Fungal Genetics and Biology 47 (2010) 693706

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier.com/locate/yfgbi

Sex in Penicillium: Combined phylogenetic and experimental approaches

M. Lpez-Villavicencio a,*,1, G. Aguileta b,1, T. Giraud b, D.M. de Vienne a,b, S. Lacoste a, A. Couloux c, J. Dupont a
a

Origine, Structure, Evolution de la Diversit, UMR 7205 CNRS-MNHN, Musum national dhistoire naturelle, CP39, 57 rue Cuvier, 75231 Paris Cedex 05, France Ecologie, Systmatique et Evolution, UMR 8079, Btiment 360, Universit Paris-Sud, F-91405 Orsay cedex, France; UMR 8079, Btiment 360, CNRS, F-91405 Orsay cedex; France c Genoscope Centre National de Squenage: BP 191, 91006 EVRY cedex, France
b

a r t i c l e

i n f o

a b s t r a c t
We studied the mode of reproduction and its evolution in the fungal subgenus Penicillium Biverticillium using phylogenetic and experimental approaches. We sequenced mating type (MAT) genes and nuclear DNA fragments in sexual and putatively asexual species. Examination of the concordance between individual trees supported the recognition of the morphological species. MAT genes were detected in two putatively asexual species and were found to evolve mostly under purifying selection, although high substitution rates were detected at some sites in some clades. The rst steps of sexual reproduction could be induced under controlled conditions in one of the two species, although no mature cleistothecia were produced. Altogether, these ndings suggest that the asexual Penicillium species may have lost sex only very recently and/or that the MAT genes are involved in other functions. An ancestral state reconstruction analysis indicated several events of putative sex loss in the genus. Alternatively, it is possible that the supposedly asexual Penicillium species may have retained a cryptic sexual stage. 2010 Published by Elsevier Inc.

Article history: Received 25 January 2010 Accepted 6 May 2010 Available online 9 May 2010 Keywords: Positive selection Relaxed selection dN dS Talaromyces Experimental crosses

1. Introduction Despite the costs of sex (Otto and Lenormand, 2002), most eukaryotes engage in sexual recombination at least at some point in their life cycle. The predominance of sexual reproduction suggests that sex must provide some advantages. Although asexual reproduction is common in nature, exclusively asexual taxa are rare and they are considered to be short-lived (Judson and Normark, 1996). Many models have been built to explore shortand long-term advantages of sex to explain its maintenance, but evidence from natural cases is still scarce (but see De Visser and Elena, 2007, for recent experimental evidence for direct benets of sex). More information is needed on suitable biological models that could be used to tackle these issues. The empirical study of sex and recombination has been based on vertebrates, insects and plants models, while other groups of eukaryotes, including fungi, have been neglected (Birky, 1999). Biological groups that exhibit a diversity of reproductive strategies provide unique opportunities to study the evolution of sex. Groups such as fungi are thus excellent models as they present a great range of reproductive strategies, including obligatory sexual species, those that alternate sexual and asexual reproduction, and others that appear to be strictly asexual (Taylor et al., 1999). Fungi also

* Corresponding author. Fax: +33 1 69 15 73 53. E-mail address: mlopez@mnhn.fr (M. Lpez-Villavicencio). 1 Both authors contributed equally to this paper. 1087-1845/$ - see front matter 2010 Published by Elsevier Inc. doi:10.1016/j.fgb.2010.05.002

appear to have had multiple transitions from sexuality to asexuality (Lobuglio et al., 1993). In Fungi, asexual reproduction by production of asexual propagules (e.g. conidia) has been considered to be particularly common, with a quarter of fungal species thought to reproduce only by asexual means (Taylor et al., 1999). However, recent studies have shown that a great number of fungal asexual species are in fact capable of sexual reproduction. Sex in these species is only difcult to observe in nature and challenging to induce in the laboratory. Some species for which sex has not been observed, like Coccidioides immitis, present population structures consistent with recombination, suggesting the existence of cryptic sex in nature (Burt et al., 1996). Sex has been successfully induced under controlled conditions in species such as Candida albicans (Hull et al., 2000), Aspergillus fumigatus (OGorman et al., 2009), A. avus and A. parasiticus, which were long thought to be asexual (Horn et al., 2009a,b). Finally, apparently functional mating type genes (i.e. genes that dene mating compatibility in fungi) have recently been identied and characterized in several species with no sexual cycle described, such as A. oryzae (Galagan et al., 2005), and recently in Penicillium chrysogenum and Acremonium chrysogenum (Hoff et al., 2008; Pggeler et al., 2008). Other fungal species shown to be truly clonal from a population genetic standpoint, such as Penicillium marneffei, also present mating type genes, suggesting that sex has been lost recently (Woo et al., 2006; Fisher, 2007). Alternatively, sexual reproduction that would always occur between identical clones, as allowed under homothallism, would not be distinguishable from strictly asexual reproduction using population genetics.

694

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

Besides the fact that Fungi represent suitable biological models for studying the maintenance of sex and recombination, the study of reproductive strategies in this group has important direct applications. Until very recently, many fungal plant pathogens and some important animal pathogens and species with biotechnological importance were assumed to be clonal with widespread distributions (Taylor et al., 1999). However, recent studies have revealed the existence of recombination in some of these important species (Burt et al., 1996; Couch et al., 2005). Deciphering the mode of reproduction of pathogens may have profound implications for our understanding of the biology and for the management of the species. Recombination should maintain genetic variation within populations and generate new genotypes, which can present new or increased virulence, pathogenicity or drug resistance (Dyer and Paoletti, 2005; Taylor et al., 1999). Furthermore, many of the fungi used in industry are thought to have only asexual reproduction, and the discovery of a sexual stage could help improving strain quality by crosses (Pggeler, 2001). Here, we studied the evolution of reproduction in the fungal subgenus Penicillium Biverticillium using phylogenetic and experimental approaches. This group includes important species, such as the opportunistic pathogen P. marneffei, food and feed spoilers as well as species of importance in the food and biotechnology industries, such as P. pinophilum and P. funiculosum (Domsch et al., 1980). In the fungal genus Penicillium counting ca. 250 species (Pitt, 1979), only few species have a complete life cycle described, the teleomorphs being then Talaromyces or Eupenicillium. The remaining species are considered as strictly asexual fungi, corresponding to several independent losses of sex (Lobuglio et al., 1993). Asexual species have been classied into four subgenera, Aspergilloides, Biverticillium, Penicillium and Furcatum on the base of the morphology of their penicilli (Pitt, 1979). The subgenus Biverticillium is phylogenetically related to Talaromyces (Lobuglio et al., 1993), while the remaining three subgenera are related to Eupenicillium (Peterson, 2000) and are close to Aspergillus and related teleomorphs (Berbee et al., 1995). The teleomorphs Talaromyces and Eupenicillium constitute two distinct phylogenetic lineages within the family Trichocomaceae. We rst constructed a robust phylogeny of the fungal subgenus Penicillium Biverticillium to (1) improve our knowledge of their relationships, (2) test if the criterion of concordance between multiple gene genealogies supported the extant described morphological species (Dettman et al., 2003; Le Gac et al., 2007), and (3) evaluate the relationships between sexual and asexual species, in order to estimate the number of transitions towards asexuality. We used more strains per species, more genes, and partly different species, than those analyzed previously by Lobuglio et al. (1993). For building phylogenies, we used several genes recently proposed by Aguileta et al. (2008) as having a high phylogenetic performance in fungi, in addition to some genes commonly used for fungal phylogenies. Most of the published fungal phylogenies are indeed based on the same DNA markers, for instance the ribosomal genes or spacers, and genes coding for elongation factor proteins, RNA polymerase and beta tubulin (James et al., 2006; Lobuglio et al., 1993). However, a recent study has shown that these genes may be suboptimal phylogenetic markers, inferring different relationships among species than those supported by most genes in the genomes (Aguileta et al., 2008). We therefore wanted to compare the utility of the genes typically used in fungal phylogenies vs. that of the genes found to have a high phylogenetic performance by Aguileta et al. (2008). We were also interested in assessing whether the species considered as asexual were in fact so. For this goal, we rst tried to detect mating type genes, and sequenced them in sexual and asexual species. Mating-type loci are called idiomorphs rather than alleles in ascomycetes due to the uncertainty of the origin by com-

