International Journal of Scientific Research in Knowledge (IJSRK), 1(9), pp. 349-357, 2013 Available online at http://www.ijsrpub.

com/ijsrk ISSN: 2322-4541; 2013 IJSRPUB http://dx.doi.org/10.12983/ijsrk-2013-p349-357

Full Length Research Paper Validation of Fiber Quality Linked SSR Markers Derived from Allotetraploid (Gossypium hirsutum) in Diploid (Gossypium arboreum)
Kundan K. Mishra1, Ranbir Singh Fougat1*, Amit Ballani2
Centre of Excellence in Biotechnology, B. A. College of Agriculture, Anand Agricultural University, Anand 388 110, Gujarat, India 2 Department of Agricultural Botany, B. A. College of Agriculture, Anand Agricultural University, Anand 388 110, Gujarat, India *Corresponding Author: Tel: -02692-261134 (O), 02692-263003 (R); Fax: 02692-261134 (O); E-mail: kkmbt@yahoo.co.in
Received 20 July 2013; Accepted 15 August 2013
1

Abstract. Present study was conducted to estimate genetic diversity for fiber quality traits among elite G. arboreum and G. hirsutum cotton genotypes using simple sequence repeat (SSR) markers; and to establish relationship between genetic diversity of all three species including 13 genotypes. The experimental plant material included 13 genotypes viz., 824, CINA 329, CINA318, Jawahar Tapti, CINA344, CINA333, DLSA17, G. cot H12, G. cot H4, G. cot H16, G. cot H10, G cot 8 and G. cot 20. The genotypes were amplified by 29 SSR primer pairs belonging to BNL (11), CIR (06), NAU (08) and JESPR (04) series. All 29 primers showed amplification and produced a total of 343 bands. Average number of bands amplified by each primer was 11. Statistical analysis for SSR data was conducted using software program me NTSYS pc version 2.02e. The genetic distance (GD) among the cotton genotypes ranged from 0.19 to 0.70. The highest GD (0.70) was detected between 824 and CINA344 while the lowest GD (0.19) was observed between G.cot H10 and G.cot 20. The average observed mean heterozygosity was 0.70 and observed mean percentage of polymorphic loci was 70%. Key words: Cotton, Genotypes, Primers, Polymorphism, Genetic diversity, Genetic distance.

1. INTRODUCTION The genus Gossypium occurs naturally throughout tropical and subtropical regions, and that were domesticated independently as sources of textile fiber belongs to family Malvaceae includes 50 species. 45 species are diploid (2n=2x=26) and five are allotetraploid (2n=4x=52) (Wendal and Cronn, 2003). Among these approximate 50 species four are cultivated viz. Gossypium arboreum L. (n=x=13, A2) and Gossypium herbaceum L. (n=x=13 A1) are diploids while Gossypium barbadense L. [n=2x=26, (AD)2] and Gossypium hirsutum L.[n=2x=26, (AD)2] are tetraploid (Kumria et al., 2003). Cotton is an important source of natural fiber, which plays an important role in global economy and as a raw material in the textile industry. Globally cotton crops are grown on ~32 million hectares (mha) with appoximately 70% of the production in developing countries (Cotton research of India 2010). India, USA, China, Australia, Pakistan and Uzbekistan are main producers of cotton in the world. Gossypium herbaceum L is limited to Gujarat and Karnataka. Gossypium hirsutum L and Gossypium arboreum L are grown in all the major cotton growing states of India. Enhanced cotton resources are needed to facilitate the improvement of fiber quality and other agronomic

traits of this important crop. Therefore, an important area of cotton genomics research is germplasm characterization and utilization. Analysis of genetic diversity and relatedness between species and among genotypes is useful in plant breeding programs because it provides a tool for accurate organization of germplasm and efficient parental selection. Moreover exotic germplasm is an important source of genes which can be transferred in breeding programs through marker assisted selection. With advancement in molecular marker technology, marker-assisted selection (MAS) combined with conventional breeding has been one way in which fiber quality can improve. Simple sequence repeat (SSR) markers (microsatellite) are tandemly repeated DNA motifs (16bp long) which may vary in the number of repeats at given locus, have been successfully employed in many genetic diversity studies (Liu et al., 2000b; Grutierrez et al., 2002) and are useful for a variety of applications in plant genetics and breeding because of their reproducibility, multiallelic nature, co dominant, relative abundance and good genomic coverage (Powel et al., 1996). SSR are easy to use and analyze (Morgante and Olivieri 1993). The variation among microsatellite is thought to be due to the slippage of DNA polymerase during replication or unequal crossing over, resulting in differences in the copy

