BIOTECHNOLOGY WITH PROMOTING LAW AND ORDER BIOTERRORISM, LEGAL BATTLES, & FORENSICS

C.T. HEDREYDA NO. 13

BIOTERRORISM Threats of bioterrorism have been major concerns in recent years. It is therefor e important to provide students with information on bioterrorism and how living organisms, parts of living organisms or products of living organism can be used as biological weapons. It is also important to emphasize that developments in recom binant DNA technology do not pose any greater danger of producing superbugs for use as biological weapons because some living organism in their present form can alread y be used as biological weapons

What is Bioterrorism? Bioterrorism is a type of warfare that makes use of biological agents (biologica l weapons) to inflict harm to the enemy. Biological weapons may be toxins or chemi cals produced by microorganisms, plants or animals. They may also be infectious agent s such as bacteria, viruses, protozoans, or fungi. These agents are microscopic, y et deadly. Different forms of bioterrorism has been used by man in the past.

Table 1. Bioterrorism: Past, Present, and Future 6th century BC: Poisons from plants were used to contaminate drinking and bathing wells of enemies. 5th century BC:

To conquer South America, natives were given gifts and clothing laden with virus. 4th century BC: Earthen pots with serpents were thrown to enemies. 1346: Plague-ridden dead were hurled over the walls of the city. 1763: Native Americans were presented with blankets and handkerchiefs contaminated with smallpox.

1860-1865: Ponds were infected with carcasses of dead animals 1914-1917: Alleged cholera organism was spread in Italy by Germans. 1925: Geneva protocol banned biological weapons and Japan refused to follow. 1932: A Japanese physician and army officer began experiments on biological warfare and troops invade Manchuria with such weapons. 1936: Biowarfare such as cholera and anthrax were tested by Chinese soldiers on civilians 1940-1941: A plague bacteria were released in Chuhsien and Ninpo, China. 1941: British experimented with anthrax off Scottish coast. 1941-1943: US studied defense against biological warfare in camps located in Maryland, Mississippi and later in Utah. 1946: The US announced its involvement in biological weapons research. 1960 s: Vietcongs used fecally contaminated spear traps in the Vietnam War. 1964: A virus and rickettsiae production plant was constructed. 1969-1970: US President Nixon renounced biological warfare and limited the research to defense measures only. 1970-Present: Advocacy against biological warfare

1995: Iraqi authorities acknowledged that they had 100 botulinum toxins, 50 anthrax, 16 aflatoxin bombs, 13 botulinum toxin, 10 anthrax, and 2 aflatoxin Scud missile warheads, 122-mm rockets filled with anthrax, botulinum, and aflatoxin.

Table 2. Countries suspected of manufacturing biological weapons Bulgaria Taiwan Iran Libya Egypt China Israel Laos Iraq Cuba North Korea Syria South Korea India South Africa Vietnam Russia

Table 8.3 Biological weapons that terrorists could potentially use

Anthrax Salmonella Smallpox Cryptococcosis Hemorrhagic fever Typhoid Escherichia coli Pneumonic plague Diptheria Ricin Dengue fever Shigella flexneri Malaria Rift Valley fever Cobra venom Cholera Bubonic plague Shellfish toxin Saxitoxin Botulinum toxin Nocardiosis

Q fever Aflatoxin Meliodosis Tubercolosis Glanders S. dysenteriae Infectious hepatitis Encephalitides Blastomycosis Haemophilus influenzae Staphylococcus enterotoxin B Yellow fever Psittacosis (parrot fever) Brucellosis (undulant fever) Venezuelan equine encephalitis Tularemia (rabbit fever) Rocky Mountain spotted fever Histoplasma capsulatum Yersinia pestis (The Black Death of the 14th century) Typhus, tricothecene mycotoxin Coccidiodomycosis (San Joaquin Valley / Desert fever)

Why use Biological Weapons? These are the characteristics of agents used as biological weapons: . Invisible or microscopic . Simple laboratory techniques are required for preparation of these agents and may not require sophisticated apparatus . Easy to multiply and maintain . Difficult to trace . Very deadly