mon descent. Most ascomycetes present two idiomorphs MAT 11 and MAT 1-2. These genes code for transcription factors that induce the production of pheromones and pheromone receptors. The MAT 1-1 idiomorph includes a gene encoding a protein with a motif called the a1 domain, while the MAT 1-2 idiomorph presents a gene encoding a protein with a DNA-binding domain similar to that of the high mobility group (HMG) (Coppin et al., 1997). Homothallic fungi can undergo intra-haploid mating (Giraud et al., 2008), the proximal cause being in most of the lamentous homothallic ascomycetes, each haploid possesses two alternate forms of the MAT locus in its genome (Coppin et al., 1997). In contrast, heterothallic fungi carry a single MAT idiomorph and two strains carrying complementary MAT idiomorphs are required for sex to occur. Selective pressures acting on mating type genes are expected to be different in sexual vs. asexual species, and these pressures can be detected based on sequences (i.e. ODonnell et al., 2004). In sexually reproducing species, mating type genes must remain functional in order for sex to take place, implying that purifying selection should act (Devier et al., 2009; ODonnell et al., 2004). On the other hand, in asexual species still carrying mating type genes, mutations driving loss of function should be selectively neutral (Fisher, 2007), leading to relaxed selection. Positive selection may act on MAT genes in sexual species, involving rapid and recurrent changes that proved advantageous (Wik et al., 2008). We therefore looked for footprints of acceleration in substitution rates (indicating relaxed selection or positive selection) on MAT genes. Finally, when species were found to have both MAT 1-1 and MAT 1-2 alleles, we attempted to induce a sexual cycle experimentally. 2. Material and methods 2.1. Group of study and fungal isolates Most of the isolates of Talaromyces and Penicillium used in this study were obtained from the LCP culture collection (Laboratoire Cryptogamie Paris) at the French Natural History Museum (Musum National dHistoire Naturelle), Paris. Additional isolates used were donated by the MUCL collection (Mycothque de lUniversit Catholique de Louvain, Louvain La Neuve, Belgium) and by CMPG (Collection Mycologie Pharmacie Grenoble) and are now included in the LCP collection (Supplementary material Table S1). 2.2. Phylogenetic marker selection and primer design We used the FUNYBASE (Marthey et al., 2008) in order to search for single-copy orthologs and estimate their phylogenetic performance at different taxonomic scales within the Penicillium genus. We chose genes having an ortholog, and no paralog, in all complete fungal genomes analyzed by Aguileta et al. (2008), having a high phylogenetic performance (i.e. topological score higher than 91, see Aguileta et al., 2008), and having different levels of divergence among species. The exact functions of these genes are uncertain and their putative functions were inferred by BLAST analyses. We therefore only used their abbreviated names as in Aguileta et al. (2008) (for further details on the genes and their annotations see Marthey et al., 2008). Three genes were chosen: MS277 (putative ribosome biogenesis protein), MS456 (putative DNA replication licensing factor), and FG610 (putative chaperonin complex component TCP-1). MS277 and MS456 were the two sole genes found to yield the same topology as whole-genome sequences by Aguileta et al. (2008). Using FUNYBASE, the protein sequences of the chosen genes were downloaded from A. fumigatus, as this species was one of the closest to the group Penicillium/Talaromyces available in the database and could therefore be used as an outgroup. To obtain the

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

695

nucleotide sequences, we performed TBLASTN searches at NCBI. The recovered nucleotide sequence of A. fumigatus was also blasted (BLASTN) against the genome sequences of P. marneffei and Talaromyces stipitatus available in GenBank. The nucleotide sequences from each candidate ortholog extracted from A. fumigatus, P. marneffei and T. stipitatus were then aligned and conserved regions were targeted for primer design, using Primer3 (http://www.fokker.wi.mit.edu/primer3/input.htm). The primer sets used for gene amplication and the expected sizes of the amplicons are shown in Table 1. We also amplied the ITS rDNA, partial beta tubulin and translation elongation factor genes (EF-1alpha), commonly used for fungal phylogenies. We used respectively primers sets ITS 4/ITS 5 (White et al., 1990), Bt2a/Bt2b (Glass and Donaldson, 1995) and EF6/EF1D (Peterson et al., 2004). The sequences obtained using the beta tubulin and EF-1 alpha genes could however not be used because their introns were not alignable and because, once they were removed, the sequences were not phylogenetically informative enough. We therefore, restricted the full analyses to these four DNA fragments: MS277, MS456, FG610 and the ITS. 2.3. Mating type gene amplication We attempted to amplify mating type genes using three different sets of primers. First we used the degenerated primers designed by Woo et al. (2006) to amplify mating type genes in Penicillium species. These primers allowed the detection of mating type genes in only a few strains for species phylogenetically close to P. marneffei. The sequences obtained using these primers were aligned to develop a second set of primers (MAT 1-1-a and MAT 1-2-a, Table 1). This second set of primers amplied fragments in many strains, including those for which the rst primers did not allowed amplication of mating type genes. However, the sizes of the amplicons obtained were small (<250 bp), impeding the analysis of selective pressures acting on mating type genes. We therefore developed a third set of primers (MAT 1-1-b and MAT 1-2-b, Table 1) using the nucleotide sequences of the MAT 1-1 and MAT 1-2 idiomorphs from P. marneffei described by Woo et al. (2006) (GenBank Accession No. DQ340761 and DQ340762) and the MAT 1-1 and MAT 1-2 sequences from T. stipitatus (GenBank Accession No. EQ962658 and EQ962662 respectively). In all the cases, primers were designed in conserved regions of MAT 1-1 and MAT 1-2, using Primer3 online (http://www.frodo.wi.mit.edu/cgi-bin/pri mer3/primer3_www.cgi).
Table 1 Primers used for amplication and sequencing. Gene ITS Elongation Factor Beta Tubulin MS277 M456 FG610 Mating type Mating type Mating type Mating type MAT 1-1a MAT 1-2a MAT 1-1b MAT 1-2b Primer ITS-4 ITS-5 EF6 EF1d BT 2 a BT 2 b Sequence (50 30 )

2.4. DNA extraction, amplication and sequencing of nuclear genes Isolates were grown on MEA (2%) plates for 35 days at 25 C. DNA extraction was performed using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). For all amplications a standard PCR program was used with the following cycle conditions: one denaturation step for 5 min at 95 C, followed by 30 cycles with 30 s of denaturation at 95 C, 30 s of primer annealing between 50 and 60 C depending on the TM of chosen primers, 30 s to 1 min of elongation at 72 C following by a nal extension of 7 min at 72 C. For some primers, a touchdown annealing was used, from 60 C to 50 C for 30 s (0.5 C per cycle) (see Table 1 for details). Amplication products were separated on 1.5% agarose gels, stained with SybrSafe (Biowhitaker Molecular Applications, Rockland, ME, USA) and photographed under UV illumination. PCR products were puried and sequenced at the Genoscope (Evry, France) in both directions using amplifying primers. Sequences were deposited at GenBank under the numbers GU396463 to GU396534 for MS277, GU396381 to GU396462 for MS456, GU396604 to GU396667 for FG610, GU396535 to GU396603for ITS rDNA, GU454805 to GU454829 for MAT 1-1 and GU454830 to GU454847 for MAT 1-2 (all the alignments are available upon request). 2.5. Mating type detection and crosses under controlled conditions To test for sexual reproduction ability, complementary strains from the putative asexual species P. pinophilum and P. funiculosum previously identied as MAT 1-1 and MAT 1-2 were cultivated under controlled conditions. These species were chosen because they presented several strains of opposite mating types. For P. pinophilum crosses were performed using four isolates detected as MAT 1-1 (strains MUCL 38548, IMI 211.742, LCP 1699 and LCP 1527) and three isolates detected as MAT 1-2 (strains CMPG 505, CMPG 568 and CMPG 1507). For P. funiculosum two MAT 1-1 isolates (LCP 3383 and CMPG 567) and two MAT 1-2 strains (LCP 3189 and CMPG 177) were used. Cultures were grown by pairs on malt-agar plates under daylight at 25 C. Microscopic observation of plates were done after 15 days and then after 8 weeks of incubation on unsealed plate. 2.6. Phylogenetic analyses For each isolate, sequence data obtained for both strands of each locus were edited and assembled using CodonCode aligner v

Annealing temperature (C) 55 50 55 Touchdown 6050 50 55 Touchdown 6050 Touchdown 6050 Touchdown 6050 Touchdown 6050

Amplicon size 700 700 700 770 500 723 130 250 1000 770

TCCTCCGCTTATTGATATGC GGAAGTAAAAGTCGTAACAAGG CTTSTYCCARCCCTTGTACCA GGCCACGTCGATTCCGG GGTAACCAAATCGGTGCTGCTTTC ACCCTCAGTGTAGTGACCCTTGGC ACACCYCACCARCAACTCAT ATCTGRAAGTCGCCCCATC CTGATGGGTGATCCYGGTGT TTGTTGTGCATGTGGACGTA CCGCAAYAAGATCGTCATCA AGCATMTCCTGTGCATTCTTCA CGCCCTCTGAATAGTTTTATCG GCCCATTTTCCTTTGTAGGG AGGTTCCTCGACCCCCTAAT TTTTTCTCACACGGTTTGC CCACGTATAACGGGGCATC CGGCTTGCCAMAGGTCTT GTGATAATGCTTSCGATAGAGAATG GTTGGAGAGGAGGCGTTGAC

