.T., Harkin, M.A., Chapman, P.A., Siddons, C.A., Cerda 2000. A one year study of Escherichia coli O157 in raw beef and lamb products. Epidemiol. Infect. 124, 207213. Coia, J., Johnson, Y., Steers, N.J., Hanson, M.F., 2001. A survey of the prevalence of Escherichia coli O157 in raw meats, raw cows milk and raw-milk cheeses in the south-east Scotland. Int. J. Food Microbiol. 66, 6369. De Boer, E., Heuvelink, A.E., 2001. Foods as vehicles of VTEC infection. In: Duffy, G., Garvey, P., McDowell, D.A. (Eds.), Verocytotoxigenic E. coli, rst ed. pp. 181200. De Swarte, C., Donker, R.A., 2003. Towards a food safety policy based on FSOs. Workshop on Impact of Food Safety Objectives on Microbiological Food Safety Management, Marseille, France, pp. 2228. Dorsa, W.J., Cutter, C.N., Siragusa, G.R., Koohmaraie, M., 1996. Microbial decontamination of beef and sheep carcasses by steam,

ARTICLE IN PRESS
E. Carney et al. / Food Microbiology 23 (2006) 5259 hot water spray washes, and a steam-vacuum sanitizer. J. Food Prot. 59, 127135. Elder, R.O., Keen, J.E., Siragusa, G.R., Barkocy-Gallagher, G.A., Koohmaraie, M., Laegreid, W.W., 2000. Correlation of enterohaemorrhagic Escherichia coli O157 prevalence in feces, hides and carcasses of beef cattle during processing. Proc. Natl. Acad. Sci. USA 97, 29993003. Fantelli, K., Stephan, R., 2001. Prevalence and characteristics of Shigatoxin-producing Escherichia coli and Listeria monocytogenes strains isolated from minced meat in Switzerland. Int. J. Food Microbiol. 70, 6369. Fegan, N., Higgs, G., Vanderlinde, P., Desmarchelier, P., 2003. Enumeration of Escherichia coli O157 in cattle faeces using most probable number technique and automated immunomagnetic separation. Lett. Appl. Microbiol. 38, 5659. Fegan, N., Vanderlinde, P., Higgs, G., Desmarchelier, P., 2004. The prevalence and concentration of Escherichia coli O157 in faeces of cattle from different production systems at slaughter. J. Appl. Microbiol. 97, 362370. Fitzmaurice, J., Glennon, M., Duffy, G., Sheridan, J.J., Carroll, C., Maher, M., 2004. Application of real-time PCR and RT-PCR assays for the detection and quantication of VT 1and VT 2 toxin genes in E. coli O157:H7. Mol. Cell. Probes 18, 123132. Fratamico, P.M., Bagi, L.K., Tiziana, P., 2000. A multiplex polymerase chain reaction assay for the rapid detection and identication of Escherichia coli O157:H7 in foods and bovine faeces. J. Food Prot. 63, 10321037. Gill, C.O., 1995. Current and emerging approaches to assuring the hygienic condition of red meats. Can. J. Anim. Sci. 75, 113. Gill, C.O., Bryant, J., 1997. Decontamination of carcasses by vacuumhot water cleaning and steam pasteurizing during routine operations at a beef packing plant. Meat Sci 47, 267276. Gill, C.O., McGinnis, J.C., 2000. Contamination of beef trimmings with Escherichia coli during a carcass breaking process. Food Res. Int. 33, 125130. Gill, C.O., Bryant, J., Bedard, D., 1999a. The effects of hot water pasteurizing treatments on the appearances and microbial condition of beef carcass sides. Food Microbiol. 16, 281289. Gill, C.O., McGinnis, J.C., Jones, T., 1999b. Assessment of the microbiological conditions of tails, tongues and head meats at two beef-packing plants. J. Food Prot. 62, 674677. Hara-Kudo, Y., Ikedo, M., Kodaka, H., Nakagawa, H., Goto, K., Masuda, T., Konuma, H., Kojima, T., Kumagai, S., 2000. Selective enrichment with a resuscitation step for the isolation of freezeinjured Escherichia coli O157:H7 from foods. Appl. Environ. Microbiol. 