349

Mishra et al. Validation of Fiber Quality Linked SSR Markers Derived from Allotetraploid (Gossypium hirsutum) in Diploid (Gossypium arboreum)

number of the actual nucleotide sequences (Yu et al., 1999). Polymorphism among individuals arises from changes in the number of the repeats. In the other words, these markers meet most of the requirements for ideal markers for assessing gene flow. Tracking of microsatellite markers requires specifically designed primers for conserved flanking region of repeats and PCR amplification of this region. The availability and abundance of microsatellite markers throughout the cotton genome coupled with the fact that they are polymorphic, co dominant and are based on polymerase chain reaction (PCR) make them particularly useful in genetic diversity studies of cotton (Reddy et al., 2001). SSR markers seems to be a good tool for genomic studies and can minimize the laborious cloning and screening steps of SSR development (Liu et al., 2000). So far SSR markers for fibre quality traits in desi cotton is concerned less SSR markers are available and being common A genome between tetraploid and diploid cotton, the information generated from tetraploid cotton could be successfully utilized for MAS in diploid cotton for fibre quality traits. The objective of present study is to validate fibre quality linked SSR markers of tetraploid cotton in diploid cotton, and to determine the genetic diversity and similarity between all genotypes used for study and utilization of SSR markers for marker assisted selection(MAS) in diploid cotton 2. MATERIALS AND METHODS 2.1. Cotton genotypes The genotypes of cotton were procured from Regional Research Station, AAU Anand, Main Cotton Research Station, Surat, Regional Cotton Research Station Viramgam and Regional Cotton Research Station, Bharuch. Total 13 cotton genotypes were used for study, out of which 6 genotypes were of G. hirsutum, 7 genotypes were of G. arboreum. (Table 1) 2.2. Selection and synthesis of SSR primers A total of 29 QTL SSR primers for different agronomic traits Fiber length, fiber strength, Boll weight and lint percentage belonging to JESPR, NAU, CIR, BNL series were chosen randomly across the cotton genome and downloaded from Cotton Marker Database (CMD). The sequences for these SSRs are available at http://www.cottonmarker.org/projects/cm/. They were

custom synthesized by MWG Biotech Pvt Ltd. Bangalore, India. 2.3. Extraction and quantification of cotton genomic DNA Total genomic DNA was extracted from the leaves of standing crop by Cetyl trimethyl ammonium bromide (CTAB) method (Dakshinamoorthy and selvaraj, 2000) with minor modifications. Fresh leaves (300 mg) of young plant genotypes (15 Days after germination) were collected from Vegetable Polyhouse and crushed in the presence of liquid nitrogen. DNA extraction buffer (CTAB) containing 2.5 % Polyvinyl Pyrrolidone (PVP) was used to isolate DNA. Spectrophotometry was performed to determine DNA concentration by using Nanodrop N.D.1000 (Software V.3.3.0, Thermo Scientific, USA) at absorbance ratio 260/280 nm and the quality of obtained DNA was checked on 0.8% agarose gel. 2.4. Amplification Electrophoresis of genomic DNA and

All the PCR reactions were carried out in 200 l thin walled PCR tubes. Component of PCR reaction was prepared by adding Taq Buffer A (10X Tris with 15Mm MgCl2) followed by forward and reverse primers, dNTPs, Taq DNA polymerase (Fermentas, India) and template DNA. The reagents were mixed by gently tapping against the tube and brief spin (~10,000 rpm for 30 seconds). An initial denaturing step of 4 min at 94C was followed by 42 PCR cycles (denaturing at 94C for 1 min, primer annealing at 4060C for, 1 min and primer extension at 72C for 2 min). A final step of 7 min at 72C was carried out for polishing the ends of PCR products. The PCR amplification cycles were carried out in a thermal cycler (T-Gradient, Bio-metra, BIORAD). Agarose gel of 2.5 % concentration was prepared in 1X TBE (2.5 g agarose in 100 ml 1X TBE and 2.5 l Ethidium bromide from 10 mg/ml stock). PCR amplified products (9 l and 1 l 6X loading dye) were loaded into the wells. The 100 bp standard DNA ladder (1 l) (marker) was also run along with the samples. The electrophoresis was conducted at 100 V current (constant) for 2.5 hrs. to separate the amplified bands. The separated bands were visualized under UV transilluminator (Biometra, Germany) and photographed using gel documentation system (Biorad, California).