696

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

1.3.4. (CodonCode Software). Initial nucleotide and corresponding amino acid alignments were made for individual genes using ClustalW (v 1.83) (Thompson et al., 1994) and T-coffee v 5.05 (Notredame et al., 2000) both with default settings. In order to be sure of the quality of the alignments and the reading frame, we aligned nucleotide sequences using the corresponding amino acid alignments as a guide. The reading frame of each nucleotide sequence was determined using the emboss wise2 software and the guided alignment was done with the tranalign emboss program (http://www.emboss.sourceforge.net/). Manual edition of the alignments was done to remove gaps and verify their quality. Only unambiguously aligned regions were kept for further analyses. 2.6.1. Phylogenetic reconstruction and comparison We used sequence alignments separately to obtain individual trees, under both likelihood and Bayesian frameworks. We tried to amplify the four different DNA fragments (ITS, MS277, MS456, and FG610) in all the strains used in the study (Supplementary material). However, not all the sequences amplied in all the strains. Differences in the number of strains in each tree prevented formal comparisons between full individual trees. We therefore created restricted overlapping datasets, including only the sequences of the strains that were successfully amplied for all the four sequences MS277, MS456, FG610 and the ITS. Using this restricted dataset, we built (i) four single-sequence trees and (ii) a single tree based on a concatenation of the sequences obtained with a custom-made perl script. 2.6.1.1. Maximum likelihood analysis. PHYML (v 2.4.4) (Guindon and Gascuel, 2003) was used to infer phylogenetic trees from individual and concatenated alignments. Gaps were treated as missing data. Modeltest v 3.7 (Posada and Crandall, 2001) was used to predict the best evolutionary model for tree inference. The chosen model, based on the AIC and BIC ranking criteria in modeltest was the GTR+I+G with 4 rate categories. The same model was used for concatenated datasets. To determine node support for the tree topologies, bootstrap analysis was conducted using the consense program in the Phylip package (v 3.66) with 100 replicates and the majority consensus rule was chosen to obtain the nal tree. For rooting the tree, the A. fumigatus sequence was chosen as outgroup. 2.6.1.2. Bayesian analysis. MrBayes (v 3.1.2) was also used to infer phylogenetic trees from individual alignments. The model chosen with modeltest was GTR+I+G with 4 rate categories. Two independent chains with 1 million generations each were conducted. The rst 25% of the trees were discarded as burn-in and the remaining trees were sampled every 100 trees for a total of 10,004 trees used to infer the consensus tree. Bayesian posterior probabilities were obtained for the internal nodes. MrBayes determines which model suits each partition best. 2.6.2. Comparison among trees and use of concordance between multiple individual gene trees for species recognition 2.6.2.1. Comparison among methods for each individual gene tree. Maximum likelihood (ML) and Bayesian trees for each gene were compared by visual inspection by assessing whether differences in topologies could be observed at well-supported nodes. Further, we used two topological comparisons, the RobinsonFoulds (Robinson and Foulds, 1981) and the KuhnerFelsenstein (Kuhner and Felsenstein, 1994) metrics, as implemented in the treedist program in phylip v 3.66 (Felsenstein, 1989), as well as the Nyes topological comparison (Nye et al., 2006).

2.6.2.2. Comparison among individual gene trees. In order to use the criterion of concordance between individual gene trees for species recognition in the Penicillium/Talaromyces group (Dettman et al., 2003), we built restricted alignments that included only the strains that could be amplied for the four DNA fragments (ITS, MS277, MS456 and FG610). A concatenated dataset using these four sequences was created. Four single-gene trees and a concatenated tree were constructed using ML. Following the criterion of concordance between multiple individual locus trees (Dettman et al., 2003; Le Gac et al., 2007), a clade was considered as an independent evolutionary lineage (i.e. a phylogenetic taxon) when the clade was well supported in at least two single-locus trees and was not contradicted by any other single-locus tree. A clade was considered as well supported when its basal node showed MP bootstrap proportions higher than 70%. To compare the individual gene trees we used the same indexes as above (Felsenstein, 1989; Kuhner and Felsenstein, 1994; Nye et al., 2006; Robinson and Foulds, 1981). The different full gene trees (including all strains yielding successful amplications) were also compared by visual inspection, by checking whether differences in topologies were found at well-supported nodes. When discordant topologies were found, tests were run to assess whether the differences were signicant, using the CONSEL package v 0.1i which implements the AU test (Shimodaira and Hasegawa, 2001), the KH test (Kishino and Hasegawa, 1989), the SH test (Shimodaira and Hasegawa, 1999) and computation of the RELL bootstrap proportions (Shimodaira and Hasegawa, 1999). These tests compare the p-value associated with each tree, which represents the possibility of that tree being the true tree given the data. The competing topologies are thus ranked according to their p-values in order to determine which one is the most likely. 2.7. Determining selective pressure on mating type genes The evolution of mating type genes in sexual and asexual fungal species is expected to differ with respect to the selective pressure acting on each type of species. In sexual species there is pressure to maintain mating type genes functional, so strong purifying selection is expected. On the contrary, asexual species should relax this constraint and accumulate substitutions at a higher rate than sexual species, which is called relaxed selection. Footprints of purifying selection may therefore be good evidence that sexual reproduction is still important in nature or that it regularly occurred until recently. We were thus interested in characterizing the differences in selective pressure in the evolution of mating type genes in Penicillium vs. Talaromyces. We conducted tests on datasets where all the available sequences of each species were included as well as on a subset of these datasets, including a single sequence per species, in order to focus on between-species substitutions. Powerful statistical methods are available to measure the selective constraint on genes, by calculating whether the genes evolve neutrally, under purifying, or relaxed/positive selection based on the comparison between synonymous and nonsynonymous substitutions (these tests cannot distinguish between relaxed and positive selection as both increase the number of nonsynonymous substitutions). We used the program codeml in the PAML 4 package (Yang, 1997, 2007) to measure the nonsynonymous/synonymous substitution rate ratio (dN/dS), also referred to as x. x < 1 suggests purifying selection, x = 1 is consistent with neutral evolution, and x > 1 is indicative of positive selection. x values close to or higher than 1 may also indicate relaxed selection. Nested codon models implementing the x ratio can be compared by means of a likelihood ratio test (LRT). We used the null model M1a, which assumes two site classes with 1 > x > 0, and x1 = 1, which therefore implicitly supposed that there are no sites under positive selection. This

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

697

model was compared with the alternative model M2a, which adds an extra class of sites that allows x to take values higher than 1. We also compared the null model M7, which assumes a beta distribution of x across sites, with the alternative model M8, which adds an extra class of sites to M7 where x can take values higher than 1. Thereby positive selection can be detected if a model allowing for positive selection is signicantly more likely (as estimated by the LRT) than a null model without positive selection. We checked for signicant variability across sites by means of a LRT that compares model M0, which assumes a single x value for all sites in the alignment, with model M3, which assumes that x is distributed in three classes of site, x0 = 0, x1 = 1, and x2 that can take values higher than 1, thus allowing for the detection of positive selection. We were also interested in contrasting the selective pressures acting in the mating type genes vs. the house-keeping genes in order to test: (i) whether mating type genes are under different selective constraints than the house-keeping genes employed in this study for building the phylogeny and (ii) whether the mating type genes are less constrained (i.e., have higher substitution rates) in asexual species than in sexual ones. To do so, we used the parameter estimates of models M1a and M2a to determine the fraction of sites that belonged to each class of sites according to their x values (i.e., 1 > x > 0, x1 = 1 and x2 > 1). Selective pressure is expected to vary along the different lineages in the phylogeny, as some species may be under higher or lower constraints relative to the overall pressure across the tree. We explored dN/dS variability along the different branches of MAT and marker gene trees by assuming an independent x ratio for each lineage. This corresponds to the free-ratios test, which can be compared to model M0 (where all branches are assumed to have the same x value) by a LRT. This is not a formal test to test for branch-specic variations in dN/dS ratio (for branch-specic models see Yang, 1998; Yang and Nielsen, 1998), but we used it as an exploratory means to detect species of interest that could be further validated by other tests and also experimentally. Finally, for specic branches of interest, we used branch-site models (Yang and Nielsen, 2002; Zhang et al., 2005). These are powerful methods that can predict specic sites at particular branches to evolve under higher substitution rates, as they allow x to vary at different branches in the tree. In branch-site models, it is assumed that branches are divided a priori into foreground and background lineages, and positive selection is allowed to occur only at foreground branches. We used alternative model A that assumes four classes of sites: class 0 includes the codons that are conserved throughout the tree (1 > x > 0). Site class 1 includes codons that are neutral across the entire phylogeny (x1 = 1). Site classes 2a and 2b include codons that are conserved or neutral on background branches but can have high substitution rates on foreground branches (x2 > 1). As a null model we used model A, but with x2 xed to 1 (x2 = 1). We implemented a LRT that compares null model A with alternative model A in order to test for point events of high substitution rates. 2.8. Ancestral state reconstruction To estimate the number of events of putative sex losses in the Penicillium/Talaromyces group, we performed an ancestral state reconstruction analysis, accounting for phylogenetic uncertainty (Pagel et al., 2004). We use an alignment of the locus MS277 containing a single individual per species, chosen at random, and using A. fumigatus as a sexual outgroup. We constructed a Markov chain to implement a model of trait evolution, and used the chain to estimate the posterior probability distribution of the rate coefcient and of the nature of the ancestral states at each node. The model in our case is dened by two rates, qAS (transition from asexuality