Disadvantages of Biological Weapons These are the disadvantages of using biological weapons to those involve in prep aring the agents: . high risk of worker being contaminated . living organism may be destroyed when incorporated into bombs and missiles (by

heat) . problem of dispersal and attack, difficult to deploy . requires confirmation that strains are pathogenic or disease causing . problems of acquisition for highly restricted microbes

Some Biological Agents in Use Anthrax Anthrax usually affects livestock and is caused by the bacterium Bacillus anthra cis. The bacterium produces spores that make toxin which can be fatal to man and animals.

B. anthracis is a rod-shaped Gram-positive spore-forming and non-motile facultat ive aerobe. The spores produced are invisible, colorless, and tasteless. It takes less than a speck of spores to make a person ill. It is also highly resistant to heat, cold, radiation, dessica tion, and disinfectants. B. anthracis needs oxygen to sporulate and to produce a polypepti de capsule (polyglutamic acid) which protects the bacterium from host defenses and phagocyt osis.

Several of the advantages in using anthrax as a biological weapon are that the t ough spores survive delivery via bombs and they are relatively easy to obtain. Furthermore, anthrax is estimated to have caused 95,000 deaths and 125,000 casualties.

There are three forms of anthrax, all of which are treatable with antibiotics: 1. cutaneous anthrax the bacterium enters a cut in the skin, resulting to skin s ores with characteristic black center

2. intestinal anthrax bacterium ingested from meat of infected animal causes inflammation of the intestines, vomiting of blood and severe diarrhea

3. inhalation anthrax infects the lungs; cold or flu-like symptoms develop initi ally , with fatigue, low grade fever and dry cough, later developing into high fever

and pneumonia

These forms are not transmitted from an infected person to another and can be prevented with vaccine (in limited supply at present) for both man and animals.

Smallpox Smallpox is a highly contagious viral disease caused by the virus Variola. Consi dered to be an ancient killer, it has been eradicated through worldwide vaccination. Know n stocks of virus exist in only two world health organization laboratories, but ma y come into the hands of terrorists. Signs and symptoms include high fever, tiny pus-fi lled blisters on the face, arms, and legs. There is no proven treatment and the disea se can kill

within weeks, fatal in about 30% of cases. However, a vaccine is available which can lessen the severity of the disease.

Plague Also known as the Black Death in the Middle Ages, the pestilence spread across A sia and Europe and killed a third of the world s inhabitants at that time, about 20-30 mil lion people. It is caused by Yersinia pestis, a bacterium found in rats, squirrels, a nd wild dogs. The most common type of plague is the bubonic plague, which kills within 4 -6 days. The second form is pneumonic plague where infection moves to the lungs and the third form is septicemic plague, which is the most deadly. Now, antibiotics, whi ch were not available before, can be used to prevent it.

Botulism Botulism is a muscle paralyzing disease caused by the toxin made by the bacteriu m Clostridium botulinum. It can kill within 24 hours and can be obtained from impr operly canned foods or fish. Symptoms include abdominal cramps, nausea, vomiting, diarr hea, double vision, and difficulty to swallow. The Center for Disease Control (CDC) k eeps an antidote to botulinum toxin in storage; a penicillin treatment can also be used. An experimental vaccine exists but since the disease is too rare, immunization is n ot done.

Tularemia Tularemia is caused by the bacterium Francisella tularensis, which could be acqu ired by coming in contact with blood or body fluids from infected animals such as rabbit s and squirrels, from the bite of a fly or tick that carries blood of an infected anim al or from contaminated food. It can also be contracted by inhaling the causative bacteria. Tularemia causes fever, headache, chills, weakness and ulcerated sore. Furthermo re, enlarged and tender nodes result when F. tularensis is transmitted through tick bites. When the disease is obtained through intake of contaminated water, mouth and thr oat sores, vomiting and diarrhea result. Tularemia can also affect the lungs, leadin g to

pneumonia.