350

International Journal of Scientific Research in Knowledge (IJSRK), 1(9), pp. 349-357, 2013

Fig. 1: Dendrogram showing the genetic relationship between different cotton genotypes based on Neis similarity, coefficients using UPGMA as the clustering method for the polymorphism data obtained at 29 SSR loci.

2.5. Scoring and analysis of data Clear and distinct bands amplified by SSR primers were scored for the presence and absence of the corresponding band among the 13 cotton genotypes. The scores 1 and 0 indicates the presence or absence of bands respectively. The data was entered into binary matrix and subsequently analyzed using NTSYSpc version 2.0. Coefficients of similarity were calculated by using Jaccards similarity coefficient by SIMQUAL function and cluster analysis was performed by agglomerative technique using the UPGMA (Un-weighted Pair Group Method with Arithmetic Mean) method by SAHN clustering function of NTSYS-pc. Relationships between the cotton cultivars were graphically represented in the form of dendrograms. Grouping of genotypes also evaluated by Principle Coordinate Analysis (PCA) as

reported by (Thomas et al., 2006). PCA was performed by extracting Eigen value and Eigen vectors from a correlation matrix which was generated using a standardized data matrix. The expected heterozygosity, Hn for a molecular marker was calculated as, Hn= 1-Pi2 Where, pi is the allele frequency of the ith allele. The arithmetic mean heterozygosity, Hav was calculated for each marker class as, Hav= Hn/n Where, n is the number of markers or loci analyzed. Marker index (MI) is calculated as, MI= E (Hav) p Where, E is the effective multiplex ratio (E=n, where, is the fraction of polymorphic markers or loci).

351

Mishra et al. Validation of Fiber Quality Linked SSR Markers Derived from Allotetraploid (Gossypium hirsutum) in Diploid (Gossypium arboreum)

Fig. 2: PIC distribution profile of SSR markers used in study Table 1: List of cotton genotypes
Sr. No. 1. 2. 3. 4. 5. 6. 7. Gossypium arboreum 824 CINA 329 CINA318 Jawahar Tapti CINA344 CINA333 DLSA17 Sr. No. 8. 9. 10. 11. 12. 13. ---Gossypium hirsutum G. cot H12 G. cot H4 G. cot H16 G. cot H10 G cot 8 G. cot 20 ----

Table 2: List of SSR primers and their repeat sequence

Primer Name BNL1317(F) BNL1317 (R) BNL1414(F) BNL1414 (R) BNL1231(F) BNL1231 (R) BNL4030(F) BNL4030 (R) BNL3140(F) BNL3140 (R) BNL3408(F) BNL3408(R) BNL3482(F) BNL3482(R) Primer Sequence 5' to 3' AAAAATCAGCCAAATTGGGA CGTCAACAATTGTCCCAAGA AAAAACCCCTTTCCATCCAT GGGTGTCCTTCCCAAAAATT TAATAAAAGGGAAAGGAAAGAGTT TATGGCTCTAGAATATTCCCTCG CCTCCCTCACTTAAGGTGCA ATGTTGTAAGGGTGCAAGGC CACCATTGTGGCAACTGAGT GGAAAAGGGAAAGCCATTGT ATCCAAACCATTGCACCACT GTGTACGTTGAGAAGTCATCTGC ATTTGCCCCAGGTTTTTTTT GCAACACCTTTTCCTCCCTA Repeat Sequence (AG)14 (AG)14 (AG)16 (AG)16 (AG)15 (AG)15 (GT)10 (GT)10 (GA)11 (GA)11 GT2AT(GT)12 GT2AT(GT)12 (AC)12 (AC)12

352

International Journal of Scientific Research in Knowledge (IJSRK), 1(9), pp. 349-357, 2013