to sexuality) and qSA (transition from sexuality to asexuality), by the likelihood function that evaluates the data on a tree given the rates, by the prior probability distributions for the rate parameters, and by the set of 100 trees as obtained from a bootstrap analysis performed by PHYML on the aligned sequences. In our analysis, we constrained the rate qAS to 0, as a transition from asexuality to sexuality is highly unlikely. We used uniform prior distributions for the other parameters, assuming that all values of the parameters were equally likely a priori. The principle of the Bayesian estimation of the parameters is as follows: at each iteration the chain proposes a new combination of rate parameters and randomly selects a new tree from the sample of 100 initial ones. The likelihood of the new combination is evaluated and this new state of the chain is accepted or rejected (for more details, see Pagel et al., 2004). We ran the Markov chain for 5,050,000 iterations, discarded the 50,000 rst sets of parameters and sampled from the chain every 100 generations. This yielded 50,000 sets of rate coefcients from which we estimated the joint probability distribution. Each sampled set of coefcient was also used to reconstruct ancestral states at each node of the majority-rule consensus tree obtained from the 100 initial trees. Note that the transition rate from asexuality to sexuality was set to 0, each node leading to both sexual and asexual species having a probability of being sexual equals to 1. To take into account phylogenetic uncertainty, we used the most recent common ancestor (MRCA) approach proposed by Pagel et al. (2004). For each node in the consensus tree, we identied in each tree the MRCA of the group of species and reconstructed the state at that node and combined the information at that node. 3. Results 3.1. Phylogenetic analysis of single-locus datasets and species recognition 3.1.1. Comparison between methods of reconstruction for each individual gene tree Taxonomic identications of the isolates were validated by comparison of their ITS sequences with those of ex-type or representative isolates (Lobuglio et al., 1993) deposited in GenBank. Using maximum likelihood and Bayesian analyses, we obtained individual gene trees for the ITS, MS277, MS456, and FG610 genes. The tree generated using MS277 was both the one with the highest number of strains and the best resolved of all the trees produced (Fig. 1). All other trees are presented in Supplementary material (Figs. S1S3). Single-gene trees resulting from Bayesian and ML analyses were compared using three different metrics, Robinson Foulds (Robinson and Foulds, 1981), KuhnerFelsenstein (Kuhner and Felsenstein, 1994) and Nyes topological comparison (Nye et al., 2006). Table 2 shows the results of the comparisons. All topologies were highly congruent according to the three metrics employed, between ML and Bayesian trees. 3.1.2. Phylogenetic relationships within Penicillium subgenus Biverticillium Three major robust monophyletic clades (>98% Bootstrap Proportions) were reconstructed within the subgenus Biverticillium, among species investigated in this study (Fig. 1). All the terminal clades representative of the species were also signicantly supported, with the exception of P. funiculosum. A main clade groups most of the isolates of P. funiculosum and includes P. rubrum isolates, while the neotype strain of P. funiculosum (MUCL 38969) groups outside (73% BP) with two Talaromyces sp. isolates (LCP 4272 and LCP 4224). Talaromyces and Penicillium species are interspersed in the phylogeny. The clade I supports the

698

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

Talaromyces macrosporus

MAT 1-1 MAT 1-2

100

100 100 100

T. flavus P. aculeatum
69 99 65

96

P. funiculosum

100 100 73 96

100 68

P. rubrum P. funiculosum Talaromyces sp P. funiculosum

91

100 100

90 72 67 88 94

P. pinophilum

Clade III

100

100 97 100

P. purpurogenum var. rubrisclerotium P. verruculosum P. marneffei T. stipitatus P. erythromellis

100 88 66

97 99

100

P. minioluteum T. udagawae

Clade II
100 98 100

81 100 100

73 100

T. trachyspermus

77 100 90 100 100 65 100

P. purpurogenum P. piceum P. loliense

91

Talaromyces sp P. variabile T. wortmanii

89

98

P. loliense P. rugulosum

Clade I

T. bacillisporus

Fig. 1. Tree based on the gene MS277 (ribosome biogenesis protein) generated by maximum likelihood using the model GTR+I+G with 4 rate categories and 100 bootstrap replicates. Bootstrap values higher than 65% are reported at each node. Penicillium species are putatively asexual while Talaromyces species have a sexual stage described. Strains where mating type genes could be amplied are indicated (MAT 1-1 genes white circles; MAT 1-2 genes full circles). Only strains for which the gene MS277 was amplied are shown in the gure, so that some strains used in the study are lacking in the tree. The scale indicates the number of expected nucleotide substitutions along the branch.

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706 Table 2 Pairwise topological comparisons between Maximum Likelihood and Bayesian individual gene trees for each gene using three different metrics. These full gene trees include all strains yielding successful amplications. Gene ITS MS277 MS456 FG610 Robinson Foulds 56 32 59 38 Nyes topological score (%) 84.2 93.9 85.4 87.3 Kuhner Felsenstein 1.509272e01 5.592012e01 3.077379e01 9.223337e01

699

evolves under different rates in the two misplaced species than in the other species, possibly being less constrained. 3.1.4. Species recognition: comparison between individual gene trees built using the restricted dataset In order to use the criterion of concordance between multiple gene genealogies to delimit species, we compared the trees generated by maximum likelihood using four independent nuclear loci (ITS, MS277, MS456 and FG610) on the exact same set of strains, those for which we could obtain sequences for all the four DNA fragments. A tree was also built using a concatenation of these alignments (Fig. 2). Bold branches on this concatenated tree indicate the clades identied as independent evolutionary lineages. The morphological species delimitation was supported by the criterion of concordance between multiple gene genealogies for all the six species represented by at least two strains in the restricted dataset (P. funiculosum, P. pinophilum, T. stipitatus, T. trachyspermus, P. minioluteum, and P. piceum). The phylogenetic relationships were in agreement with the relationships previously inferred based on morphological and physiological characters (Pitt, 1979). The comparisons of the individual gene trees using the RobinsonFoulds and KuhnerFelsensteins metrics, and the Nyes topological comparison are given in Table 4. All topologies were overall congruent according to the three metrics employed. 3.2. Phylogenetic distribution of sexuality and reconstruction of the ancestral state of the mode of reproduction The sexual and putatively asexual clades are interspersed in the phylogeny, suggesting that there have been several independent losses of the sexuality in the fungal subgenus Penicillium Biverticillium. The ancestral character state reconstruction in fact inferred a total of 10 putative sex losses (Fig. 3), considering that all the putatively asexual species are really so. 3.3. Phylogenetic distribution of mating types and selective pressure on mating type genes The rst steps in our study for approaching the reproductive mode of putatively asexual species of Penicillium was to search for mating type genes by PCR and to assess the selective pressure they were subject to. We used three different sets of primers to attempt amplications of mating type genes in all the species used in this study. MAT genes were amplied in several species of Penicillium and Talaromyces mainly from the species phylogenetically close to P. marneffei and T. stipitatus, that were the species used to design the mating type primers (Table 5). In some species, MAT 1-1 genes presented a small intron (20 bp) while all MAT 12 sequences presented one putative conserved intron (50 bp) (Data not shown). All introns were removed for further analyses. A single

relationships between T. bacillisporus and T. wortmanii with P. loliense, P. piceum, P. rugulosum and P. variabile. The clades II and III are sister clades. In the clade II, the relationships between T. trachyspermus and P. purpurogenum and between T. udagawae and P. minioluteum are well supported (P97% BP), while P. erythromellis is not signicantly grouped with the two latest. In the clade III, T. stipitatus is in a basal position to a major robust sub-clade containing T. avus, T. macrosporus, P. pinophilum, P. funiculosum; P. rubrum, P. marneffei, P. aculeatum, P. purpurogenum var. rubrisclerotium and P. verruculosum. However relationships within this sub-clade are not resolved. When comparing our results to LoBuglio et al. (1993), Talaromyces and Penicillium species groupings were maintained even if species sampling was not exactly the same. In our study bootstrap values have reached 97% for clade II as a sister of clade III, and 99100% for each clade. 3.1.3. Comparison between individual gene trees built using the full datasets When comparing by visual inspection the individual gene trees built using the full sequence datasets, the placements of a few strains were different between some of the trees, but the corresponding nodes had so little support that these differences were not meaningful. The only incongruence that concerned well-supported nodes was the one involving the two T. trachyspermus strains CMPG 545 and CMPG 563, that had different placements in the ITS tree as compared to all the other trees. Using the enforced topology test, we tested whether the ITS data signicantly supported a topology that differed relative to the other single-gene trees. We therefore constrained the ITS tree to place the two problematic strains as they appear in all other trees. The CONSEL analysis was signicant, suggesting that the topology supported by the ITS data is in fact signicantly different from the other single gene topologies (Table 3). The two misplaced T. trachyspermus strains (CMPG 545 and CMPG 563) have unexpectedly long branches (0.084 and 0.125 in the ML and Bayesian trees, respectively) as compared to the clade where they should be placed, which has a branch length of 0.010 in the two analyses. This suggests that ITS

Table 3 CONSEL analysis for the enforced topology tests. Tree ITS Modied ITS Obs 2.0 2.0 au 0.679 0.321 np 0.690 0.310 bp 0.693 0.307 pp 0.882 0.118 kh 0.694 0.306 sh 0.694 0.306 wkh 0.694 0.306 wsh 0.694 0.306

au p-values for the approximately unbiased (AU) test. np bootstrap probability of the selection. bp same as np, but calculated directly from the replicates. pp Bayesian posterior probability (pp) calculated by the BIC criterion. kh p-values for the KishinoHasegawa (KH) test. sh p-values for the ShimodairaHasegawa (SH) test. wkh p-values for the weighted KishinoHasegawa (WKH) test. wsh p-values for the weighted ShimodairaHasegawa (WKH) test. For more details see Shimodaira and Hasegawa (2001).