Ricin Ricin is a poison derived from castor bean plants, the same beans used to make c astor oil. Ingestion of poisoned food or contaminated water supply can cause intestina l

bleeding and organ damage. It can be turned into an aerosol and can contaminate by inhalation causing severe respiratory problems and damaged lungs. No anti-ricin vaccine or antidote exists, possessing a serious threat as a biological weapon.

Reference / Suggested Readings: Bioterrorism. (2009) Retrieved June 16, 2009, from Centers for Disease Control and Prevention. Website: http://www.bt.cdc.gov/bioterrorism Bioterrorism. (2009) Retrieved June 16, 2009, from World Health Organization. <http://www.who.int/topics/bioterrorism/en/>.

Suggested Teacher s Aid: Powerpoint Presentation Bioterrorism

DNA FINGERPRINTING AND LEGAL BATTLES

DNA fingerprinting is the determination of an individual s unique collection of DN A restriction fragments. It is now used to identify criminals or exonerate individ uals falsely accused of crimes. This section is included to provide students with nec essary introductory information about this modern technique that is now being used to r esolve legal battles. How to Do DNA Fingerprinting: The Big Picture Depending on the number of starting tissues or cells, several methods are used f or DNA fingerprinting. For more than 1000 cells, restriction fragment length polymorphi sm (RFLP) and Southern blotting can be used. For limited sample amounts, typically around 20 1000 cells, polymerase chain reaction (PCR) analysis can be done. Restriction Enzymes One important thing to remember in doing DNA fingerprinting is the use of restri ction enzymes or restriction endonucleases (REs). These enzymes occur naturally in bac

teria and hundreds are purified and available commercially. REs recognize specific bas e sequences in DNA and cut the DNA at those recognition sites. A specific RE is us ually named after the bacterial genus, species, strain, and type, For example, the enz yme

EcoRI comes from the bacterium Escherichia coli (hence the name Eco in EcoRI) st rain R, type I.

Restriction Enzyme Recognition Site Restriction enzymes recognize specific four to eight DNA base pair sequences. Th ese recognition sites have symmetry, one of the defining characteristics of these se quences. For example, EcoRI recognizes the DNA sequence 5 GA.ATTC 3 while PvuII cuts at the DNA sequence 5 CAG.CTG 3 (arrows indicate site of cleavage). Some enzymes, like EcoRI, cut the DNA in a staggered fashion, producing overhangs. St ill, others like PvuII cut in a blunt-ended or in a direct fashion.

Frequency of Cutting

The average distance between cuts is: 4n

where n

is number of base pairs in recognition site.

4-base cutter: 44 = 256 base pairs (bp) 5-base cutter: 45 = 1,024 bp 6-base cutter: 46 = 4,096 bp 8-base cutter: 48 = 65,536 bp

For example, a four-base cutter cuts the DNA approximately after every 256 base pairs.

RFLP Analysis RFLP is restriction fragment length polymorphism. For related DNA molecules, the re are differences in DNA fragment sizes after restriction enzyme digestion. These differences are due to the presence of different DNA sequences. In RFLP analysis , we only use certain regions of the genome that are highly variable. The Need to Analyze Only a Small Fraction of the Genome The human genome is too big to analyze. Consider this: humans have about 3 x 109 base pairs of DNA. Using a restriction enzyme that cuts at an eight-base recognition

site, there would be about 46,000 bands that are produced after digestion. These numbe rs of bands are way bigger than what is very much amenable for analysis.

Most regions of the genome are not also suitable for analysis or use in DNA fingerprinting as 99 99.99% of DNA sequence is identical between individuals. On e logical solution would be to limit analysis to a few genomic regions and to focu s on regions that are highly variable.