BNL1531(F) BNL1531(R) BNL2920(F) BNL2920(R) BNL580(F) BNL580(R) BNL341(F) BNL341(R) CIR246(F) CIR246(R) CIR45(F) CIR45(R) CIR381(F) CIR381(R) CIR078(F) CIR078(R) CIR182(F) CIR182(R) CIR307(F) CIR307(R) JESPR65(F) JESPR65(R) JESPR307(F) JESPR307(R) JESPR208(F) JESPR208(R) JESPR127(F) JESPR127(R) NAU3260(F) NAU3260(R) NAU1233(F) NAU1233(R) NAU1200(F) NAU1200(R) NAU3654(F)

CTGCAACAAGAGCCTGTGTC ATGGAGATTGGCTGAGATGG TTCTTGCATTGAATAATACTGGC CTTAATTCTAAAAATCAATAAATTTAGCC CTATGTTTGGCCTTGGCATT TAGTGACAGATATCCCCGGC ACCTGGGGTACTTGTCCACA CCATCCCATTTGTGATACCC TTAGGGTTTAGTTGAATGG ATGAACACACGCACG ACTAGCAGTGCGAATACA TGGTTAAGGGTTGGG TTTCCATCCTTTTGTGA AAGGAGAAGAACAAGCAA TGCATGATGAAGTTAGA ACATAAATCCCAAGAAC CTTCATCATAGTAGCGAGTT GAATCAAGCAGAGGATTT GACTTGAAAAGATTACACAC GAATTTGCTGGCTCT CCACCCAATTTAAGAAGAAATTG GGTTAGTTGTATTAGGGTCGTTG CTTGGCCATGTATTCCTTCA GAAAGACACTAAGCTGAGGC CGCAACCAAACATATACTTCACAC CCCTTTCCATCCATAGAACG GATTTGGGTAACATTGGCTC CTGCAGTGTTGTGTTGGGTAGA TTTTGCAGATGTTTGTAGGG TTTCTTCAACAGGGGCTAAG TTCGGGAAAGTTAGAGGAGA TCCTCAGAGCTCGGAATAGT CAACAGCAACAACCACAA CTGCCTCGAGGACAAATAGT TTACCAGCAGCCAACACTAA

(AG)14 (AG)14 (AG)12 (AG)12 (GT)+(GT)+(CT)14 (GT)+(GT)+(CT)14 (GA)14 (GA)14 (TG)6 (TG)6 (TG)7 (TG)7 (AC)7 (AC)7 (GT)7 (GT)7 (AC)10 (AC)10 (AC)18 (AC)18 (GAA)25 (GAA)25 (TGA)11 (TGA)11 (CT)15 (CT)15 (GA)9AA(GA)5 (GA)9AA(GA)5 (CT)4 4CA(CT)4 (CT)4 4CA(CT)4 (AAT)6 (AAT)6 (CAG)11 (CAG)11 (TGA)5

353

Mishra et al. Validation of Fiber Quality Linked SSR Markers Derived from Allotetraploid (Gossypium hirsutum) in Diploid (Gossypium arboreum)
NAU3654(R) NAU1369(F) NAU1369(R) NAU2035(F) NAU2035(R) NAU923(F) NAU923(R) NAU1043(F) NAU1043(R) TCCCCTTCAACATCTTCTTC TGGCAGAGATGAATGTAAGC GGTAACGGATGGAAAATCAC CGAGAAACTTCACTGGACCT GAAAAGGTAGGCTTGTTGGA GGAATTCAAGGTTGAAGGAG CCTCTTCTTTGGCTCTGAAA GTATCCGCCCACAAATAAAG GCATCGTGAGAGAAAGTGAA (TGA)5 (AGGCGG)3 (AGGCGG)3 (GATA)4 (GATA)4 (TCTTTT)4 (TCTTTT)4 (TTC)14 (TTC)14