700

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

Fig. 2. Tree generated by maximum likelihood analysis based on four concatenated nuclear loci (ITS, MS277, MS456 and FG610). Bold branches indicate the clades identied as independent evolutionary lineages supported by the majority of the loci. Bootstrap values higher than 70% are reported at each node. Table 4 Pairwise topological comparisons, using three different metrics (A, RobinsonFouldsdistance, B, KuhnerFelsensteindistance and C, Nyes topological score), between individual gene trees and the concatenated tree, using the restricted dataset including only the strains for which all four genes could be sequenced. MS277 A MS277 ITS MS456 FG610 Concatenated dataset B MS277 ITS MS456 FG610 Concatenated dataset C MS277 ITS MS456 FG610 Concatenated dataset 0 32 32 26 20 0 361.335 369.801 365.508 307.919 0 ITS 32 0 32 34 32 361.335 0 355.626 358.398 375.77 74.1% 0 MS456 32 32 0 32 26 369.801 355.626 0 356.7 324.877 74% 72.6% 0 FG610 26 34 32 0 18 365.508 358.398 356.7 0 300.978 76.5% 71.7% 75.4% 0 Concatenated dataset 20 32 26 18 0 307.919 375.77 324.877 300.978 0 84.2% 73.4% 78.8% 86% 0

partial mating type gene could be amplied in several Penicillium species, as well as in the strains from T. trachyspermus, T. wortmanii and T. udagawae. These Talaromyces species being homothallic,

they were expected to carry both MAT idiomorphs. However, the phylogenetic distance of these species from T. stipitatus and P. marneffei could have impeded annealing of the primers. In contrast,

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

701

Fig. 3. Ancestral character state reconstruction of sexuality and asexuality based on the MS277 gene using the Bayesian estimation method. Light gray boxes represent sexual species. Black boxes represent asexual ones. At each node, the lled circle represents the probability that this node is at a particular state: light gray for sexual, dark for asexual. Note that the probability that a given node is considered as sexual is equal to 1 as long as one of its descendants is asexual. This is due to the constraint we applied on the analysis that disables transitions from asexuality to sexuality (see text).

two mating type genes were detected in the six strains of T. avus and in the two strains of T. stipitatus used in this study (Fig. 1). Mating type genes could thus be amplied in the putatively asexual species close to P. marneffei and T. stipitatus (Table 5, Fig. 1). In P. pinophilum, MAT 1-1 was detected in 5 out of 14 strains while MAT 1-2 was detected in 9 out of 14 strains. In P. funiculosum, most of the strains were detected as MAT 1-1, MAT 1-2 being amplied in only 2 out of 14 strains. In P. erythromellis, all the four analyzed strains seemed to carry only MAT 1-1 (Table 5, Fig. 1). Overall, most Talaromyces strains showed amplication of both MAT 1-1 and MAT 1-2 sequences, in agreement with the reports of homothallism in these species (Takada and Udagawa, 1988). In contrast, although all the strains of Penicillium were also systematically screened for MAT 1-1 and MAT 1-2 sequences, only a single mating type was detected in all the Penicillium strains, which would correspond to a heterothallic breeding system in sexual species. 3.4. Selection pressures on MAT genes No evidence of positive or relaxed selection was found in any of the tests performed using all the strains (i.e. multiple strains per species). Instead, both MAT 1-1 and MAT 1-2 genes had low dN/ dS values in all the models used. Likelihood ratio tests comparing respectively models M1a vs. M2a, and models M7 vs. M8, rejected the models that allow for increased substitution rates in favor of the null model where dN/dS values > 1 are not permitted (Table 6). Furthermore, most of the sites in MAT genes showed x values well below one. Table 5 and Fig. 4 show the LRTs for models M1a and M2a for the two MAT genes as well as for the house-keeping genes, using the full dataset, i.e. multiple strains per species.

Analyzed together, the MAT 1-1 sequences showed 72% of fairly conserved sites, at x = 0.14 (Fig. 4). When analyzed separately, MAT 1-1 sequences in Penicillium (the asexual group) showed 85% of conserved sites, with x = 0.17, whereas the MAT 1-1 sequences in Talaromyces (the sexual group) appeared slightly less conserved, with x = 0.20 at 76% of sites. We had not enough MAT 1-2 sequences from Talaromyces to estimate x separately but the overall estimated value was x = 0.22 at 93% of sites. From these results, MAT 1-1 seems to be under stronger purifying selection, but at a smaller fraction of sites than MAT 1-2 (x = 0.14 in 72% of sites vs x = 0.22 in 93% of sites). Overall, MAT 1-1 and MAT 1-2 genes in all the analyzed species were highly conserved, even in species considered as asexual. The results from the branch-site analysis however suggest that there are two sites with high substitution rates (x2 = 41.23) in MAT 1-1 in the lineage leading to the species P. pinophilum (CMPG 505, LCP 3569 and LCP 2604) and P. purpurogenum var. rubrisclerotium (MUCL 29225), i.e. to a Penicillium clade, putatively asexual. We ran the same analyses as above using a dataset including a single strain per species to concentrate on between-species substitution rates, and we obtained similar results (Table 6). As above, no positive or relaxed selection was detected, except for the MAT 1-1 gene that showed two sites as having increased substitution rates at a particular branch leading to P. pinophilum (x2 = 34.64). House-keeping genes were also under strong purifying selection (analyses using the full dataset), and appeared even more constrained (Table 6): MS277 had 72% of sites with x = 0.14; MS456 showed the strongest purifying selection with x = 0.007 at 94% of the sites; FG501 had 95% of sites at x = 0.03, and FG610 exhibited 94% of sites under x = 0.02 (Fig. 4).

702 Table 5 Strains where mating type genes were detected. Collection no. LCP 2604 CMPG 568 CMPG 505 MUCL 46114 CMPG 1507 LCP 3569 MUCL 14090 LCP 3438 LCP 5166 MUCL 38548 LCP 1699 LCP 1527 IMI 211.742 MUCL 47343 MUCL 19010 MUCL 29225 FRR 1868 LCP 2233 LCP 3727 LCP 4464 LCP 3383 CMPG 567 CMPG 921 CMPG 534 CMPG 233 LCP 5346 CMPG 811 CMPG 556 CMPG 757 CMPG 527 CMPG 34 LCP.5345 CMPG 177 LCP 3189 LCP 4991 MUCL 38781 MUCL 38803 LCP 2692 LCP 2466 LCP 2892 LCP 3067 LCP.2888 LCP 2885 LCP 2481 LCP 4144 LCP 4437 LCP 4440 LCP LCP LCP LCP LCP 1489 4224 4272 4434 4435

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706 Table 6 LRTs for site-specic, free-ratios and branch-site analyses for MAT genes for all strains and one strain per species. All strains LRT MAT 1 all strains M0 vs. M3 M1a vs. M2a M7 vs. M8 M0 vs. FR Manull vs. MAalt One strain/species M0 vs. M3 M1a vs. M2a M7 vs. M8 M0 vs. FR Manull vs. MAalt Manull vs. MAalt MAT 2 all strains M0 vs. M3 M1a vs. M2a M7 vs. M8 M0 vs. FR Manull vs. MAalt Markers MS277 M0 vs. M3 M1a vs. M2a M7 vs. M8 MS456 M0 vs. M3 M1a vs. M2a M7 vs. M8 FG610 M0 vs. M3 M1a vs. M2a M7 vs. M8 108.68 0 1.36 2 2 2 2.51442E24 1 0.506616995 2d 52.6 0 0.5 55.45 14.74 43.5 0 0 54.28 13.19 5.37 5.5 0 0 6.05 0 117.61 0 0.16 95.18 0 0.54 Degrees of freedom 2 2 2 13 1 2 2 2 26 1 1 2 2 2 6 1 2 2 2 2 2 2 p-value 3.78491E12 1 0.778022372 3.36849E07 0.0001234 3.58175E10 1 1 0.000935868 0.000281447 0.02048598 0.063927861 1 1 0.417612437 1 2.89276E26 1 0.923116346 2.14746E21 1 0.763379495

Mating type detected MAT 1-1 MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT 1-1 1-1 1-1 1-1 1-1 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2

Species Penicillium sp. P. P. P. P. P. P. P. P. P. P. P. P. P. P. pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum pinophilum

MAT 1-1 MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-1 1-2 1-2

P. purpurogenum var. rubrisclerotium P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. P. erythromellis erythromellis erythromellis erythromellis funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum funiculosum

MAT 1-1 MAT 1-1 MAT 1-1 MAT 1-1 MAT 1-2 MAT MAT MAT MAT MAT MAT 1-1/MAT 1-2 1-1/MAT 1-2 1-1/MAT 1-2 1-1/MAT 1-2 1-1/MAT 1-2 1-1 /MAT 1-2

P. rubrum P. verruculosum P. aculeatum P. aculeatum P. aculeatum T. T. T. T. T. T. avus avus avus avus avus avus

MAT 1-1/MAT 1-2 MAT 1-1/MAT 1-2 MAT MAT MAT MAT MAT MAT MAT MAT MAT MAT 1-1 1-1 /MAT 1-2 1-1/MAT 1-2 1-1 1-1 1-1 1-1 1-1 1-1 1-1

T. macrosporus. T. macrosporus T. wortmanii Talaromyces sp. Talaromyces sp. Talaromyces sp. Talaromyces sp. T. T. T. T. T. trachyspermus trachyspermus trachyspermus trachyspermus trachyspermus

controlled conditions. Sexual structures and ascospores were observed in controlled conditions for the cross of two strains belonging to species P. pinophilum (strains CMPG 505 MUCL 38548) (Supplementary material). These two strains of opposite mating types placed under controlled conditions produced ascogenous hyphae and antheridia after 15 days and cleistotothecia after 30 45 days. Microscopic observation of the crosses was made using methylene blue/lactophenol staining to contrast the structures that are hyaline. Conidiophores and conidia were produced 6 days after incubation, but penicilli were difcult to observe when cultures became old. To facilitate the observation of ascogonia and antheridia we took samples at the periphery of the colony, where conidiophores are rare (Supplementary material, Fig. S7). Cleistothecia were formed but were long to ripe. Ascospores were observed only when media dried (90 days). In P. funiculosum, no evidence of sexual development was detected.