Simple Tandem Repeats

Simple tandem repeats or STRs are regions of DNA containing tandem copies of di, tri- or tetranucleotide repeat units. For example, Dinucleotide repeats: GTGTGTGTGTGT Trinucleotide repeats: ACGACGACGACG Tetranucleotide repeats: TATCTATCTATC The number of repeats varies greatly between individuals and STRs make up 10-15% of the mammalian genome (Figure 8-1). STRs are also called junk DNA . microsatellites or

Regions of Chromosome Analyzed for DNA Fingerprinting Often Contain STRs

Picture1 Person 2ACTACTACTACT400 ACTrepeatsEcoRIEcoRIPerson 2ACTACTACTACT400 ACTrepeatsEc oRIEcoRIACTACTPerson 1ACTACT100 ACTrepeatsEcoRIEcoRIACTACTPerson 1ACTACT100 ACTr epeatsEcoRIEcoRI Person 2ACTACTACTACT400 ACTrepeatsEcoRIEcoRIPerson 2ACTACTACTACT400 ACTrepeatsEc oRIEcoRIACTACTPerson 1ACTACT100 ACTrepeatsEcoRIEcoRIACTACTPerson 1ACTACT100 ACTr epeatsEcoRIEcoRIACTACTPerson 1ACTACT100 ACTrepeatsEcoRIEcoRIACTACTPerson 1ACTACT 100 ACTrepeatsEcoRIEcoRI

Figure 1. EcoRI fragment from Person 2 is 900 bp longer than in

Person 1 (http://www.accessexcellence.org).

Figure 2. A fragment of DNA recognized by a probe having a sequence complementary to that region of the DNA (http://www.accessexcellence.org).

Picture2 CAGTATACACAAGTACCGTACCGTGCTCAGTTATACGCCGAATGGCATGGCAATGGCATGGCAprobe CAGTATACACAAGTACCGTACCGTGCTCAGTTATACGCCGAATGGCATGGCAATGGCATGGCAprobe

DNA Fingerprinting Methods

1. Isolate and amplify DNA if needed.

2. DNA is cleaved into smaller pieces with restriction enzymes

3. DNA is separated with gel electrophoresis

4. DNA is transferred to a nylon membrane (blotting) (Figure 8-3)

5. A radioactive primer is designed that will be complementary to unique regions (VNTR etc). Add this to nylon membrane containing DNA.

6. Wash off excess primer and hold nylon up to a photographic plate to expose. T he pattern will be unique to the individual.

References / Suggested Readings: Access Excellence @ The National Health Museum. (2009) Retrieved June 16, 2009, from The National Health Museum <http://www.accessexcellence.org/>. Alberts, Bray, Hopkin, Johnson, Lewis, Raff, Roberts, and Walter. (2003) Essential Cell Biology. USA: Garland Science.

Suggested Teaching Aid: Powerpoint Presentation Current Trends in DNA Forensic Science Legal Issues and Biotechnology

Picture3 Picture4

Figure 3. The processes involved in Southern blotting (A-E), which is used to detect specific DNA fragments (Alberts, et. al., 2003)

DNA ANALYSIS AND FORENSICS DNA analysis is now used to distinguish one individual from another, determine t he presence of an individual in a location by evaluating the presence of his DNA in samples collected from thet area. This is because, no two individuals possess the exactl y the same DNA profile except identical twins. There are several non coding regions in the human DNA that were observed to be h ighly variable among individuals. Non-coding means that these are regions that do not code for proteins and often times their functions are not yet known. Usually, these a re repeated DNA sequences or simply called repeats and are useful to distinguish on e person from another. Sequences of the DNA in these regions are variable and have been used to distinguish individuals at the molecular level.

a. Restriction Fragment Length Polymorphism (RFLP, Figure 4 and 5)

Individual 1 posses 4 repeats in one region of his genome and individual 2 has o nly two repeats in that region. So if the DNA from the two individuals are analyzed afte r restriction enzyme digestion that cuts at the sequences next to the repeats , di fferent size fragments will be generated and observed when the cut DNA is run in an agarose o r polyacrylamide DNA gel. Thus, the difference is observed. The DNA fragment of individual 1 with 4 repeats will migrate at a higher location in the gel than th

e fragment from individual 2. The technique is called RFLP Restriction Fragment Length

Polymorphism. Because of the variability of DNA sequence in certain regions of t he genetic material, when the DNA is cut with a restriction enzyme, the length of t he DNA fragments generated in two individuals will not be the same, thus will polymorph ism or variable lengths is observed.