3. RESULTS AND DISCUSSIONS 3.1. Genetic Diversity Analysis using Microsatellite Markers PCR amplification of genomic DNA of 13 cotton genotypes, using twenty nine primers generated 354 scorable bands in both diploids and tetraploid genotypes with average of 10.45 bands per primer. The size of the bands ranged from 80 bp to 655 bp. On an average, 2.31 alleles were generated per primer. The SSR primers tested in present investigation produced fragments of different size. The minimum (80bp) sized fragment was amplified by primer BNL341, whereas maximum (655 bp) sized fragment was amplified by primer BNL4030. The PIC value ranged from 0.19 (NAU3260) to 0.74 (JESPR 208) with an average of 0.37. 3.2. Cluster Analysis of SSR markers in cotton Dendrogram based on Nei's (1978) unbiased measures of genetic distance by UPGMA method formed two major clusters which grouped all 13 cotton genotypes Cluster 1(A) which was smallest in all clusters included 824, G cot H12 and G cot H4. Second cluster formed two subgroups viz. B1 and B2. Cluster B1 included six genotypes CINA 329, CINA318, G. cotH16, G cot H16, G.cotH10, G.cot 20 and G.cot 8. The B2 cluster includes 4 genotypes viz.CINA344, DLSA17, CINA333 and Jawahar tapti. A2B includes 4 genotypes viz. CINA344, Jawar Tapti, CINA333, DLSA17 which leads us to assume that the B1, B2 subgroup cluster included the varieties of similar genetic origin and which can be helpful for consideration of these varieties for the hybridization programme. The involvement of genotypes in the same cluster again indicated that the varieties with the same genetic composition were falling in the one cluster and this can help to conduct a hybridization programme with these genotypes. The similarity

coefficients ranged from 0.19 to 0.74 for all accessions. Thus, the relatedness of the cultivars studied was efficiently established through the use of SSR markers though with some differences in the positioning of some cultivars at various clusters. Dendrograms generated for SSR markers of cotton genotypes reflect relationships among most of the diploid G.arboreum and tetraploid G. hirsutum cultivars, depending upon their fiber quality traits. 3.3. DISCUSSION The electrophoretic profiles obtained with the study of the primers, 29 primers gave amplification in both diploids and tetraploids, out of which 21 primers gave polymorphism in both diploid and tetraploid cotton species (75.75%). However, primers BNL1531, CIR246, CIR307, JESPR65, NUA1369, NAU2035, do not produced any polymorphism among two genotypes analyzed. SSR markers amplified by primer BNL2920, BNL4030, BNL580 JESPR208, JESPR307, NAU1200, NAU4024, NAU153 1and NAU923 gave high polymorphism and they are also abundant in diploid (G. arboreum) genotypes therefore, they are best markers for marker assisted selection (MAS) in diploid genotypes for fibre quality traits. Further the polymorphism found among the diploids genotypes for molecular markers can be utilized to establish useful associations between these markers and traits that contribute to improve fiber quality traits. Fiber quality linked SSR markers of tetraploid cotton in diploid species may be used to amplify DNA fragments in most of G.arboreum genome. SSR markers used for this study reveal diversity and similarities among and between genotypes of diploid cotton genotypes based on molecular characterization through SSR. The highest PIC value was recorded for JESPR 208 (0.74) and lowest for NAU (0.19), whereas, mean PIC value from all tested microsatellite was 0.37 (Table-3).

354

International Journal of Scientific Research in Knowledge (IJSRK), 1(9), pp. 349-357, 2013

Table 3: Results analysis of all SSR marker used in study

Sr. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. Locus Name BNL 2920 BNL 1317 BNL341 BNL1414 BNL4030 BNL3408 BNL3482 BNL 1030 BNL3650 BNL 58O BNL 1531 CIR30 CIR45 CIR70 CIR78 CIR246 CIR 307 JESPR 127 JESPR 307 JESPR 65 JESPR208 NAU326O NAU4024 NAU1200 NAU1369 NAU1531 NAU2035 NAU3654 NAU 923 Total Average Molecular band size (bp) 390-194 400-256 125-80 197-167 655-156 158-130 380-330 190-172 130-96 310-265 223 366-217 167-124 286-186 336-295 230 235 586-375 388-194 316 526-234 179-152 569-102 276-108 369 296-96 282 276-96 524-260 Total No. of bands 27 9 8 8 27 6 4 6 8 5 3 9 17 4 6 4 6 9 12 3 25 9 29 16 4 21 3 10 21 319 11.00 Total No. Alleles 4 3 2 2 4 2 2 2 2 3 1 2 2 2 2 1 1 2 3 1 4 2 4 3 1 3 1 2 4 67 2.31 PIC value 0.68 0.54 0.49 0.47 0.58 0.49 0.39 0.39 0.42 0.49 0 0.64 0.42 0.24 0.37 0 0 0.48 0.70 0 0.74 0.19 0.58 0.63 0 0.69 0 0.29 0.70 12.21 0.37