CMPG 545 CMPG 563 LCP 2889 LCP 2890 LCP 2884 CMPG 1216 LCP 4441 LCP 4439

4. Discussion Multiple gene genealogies were used in this study to compare phylogenetic and morphological criteria for species recognition and to infer phylogenetic relationships among the most common species of the Penicillium/Talaromyces group. The individual gene trees (ITS, MS456, MS277 and FG610) showed overall concordant topologies and we could obtain well resolved phylogenies. The species were grouped into three major clades, in agreement with morphology. Clade I contains species with yellow mycelium that grow slowly on the media recommended for the taxonomy of the group (Pitt, 1979). The sister clades II and III are more diverse and contain species producing red pigmentation. Pitt (1979) used growth rates as the primary distinctive character to accommodate

MAT 1-1 MAT 1-1/MAT 1-2 MAT 1-1/MAT 1-2

T. udagawae T. stipitatus T. stipitatus

3.5. Inducing sex in Penicillium species under controlled conditions To test for sexual reproduction ability, complementary strains from the asexual species P. pinophilum and P. funiculosum previously detected as MAT 1-1 and MAT 1-2 were cultivated under

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

703

Fig. 4. Histograms indicating the number of sites falling in different classes of omega values (dN/dS) for the MAT 1 (A) and MAT 2 (B) genes in the analysis using the full dataset (i.e., multiple strains per species).

non synnematous species of the subgenus Biverticillium into the Series Miniolutea and Islandica of the Section Simplicium. Here we have shown a clear overlap between the Ser. Islandica and the Clade I. The previous uncertainty about the placement of P. erythromellis (only known then from the Type isolate in 1979) in Ser. Islandica, slow growing but showing red pigmentation more akin to some members of the Ser. Miniolutea, is resolved in our molecular phylogeny in favor to Ser. Miniolutea. The species of the Series Miniolutea segregate into two sister clades: clade II, composed of P. erythromellis, P. purpurogenum and P. minioluteum, and clade III, including some species of the complex P. funiculosum (P. funiculosum, P. pinophilum, P. purpurogenum var. sclerotium and P. rubrum) with the closely related P. aculeatum and P. verruculosum. All the species analyzed in this study are phylogenetically well delimitated, with the exception of the taxonomically confused complex P. funiculosum (Van Reenen-Hoekstra et al., 1990), including associated Talaromyces. However, we have shown here a clear phylogenetic delimitation of P. minioluteum and P. pinophilum, one time synonymised with P. funiculosum (Raper and Thom, 1949).

The genes used to build the phylogenies in this study showed a good power for solving the relationships between the different species. The MS277 tree provided signicantly higher resolution and better support than the rest of the genes used, including the ITS. Two of the most commonly used genes for fungal phylogenies, the EF-1alpha and beta-tubulin genes, did not provide useful information. Altogether these results are in accordance with the study of Aguileta et al. (2008) and Marthey et al. (2008) in showing that MS277 appears to be one of the most powerful genes for fungal phylogenies. Beyond a better understanding of the phylogenetic relationships in the Penicillium/Talaromyces group, we were interested in reconstructing the evolutionary history of the reproduction mode in this genus. We thus looked at the distribution of sexual Talaromyces and putative asexual Penicillium species in the tree. Penicillium species were interspersed in the phylogeny among Talaromyces species, conrming that they do not represent a single clade, as previously shown (Lobuglio et al., 1993). Morphological characters used in the classication schemes to separate

704

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

taxonomically Penicillium and Talaromyces species (Pitt, 1979) did not reect phylogenetic relationships, but only the ability of in vitro induction of sexual structures. Considering that the putatively asexual species are indeed purely clonal, we inferred 10 independent losses of sex in the Penicillium/Talaromyces group. We have used some additional species compared to Lobuglio et al. (1993), which reveal further events of sex losses. These ndings are relevant to the study of the maintenance of sex despite its cost, across the tree of life (Otto and Lenormand, 2002). It reinforces the idea that sex is often lost, but asexuality remains in terminal branches, because these asexual clades are not able to persist long enough to diversify (Otto and Lenormand, 2002). Because such conclusion relies on the assumption that the putatively asexual species are effectively so, we attempted to detect mating type genes in these species and to analyze the selective pressure they were subjected to. We were able to detect sequences of mating type genes in several species, including Penicillium species. More generally, mating type genes have been found in most of the fungal species where they have been searched, regardless of their sexual and asexual status. Only in one (sexual) species, the ascomycete yeast Lodderomyces elongisporus, mating type genes have been reported to be absent after genome sequencing (Lin and Heitman, 2007). Mating type genes in our study were found to be highly conserved, even in the putatively asexual Penicillium species, although his substitution rates were detected in a Penicillium clade. Mating type genes seemed to be under weaker purifying selection than the house-keeping genes, but this was true both in sexual or asexual fungi. These results are also consistent with other studies in fungi: in almost all the putatively asexual species where mating type genes have been sequenced, they presented no evidence of loss-of-function mutations (ODonnell et al., 2004). Only in the entomopathogenic fungus Cordyceps takaomontana did mating type loci contain pseudogenes (Yokoyama et al., 2003). This suggests that in most fungi, mating type genes may still be functional, which is not expected if these species were truly asexual for long. However, mating type genes may also be conserved in asexual species if they are involved in other functions, which has in fact been reported (Wik et al., 2008; Verna and Ballester, 1999; SteinbergNeifach and Eshel, 2000). The nding that MAT genes in Penicillium species seemed to mostly evolve under purifying selection however raises the question of whether they are able to undergo sexual reproduction. In the species P. pinophilum, strains collected in several continents showed relatively balanced frequencies of MAT 1-1 and MAT 1-2 strains, which is an indication of the occurrence of more or less recent sex events. Further, these P. pinophilum strains carrying MAT 1-1 and MAT 1-2 are intermingled in the phylogeny, suggesting that they recombine in nature, or at least that recombination occurred until recently. Strains with opposite mating types were in fact able to initiate sexual reproduction and clesitothecia and asci production. Ascospore formation took signicantly longer than for the sexual Talaromyces, but our laboratory conditions may not be optimal to trigger its sexual reproduction. Some species considered as asexual, like A. fumigatus, have previously been found to reproduce sexually under controlled conditions, but more slowly than their sexual relatives and only after several months of culturing (OGorman et al., 2009). Here, we were not able to observe mature ascospores and the following crossing experiments produced immature cleistothecia. This prevented testing ascospore viability to study the tness consequences of sexual reproduction and to perform analyses of the progeny in order to ensure that the ascospores were in fact produced after meiosis and recombination. Altogether, these results suggest that P. pinophilum may have lost sex only recently.

