Vous êtes sur la page 1sur 9

LICENCE SCIENCES ET TECHNOLOGIES Mention Sciences de la Vie Parcours Biologie cellulaire et Biochimie (Semestre 3)

TD de Biologie Molculaire (Procaryote) Anne 2007/2008

Mme Ccile Jourlin-Castelli

Problme 1 :
Il existe une molcule AB possdant un effet ltal sur Escherichia coli. Cependant cette bactrie est capable de synthtiser une protine G, qui neutralise laction de lantibiotique AB. La croissance est donc possible, mais seulement en prsence dune concentration en AB infrieure (ou gale) 5g/ml. Au dessus de cette concentration, la quantit de protine G est insuffisante pour neutraliser leffet toxique de AB et la croissance sarrte. On cherche isoler le gne codant pour cette protine G. Pour cela, on ralise une banque de lADN de la bactrie sauvage par hydrolyse partielle du chromosome par lenzyme Sau3A. Les fragments dADN sont insrs dans le site unique BamHI dun plasmide multicopie de type pBR322 de taille 4,5 kb portant le gne de rsistance lampicilline (on rappelle que les enzymes Sau3A et BamHI gnrent des extrmits compatibles). Les diffrents plasmides recombinants sont utiliss pour transformer une bactrie rceptrice sauvage. On slectionne des bactries AmpR, puis on recherche des clones capables de pousser sur un milieu contenant de lantibiotique AB forte concentration (50g/ml). Expliquer ce qui a t fait et pourquoi on peut slectionner de telles bactries.

Problme 2 :
On souhaite tudier le gne de Salmonella homologue au gne neoA dE. coli qui a t clon dans un autre laboratoire et qui confre la rsistance la nomycine. Pour cela, on essaie de cloner au site EcoRI du vecteur plasmidique pBR330 (voir schma) un fragment EcoRIEcoRI d'ADN gnomique de Salmonella portant le gne homologue au gne neoA.

1. Clonage. Proposez un protocole de clonage et indiquez comment slectionneriez-vous les clones recombinants? 2. Analyse par restriction d'un plasmide recombinant. Un des plasmides recombinants contenant le gne neoA (appel pBN1) est digr par les enzymes de restriction BamHI et EcoRI. Aprs migration et sparation des fragments d'ADN sur gel d'agarose puis coloration au bromure d'thidium, on obtient les profils de restriction suivants:

Donner la carte de restriction du plasmide recombinant pBN1.

Problme 3 :
On clone un fragment d'ADN gnomique EcoRI-BamHI de 2 kb de Bacillus subtilis aux sites EcoRI et BamHI du plasmide pBLQ54 (voir schmas ci-dessous).

Rgion de l'ADN gnomique de Bacillus subtilis contenant le fragment EcoRI-BamHI de 2 kb:

les chiffres correspondent des longueurs exprimes en kb a- On appellera pBACI le plasmide recombinant obtenu l'issue du clonage. Prsentez un schma du plasmide pBACI et positionnez les sites de restriction sur ce schma. b- Pour contrler le rsultat du clonage, on fait une analyse par restriction de pABACI en utilisant les enzymes de restriction HindIII puis PvuII, puis en ralisant une lectrophorse en gel d'agarose. Schmatiser ce que l'on doit observer l'issue de l'lectrophorse pour les deux digestions enzymatiques en indiquant en clair les tailles des diffrentes bandes obtenues.

Problme 4 : Amplification/clonage
Le squenage complet du gnome dErwinia chrysanthemi, une bactrie phytopathogne, est achev. Il rvle lexistence dun gne codant potentiellement pour une cellulase, un facteur de virulence tudi par votre laboratoire. Votre travail consiste dans un premier temps cloner ce gne par PCR. Vous disposez pour cela : -dun bon de commande pour oligonuclotides, -dun plasmide portant les sites de restriction EcoRI et BamHI au site multiple de clonage, -de la squence de la rgion dADN dintrt (voir figure ci-dessous).