4. CONCLUSION From this comparative study between tetraploid and diploid cotton species it can be concluded that traploid-derived SSR primers for fibre quality traits could be successfully used in diploid species of cotton for marker assisted breeding. Large portions of SSR flanking regions appear to be conserved among diploid and tetraploid genomes of cotton. Indicating that flanking sequences around repeats are conserved in the diploid and tetraploid species of cotton. SSR markers amplified by primer gave high polymorphism and they are also abundant in diploid (,G.arboreum) species therefore, they are best markers for marker assisted selection (MAS) in diploid G.arboreum) species for fibre quality traits. These studies determined that tetraploid derived SSR markers and primer could be used to amplify DNA fragment in diploid species. REFERENCES Abdurakhmonov IY, Buriev ZT, Saha S, Pepper AE. (2007). Microsatellite markers associated with lint percentage trait in cotton, Gossypium hirsutum. Euphytica, 156: 141-156.

Andersen JR, Lubberstedt T (2003). Functional markers in plants. Trends Plant Sci., 8: 554560. Brubaker CL, Paterson AH, Wendel JF (1999). Comparative genetic mapping of allotetraploid cotton and its progenitors. Genome, 42: 184203. Liu Diqui, Guo Xiaoping, Lin,Zhongxu, Nie Yichun and Xianlong Zhang (2006). Genetic diversity of Asian cotton (.Gossypium arboreum L) in china avaluated by microsatellite analysis. Genetic Resources and Crop Evolution 53:1145-1152. Dongre AB, Bhandarkar Manoj, Banerjee Subha (2007). Genetic diversity in tetraploid and diploid cotton (Gossypium spp) using ISSR and microsatellite DNA markers. Indian Journal of Biotechnology, 6: 349-353. Han ZG, Guo WZ, Song XL, Zhang TZ (2004). Genetic mapping of EST-derived microsatellites from the diploid Gossypium arboreum in allotetraploid cotton. Mol Genet Genomics, 272: 308327. Mc Carty Jack C, Jixiang Wu, Jenkins Johnie N. (2006). Genetic diversity for agronomic and fiber traits in day-neutral accessions derived

355

Mishra et al. Validation of Fiber Quality Linked SSR Markers Derived from Allotetraploid (Gossypium hirsutum) in Diploid (Gossypium arboreum)

from primitive cotton germplasm. Euphytica, 148: 283-293. Kalivas A, Xanthopoulos F, Kehagia O, Tsaftaris AS (2011). Agronomic characterization, genetic diversity and association analysis of cotton cultivars using simple sequence repeat molecular markers, Genetics and Molecular Research, 10(1): 208-217. Lascape JM, Dessauw D, Rajab M, Noyer JL, Hau B (2007). Microsatellite diversity in tetraploid Gossypium germplasm: assembling a highly informative genotyping set of cotton SSRs. Mol. Breed, 19(1): 45-58. Lin Z, He D, Zhang X, Nie Y, Guo X, Feng C, Stewart JMCD (2005). Linkage map construction and mapping QTL for cotton fibre quality using SRAP, SSR and RAPD. Plant Breeding, 124: 180-187. Liu S, Saha S, Stelly D, Burr B, Cantrell RG (2000). Chromosomal assignment of microsatellite loci in cotton. J. Hered., 91:326-332. Khan. Altaf M , Qureshi Samina N, Saha Sukumar,. Jenkins Johnie N, Brubaker Curt L, Reddy Oumesh UK (2006). Usefulness of SSR derived from Tetraploid Gossypium spp. for analyses of Diploid Gossypium spp. Journal of Crop Improvement, 16(1/2): (31/32). Mei M, Syed NH, Gao W, Thaxton PM, Smith CW, Stelly DM, Chen ZJ (2004). Genetic mapping and QTL analysis of fiber-related traits in cotton (Gossypium). Theor Appl Genet, 108:280-291. Nei M (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89: 583-590. Reddy OU, Pepper AE, Abdurakmonov I, Saha S, Jenkins J, Brook T, El-Zik KM (2001). New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. J. Cotton. Sci., 5: 103-113. Rohlf FJ (1998). NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System, Version 2.1, User Guide. Exeter Software. New York. Saha S, Wu J, Jenkins JN, McCarty JC Jr, Gutierrez OA, Percy RG, Raska DA, Stelly DM (2004). Association of agronomic and fiber traits with specific Pima 3-79 chromosomes in a TM-1 Background. J Cotton Sci, 8: 162169. Qureshi Samina N, Saha Sukumar, Kantely Ramesh V, Jenkins JN (2004). EST-SSR, A New Class of Genetic Markers in Cotton. The Journal of Cotton Science, 8: 112-123.