This idea of recent loss of sex is also supported by the evidence of high substitution rates in the MAT 1-1 gene in the Penicillium clade containing the species P. pinophilum. Such a high substitution rate can indeed be due to relaxed selection. It could also be due to recruitment of the gene in other functions than mating. Wik et al. (2008) reported that mating type genes in Neurospora evolved faster than several nuclear genes and that they were under positive selection even in heterothallic species. This has been explained by the fact that, in Neurospora, mating type genes are also involved in vegetative incompatibility. Vegetative incompatibility genes may indeed be highly variable and sometimes evolve under diversifying selection because of frequency dependent selection (Wu et al., 1998). Other functions have also been attributed to mating types genes. In Saccharomyces cerevisiae, mating type genes take part in maintaining cell wall integrity and stress response (Verna and Ballester, 1999). Also in S. cerevisiae, the simultaneous expression of both mating-type alleles in haploid yeasts maintains the stability of the microtubules involved in mitosis processes (Steinberg-Neifach and Eshel, 2000). In the group Pencillium/Talaromyces, all the species already known to reproduce sexually are homothallic except the heterothallic T. derxii (Takada and Udagawa, 1988). The amplication of both MAT 1-1 and MAT 1-2 in several Talaromyces species is in agreement with homothallism. In contrast, a single mating type idiomorph was detected in all the Penicillium species analyzed in this study, suggesting that, if those species reproduce sexually, they are heterothallic. If they are in fact asexual and the lack of amplication is not merely due to mutations in the primer regions (which could be likely under relaxed selection in asexual species), the results indicate that the Penicillium species had heterothallic sexual ancestors, or alternatively, they have lost one mating type after having lost sexual ability. The distribution of the MAT 1-1 and MAT 1-2 sequences in the Clade III, with basal clades presenting both idiomorphs, may suggest that homothallism is ancestral in this group, but additional data would be needed to reconstruct the ancestral state. In fungal groups such as Cochliobolus and Fusarium, homothallism was suggested to be derived from heterothallism several times independently by fusion or linkage of the two idiomorphs (ODonnell et al., 2004; Yun et al., 1999). In other groups, such as Aspergillus, the reverse situation seems to have occurred. Heterothallic species may appear from a hypothetical homothallic ancestor presenting closely linked mating type genes separated by gene translocation and with subsequent gene loss (Galagan et al., 2005). The evolution of homothallism and heterothallism is interesting from an evolutionary point of view (Billiard et al., in press). Heterothallism has traditionally been considered as a mechanism that promotes outcrossing, while homothallism would favor selng. However, diploids of heterothallic fungi are heterozygous at the mating-type locus and meiosis segregates haploid genotypes that are compatible for mating and are thus able to undergo selng. In the case of homothallism, mating with an identical haploid has little advantage over asexual reproduction, being unable to create any genetic variation by recombination, or to repair DNA. Therefore, it has been suggested that homothallism has instead evolve in outcrossing species to allow universal compatibility among gametes (Billiard et al., in press; Giraud et al., 2008), while heterothallism would have evolved to avoid mating between identical haploids (Czaran and Hoekstra, 2004). Interestingly, some homothallic fungi, such as the homothallic Neurospora species, rely mainly on the intra-haploid mating for reproduction and neither asexual conidia nor outcrossing have been observed in nature (Glass et al., 2000). In this case, sexual reproduction by intra-haploid mating could be selected for if it provides advantages not related with recombination. In fungi, such advantages include production of resistant sexual spores, cell rejuvenation and senes-

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706

705

cence avoidance and reduced accumulation of slightly deleterious mutations (Aanen and Hoekstra, 2007; Bruggeman et al., 2003; Haedens et al., 2005). Regarding sexual ability in Penicillium species, we could obtain the rst steps of sexual reproduction in P. pinophilum, but we could not obtain mature cleistothecia. Therefore, there is no compelling evidence of efcient sexual reproduction, although sexuality in this species cannot be completely ruled out. We detected mating type genes that appeared to be still functional, based on their sequences and the ability of the strains to undergo at least the rst steps of sexual reproduction, although they appeared to evolve more rapidly than in sexual species, in particular MAT 1-1. The only way to condently elucidate the mode of reproduction of the fungus in nature is to sample large populations and look for footprints of recombination (Taylor et al., 1999), but we could not obtain enough strains of each species for such studies. In conclusion, our study provides a robust and comprehensive phylogeny of the Penicillium subgenus Biverticillium, improving our knowledge of the relationships between the species. Further, it provides important new information on the reproductive mode of this group. Altogether our results suggest that sex has been lost recently in the Penicillium species, although further studies are still needed to reject the hypothesis of cryptic sex. If sex has really been lost in the Penicillium species, our analyses suggest at least ten independent origins of asexuality, which makes this group a model of choice to investigate the maintenance of sex. Acknowledgments We thank two anonymous reviewers and Matthew Fisher for their comments on previous versions of this manuscript, and John Taylor for stimulating discussions. We thank Cony Decock and Lucile Sage, curators of the MUCL and CMPG collections respectively, for providing numerous isolates. This work was supported by the Consortium National de Recherche en Gnomique, and the Service de Systmatique Molculaire of the Musum National dHistoire Naturelle (IFR 101). It is part of the agreement no. 2005/67 between the Genoscope and the Musum National dHistoire Naturelle on the Project Macrophylogeny of life directed by Guillaume Lecointre. We acknowledge the Grant ANR 09-BLAN-FungiSex. DMdV beneted from the support of the Chair Modlisation Mathmatique et biodiversit VEOLIA-Ecole Polytechnique-MNHN. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.fgb.2010.05.002. References
Aanen, D.K., Hoekstra, R.F., 2007. Why sex is good: on fungi and beyond. In: Heitman, J., Kronstad, J.W., Taylor, J.W., Casselton, L.A. (Eds.), Sex in Fungi: Molecular Determination and Evolutionary Implications. ASM Press, Washington, DC, pp. 527534. Aguileta, G., Marthey, S., Chiapello, H., Lebrun, M.H., Rodolphe, F., Fournier, E., Gendrault-Jacquemard, A., Giraud, T., 2008. Assessing the performance of single-copy genes for recovering robust phylogenies. Syst. Biol. 57, 613627. Berbee, M.L., Yoshimura, A., Sugiyama, J., Taylor, J.W., 1995. Is Penicillium monophyletic? An evaluation of phylogeny in the family Trichocomaceae from 18S, 5. 8S and ITS ribosomal DNA sequence data. Mycologia 87, 210222. Billiard, S., Lpez-Villavicencio, M., Devier, B., Hood, M.E., Fairhead, C., Giraud, T., in press. Having sex, yes, but with whom? Inferences from fungi on the evolution of anisogamy and mating types. Biol. Rev. Birky, C.W., 1999. An even broader perspective on sex and recombination. J. Evol. Biol. 12, 10131016. Bruggeman, J., Debets, A.J.M., Wijngaarden, P.J., deVisser, J.A.G.M., Hoekstra, R.F., 2003. Sex slows down the accumulation of deleterious mutations in the homothallic fungus Aspergillus nidulans. Genetics 164, 479485. Burt, A., Carter, D.A., Koenig, G.L., White, T.J., Taylor, J.W., 1996. Molecular markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proc. Natl. Acad. Sci. USA 93, 770773.

Coppin, E., Debuchy, R., Arnaise, S., Picard, M., 1997. Mating types and sexual development in lamentous ascomycetes. Microbiol. Mol. Biol. Rev. 61, 411 428. Couch, B.C., Fudal, I., Lebrun, M.H., Tharreau, D., Valent, B., Van Kim, P., Notteghem, J.-L., Kohn, L.M., 2005. Origins of host-specic populations of the blast pathogen Magnaporthe oryzae in crop domestication with subsequent expansion of pandemic clones on rice and weeds of rice. Genetics 170, 613630. Czaran, T.L., Hoekstra, R.F., 2004. Evolution of sexual asymmetry. BMC Evol. Biol. 4, 34. De Visser, J.A., Elena, S.F., 2007. The evolution of sex: empirical insights into the roles of epistasis and drift. Nat. Rev. Genet. 8, 139149. Dettman, J., Jacobson, D., Taylor, J., 2003. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution, 27032720. Devier, B., Aguileta, G., Hood, M.E., Giraud, T., 2009. Ancient trans-specic polymorphism at pheromone receptor genes in Basidiomycetes. Genetics 181, 209223. Domsch, K.H., Gams, W., Anderson, T.H., 1980. Compendium of Soil Fungi. Academic Press, London. Dyer, P.S., Paoletti, M., 2005. Reproduction in Aspergillus fumigatus: sexuality in a supposedly asexual species? Med. Mycol. 43, S7S14. Felsenstein, J., 1989. PHYLIP phylogeny inference package (version 3.2). Cladistics 5, 164166. Fisher, M.C., 2007. The evolutionary implications of an asexual lifestyle manifested by Pencillium marneffei. In: Heitman, J., Kronstad, J.W., Taylor, J.W., Casselton, L.A. (Eds.), Sex in Fungi: Molecular Determination and Evolutionary Implications. ASM Press, Washington, DC, pp. 201212. Galagan, J.E., Calvo, S.E., Cuomo, C., Ma, L.J., Wortman, J.R., Batzoglou, S., Lee, S.I., Basturkmen, M., Spevak, C.C., Clutterbuck, J., Kapitonov, V., Jurka, J., Scazzocchio, C., Farman, M., Butler, J., Purcell, S., Harris, S., Braus, G.H., Draht, O., Busch, S., DEnfert, C., Bouchier, C., Goldman, G.H., Bell-Pedersen, D., Grifths-Jones, S., Doonan, J.H., Yu, J., Vienken, K., Pain, A., Freitag, M., Selker, E.U., Archer, D.B., Penalva, M.A., Oakley, B.R., Momany, M., Tanaka, T., Kumagai, T., Asai, K., Machida, M., Nierman, W.C., Denning, D.W., Caddick, M., Hynes, M., Paoletti, M., Fischer, R., Miller, B., Dyer, P., Sachs, M.S., Osmani, S.A., Birren, B.W., 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438, 11051115. Giraud, T., Yockteng, R., Lpez-Villavicencio, M., Refregier, G., Hood, M.E., 2008. Mating system of the anther smut fungus Microbotryum violaceum: selng under heterothallism. Eukaryot. Cell 7, 765775. Glass, N.L., Donaldson, G.C., 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from lamentous ascomycetes. Appl. Environ. Microbiol. 61, 13231330. Glass, N.L., Jacobson, D.J., Shiu, P.K.T., 2000. The genetics of hyphal fusion and vegetative incompatibility in lamentous ascomycete fungi. Ann. Rev. Genet. 34, 165186. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696704. Haedens, V., Malagnac, F., Silar, P., 2005. Genetic control of an epigenetic cell degeneration syndrome in Podospora anserina. Fungal Genet. Biol. 42, 564577. Hoff, B., Pggeler, S., Kck, U., 2008. Eighty years after its discovery, Flemings Penicillium strain discloses the secret of its sex. Eukaryot. Cell 7, 465470. Horn, B.W., Moore, G.G., Carbone, I., 2009a. Sexual reproduction in Aspergillus avus. Mycologia 101, 423. Horn, B.W., Ramirez-Prado, J.H., Carbone, I., 2009b. Sexual reproduction and recombination in the aatoxin-producing fungus Aspergillus parasiticus. Fungal Genet. Biol. 46, 169175. Hull, C.M., Raisner, R.M., Johnson, A.D., 2000. Evidence for mating of the asexual yeast Candida albicans in a mammalian host. Science 289, 307310. James, T.Y., Kauff, F., Schoch, C.L., Matheny, P.B., Hofstetter, V., Cox, C.J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H.T., Rauhut, A., Reeb, V., Arnold, A.E., Amtoft, A., Stajich, J.E., Hosaka, K., Sung, G.H., Johnson, D., ORourke, B., Crockett, M., Binder, M., Curtis, J.M., Slot, J.C., Wang, Z., Wilson, A.W., Schussler, A., Longcore, J.E., ODonnell, K., Mozley-Standridge, S., Porter, D., Letcher, P.M., Powell, M.J., Taylor, J.W., White, M.M., Grifth, G.W., Davies, D.R., Humber, R.A., Morton, J.B., Sugiyama, J., Rossman, A.Y., Rogers, J.D., Pster, D.H., Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R.A., Kohlmeyer, J., Volkmann-Kohlmeyer, B., Spotts, R.A., Serdani, M., Crous, P.W., Hughes, K.W., Matsuura, K., Langer, E., Langer, G., Untereiner, W.A., Lucking, R., Budel, B., Geiser, D.M., Aptroot, A., Diederich, P., Schmitt, I., Schultz, M., Yahr, R., Hibbett, D.S., Lutzoni, F., McLaughlin, D.J., Spatafora, J.W., Vilgalys, R., 2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature 443, 818822. Judson, O.P., Normark, B.B., 1996. Ancient asexual scandals. Trends Ecol. Evol. 11, 4146. Kishino, H., Hasegawa, M., 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea. J. Mol. Evol. 29, 170179. Kuhner, M.K., Felsenstein, J., 1994. A simulation comparison of phylogeny algorithms under equal and unequal evolutionary rates. Mol. Biol. Evol. 11, 459468. Le Gac, M., Hood, M.E., Fournier, E., Giraud, T., 2007. Phylogenetic evidence of hostspecic cryptic species in the anther smut fungus. Evolution 61, 1526. Lin, X., Heitman, J., 2007. Mechanisms of homothallism in Fungi and transitions between heterothallism and homothallism. In: Heitman, J., Kronstad, J.W., Taylor, J.W., Casselton, L.A. (Eds.), Sex in Fungi: Molecular Determination and Evolutionary Implications. ASM Press, Washington, DC, pp. 3557.