Lanes designated as 1-7 are seven individuals exhibiting different RFLP profiles or banding patterns when their DNA was cut with a restriction enzyme. The lane labeled as Bloodstain is blood recovered from a crime scene. Which individual (from 1-7) matches the profile of the individual who left bloodstains in the crime scene? rflp2

Figure 5. An example of a RFLP Profile

To be accurate and acceptable, several restriction enzymes (Figure 8.6) are used to evaluate similarity or difference in band patterns. Significant similarity shoul d be observed in almost all if not all the restriction enzymes used to avoid false po sitive or negative matches. Below are examples of profiles generated using 3 different restriction enzymes. b. Variable Number of Tandem Repeats (VNTR) VNTR is a type of DNA sequence whose length vary from 1,000 to 20,000 bases. Within VNTR, there are base sequences of a shorter length (15 75 bases) that are repeated, with the number of repeat units varying between individuals.

c. How are DNA Profiles Generated by Polymerase Chain Reaction or PCR? Polymerase chain reaction is a technique that allows in vitro replication of a f ragment of DNA, resulting in several copies of the DNA fragment. If the fragments are lo aded in a DNA gel, the bands representing the size fragment of DNA could be visualized because several copies of the fragment will be stained with ethidium bromide and clearly seen under UV light.

d. What are needed for PCR ? 1. The DNA of the person serves as the template. 2. A pair of forward and reverse primers , a short segment of DNA of about nucleotides designed to match known sequences found in variable regions of the DNA is also needed. 3. The reaction mixture will contain nucleotide triphosphates (with 4 possible bases that make up the DNA) to be added to the growing chain of DNA. 4. An enzyme is added to catalyze polymerization of nucleotides. Taq polymerase and other brands are available for this. 5. The DNA template denatures or two strands separate. 6. The forward and reverse primers anneal to complementary regions of the DNA template and allows the start of in vitro replication by adding corresponding nucleotides with the aid of Taq polymerase. 7. This process repeats several times producing several copies of the DNA fragme nt

(Figure 7 10)

Figure 6. RFLP using 3 restriction enzymes

5 3

3 5

Denaturation

5 3

Annealing of primers and elongation 5 3

5 3

Forward primer Forward primer

Reverse primer Reverse primer

5 3 5 3

Figure 7. Cycle 1 of PCR using DNA template from Individual 1

Annealing of primers and elongation Cycle 2 5 3

5 3

5 3 5 3

5 3

Figure 8 Cycle 2 of PCR using DNA Template from Individual 1

DNA template Individual 2

3 5

3 5

Denaturation

5 3

3 5

Annealing of primers and elongation Cycle 1

5 3

3 Forward primer Forward primer

Reverse primer Reverse primer

AMPLIFICATION

3 5 3 5

Figure 9. Cycle 1 of PCR using DNA Template from Individual 2

CYCLE 2

5 3

5 3

5 3 5 3

Figure 10. Product Cycle 2 of PCR using DNA Template from Individual 2

Because of the difference in DNA sequence within the region where primers anneal in individual 1 and 2, different banding pattern will be observed when the PCR products are loaded and run in a DNA gel. One fragment produced for each individual have the same size, therefore migrate in the same position.

The other fragment produced in 1 is larger than the second fragment in 2

2 1

Figure 11. DNA profile of PCR products of Individual 1 vs Individual 2

1 2 3 4 5

6 7 8 9 10

Figure 12. DNA profiles of 4 individuals vs the sample from the crime scene using 10 sets of PCR primers

Compare the PCR profiles in 10 different regions of the genetic material using 1 0 different primer pairs in 4 suspects. Which profile matches the profile of the possible perpetuator of crime based on the DNA extracted from samples taken from the crime scene.