66, 28662872. Heuvelink, A.E., Zwartkruis-Nahuis, J.T.M., Beumer, R.R., de Boer, E., 1999. Occurrence and survival of Verocytotoxin-producing Escherichia coli in meats obtained from retail outlets in the Netherlands. J. Food Prot. 62, 11151122. Jericho, K.W.F., Kozub, G.C., Gannon, V., Thomas, E.J.G., King, R.K., Bigham, R.L., Tanaka, E.E., Dixon-MacDougall, J.M., Nishiyama, B.J., Kirbyson, H., Bradley, J.A., 1997. Verication of the level of microbiological control for the slaughter and cooling processes of beef carcass production at a high-line-speed abattoir. J. Food Prot. 60, 15091514. Karch, H., Meyer, T., Ru ssmann, H., Heesemann, J., 1992. Frequent loss of Shiga-like toxin genes in clinical isolates of Escherichia coli upon subcultivation. Infect. Immun., 34643467. McEvoy, J.M., Doherty, A.M., Sheridan, J.J., Blair, I.S., McDowell, D.A., 2001. Use of steam condensing at sub-atmospheric pressures 59 to reduce Escherichia coli O157:H7 numbers on bovine hide. J. Food. Prot. 64, 16551660. McEvoy, J.M., Doherty, A.M., Sheridan, J.J., Thomson-Carter, F.M., Garvey, P., McGuire, L., Blair, I.S., McDowell, D.A., 2003. The prevalence and spread of Escherichia coli O157:H7 at a commercial beef abattoir. J. Appl. Microbiol. 95, 256266. NDSC (National Disease Surveillance Centre), 2002. Epidemiology of Verotoxigenic E. coli O157 in Ireland. Annual Report, The National Disease Surveillance Centre, Dublin, Ireland. Nutsch, A.L., Phebus, R.K., Riemann, M.J., Schafer, D.E., Boyer Jr., J.E., Wilson, R.C., Leising, J.D., Kastner, C.L., 1997. Evaluation of a steam pasteurization process in a commercial beef processing facility. J. Food Prot. 60, 485492. Nutsch, A.L., Phebus, R.K., Riemann, M.J., Kotrola, J.S., Wilson, R.C., Boyer Jr., J.E., Brown, T.L., 1998. Steam pasteurization of commercially slaughtered beef carcasses: evaluation of bacterial populations at ve anatomical locations. J. Food Prot. 61, 571577. OBrien, S.B., Carney, E., Sheridan, J.J., McDowell, D.A., Blair, I.S., Duffy, G., 2004. Prevalence and numbers of Escherichia coli O157 on bovine hide at a beef slaughter plant. J. Food. Prot., accepted. Omisakin, F., MacRae, M., Ogden, I.D., Strachan, N.J.C., 2003. Concentration and prevalence of Escherichia coli O157 in cattle feces at slaughter. Appl. Environ. Microbiol. 69, 24442447. Paton, A.W., Paton, J.C., 1998. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, Enterohaemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 36, 598602. Phebus, R.K., Nutsch, A.L., Schafer, D.E., Wilson, R.C., Riemann, M.J., Leising, J.D., Kastner, C.L., Wolf, J.R., Prasai, R.K., 1997. Comparison of steam pasteurization and other methods for reduction of pathogens on surfaces of freshly slaughtered beef. J. Food Prot. 60, 476484. PHLS, 2002. Standard Operating ProcedureEnumeration of Enterobacteriaceae by the Colony Count Technique, F23. P. 4 Technical Service Division, PHLS HQ. Scanga, J.A., Grona, A.D., Belk, K.E., Sofos, J.N., Bellinger, G.R., Smith, G.C., 2000. Microbiological contamination of raw beef trimmings and ground beef. Meat Sci. 56, 145152. Sheridan, J.J., 2004. Risk reduction and prevention strategies towards pathogen-free food in Ireland. In: Proceedings of Conference Thinking Beyond Tomorrow, 1718 June 2004, Dublin, Ireland, pp. 4554. Stephens, P.J., Joynson, J.A., 1998. Direct inoculation into media containing bile salts and antibiotics is unsuitable for the detection of acid/salt stressed Escherichia coli. Lett. Appl. Microbiol. 27, 147151. Tornadijo, M.E., Garc a, M.C., Fresno, J.M., Carballo, J., 2001. Study of Enterobacteriaceae during the manufacture and ripening n cheese. Food Microbiol. 18, 499509. of San Simo Uhitil, S., Jaks ic, S., Petrak, T., Botka-Petrak, K., 2004. Presence of Escherichia coli O157:H7 in ground beef and ground baby beef meat. J. Food Prot. 64, 862864. Vernozy-Rozand, C., Ray-Gueniot, S., Ragot, C., Bavai, C., Mazuy, C., Montet, M.P., Richard, Y., Bouvet, J., 2002. Prevalence of Escherichia coli O157:H7 in industrial minced beef. Lett. Appl. Microbiol. 35, 711. Willshaw, G.A., Thirlwell, J., Jones, A.P., Parry, S., Salmon, R.L., Hickey, M., 1994. Verocytotoxin-producing Escherichia coli O157 in beefburgers linked to an outbreak of diarrhoea, haemorrhagic colitis and haemolytic uraemic syndrome in Britain. Lett. Appl. Microbiol. 19, 304307.