Dtaillez le protocole choisi pour le clonage de ce gne avec, en particulier, le choix de la squence des oligonuclotides.
1 3 2

celZ(1,3 kb)

5 GCAATATTGATGAACACACCGACTGAATAGA ATAAAACCAATCGCCTATTCTATTTACAGTTAAC ACTAACACTAACACATCGCCATATGAAATGGAG ATTCATGTATGCCGCTCTCTTATTTGGATAAGA 3 5 AGCTGTAACTAATTGATTAATCTT TTCACACCCCAAAAAACAGCGTGC 3

ATC TAC AAC GAA CCG CTT CAG GTT CTG CAG I Y N E P L Q V L Q

Les portions de squences (1,2,3) qui vous sont donnes sont celles du brin codant. La protine CelZ est en fait compose de deux domaines (le premier domaine se terminant l'acide amin glutamate, E, voir rgion 3 sur la figure). Afin d'tudier les proprits de ces deux domaines de manire indpendante, on veut cloner les rgions d'ADN codant pour ces domaines. Dfinir la squence des oligonuclotides ncessaires la ralisation de ces deux clonages.

La Raction de Polymrisation en Chane (P.C.R) Principe : La PCR (Polymerase Chain Reaction ) consiste amplifier slectivement une squence particulire d'ADN par action rpte d'une ADN polymrase. Le fragment d'ADN amplifier est compris entre deux squences qui doivent tre connues.

Zone amplifier 5 3 primers 3 5 Dnaturation de l'ADN bicatnaire, hybridation des primers, synthses des brins complmentaires 5 3 3 5 2me cycle (idem) 5 3 3 3 5 5 3 5 3 5 3 5 3 5 n cycles (idem) 3 5 5 5 3 5 3 5 3 3 5

5 3 3 5

+ + +

5 3 5 3 3 3

+ + + +
5 3

5 3 5 3 5 3 5 3 5 Amplimre 5 3 3 5

3 5

Problme 5 : Dtermination du site dinitiation de la transcription


Le promoteur du gne celZ prcdemment cit veut tre identifi. Le site dinitiation de la transcription est dtermin par la mthode dextension damorce en utilisant loligonuclotide suivant : ExtZ : 5 TCTTATCCAAATAAGAGAGC 3 Le mme oligonuclotide est utilis pour raliser une raction de squence par la mthode de Sanger. La raction dextension damorce et la raction de squence ont t charges sur un gel. Le rsultat est le suivant : A T C G

A partir de ce rsultat, positionner le site dinitiation de la transcription et positionner les squences -35 et -10 .

Problme 6 : Rgulation transcriptionnelle


La TMAO rductase est une protine dEscherichia coli qui est code par le gne torA. Elle permet la rduction du TMAO en TMA. Dans le but dtudier la rgulation du gne torA, diffrentes expriences ont t ralises : Exprience 1 : Une fusion transcriptionnelle entre le gne torA et le gne rapporteur lacZ a t ralise (souche A). Lactivit -galactosidase de la souche A est mesure aprs croissance en prsence ou en absence de TMAO. Les rsultats sont les suivants : + TMAO - TMAO activit -galactosidase 330 5

De quel type de rgulation sagitil ?

Exprience 2 : Une mutagense par transposition est ralise sur une souche sauvage dE. coli. Ce Tn confre la rsistance la ttracycline (TcR) aux souches le contenant. Des mutants ne prsentant plus dactivit TMAO rductase sont obtenus. De quel type de mutant peut il sagir ? Exprience 3 : Linsertion Tn dune souche mutante (souche B) est transduite dans la souche A. La souche C obtenue contient linsertion Tn et la fusion torA-lacZ. Lactivit galactosidase est mesure aprs croissance en prsence ou en absence de TMAO. Les rsultats sont les suivants : + TMAO - TMAO activit -galactosidase 5 5

Que peut on en conclure ? Exprience 4 : Linsertion Tn a t localise par une mthode de biologie molculaire. Elle se situe dans un gne nomm torR. Le gne torR a t clon dans un vecteur appel pJF. Le vecteur pJF et le plasmide rsultant (ptorR) ont t introduits dans la souche C et lactivit galactosidase a t mesure aprs croissance en prsence ou en absence de TMAO. Les rsultats sont les suivants : +TMAO 5 5 350 - TMAO 5 5 5

Souche C Souche C + pJF Souche C + ptorR Que peut on en conclure ?