706

M. Lpez-Villavicencio et al. / Fungal Genetics and Biology 47 (2010) 693706 Takada, M., Udagawa, S., 1988. A new species of heterothallic Talaromyces. Mycotaxon 31, 417425. Taylor, J.W., Jacobson, D.J., Fisher, M.C., 1999. The evolution of asexual fungi: reproduction, speciation and classication. Annu. Rev. Phytopat. 37, 197 246. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal-W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specic gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680. Van Reenen-Hoekstra, E.S., Frisvad, J.C., Samson, R.A., Stolk, A.C., 1990. The Penicillium funiculosum complex-well dened species and problematic taxa. In: Samson, R.A., Pitt, J.I. (Eds.), Modern Concepts in Penicillium and Aspergillus Classication. Plenum Press, New York, pp. 173192. Verna, J., Ballester, R., 1999. A novel role for the mating type (MAT) locus in the maintenance of cell wall integrity in Saccharomyces cerevisiae. Mol. Gen. Genet. 261, 681689. White, T.J., Bruns, T., Lee, S., Taylor, J.W., 1990. Amplication and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press Inc., New York, pp. 315322. Wik, L., Karlsson, M., Johannesson, H., 2008. The evolutionary trajectory of the mating-type (mat) genes in Neurospora relates to reproductive behavior of taxa. BMC Evol. Biol. 8, 109. Woo, P.C., Chong, K.T., Tse, H., Cai, J.J., Lau, C.C., Zhou, A.C., Lau, S.K., Yuen, K.Y., 2006. Genomic and experimental evidence for a potential sexual cycle in the pathogenic thermal dimorphic fungus Penicillium marneffei. FEBS Lett. 580, 34093416. Wu, J., Saupe, S.J., Glass, N.L., 1998. Evidence for balancing selection operating at the het-c heterokaryon incompatibility locus in a group of lamentous fungi. Proc. Natl. Acad. Sci. USA 95, 1239812403. Yang, Z., 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13, 555556. Yang, Z., 2007. PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 15861591. Yang, Z.H., 1998. On the best evolutionary rate for phylogenetic analysis. Syst. Biol. 47, 125133. Yang, Z.H., Nielsen, R., 1998. Synonymous and nonsynonymous rate variation in nuclear genes of mammals. J. Mol. Evol. 46, 409418. Yang, Z.H., Nielsen, R., 2002. Codon-substitution models for detecting molecular adaptation at individual sites along specic lineages. Mol. Biol. Evol. 19, 908 917. Yokoyama, E., Yamagishi, K., Hara, A., 2003. Structures of the mating-type loci of Cordyceps takaomontana. Appl. Environ. Microbiol. 69, 5019. Yun, S.H., Berbee, M.L., Yoder, O.C., Turgeon, B.G., 1999. Evolution of the fungal selffertile reproductive life style from self-sterile ancestors. Proc. Natl. Acad. Sci. USA 96, 55925597. Zhang, J.Z., Nielsen, R., Yang, Z.H., 2005. Evaluation of an improved branch-site likelihood method for detecting positive selection at the molecular level. Mol. Biol. Evol. 22, 24722479.

Lobuglio, K.F., Pitt, J.I., Taylor, J.W., 1993. Phylogenetic analysis of two ribosomal DNA regions indicates multiple independent losses of a sexual Talaromyces state among asexual Penicillium species in subgenus Biverticillium. Mycologia 85, 592604. Marthey, S., Aguileta, G., Rodolphe, F., Gendrault, A., Giraud, T., Fournier, E., LopezVillavicencio, M., Gautier, A., Lebrun, M.H., Chiapello, H., 2008. FUNYBASE: a FUNgal phYlogenomic dataBASE. BMC Bioinf. 9, 456. Notredame, C., Higgins, D.G., Heringa, J., 2000. T-coffee: a novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 302, 205217. Nye, T.M., Lio, P., Gilks, W.R., 2006. A novel algorithm and web-based tool for comparing two alternative phylogenetic trees. Bioinformatics 22, 117119. ODonnell, K., Ward, T.J., Geiser, D.M., Kistler, H.C., Aoki, T., 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 41, 600623. OGorman, C.M., Fuller, H.T., Dyer, P.S., 2009. Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature 457, 471474. Otto, S.P., Lenormand, T., 2002. Resolving the paradox of sex and recombination. Nat. Rev. Genet. 3, 252261. Pagel, M., Meade, A., Barker, D., 2004. Bayesian estimation of ancestral character states on phylogenies. Syst. Biol. 53, 673684. Peterson, S.W., 2000. Phylogenetic analysis of Penicillium species based on ITS and LSU-rDNA nucleotide sequences. In: Samson, R.A., Pitt, J.I. (Eds.), Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classication. Hargrove Academic Publishers, Amsterdam. Peterson, S.W., Bayer, E.M., Wicklow, D.T., 2004. Penicillium thiersii, Penicillium angulare and Penicillium decaturense, new species isolated from wood-decay fungi in North America and their phylogenetic placement from multilocus DNA sequence analysis. Mycologia 96, 12801293. Pitt, J.I., 1979. Genus Penicillium and its Telemorphic States Eupenicillium and Talaromyces. Academic Press, London. Pggeler, S., 2001. Mating-type genes for classical strain improvements of ascomycetes. Appl. Microbiol. Biotechnol. 56, 589601. Pggeler, S., Hoff, B., Kuck, U., 2008. Asexual cephalosporin C producer Acremonium chrysogenum carries a functional mating type locus. Appl. Microbiol. Biotechnol. 74, 60066016. Posada, D., Crandall, K.A., 2001. Evaluation of methods for detecting recombination from DNA sequences: computer simulations. Proc. Natl. Acad. Sci. USA 98, 1375713762. Raper, K.B., Thom, C., 1949. A Manual of the Penicillia. Williams and Wilkins, Baltimore, Maryland. Robinson, D.F., Foulds, L.R., 1981. Comparison of phylogenetic trees. Math. Biosci. 53, 131147. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 11141116. Shimodaira, H., Hasegawa, M., 2001. CONSEL: for assessing the condence of phylogenetic tree selection. Bioinformatics 17, 12461247. Steinberg-Neifach, O., Eshel, D., 2000. Simultaneous expression of both MAT loci in haploid cells suppresses mutations in yeast microtubule motor genes. Mol. Gen. Genet. 264, 300305.