Liu S, Saha S, Stelly D, Burr B, Cantrell RG (2000). Chromosomal Assignment of Microsatellite Loci in cotton. The American Genetic Association, 91: 326-332. Saha Sukumar, Karaca Mehmet,. Jenkins Johnie N, Allan E. Zipf, Reddy O. Umesh K. Kantety Ramesh V (2003). Simple sequence repeats as useful resource to study transcribed genes of cotton. Euphytica, 130:355-364. Changbiao Wang, Wangzhen Guo, Cai Caiping and Tianzhen Zhang (2006). Characterization, development and exploitation of EST-derived microsatellites in Gossypium raimondii Ulbrich. Chinese Science Bulletin, 51 (5): 557-561. Wangzhen Guo, Caiping Cai, Changbiao Wang, Zhiguo Han, Xianliang Song, Kai Wang, Xiaowei Niu, Cheng Wang, Keyu Lu, Ben Shi Tianzhen Zhang (2007). A MicrosatelliteBased, Gene-Rich Linkage Map Reveals Genome Structure, Function and Evolution in Gossypium. Genetics, 176: 527-541. Wendel JF, Brubaker CL, Percival AE (1992). Genetic diversity in Gossypium hirsutum and the origin of upland cotton. American Journal of Botany, 79: 1291-1310. Wendel JF, Cronn RC (2003). Polyploidy and the evolutionary history of cotton. Advances in Agronomy, 78: 139-186. Han Zhiguo, Changbio Wang, Xianliang Song, Guo Wangzhen, Gou Jinying, Li Chunhong, Chen Xiaoya and Zhang Tianzhen (2006). Characteristics, development and mapping of Gossypium hirsutum derived EST-SSR in allotetraploid cotton. Theor Appl Genet, 112: 430-439. Han ZG, Zhang Tianzhen (2004). EST-SSR Based Genetic Diversity Assessment of Xinjing Cultivars in Upland Cotton. Journal of Genetics and Molecular Biology, 15: 171-181. Han ZG, Guo WZ, Song XL, Zhang TZ (2004). Genetic mapping of EST- derived microsatellite from the diploid Gossypium arboreum in allotetraploid cotton. Mol Gen Genomics, 272: 308-327. Zhang T, Yuan Y, Yu J, Guo W, Kohel RJ (2003). Molecular tagging of major QTL for fiber strength in Upland cotton and its markerassisted selection. Theor Appl Genet, 106:262 268.

356

International Journal of Scientific Research in Knowledge (IJSRK), 1(9), pp. 349-357, 2013

Dr.R.S.Fougat Ph.D in plant breeding and genetics having 28 years of teaching and research experience in agricultural science. Guided 10 Ph.D and 30 Msc student in Plant breeding and genetics and agricultural biotechnology Published more than 60 research papers in international and national Journals. Sucessfully completed 12 research project of ICAR, CSIR, DBT and DST Govt of India. His current research is focuses on Molecular markers technology in plants, functional genomics of various plant and transgenic plants development for fibre quality traits in cotton. At present he is serving as Professor& Head and Unit Officer, Deptt. of Ag. Biotech, AAU, Anand (Gujarat) India.

Dr. Kundan K. Mishra M.Sc (NET) Ph.D in Plant Biotechnology from Centre of Excellance in Biotechnology Anand Agricultural University (AAU) India, having 12 years of teaching and research experience in Biotechnology. Published several research papers in international and national Journals and written three books. His current research is focuses on Molecular markers technology in plants, gene cloning and their expression and functional genomics of plants. At present serving as Assistant Professor (senior grade), Department of Biotechnology, N.V.Patel College of Pure and Applied Sciences ,(Sardar Patel University), Vallabh.Vidyanagar. Anand (Gujarat) India.

Dr. Amit Ballani M.Sc (NET) Ph.D in plant biotechnology from anand agricultural university (AAU) India having 10 years of teaching and research experience in Biotechnology. Published research papers in international and national Journals and written three books. His current research is focuses on SNP markers technology in Rice. Immunology and functional genomics . At present serving as Assistant Professor (senior grade) Dept. of Biotechnology, NVPAS, SPU, V.V.Nagar Anand (Gujarat) India.

357