Exprience 5 : Lanalyse de la squence du promoteur de torA a mis en vidence quatre squences rptes. Chacune de ces squences a t mute de faon indpendante. Des fusions transcriptionnelles entre les promoteurs sauvage et muts de torA et le gne lacZ ont t ralises sur plasmide. Lactivit -galactosidase a t mesure aprs croissance en prsence ou en absence de TMAO dune souche sauvage contenant les diffrents plasmides. Les rsultats sont les suivants : Squences sauvages Squence 1 mute Squence 2 mute Squence 3 mute Squence 4 mute +TMAO 2000 300 300 100 100 - TMAO 60 60 60 60 60

Quel modle pouvez vous proposer ?

Problme 7 :
On tudie la rgulation d'un gne d E. coli appel genA. On sait doser l'activit de la protine A code par ce gne. Exprience 1 : On cultive une souche d' E. coli sauvage en prsence ou en absence d'un produit P. A un moment donn de la croissance l'activit de la protine A est dose. Les rsultats sont ports ci-dessous et exprims en activit spcifique (Units /mg de protines). culture + P culture P U/mg 1500 10

Comment s'appelle ce phnomne de rgulation ? Quel(s) type(s) de mcanisme(s) de rgulation peut-on proposer ? Exprience 2 : Une mutagense par transposon (Tn) est ralise sur la souche sauvage. Ce Tn confre la rsistance l'ampiciline (ApR) aux souches le contenant. Parmi toutes les insertions obtenues, une paraissait intressante et a t retenue pour la suite. Cette insertion a t appele Tn1 et on sait qu'elle se trouve dans le gne codant pour le rgulateur du systme. On cultive cette souche en prsence ou en absence de P et l'activit de la protine A est dose comme prcdemment. culture + P culture P U/mg 1500 1500

A quel(s) type(s) de rgulateur pensez-vous au vu des rsultats? Exprience 3 : Une autre mutagense par Tn est ralise sur la souche sauvage d'une part et sur la souche Tn1 obtenue dans lexprience 2 d'autre part. Ce Tn confre la rsistance la ttracycline (TcR) et dans un des mutants de chacune des 2 souches on sait que le Tn est insr dans le gne genA (souches rsultantes Tn2 et Tn1.2 respectivement). Aucune activit correspondant la protine A n'est dcelable dans ces deux souches en prsence ou en absence de P. Est-il ncessaire de vous demander si ce rsultat est cohrent? Les insertions Tn dans chacune des souches (Tn1 et Tn2) ont t localises. Elles se situent dans la rgion chromosomique contenant le gne proA dont le produit intervient dans la voie mtabolique de synthse de la proline.

Exprience 4 : Un fragment d'ADN de 10 kb, provenant du chromosome d'E. coli sauvage, a t insr dans un vecteur pEX. Par ailleurs la taille de ce fragment de 10 kb a t rduite (par une technique que vous n'avez pas connatre) et ces fragments rduits ont t insrs sparment sur le plasmide pEX. Chacun des plasmides ainsi que le vecteur pEX de dpart (sans fragment insr) a t introduit par transformation dans diffrentes souches de E. coli. L'activit de la protine A ou le phnotype des transformants sont ports ci-aprs. Seuls sont schmatiss les fragments ports par les diffrents plasmides.

Souches transformes ----------------------------------------------------------Tn1 Tn2 proA ----------------------------------------------------------Activit en U/mg Phnotype +P pEX 10 kb I------------------------------I 3 kb I--------I 3,5 kb 3,5 kb I---------I I-----------I 1500 1500 1500 1500 1500 -P 1500 10 10 1500 1500 +P 0 1500 0 1500 0 -P 0 10 0 10 0 ProPro+ ProProPro+

Expliquez ces rsultats. Quel est le mcanisme de rgulation probablement mis en jeu ? Profitez-en pour faire une synthse des 4 expriences.